Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

PubMed

Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

2010-04-01

We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

PubMed Central

Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

2010-01-01

Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

PubMed

Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

2008-03-01

We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

Mitochondrial targeting of recombinant RNAs modulates the level of a heteroplasmic mutation in human mitochondrial DNA associated with Kearns Sayre Syndrome

PubMed Central

Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

2013-01-01

Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

PubMed Central

Sin, Jeong-Im

2009-01-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

PubMed

Sin, Jeong-Im

2009-09-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Fish as bioreactors: transgene expression of human coagulation factor VII in fish embryos.

PubMed

Hwang, Gyulin; Müller, Ferenc; Rahman, M Aziz; Williams, Darren W; Murdock, Paul J; Pasi, K John; Goldspink, Geoffrey; Farahmand, Hamid; Maclean, Norman

2004-01-01

A plasmid containing human coagulation factor VII (hFVII) complementary DNA regulated by a cytomegalovirus promoter was microinjected into fertilized eggs of zebrafish, African catfish, and tilapia. The active form of hFVll was detected in the fish embryos by various assays. This positive expression of human therapeutic protein in fish embryos demonstrates the possibility of exploitation of transgenic fish as bioreactors.

RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1992-01-01

The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

PubMed

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

PubMed Central

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

NASA Astrophysics Data System (ADS)

Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

2008-09-01

We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

Motif-based analysis of large nucleotide data sets using MEME-ChIP

PubMed Central

Ma, Wenxiu; Noble, William S; Bailey, Timothy L

2014-01-01

MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928

Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

PubMed

Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

2011-12-01

High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

PubMed

Giehr, Pascal; Walter, Jörn

2018-01-01

The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

PubMed

Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

2017-01-11

We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

1997-01-01

A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

PubMed

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Replication-associated mutational asymmetry in the human genome.

PubMed

Chen, Chun-Long; Duquenne, Lauranne; Audit, Benjamin; Guilbaud, Guillaume; Rappailles, Aurélien; Baker, Antoine; Huvet, Maxime; d'Aubenton-Carafa, Yves; Hyrien, Olivier; Arneodo, Alain; Thermes, Claude

2011-08-01

During evolution, mutations occur at rates that can differ between the two DNA strands. In the human genome, nucleotide substitutions occur at different rates on the transcribed and non-transcribed strands that may result from transcription-coupled repair. These mutational asymmetries generate transcription-associated compositional skews. To date, the existence of such asymmetries associated with replication has not yet been established. Here, we compute the nucleotide substitution matrices around replication initiation zones identified as sharp peaks in replication timing profiles and associated with abrupt jumps in the compositional skew profile. We show that the substitution matrices computed in these regions fully explain the jumps in the compositional skew profile when crossing initiation zones. In intergenic regions, we observe mutational asymmetries measured as differences between complementary substitution rates; their sign changes when crossing initiation zones. These mutational asymmetries are unlikely to result from cryptic transcription but can be explained by a model based on replication errors and strand-biased repair. In transcribed regions, mutational asymmetries associated with replication superimpose on the previously described mutational asymmetries associated with transcription. We separate the substitution asymmetries associated with both mechanisms, which allows us to determine for the first time in eukaryotes, the mutational asymmetries associated with replication and to reevaluate those associated with transcription. Replication-associated mutational asymmetry may result from unequal rates of complementary base misincorporation by the DNA polymerases coupled with DNA mismatch repair (MMR) acting with different efficiencies on the leading and lagging strands. Replication, acting in germ line cells during long evolutionary times, contributed equally with transcription to produce the present abrupt jumps in the compositional skew. These results demonstrate that DNA replication is one of the major processes that shape human genome composition.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General Phenomenon Governed by Steric Hindrance in Duplex DNA.

PubMed

Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin

2016-04-19

G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.

Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

PubMed Central

Berns, K. I.; Rose, J. A.

1970-01-01

Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

PubMed

Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

2018-08-27

A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Dynamic maps of UV damage formation and repair for the human genome

PubMed Central

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-01-01

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS–Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS–Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage. PMID:28607063

Dynamic maps of UV damage formation and repair for the human genome.

PubMed

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-06-27

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS-Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS-Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage.

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

Defining functional DNA elements in the human genome

PubMed Central

Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

2014-01-01

With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

PubMed

Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

2012-09-15

A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

NASA Astrophysics Data System (ADS)

Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

2013-03-01

We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

Herpesvirus papio: state and properties of intracellular viral DNA in baboon lymphoblastoid cell lines.

PubMed

Falk, L; Lindahl, T; Bjursell, G; Klein, G

1979-07-15

Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.

DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

PubMed

Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

2006-12-15

We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

PubMed

Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

2014-10-09

A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Sensitive detection of multiple pathogens using a single DNA probe.

PubMed

Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

2016-12-15

A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array.

PubMed

Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina; Guldberg, Per; Dufva, Martin; Wang, Shan X; Hansen, Mikkel F

2017-09-26

Epigenetic modifications, in particular DNA methylation, are gaining increasing interest as complementary information to DNA mutations for cancer diagnostics and prognostics. We introduce a method to simultaneously profile DNA mutation and methylation events for an array of sites with single site specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection of DNA hybridization, which is insensitive to temperature variation. The melting curve approach further enhances the assay specificity and tolerance to variations in probe length. We demonstrate the utility of this method by simultaneously profiling five mutation and four methylation sites in human melanoma cell lines. The method correctly identified all mutation and methylation events and further provided quantitative assessment of methylation density validated by bisulphite pyrosequencing.

Non-covalent interactions of the carcinogen (+)-anti-BPDE with exon 1 of the human K-ras proto-oncogene

NASA Astrophysics Data System (ADS)

Rodriguez, Jorge H.; Deligkaris, Christos

2013-03-01

Investigating the complementary, but different, effects of physical (non-covalent) and chemical (covalent) mutagen-DNA and carcinogen-DNA interactions is important for understanding possible mechanisms of development and prevention of mutagenesis and carcinogenesis. A highly mutagenic and carcinogenic metabolite of the polycyclic aromatic hydrocarbon benzo[ α]pyrene, namely (+)-anti-BPDE, is known to undergo both physical and chemical complexation with DNA. The major covalent adduct, a promutagenic, is known to be an external (+)-trans-anti-BPDE-N2-dGuanosine configuration whose origins are not fully understood. Thus, it is desirable to study the mechanisms of external non-covalent BPDE-DNA binding and their possible relationships to external covalent trans adduct formation. We present a detailed codon-by-codon computational study of the non-covalent interactions of (+)-anti-BPDE with DNA which explains and correctly predicts preferential (+)-anti-BPDE binding at minor groove guanosines. Due to its relevance to carcinogenesis, the interaction of (+)-anti-BPDE with exon 1 of the human K-ras gene has been studied in detail. Present address: Department of Physics, Drury University

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

DTIC Science & Technology

2008-01-01

C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

Cell-free identification of novel N-myristoylated proteins from complementary DNA resources using bioorthogonal myristic acid analogues.

PubMed

Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko

2014-11-01

To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

PubMed

Liu, Ziping; Su, Xingguang

2017-01-15

In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanistic Insights into Archaeal and Human Argonaute Substrate Binding and Cleavage Properties

PubMed Central

Willkomm, Sarah; Zander, Adrian; Grohmann, Dina; Restle, Tobias

2016-01-01

Argonaute (Ago) proteins from all three domains of life are key players in processes that specifically regulate cellular nucleic acid levels. Some of these Ago proteins, among them human Argonaute2 (hAgo2) and Ago from the archaeal organism Methanocaldococcus jannaschii (MjAgo), are able to cleave nucleic acid target strands that are recognised via an Ago-associated complementary guide strand. Here we present an in-depth kinetic side-by-side analysis of hAgo2 and MjAgo guide and target substrate binding as well as target strand cleavage, which enabled us to disclose similarities and differences in the mechanistic pathways as a function of the chemical nature of the substrate. Testing all possible guide-target combinations (i.e. RNA/RNA, RNA/DNA, DNA/RNA and DNA/DNA) with both Ago variants we demonstrate that the molecular mechanism of substrate association is highly conserved among archaeal-eukaryotic Argonautes. Furthermore, we show that hAgo2 binds RNA and DNA guide strands in the same fashion. On the other hand, despite striking homology between the two Ago variants, MjAgo cannot orientate guide RNA substrates in a way that allows interaction with the target DNA in a cleavage-compatible orientation. PMID:27741323

Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

PubMed

Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

2012-10-08

One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

Gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein messenger RNAs as colonic carcinoma.

PubMed

Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B

1993-09-01

The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Detection of Z DNA binding proteins in tissue culture cells.

PubMed Central

Leith, I R; Hay, R T; Russell, W C

1988-01-01

A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

PubMed

Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

2016-04-01

The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

Functional studies of RYR1 mutations in the skeletal muscle ryanodine receptor using human RYR1 complementary DNA.

PubMed

Sato, Keisaku; Pollock, Neil; Stowell, Kathryn M

2010-06-01

Malignant hyperthermia is associated with mutations within the gene encoding the skeletal muscle ryanodine receptor, the calcium channel that releases Ca from sarcoplasmic reticulum stores triggering muscle contraction, and other metabolic activities. More than 200 variants have been identified in the ryanodine receptor, but only some of these have been shown to functionally affect the calcium channel. To implement genetic testing for malignant hyperthermia, variants must be shown to alter the function of the channel. A number of different ex vivo methods can be used to demonstrate functionality, as long as cells from human patients can be obtained and cultured from at least two unrelated families. Because malignant hyperthermia is an uncommon disorder and many variants seem to be private, including the newly identified H4833Y mutation, these approaches are limited. The authors cloned the human skeletal muscle ryanodine receptor complementary DNA and expressed both normal and mutated forms in HEK-293 cells and carried out functional analysis using ryanodine binding assays in the presence of a specific agonist, 4-chloro-m-cresol, and the antagonist Mg. Transiently expressed human ryanodine receptor proteins colocalized with an endoplasmic reticulum marker in HEK-293 cells. Ryanodine binding assays confirmed that mutations causing malignant hyperthermia resulted in a hypersensitive channel, while those causing central core disease resulted in a hyposensitive channel. The functional assays validate recombinant human skeletal muscle ryanodine receptor for analysis of variants and add an additional mutation (H4833Y) to the repertoire of mutations that can be used for the genetic diagnosis of malignant hyperthermia.

Basics of DNA biosensors and cancer diagnosis.

PubMed

Sohrabi, Nasrin; Valizadeh, Alireza; Farkhani, Samad Mussa; Akbarzadeh, Abolfazl

2016-01-01

The human genome is exposed to mutations during the life cycle because of many types of changes in the DNA. Viruses, radiation, transposons, mutagenic chemicals, or any errors that happen during DNA replication or the meiotic process in the cell, may cause the mutation. Many mutations have no effect on phenotype or health, while some mutations cause crucial diseases such as cancer or cardiac diseases; therefore, a better understanding of the effects of mutation on phenotype is a very important part of genetic studies. Biosensors based on DNA, RNA, and peptide nucleic acids are the most sensitive tools, due to a strong pairing of lined up nucleotide strands between bases in their complementary parts. These methods can provide information to assist clinicians in making successful treatment decisions and increase the patient survival rate. In this review, we discuss DNA biosensors based on peptide nucleic acids that have an important role in cancer diagnosis.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

PubMed Central

Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

2010-01-01

Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

PubMed

Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

2008-09-01

Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Method of artificial DNA splicing by directed ligation (SDL).

PubMed Central

Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA

1991-01-01

An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363

Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

PubMed

Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

2014-10-17

Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

Human Immunodeficiency Virus Integration Protein Expressed in Escherichia Coli Possesses Selective DNA Cleaving Activity

NASA Astrophysics Data System (ADS)

Sherman, Paula A.; Fyfe, James A.

1990-07-01

The human immunodeficiency virus (HIV) integration protein, a potential target for selective antiviral therapy, was expressed in Escherichia coli. The purified protein, free of detectable contaminating endonucleases, selectively cleaved double-stranded DNA oligonucleotides that mimic the U3 and the U5 termini of linear HIV DNA. Two nucleotides were removed from the 3' ends of both the U5 plus strand and the U3 minus strand; in both cases, cleavage was adjacent to a conserved CA dinucleotide. The reaction was metal-ion dependent, with a preference for Mn2+ over Mg2+. Reaction selectivity was further demonstrated by the lack of cleavage of an HIV U5 substrate on the complementary (minus) strand, an analogous substrate that mimics the U3 terminus of an avian retrovirus, and an HIV U5 substrate in which the conserved CA dinucleotide was replaced with a TA dinucleotide. Such an integration protein-mediated cleavage reaction is expected to occur as part of the integration event in the retroviral life cycle, in which a double-stranded DNA copy of the viral RNA genome is inserted into the host cell DNA.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

PubMed

Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

2016-01-15

In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

PubMed

Liu, G; Gelboin, H V; Myers, M J

1991-02-01

The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

PubMed

Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

2018-01-01

We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

NASA Astrophysics Data System (ADS)

Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

2013-03-01

We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

PubMed

Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

2011-08-01

Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

NASA Astrophysics Data System (ADS)

Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

2018-05-01

In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1991-01-01

We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

A Sequence-Dependent DNA Condensation Induced by Prion Protein

PubMed Central

2018-01-01

Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

A Sequence-Dependent DNA Condensation Induced by Prion Protein.

PubMed

Bera, Alakesh; Biring, Sajal

2018-01-01

Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

DNA strand displacement system running logic programs.

PubMed

Rodríguez-Patón, Alfonso; Sainz de Murieta, Iñaki; Sosík, Petr

2014-01-01

The paper presents a DNA-based computing model which is enzyme-free and autonomous, not requiring a human intervention during the computation. The model is able to perform iterated resolution steps with logical formulae in conjunctive normal form. The implementation is based on the technique of DNA strand displacement, with each clause encoded in a separate DNA molecule. Propositions are encoded assigning a strand to each proposition p, and its complementary strand to the proposition ¬p; clauses are encoded comprising different propositions in the same strand. The model allows to run logic programs composed of Horn clauses by cascading resolution steps. The potential of the model is demonstrated also by its theoretical capability of solving SAT. The resulting SAT algorithm has a linear time complexity in the number of resolution steps, whereas its spatial complexity is exponential in the number of variables of the formula. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Isolation and expression of the human gametocyte-specific factor 1 gene (GTSF1) in fetal ovary, oocytes, and preimplantation embryos.

PubMed

Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M

2017-01-01

Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Pre-exposure to 50 Hz magnetic fields modifies menadione-induced genotoxic effects in human SH-SY5Y neuroblastoma cells.

PubMed

Luukkonen, Jukka; Liimatainen, Anu; Höytö, Anne; Juutilainen, Jukka; Naarala, Jonne

2011-03-23

Extremely low frequency (ELF) magnetic fields (MF) are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis) to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS). Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome.

Electrochemical biosensor for Mycobacterium tuberculosis DNA detection based on gold nanotubes array electrode platform.

PubMed

Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi

2016-04-15

The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.

Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

PubMed

Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

2011-07-21

Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

PubMed

de Bellocq, J Goüy; Leirs, H

2009-09-01

Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

PubMed Central

Odelberg, S J; Weiss, R B; Hata, A; White, R

1995-01-01

Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

Label-Free Nanopore Biosensor for Rapid and Highly Sensitive Cocaine Detection in Complex Biological Fluids.

PubMed

Rauf, Sana; Zhang, Ling; Ali, Asghar; Liu, Yang; Li, Jinghong

2017-02-24

Detection of very low amounts of illicit drugs such as cocaine in clinical fluids like serum continues to be important for many areas in the fight against drug trafficking. Herein, we constructed a label-free nanopore biosensor for rapid and highly sensitive detection of cocaine in human serum and saliva samples based on target-induced strand release strategy. In this bioassay, an aptamer for cocaine was prehybridized with a short complementary DNA. Owing to cocaine specific binding with aptamer, the short DNA strand was displaced from aptamer and translocation of this output DNA through α-hemolysin nanopore generated distinct spike-like current blockages. When plotted in double-logarithmic scale, a linear relationship between target cocaine concentration and output DNA event frequency was obtained in a wide concentration range from 50 nM to 100 μM of cocaine, with the limit of detection down to 50 nM. In addition, this aptamer-based sensor method was successfully applied for cocaine detection in complex biological fluids like human saliva and serum samples with great selectivity. Simple preparation, low cost, rapid, label-free, and real sample detection are the motivating factors for practical application of the proposed biosensor.

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

Proteome-scale human interactomics

PubMed Central

Luck, Katja; Sheynkman, Gloria M.; Zhang, Ivy; Vidal, Marc

2017-01-01

Cellular functions are mediated by complex interactome networks of physical, biochemical, and functional interactions between DNA sequences, RNA molecules, proteins, lipids, and small metabolites. A thorough understanding of cellular organization requires accurate and relatively complete models of interactome networks at proteome-scale. The recent publication of four human protein-protein interaction (PPI) maps represents a technological breakthrough and an unprecedented resource for the scientific community, heralding a new era of proteome-scale human interactomics. Our knowledge gained from these and complementary studies provides fresh insights into the opportunities and challenges when analyzing systematically generated interactome data, defines a clear roadmap towards the generation of a first reference interactome, and reveals new perspectives on the organization of cellular life. PMID:28284537

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

PubMed

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2016-01-07

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

PubMed Central

2015-01-01

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

Yeast Pif1 accelerates annealing of complementary DNA strands.

PubMed

Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

2014-12-09

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

PubMed

Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

2016-12-15

A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

Ancient DNA from latrines in Northern Europe and the Middle East (500 BC-1700 AD) reveals past parasites and diet.

PubMed

Søe, Martin Jensen; Nejsum, Peter; Seersholm, Frederik Valeur; Fredensborg, Brian Lund; Habraken, Ruben; Haase, Kirstine; Hald, Mette Marie; Simonsen, Rikke; Højlund, Flemming; Blanke, Louise; Merkyte, Inga; Willerslev, Eske; Kapel, Christian Moliin Outzen

2018-01-01

High-resolution insight into parasitic infections and diet of past populations in Northern Europe and the Middle East (500 BC- 1700 AD) was obtained by pre-concentration of parasite eggs from ancient latrines and deposits followed by shotgun sequencing of DNA. Complementary profiling of parasite, vertebrate and plant DNA proved highly informative in the study of ancient health, human-animal interactions as well as animal and plant dietary components. Most prominent were finding of soil-borne parasites transmitted directly between humans, but also meat-borne parasites that require consumption of raw or undercooked fish and pork. The detection of parasites for which sheep, horse, dog, pig, and rodents serves as definitive hosts are clear markers of domestic and synanthropic animals living in closer proximity of the respective sites. Finally, the reconstruction of full mitochondrial parasite genomes from whipworm (Ascaris lumbricoides) and roundworm species (Trichuris trichiura and Trichuris muris) and estimates of haplotype frequencies elucidates the genetic diversity and provides insights into epidemiology and parasite biology.

Ancient DNA from latrines in Northern Europe and the Middle East (500 BC–1700 AD) reveals past parasites and diet

PubMed Central

Nejsum, Peter; Seersholm, Frederik Valeur; Fredensborg, Brian Lund; Habraken, Ruben; Haase, Kirstine; Hald, Mette Marie; Simonsen, Rikke; Højlund, Flemming; Blanke, Louise; Merkyte, Inga; Willerslev, Eske; Kapel, Christian Moliin Outzen

2018-01-01

High-resolution insight into parasitic infections and diet of past populations in Northern Europe and the Middle East (500 BC- 1700 AD) was obtained by pre-concentration of parasite eggs from ancient latrines and deposits followed by shotgun sequencing of DNA. Complementary profiling of parasite, vertebrate and plant DNA proved highly informative in the study of ancient health, human-animal interactions as well as animal and plant dietary components. Most prominent were finding of soil-borne parasites transmitted directly between humans, but also meat-borne parasites that require consumption of raw or undercooked fish and pork. The detection of parasites for which sheep, horse, dog, pig, and rodents serves as definitive hosts are clear markers of domestic and synanthropic animals living in closer proximity of the respective sites. Finally, the reconstruction of full mitochondrial parasite genomes from whipworm (Ascaris lumbricoides) and roundworm species (Trichuris trichiura and Trichuris muris) and estimates of haplotype frequencies elucidates the genetic diversity and provides insights into epidemiology and parasite biology. PMID:29694397

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Pre-Exposure to 50 Hz Magnetic Fields Modifies Menadione-Induced Genotoxic Effects in Human SH-SY5Y Neuroblastoma Cells

PubMed Central

Luukkonen, Jukka; Liimatainen, Anu; Höytö, Anne; Juutilainen, Jukka; Naarala, Jonne

2011-01-01

Background Extremely low frequency (ELF) magnetic fields (MF) are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis) to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. Methodology/Principal Findings Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS). Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. Conclusions The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome. PMID:21448285

Investigating the potential of multiwalled carbon nanotubes based zinc nanocomposite as a recognition interface towards plant pathogen detection.

PubMed

Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar

2017-11-01

The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

PubMed Central

Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2015-01-01

The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

3'-End labeling of nucleic acids by a polymerase ribozyme.

PubMed

Samanta, Biswajit; Horning, David P; Joyce, Gerald F

2018-06-13

A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

2014-09-03

A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

Properties of an unusual DNA primase from an archaeal plasmid

PubMed Central

Beck, Kirsten; Lipps, Georg

2007-01-01

Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

PubMed

Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-01-01

To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

Formation of template-switching artifacts by linear amplification.

PubMed

Chakravarti, Dhrubajyoti; Mailander, Paula C

2008-07-01

Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

Off-line monitoring of bacterial stress response during recombinant protein production using an optical biosensor.

PubMed

Vostiar, Igor; Tkac, Jan; Mandenius, Carl-Fredrik

2004-07-15

A surface plasmon resonance (SPR) biosensor was used to monitor the profiles of the heat-shock protein (DnaK) and the expression of a heterologous protein to map the dynamics of the cellular stress response in Escherichia coli. As expression system was used an E. coli strain overproducing human recombinant superoxide dismutase (rhSOD). Expression of DnaK showed complex patterns differing with strength of induction. The strong up-regulation of DnaK expression was observed in all cultivations which over-produced of rhSOD. Similar patterns were not observed in non-induced reference cultures. Differences in DnaK concentration profiles were correlated with induction strength. Presented data, carried out in shake flask and glucose limited fed-batch cultivation, show a good consistency with previously published transcriptional profiling results and provide complementary information to understand stress response related to overproduction of recombinant protein. The study also demonstrates the feasibility of using the SPR as a two channel protein array for monitoring of intracellular components.

Simple diazonium chemistry to develop specific gene sensing platforms.

PubMed

Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E

2014-02-27

A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kawagoe, Kazuyoshi; Takeda, Junji; Kinoshita, Taroh

Many membrane proteins are anchored to the cell membrane by glycosylphosphatidylinositol (GPI). The core structure and biosynthesis of the GPI anchor are well conserved in eukaryote cells. We previously cloned a human PIGA gene that participates in GPI anchor biosynthesis. We have now cloned complementary and genomic DNA of Pig-a, the murine homologue of PIGA, and compared its function and gene structure with those of PIGA. The deduced amino acid sequence of mouse PIG-A is 88% identical with that of human PIG-A. Transfection of Pig-a cDNA complemented the defects of both a PIG-A-deficient murine cell line and a PIG-A-deficient humanmore » cell line, demonstrating that functions of mouse and human PIG-A are conserved. Like human PIGA, the chromosomal Pig-a gene has six exons and spans approximately 16 kb. Moreover, Pig-a was mapped to X-F3/4, which is syntenic to human Xp22.1, where PIGA is located. Thus, murine Pig-a provides a good animal model to study paroxysmal nocturnal hemoglobinuria, a disease caused by a somatic mutation of PIGA. Database analysis demonstrated that a yeast gene, SPT14, is homologous to Pig-a and PIGA and that these genes are members of a glycosyltransferase gene family.« less

[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

PubMed

Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

2013-01-01

Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

A Novel Method for Rapid Hybridization of DNA to a Solid Support

PubMed Central

Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

2013-01-01

Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

Ethical reasons for narrowing the scope of biotech patents.

PubMed

Andreassen, Tom

2015-11-01

Patents on biotech products have a scope that goes well beyond what is covered by the most widely applied ethical justifications of intellectual property. Neither natural rights theory from Locke, nor public interest theory of IP rights justifies the wide scope of legal protection. The article takes human genes as an example, focusing on the component that is not invented but persists as unaltered gene information even in the synthetically produced complementary DNA, the cDNA. It is argued that patent on cDNA holds this information captive, or illegitimately appropriates it in limiting other researchers and inventors' opportunity to explore new functions and uses based on this non-invented information. A tighter connection between legal IP protection and the use description stated in the patent claim is suggested. By binding protection to the product's foreseeable functions and use, instead of the product itself and all future uses of it, legitimacy of biotech product patents is restored.

mga genosensor for early detection of human rheumatic heart disease.

PubMed

Singh, Swati; Kaushal, Ankur; Khare, Shashi; Kumar, Ashok

2014-05-01

The 5' amino-labeled DNA probe complementary to mga gene of Streptococcus pyogenes was immobilized on carboxylated multiwall carbon nanotubes electrode and hybridized with 0.1-100 ng/6 μl single-stranded genomic DNA (ssG-DNA) of S. pyogenes from throat swab of suspected rheumatic heart disease (RHD) patients. Electrochemical response was measured by cyclic voltammetry (CV), differential pulse voltammetry (DPV), and electrochemical impedance (EI). The sensitivity of the sensor was 106.03 (μA/cm(2))/ng and limit of detection (LOD) was found 0.014 ng/6 μl with regression coefficient (R(2)) of 0.921 using DPV. The genosensor was characterized by FTIR and SEM, and electrode was found stable for 6 months on storage at 4 °C with 5-6 % loss in initial DPV current. mga genosensor is the first report on RHD sensor which can save life of several suspected patients by early diagnosis in 30 min.

Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

PubMed

Deng, Jiajia; Toh, Chee-Seng

2013-06-17

A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

Proteome-Scale Human Interactomics.

PubMed

Luck, Katja; Sheynkman, Gloria M; Zhang, Ivy; Vidal, Marc

2017-05-01

Cellular functions are mediated by complex interactome networks of physical, biochemical, and functional interactions between DNA sequences, RNA molecules, proteins, lipids, and small metabolites. A thorough understanding of cellular organization requires accurate and relatively complete models of interactome networks at proteome scale. The recent publication of four human protein-protein interaction (PPI) maps represents a technological breakthrough and an unprecedented resource for the scientific community, heralding a new era of proteome-scale human interactomics. Our knowledge gained from these and complementary studies provides fresh insights into the opportunities and challenges when analyzing systematically generated interactome data, defines a clear roadmap towards the generation of a first reference interactome, and reveals new perspectives on the organization of cellular life. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

NASA Astrophysics Data System (ADS)

Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

2013-10-01

We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate. Electronic supplementary information (ESI) available: Details on the synthesis, purification and characterisation of the DHLA-PEG600-N3, cyclooctyne-DNA, and QD-TBA20 conjugates as well as all supporting figures and tables. See DOI: 10.1039/c3nr02897f

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Flower-like ZnO nanostructure based electrochemical DNA biosensor for bacterial meningitis detection.

PubMed

Tak, Manvi; Gupta, Vinay; Tomar, Monika

2014-09-15

Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.

A nanophosphor-based method for selective DNA recovery in Synthosomes.

PubMed

Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

2006-01-01

A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

PubMed Central

van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

2010-01-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

PubMed

van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

2010-11-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

Highly labeled methylene blue-ds DNA silica nanoparticles for signal enhancement of immunoassays: application to the sensitive detection of bacteria in human platelet concentrates.

PubMed

Bonnet, Romaric; Farre, Carole; Valera, Lionel; Vossier, Ludivine; Léon, Fanny; Dagland, Typhaine; Pouzet, Agnès; Jaffrézic-Renault, Nicole; Fareh, Jeannette; Fournier-Wirth, Chantal; Chaix, Carole

2018-05-15

A nanoparticle-based electrochemical sandwich immunoassay was developed for bacteria detection in platelet concentrates. For the assay, magnetic beads were functionalized with antibodies to allow the specific capture of bacteria from the complex matrix, and innovative methylene blue-DNA/nanoparticle assemblies provided the electrochemical response for amplified detection. This nanoparticular system was designed as a temperature-sensitive nano-tool for electrochemical detection. First, oligonucleotide-functionalized nanoparticles were obtained by direct synthesis of the DNA strands on the nanoparticle surface using an automated oligonucleotide synthesizer. Densely packed DNA coverage was thus obtained. Then, DNA duplexes were constructed on the NP surface with a complementary strand bearing a 3 methylene blue tag. This strategy ultimately produced highly functionalized nanoparticles with electrochemical markers. These assemblies enabled amplification of the electrochemical signal, resulting in a very good sensitivity. A proof-of-concept was carried out for E. coli detection in human platelet concentrates. Bacterial contamination of this complex biological matrix is the highest residual infectious risk in blood transfusion. The development of a rapid assay that could reach 10-102 CFU mL-1 sensitivity is a great challenge. The nanoparticle-based electrochemical sandwich immunoassay carried out on a boron doped diamond electrode proved to be sensitive for E. coli detection in human platelets. Two antibody pairs were used to develop either a generic assay against certain Gram negative strains or a specific assay for E. coli. The methylene blue-DNA/nanoparticles amplify sensitivity ×1000 compared with the assay run without NPs for electrochemical detection. A limit of detection of 10 CFU mL-1 in a biological matrix was achieved for E. coli using the highly specific antibody pair.

CTC1-mediated C-strand fill-in is an essential step in telomere length maintenance

PubMed Central

Feng, Xuyang; Hsu, Shih-Jui; Kasbek, Christopher; Chaiken, Mary

2017-01-01

Abstract To prevent progressive telomere shortening as a result of conventional DNA replication, new telomeric DNA must be added onto the chromosome end. The de novo DNA synthesis involves elongation of the G-rich strand of the telomere by telomerase. In human cells, the CST complex (CTC1-STN1-TEN1) also functions in telomere replication. CST first aids in duplication of the telomeric dsDNA. Then after telomerase has extended the G-rich strand, CST facilitates fill-in synthesis of the complementary C-strand. Here, we analyze telomere structure after disruption of human CTC1 and demonstrate that functional CST is essential for telomere length maintenance due to its role in mediating C-strand fill-in. Removal of CTC1 results in elongation of the 3΄ overhang on the G-rich strand. This leads to accumulation of RPA and telomeric DNA damage signaling. G-overhang length increases with time after CTC1 disruption and at early times net G-strand growth is apparent, indicating telomerase-mediated G-strand extension. In contrast, C-strand length decreases continuously, indicating a deficiency in C-strand fill-in synthesis. The lack of C-strand maintenance leads to gradual shortening of the telomeric dsDNA, similar to that observed in cells lacking telomerase. Thus, telomerase-mediated G-strand extension and CST-mediated C-strand fill-in are equally important for telomere length maintenance. PMID:28334750

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA

PubMed Central

Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo

1971-01-01

The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808

Structural Insights into the HIV-1 Minus-strand Strong-stop DNA*

PubMed Central

Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

2016-01-01

An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3′-end of the genomic RNA with the complementary r region at the 3′-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). PMID:26668324

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Nature and distribution of feline sarcoma virus nucleotide sequences.

PubMed Central

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed Central

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-01-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-02-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE PAGES

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

2015-06-02

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

Porcine circovirus: transcription and rolling-circle DNA replication

USDA-ARS?s Scientific Manuscript database

This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

Laser microbeams for DNA damage induction, optical tweezers for the search on blood pressure relaxing drugs: contributions to ageing research

NASA Astrophysics Data System (ADS)

Grigaravicius, P.; Monajembashi, S.; Hoffmann, M.; Altenberg, B.; Greulich, K. O.

2009-08-01

One essential cause of human ageing is the accumulation of DNA damages during lifetime. Experimental studies require quantitative induction of damages and techniques to visualize the subsequent DNA repair. A new technique, the "immuno fluorescent comet assay", is used to directly visualize DNA damages in the microscope. Using DNA repair proteins fluorescently labeled with green fluorescent protein, it could be shown that the repair of the most dangerous DNA double strand breaks starts with the inaccurate "non homologous end joining" pathway and only after 1 - 1 ½ minutes may switch to the more accurate "homologous recombination repair". One might suggest investigating whether centenarians use "homologous recombination repair" differently from those ageing at earlier years and speculate whether it is possible, for example by nutrition, to shift DNA repair to a better use of the error free pathway and thus promote healthy ageing. As a complementary technique optical tweezers, and particularly its variant "erythrocyte mediated force application", is used to simulate the effects of blood pressure on HUVEC cells representing the inner lining of human blood vessels. Stimulating one cell induces in the whole neighbourhood waves of calcium and nitric oxide, known to relax blood vessels. NIFEDIPINE and AMLODIPINE, both used as drugs in the therapy of high blood pressure, primarily a disease of the elderly, prolong the availability of nitric oxide. This partially explains their mode of action. In contrast, VERAPAMILE, also a blood pressure reducing drug, does not show this effect, indicating that obviously an alternative mechanism must be responsible for vessel relaxation.

A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

PubMed

Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

2013-12-04

Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

PubMed

Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

PubMed Central

Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

PubMed Central

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

2010-07-01

In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

PubMed

Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

2013-12-15

We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

NASA Astrophysics Data System (ADS)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

PubMed

Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

2017-09-19

DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

Quantum dot-based microfluidic biosensor for cancer detection

NASA Astrophysics Data System (ADS)

Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

2015-05-01

We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

Ultrasensitive and label-free detection of pathogenic avian influenza DNA by using CMOS impedimetric sensors.

PubMed

Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C

2012-05-15

This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.

An anti-DNA antibody prefers damaged dsDNA over native.

PubMed

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2017-01-01

DNA-protein interactions, including DNA-antibody complexes, have both fundamental and practical significance. In particular, antibodies against double-stranded DNA play an important role in the pathogenesis of autoimmune diseases. Elucidation of structural mechanisms of an antigen recognition and interaction of anti-DNA antibodies provides a basis for understanding the role of DNA-containing immune complexes in human pathologies and for new treatments. Here we used Molecular Dynamic simulations of bimolecular complexes of a segment of dsDNA with a monoclonal anti-DNA antibody's Fab-fragment to obtain detailed structural and physical characteristics of the dynamic intermolecular interactions. Using a computationally modified crystal structure of a Fab-DNA complex (PDB: 3VW3), we studied in silico equilibrium Molecular Dynamics of the Fab-fragment associated with two homologous dsDNA fragments, containing or not containing dimerized thymine, a product of DNA photodamage. The Fab-fragment interactions with the thymine dimer-containing DNA was thermodynamically more stable than with the native DNA. The amino acid residues constituting a paratope and the complementary nucleotide epitopes for both Fab-DNA constructs were identified. Stacking and electrostatic interactions were shown to play the main role in the antibody-dsDNA contacts, while hydrogen bonds were less significant. The aggregate of data show that the chemically modified dsDNA (containing a covalent thymine dimer) has a higher affinity toward the antibody and forms a stronger immune complex. These findings provide a mechanistic insight into formation and properties of the pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus, associated with skin photosensibilization and DNA photodamage.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-12

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

PubMed

Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

2018-06-04

The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

A Smart DNA Tweezer for Detection of Human Telomerase Activity.

PubMed

Xu, Xiaowen; Wang, Lei; Li, Kan; Huang, Qihong; Jiang, Wei

2018-03-06

Reliable and accurate detection of telomerase activity is crucial to better understand its role in cancer cells and to further explore its function in cancer diagnosis and treatment. Here, we construct a smart DNA tweezer (DT) for detection of telomerase activity. The DT is assembled by three specially designed single-stranded oligonucleotides: a central strand dually labeled with donor/acceptor fluorophores and two arm strands containing overhangs complementary to telomerase reaction products (TRPs). It can get closed through hybridization with TRPs and get reopen through strand displacement reaction by TRPs' complementary sequences. First, under the action of telomerase, telomerase binding substrates (TS) are elongated to generate TRPs ended with telomeric repeats (TTAGGG) n . TRPs hybridize with the two arm overhangs cooperatively and strain DT to closed state, inducing an increased fluorescence resonance energy transfer (FRET) efficiency, which is utilized for telomerase activity detection. Second, upon introduction of a removal strand (RS) complementary to TRPs, the closed DT is relaxed to open state via the toehold-mediated strand displacement, inducing a decreased FRET efficiency, which is utilized for determination of TRP length distribution. The detection limit of telomerase activity is equivalent to 141 cells/μL for HeLa cells, and telomerase-active cellular extracts can be differentiated from telomerase-inactive cellular extracts. Furthermore, TRPs owning 1, 2, 3, 4, and ≥5 telomeric repeats are identified to account for 25.6%, 20.5%, 15.7%, 12.5%, and 25.7%, respectively. The proposed strategy will offer a new approach for reliable, accurate detection of telomerase activity and product length distribution for deeper studying its role and function in cancer.

Topological Interaction by Entanglement of DNA

NASA Astrophysics Data System (ADS)

Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

2012-02-01

We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

PubMed

Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-11-20

We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

PubMed

Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

2009-09-01

Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Genome Editing: A New Approach to Human Therapeutics.

PubMed

Porteus, Matthew

2016-01-01

The ability to manipulate the genome with precise spatial and nucleotide resolution (genome editing) has been a powerful research tool. In the past decade, the tools and expertise for using genome editing in human somatic cells and pluripotent cells have increased to such an extent that the approach is now being developed widely as a strategy to treat human disease. The fundamental process depends on creating a site-specific DNA double-strand break (DSB) in the genome and then allowing the cell's endogenous DSB repair machinery to fix the break such that precise nucleotide changes are made to the DNA sequence. With the development and discovery of several different nuclease platforms and increasing knowledge of the parameters affecting different genome editing outcomes, genome editing frequencies now reach therapeutic relevance for a wide variety of diseases. Moreover, there is a series of complementary approaches to assessing the safety and toxicity of any genome editing process, irrespective of the underlying nuclease used. Finally, the development of genome editing has raised the issue of whether it should be used to engineer the human germline. Although such an approach could clearly prevent the birth of people with devastating and destructive genetic diseases, questions remain about whether human society is morally responsible enough to use this tool.

A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

PubMed

Wang, Guannan; Su, Xingguang

2010-06-01

A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

[DNA structure from A to Z--biological implications of structural diversity of DNA].

PubMed

Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

2006-01-01

Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres

PubMed Central

Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling

2012-01-01

An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Insights into DNA-mediated interparticle interactions from a coarse-grained model

NASA Astrophysics Data System (ADS)

Ding, Yajun; Mittal, Jeetain

2014-11-01

DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

Ultrasensitive detection of nucleic acids and proteins using quartz crystal microbalance and surface plasmon resonance sensors based on target-triggering multiple signal amplification strategy.

PubMed

Sun, Wenbo; Song, Weiling; Guo, Xiaoyan; Wang, Zonghua

2017-07-25

In this study, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) sensors were combined with template enhanced hybridization processes (TEHP), rolling circle amplification (RCA) and biocatalytic precipitation (BCP) for ultrasensitive detection of DNA and protein. The DNA complementary to the aptamer was released by the specific binding of the aptamer to the target protein and then hybridized with the capture probe and the assistant DNA to form a ternary "Y" junction structure. The initiation chain was generated by the template-enhanced hybridization process which leaded to the rolling circle amplification reaction, and a large number of repeating unit sequences were formed. Hybridized with the enzyme-labeled probes, the biocatalytic precipitation reaction was further carried out, resulting in a large amount of insoluble precipitates and amplifying the detection signal. Under the optimum conditions, detection limits as low as 43 aM for target DNA and 53 aM for lysozyme were achieved. In addition, this method also showed good selectivity and sensitivity in human serum. Copyright © 2017 Elsevier B.V. All rights reserved.

An integrated semiconductor device enabling non-optical genome sequencing.

PubMed

Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

2011-07-20

The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

Usefulness of telomere length in DNA from human teeth for age estimation.

PubMed

Márquez-Ruiz, Ana Belén; González-Herrera, Lucas; Valenzuela, Aurora

2018-03-01

Age estimation is widely used to identify individuals in forensic medicine. However, the accuracy of the most commonly used procedures is markedly reduced in adulthood, and these methods cannot be applied in practice when morphological information is limited. Molecular methods for age estimation have been extensively developed in the last few years. The fact that telomeres shorten at each round of cell division has led to the hypothesis that telomere length can be used as a tool to predict age. The present study thus aimed to assess the correlation between telomere length measured in dental DNA and age, and the effect of sex and tooth type on telomere length; a further aim was to propose a statistical regression model to estimate the biological age based on telomere length. DNA was extracted from 91 tooth samples belonging to 77 individuals of both sexes and 15 to 85 years old and was used to determine telomere length by quantitative real-time PCR. Our results suggested that telomere length was not affected by sex and was greater in molar teeth. We found a significant correlation between age and telomere length measured in DNA from teeth. However, the equation proposed to predict age was not accurate enough for forensic age estimation on its own. Age estimation based on telomere length in DNA from tooth samples may be useful as a complementary method which provides an approximate estimate of age, especially when human skeletal remains are the only forensic sample available.

Cotton Leaf Curl Multan Betasatellite DNA as a Tool to Deliver and Express the Human B-Cell Lymphoma 2 (Bcl-2) Gene in Plants.

PubMed

Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar

2016-05-01

The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.

'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

PubMed

Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

2018-02-01

Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

ERIC Educational Resources Information Center

Militello, Kevin T.

2013-01-01

Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

Therapeutic touch affects DNA synthesis and mineralization of human osteoblasts in culture.

PubMed

Jhaveri, Ankur; Walsh, Stephen J; Wang, Yatzen; McCarthy, MaryBeth; Gronowicz, Gloria

2008-11-01

Complementary and alternative medicine (CAM) techniques are commonly used in hospitals and private medical facilities; however, the effectiveness of many of these practices has not been thoroughly studied in a scientific manner. Developed by Dr. Dolores Krieger and Dora Kunz, Therapeutic Touch is one of these CAM practices and is a highly disciplined five-step process by which a practitioner can generate energy through their hands to promote healing. There are numerous clinical studies on the effects of TT but few in vitro studies. Our purpose was to determine if Therapeutic Touch had any effect on osteoblast proliferation, differentiation, and mineralization in vitro. TT was performed twice a week for 10 min each on human osteoblasts (HOBs) and on an osteosarcoma-derived cell line, SaOs-2. No significant differences were found in DNA synthesis, assayed by [(3)H]-thymidine incorporation at 1 or 2 weeks for SaOs-2 or 1 week for HOBs. However, after four TT treatments in 2 weeks, TT significantly (p = 0.03) increased HOB DNA synthesis compared to controls. Immunocytochemistry for Proliferating Cell Nuclear Antigen (PCNA) confirmed these data. At 2 weeks in differentiation medium, TT significantly increased mineralization in HOBs (p = 0.016) and decreased mineralization in SaOs-2 (p = 0.0007), compared to controls. Additionally, Northern blot analysis indicated a TT-induced increase in mRNA expression for Type I collagen, bone sialoprotein, and alkaline phosphatase in HOBs and a decrease of these bone markers in SaOs-2 cells. In conclusion, Therapeutic Touch appears to increase human osteoblast DNA synthesis, differentiation and mineralization, and decrease differentiation and mineralization in a human osteosarcoma-derived cell line. (c) 2008 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Electron transfer of plurimodified DNA SAMs.

PubMed

Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

2007-07-17

An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

PubMed Central

Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2015-01-01

The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

PubMed

Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

2016-02-02

The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

Double stranded nucleic acid biochips

DOEpatents

Chernov, Boris; Golova, Julia

2006-05-23

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

Molecular inversion probe assay for allelic quantitation

PubMed Central

Ji, Hanlee; Welch, Katrina

2010-01-01

Molecular inversion probe (MIP) technology has been demonstrated to be a robust platform for large-scale dual genotyping and copy number analysis. Applications in human genomic and genetic studies include the possibility of running dual germline genotyping and combined copy number variation ascertainment. MIPs analyze large numbers of specific genetic target sequences in parallel, relying on interrogation of a barcode tag, rather than direct hybridization of genomic DNA to an array. The MIP approach does not replace, but is complementary to many of the copy number technologies being performed today. Some specific advantages of MIP technology include: Less DNA required (37 ng vs. 250 ng), DNA quality less important, more dynamic range (amplifications detected up to copy number 60), allele specific information “cleaner” (less SNP crosstalk/contamination), and quality of markers better (fewer individual MIPs versus SNPs needed to identify copy number changes). MIPs can be considered a candidate gene (targeted whole genome) approach and can find specific areas of interest that otherwise may be missed with other methods. PMID:19488872

Gene chips and arrays revealed: a primer on their power and their uses.

PubMed

Watson, S J; Akil, H

1999-03-01

This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

Potential of mean force of DNA guided assemblies past Debye-Hückel regime

NASA Astrophysics Data System (ADS)

Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica

Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.

Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

PubMed

Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

2013-07-15

Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

PubMed Central

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-01-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

PubMed Central

Barth, Anna; Kobbe, Daniela; Focke, Manfred

2016-01-01

Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

Quantum dot-based microfluidic biosensor for cancer detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

2015-05-11

We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection

NASA Astrophysics Data System (ADS)

Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.

2017-09-01

Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.

Controlled assembly of artificial protein-protein complexes via DNA duplex formation.

PubMed

Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J

2015-03-18

DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.

Electrochemical detection of the MT-ND6 gene and its enzymatic digestion: application in human genomic sample.

PubMed

Mazloum-Ardakani, Mohammad; Ahmadi, Roya; Heidari, Mohammad Mehdi; Sheikh-Mohseni, Mohammad Ali

2014-06-15

A simple electrochemical biosensor was developed for the detection of the mitochondrial NADH dehydrogenase 6 gene (MT-ND6) and its enzymatic digestion by BamHI enzyme. This biosensor was fabricated by modification of a glassy carbon electrode with gold nanoparticles (AuNPs/GCE) and a probe oligonucleotide (ssDNA/AuNPs/GCE). The probe, which is a thiolated segment of the MT-ND6 gene, was deposited by self-assembling immobilization on AuNPs/GCE. Two indicators including methylene blue (MB) and neutral red (NR) were used as the electroactive indicators and the electrochemical response of the modified electrode was measured by differential pulse voltammetry. The proposed biosensor can detect the complementary sequences of the MT-ND6 gene. Also the modified electrode was used for the detection of an enzymatic digestion process by BamHI enzyme. The electrochemical biosensor can detect the MT-ND6 gene and its enzymatic digestion in polymerase chain reaction (PCR)-amplified DNA extracted from human blood. Also the biosensor was used directly for detection of the MT-ND6 gene in all of the human genome. Copyright © 2014 Elsevier Inc. All rights reserved.

Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

PubMed

Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

2017-02-23

Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency

PubMed Central

Kohn, Donald B.; Weinberg, Kenneth I.; Nolta, Jan A.; Heiss, Linda N.; Lenarsky, Carl; Crooks, Gay M.; Hanley, Mary E.; Annett, Geralyn; Brooks, Judith S.; El-Khoureiy, Anthony; Lawrence, Kim; Wells, Susie; Moen, Robert C.; Bastian, John; Williams-Herman, Debora E.; Elder, Melissa; Wara, Diane; Bowen, Thomas; Hershfield, Michael S.; Mullen, Craig A.; Blaese, R. Michael; Parkman, Robertson

2010-01-01

Haematopoietic stem cells in umbilical cord blood are an attractive target for gene therapy of inborn errors of metabolism. Three neonates with severe combined immunodeficiency were treated by retroviral-mediated transduction of the CD34+ cells from their umbilical cord blood with a normal human adenosine deaminase complementary DNA followed by autologous transplantation. The continued presence and expression of the introduced gene in leukocytes from bone marrow and peripheral blood for 18 months demonstrates that umbilical cord blood cells may be genetically modified with retroviral vectors and engrafted in neonates for gene therapy. PMID:7489356

The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor.

PubMed

Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza

2014-12-01

This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.

Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

PubMed

Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

2009-03-01

A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

Molecular cloning and characterization of arginine kinase gene of Toxocara canis.

PubMed

Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok

2015-06-01

Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.

Xeroderma Pigmentosum Group C Deficiency Alters Cigarette Smoke DNA Damage Cell Fate and Accelerates Emphysema Development.

PubMed

Sears, Catherine R; Zhou, Huaxin; Justice, Matthew J; Fisher, Amanda J; Saliba, Jacob; Lamb, Isaac; Wicker, Jessica; Schweitzer, Kelly S; Petrache, Irina

2018-03-01

Cigarette smoke (CS) exposure is a major risk factor for the development of emphysema, a common disease characterized by loss of cells comprising the lung parenchyma. The mechanisms of cell injury leading to emphysema are not completely understood but are thought to involve persistent cytotoxic or mutagenic DNA damage induced by CS. Using complementary cell culture and mouse models of CS exposure, we investigated the role of the DNA repair protein, xeroderma pigmentosum group C (XPC), on CS-induced DNA damage repair and emphysema. Expression of XPC was decreased in mouse lungs after chronic CS exposure and XPC knockdown in cultured human lung epithelial cells decreased their survival after CS exposure due to activation of the intrinsic apoptosis pathway. Similarly, cell autophagy and apoptosis were increased in XPC-deficient mouse lungs and were further increased by CS exposure. XPC deficiency was associated with structural and functional changes characteristic of emphysema, which were worsened by age, similar to levels observed with chronic CS exposure. Taken together, these findings suggest that repair of DNA damage by XPC plays an important and previously unrecognized role in the maintenance of alveolar structures. These findings support that loss of XPC, possibly due to chronic CS exposure, promotes emphysema development and further supports a link between DNA damage, impaired DNA repair, and development of emphysema.

Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

PubMed

Ahour, F; Shamsi, A

2017-09-01

Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

Cancer.gov

The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

2017-12-01

Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

Ultraaccurate genome sequencing and haplotyping of single human cells.

PubMed

Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

2017-11-21

Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

A chemiluminescence biosensor based on the adsorption recognition function between Fe3O4@SiO2@GO polymers and DNA for ultrasensitive detection of DNA

NASA Astrophysics Data System (ADS)

Sun, Yuanling; Li, Jianbo; Wang, Yanhui; Ding, Chaofan; Lin, Yanna; Sun, Weiyan; Luo, Chuannan

2017-05-01

In this work, a chemiluminescence (CL) biosensor was prepared for ultrasensitive determination of deoxyribonucleic acid (DNA) based on the adsorption recognition function between core-shell Fe3O4@SiO2 - graphene oxide (Fe3O4@SiO2@GO) polymers and DNA. The Fe3O4@SiO2@GO polymers were composed by GO and magnetite nanoparticles. And the core-shell polymers were confirmed by Scanning Electron Microscope (SEM), X-Ray Powder Diffraction (XRD) and Fourier Transform Infrared (FTIR). Then Fe3O4@SiO2@GO was modified by DNA. Based on the principle of complementary base, Fe3O4@SiO2@GO-DNA was introduced to the CL system and the selectivity, sensitivity of DNA detection was significantly improved. The adsorption properties of Fe3O4@SiO2@GO to DNA were researched through the adsorption equilibrium, adsorption kinetic and thermodynamics. Under optimized CL conditions, DNA could be assayed with the linear concentration range of 5.0 × 10- 12-2.5 × 10- 11 mol/L. The detection limit was 1.7 × 10- 12 mol/L (3δ) and the relative standard deviation (RSD) was 3.1%. The biosensor was finally used for the determination of DNA in laboratory samples and recoveries ranged from 99% to 103%. The satisfactory results revealed the potential application of Fe3O4@SiO2@GO-DNA-CL biosensor in the diagnosis and the treatment of human genetic diseases.

DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

EPA Science Inventory

A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

Decreased hepatocyte membrane potential differences and GABAA-beta3 expression in human hepatocellular carcinoma.

PubMed

Minuk, Gerald Y; Zhang, Manna; Gong, Yuewen; Minuk, Leonard; Dienes, Hans; Pettigrew, Norman; Kew, Michael; Lipschitz, Jeremy; Sun, Dongfeng

2007-03-01

To determine whether hepatocyte membrane potential differences (PDs) are depolarized in human HCC and whether depolarization is associated with changes in GABAA receptor expression, hepatocyte PDs and gamma-aminobutyric acid (GABA)A receptor messenger RNA (mRNA) and protein expression were documented in HCC tissues via microelectrode impalement, real-time reverse-transcriptase polymerase chain reaction, and Western blot analysis, respectively. HCC tissues were significantly depolarized (-19.8+/-1.3 versus -25.9+/-3.2 mV, respectively [P<0.05]), and GABAA-beta3 expression was down-regulated (GABAA-beta3 mRNA and protein expression in HCC; 5,693+/-1,385 and 0.29+/-0.11 versus 11,046+/-4,979 copies/100 mg RNA and 0.62+/-0.16 optical density in adjacent tumor tissues, respectively [P=0.002 and P<0.0001, respectively]) when compared with adjacent nontumor tissues. To determine the physiological relevance of the down-regulation, human malignant hepatocytes deficient in GABAA-beta3 receptor expression (Huh-7 cells) were transfected with GABAA-beta3 complementary DNA (cDNA) or vector alone and injected into nu/nu nude mice (n=16-17 group). Tumors developed after a mean (+/-SD) of 51+/-6 days (range: 41-60 days) in 7/16 (44%) mice injected with vector-transfected cells and 70+/-12 days (range: 59-86 days) in 4/17 (24%) mice injected with GABAA-beta3 cDNA-transfected cells (P<0.005). The results of this study indicate that (1) human HCC tissues are depolarized compared with adjacent nontumor tissues, (2) hepatic GABAA-beta3 receptor expression is down-regulated in human HCC, and (3) restoration of GABAA-beta3 receptor expression results in attenuated in vivo tumor growth in nude mice.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Step-gate polysilicon nanowires field effect transistor compatible with CMOS technology for label-free DNA biosensor.

PubMed

Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F

2013-02-15

Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.

Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

PubMed

Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

2012-01-01

A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

PubMed

Thomason, Lynn C; Costantino, Nina; Court, Donald L

2016-09-13

Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

PubMed

Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

2016-04-01

An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

PubMed

Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

2016-12-01

Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Specific identification of human papillomavirus type in cervical smears and paraffin sections by in situ hybridization with radioactive probes: a preliminary communication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, J.; Gendelman, H.E.; Naghashfar, Z.

1985-01-01

Cervical Papanicolaou smears and paraffin sections of biopsy specimens obtained from women attending dysplasia clinics were examined for viral DNA sequences by in situ hybridization technique using TVS-labeled cloned recombinant DNA probes of human papillomavirus (HPV) types 6, 11, and 16. These and one unrelated DNA probe complementary to measles virus RNA were labeled by nick translation using either one or two TVS-labeled nucleotides. Paraffin sections and cervical smears were collected on pretreated slides, hybridized with the probes under stringent or nonstringent conditions for 50 h, and autoradiographed. Additional cervical specimens from the same women were examined for the presencemore » of genus-specific papillomavirus capsid antigen by the immunoperoxidase technique. Preliminary results may be summarized as follows. The infecting virus could be identified in smears as well as in sections. Viral DNA sequences were detected only when there were condylomatous cells in the specimen and in only a proportion of the condylomatous cells. Even under stringent conditions, some specimens reacted with both HPV-6 and HPV-11. In some instances, the cells did not hybridize with any of the three probes even when duplicate specimens contained frankly condylomatous, capsid antigen-positive cells. In situ hybridization of Papanicolaou smears or of tissue sections is a practical method for diagnosis and follow-up of specific papillomavirus infection using routinely collected material.« less

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

1984-02-01

Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

NASA Astrophysics Data System (ADS)

Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

2015-09-01

The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

PubMed

David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

2016-05-19

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

G-quadruplexes as novel cis-elements controlling transcription during embryonic development

PubMed Central

David, Aldana P.; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B.

2016-01-01

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. PMID:26773060

Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

NASA Astrophysics Data System (ADS)

Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

2016-09-01

Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.

Metabolic rescue in pluripotent cells from patients with mtDNA disease.

PubMed

Ma, Hong; Folmes, Clifford D L; Wu, Jun; Morey, Robert; Mora-Castilla, Sergio; Ocampo, Alejandro; Ma, Li; Poulton, Joanna; Wang, Xinjian; Ahmed, Riffat; Kang, Eunju; Lee, Yeonmi; Hayama, Tomonari; Li, Ying; Van Dyken, Crystal; Gutierrez, Nuria Marti; Tippner-Hedges, Rebecca; Koski, Amy; Mitalipov, Nargiz; Amato, Paula; Wolf, Don P; Huang, Taosheng; Terzic, Andre; Laurent, Louise C; Izpisua Belmonte, Juan Carlos; Mitalipov, Shoukhrat

2015-08-13

Mitochondria have a major role in energy production via oxidative phosphorylation, which is dependent on the expression of critical genes encoded by mitochondrial (mt)DNA. Mutations in mtDNA can cause fatal or severely debilitating disorders with limited treatment options. Clinical manifestations vary based on mutation type and heteroplasmy (that is, the relative levels of mutant and wild-type mtDNA within each cell). Here we generated genetically corrected pluripotent stem cells (PSCs) from patients with mtDNA disease. Multiple induced pluripotent stem (iPS) cell lines were derived from patients with common heteroplasmic mutations including 3243A>G, causing mitochondrial encephalomyopathy and stroke-like episodes (MELAS), and 8993T>G and 13513G>A, implicated in Leigh syndrome. Isogenic MELAS and Leigh syndrome iPS cell lines were generated containing exclusively wild-type or mutant mtDNA through spontaneous segregation of heteroplasmic mtDNA in proliferating fibroblasts. Furthermore, somatic cell nuclear transfer (SCNT) enabled replacement of mutant mtDNA from homoplasmic 8993T>G fibroblasts to generate corrected Leigh-NT1 PSCs. Although Leigh-NT1 PSCs contained donor oocyte wild-type mtDNA (human haplotype D4a) that differed from Leigh syndrome patient haplotype (F1a) at a total of 47 nucleotide sites, Leigh-NT1 cells displayed transcriptomic profiles similar to those in embryo-derived PSCs carrying wild-type mtDNA, indicative of normal nuclear-to-mitochondrial interactions. Moreover, genetically rescued patient PSCs displayed normal metabolic function compared to impaired oxygen consumption and ATP production observed in mutant cells. We conclude that both reprogramming approaches offer complementary strategies for derivation of PSCs containing exclusively wild-type mtDNA, through spontaneous segregation of heteroplasmic mtDNA in individual iPS cell lines or mitochondrial replacement by SCNT in homoplasmic mtDNA-based disease.

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

2012-04-01

A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

PubMed

Naimuddin, Mohammed; Kubo, Tai

2011-12-01

We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Functional metagenomics to mine the human gut microbiome for dietary fiber catabolic enzymes.

PubMed

Tasse, Lena; Bercovici, Juliette; Pizzut-Serin, Sandra; Robe, Patrick; Tap, Julien; Klopp, Christophe; Cantarel, Brandi L; Coutinho, Pedro M; Henrissat, Bernard; Leclerc, Marion; Doré, Joël; Monsan, Pierre; Remaud-Simeon, Magali; Potocki-Veronese, Gabrielle

2010-11-01

The human gut microbiome is a complex ecosystem composed mainly of uncultured bacteria. It plays an essential role in the catabolism of dietary fibers, the part of plant material in our diet that is not metabolized in the upper digestive tract, because the human genome does not encode adequate carbohydrate active enzymes (CAZymes). We describe a multi-step functionally based approach to guide the in-depth pyrosequencing of specific regions of the human gut metagenome encoding the CAZymes involved in dietary fiber breakdown. High-throughput functional screens were first applied to a library covering 5.4 × 10(9) bp of metagenomic DNA, allowing the isolation of 310 clones showing beta-glucanase, hemicellulase, galactanase, amylase, or pectinase activities. Based on the results of refined secondary screens, sequencing efforts were reduced to 0.84 Mb of nonredundant metagenomic DNA, corresponding to 26 clones that were particularly efficient for the degradation of raw plant polysaccharides. Seventy-three CAZymes from 35 different families were discovered. This corresponds to a fivefold target-gene enrichment compared to random sequencing of the human gut metagenome. Thirty-three of these CAZy encoding genes are highly homologous to prevalent genes found in the gut microbiome of at least 20 individuals for whose metagenomic data are available. Moreover, 18 multigenic clusters encoding complementary enzyme activities for plant cell wall degradation were also identified. Gene taxonomic assignment is consistent with horizontal gene transfer events in dominant gut species and provides new insights into the human gut functional trophic chain.

Using Complementary Learning Clusters in Studying Literature to Enhance Students' Medical Humanities Literacy, Critical Thinking, and English Proficiency.

PubMed

Liao, Hung-Chang; Wang, Ya-Huei

2016-04-01

This study examined whether students studying literature in complementary learning clusters would show more improvement in medical humanities literacy, critical thinking skills, and English proficiency compared to those in conventional learning clusters. Ninety-three students participated in the study (M age = 18.2 years, SD = 0.4; 36 men, 57 women). A quasi-experimental design was used over 16 weeks, with the control group (n = 47) working in conventional learning clusters and the experimental group (n = 46) working in complementary learning clusters. Complementary learning clusters were those in which individuals had complementary strengths enabling them to learn from and offer assistance to other cluster members, hypothetically facilitating the learning process. Measures included the Medical Humanities Literacy Scale, Critical Thinking Disposition Assessment, English proficiency tests, and Analytic Critical Thinking Scoring Rubric. The results showed that complementary learning clusters have the potential to improve students' medical humanities literacy, critical thinking skills, and English proficiency. © The Author(s) 2016.

Characterization of soil nematode communities in three cropping systems through morphological and DNA metabarcoding approaches

USDA-ARS?s Scientific Manuscript database

Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Toward three-dimensional microelectronic systems: directed self-assembly of silicon microcubes via DNA surface functionalization.

PubMed

Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra

2013-07-02

The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA functionalization and hybridization. The yield of formed aggregates was found to be about 44%, with a relative fraction of dimers of some 30%. Finally, the electrical properties of the formed dimers were characterized using probe tips inside a scanning electron microscope.

Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

PubMed

Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

2005-01-01

Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

PubMed

Cui, Chenghua; Shu, Wei; Li, Peining

2016-01-01

Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

PubMed Central

Hardman, Norman

1974-01-01

Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

PubMed Central

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen.

PubMed

Nordin, Noordiana; Yusof, Nor Azah; Radu, Son; Hushiarian, Roozbeh

2018-06-03

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm 2 ). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

PubMed

Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

2018-05-24

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

PubMed

Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

2014-03-04

Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

Simulations Using Random-Generated DNA and RNA Sequences

ERIC Educational Resources Information Center

Bryce, C. F. A.

1977-01-01

Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

Comparison of multiple gene assembly methods for metabolic engineering

Treesearch

Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

2007-01-01

A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

USDA-ARS?s Scientific Manuscript database

A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

A chemiluminescence biosensor based on the adsorption recognition function between Fe3O4@SiO2@GO polymers and DNA for ultrasensitive detection of DNA.

PubMed

Sun, Yuanling; Li, Jianbo; Wang, Yanhui; Ding, Chaofan; Lin, Yanna; Sun, Weiyan; Luo, Chuannan

2017-05-05

In this work, a chemiluminescence (CL) biosensor was prepared for ultrasensitive determination of deoxyribonucleic acid (DNA) based on the adsorption recognition function between core-shell Fe 3 O 4 @SiO 2 - graphene oxide (Fe 3 O 4 @SiO 2 @GO) polymers and DNA. The Fe 3 O 4 @SiO 2 @GO polymers were composed by GO and magnetite nanoparticles. And the core-shell polymers were confirmed by Scanning Electron Microscope (SEM), X-Ray Powder Diffraction (XRD) and Fourier Transform Infrared (FTIR). Then Fe 3 O 4 @SiO 2 @GO was modified by DNA. Based on the principle of complementary base, Fe 3 O 4 @SiO 2 @GO-DNA was introduced to the CL system and the selectivity, sensitivity of DNA detection was significantly improved. The adsorption properties of Fe 3 O 4 @SiO 2 @GO to DNA were researched through the adsorption equilibrium, adsorption kinetic and thermodynamics. Under optimized CL conditions, DNA could be assayed with the linear concentration range of 5.0×10 -12 -2.5×10 -11 mol/L. The detection limit was 1.7×10 -12 mol/L (3δ) and the relative standard deviation (RSD) was 3.1%. The biosensor was finally used for the determination of DNA in laboratory samples and recoveries ranged from 99% to 103%. The satisfactory results revealed the potential application of Fe 3 O 4 @SiO 2 @GO-DNA-CL biosensor in the diagnosis and the treatment of human genetic diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Kits for Characterization of Chromosomal Inversions Using Probes

NASA Technical Reports Server (NTRS)

Ray, F. Andrew (Inventor)

2017-01-01

A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

PubMed Central

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

PubMed

Rosa, A M M; Prazeres, D M F; Paulo, P M R

2017-06-28

Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arondel, V.; Lemieux, B.; Hwang, I.

1992-11-20

A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less

[Sea urchin embryo, DNA-damaged cell cycle checkpoint and the mechanisms initiating cancer development].

PubMed

Bellé, Robert; Le Bouffant, Ronan; Morales, Julia; Cosson, Bertrand; Cormier, Patrick; Mulner-Lorillon, Odile

2007-01-01

Cell division is an essential process for heredity, maintenance and evolution of the whole living kingdom. Sea urchin early development represents an excellent experimental model for the analysis of cell cycle checkpoint mechanisms since embryonic cells contain a functional DNA-damage checkpoint and since the whole sea urchin genome is sequenced. The DNA-damaged checkpoint is responsible for an arrest in the cell cycle when DNA is damaged or incorrectly replicated, for activation of the DNA repair mechanism, and for commitment to cell death by apoptosis in the case of failure to repair. New insights in cancer biology lead to two fundamental concepts about the very first origin of cancerogenesis. Cancers result from dysfunction of DNA-damaged checkpoints and cancers appear as a result of normal stem cell (NCS) transformation into a cancer stem cell (CSC). The second aspect suggests a new definition of "cancer", since CSC can be detected well before any clinical evidence. Since early development starts from the zygote, which is a primary stem cell, sea urchin early development allows analysis of the early steps of the cancerization process. Although sea urchins do not develop cancers, the model is alternative and complementary to stem cells which are not easy to isolate, do not divide in a short time and do not divide synchronously. In the field of toxicology and incidence on human health, the sea urchin experimental model allows assessment of cancer risk from single or combined molecules long before any epidemiologic evidence is available. Sea urchin embryos were used to test the worldwide used pesticide Roundup that contains glyphosate as the active herbicide agent; it was shown to activate the DNA-damage checkpoint of the first cell cycle of development. The model therefore allows considerable increase in risk evaluation of new products in the field of cancer and offers a tool for the discovery of molecular markers for early diagnostic in cancer biology. Prevention and early diagnosis are two decisive elements of human cancer therapy.

The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

PubMed Central

2015-01-01

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

Single Molecule Nano-Metronome

PubMed Central

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

DTIC Science & Technology

2006-07-28

manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

PubMed Central

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

2011-01-01

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

PubMed

Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

2012-01-15

A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

DNA Nanotechnology for Cancer Therapy

PubMed Central

Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

2016-01-01

DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

PubMed Central

Ludwig, Linda B; Ambrus, Julian L; Krawczyk, Kristie A; Sharma, Sanjay; Brooks, Stephen; Hsiao, Chiu-Bin; Schwartz, Stanley A

2006-01-01

Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ) protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). Results Inspection of published sequences revealed a potential transcription initiator element (INR) situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR) suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s) could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s) were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK) sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP) sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The novel HAPs are encoded in a region of the LTR that has already been shown to be deleted in some HIV-infected long-term survivors and represent new potential targets for vaccine development. PMID:17090330

Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

PubMed

Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

2017-05-08

In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

PubMed

Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

2018-01-01

Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

Genome-wide alterations of the DNA replication program during tumor progression

NASA Astrophysics Data System (ADS)

Arneodo, A.; Goldar, A.; Argoul, F.; Hyrien, O.; Audit, B.

2016-08-01

Oncogenic stress is a major driving force in the early stages of cancer development. Recent experimental findings reveal that, in precancerous lesions and cancers, activated oncogenes may induce stalling and dissociation of DNA replication forks resulting in DNA damage. Replication timing is emerging as an important epigenetic feature that recapitulates several genomic, epigenetic and functional specificities of even closely related cell types. There is increasing evidence that chromosome rearrangements, the hallmark of many cancer genomes, are intimately associated with the DNA replication program and that epigenetic replication timing changes often precede chromosomic rearrangements. The recent development of a novel methodology to map replication fork polarity using deep sequencing of Okazaki fragments has provided new and complementary genome-wide replication profiling data. We review the results of a wavelet-based multi-scale analysis of genomic and epigenetic data including replication profiles along human chromosomes. These results provide new insight into the spatio-temporal replication program and its dynamics during differentiation. Here our goal is to bring to cancer research, the experimental protocols and computational methodologies for replication program profiling, and also the modeling of the spatio-temporal replication program. To illustrate our purpose, we report very preliminary results obtained for the chronic myelogeneous leukemia, the archetype model of cancer. Finally, we discuss promising perspectives on using genome-wide DNA replication profiling as a novel efficient tool for cancer diagnosis, prognosis and personalized treatment.

Label-free electrochemiluminescence biosensor for ultrasensitive detection of telomerase activity in HeLa cells based on extension reaction and intercalation of Ru(phen)3 (2.).

PubMed

Lin, Yue; Yang, Linlin; Yue, Guiyin; Chen, Lifen; Qiu, Bin; Guo, Longhua; Lin, Zhenyu; Chen, Guonan

2016-10-01

Telomerase is one of the most common markers of human malignant tumors, such as uterine, stomach, esophageal, breast, colorectal, laryngeal squamous cell, thyroid, bladder, and so on. It is necessary to develop some sensitive but convenient detection methods for telomerase activity determination. In this study, a label-free and ultrasensitive electrochemiluminescence (ECL) biosensor has been fabricated to detect the activity of telomerase extracted from HeLa cells. Thiolated telomerase substrate (TS) primer was immobilized on the gold electrode surface through gold-sulfur (Au-S) interaction and then elongated by telomerase specifically. Then, it was hybridized with complementary DNA to form double-stranded DNA (dsDNA) fragments on the electrode surface, and Ru(phen)3 (2+) has been intercalated into the dsDNA grooves to act as the ECL probe. The enhanced ECL intensity has a linear relationship with the number of HeLa cells in the range of 5∼5000 and with a detection limit of 2 HeLa cells. The proposed ECL biosensor has high specificity to telomerase in the presence of common interferents. The relative standard deviations (RSDs) were <5 % at 100 HeLa cells. The proposed method provides a convenient approach for telomerase-related cancer screening or diagnosis.

DNA impedance biosensor for detection of cancer, TP53 gene mutation, based on gold nanoparticles/aligned carbon nanotubes modified electrode.

PubMed

Fayazfar, H; Afshar, A; Dolati, M; Dolati, A

2014-07-11

For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.; Maye, M; Zhang, Y

We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

Inferences of Recent and Ancient Human Population History Using Genetic and Non-Genetic Data

ERIC Educational Resources Information Center

Kitchen, Andrew

2008-01-01

I have adopted complementary approaches to inferring human demographic history utilizing human and non-human genetic data as well as cultural data. These complementary approaches form an interdisciplinary perspective that allows one to make inferences of human history at varying timescales, from the events that occurred tens of thousands of years…

DNA attachment to support structures

DOEpatents

Balhorn, Rodney L.; Barry, Christopher H.

2002-01-01

Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

Higher Levels of Neanderthal Ancestry in East Asians than in Europeans

PubMed Central

Wall, Jeffrey D.; Yang, Melinda A.; Jay, Flora; Kim, Sung K.; Durand, Eric Y.; Stevison, Laurie S.; Gignoux, Christopher; Woerner, August; Hammer, Michael F.; Slatkin, Montgomery

2013-01-01

Neanderthals were a group of archaic hominins that occupied most of Europe and parts of Western Asia from ∼30,000 to 300,000 years ago (KYA). They coexisted with modern humans during part of this time. Previous genetic analyses that compared a draft sequence of the Neanderthal genome with genomes of several modern humans concluded that Neanderthals made a small (1–4%) contribution to the gene pools of all non-African populations. This observation was consistent with a single episode of admixture from Neanderthals into the ancestors of all non-Africans when the two groups coexisted in the Middle East 50–80 KYA. We examined the relationship between Neanderthals and modern humans in greater detail by applying two complementary methods to the published draft Neanderthal genome and an expanded set of high-coverage modern human genome sequences. We find that, consistent with the recent finding of Meyer et al. (2012), Neanderthals contributed more DNA to modern East Asians than to modern Europeans. Furthermore we find that the Maasai of East Africa have a small but significant fraction of Neanderthal DNA. Because our analysis is of several genomic samples from each modern human population considered, we are able to document the extent of variation in Neanderthal ancestry within and among populations. Our results combined with those previously published show that a more complex model of admixture between Neanderthals and modern humans is necessary to account for the different levels of Neanderthal ancestry among human populations. In particular, at least some Neanderthal–modern human admixture must postdate the separation of the ancestors of modern European and modern East Asian populations. PMID:23410836

Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

DTIC Science & Technology

2008-09-22

the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

NASA Astrophysics Data System (ADS)

Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

1989-06-01

The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

Development and validation of a modified comet assay to phenotypically assess nucleotide excision repair.

PubMed

Langie, Sabine A S; Knaapen, Ad M; Brauers, Karen J J; van Berlo, Damien; van Schooten, Frederik-Jan; Godschalk, Roger W L

2006-03-01

There is an increasing need for simple and reliable approaches to phenotypically assess DNA repair capacities. Therefore, a modification of the alkaline comet assay was developed to determine the ability of human lymphocyte extracts to perform the initial steps of the nucleotide excision repair (NER) process, i.e. damage recognition and incision. Gel-embedded nucleoids from A549 cells, pre-exposed to 1 microM benzo[a]pyrene-diol-epoxide, were incubated with cell extracts from frozen or freshly isolated lymphocytes. The rate at which incisions are introduced and the subsequent increase in tail moment is indicative for the repair capacity of the extracts. Freshly prepared extracts from lymphocytes of human volunteers (n = 8) showed significant inter-individual variations in their DNA repair capacity, which correlated with the removal of bulky DNA lesions over a period of 48 h determined by (32)P-post-labelling (R(2) = 0.76, P = 0.005). Repeated measurements revealed a low inter-assay variation (11%). Storage of cell extracts for more than 3 weeks significantly reduced (up to 80%) the capacity to incise the damaged DNA as compared to freshly isolated extracts. This reduction was completely restored by addition of ATP to the extracts before use, as it is required for the incision step of NER. In contrast, extracts freshly prepared from frozen lymphocyte pellets can be used without loss of repair activity. DNA repair deficient XPA-/- and XPC-/- fibroblasts were used to further validate the assay. Although some residual capacity to incise the DNA was observed in these cells, the repair activity was restored to normal wild-type levels when a complementary mixture of both extracts (thereby restoring XPA and XPC deficiency) was used. These results demonstrate that this repair assay can be applied in molecular epidemiological studies to assess inter-individual differences in NER.

The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.

PubMed

Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L

2001-04-06

The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Getting it Right: How DNA Polymerases Select the Right Nucleotide.

PubMed

Ludmann, Samra; Marx, Andreas

2016-01-01

All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

PubMed Central

Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

2010-01-01

Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

PCR-based detection of gene transfer vectors: application to gene doping surveillance.

PubMed

Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

2013-12-01

Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

The Hmong Diaspora: preserved South-East Asian genetic ancestry in French Guianese Asians.

PubMed

Brucato, Nicolas; Mazières, Stéphane; Guitard, Evelyne; Giscard, Pierre-Henri; Bois, Etienne; Larrouy, Georges; Dugoujon, Jean-Michel

2012-01-01

The Hmong Diaspora is one of the widest modern human migrations. Mainly localised in South-East Asia, the United States of America, and metropolitan France, a small community has also settled the Amazonian forest of French Guiana. We have biologically analysed 62 individuals of this unique Guianese population through three complementary genetic markers: mitochondrial DNA (HVS-I/II and coding region SNPs), Y-chromosome (SNPs and STRs), and the Gm allotypic system. All genetic systems showed a high conservation of the Asian gene pool (Asian ancestry: mtDNA=100.0%; NRY=99.1%; Gm=96.6%), without a trace of founder effect. When compared across various Asian populations, the highest correlations were observed with Hmong-Mien groups still living in South-East Asia (Fst<0.05; P-value<0.05). Despite a long history punctuated by exodus, the French Guianese Hmong have maintained their original genetic diversity. Copyright © 2012 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.

PubMed

Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng

2018-05-31

By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.

Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

PubMed

Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

2018-02-15

Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

Liquid biopsy in non-small cell lung cancer: a key role in the future of personalized medicine?

PubMed

Pi, Can; Zhang, Ming-Feng; Peng, Xiao-Xiao; Zhang, Yi-Chen; Xu, Chong-Rui; Zhou, Qing

2017-12-01

Liquid biopsies, especially the analysis of circulating tumor DNA (ctDNA), as a novel and non-invasive method for the diagnosis and monitoring of non-small cell lung cancer (NSCLC) have already been implemented in clinical settings. The majority of ctDNA is released from apoptotic or necrotic tumor cells, thus reflecting the genetic profile of a tumor. Numerous studies have reported a high concordance in mutation profiles derived from liquid biopsy and tissue biopsy, especially in driver genes. Liquid biopsy could overcome the clonal heterogeneity of tumour biopsy, as it provides a single snapshot of a tumour tissue. Moreover, non-invasiveness is the biggest advantage for liquid biopsy, and the procedure can be repeatedly performed during the treatment for the purpose of monitoring. Therefore, ctDNA could act as a potential complementary method for tissue biopsies in diagnosis, prognostic, treatment response and resistance. Areas covered: This review summarizes the recent advancements in liquid biopsy with a focus on NSCLC, including its applications and technologies associated with assessing ctDNA. The authors conclude the review by discussing the challenges associated with liquid biopsy. Expert commentary: The analysis of ctDNA represents a promising method for liquid biopsy, which will be a novel and potentially complementary method in diagnosis, treatment and prognostic in NSCLC at all stages.

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Regulation of corneal repair by particle-mediated gene transfer of opioid growth factor receptor complementary DNA.

PubMed

Zagon, Ian S; Sassani, Joseph W; Malefyt, Kristin J; McLaughlin, Patricia J

2006-11-01

To determine whether molecular manipulation of the opioid growth factor receptor (OGFr) alters corneal reepithelialization following central corneal abrasion in rats. The plasmid pcDNA3.1 + OGFr, carrying the rat OGFr complementary DNA in both the sense and antisense orientations, and empty vector (EV), were delivered by gene gun to the rat cornea. After 24 hours, corneas were abraded and reepithelialization was documented by fluorescein photography. Twenty-four hours after wounding, DNA synthesis (with bromodeoxyuridine) was examined. Eyes transfected with sense constructs of OGFr had corneal defects that were 24%, 52%, and 50% larger than the EV group at 16, 24, and 28 hours, respectively. Conversely, corneas transfected with antisense constructs of OGFr had corneal defects that were 56% and 48% smaller than the EV group at 16 and 24 hours, respectively. Bromodeoxyuridine labeling in the basal and suprabasal layers of the antisense group were increased 3.3- and 3.7-fold, respectively, in DNA synthesis from corresponding EV layers; DNA synthesis was comparable in the sense and EV groups. Excess OGFr delays reepithelialization, whereas attenuation of OGFr accelerates repair of the corneal surface. Clinical Relevance Inhibition of opioid growth factor action using gene therapy could be important in the treatment of corneal diseases such as nonhealing and recurrent erosions, diabetic keratopathy, and neurotrophic keratitis.

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

PubMed

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

2011-11-27

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection.

PubMed

Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

2017-05-10

A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.

Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

PubMed

Saleh, Mona; El-Matbouli, Mansour

2015-06-01

Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

Mechanisms of Surface-Mediated DNA Hybridization

PubMed Central

2015-01-01

Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

Impedimetric genosensor for detection of hepatitis C virus (HCV1) DNA using viral probe on methylene blue doped silica nanoparticles.

PubMed

Singhal, Chaitali; Ingle, Aviraj; Chakraborty, Dhritiman; Pn, Anoop Krishna; Pundir, C S; Narang, Jagriti

2017-05-01

An impedimetric genosensor was fabricated for detection of hepatitis C virus (HCV) genotype 1 in serum, based on hybridization of the probe with complementary target cDNA from sample. To achieve it, probe DNA complementary to HCVgene was immobilized on the surface of methylene blue (MB) doped silica nanoparticles MB@SiNPs) modified fluorine doped tin oxide (FTO) electrode. The synthesized MB@SiNPs was characterized using scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) pattern. This modified electrode (ssDNA/MB@SiNPs/FTO) served both as a signal amplification platform (due to silica nanoparticles (SiNPs) as well as an electrochemical indicator (due to methylene blue (MB)) for the detection of the HCV DNA in patient serum sample. The genosensor was optimized and evaluated. The sensor showed a dynamic linear range 100-10 6 copies/mL, with a detection limit of 90 copies/mL. The sensor was applied for detection of HCV in sera of hepatitis patient and could be renewed. The half life of the sensor was 4 weeks. The MB@SiNPs/FTO electrode could be used for preparation of other gensensors also. Copyright © 2017 Elsevier B.V. All rights reserved.

Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

PubMed

del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

2014-04-15

Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

PubMed

Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

2014-06-01

Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

Electrical detection of DNA hybridization: three extraction techniques based on interdigitated Al/Al2O3 capacitors.

PubMed

Moreno-Hagelsieb, L; Foultier, B; Laurent, G; Pampin, R; Remacle, J; Raskin, J-P; Flandre, D

2007-04-15

Based on interdigitated aluminum electrodes covered with Al(2)O(3) and silver precipitation via biotin-antibody coupled gold nano-labels as signal enhancement, three complementary electrical methods were used and compared to detect the hybridization of target DNA for concentrations down to the 50 pM of a PCR product from cytochrome P450 2b2 gene. Human hepatic cytochrome P450 (CYP) enzymes participate in detoxification metabolism of xenobiotics. Therefore, determination of mutational status of P450 gene in a patient could have a significant impact on the choice of a medical treatment. Our three electrical extraction procedures are performed on the same interdigitated capacitive sensor lying on a passivated silicon substrate and consist in the measurement of respectively the low-frequency inter-electrodes capacitance, the high-frequency self-resonance frequency, and the equivalent MOS capacitance between the short-circuited electrodes and the backside metallization of the silicon substrate. This study is the first of its kind as it opens the way for correlation studies and noise reduction techniques based on multiple electrical measurements of the same DNA hybridization event with a single sensor.

Transformation of lymphocytes by Herpesvirus papio.

PubMed

Falk, L A; Henle, G; Henle, W; Deinhardt, F; Schudel, A

1977-08-15

Cotton-topped (CT) or white-lipped (WL) marmoset lymphocytes were transformed in vitro with herpesvirus papio (HVP) into permanently growing lymphoblastoid cell lines (LCL). Five of 9 HVP-transformed CT cell lines contained cells with antigens reacting with antibodies to Epstein-Barr virus (EBV) capsid antigen (VCA) and/or to EBV-induced early antigens (EA). None of 12 WL LCL revealed such antigen-producing cells. Cells from both groups of cultures failed to react with antibodies to the EBV-specified nuclear antigen (EBNA). Exposure of baboon circulating lymphocytes to X-irradiated HVP or EBV-carring cells, or to suspensions of EBV resulted in establishment of LCL which all contained VCA and/or EA-positive, but no EBNA-positive cells. Nuclear antigens were undetectable also with anti-VCA-positive sera from baboons, chimpanzees, or other non-human primates. DNA-complementary RNA (cRNA) filter hybridization with EBV cRNA showed that with one exception transformed CT or WL marmoset cells contained at least 1-2 virus genome equivalents per cell, while at least 12-25 virus genome equivalents per cell were detected in transformed baboon cells. These data need confirmation by DNA-DNA reassociation kinetics.

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes

NASA Astrophysics Data System (ADS)

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2015-12-01

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b

Critical effective methods to detect genotoxic carcinogens and neoplasm-promoting agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weisburger, J.H.; Williams, G.M.

1991-01-01

Neoplasia in fish can result from contamination of waters with carcinogens and promoters. Cancer in fish, therefore, is a possible indicator of cancer risk to man and serves as a guide to the need for preventative approaches involving improved means of waste disposal and environmental hygiene. Moreover, cancer in fish indicates that this important food source may be contaminated. Detection of genotoxic carcinogens to which fish are exposed can be achieved quickly and efficiently by carefully selected batteries of complementary in vitro and in vivo bioassays. One such battery consists of the Ames test, a reverse mutation assay in prokaryoticmore » Salmonella typhimurium, and the Williams test, involving DNA repair in freshly explanted metabolically highly competent liver cells from diverse species, including humans. Determination of DNA-carcinogen adducts by varied techniques, including {sup 32}P-postlabeling, as well as DNA breakage, mammalian cell mutagenicity, chromosome aberrations, sister chromatid exchange, or cell transformation represent additional approaches, each with its own advantages and disadvantages. More research is needed on systems to apprehend neoplasm promoters, but tests to determine interruption of intercellular communications through gap junctions appear promising. Other approaches rely on measurement of enzymes such as ornithine decarboxylase and protein kinase C. Approaches to the definition of risk to fish or humans require characterization of the genotoxic or nongenotoxic properties of a chemical, relative potency data obtained in select, limited rodent bioassays, and knowledge of prevailing environmental concentrations of specific carcinogens.« less

Critical effective methods to detect genotoxic carcinogens and neoplasm-promoting agents.

PubMed

Weisburger, J H; Williams, G M

1991-01-01

Neoplasia in fish can result from contamination of waters with carcinogens and promoters. Cancer in fish, therefore, is a possible indicator of cancer risk to man and serves as a guide to the need for preventive approaches involving improved means of waste disposal and environmental hygiene. Moreover, cancer in fish indicates that this important food source may be contaminated. Detection of genotoxic carcinogens to which fish are exposed can be achieved quickly and efficiently by carefully selected batteries of complementary in vitro and in vivo bioassays. One such battery consists of the Ames test, a reverse mutation assay in prokaryotic Salmonella typhimurium, and the Williams test, involving DNA repair in freshly explanted metabolically highly competent liver cells from diverse species, including humans. Determination of DNA-carcinogen adducts by varied techniques, including 32P-postlabeling, as well as DNA breakage, mammalian cell mutagenicity, chromosome aberrations, sister chromatid exchange, or cell transformation represent additional approaches, each with its own advantages and disadvantages. More research is needed on systems to apprehend neoplasm promoters, but tests to determine interruption of intercellular communications through gap junctions appear promising. Other approaches rely on measurement of enzymes such as ornithine decarboxylase and protein kinase C. Approaches to the definition of risk to fish or humans require characterization of the genotoxic or nongenotoxic properties of a chemical, relative potency data obtained in select, limited rodent bioassays, and knowledge of prevailing environmental concentrations of specific carcinogens.

Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

NASA Astrophysics Data System (ADS)

Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

2012-02-01

Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

Rupture of DNA aptamer: New insights from simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

2015-10-28

Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

PubMed

Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

2000-07-05

The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Mitra, S.

Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

Epigenetic regulation of normal human mammary cell type-specific miRNAs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrba, Lukas; Garbe, James C.; Stampfer, Martha R.

2011-08-26

Epigenetic mechanisms are important regulators of cell type–specific genes, including miRNAs. In order to identify cell type-specific miRNAs regulated by epigenetic mechanisms, we undertook a global analysis of miRNA expression and epigenetic states in three isogenic pairs of human mammary epithelial cells (HMEC) and human mammary fibroblasts (HMF), which represent two differentiated cell types typically present within a given organ, each with a distinct phenotype and a distinct epigenotype. While miRNA expression and epigenetic states showed strong interindividual concordance within a given cell type, almost 10% of the expressed miRNA showed a cell type–specific pattern of expression that was linkedmore » to the epigenetic state of their promoter. The tissue-specific miRNA genes were epigenetically repressed in nonexpressing cells by DNA methylation (38%) and H3K27me3 (58%), with only a small set of miRNAs (21%) showing a dual epigenetic repression where both DNA methylation and H3K27me3 were present at their promoters, such as MIR10A and MIR10B. Individual miRNA clusters of closely related miRNA gene families can each display cell type–specific repression by the same or complementary epigenetic mechanisms, such as the MIR200 family, and MIR205, where fibroblasts repress MIR200C/141 by DNA methylation, MIR200A/200B/429 by H3K27me3, and MIR205 by both DNA methylation and H3K27me3. Since deregulation of many of the epigenetically regulated miRNAs that we identified have been linked to disease processes such as cancer, it is predicted that compromise of the epigenetic control mechanisms is important for this process. Overall, these results highlight the importance of epigenetic regulation in the control of normal cell type–specific miRNA expression.« less

Controlling charge current through a DNA based molecular transistor

NASA Astrophysics Data System (ADS)

Behnia, S.; Fathizadeh, S.; Ziaei, J.

2017-01-01

Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

Hiding message into DNA sequence through DNA coding and chaotic maps.

PubMed

Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

2014-09-01

The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1998-11-03

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

NASA Technical Reports Server (NTRS)

Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

1999-01-01

Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

Phase behaviour in complementary DNA-coated gold nanoparticles and fd-viruses mixtures: a numerical study.

PubMed

Chiappini, Massimiliano; Eiser, Erika; Sciortino, Francesco

2017-01-01

A new gel-forming colloidal system based on a binary mixture of fd-viruses and gold nanoparticles functionalized with complementary DNA single strands has been recently introduced. Upon quenching below the DNA melt temperature, such a system results in a highly porous gel state, that may be developed in a new functional material of tunable porosity. In order to shed light on the gelation mechanism, we introduce a model closely mimicking the experimental one and we explore via Monte Carlo simulations its equilibrium phase diagram. Specifically, we model the system as a binary mixture of hard rods and hard spheres mutually interacting via a short-range square-well attractive potential. In the experimental conditions, we find evidence of a phase separation occurring either via nucleation-and-growth or via spinodal decomposition. The spinodal decomposition leads to the formation of small clusters of bonded rods and spheres whose further diffusion and aggregation leads to the formation of a percolating network in the system. Our results are consistent with the hypothesis that the mixture of DNA-coated fd-viruses and gold nanoparticles undergoes a non-equilibrium gelation via an arrested spinodal decomposition mechanism.

Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

PubMed Central

Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

1990-01-01

Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

Fischer carbene mediated covalent grafting of a peptide nucleic acid on gold surfaces and IR optical detection of DNA hybridization with a transition metalcarbonyl label

NASA Astrophysics Data System (ADS)

Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle

2016-11-01

Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.

Role of AIF in human coronary artery endothelial cell apoptosis.

PubMed

Zhang, Wenguang; Li, Dayuan; Mehta, Jawahar L

2004-01-01

Apoptosis-inducing factor (AIF), which exerts its effect via a caspase-independent pathway, has been suggested to be a mediator of cell injury. We have recently identified the expression of AIF in human coronary artery endothelial cells (HCAECs). The present study was designed to determine the pathophysiological role of AIF in oxidized low-density lipoprotein (ox-LDL)-induced apoptosis of HCAECs. The cells were cultured and treated with ox-LDL (40 microg/ml) for 24 h. Ox-LDL increased AIF expression, caused apoptosis of HCAECs (determined by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining and large-scale DNA fragmentation), and induced translocation of AIF from the cytoplasm to the nucleus (fluorescence immunocytochemistry). Pretreatment of HCAECs with a caspase inhibitor (ZVAD-fmk) did not influence AIF-mediated apoptosis in response to ox-LDL. We developed a specific antisense oligonucleotide targeted to the 5'-TCG CCG AAA TGT TCC GGT GTG GA-3' portion of the human AIF mRNA sequence (AIF-AS) to bind a complementary sequence overlapping the translational start site. Pretreatment of cells with the AIF-AS for 24 h resulted in suppression of ox-LDL-upregulated AIF protein, as measured by immunoblot analysis. AIF-AS also reduced apoptosis and AIF translocation (P < 0.01 vs. ox-LDL alone). Next, we constructed a recombinant AIF plasmid by inserting whole-length AIF cDNA into the expression vector pcDNA3.1 with a cytomegalovirus promoter. HCAECs transfected with plasmid showed a two- to fourfold increase in AIF expression, extensive apoptosis, and translocation of AIF from the cytoplasm to the nucleus. These results from two approaches indicate that AIF plays an important role in ox-LDL-induced endothelial injury.

RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

PubMed

Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

2017-01-01

CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

Gold surface supported spherical liposome-gold nano-particle nano-composite for label free DNA sensing.

PubMed

Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K

2013-03-15

Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.

Comparison of Constitutional and Replication Stress-Induced Genome Structural Variation by SNP Array and Mate-Pair Sequencing

PubMed Central

Arlt, Martin F.; Ozdemir, Alev Cagla; Birkeland, Shanda R.; Lyons, Robert H.; Glover, Thomas W.; Wilson, Thomas E.

2011-01-01

Copy-number variants (CNVs) are a major source of genetic variation in human health and disease. Previous studies have implicated replication stress as a causative factor in CNV formation. However, existing data are technically limited in the quality of comparisons that can be made between human CNVs and experimentally induced variants. Here, we used two high-resolution strategies—single nucleotide polymorphism (SNP) arrays and mate-pair sequencing—to compare CNVs that occur constitutionally to those that arise following aphidicolin-induced DNA replication stress in the same human cells. Although the optimized methods provided complementary information, sequencing was more sensitive to small variants and provided superior structural descriptions. The majority of constitutional and all aphidicolin-induced CNVs appear to be formed via homology-independent mechanisms, while aphidicolin-induced CNVs were of a larger median size than constitutional events even when mate-pair data were considered. Aphidicolin thus appears to stimulate formation of CNVs that closely resemble human pathogenic CNVs and the subset of larger nonhomologous constitutional CNVs. PMID:21212237

The structure of human DNase I bound to magnesium and phosphate ions points to a catalytic mechanism common to members of the DNase I-like superfamily.

PubMed

Parsiegla, Goetz; Noguere, Christophe; Santell, Lydia; Lazarus, Robert A; Bourne, Yves

2012-12-21

Recombinant human DNase I (Pulmozyme, dornase alfa) is used for the treatment of cystic fibrosis where it improves lung function and reduces the number of exacerbations. The physiological mechanism of action is thought to involve the reduction of the viscoelasticity of cystic fibrosis sputum by hydrolyzing high concentrations of DNA into low-molecular mass fragments. Here we describe the 1.95 Å resolution crystal structure of recombinant human DNase I (rhDNase I) in complex with magnesium and phosphate ions, both bound in the active site. Complementary mutagenesis data of rhDNase I coupled to a comprehensive structural analysis of the DNase I-like superfamily argue for the key catalytic role of Asn7, which is invariant among mammalian DNase I enzymes and members of this superfamily, through stabilization of the magnesium ion coordination sphere. Overall, our combined structural and mutagenesis data suggest the occurrence of a magnesium-assisted pentavalent phosphate transition state in human DNase I during catalysis, where Asp168 may play a key role as a general catalytic base.

Fluorometric aptasensing of the neonicotinoid insecticide acetamiprid by using multiple complementary strands and gold nanoparticles.

PubMed

Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad

2018-04-29

A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.

PubMed

Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping

2018-06-12

The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7  cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.

DNA methylation of phosphatase and actin regulator 3 detects colorectal cancer in stool and complements FIT.

PubMed

Bosch, Linda J W; Oort, Frank A; Neerincx, Maarten; Khalid-de Bakker, Carolina A J; Terhaar sive Droste, Jochim S; Melotte, Veerle; Jonkers, Daisy M A E; Masclee, Ad A M; Mongera, Sandra; Grooteclaes, Madeleine; Louwagie, Joost; van Criekinge, Wim; Coupé, Veerle M H; Mulder, Chris J; van Engeland, Manon; Carvalho, Beatriz; Meijer, Gerrit A

2012-03-01

Using a bioinformatics-based strategy, we set out to identify hypermethylated genes that could serve as biomarkers for early detection of colorectal cancer (CRC) in stool. In addition, the complementary value to a Fecal Immunochemical Test (FIT) was evaluated. Candidate genes were selected by applying cluster alignment and computational analysis of promoter regions to microarray-expression data of colorectal adenomas and carcinomas. DNA methylation was measured by quantitative methylation-specific PCR on 34 normal colon mucosa, 71 advanced adenoma, and 64 CRC tissues. The performance as biomarker was tested in whole stool samples from in total 193 subjects, including 19 with advanced adenoma and 66 with CRC. For a large proportion of these series, methylation data for GATA4 and OSMR were available for comparison. The complementary value to FIT was measured in stool subsamples from 92 subjects including 44 with advanced adenoma or CRC. Phosphatase and Actin Regulator 3 (PHACTR3) was identified as a novel hypermethylated gene showing more than 70-fold increased DNA methylation levels in advanced neoplasia compared with normal colon mucosa. In a stool training set, PHACTR3 methylation showed a sensitivity of 55% (95% CI: 33-75) for CRC and a specificity of 95% (95% CI: 87-98). In a stool validation set, sensitivity reached 66% (95% CI: 50-79) for CRC and 32% (95% CI: 14-57) for advanced adenomas at a specificity of 100% (95% CI: 86-100). Adding PHACTR3 methylation to FIT increased sensitivity for CRC up to 15%. PHACTR3 is a new hypermethylated gene in CRC with a good performance in stool DNA testing and has complementary value to FIT.

Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization

NASA Astrophysics Data System (ADS)

James, Carrie Rae

Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.

Analysis of Functional Dynamics of Modular Multidomain Proteins by SAXS and NMR.

PubMed

Thompson, Matthew K; Ehlinger, Aaron C; Chazin, Walter J

2017-01-01

Multiprotein machines drive virtually all primary cellular processes. Modular multidomain proteins are widely distributed within these dynamic complexes because they provide the flexibility needed to remodel structure as well as rapidly assemble and disassemble components of the machinery. Understanding the functional dynamics of modular multidomain proteins is a major challenge confronting structural biology today because their structure is not fixed in time. Small-angle X-ray scattering (SAXS) and nuclear magnetic resonance (NMR) spectroscopy have proven particularly useful for the analysis of the structural dynamics of modular multidomain proteins because they provide highly complementary information for characterizing the architectural landscape accessible to these proteins. SAXS provides a global snapshot of all architectural space sampled by a molecule in solution. Furthermore, SAXS is sensitive to conformational changes, organization and oligomeric states of protein assemblies, and the existence of flexibility between globular domains in multiprotein complexes. The power of NMR to characterize dynamics provides uniquely complementary information to the global snapshot of the architectural ensemble provided by SAXS because it can directly measure domain motion. In particular, NMR parameters can be used to define the diffusion of domains within modular multidomain proteins, connecting the amplitude of interdomain motion to the architectural ensemble derived from SAXS. Our laboratory has been studying the roles of modular multidomain proteins involved in human DNA replication using SAXS and NMR. Here, we present the procedure for acquiring and analyzing SAXS and NMR data, using DNA primase and replication protein A as examples. © 2017 Elsevier Inc. All rights reserved.

The suppression of inflammatory macrophage-mediated cytotoxicity and proinflammatory cytokine production by transgenic expression of HLA-E.

PubMed

Maeda, Akira; Kawamura, Takuji; Ueno, Takehisa; Usui, Noriaki; Eguchi, Hiroshi; Miyagawa, Shuji

2013-12-01

Macrophages participate in xenogenic rejection and represent a major biological obstacle to successful xenotransplantation. The signal inhibitory regulatory protein α (SIRPα) receptor was reported to be a negative regulator of macrophage phagocytic activity via interaction with CD47, its ligand. Because a majority of human macrophages express the inhibitory receptor CD94/NKG2A, which binds specifically to the human leukocyte antigen (HLA)-E and contains immunoreceptor tyrosine-based inhibition motifs (ITIMs), the inhibitory function of HLA class I molecules, HLA-E, on macrophage-mediated cytolysis was examined. The suppressive effect against proinflammatory cytokine production by macrophages was also examined. Complementary DNA (cDNA) of HLA-E, and CD47 were prepared and transfected into swine endothelial cells (SEC). The expression of the modified genes was evaluated by flow cytometry and macrophage-mediated cytolysis was assessed using in vitro generated macrophages. Transgenic expression of HLA-E significantly suppressed the macrophage-mediated cytotoxicity. HLA-E transgenic expression demonstrated a significant suppression equivalent to CD47 transgenic expression. Furthermore, transgenic HLA-E suppressed the production of pro-inflammatory cytokines by inflammatory macrophages. These results indicate that generating transgenic HLA-E pigs might protect porcine grafts from, not only NK cytotoxicity, but also macrophage-mediated cytotoxicity. © 2013 Elsevier B.V. All rights reserved.

Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

PubMed Central

Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

2012-01-01

In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection

PubMed Central

Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

2017-01-01

A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033

Maintenance and integrity of the mitochondrial genome: a plethora of nuclear genes in the budding yeast.

PubMed

Contamine, V; Picard, M

2000-06-01

Instability of the mitochondrial genome (mtDNA) is a general problem from yeasts to humans. However, its genetic control is not well documented except in the yeast Saccharomyces cerevisiae. From the discovery, 50 years ago, of the petite mutants by Ephrussi and his coworkers, it has been shown that more than 100 nuclear genes directly or indirectly influence the fate of the rho(+) mtDNA. It is not surprising that mutations in genes involved in mtDNA metabolism (replication, repair, and recombination) can cause a complete loss of mtDNA (rho(0) petites) and/or lead to truncated forms (rho(-)) of this genome. However, most loss-of-function mutations which increase yeast mtDNA instability act indirectly: they lie in genes controlling functions as diverse as mitochondrial translation, ATP synthase, iron homeostasis, fatty acid metabolism, mitochondrial morphology, and so on. In a few cases it has been shown that gene overexpression increases the levels of petite mutants. Mutations in other genes are lethal in the absence of a functional mtDNA and thus convert this petite-positive yeast into a petite-negative form: petite cells cannot be recovered in these genetic contexts. Most of the data are explained if one assumes that the maintenance of the rho(+) genome depends on a centromere-like structure dispensable for the maintenance of rho(-) mtDNA and/or the function of mitochondrially encoded ATP synthase subunits, especially ATP6. In fact, the real challenge for the next 50 years will be to assemble the pieces of this puzzle by using yeast and to use complementary models, especially in strict aerobes.

Sandwiching spherical 1,2-dioleoyltrimethylammoniumpropane liposome in gold nanoparticle on solid transducer for electrochemical ultrasensitive DNA detection and transfection.

PubMed

Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman

2014-08-15

Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.

Percutaneous transendocardial delivery of self-complementary adeno-associated virus 6 achieves global cardiac gene transfer in canines

PubMed Central

Bish, Lawrence T.; Sleeper, Meg M.; Brainard, Benjamin; Cole, Stephen; Russell, Nicholas; Withnall, Elanor; Arndt, Jason; Reynolds, Caryn; Davison, Ellen; Sanmiguel, Julio; Wu, Di; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Prior strategies have employed cardio-pulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus or plasmid DNA. While single stranded adeno-associated virus vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented by using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated virus vectors to the canine myocardium. Four vectors were evaluated—single stranded adeno-associated virus 9, self-complementary adeno-associated virus 9, self-complementary adeno-associated virus 8, self-complementary adeno-associated virus 6—so that comparison could be made between single stranded and self complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that self-complementary adeno-associated virus is superior to single stranded adeno-associated virus and that adeno-associated virus 6 is superior to other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15 to 4000 times more abundant in the heart than in any other organ for self-complementary adeno-associated virus 6. Percutaneous transendocardial injection of self-complementary adeno-associated virus 6 is a safe, effective method for achieving efficient cardiac gene transfer. PMID:18813281

Expression of the Murine Duchenne Muscular Dystrophy Gene in Muscle and Brain

NASA Astrophysics Data System (ADS)

Chamberlain, Jeffrey S.; Pearlman, Joel A.; Muzny, Donna M.; Gibbs, Richard A.; Ranier, Joel E.; Reeves, Alice A.; Caskey, C. Thomas

1988-03-01

Complementary DNA clones were isolated that represent the 5' terminal 2.5 kilobases of the murine Duchenne muscular dystrophy (Dmd) messenger RNA (mRNA). Mouse Dmd mRNA was detectable in skeletal and cardiac muscle and at a level approximately 90 percent lower in brain. Dmd mRNA is also present, but at much lower than normal levels, in both the muscle and brain of three different strains of dystrophic mdx mice. The identification of Dmd mRNA in brain raises the possibility of a relation between human Duchenne muscular dystrophy (DMD) gene expression and the mental retardation found in some DMD males. These results also provide evidence that the mdx mutations are allelic variants of mouse Dmd gene mutations.

Site-directed nucleases: a paradigm shift in predictable, knowledge-based plant breeding.

PubMed

Podevin, Nancy; Davies, Howard V; Hartung, Frank; Nogué, Fabien; Casacuberta, Josep M

2013-06-01

Conventional plant breeding exploits existing genetic variability and introduces new variability by mutagenesis. This has proven highly successful in securing food supplies for an ever-growing human population. The use of genetically modified plants is a complementary approach but all plant breeding techniques have limitations. Here, we discuss how the recent evolution of targeted mutagenesis and DNA insertion techniques based on tailor-made site-directed nucleases (SDNs) provides opportunities to overcome such limitations. Plant breeding companies are exploiting SDNs to develop a new generation of crops with new and improved traits. Nevertheless, some technical limitations as well as significant uncertainties on the regulatory status of SDNs may challenge their use for commercial plant breeding. Copyright © 2013 Elsevier Ltd. All rights reserved.

Multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole DNA biosensor for label-free detection of genetically modified organisms by QCM and EIS.

PubMed

Truong, Thi Ngoc Lien; Tran, Dai Lam; Vu, Thi Hong An; Tran, Vinh Hoang; Duong, Tuan Quang; Dinh, Quang Khieu; Tsukahara, Toshifumi; Lee, Young Hoon; Kim, Jong Seung

2010-01-15

In this paper, we describe DNA electrochemical detection for genetically modified organism (GMO) based on multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole (PPy). DNA hybridization is studied by quartz crystal microbalance (QCM) and electrochemical impedance spectroscopy (EIS). An increase in DNA complementary target concentration results in a decrease in the faradic charge transfer resistance (R(ct)) and signifying "signal-on" behavior of MWCNTs-PPy-DNA system. QCM and EIS data indicated that the electroanalytical MWCNTs-PPy films were highly sensitive (as low as 4pM of target can be detected with QCM technique). In principle, this system can be suitable not only for DNA but also for protein biosensor construction.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

PubMed

Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

2016-10-24

DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Creating complex molecular topologies by configuring DNA four-way junctions

NASA Astrophysics Data System (ADS)

Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi

2016-10-01

The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.

Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

NASA Astrophysics Data System (ADS)

Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

2014-01-01

DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

PubMed

Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

2006-07-01

To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

Fabrication and characterization of high-K dielectric integrated silicon nanowire sensor for DNA sensing application (Conference Presentation)

NASA Astrophysics Data System (ADS)

Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael

2016-09-01

1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

Role of messenger RNA-ribosome complex in complementary DNA display.

PubMed

Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

2013-07-15

In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

PubMed

Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

2008-12-01

Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

PubMed

Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

2009-03-15

Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.

PubMed

Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L

2005-04-01

The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Reversible Redox Activity by Ion-pH Dually Modulated Duplex Formation of i-Motif DNA with Complementary G-DNA.

PubMed

Chang, Soyoung; Kilic, Tugba; Lee, Chang Kee; Avci, Huseyin; Bae, Hojae; Oskui, Shirin Mesbah; Jung, Sung Mi; Shin, Su Ryon; Kim, Seon Jeong

2018-04-08

The unique biological features of supramolecular DNA have led to an increasing interest in biomedical applications such as biosensors. We have developed an i-motif and G-rich DNA conjugated single-walled carbon nanotube hybrid materials, which shows reversible conformational switching upon external stimuli such as pH (5 and 8) and presence of ions (Li⁺ and K⁺). We observed reversible electrochemical redox activity upon external stimuli in a quick and robust manner. Given the ease and the robustness of this method, we believe that pH- and ion-driven reversible DNA structure transformations will be utilized for future applications for developing novel biosensors.

The origin of in situ hybridization - A personal history.

PubMed

Gall, Joseph G

2016-04-01

In situ hybridization is the technique by which specific RNA or DNA molecules are detected in cytological preparations. Basically it involves formation of a hybrid molecule between an endogenous single-stranded RNA or DNA in the cell and a complementary single-stranded RNA or DNA probe. In its original form the probe was labeled with (3)H and the hybrid was detected by autoradiography. The first successful experiments in 1968 involved detection of the highly amplified ribosomal DNA in oocytes of the frog Xenopus, followed soon after by the reiterated "satellite DNA" in mouse and Drosophila chromosomes. Fluorescent probes were developed about ten years later. Copyright © 2015 Elsevier Inc. All rights reserved.

C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.

PubMed

Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

2015-07-20

Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

PubMed

Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

1997-10-15

A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

Self-Assembly of Octopus Nanoparticles into Pre-Programmed Finite Clusters

NASA Astrophysics Data System (ADS)

Halverson, Jonathan; Tkachenko, Alexei

2012-02-01

The precise control of the spatial arrangement of nanoparticles (NP) is often required to take full advantage of their novel optical and electronic properties. NPs have been shown to self-assemble into crystalline structures using either patchy surface regions or complementary DNA strands to direct the assembly. Due to a lack of specificity of the interactions these methods lead to only a limited number of structures. An emerging approach is to bind ssDNA at specific sites on the particle surface making so-called octopus NPs. Using octopus NPs we investigate the inverse problem of the self-assembly of finite clusters. That is, for a given target cluster (e.g., arranging the NPs on the vertices of a dodecahedron) what are the minimum number of complementary DNA strands needed for the robust self-assembly of the cluster from an initially homogeneous NP solution? Based on the results of Brownian dynamics simulations we have compiled a set of design rules for various target clusters including cubes, pyramids, dodecahedrons and truncated icosahedrons. Our approach leads to control over the kinetic pathway and has demonstrated nearly perfect yield of the target.

Dysregulation of RNA Interference in Breast Cancer

DTIC Science & Technology

2007-07-01

of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative

Cross index for improving cloning selectivity by partially filling in 5'-extensions of DNA produced by type II restriction endonucleases.

PubMed Central

Korch, C

1987-01-01

A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600

The generative power of weighted one-sided and regular sticker systems

NASA Astrophysics Data System (ADS)

Siang, Gan Yee; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod

2014-06-01

Sticker systems were introduced in 1998 as one of the DNA computing models by using the recombination behavior of DNA molecules. The Watson-Crick complementary principle of DNA molecules is abstractly used in the sticker systems to perform the computation of sticker systems. In this paper, the generative power of weighted one-sided sticker systems and weighted regular sticker systems are investigated. Moreover, the relationship of the families of languages generated by these two variants of sticker systems to the Chomsky hierarchy is also presented.

Autonomous generation and loading of DNA guides by bacterial Argonaute

PubMed Central

Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

2018-01-01

Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

PubMed Central

2011-01-01

Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

PubMed

Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

2011-08-24

Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

NASA Technical Reports Server (NTRS)

Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

1999-01-01

Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

Human Topoisomerase I C-Terminal Domain Fragment Containing the Active Site Tyrosine is a Molten Globule: Implication for the Formation of Competent Productive Complex

PubMed Central

Punchihewa, Chandanamali; Dai, Jixun; Carver, Megan; Yang, Danzhou

2007-01-01

Human topoisomerase I (topo I) is an essential cellular enzyme that relaxes DNA supercoiling. The 6.3 kDa C-terminal domain of topo I contains the active site tyrosine (Tyr723) but lacks enzymatic activity by itself. Activity can be fully reconstituted when the C-terminal is associated with the 56 kDa core domain. Even though several crystal structures of topo I/DNA complexes are available, crystal structures of the free topo I protein or its individual domain fragments have been difficult to obtain. In this report we analyze the human topo I C-terminal domain structure using a variety of biophysical methods. Our results indicate that this fragment protein (topo6.3) appears to be in a molten globule state. It appears to have a native-like tertiary fold that contains a large population of α-helix secondary structure and extensive surface hydrophobic regions. Topo6.3 is known to be readily activated with the association of the topo I core domain, and the molten globule state of topo6.3 is likely to be an energy-favorable conformation for the free topo I C-terminal domain protein. The structural fluctuation and plasticity may represent an efficient mechanism in the topo I functional pathway, where the flexibility aids in the complementary association with the core domain and in the formation of a fully productive topo I complex. PMID:17434318

Kinetic Self-Assembly of DNA Tiles and Bricks

DTIC Science & Technology

2016-08-26

research, and educa- tion. This is achieved by freeze drying cell-free systems into paper and other porous substrates to create materials with the...different toehold switches on paper . Experiments were performed by freeze drying the recombinant PT7 expression system onto paper discs, along with linear...DNA encoding specific switch RNAs. The paper discs were rehy- drated with or without the complementary RNA trigger 24 hr after drying and then

Two-Dimensional Nanoporous Networks Formed by Liquid-to-Solid Transfer of Hydrogen-Bonded Macrocycles Built from DNA Bases.

PubMed

Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David

2016-01-11

We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

PubMed

Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

2012-04-20

In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

NASA Astrophysics Data System (ADS)

Baghaee Ravari, Soodeh

G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

PubMed Central

Winnacker, E L

1975-01-01

Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

Visual detection of multidrug resistance gene in living cell using the molecular beacon imaging

NASA Astrophysics Data System (ADS)

Zhou, Qiumei; Ma, Yi; Gu, Yueqing

2014-09-01

A major problem in cancer treatment is the development of resistance to chemotherapeutic agents in tumor cells. Detection of effective prognostic biomarkers and targets are of crucial importance to the management of individualized therapies. However, quantitative analysis of the drug resistance gene had been difficult because of technical limitations. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA), which served as a beacon for detecting human drug resistance indicater. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5'end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. hDAuNP beacon imaged by confocal laser scanning microscopy to detect the resistance gene expression. The detected fluorescence in MCF7and MCF7/ADR cells correlates with the specific drug resistance gene expression, which is consistent with the result from Q-PCR. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression.

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

Miniaturization Technologies for Efficient Single-Cell Library Preparation for Next-Generation Sequencing.

PubMed

Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C

2016-08-01

As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

PubMed Central

Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

2016-01-01

DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

Complementary deoxyribonucleic acid cloning of spermatogonial stem cell renewal factor.

PubMed

Miura, Takeshi; Ohta, Takashi; Miura, Chiemi I; Yamauchi, Kohei

2003-12-01

Spermatogonial mitosis can be subdivided into two processes: spermatogonial stem cell renewal and spermatogonial proliferation toward meiosis. Recently it has been indicated that estrogen, estradiol-17beta, is involved in regulating the renewal of spermatogonial stem cells in eel. To determine the genes that directly regulate this process, we used expression screening to identify genes whose expression is regulated by estradiol-17beta in testes. We detected a previously unidentified cDNA clone that is up-regulated by estradiol-17beta stimulation and named it eel spermatogenesis-related substances 34 (eSRS34) cDNA. Homology searching showed that eSRS34 shares amino acid sequence similarity with human platelet-derived endothelial cell growth factor. We examined the function of eSRS34 using several in vitro systems. Recombinant eSRS34 produced by a baculovirus system induced spermatogonial mitosis in testicular organ culture. Furthermore, the addition of an antibody specific for eSRS34 prevented spermatogonial mitosis induced by estradiol-17beta stimulation in a germ cell/somatic cell coculture system. We therefore conclude that eSRS34 is a "spermatogonial stem cell renewal factor."

Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization.

PubMed

Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

2015-12-01

Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 (3-/4-) as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

NASA Astrophysics Data System (ADS)

Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

2015-06-01

Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons

PubMed Central

Tan, Carlyn Rose C.; Zhou, Lanlan

2016-01-01

Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned. PMID:27516729

DNA methylation dynamics during in vivo differentiation of blood and skin stem cells

PubMed Central

Bock, Christoph; Beerman, Isabel; Lien, Wen-Hui; Smith, Zachary D.; Gu, Hongcang; Boyle, Patrick; Gnirke, Andreas; Fuchs, Elaine; Rossi, Derrick J.; Meissner, Alexander

2012-01-01

DNA methylation is a mechanism of epigenetic regulation that is common to all vertebrates. Functional studies underscore its relevance for tissue homeostasis, but the global dynamics of DNA methylation during in vivo differentiation remain underexplored. Here we report high-resolution DNA methylation maps of adult stem cell differentiation in mouse, focusing on 19 purified cell populations of the blood and skin lineages. DNA methylation changes were locus-specific and relatively modest in magnitude. They frequently overlapped with lineage-associated transcription factors and their binding sites, suggesting that DNA methylation may protect cells from aberrant transcription factor activation. DNA methylation and gene expression provided complementary information, and combining the two enabled us to infer the cellular differentiation hierarchy of the blood lineage directly from genomic data. In summary, these results demonstrate that in vivo differentiation of adult stem cells is associated with small but informative changes in the genomic distribution of DNA methylation. PMID:22841485

Multisegment nanowire sensors for the detection of DNA molecules.

PubMed

Wang, Xu; Ozkan, Cengiz S

2008-02-01

We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons.

PubMed

Tan, Carlyn Rose C; Zhou, Lanlan; El-Deiry, Wafik S

2016-06-01

Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned.

Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

NASA Technical Reports Server (NTRS)

Egli, M.; Usman, N.; Rich, A.

1993-01-01

We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

PubMed

Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

2017-08-01

We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Definition of the specificity of DNA-methyltransferase M.Bsc4I in cell lysate by blocking of restriction endonucleases and computer modeling].

PubMed

Dedkov, V S

2009-01-01

The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.

Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

PubMed Central

Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

2001-01-01

We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

Novel ratiometric surface-enhanced raman spectroscopy aptasensor for sensitive and reproducible sensing of Hg2.

PubMed

Wu, Yan; Jiang, Tingting; Wu, Zhaoyang; Yu, Ruqin

2018-01-15

It is important to precisely monitor mercury (II) ions (Hg 2+ ) for environment protection and human health monitoring. Although many strategies have been developed in the past decades, there still remains a challenge for developing an ultrasensitive, simple and reliable approach to detect Hg 2+ . Herein, we report a ratiometric surface-enhanced Raman scattering (SERS) aptasensor by employing aptamer-modified Au@Ag core-shell nanoparticles (Au@Ag NPs) as highly functional sensing probes, allowing for ultrasensitive detection of Hg 2+ . In principle, the thiolated 5'-Cy3 labeled aptamer probe (Cy3-aptamer) is firstly immobilized on the SERS substrate surface and then hybridizes with the 5'-Rox labeled complementary DNA (cDNA) to form a rigid double-stranded DNA (dsDNA), in which the Cy3 and Rox Raman labels are used to produce the ratiometric Raman signals. In the presence of Hg 2+ , the aptamer DNA turns into the thymine (T)-Hg 2+ -T mediated hairpin structure, leading to the dissociation of dsDNA. As a result, the Rox labels are away from the Au@Ag NP SERS substrate while Cy3 labels are close to it. Therefore, the intensity of SERS signal from Cy3 labels increases while that from Rox labels decreases. The ratio between the Raman intensities of Cy3 labels and Rox labels is linear with Hg 2+ concentrations in the range from 0.001 to 1.0nM, and the limit of detection is estimated to be 0.4pM. The proposed strategy provides a new rapid, simple and reliable approach for sensitive detection of Hg 2+ and may create a universal methodology for developing analogous aptasensors for a wide range of other analytes determination. Copyright © 2017 Elsevier B.V. All rights reserved.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

PubMed

Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

2013-05-01

L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

Structural determinants of HIV-1 nucleocapsid protein for cTAR DNA binding and destabilization, and correlation with inhibition of self-primed DNA synthesis.

PubMed

Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves

2005-05-20

The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.

Dynamic Properties of DNA-Programmable Nanoparticle Crystallization.

PubMed

Yu, Qiuyan; Zhang, Xuena; Hu, Yi; Zhang, Zhihao; Wang, Rong

2016-08-23

The dynamics of DNA hybridization is very important in DNA-programmable nanoparticle crystallization. Here, coarse-grained molecular dynamics is utilized to explore the structural and dynamic properties of DNA hybridizations for a self-complementary DNA-directed nanoparticle self-assembly system. The hexagonal close-packed (HCP) and close-packed face-centered cubic (FCC) ordered structures are identified for the systems of different grafted DNA chains per nanoparticle, which are in good agreement with the experimental results. Most importantly, the dynamic crystallization processes of DNA hybridizations are elucidated by virtue of the mean square displacement, the percentage of hybridizations, and the lifetime of DNA bonds. The lifetime can be modeled by the DNA dehybridization, which has an exponential form. The lifetime of DNA bonds closely depends on the temperature. A suitable temperature for the DNA-nanoparticle crystallization is obtained in the work. Moreover, a too large volume fraction hinders the self-assembly process due to steric effects. This work provides some essential information for future design of nanomaterials.

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Inhibition of adenovirus 5 replication in COS-1 cells by antisense RNAs against the viral E1a region.

PubMed

Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I

1989-12-07

To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.

[Antisense polynucleotides and prospects for their use in fighting viruses].

PubMed

Tikhonenko, T I

1989-01-01

Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.

Fluorimetric determinations of nucleic acids using iron, osmium and samarium complexes of 4,7-diphenyl-1,10-phenanthroline

NASA Astrophysics Data System (ADS)

Salem, A. A.

2006-09-01

New sensitive, reliable and reproducible fluorimetric methods for determining microgram amounts of nucleic acids based on their reactions with Fe(II), Os(III) or Sm(III) complexes of 4,7-diphenyl-1,10-phenanthroline are proposed. Two complementary single stranded synthetic DNA sequences based on calf thymus as well as their hybridized double stranded were used. Nucleic acids were found to react instantaneously at room temperature in Tris-Cl buffer pH 7, with the investigated complexes resulting in decreasing their fluorescence emission. Two fluorescence peaks around 388 and 567 nm were obtained for the three complexes using excitation λmax of 280 nm and were used for this investigation. Linear calibration graphs in the range 1-6 μg/ml were obtained. Detection limits of 0.35-0.98 μg/ml were obtained. Using the calibration graphs for the synthetic dsDNA, relative standard deviations of 2.0-5.0% were obtained for analyzing DNA in the extraction products from calf thymus and human blood. Corresponding Recovery% of 80-114 were obtained. Student's t-values at 95% confidence level showed insignificant difference between the real and measured values. Results obtained by these methods were compared with the ethidium bromide method using the F-test and satisfactory results were obtained. The association constants and number of binding sites of synthetic ssDNA and dsDNA with the three complexes were estimated using Rosenthanl graphic method. The interaction mechanism was discussed and an intercalation mechanism was suggested for the binding reaction between nucleic acids and the three complexes.

Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems

PubMed Central

Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B.

2015-01-01

Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing. PMID:26053390

Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems.

PubMed

Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B

2015-01-01

Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing.

ICT, complementary investment, and firm performance in China

NASA Astrophysics Data System (ADS)

Sun, Linlin; Ding, Juan; Fan, Maoqing

2011-12-01

Using China firm data about ICT, we provide some insight into the link between ICT, productivity and complementary investment. The results show that the contribution of ICT capital deepening is raised when firms combine ICT use and some complementary investment (human capital, innovation and organization change).

Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA.

PubMed

Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin

2015-10-01

Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues in the N-terminus of a symmetry-related molecule and the complementary DNA strand facing away from the active site were also observed which seem to stabilize the enzyme-DNA complex. However, the significance of this observation remains to be investigated. The results provide new insights into the current knowledge about DNA damage recognition and repair by uracil-DNA glycosylases.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

[Vasopressin (ADH)].

PubMed

Hirai, A; Uchida, D; Yoshida, S

1992-12-01

Vasopressin is thought to play an important role, not only in the metabolism of water and electrolytes, but also in the regulation of renal hemodynamics. This year, great progress has been achieved in molecular biology of vasopressin receptors. First, the cloning of a complementary DNA, encoding the rat liver V1a arginine vasopressin receptor, was reported. The liver cDNA encodes a protein with seven putative transmembrane domains, which binds arginine vasopressin and related compounds with affinities similar to the native rat V1a receptor. The messenger RNA, corresponding to the cDNA, is distributed in rat tissues, known to contain V1a receptors. Second, the cloning of a complementary DNA encoding the rat kidney V2 arginine vasopressin receptor was also successful. The kidney cDNA encodes a protein with a transmembrane topography characteristic of G protein-coupled receptors. The receptor messenger RNA is detected only in the kidney. Last year, an orally active and specific vasopressin V1 receptor antagonist, OPC-21268 was first reported. The i.v. or p.o. administration of OPC-21268 dose-dependently inhibited vasopressin-induced vasoconstriction, while that induced by angiotensin II was not affected. OPC-21268 may have clinical potentials in certain hypertensive cardiovascular disorders. In addition, an orally active and specific vasopressin V2 receptor antagonist, OPC-31260 was also reported. Oral administration of OPC-31260 inhibited antidiuretic action of arginine vasopressin. OPC-31260 is thought to be useful in the treatment of certain disorders, such as the syndrome of inappropriate secretion of ADH (SIADH).

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

1999-01-01

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

1999-03-02

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

Two-dimensional self-assembly of DNA-functionalized gold nanoparticles

NASA Astrophysics Data System (ADS)

Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David

2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.

Molecular Pathways

PubMed Central

Lok, Benjamin H.; Powell, Simon N.

2012-01-01

The Rad52 protein was largely ignored in humans and other mammals when the mouse knockout revealed a largely “no-effect” phenotype. However, using synthetic lethal approaches to investigate context dependent function, new studies have shown that Rad52 plays a key survival role in cells lacking the function of the BRCA1-BRCA2 pathway of homologous recombination. Biochemical studies also showed significant differences between yeast and human Rad52, in which yeast Rad52 can promote strand invasion of RPA-coated single-stranded DNA in the presence of Rad51, but human Rad52 cannot. This results in the paradox of how is human Rad52 providing Rad51 function: presumably there is something missing in the biochemical assays that exists in-vivo, but the nature of this missing factor is currently unknown. Recent studies have suggested that Rad52 provides back-up Rad51 function for all members of the BRCA1-BRCA2 pathway, suggesting that Rad52 may be a target for therapy in BRCA pathway deficient cancers. Screening for ways to inhibit Rad52 would potentially provide a complementary strategy for targeting BRCA-deficient cancers in addition to PARP inhibitors. PMID:23071261

Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

PubMed

Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

2010-03-01

There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

BEMER Electromagnetic Field Therapy Reduces Cancer Cell Radioresistance by Enhanced ROS Formation and Induced DNA Damage.

PubMed

Storch, Katja; Dickreuter, Ellen; Artati, Anna; Adamski, Jerzy; Cordes, Nils

2016-01-01

Each year more than 450,000 Germans are expected to be diagnosed with cancer subsequently receiving standard multimodal therapies including surgery, chemotherapy and radiotherapy. On top, molecular-targeted agents are increasingly administered. Owing to intrinsic and acquired resistance to these therapeutic approaches, both the better molecular understanding of tumor biology and the consideration of alternative and complementary therapeutic support are warranted and open up broader and novel possibilities for therapy personalization. Particularly the latter is underpinned by the increasing utilization of non-invasive complementary and alternative medicine by the population. One investigated approach is the application of low-dose electromagnetic fields (EMF) to modulate cellular processes. A particular system is the BEMER therapy as a Physical Vascular Therapy for which a normalization of the microcirculation has been demonstrated by a low-frequency, pulsed EMF pattern. Open remains whether this EMF pattern impacts on cancer cell survival upon treatment with radiotherapy, chemotherapy and the molecular-targeted agent Cetuximab inhibiting the epidermal growth factor receptor. Using more physiological, three-dimensional, matrix-based cell culture models and cancer cell lines originating from lung, head and neck, colorectal and pancreas, we show significant changes in distinct intermediates of the glycolysis and tricarboxylic acid cycle pathways and enhanced cancer cell radiosensitization associated with increased DNA double strand break numbers and higher levels of reactive oxygen species upon BEMER treatment relative to controls. Intriguingly, exposure of cells to the BEMER EMF pattern failed to result in sensitization to chemotherapy and Cetuximab. Further studies are necessary to better understand the mechanisms underlying the cellular alterations induced by the BEMER EMF pattern and to clarify the application areas for human disease.

BEMER Electromagnetic Field Therapy Reduces Cancer Cell Radioresistance by Enhanced ROS Formation and Induced DNA Damage

PubMed Central

Artati, Anna; Adamski, Jerzy

2016-01-01

Each year more than 450,000 Germans are expected to be diagnosed with cancer subsequently receiving standard multimodal therapies including surgery, chemotherapy and radiotherapy. On top, molecular-targeted agents are increasingly administered. Owing to intrinsic and acquired resistance to these therapeutic approaches, both the better molecular understanding of tumor biology and the consideration of alternative and complementary therapeutic support are warranted and open up broader and novel possibilities for therapy personalization. Particularly the latter is underpinned by the increasing utilization of non-invasive complementary and alternative medicine by the population. One investigated approach is the application of low-dose electromagnetic fields (EMF) to modulate cellular processes. A particular system is the BEMER therapy as a Physical Vascular Therapy for which a normalization of the microcirculation has been demonstrated by a low-frequency, pulsed EMF pattern. Open remains whether this EMF pattern impacts on cancer cell survival upon treatment with radiotherapy, chemotherapy and the molecular-targeted agent Cetuximab inhibiting the epidermal growth factor receptor. Using more physiological, three-dimensional, matrix-based cell culture models and cancer cell lines originating from lung, head and neck, colorectal and pancreas, we show significant changes in distinct intermediates of the glycolysis and tricarboxylic acid cycle pathways and enhanced cancer cell radiosensitization associated with increased DNA double strand break numbers and higher levels of reactive oxygen species upon BEMER treatment relative to controls. Intriguingly, exposure of cells to the BEMER EMF pattern failed to result in sensitization to chemotherapy and Cetuximab. Further studies are necessary to better understand the mechanisms underlying the cellular alterations induced by the BEMER EMF pattern and to clarify the application areas for human disease. PMID:27959944

Mapping copy number variation by population-scale genome sequencing.

PubMed

Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

2011-02-03

Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

Experimental annotation of the human genome using microarray technology.

PubMed

Shoemaker, D D; Schadt, E E; Armour, C D; He, Y D; Garrett-Engele, P; McDonagh, P D; Loerch, P M; Leonardson, A; Lum, P Y; Cavet, G; Wu, L F; Altschuler, S J; Edwards, S; King, J; Tsang, J S; Schimmack, G; Schelter, J M; Koch, J; Ziman, M; Marton, M J; Li, B; Cundiff, P; Ward, T; Castle, J; Krolewski, M; Meyer, M R; Mao, M; Burchard, J; Kidd, M J; Dai, H; Phillips, J W; Linsley, P S; Stoughton, R; Scherer, S; Boguski, M S

2001-02-15

The most important product of the sequencing of a genome is a complete, accurate catalogue of genes and their products, primarily messenger RNA transcripts and their cognate proteins. Such a catalogue cannot be constructed by computational annotation alone; it requires experimental validation on a genome scale. Using 'exon' and 'tiling' arrays fabricated by ink-jet oligonucleotide synthesis, we devised an experimental approach to validate and refine computational gene predictions and define full-length transcripts on the basis of co-regulated expression of their exons. These methods can provide more accurate gene numbers and allow the detection of mRNA splice variants and identification of the tissue- and disease-specific conditions under which genes are expressed. We apply our technique to chromosome 22q under 69 experimental condition pairs, and to the entire human genome under two experimental conditions. We discuss implications for more comprehensive, consistent and reliable genome annotation, more efficient, full-length complementary DNA cloning strategies and application to complex diseases.

78 FR 64963 - National Center for Complementary & Alternative Medicine; Amended Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-30

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary & Alternative Medicine; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Center for Complementary and Alternative Medicine Special Emphasis Panel, October...

77 FR 4052 - National Center for Complementary & Alternative Medicine; Amended Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-26

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary & Alternative Medicine; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Advisory Council for Complementary and Alternative Medicine, February 3, 2012, 8...

Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction.

PubMed

Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

2014-01-24

DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.

Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

PubMed

Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

2010-04-15

The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection

PubMed Central

Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

2008-01-01

To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531

Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

PubMed

Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

2014-01-10

A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

RISK ASSESSMENT AND LIFE CYCLE IMPACT ASSESSMENT (LCIA) FOR HUMAN HEALTH CANCEROUS AND NONCANCEROUS EMISSIONS: INTEGRATED AND COMPLEMENTARY WITH CONSISTENCY WITHIN THE USEPA

EPA Science Inventory

The historical parallels, complementary roles, and potential for integration of human health risk assessment (RA) and Life-Cycle Impact Assessment (LCIA) are explored. Previous authors have considered the comparison of LCA and risk assessment recognizing the inherent differences ...

Identification of dually acylated proteins from complementary DNA resources by cell-free and cellular metabolic labeling.

PubMed

Moriya, Koko; Kimoto, Mayumi; Matsuzaki, Kanako; Kiwado, Aya; Takamitsu, Emi; Utsumi, Toshihiko

2016-10-15

To establish a strategy to identify dually fatty acylated proteins from cDNA resources, seven N-myristoylated proteins with cysteine (Cys) residues within the 10 N-terminal residues were selected as potential candidates among 27 N-myristoylated proteins identified from a model human cDNA resource. Seven proteins C-terminally tagged with FLAG tag or EGFP were generated and their susceptibility to protein N-myristoylation and S-palmitoylation were evaluated by metabolic labeling with [(3)H]myristic acid or [(3)H]palmitic acid either in an insect cell-free protein synthesis system or in transfected mammalian cells. As a result, EEPD1, one of five proteins (RFTN1, EEPD1, GNAI1, PDE2A, RNF11) found to be dually acylated, was shown to be a novel dually fatty acylated protein. Metabolic labeling experiments using G2A and C7S mutants of EEPD1-EGFP revealed that the palmitoylation site of EEPD1 is Cys at position 7. Analysis of the intracellular localization of EEPD1 C-terminally tagged with FLAG tag or EGFP and its G2A and C7S mutants revealed that the dual acylation directs EEPD1 to localize to the plasma membrane. Thus, dually fatty acylated proteins can be identified from cDNA resources by cell-free and cellular metabolic labeling of N-myristoylated proteins with Cys residue(s) close to the N-myristoylated N-terminus. Copyright © 2016 Elsevier Inc. All rights reserved.

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

PubMed

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Research on Image Encryption Based on DNA Sequence and Chaos Theory

NASA Astrophysics Data System (ADS)

Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

2018-04-01

Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

PubMed

Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

2016-07-15

A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

Diverse Applications of Environmental DNA Methods in Parasitology.

PubMed

Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

2015-10-01

Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, Joe W.; Pinkel, Daniel

1991-01-01

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

DNA nanostructure-based drug delivery nanosystems in cancer therapy.

PubMed

Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

2017-11-25

DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutations altering the cleavage specificity of a homing endonuclease

PubMed Central

Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

2002-01-01

The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

A missense mutation in MKRN3 in a Danish girl with central precocious puberty and her brother with early puberty.

PubMed

Känsäkoski, Johanna; Raivio, Taneli; Juul, Anders; Tommiska, Johanna

2015-12-01

Idiopathic central precocious puberty (ICPP) results from the premature reactivation of the hypothalamic-pituitary-gonadal axis leading to development of secondary sexual characteristics prior to 8 y in girls or 9 y in boys. Since the initial discovery of mutations in the maternally imprinted MKRN3 gene in 2013, several case reports have described mutations in this gene in ICPP patients from different populations, highlighting the importance of MKRN3 as a regulator of pubertal onset. We screened 29 Danish girls with ICPP for mutations in MKRN3. Expression of MKRN3 in human hypothalamic complementary DNA (cDNA) was investigated by PCR. One paternally inherited rare variant, c.1034G>A (p.Arg345His), was identified in one girl with ICPP and in her brother with early puberty. The variant is predicted to be deleterious by three different in silico prediction programs. Expression of MKRN3 was confirmed in adult human hypothalamus. Our results are in line with previous studies in which paternally inherited MKRN3 mutations have been found both in males and in females with ICPP or early puberty. Our report further expands the set of MKRN3 mutations identified in ICPP patients across diverse populations, thus supporting the major regulatory function of MKRN3 in pubertal onset.

Novel interactive partners of neuroligin 3: new aspects for pathogenesis of autism.

PubMed

Shen, Chen; Huo, Li-rong; Zhao, Xin-liang; Wang, Pei-rong; Zhong, Nanbert

2015-05-01

Autism is a neurodevelopmental disorder with a strong genetic predisposition. Neurolign 3 (NLGN3) as a postsynaptic transmembrane protein, functions in both neuron synaptogenesis and glia-neuron communications. Previously, a gain of function mutation (R451C) in NLGN3 was identified in autistic patients, which illustrates the involvement of NLGN3 in autism pathogenesis. As proper synaptic targeting and functioning are controlled by intracellular protein interactions, in the current study, we tried to discover the intracellular regulation network in which NLGN3 might be involved by a yeast two-hybrid-based interactor identification. Fifty-one protein candidate partners were identified after screening a human fetal complementary DNA (cDNA) library with an intracellular fragment of NLGN3. The interactions of NLGN3 with a subset of candidates, including EEF1A1, FLNA, ITPRIP, CYP11A1, MT-CO2, GPR175, ACOT2, and QPRT, were further validated in human neuroblastoma cells or brain tissues. Furthermore, our study suggested that NLGN3 was functioning in cytosolic calcium balance and participating in calcium-regulated cellular processes. Our findings of novel NLGN3 binding partners provide evidences of involvement of NLGN3 in multiple biological pathways, especially calcium regulating and mitochondrial function, thus suggesting further significance. This new data not only leads to a better understanding of the physiological functions of NLGN3, but also provide new aspects for pathogenesis of autism.

Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.

PubMed

Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2014-12-05

The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models. Copyright © 2014 Elsevier B.V. All rights reserved.

Polμ tumor variants decrease the efficiency and accuracy of NHEJ

PubMed Central

Sastre-Moreno, Guillermo; Pryor, John M.; Díaz-Talavera, Alberto; Ruiz, José F.; Ramsden, Dale A.

2017-01-01

Abstract The non homologous end-joining (NHEJ) pathway of double-strand break (DSB) repair often requires DNA synthesis to fill the gaps generated upon alignment of the broken ends, a complex task performed in human cells by two specialized DNA polymerases, Polλ and Polμ. It is now well established that Polμ is the one adapted to repair DSBs with non-complementary ends, the most challenging scenario, although the structural basis and physiological implications of this adaptation are not fully understood. Here, we demonstrate that two human Polμ point mutations, G174S and R175H, previously identified in two different tumor samples and affecting two adjacent residues, limit the efficiency of accurate NHEJ by Polμ in vitro and in vivo. Moreover, we show that this limitation is the consequence of a decreased template dependency during NHEJ, which renders the error-rate of the mutants higher due to the ability of Polμ to randomly incorporate nucleotides at DSBs. These results highlight the relevance of the 8 kDa domain of Polμ for accurate and efficient NHEJ, but also its contribution to the error-prone behavior of Polμ at 2-nt gaps. This work provides the first demonstration that mutations affecting Polμ identified in tumors can alter the efficiency and fidelity of NHEJ. PMID:28973441

Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

PubMed

Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

2017-05-30

A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1.

PubMed

Nishimasu, Hiroshi; Yamano, Takashi; Gao, Linyi; Zhang, Feng; Ishitani, Ryuichiro; Nureki, Osamu

2017-07-06

The RNA-guided Cpf1 nuclease cleaves double-stranded DNA targets complementary to the CRISPR RNA (crRNA), and it has been harnessed for genome editing technologies. Recently, Acidaminococcus sp. BV3L6 (AsCpf1) was engineered to recognize altered DNA sequences as the protospacer adjacent motif (PAM), thereby expanding the target range of Cpf1-mediated genome editing. Whereas wild-type AsCpf1 recognizes the TTTV PAM, the RVR (S542R/K548V/N552R) and RR (S542R/K607R) variants can efficiently recognize the TATV and TYCV PAMs, respectively. However, their PAM recognition mechanisms remained unknown. Here we present the 2.0 Å resolution crystal structures of the RVR and RR variants bound to a crRNA and its target DNA. The structures revealed that the RVR and RR variants primarily recognize the PAM-complementary nucleotides via the substituted residues. Our high-resolution structures delineated the altered PAM recognition mechanisms of the AsCpf1 variants, providing a basis for the further engineering of CRISPR-Cpf1. Copyright © 2017 Elsevier Inc. All rights reserved.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

The mirror neuron system is more active during complementary compared with imitative action.

PubMed

Newman-Norlund, Roger D; van Schie, Hein T; van Zuijlen, Alexander M J; Bekkering, Harold

2007-07-01

We assessed the role of the human mirror neuron system (MNS) in complementary actions using functional magnetic resonance imaging while participants prepared to execute imitative or complementary actions. The BOLD signal in the right inferior frontal gyrus and bilateral inferior parietal lobes was greater during preparation of complementary than during imitative actions, suggesting that the MNS may be essential in dynamically coupling action observation to action execution.

Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

PubMed

Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

2007-06-01

To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

An electrochemiluminescent DNA sensor based on nano-gold enhancement and ferrocene quenching.

PubMed

Yao, Wu; Wang, Lun; Wang, Haiyan; Zhang, Xiaolei; Li, Ling; Zhang, Na; Pan, Le; Xing, Nannan

2013-02-15

An electrochemiluminescent DNA (ECL-DNA) sensor based on nano-gold signal enhancement (i.e. gold nanoparticles, GNP) and ferrocene signal quenching was investigated. The Au electrode was first modified with GNPs through electrodeposition method, followed by subsequent immobilization of single-stranded probe DNA labeled with ruthenium complex. The resulting sensor produced a higher ECL signal due to its higher density of self-assembled probe DNAs on the surface. Upon the hybridization of probe DNA with complementary target DNA labeled with ferrocene, ECL intensity decreased significantly due to spatial separation of ECL label from the electrode surface. As a result, the ECL signal was simultaneously quenched by ferrocene. The effects of both nano-gold electrodeposition time and ferrocene on the performance of ECL-DNA sensor were studied in detail and possible reasons for these effects were suggested as well. The reported ECL-DNA sensor showed great sensitivity and may provide an alternative approach for DNA detection in diagnostics and gene analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

Complementary DNA cloning, functional expression and characterization of a novel cytochrome P450, CYP2D50, from equine liver.

PubMed

DiMaio Knych, H K; Stanley, S D

2008-10-01

Members of the CYP2D family constitute only about 2-4% of total hepatic CYP450s, however, they are responsible for the metabolism of 20-25% of commonly prescribed therapeutic compounds. CYP2D enzymes have been identified in a number of different species. However, vast differences in the metabolic activity of these enzymes have been well documented. In the horse, the presence of a member of the CYP2D family has been suggested from studies with equine liver microsomes, however its presence has not been definitively proven. In this study a cDNA encoding a novel CYP2D enzyme (CYP2D50) was cloned from equine liver and expressed in a baculovirus expression system. The nucleotide sequence of CYP2D50 was highly homologous to that of human CYP2D6 and therefore the activity of the enzyme was characterized using dextromethorphan and debrisoquine, two isoform selective substrates for the human orthologue. CYP2D50 displayed optimal catalytic activity with dextromethorphan using molar ratios of CYP2D50 to NADPH CYP450 reductase of 1:15. Although CYP2D50 and CYP2D6 shared significant sequence homology, there were striking differences in the catalytic activity between the two enzymes. CYP2D50 dextromethorphan-O-demethylase activity was nearly 180-fold slower than the human counterpart, CYP2D6. Similarly, rates of formation of 4-hydroxydebrisoquine activity were 50-fold slower for CYP2D50 compared to CYP2D6. The results of this study demonstrate substantial interspecies variability in metabolism of substrates by CYP2D orthologues in the horse and human and support the need to fully characterize this enzyme system in equids.

DNA Nanostructures as Smart Drug-Delivery Vehicles and Molecular Devices.

PubMed

Linko, Veikko; Ora, Ari; Kostiainen, Mauri A

2015-10-01

DNA molecules can be assembled into custom predesigned shapes via hybridization of sequence-complementary domains. The folded structures have high spatial addressability and a tremendous potential to serve as platforms and active components in a plethora of bionanotechnological applications. DNA is a truly programmable material, and its nanoscale engineering thus opens up numerous attractive possibilities to develop novel methods for therapeutics. The tailored molecular devices could be used in targeting cells and triggering the cellular actions in the biological environment. In this review we focus on the DNA-based assemblies - primarily DNA origami nanostructures - that could perform complex tasks in cells and serve as smart drug-delivery vehicles in, for example, cancer therapy, prodrug medication, and enzyme replacement therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

DTIC Science & Technology

2007-10-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

DTIC Science & Technology

2007-01-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system.

PubMed

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system

PubMed Central

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010

Electrosynthesis and characterization of nanostructured polyquinone for use in detection and quantification of naturally occurring dsDNA.

PubMed

Hernández, Loreto A; Del Valle, María A; Armijo, Francisco

2016-05-15

The detection of naturally occurring desoxyribonucleic acid (DNA) has become a subject of study by the projections that would generate to be able to sense the genetic material for the detection of future diseases. Bearing this in mind, to provide new measuring strategies, in the current work the preparation of a low-cost electrode, modified with poly(1-amino-9,10-anthraquinone) nanowires using a SiO2 template, is carried out; the assembly is next modified by covalently attaching ssDNA strands. It must be noted that all this is accomplished by using solely electrochemical techniques, according to methodology developed for this purpose. SEM images of the modified surface show high order and homogeneity in the distribution of modified nanowires over the electrode surface. In turn, after the hybridization with its complementary strand, the voltammetric responses enable corroborating the linear relationship between hybridization at different DNA concentrations and normalized current response, obtaining a limit of detection (LOD) 5.7·10(-12)gL(-1) and limit of quantification (LOQ) 1.9·10(-11)gL(-1). The working dynamic range is between 1.4·10(-7) and 8.5·10(-9)gL(-1) with a correlation coefficient 0.9998. The successful obtaining of the modified electrode allows concluding that the high order reached by the nanostructures, guides the subsequent single strand of DNA (ssDNA) covalent attachment, which after hybridization with its complementary strand brings about a considerable current increase. This result allows foreseeing a guaranteed breakthrough with regard to the use of the biosensor in real samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

PubMed Central

Suard, Y M; Tosi, M; Kraehenbuhl, J P

1982-01-01

Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

A large Raman scattering cross-section molecular embedded SERS aptasensor for ultrasensitive Aflatoxin B1 detection using CS-Fe3O4 for signal enrichment

NASA Astrophysics Data System (ADS)

Chen, Quansheng; Yang, Mingxiu; Yang, Xiaojing; Li, Huanhuan; Guo, Zhiming; Rahma, M. H.

2018-01-01

With growing concern on oil safety problems, developing a simple and sensitive method to detect Aflatoxin B1 (AFB1), a common mycotoxin in peanut oil, is very necessary. In this study, Surface-enhanced Raman Scattering (SERS) aptasensor was developed for ultrasensitive AFB1 detection using the amino-terminal AFB1 aptamer (NH2-DNA1); and thiol-terminal AFB1 complementary aptamer (SH-DNA2) conjugated magnetic-beads (CS-Fe3O4) as enrichment nanoprobe and AuNR@DNTB@Ag nanorods (ADANRs) as reporter nanoprobe respectively. 5,5‧-Dithiobis(2-nitrobenzoicacid) (DNTB) with large Raman scattering cross-section and no fluorescence interference was embedded in Au and Ag core/shell nanorods as Raman reporter molecules. CS-Fe3O4 possessed excellent biocompatibility and superparamagnetism for rapid signal enrichment. Therefore, NH2-DNA1-CS-Fe3O4 and SH-DNA2-ADANRs were fabricated via the hybrid reaction between aptamers and complementary aptamers. When there is AFB1, AFB1 would competitively combine with the NH2-DNA1-CS-Fe3O4 inducing the dissociation of SH-DNA2-ADANRs from CS-Fe3O4 and further decreasing the SERS signal. Based on this developed SERS aptasensor, a low limit of 0.0036 ng/mL and an effective linear detection range from 0.01 to 100 ng/mL with the correlation coefficient up to 0.986 for AFB1 detection were obtained. Moreover, the specificity of this SERS aptasensor was demonstrated by detecting other two mycotoxins and its accuracy for AFB1 detection in real peanut oil was further confirmed by standard addition recovery test.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon.

PubMed

Xue, Jianpeng; Shan, Lingling; Chen, Haiyan; Li, Yang; Zhu, Hongyan; Deng, Dawei; Qian, Zhiyu; Achilefu, Samuel; Gu, Yueqing

2013-03-15

Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5' end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. Copyright © 2012 Elsevier B.V. All rights reserved.

Evaluation of tyrosine-kinase receptor c-KIT (c-KIT) mutations, mRNA and protein expression in canine leukemia: might c-KIT represent a therapeutic target?

PubMed

Giantin, M; Aresu, L; Aricò, A; Gelain, M E; Riondato, F; Martini, V; Comazzi, S; Dacasto, M

2013-04-15

The tyrosine-kinase receptor c-KIT (c-KIT) plays an important role in proliferation, survival and differentiation of progenitor cells in normal hematopoietic cells. In human hematological malignancies, c-KIT is mostly expressed by progenitor cell neoplasia and seldom by those involving mature cells. Tyrosine kinase inhibitors (TKIs) are actually licensed for the first- and second-line treatment of human hematologic disorders. Aim of the present study was to evaluate c-KIT mRNA and protein expression and complementary DNA (cDNA) mutations in canine leukemia. Eleven acute lymphoblastic leukemia (ALL) and acute undifferentiated leukemia (AUL) and 12 chronic lymphocytic leukemia (CLL) were enrolled in this study. The amounts of c-KIT mRNA and protein were determined, in peripheral blood samples, by using quantitative real time RT-PCR, flow cytometry and immunocytochemistry, respectively. The presence of mutations on c-KIT exons 8-11 and 17 were investigated by cDNA sequencing. Higher amounts of c-KIT mRNA were found in ALL/AUL compared to CLL, and this latter showed a lower pattern of gene expression. Transcriptional data were confirmed at the protein level. No significant gain-of-function mutations were ever observed in both ALL/AUL and CLL. Among canine hematological malignancies, ALL/AUL typically show a very aggressive biological behavior, partly being attributable to the lack of efficacious therapeutic options. The high level of c-KIT expression found in canine ALL/AUL might represent the rationale for using TKIs in future clinical trials. Copyright © 2013 Elsevier B.V. All rights reserved.

F14512, a potent antitumor agent targeting topoisomerase II vectored into cancer cells via the polyamine transport system.

PubMed

Barret, Jean-Marc; Kruczynski, Anna; Vispé, Stéphane; Annereau, Jean-Philippe; Brel, Viviane; Guminski, Yves; Delcros, Jean-Guy; Lansiaux, Amélie; Guilbaud, Nicolas; Imbert, Thierry; Bailly, Christian

2008-12-01

The polyamine transport system (PTS) is an energy-dependent machinery frequently overactivated in cancer cells with a high demand for polyamines. We have exploited the PTS to selectively deliver a polyamine-containing drug to cancer cells. F14512 combines an epipodophyllotoxin core-targeting topoisomerase II with a spermine moiety introduced as a cell delivery vector. The polyamine tail supports three complementary functions: (a) facilitate formulation of a water-soluble compound, (b) increase DNA binding to reinforce topoisomerase II inhibition, and (c) facilitate selective uptake by tumor cells via the PTS. F14512 is 73-fold more cytotoxic to Chinese hamster ovary cells compared with CHO-MG cells with a reduced PTS activity. A decreased sensitivity of L1210 leukemia cells to F14512 was observed in the presence of putrescine, spermidine, and spermine. In parallel, the spermine moiety considerably enhances the drug-DNA interaction, leading to a reinforced inhibition of topoisomerase II. The spermine tail of F14512 serves as a cell delivery vehicle as well as a DNA anchor, and this property translates at the cellular level into a distinct pharmacologic profile. Twenty-nine human solid or hematologic cell lines were used to characterize the high cytotoxic potential of F14512 (median IC50 of 0.18 micromol/L). Finally, the potent antitumor activity of F14512 in vivo was evidenced with a MX1 human breast tumor xenograft model, with partial and complete tumor regressions. This work supports the clinical development of F14512 as a novel targeted cytotoxic drug and sheds light on the concept of selective delivery of drugs to tumor cells expressing the PTS.

DNA cytoskeleton for stabilizing artificial cells.

PubMed

Kurokawa, Chikako; Fujiwara, Kei; Morita, Masamune; Kawamata, Ibuki; Kawagishi, Yui; Sakai, Atsushi; Murayama, Yoshihiro; Nomura, Shin-Ichiro M; Murata, Satoshi; Takinoue, Masahiro; Yanagisawa, Miho

2017-07-11

Cell-sized liposomes and droplets coated with lipid layers have been used as platforms for understanding live cells, constructing artificial cells, and implementing functional biomedical tools such as biosensing platforms and drug delivery systems. However, these systems are very fragile, which results from the absence of cytoskeletons in these systems. Here, we construct an artificial cytoskeleton using DNA nanostructures. The designed DNA oligomers form a Y-shaped nanostructure and connect to each other with their complementary sticky ends to form networks. To undercoat lipid membranes with this DNA network, we used cationic lipids that attract negatively charged DNA. By encapsulating the DNA into the droplets, we successfully created a DNA shell underneath the membrane. The DNA shells increased interfacial tension, elastic modulus, and shear modulus of the droplet surface, consequently stabilizing the lipid droplets. Such drastic changes in stability were detected only when the DNA shell was in the gel phase. Furthermore, we demonstrate that liposomes with the DNA gel shell are substantially tolerant against outer osmotic shock. These results clearly show the DNA gel shell is a stabilizer of the lipid membrane akin to the cytoskeleton in live cells.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.

DTIC Science & Technology

1991-02-01

Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides

Rapid high-throughput analysis of ochratoxin A by the self-assembly of DNAzyme-aptamer conjugates in wine.

PubMed

Yang, Cheng; Lates, Vasilica; Prieto-Simón, Beatriz; Marty, Jean-Louis; Yang, Xiurong

2013-11-15

We report a new label-free colorimetric aptasensor based on DNAzyme-aptamer conjugate for rapid and high-throughput detection of Ochratoxin A (OTA, a possible human carcinogen, group 2B) in wine. Two oligonucleotides were designed for this detection. One is N1 for biorecognition, which includes two adjacent sequences: the OTA-specific aptamer sequence and the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The other is a blocking DNA (B2), which is partially complementary to a part of the OTA aptamer and partially complementary to a part of the DNAzyme. The existence of OTA reduces the hybridization between N1 and B2. Thus, the activity of the non-hybridized DNAzyme is linearly correlated with the concentration of OTA up to 30 nM with a limit of detection of 4 nM (3σ). Meanwhile, a double liquid-liquid extraction (LLE) method is accordingly developed to purify OTA from wine. Compared with the existing HPLC-FD or immunoassay methods, the proposed strategy presents the most appropriate balance between accuracy and facility, resulting in a considerable improvement of real-time quality control, and thereby, preventing chronic poisoning caused by OTA contained red wine. Copyright © 2013 Elsevier B.V. All rights reserved.

78 FR 51734 - National Center for Complementary and Alternative Medicine Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-21

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary and Alternative Medicine Notice of Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council for Complementary and Alternative...

76 FR 79202 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-21

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council for Complementary and Alternative...

77 FR 43099 - National Center For Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-23

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center For Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council for Complementary and Alternativ...

76 FR 55073 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-06

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended (5 U.S.C. App.), notice is hereby given of the National Advisory Council for Complementary and Alternative Medicine ...

78 FR 19498 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-01

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council for Complementary and Alternative...

Asymmetry and Extent of In Vivo Transcripition of R-Plasmid Deoxyribonucleic Acid in Escherichia coli

PubMed Central

Vapnek, Daniel; Spingler, Elizabeth

1974-01-01

Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013

DNA biosensing with 3D printing technology.

PubMed

Loo, Adeline Huiling; Chua, Chun Kiang; Pumera, Martin

2017-01-16

3D printing, an upcoming technology, has vast potential to transform conventional fabrication processes due to the numerous improvements it can offer to the current methods. To date, the employment of 3D printing technology has been examined for applications in the fields of engineering, manufacturing and biological sciences. In this study, we examined the potential of adopting 3D printing technology for a novel application, electrochemical DNA biosensing. Metal 3D printing was utilized to construct helical-shaped stainless steel electrodes which functioned as a transducing platform for the detection of DNA hybridization. The ability of electroactive methylene blue to intercalate into the double helix structure of double-stranded DNA was then exploited to monitor the DNA hybridization process, with its inherent reduction peak serving as an analytical signal. The designed biosensing approach was found to demonstrate superior selectivity against a non-complementary DNA target, with a detection range of 1-1000 nM.

Instructing cells with programmable peptide DNA hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida

The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less

Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB

PubMed Central

Sugiman-Marangos, Seiji N.; Weiss, Yoni M.; Junop, Murray S.

2016-01-01

Accurate pairing of DNA strands is essential for repair of DNA double-strand breaks (DSBs). How cells achieve accurate annealing when large regions of single-strand DNA are unpaired has remained unclear despite many efforts focused on understanding proteins, which mediate this process. Here we report the crystal structure of a single-strand annealing protein [DdrB (DNA damage response B)] in complex with a partially annealed DNA intermediate to 2.2 Å. This structure and supporting biochemical data reveal a mechanism for accurate annealing involving DdrB-mediated proofreading of strand complementarity. DdrB promotes high-fidelity annealing by constraining specific bases from unauthorized association and only releases annealed duplex when bound strands are fully complementary. To our knowledge, this mechanism provides the first understanding for how cells achieve accurate, protein-assisted strand annealing under biological conditions that would otherwise favor misannealing. PMID:27044084

Dynamic DNA nanotechnology using strand-displacement reactions

NASA Astrophysics Data System (ADS)

Zhang, David Yu; Seelig, Georg

2011-02-01

The specificity and predictability of Watson-Crick base pairing make DNA a powerful and versatile material for engineering at the nanoscale. This has enabled the construction of a diverse and rapidly growing set of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Although it had initially focused on the self-assembly of static structures, DNA nanotechnology is now also becoming increasingly attractive for engineering systems with interesting dynamic properties. Various devices, including circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures, have recently been rationally designed to use DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands. This mechanism allows for the kinetic control of reaction pathways. Here, we review DNA strand-displacement-based devices, and look at how this relatively simple mechanism can lead to a surprising diversity of dynamic behaviour.

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, J.W.; Pinkel, D.

1991-07-02

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

Instructing cells with programmable peptide DNA hybrids

DOE PAGES

Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida; ...

2017-07-10

The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less

Reliable method for generating double-stranded DNA vectors containing site-specific base modifications.

PubMed

Brégeon, Damien; Doetsch, Paul W

2004-11-01

Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.

Instructing cells with programmable peptide DNA hybrids

NASA Astrophysics Data System (ADS)

Freeman, Ronit; Stephanopoulos, Nicholas; Álvarez, Zaida; Lewis, Jacob A.; Sur, Shantanu; Serrano, Chris M.; Boekhoven, Job; Lee, Sungsoo S.; Stupp, Samuel I.

2017-07-01

The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the ability to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.

Development of a mass sensitive quartz crystal microbalance (QCM)-based DNA biosensor using a 50 MHz electronic oscillator circuit.

PubMed

García-Martinez, Gonzalo; Bustabad, Enrique Alonso; Perrot, Hubert; Gabrielli, Claude; Bucur, Bogdan; Lazerges, Mathieu; Rose, Daniel; Rodriguez-Pardo, Loreto; Fariña, Jose; Compère, Chantal; Vives, Antonio Arnau

2011-01-01

This work deals with the design of a high sensitivity DNA sequence detector using a 50 MHz quartz crystal microbalance (QCM) electronic oscillator circuit. The oscillator circuitry is based on Miller topology, which is able to work in damping media. Calibration and experimental study of frequency noise are carried out, finding that the designed sensor has a resolution of 7.1 ng/cm(2) in dynamic conditions (with circulation of liquid). Then the oscillator is proved as DNA biosensor. Results show that the system is able to detect the presence of complementary target DNAs in a solution with high selectivity and sensitivity. DNA target concentrations higher of 50 ng/mL can be detected.

“Ultra-high resolution optical trap with single fluorophore sensitivity”

PubMed Central

Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

2013-01-01

We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

ATM and ATR play complementary roles in the behavior of excitatory and inhibitory vesicle populations.

PubMed

Cheng, Aifang; Zhao, Teng; Tse, Kai-Hei; Chow, Hei-Man; Cui, Yong; Jiang, Liwen; Du, Shengwang; Loy, Michael M T; Herrup, Karl

2018-01-09

ATM (ataxia-telangiectasia mutated) and ATR (ATM and Rad3-related) are large PI3 kinases whose human mutations result in complex syndromes that include a compromised DNA damage response (DDR) and prominent nervous system phenotypes. Both proteins are nuclear-localized in keeping with their DDR functions, yet both are also found in cytoplasm, including on neuronal synaptic vesicles. In ATM- or ATR-deficient neurons, spontaneous vesicle release is reduced, but a drop in ATM or ATR level also slows FM4-64 dye uptake. In keeping with this, both proteins bind to AP-2 complex components as well as to clathrin, suggesting roles in endocytosis and vesicle recycling. The two proteins play complementary roles in the DDR; ATM is engaged in the repair of double-strand breaks, while ATR deals mainly with single-strand damage. Unexpectedly, this complementarity extends to these proteins' synaptic function as well. Superresolution microscopy and coimmunoprecipitation reveal that ATM associates exclusively with excitatory (VGLUT1 + ) vesicles, while ATR associates only with inhibitory (VGAT + ) vesicles. The levels of ATM and ATR respond to each other; when ATM is deficient, ATR levels rise, and vice versa. Finally, blocking NMDA, but not GABA, receptors causes ATM levels to rise while ATR levels respond to GABA, but not NMDA, receptor blockade. Taken together, our data suggest that ATM and ATR are part of the cellular "infrastructure" that maintains the excitatory/inhibitory balance of the nervous system. This idea has important implications for the human diseases resulting from their genetic deficiency.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Differential expression of a novel seven transmembrane domain protein in epididymal fat from aged and diabetic mice.

PubMed

Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C

1999-06-01

To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.

The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

NASA Astrophysics Data System (ADS)

Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

2018-02-01

DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

Genome-wide epigenetic perturbation jump-starts patterns of heritable variation found in nature.

PubMed

Roux, Fabrice; Colomé-Tatché, Maria; Edelist, Cécile; Wardenaar, René; Guerche, Philippe; Hospital, Frédéric; Colot, Vincent; Jansen, Ritsert C; Johannes, Frank

2011-08-01

We extensively phenotyped 6000 Arabidopsis plants with experimentally perturbed DNA methylomes as well as a diverse panel of natural accessions in a common garden. We found that alterations in DNA methylation not only caused heritable phenotypic diversity but also produced heritability patterns closely resembling those of the natural accessions. Our findings indicate that epigenetically induced and naturally occurring variation in complex traits share part of their polygenic architecture and may offer complementary adaptation routes in ecological settings.

A surface-confined DNA assembly amplification strategy on DNA nanostructural scaffold for electrochemiluminescence biosensing.

PubMed

Feng, Qiu-Mei; Guo, Yue-Hua; Xu, Jing-Juan; Chen, Hong-Yuan

2018-02-15

A critical challenge in surface-based DNA assembly amplification is the reduced accessibility of DNA strands arranged on a heterogeneous surface compared to that in homogeneous solution. Here, a novel in situ surface-confined DNA assembly amplification electrochemiluminescence (ECL) biosensor based on DNA nanostructural scaffold was presented. In this design, a stem-loop structural DNA segment (Hairpin 1) was constructed on the vertex of DNA nanostructural scaffold as recognition probe. In the present of target DNA, the hairpin structure changed to rod-like through complementary hybridization with target DNA, resulting in the formation of Hairpin 1:target DNA. When the obtained Hairpin 1:target DNA met Hairpin 2 labeled with glucose oxidase (GOD), the DNA cyclic amplification was activated, releasing target DNA into homogeneous solution for the next recycling. Thus, the ECL signal of Ru(bpy) 3 2+ -TPrA system was quenched by H 2 O 2 , the product of GOD catalyzing glucose. As a result, this proposed method achieved a linear range response from 50 aM to 10 pM with lower detection limit of 20 aM. Copyright © 2017 Elsevier B.V. All rights reserved.

Interactions of the EcoRV restriction endonuclease with fluorescent oligodeoxynucleotides.

PubMed

Erskine, S G; Halford, S E

1995-05-19

A self-complementary dodecadeoxyribonucleotide that contains the recognition sequence for the R.EcoRV ENase was synthesised with a primary amino group at its 5' terminus. The 5' amino function was labeled with the fluorescent dye 5-[dimethylamino] napthalene-1-sulfonyl chloride. The labeled oligodeoxyribonucleotide in its duplex form was shown to be a suitable substrate for kinetic studies on the ENase and that no significant dye-DNA or dye-protein interactions occurred. Finally, the binding of R.EcoRV to the labeled DNA was followed by detecting the fluorescence resonance energy transfer between the tryptophans of the protein and the fluorescent labels of the DNA.

Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change

DOEpatents

Miles, Robin R [Danville, CA; Belgrader, Phillip [Severna Park, MD; Fuller, Christopher D [Oakland, CA

2007-01-02

Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.

Effect of light chain V region duplication on IgG oligomerization and in vivo efficacy.

PubMed

Shuford, W; Raff, H V; Finley, J W; Esselstyn, J; Harris, L J

1991-05-03

A human immunoglobulin G1 (IgG1) antibody oligomer was isolated from a transfected myeloma cell line that produced a monoclonal antibody to group B streptococci. Compared to the IgG1 monomer, the oligomer was significantly more effective at protecting neonatal rats from infection in vivo. The oligomer was also shown to cross the placenta and to be stable in neonatal rats. Immunochemical analysis and complementary DNA sequencing showed that the transfected cell line produced two distinct kappa light chains: a normal light chain (Ln) with a molecular mass of 25 kilodaltons and a 37-kilodalton species (L37), the domain composition of which was variable-variable-constant (V-V-C). Cotransfection of vectors encoding the heavy chain and L37 resulted in production of oligomeric IgG.

Using the clustered circular layout as an informative method for visualizing protein-protein interaction networks.

PubMed

Fung, David C Y; Wilkins, Marc R; Hart, David; Hong, Seok-Hee

2010-07-01

The force-directed layout is commonly used in computer-generated visualizations of protein-protein interaction networks. While it is good for providing a visual outline of the protein complexes and their interactions, it has two limitations when used as a visual analysis method. The first is poor reproducibility. Repeated running of the algorithm does not necessarily generate the same layout, therefore, demanding cognitive readaptation on the investigator's part. The second limitation is that it does not explicitly display complementary biological information, e.g. Gene Ontology, other than the protein names or gene symbols. Here, we present an alternative layout called the clustered circular layout. Using the human DNA replication protein-protein interaction network as a case study, we compared the two network layouts for their merits and limitations in supporting visual analysis.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

UVA irradiation of BrU-substituted DNA in the presence of Hoechst 33258.

PubMed

Saha, Abhijit; Kizaki, Seiichiro; Han, Ji Hoon; Yu, Zutao; Sugiyama, Hiroshi

2018-01-01

Given that our knowledge of DNA repair is limited because of the complexity of the DNA system, a technique called UVA micro-irradiation has been developed that can be used to visualize the recruitment of DNA repair proteins at double-strand break (DSB) sites. Interestingly, Hoechst 33258 was used under micro-irradiation to sensitize 5-bromouracil ( Br U)-labelled DNA, causing efficient DSBs. However, the molecular basis of DSB formation under UVA micro-irradiation remains unknown. Herein, we investigated the mechanism of DSB formation under UVA micro-irradiation conditions. Our results suggest that the generation of a uracil-5-yl radical through electron transfer from Hoechst 33258 to Br U caused DNA cleavage preferentially at self-complementary 5'-AA Br U Br U-3' sequences to induce DSB. We also investigated the DNA cleavage in the context of the nucleosome to gain a better understanding of UVA micro-irradiation in a cell-like model. We found that DNA cleavage occurred in both core and linker DNA regions although its efficiency reduced in core DNA. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor

PubMed Central

Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

2015-01-01

A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239

A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

PubMed

Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

2015-11-09

A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

A novel input-parasitic compensation technique for a nanopore-based CMOS DNA detection sensor

NASA Astrophysics Data System (ADS)

Kim, Jungsuk

2016-12-01

This paper presents a novel input-parasitic compensation (IPC) technique for a nanopore-based complementary metal-oxide-semiconductor (CMOS) DNA detection sensor. A resistive-feedback transimpedance amplifier is typically adopted as the headstage of a DNA detection sensor to amplify the minute ionic currents generated from a nanopore and convert them to a readable voltage range for digitization. But, parasitic capacitances arising from the headstage input and the nanopore often cause headstage saturation during nanopore sensing, thereby resulting in significant DNA data loss. To compensate for the unwanted saturation, in this work, we propose an area-efficient and automated IPC technique, customized for a low-noise DNA detection sensor, fabricated using a 0.35- μm CMOS process; we demonstrated this prototype in a benchtop test using an α-hemolysin ( α-HL) protein nanopore.

Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

PubMed

Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

2017-01-01

Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.