Science.gov

Sample records for human cytomegalovirus ie1

  1. Human cytomegalovirus IE1 protein alters the higher-order chromatin structure by targeting the acidic patch of the nucleosome.

    PubMed

    Fang, Qianglin; Chen, Ping; Wang, Mingzhu; Fang, Junnan; Yang, Na; Li, Guohong; Xu, Rui-Ming

    2016-01-26

    Human cytomegalovirus (hCMV) immediate early 1 (IE1) protein associates with condensed chromatin of the host cell during mitosis. We have determined the structure of the chromatin-tethering domain (CTD) of IE1 bound to the nucleosome core particle, and discovered that IE1-CTD specifically interacts with the H2A-H2B acidic patch and impairs the compaction of higher-order chromatin structure. Our results suggest that IE1 loosens up the folding of host chromatin during hCMV infections.

  2. Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones specifically activated by IE1 peptides in vitro.

    PubMed Central

    Davignon, J L; Castanié, P; Yorke, J A; Gautier, N; Clément, D; Davrinche, C

    1996-01-01

    The control of latent cytomegalovirus (CMV) infections by the immune system is poorly understood. We have previously shown that CD4+ T cells specific for the human CMV major regulatory protein IE1 are frequent in latently infected healthy blood donors. In order to learn about the possible role of these cells, we have developed IE1-specific CD4+ T-cell clones and, in this study, analyzed their epitope specificity and function in vitro. We measured their cytokine production when stimulated with specific IE1 peptides or whole recombinant IE1 protein. Their cytokine profiles, as deduced from gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), and interleukin-4 (IL-4) and IL-6 production, were of the Th0- and Th1-like phenotypes. Supernatants from IE1-specific clones producing IFN-gamma and TNF-alpha were shown to inhibit CMV replication in U373 MG cells. This effect was due, as found by using cytokine-specific neutralizing antibodies, mostly to IFN-gamma, which was secreted at higher levels than TNF-alpha. To better assess the anti-CMV activity of cytokines, recombinant IFN-gamma and TNF-alpha were used and shown to have a synergistic effect on the inhibition of CMV replication and protein expression. Thus, IE1-specific CD4+ T cells display in vitro anti-CMV activity through cytokine secretion and may play a role in the control of in vivo latent infections. PMID:8642638

  3. Two Polypyrimidine Tracts in Intron 4 of the Major Immediate Early Gene Are Critical for Gene Expression Switching from IE1 to IE2 and for Replication of Human Cytomegalovirus

    PubMed Central

    Hou, Wangheng; Torres, Lilith; Cruz-Cosme, Ruth; Arroyo, Fernando; Irizarry, Luis; Luciano, Dalia; Márquez, Arturo; Rivera, Leslie L.; Sala, Antonio L.; Luo, Min-hua

    2016-01-01

    ABSTRACT The human cytomegalovirus (HCMV) major immediate early (MIE) gene is essential for viral replication. The most abundant products encoded by the MIE gene include IE1 and IE2. Genes of IE1 and IE2 share the MIE promoter (MIEP), the first 3 exons, and the first 2 introns. IE1 is expressed earlier than IE2 after CMV infection or MIE gene transfection. In this study, we identified 2 polypyrimidine (Py) tracts in intron 4 (between exons 4 and 5) that are responsible for transcriptional switching from IE1 to IE2. The first Py is important and the second one is essential for the splicing and expression of IE2. In searching for the mechanisms of MIE gene switching from IE1 to IE2, we found that the second Py was required for the IE2's fourth intron to bind to a splicing factor such as U2AF65, as determined by an RNA electrophoretic mobility shift assay and a chromatin immunoprecipitation (ChIP) assay, while the first Py enhanced the binding of U2AF65 with the intron. An HCMV BACmid with the second Py mutated failed to produce any virus, while the HCMV with the first Py mutated replicated with a defective phenotype. Furthermore, we designed a small RNA (scRNAPy) that is complementary to the intron RNA covering the two Pys. The scRNAPy interfered with the interaction of U2AF65 with the intron and repressed the IE2 expression. Therefore, our studies implied that IE2 gene splicing might be an anti-CMV target. IMPORTANCE CMV is a ubiquitous herpesvirus and a significant cause of disease and death in the immunocompromised and elderly. Insights into its gene regulation will provide clues in designing anti-CMV strategies. The MIE gene is one of the earliest genes of CMV and is essential for CMV replication. It is known that the MIE gene needs to be spliced to produce more than two proteins; however, how MIE gene splicing is regulated remains elusive. In the present studies, we identified two Pys in intron 4 and found that the first Py is important and the second is

  4. Crystal structure of cytomegalovirus IE1 protein reveals targeting of TRIM family member PML via coiled-coil interactions.

    PubMed

    Scherer, Myriam; Klingl, Stefan; Sevvana, Madhumati; Otto, Victoria; Schilling, Eva-Maria; Stump, Joachim D; Müller, Regina; Reuter, Nina; Sticht, Heinrich; Muller, Yves A; Stamminger, Thomas

    2014-11-01

    PML nuclear bodies (PML-NBs) are enigmatic structures of the cell nucleus that act as key mediators of intrinsic immunity against viral pathogens. PML itself is a member of the E3-ligase TRIM family of proteins that regulates a variety of innate immune signaling pathways. Consequently, viruses have evolved effector proteins to modify PML-NBs; however, little is known concerning structure-function relationships of viral antagonists. The herpesvirus human cytomegalovirus (HCMV) expresses the abundant immediate-early protein IE1 that colocalizes with PML-NBs and induces their dispersal, which correlates with the antagonization of NB-mediated intrinsic immunity. Here, we delineate the molecular basis for this antagonization by presenting the first crystal structure for the evolutionary conserved primate cytomegalovirus IE1 proteins. We show that IE1 consists of a globular core (IE1CORE) flanked by intrinsically disordered regions. The 2.3 Å crystal structure of IE1CORE displays an all α-helical, femur-shaped fold, which lacks overall fold similarity with known protein structures, but shares secondary structure features recently observed in the coiled-coil domain of TRIM proteins. Yeast two-hybrid and coimmunoprecipitation experiments demonstrate that IE1CORE binds efficiently to the TRIM family member PML, and is able to induce PML deSUMOylation. Intriguingly, this results in the release of NB-associated proteins into the nucleoplasm, but not of PML itself. Importantly, we show that PML deSUMOylation by IE1CORE is sufficient to antagonize PML-NB-instituted intrinsic immunity. Moreover, co-immunoprecipitation experiments demonstrate that IE1CORE binds via the coiled-coil domain to PML and also interacts with TRIM5α We propose that IE1CORE sequesters PML and possibly other TRIM family members via structural mimicry using an extended binding surface formed by the coiled-coil region. This mode of interaction might render the antagonizing activity less susceptible to

  5. Immediate–Early (IE) gene regulation of cytomegalovirus: IE1- and pp71-mediated viral strategies against cellular defenses

    PubMed Central

    Torres, Lilith; Tang, Qiyi

    2015-01-01

    Three crucial hurdles hinder studies on human cytomegalovirus (HCMV): strict species specificity, differences between in vivo and in vitro infection, and the complexity of gene regulation. Ever since the sequencing of the whole genome was first accomplished, functional studies on individual genes have been the mainstream in the CMV field. Gene regulation has therefore been elucidated in a more detailed fashion. However, viral gene regulation is largely controlled by both cellular and viral components. In other words, viral gene expression is determined by the virus–host interaction. Generally, cells respond to viral infection in a defensive pattern; at the same time, viruses try to counteract the cellular defense or else hide in the host (latency). Viruses evolve effective strategies against cellular defense in order to achieve replicative success. Whether or not they are successful, cellular defenses remain in the whole viral replication cycle: entry, immediate–early (IE) gene expression, early gene expression, DNA replication, late gene expression, and viral egress. Many viral strategies against cellular defense, and which occur in the immediate–early time of viral infection, have been documented. In this review, we will summarize the documented biological functions of IE1 and pp71 proteins, especially with regard to how they counteract cellular intrinsic defenses. PMID:25501994

  6. Ablation of the Regulatory IE1 Protein of Murine Cytomegalovirus Alters In Vivo Pro-inflammatory TNF-alpha Production during Acute Infection

    PubMed Central

    Wilhelmi, Vanessa; Lisnic, Vanda Juranic; Hsieh, Wei Yuan; Blanc, Mathieu; Livingston, Andrew; Busche, Andreas; Tekotte, Hille; Messerle, Martin; Auer, Manfred; Fraser, Iain; Jonjic, Stipan; Angulo, Ana; Reddehase, Matthias J.; Ghazal, Peter

    2012-01-01

    Little is known about the role of viral genes in modulating host cytokine responses. Here we report a new functional role of the viral encoded IE1 protein of the murine cytomegalovirus in sculpting the inflammatory response in an acute infection. In time course experiments of infected primary macrophages (MΦs) measuring cytokine production levels, genetic ablation of the immediate-early 1 (ie1) gene results in a significant increase in TNFα production. Intracellular staining for cytokine production and viral early gene expression shows that TNFα production is highly associated with the productively infected MΦ population of cells. The ie1- dependent phenotype of enhanced MΦ TNFα production occurs at both protein and RNA levels. Noticeably, we show in a series of in vivo infection experiments that in multiple organs the presence of ie1 potently inhibits the pro-inflammatory cytokine response. From these experiments, levels of TNFα, and to a lesser extent IFNβ, but not the anti-inflammatory cytokine IL10, are moderated in the presence of ie1. The ie1- mediated inhibition of TNFα production has a similar quantitative phenotype profile in infection of susceptible (BALB/c) and resistant (C57BL/6) mouse strains as well as in a severe immuno-ablative model of infection. In vitro experiments with infected macrophages reveal that deletion of ie1 results in increased sensitivity of viral replication to TNFα inhibition. However, in vivo infection studies show that genetic ablation of TNFα or TNFRp55 receptor is not sufficient to rescue the restricted replication phenotype of the ie1 mutant virus. These results provide, for the first time, evidence for a role of IE1 as a regulator of the pro-inflammatory response and demonstrate a specific pathogen gene capable of moderating the host production of TNFα in vivo. PMID:22952450

  7. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell.

  8. Cytomegalovirus (CMV) IE1- and pp65-specific CD8+ T cell responses broaden over time after primary CMV infection in infants.

    PubMed

    Gibson, Laura; Dooley, Sheryl; Trzmielina, Sonia; Somasundaran, Mohan; Fisher, Donna; Revello, Maria Grazia; Luzuriaga, Katherine

    2007-06-15

    Cytomegalovirus (CMV) infection remains a significant cause of morbidity and mortality in young children. We have previously shown that CD8+ T cell responses to CMV pp65 or IE1 protein were readily detectable in children with congenital or postnatal CMV infection. Here, we have further characterized the evolution of the peptide specificity of these responses in 7 infants<6 months of age at the start of the study. Thirteen pp65 and 15 IE1 peptides (median, 5 peptides/infant) were targeted, and most (61%) represented sequences not previously reported. Peptide specificity remained stable or broadened over time despite the clearance of CMV viremia. Loss of peptide recognition was not observed. Responses with the highest functional peptide avidity were not necessarily detected earliest. These data provide additional evidence that young infants can generate diverse CMV-specific CD8+ T cell responses but show that early responses may exhibit relatively focused peptide specificity and lower peptide avidity.

  9. Human cytomegalovirus: propagation, quantification, and storage.

    PubMed

    Britt, William J

    2010-08-01

    Human cytomegalovirus (HCMV) is the largest and perhaps the most structurally complex member of the family of human herpesviruses. It is the prototypic virus of the beta-herpesvirus subfamily. As with other cytomegaloviruses, HCMV is exquisitely species specific and undergoes lytic replication only in cells of human origin. In addition, its replication is limited almost entirely to primary cells and a limited number of transformed cell lines. Together with its prolonged replicative cycle of approximately 48 hr, the propagation and quantification of HCMV can present technical challenges. In this brief set of protocols, the propagation of laboratory strains of HCMV and their quantitation is described. In a third series of protocols, the concentration and gradient purification of HCMV for more specialized downstream applications is described.

  10. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection.

  11. Transactivation of cellular genes involved in nucleotide metabolism by the regulatory IE1 protein of murine cytomegalovirus is not critical for viral replicative fitness in quiescent cells and host tissues.

    PubMed

    Wilhelmi, Vanessa; Simon, Christian O; Podlech, Jürgen; Böhm, Verena; Däubner, Torsten; Emde, Simone; Strand, Dennis; Renzaho, Angélique; Lemmermann, Niels A W; Seckert, Christof K; Reddehase, Matthias J; Grzimek, Natascha K A

    2008-10-01

    Despite its high coding capacity, murine CMV (mCMV) does not encode functional enzymes for nucleotide biosynthesis. It thus depends on cellular enzymes, such as ribonucleotide reductase (RNR) and thymidylate synthase (TS), to be supplied with deoxynucleoside triphosphates (dNTPs) for its DNA replication. Viral transactivation of these cellular genes in quiescent cells of host tissues is therefore a parameter of viral fitness relevant to pathogenicity. Previous work has shown that the IE1, but not the IE3, protein of mCMV transactivates RNR and TS gene promoters and has revealed an in vivo attenuation of the mutant virus mCMV-DeltaIE1. It was attractive to propose the hypothesis that lack of transactivation by IE1 and a resulting deficiency in the supply of dNTPs are the reasons for growth attenuation. Here, we have tested this hypothesis with the mutant virus mCMV-IE1-Y165C expressing an IE1 protein that selectively fails to transactivate RNR and TS in quiescent cells upon transfection while maintaining the capacity to disperse repressive nuclear domains (ND10). Our results confirm in vivo attenuation of mCMV-DeltaIE1, as indicated by a longer doubling time in host organs, whereas mCMV-IE1-Y165C replicated like mCMV-WT and the revertant virus mCMV-IE1-C165Y. Notably, the mutant virus transactivated RNR and TS upon infection of quiescent cells, thus indicating that IE1 is not the only viral transactivator involved. We conclude that transactivation of cellular genes of dNTP biosynthesis is ensured by redundancy and that attenuation of mCMV-DeltaIE1 results from the loss of other critical functions of IE1, with its function in the dispersal of ND10 being a promising candidate.

  12. Human immune responses to major human cytomegalovirus glycoprotein complexes.

    PubMed Central

    Liu, Y N; Kari, B; Gehrz, R C

    1988-01-01

    Sera from both human cytomegalovirus (HCMV)-seropositive adults and infants with congenital HCMV infection recognized two major HCMV glycoprotein complexes. However, proliferative responses of peripheral blood mononuclear cells to these complexes varied among seropositive adults and were not detected in any of the infants. Thus, these glycoproteins alone may not be sufficient to develop a subviral HCMV vaccine. Images PMID:2828655

  13. Positive Expression of Human Cytomegalovirus Phosphoprotein 65 in Atherosclerosis

    PubMed Central

    Wang, Zhe; Cai, Jun; Zhang, Mingming; Wang, Xiaojing; Chi, Hongjie; Feng, Haijun

    2016-01-01

    Previous studies showed that human cytomegalovirus (HCMV) is associated with atherosclerosis. However, local vascular atherosclerosis related HCMV infection and protein expression remain unclear. This study aimed to assess the relationship between HCMV infection and atherosclerosis. Formalin-fixed, paraffin-embedded peripheral artery specimens were obtained from 15 patients with atherosclerosis undergoing vascular surgery from 2008 to 2010 at Zhongnan Hospital, Wuhan University. Pathological analyses were carried out after hematoxylin and eosin (H&E) and Masson trichrome staining. In situ hybridization and immunohistochemistry with two different monoclonal antibodies were employed to detect HCMV nucleic acids and proteins, respectively. H&E and Masson trichrome staining showed homogeneous extracellular matrix in femoral artery, while smooth muscle fibers were interlaced with collagen fibers; in carotid artery, inflammatory cell infiltration, foam cell vascular change, cholesterol crystals, and layered collagen fibers were observed. In situ hybridization showed no expression of HCMV nucleic acids in all 15 cases. Immunohistochemical staining for protein immediate-early protein (IE1 72) was negative in all cases, while phosphoprotein 65 (pp65) expression was detected in 14 cases. A high rate of positive pp65 signals was found in patients with atherosclerosis, suggesting that local HCMV infection may be associated with the pathogenesis of atherosclerosis. Further studies on this relationship are warranted. PMID:27990427

  14. Human cytomegalovirus latent gene expression in granulocyte-macrophage progenitors in culture and in seropositive individuals.

    PubMed Central

    Kondo, K; Xu, J; Mocarski, E S

    1996-01-01

    Following infection with cytomegalovirus, human granulocyte-macrophage progenitors carry the viral genome but fail to support productive replication. Viral transcripts arise from a region encompassing the major regulatory gene locus; however, their structure differs significantly from productive phase transcripts. One class, sense transcripts, is encoded in the same direction as productive phase transcripts but uses two novel start sites in the ie1/ie2 promoter/enhancer region. These transcripts have the potential to encode a novel 94 aa protein. The other class, antisense transcript, is unspliced and complimentary to ie1 exons 2-4, and has the potential to encode novel 154 and 152 aa proteins. Consistent with a role in latency, these transcripts are present in bone marrow aspirates from naturally infected, healthy seropositive donors but are not present in seronegative controls. Sense latent transcripts are present in a majority of seropositive individuals. Consistent with the expression of latent transcripts, antibody to the 94 aa and 152 aa proteins is detectable in the serum of seropositive individuals. Thus, latent infection by cytomegalovirus is accompanied by the presence of latency-associated transcripts and expression of immunogenic proteins. Overall, these results suggest that bone marrow-derived myeloid progenitors are an important natural site of viral latency. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855322

  15. Infrequency of cytomegalovirus genome in coronary arteriopathy of human heart allografts.

    PubMed Central

    Gulizia, J. M.; Kandolf, R.; Kendall, T. J.; Thieszen, S. L.; Wilson, J. E.; Radio, S. J.; Costanzo, M. R.; Winters, G. L.; Miller, L. L.; McManus, B. M.

    1995-01-01

    In heart transplantation, long-term engraftment success is severely limited by the rapid development of obliterative disease of the coronary arteries. Data from various groups have been suggestive of a pathogenetic role of herpesviruses, particularly human cytomegalovirus, in accelerated allograft coronary artery disease; however, results are not yet conclusive. This study examines the hypothesis that human cytomegalovirus infection of allograft tissues is related pathogenetically and directly to accelerated coronary artery disease. Using in situ DNA hybridization and polymerase chain reaction, we examined particular coronary artery segments from 41 human heart allografts (ranging from 4 days to greater than 4 years after transplantation; mean, 457 days) and 22 donor age- and gender-comparable, coronary site-matched trauma victims for presence of human cytomegalovirus DNA. Human cytomegalovirus genome was detected in 8 of 41 (19.5%) allografts and in 1 of 22 (4.5%) control hearts. This difference in positivity was not statistically significant (P = 0.10). In the human cytomegalovirus-positive hearts, viral genome was localized to perivascular myocardium or coronary artery media or adventitia. Human cytomegalovirus genome was not detected in arterial intima of any allograft or control heart, although human cytomegalovirus genome was readily identified within intima of small pulmonary arteries from lung tissue with human cytomegalovirus pneumonitis. By statistical analyses, the presence of human cytomegalovirus genome was not associated with the nature or digitized extent of transplant arteriopathy, evidence of rejection, allograft recipient or donor serological data suggestive of human cytomegalovirus infection, duration of allograft implantation, or causes of death or retransplantation. Thus, our data indicate a low frequency of detectable human cytomegalovirus genome in accelerated coronary artery disease and do not support a direct role for human cytomegalovirus

  16. Cytomegalovirus (CMV) infection

    MedlinePlus

    CMV mononucleosis; Cytomegalovirus; CMV; Human cytomegalovirus; HCMV ... infection is spread by: Blood transfusions Organ transplants ... viruses remain in your body for the rest of your life. If your ...

  17. Human embryonic stem cell lines model experimental human cytomegalovirus latency.

    PubMed

    Penkert, Rhiannon R; Kalejta, Robert F

    2013-05-28

    Herpesviruses are highly successful pathogens that persist for the lifetime of their hosts primarily because of their ability to establish and maintain latent infections from which the virus is capable of productively reactivating. Human cytomegalovirus (HCMV), a betaherpesvirus, establishes latency in CD34(+) hematopoietic progenitor cells during natural infections in the body. Experimental infection of CD34(+) cells ex vivo has demonstrated that expression of the viral gene products that drive productive infection is silenced by an intrinsic immune defense mediated by Daxx and histone deacetylases through heterochromatinization of the viral genome during the establishment of latency. Additional mechanistic details about the establishment, let alone maintenance and reactivation, of HCMV latency remain scarce. This is partly due to the technical challenges of CD34(+) cell culture, most notably, the difficulty in preventing spontaneous differentiation that drives reactivation and renders them permissive for productive infection. Here we demonstrate that HCMV can establish, maintain, and reactivate in vitro from experimental latency in cultures of human embryonic stem cells (ESCs), for which spurious differentiation can be prevented or controlled. Furthermore, we show that known molecular aspects of HCMV latency are faithfully recapitulated in these cells. In total, we present ESCs as a novel, tractable model for studies of HCMV latency.

  18. Murine cytomegalovirus resistant to antivirals has genetic correlates with human cytomegalovirus.

    PubMed

    Scott, G M; Ng, H-L; Morton, C J; Parker, M W; Rawlinson, W D

    2005-08-01

    Human cytomegalovirus (HCMV) resistance to antivirals is a significant clinical problem. Murine cytomegalovirus (MCMV) infection of mice is a well-described animal model for in vivo studies of CMV pathogenesis, although the mechanisms of MCMV antiviral susceptibility need elucidation. Mutants resistant to nucleoside analogues aciclovir, adefovir, cidofovir, ganciclovir, penciclovir and valaciclovir, and the pyrophosphate analogue foscarnet were generated by in vitro passage of MCMV (Smith) in increasing concentrations of antiviral. All MCMV antiviral resistant mutants contained DNA polymerase mutations identical or similar to HCMV DNA polymerase mutations known to confer antiviral resistance. Mapping of the mutations onto an MCMV DNA polymerase three-dimensional model generated using the Thermococcus gorgonarius Tgo polymerase crystal structure showed that the DNA polymerase mutations potentially confer resistance through changes in regions surrounding a catalytic aspartate triad. The ganciclovir-, penciclovir- and valaciclovir-resistant isolates also contained mutations within MCMV M97 identical or similar to recognized GCV-resistant mutations of HCMV UL97 protein kinase, and demonstrated cross-resistance to antivirals of the same class. This strongly suggests that MCMV M97 has a similar role to HCMV UL97 in the phosphorylation of nucleoside analogue antivirals. All MCMV mutants demonstrated replication-impaired phenotypes, with the lowest titre and plaque size observed for isolates containing mutations in both DNA polymerase and M97. These findings indicate DNA polymerase and protein kinase regions of potential importance for antiviral susceptibility and replication. The similarities between MCMV and HCMV mutations that arise under antiviral selective pressure increase the utility of MCMV as a model for in vivo studies of CMV antiviral resistance.

  19. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi

    2013-01-01

    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  20. Human antibody technology and the development of antibodies against cytomegalovirus.

    PubMed

    Ohlin, Mats; Söderberg-Nauclér, Cecilia

    2015-10-01

    Cytomegalovirus (CMV) is a virus that causes chronic infections in a large set of the population. It may cause severe disease in immunocompromised individuals, is linked to immunosenescence and implied to play an important role in the pathogenesis of cardiovascular diseases and cancer. Modulation of the immune system's abilities to manage the virus represent a highly viable therapeutic option and passive immunotherapy with polyclonal antibody preparations is already in clinical use. Defined monoclonal antibodies offer many advantages over polyclonal antibodies purified from serum. Human CMV-specific monoclonal antibodies have consequently been thoroughly investigated with respect to their potential in the treatment of diseases caused by CMV. Recent advances in human antibody technology have substantially expanded the breadth of antibodies for such applications. This review summarizes the fundamental basis for treating CMV disease by use of antibodies, the basic technologies to be used to develop such antibodies, and relevant human antibody specificities available to target this virus.

  1. Growth in Agarose of Human Cells Infected with Cytomegalovirus

    PubMed Central

    Lang, David J.; Montagnier, Luc; Latarjet, Raymond

    1974-01-01

    After infection by human cytomegalovirus (CMV), human diploid fibroblasts could grow in agarose medium for several generations. Clones of infected cells grew for weeks, although in every case they ultimately underwent lysis owing to the cytopathic effect of the virus. Virus was inoculated at high dilution and after UV irradiation in an effort to derive cells infected with noninfectious defective particles still capable of inducing cell stimulation. Dilute or irradiated virus occasionally yielded large colonies of replicating cells, although permanent transformation was not observed. One clone derived from UV-CMV-infected cells was passaged four times before undergoing lysis. During these passages the cells exhibited alterations in morphology and orientation. Images PMID:4367907

  2. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  3. Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina

    PubMed Central

    Distéfano, Angélica Lidia; Alonso, Alicia; Martin, Fabián; Pardon, Fabián

    2004-01-01

    Background Human cytomegalovirus (CMV) is one of the most commonly found agents of congenital infections. Primary maternal infection is associated with risk of symptomatic congenital diseases, and high morbidity is frequently associated with very low birth weight. Neonates with asymptomatic infection develop various sequelae during infancy. This is the first Argentine study performed in neonates with congenital and postnatal HCMV infection. The purpose of this study was to evaluate the performance of the polymerase chain reaction (PCR) technique with different pairs of primers, to detect cytomegalovirus isolated in tissue cultures and directly in urine and dried blood spot (DBS) specimens. Results were compared with IgM detection. Methods The study was performed between 1999 and 2001 on routine samples in the Laboratory. A total of 61 urine and 56 serum samples were selected from 61 newborns/infants, 33 patients whose samples were analyzed during the first two to three weeks of life were considered congenital infections; the remaining 28 patients whose samples were taken later than the third week were grouped as perinatal infections, although only in 4 the perinatal transmission of infection was determined unequivocally Cytomegalovirus diagnosis was made by isolating the virus from urine samples in human foreskin fibroblast cells. Three different primer pairs directed to IE, LA and gB genes were used for the HCMV PCR assay in viral isolates. Subsequently, PCR and nested PCR (nPCR) assays with gB primers were performed directly in urine and in 11 samples of dried blood spot (DBS) on Guthrie Card, these results were then compared with serology. Results The main clinical manifestations of the 33 patients with congenital infection were purpura, jaundice, hepatomegaly and anaemia. Three patients presented low birth weight as single symptom, 10, intracranial calcifications, and 2, kidney failure. In the 28 patients grouped as with perinatal infection, anaemia

  4. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  5. Human Cytomegalovirus Carries a Cell-Derived Phospholipase A2 Required for Infectivity

    PubMed Central

    Allal, Cuider; Buisson-Brenac, Claire; Marion, Vincent; Claudel-Renard, Clotilde; Faraut, Thomas; Dal Monte, Paola; Streblow, Daniel; Record, Michel

    2004-01-01

    Human cytomegalovirus (HCMV) is known to carry host cell-derived proteins and mRNAs whose role in cell infection is not understood. We have identified a phospholipase A2 (PLA2) activity borne by HCMV by using an assay based on the hydrolysis of fluorescent phosphatidylcholine. This activity was found in all virus strains analyzed and in purified strains. It was calcium dependent and was sensitive to inhibitors of cytosolic PLA2 (cPLA2) but not to inhibitors of soluble PLA2 or calcium-independent PLA2. No other phospholipase activity was detected in the virus. Purified virus was found to contain human cellular cPLA2α, as detected by monoclonal antibody. No homology with PLA2 was found in the genome of HCMV, indicating that HCMV does not code for a PLA2. Decreased de novo expression of immediate-early proteins 1 and 2 (IE1 and IE2), tegument phosphoprotein pp65, and virus production was observed when HCMV was treated with inhibitors of cPLA2. Cell entry of HCMV was not altered by those inhibitors, suggesting the action of cPLA2 was postentry. Together, our results indicate a selective sorting of a cell-derived cPLA2 during HCMV maturation, which is further required for infectivity. PMID:15220446

  6. Human Cytomegalovirus UL97 Phosphorylates the Viral Nuclear Egress Complex

    PubMed Central

    Sharma, Mayuri; Bender, Brian J.; Kamil, Jeremy P.; Lye, Ming F.; Pesola, Jean M.; Reim, Natalia I.; Hogle, James M.

    2014-01-01

    ABSTRACT Herpesvirus nucleocapsids exit the host cell nucleus in an unusual process known as nuclear egress. The human cytomegalovirus (HCMV) UL97 protein kinase is required for efficient nuclear egress, which can be explained by its phosphorylation of the nuclear lamina component lamin A/C, which disrupts the nuclear lamina. We found that a dominant negative lamin A/C mutant complemented the replication defect of a virus lacking UL97 in dividing cells, validating this explanation. However, as complementation was incomplete, we investigated whether the HCMV nuclear egress complex (NEC) subunits UL50 and UL53, which are required for nuclear egress and recruit UL97 to the nuclear rim, are UL97 substrates. Using mass spectrometry, we detected UL97-dependent phosphorylation of UL50 residue S216 (UL50-S216) and UL53-S19 in infected cells. Moreover, UL53-S19 was specifically phosphorylated by UL97 in vitro. Notably, treatment of infected cells with the UL97 inhibitor maribavir or infection with a UL97 mutant led to a punctate rather than a continuous distribution of the NEC at the nuclear rim. Alanine substitutions in both UL50-S216 and UL53-S19 resulted in a punctate distribution of the NEC in infected cells and also decreased virus production and nuclear egress in the absence of maribavir. These results indicate that UL97 phosphorylates the NEC and suggest that this phosphorylation modulates nuclear egress. Thus, the UL97-NEC interaction appears to recruit UL97 to the nuclear rim both for disruption of the nuclear lamina and phosphorylation of the NEC. IMPORTANCE Human cytomegalovirus (HCMV) causes birth defects and it can cause life-threatening diseases in immunocompromised patients. HCMV assembles in the nucleus and then translocates to the cytoplasm in an unusual process termed nuclear egress, an attractive target for antiviral therapy. A viral enzyme, UL97, is important for nuclear egress. It has been proposed that this is due to its role in disruption of the

  7. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  8. Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region.

    PubMed Central

    Azad, R F; Driver, V B; Tanaka, K; Crooke, R M; Anderson, K P

    1993-01-01

    Phosphorothioate oligonucleotides complementary to mRNA of the human cytomegalovirus (HCMV) DNA polymerase gene or to RNA transcripts of the major immediate-early regions 1 and 2 (IE1 and IE2) of HCMV were evaluated for antiviral activity in a 96-well immunoassay with primary human dermal fibroblasts as host cells. Oligonucleotides complementary to RNA of the IE2 region exhibited the most potent antiviral activity. One of these oligonucleotides, ISIS 2922, was at least 30-fold more potent than the nucleoside analog, ganciclovir, with a 50% effective concentration of 0.37 microM in the 96-well immunoassay. In an infectious virus yield reduction assay, ISIS 2922 and ganciclovir reduced production of infectious virus by 2 log units at concentrations of 2.2 and 36 microM, respectively. A control oligonucleotide showed no inhibition of virus production at concentrations as high as 3 microM. ISIS 2922 reduced IE protein synthesis in HCMV-infected cells in a dose-dependent manner which correlated with antiviral activity. The antiviral activity of ISIS 2922 was not due to oligonucleotide-induced cytotoxicity since effects on cell viability or proliferation were observed only at concentrations well in excess of effective antiviral concentrations. The specificity and potency of ISIS 2922 suggest that it may be useful for the treatment of cytomegalovirus disease in humans. Images PMID:8239610

  9. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  10. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    PubMed

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  11. In Silico Pattern-Based Analysis of the Human Cytomegalovirus Genome

    PubMed Central

    Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T.; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas

    2003-01-01

    More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/). PMID:12634390

  12. Detection of human cytomegalovirus in normal and neoplastic breast epithelium

    PubMed Central

    2010-01-01

    Introduction Human cytomegalovirus (HCMV) establishes a persistent life-long infection, and can cause severe pathology in the fetus and the immunocompromised host[1]. Breast milk is the primary route of transmission in humans worldwide, and breast epithelium is thus a likely site of persistent infection and/or reactivation, though this phenomenon has not previously been demonstrated. Increasing evidence indicates HCMV infection can modulate signaling pathways associated with oncogenesis. We hypothesized that persistent HCMV infection occurs in normal adult breast epithelium and that persistent viral expression might be associated with normal and neoplastic ductal epithelium. Methods Surgical biopsy specimens of normal breast (n = 38) breast carcinoma (n = 39) and paired normal breast from breast cancer patients (n = 21) were obtained. Specimens were evaluated by immunohistochemistry, in situ hybridization, PCR and DNA sequencing for evidence of HCMV antigens and nucleic acids. Results We detected HCMV expression specifically in glandular epithelium in 17/27 (63%) of normal adult breast cases evaluated. In contrast, HCMV expression was evident in the neoplastic epithelium of 31/32 (97%) patients with ductal carcinoma in situ (DCIS) and infiltrating ductal carcinoma (IDC) cases evaluated (p = 0.0009). Conclusions These findings are the first to demonstrate that persistent HCMV infection occurs in breast epithelium in a significant percentage of normal adult females. HCMV expression was also evident in neoplastic breast epithelium in a high percentage of normal and neoplastic breast tissues obtained from breast cancer patients, raising the possibility that viral infection may be involved in the neoplastic process. PMID:21429243

  13. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  14. Human fetal inner ear involvement in congenital cytomegalovirus infection

    PubMed Central

    2013-01-01

    Background Congenital cytomegalovirus (CMV) infection is a leading cause of sensorineural hearing loss (SNHL). The mechanisms of pathogenesis of CMV-related SNHL are still unclear. The aim is to study congenital CMV-related damage in the fetal inner ear, in order to better understand the underlying pathophysiology behind CMV-SNHL. Results We studied inner ears and brains of 20 human fetuses, all at 21 week gestational age, with a high viral load in the amniotic fluid, with and without ultrasound (US) brain abnormalities. We evaluated histological brain damage, inner ear infection, local inflammatory response and tissue viral load. Immunohistochemistry revealed that CMV was positive in 14/20 brains (70%) and in the inner ears of 9/20 fetuses (45%). In the cases with inner ear infection, the marginal cell layer of the stria vascularis was always infected, followed by infection in the Reissner’s membrane. The highest tissue viral load was observed in the inner ear with infected Organ of Corti. Vestibular labyrinth showed CMV infection of sensory cells in the utricle and in the crista ampullaris. US cerebral anomalies were detected in 6 cases, and in all those cases, the inner ear was always involved. In the other 14 cases with normal brain scan, histological brain damage was present in 8 fetuses and 3 of them presented inner ear infection. Conclusions CMV-infection of the marginal cell layer of the stria vascularis may alter potassium and ion circulation, dissipating the endocochlear potential with consequent SNHL. Although abnormal cerebral US is highly predictive of brain and inner ear damage, normal US findings cannot exclude them either. PMID:24252374

  15. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  16. Two novel human cytomegalovirus NK cell evasion functions target MICA for lysosomal degradation.

    PubMed

    Fielding, Ceri A; Aicheler, Rebecca; Stanton, Richard J; Wang, Eddie C Y; Han, Song; Seirafian, Sepehr; Davies, James; McSharry, Brian P; Weekes, Michael P; Antrobus, P Robin; Prod'homme, Virginie; Blanchet, Fabien P; Sugrue, Daniel; Cuff, Simone; Roberts, Dawn; Davison, Andrew J; Lehner, Paul J; Wilkinson, Gavin W G; Tomasec, Peter

    2014-05-01

    NKG2D plays a major role in controlling immune responses through the regulation of natural killer (NK) cells, αβ and γδ T-cell function. This activating receptor recognizes eight distinct ligands (the MHC Class I polypeptide-related sequences (MIC) A andB, and UL16-binding proteins (ULBP)1-6) induced by cellular stress to promote recognition cells perturbed by malignant transformation or microbial infection. Studies into human cytomegalovirus (HCMV) have aided both the identification and characterization of NKG2D ligands (NKG2DLs). HCMV immediate early (IE) gene up regulates NKGDLs, and we now describe the differential activation of ULBP2 and MICA/B by IE1 and IE2 respectively. Despite activation by IE functions, HCMV effectively suppressed cell surface expression of NKGDLs through both the early and late phases of infection. The immune evasion functions UL16, UL142, and microRNA(miR)-UL112 are known to target NKG2DLs. While infection with a UL16 deletion mutant caused the expected increase in MICB and ULBP2 cell surface expression, deletion of UL142 did not have a similar impact on its target, MICA. We therefore performed a systematic screen of the viral genome to search of addition functions that targeted MICA. US18 and US20 were identified as novel NK cell evasion functions capable of acting independently to promote MICA degradation by lysosomal degradation. The most dramatic effect on MICA expression was achieved when US18 and US20 acted in concert. US18 and US20 are the first members of the US12 gene family to have been assigned a function. The US12 family has 10 members encoded sequentially through US12-US21; a genetic arrangement, which is suggestive of an 'accordion' expansion of an ancestral gene in response to a selective pressure. This expansion must have be an ancient event as the whole family is conserved across simian cytomegaloviruses from old world monkeys. The evolutionary benefit bestowed by the combinatorial effect of US18 and US20 on MICA

  17. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  18. Burden of disease associated with human cytomegalovirus and prospects for elimination by universal immunisation.

    PubMed

    Griffiths, Paul D

    2012-10-01

    Cytomegalovirus is the most frequent cause of intrauterine infection and the commonest infectious agent to affect allograft recipients, yet the virus is acknowledged rarely as an occupational hazard for women of childbearing age or as a nosocomial infection. The potential role of cytomegalovirus in hastening the death of patients with AIDS, elderly people, individuals admitted to intensive-care units, and the general population is not emphasised. Development of vaccines against this important human pathogen has been delayed by reluctance to initiate proof-of-concept studies, but after recent trials, protection is a distinct possibility. Cytomegalovirus deserves to be eliminated from selected populations by means of universal immunisation as soon as suitable vaccines become licensed. This action should control disease in neonates and transplant recipients and could provide substantial additional benefits if other disease associations prove to be causal.

  19. 76 FR 69743 - The Development and Evaluation of Human Cytomegalovirus Vaccines; Public Workshop

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... Vaccines; Public Workshop AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public workshop. The... Prevention, and the National Vaccine Program Office are announcing a public workshop entitled ``The Development and Evaluation of Human Cytomegalovirus Vaccines.'' The purpose of the public workshop is...

  20. Clinical evaluation of a chemiluminescence immunoassay for determination of immunoglobulin g avidity to human cytomegalovirus.

    PubMed

    Revello, Maria Grazia; Gorini, Giovanna; Gerna, Giuseppe

    2004-07-01

    Clinical evaluation of a novel fully automated chemiluminescence immunoassay for determination of immunoglobulin G avidity to human cytomegalovirus (HCMV) showed 92.8% sensitivity and 84.7% specificity in detecting a recent (< or =90 days) primary HCMV infection. The assay appears useful for accurately diagnosing recent primary HCMV infections.

  1. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  2. An Fc receptor for human immunoglobulin G is located within the tegument of human cytomegalovirus.

    PubMed Central

    Stannard, L M; Hardie, D R

    1991-01-01

    Immunogold electron microscopy has demonstrated that human immunoglobulin G (IgG) can bind to the tegument of human cytomegalovirus virions by the Fc portion of the molecule. This binding was inhibited by preincubation of the Fc probes with protein A. Treatment of AD169 virions with Triton X-100 allowed release of the Fc-binding proteins, which were precipitated and characterized by polyacrylamide gel electrophoresis (PAGE). Polypeptides of approximately 69 and 33 kDa were recovered and shown by immunoblotting to retain their capacity to bind Fc-gold after separation under both reducing and nonreducing conditions. The combined results of blocking experiments, PAGE of precipitates, and Western blots (immunoblots) indicate that the tegument proteins which bind IgG-Fc are identical to those which bind beta 2 microglobulin. Images PMID:1851889

  3. Virion basic phosphoprotein from human cytomegalovirus contains O-linked N-acetylglucosamine.

    PubMed Central

    Benko, D M; Haltiwanger, R S; Hart, G W; Gibson, W

    1988-01-01

    A 149-kDa virion protein of human strains of cytomegalovirus is the principal acceptor for galactose added in vitro by bovine milk galactosyltransferase. Peptide comparisons with other biochemical characteristics of the galactosylated protein identified it as the virus-encoded basic phosphoprotein. This protein is an abundant constituent of the virion and is located in the tegument region, between the capsid and the envelope, rather than in the envelope layer with the recognized virion glycoproteins. The galactosylated carbohydrate was resistant to a commercial preparation of endoglycosidase F but was sensitive to removal by alkali-induced beta-elimination, indicating an O-linkage to the protein. Chromatographic and electrophoretic determinations identified the beta-eliminated material as the alditol of Gal beta 1-4GlcNAc, establishing that the human cytomegalovirus virion basic phosphoprotein contains single O-linked residues of N-acetylglucosamine. Images PMID:2833746

  4. Receptor expression and responsiveness of human peripheral blood mononuclear cells to a human cytomegalovirus encoded CC chemokine.

    PubMed

    Zheng, Qi; Xu, Jun; Gao, Huihui; Tao, Ran; Li, Wei; Shang, Shiqiang; Gu, Weizhong

    2015-01-01

    Human cytomegalovirus is a ubiquitous pathogen that infects the majority of the world's population. After long period of time co-evolving with human being, this pathogen has developed several strategies to evade host immune surveillance. One of the major trick is encoding homologous to those of the host organism or stealing host cellular genes that have significant functions in immune system. To date, we have found several viral immune analogous which include G protein coupled receptor, class I major histocompatibility complex and chemokine. Chemokine is a small group of molecules which is defined by the presence of four cysteines in highly conserved region. The four kinds of chemokines (C, CC, CXC, and CX3C) are classified based on the arrangement of 1 or 2 N-terminal cysteine residues. UL128 protein is one of the analogous that encoded by human cytomegalovirus that has similar amino acid sequences to the human CC chemokine. It has been proved to be one of the essential particles that involved in human cytomegalovirus entry into epithelial/endothelial cells as well as macrophages. It is also the target of potent neutralizing antibodies in human cytomegalovirus-seropositive individuals. We had demonstrated the chemotactic trait of UL128 protein in our previous study. Recombinant UL128 in vitro has the ability to attract monocytes to the infection region and enhances peripheral blood mononuclear cell proliferation by activating the MAPK/ERK signaling pathway. However, the way that this viral encoded chemokine interacting with peripheral blood mononuclear cells and the detailed mechanism that involving the virus entry into host cells keeps unknown. Here we performed in vitro investigation into the effects of UL128 protein on peripheral blood mononuclear cell's activation and receptor binding, which may help us further understand the immunomodulatory function of UL128 protein as well as human cytomegalovirus diffusion mechanism.

  5. Host cellular annexin II is associated with cytomegalovirus particles isolated from cultured human fibroblasts.

    PubMed Central

    Wright, J F; Kurosky, A; Pryzdial, E L; Wasi, S

    1995-01-01

    A significant amount of host cellular annexin II was found to be associated with human cytomegalovirus isolated from cultured human fibroblasts (approximately 1,160 molecules per virion). This composition was established by four different analytical approaches that included (i) Western blot (immunoblot) analysis of gradient-purified virions with a monoclonal antibody specific for annexin II, (ii) peptide mapping and sequence analysis of virus-associated proteins and proteins dissociated from virus following EDTA treatment, (iii) electron microscopic immunocytochemistry of gradient-purified virions, and (iv) labeling of virus-associated proteins by lactoperoxidase-catalyzed radioiodination. These results indicated that annexin II was primarily localized to the viral surface, where it bound in a divalent cation-dependent manner. In functional experiments, a rabbit antiserum raised against annexin II inhibited cytomegalovirus plaque formation in human foreskin fibroblast monolayers in a concentration-dependent manner. Cumulatively, these studies demonstrate an association of host annexin II with cytomegalovirus particles and provide evidence for the involvement of this cellular protein in virus infectivity. PMID:7609045

  6. Estrogen-related receptor α is required for efficient human cytomegalovirus replication

    PubMed Central

    Hwang, Jesse; Purdy, John G.; Wu, Kai; Rabinowitz, Joshua D.; Shenk, Thomas

    2014-01-01

    An shRNA-mediated screen of the 48 human nuclear receptor genes identified multiple candidates likely to influence the production of human cytomegalovirus in cultured human fibroblasts, including the estrogen-related receptor α (ERRα), an orphan nuclear receptor. The 50-kDa receptor and a 76-kDa variant were induced posttranscriptionally following infection. Genetic and pharmacological suppression of the receptor reduced viral RNA, protein, and DNA accumulation, as well as the yield of infectious progeny. In addition, RNAs encoding multiple metabolic enzymes, including enzymes sponsoring glycolysis (enolase 1, triosephosphate isomerase 1, and hexokinase 2), were reduced when the function of ERRα was inhibited in infected cells. Consistent with the effect on RNAs, a substantial number of metabolites, which are normally induced by infection, were either not increased or were increased to a reduced extent in the absence of normal ERRα activity. We conclude that ERRα is needed for the efficient production of cytomegalovirus progeny, and we propose that the nuclear receptor contributes importantly to the induction of a metabolic environment that supports optimal cytomegalovirus replication. PMID:25512541

  7. Human cytomegalovirus infection and colorectal cancer risk: a meta-analysis

    PubMed Central

    Bai, Bingjun; Wang, Xingxing; Chen, Engeng; Zhu, Hongbo

    2016-01-01

    Human cytomegalovirus infection (HCMV) has been recently considered as a factor for tumorigenesis. The current study used meta-analytical techniques to explore the prevalence of HCMV in tumor tissues and the relationship between human cytomegalovirus and colorectal cancer (CRC) risk. 11 studies detecting HCMV DNA in tumor tissues were included in meta-analysis. The prevalence rate and odds ratio (OR) were two main parameters. The overall prevalence of human cytomegalovirus DNA in tumor tissues were 27.5% (95% CI = 17.2%−37.8%). Binary logistic regression showed that the studies reported before 2010 involving formalin-fixed specimens from patients in developed region represented a lower proportion of HCMV. The tumor tissues had a significantly higher rate of virus infection compared with normal tissues (OR = 6.59, 95% CI = 4.48−9.69, I2 = 0%, P = 0.71). Subgroup analysis revealed the prevalence of the virus didn't differ in patients with different tumor stages, in tumor cells with different histologic grades, also in different kinds of specimen (polyp and adenocarcinoma). The results of current study suggested a statistically association between the virus infection and an increased risk of colorectal cancer. PMID:27732934

  8. Transformation of NIH 3T3 cells with cloned fragments of human cytomegalovirus strain AD169.

    PubMed Central

    Nelson, J A; Fleckenstein, B; Galloway, D A; McDougall, J K

    1982-01-01

    NIH 3T3 cells were transfected with restriction endonuclease and cloned human cytomegalovirus DNA fragments to identify the transforming region(s). Cleavage of human cytomegalovirus strain AD169 DNA with XbaI and HindIII left a transforming region intact whereas EcoRI inactivated this function. Transfection of cells with cosmids containing human cytomegalovirus DNA spanning the entire genome resulted in transformation by one cosmid, pCM1058, with the AD169 HindIII DNA fragments E, R, T, and a'. Cells were selected for their growth in 1.2% methylcellulose. The clones isolated had a significant replating efficiency and were oncogenic in BALB/c nu/nu mice. Transfection of cosmids and plasmids containing subsets of the viral sequences in pCM1058 identified a common region possessed by all of the transforming recombinant molecules. This region was in the HindIII E fragment with the left boundary defined by the EcoRI d-R junction and the right boundary defined by the HindIII E-T junction. Further mapping and transfection experiments determined that the transforming region was contained without a 2.9-kilobase fragment between map units 0.123 and 0.14 on the prototype molecule of the AD169 strain. Images PMID:6287019

  9. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  10. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang

    2016-01-01

    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  11. Human Cytomegalovirus Infection Enhances NK Cell Activity In Vitro

    PubMed Central

    Tschan-Plessl, Astrid; Stern, Martin; Schmied, Laurent; Retière, Christelle; Hirsch, Hans H.; Garzoni, Christian; van Delden, Christian; Boggian, Katia; Mueller, Nicolas J.; Berger, Christoph; Villard, Jean; Manuel, Oriol; Meylan, Pascal; Terszowski, Grzegorz

    2016-01-01

    Background Occurring frequently after solid organ and hematopoietic stem cell transplantation, cytomegalovirus (CMV) replication remains a relevant cause of mortality and morbidity in affected patients. Despite these adverse effects, an increased alloreactivity of natural killer (NK) cells after CMV infection has been assumed, but the underlying physiopathological mechanisms have remained elusive. Methods We used serial analyses of NK cells before and after CMV infection in kidney transplant recipients as an in vivo model for CMV primary infection to explore the imprint of CMV infection using every patient as their own control: We analyzed NK cell phenotype and function in 47 CMV seronegative recipients of CMV seropositive kidney grafts, who developed CMV primary infection posttransplant. Seronegative recipients of seronegative kidney grafts served as controls. Results We observed a significant increase of NKG2C expressing NK cells after CMV infection (mean increase, 17.5%; 95% confidence interval [95% CI], 10.2-24.9, P < 0.001), whereas cluster of differentiation (CD)57 expressing cells decreased (mean decrease, 14.1%; 95% CI, 8.0-20.2; P < 0.001). Analysis of killer immunoglobulin-like receptor (KIR) expression showed an increase of cells expressing KIR2DL1 as their only inhibitory KIR in patients carrying the cognate ligand HLA-C2 (mean increase, 10.0%; 95% CI, 1.7-18.3; P = 0.018). In C2-negative individuals, KIR2DL1 expression decreased (mean decrease, 3.9%; 95% CI, 1.6-6.2; P = 0.001). As for activating KIR, there was no conclusive change pattern. Most importantly, we observed a significantly higher NK cell degranulation and IFNγ production in response to different target cells (target K562, CD107a: mean increase, 9.9%; 95% CI, 4.8-15.0; P < 0.001; IFNγ: mean increase, 6.6%; 95% CI, 1.6-11.1; P < 0.001; target MRC-5, CD107a: mean increase, 6.9%; 95% CI, 0.7-13.1; P = 0.03; IFNγ: mean increase, 4.8%; 95% CI, 1.7-7.8; P = 0.002). Conclusions We report

  12. Examination of brains of AIDS cases for human immunodeficiency virus and human cytomegalovirus nucleic acids.

    PubMed Central

    Walker, D G; Itagaki, S; Berry, K; McGeer, P L

    1989-01-01

    The role of direct virus infection as a determining factor in acquired immunodeficiency syndrome (AIDS) dementia was investigated using in situ hybridisation for human immunodeficiency virus (HIV) and human cytomegalovirus (HCMV). Four of the five AIDS dementia patients in this series demonstrated HIV infected cells distributed in widely different parts of the brain, but only one case showed HCMV infected cells. The greater abundance of HIV was in subcortical white matter in nodular areas consisting of monocyte/macrophage infiltrates. The cells were occasionally arranged as a multinucleated syncitium. In two cases, a few large cells with the appearance of neurons were positive for HIV hybridisation. By appropriate treatment with ribonuclease, it was shown that hybridisation was primarily to HIV RNA. HCMV infected cells were observed in small numbers in only one of the positive cases, suggesting that HCMV is not a determining factor in AIDS dementia. HCMV positive cells were located in the grey matter, with an appearance suggestive of neurons. Cells expressing the MHC-class II antigen HLA-DR, a marker of reactive microglia and macrophages, were observed to be extensive in affected brain sections in the one case examined. These cells were present in greater number than HIV infected cells. In this case, extensive numbers of HIV infected cells were noticed along the peripheral margin of the substantia innominata. This could indicate infection in this case of a critical brain region from the cerebrospinal fluid. Images PMID:2543795

  13. Detection of Human Cytomegalovirus and Epstein-Barr Virus in Coronary Atherosclerotic Tissue

    PubMed Central

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-01-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples. PMID:24031529

  14. The DNA damage response induced by infection with human cytomegalovirus and other viruses.

    PubMed

    Xiaofei, E; Kowalik, Timothy F

    2014-05-23

    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  15. Clinical and biologic aspects of human cytomegalovirus resistance to antiviral drugs.

    PubMed

    Baldanti, Fausto; Lurain, Nell; Gerna, Giuseppe

    2004-05-01

    The emergence of human cytomegalovirus (HCMV) drug resistant strains is a life-threatening condition in immunocompromised individuals with active HCMV infection. HCMV drug resistance represented a major problem in patients with acquired immunodeficiency syndrome until the recent introduction of highly active antiretroviral combination therapy, which dramatically decreased the incidence in this clinical setting. However, HCMV resistance to antiviral drugs is now an emerging problem in the transplantation setting. The molecular mechanisms of HCMV drug resistance have been elucidated and rely on the selection during treatment of HCMV strains harboring mutations in two key viral genes: UL97 coding for a viral phosphotransferase and UL54 coding for the viral DNA polymerase.

  16. Human cytomegalovirus resistance to antiviral drugs: diagnosis, monitoring and clinical impact.

    PubMed

    Baldanti, Fausto; Gerna, Giuseppe

    2003-09-01

    The incidence of human cytomegalovirus (HCMV) disease in AIDS patients decreased dramatically after the introduction, a few years ago, of highly active antiretroviral combination therapy. As a consequence, the emergence of drug-resistant HCMV strains is no longer a major problem in HIV-infected individuals. However, HCMV resistance to antiviral drugs is presently recognized as an emerging problem in transplantation settings. The mechanisms of HCMV drug resistance will be analysed along with the clinical features relevant to the emergence of drug-resistant HCMV strains during antiviral treatment of patients receiving either solid organ or haematopoietic stem cell transplantation.

  17. Severe Thrombocytopenia and Acute Cytomegalovirus Colitis during Primary Human Immunodeficiency Virus Infection

    PubMed Central

    Furuhata, Masanori; Yanagisawa, Naoki; Nishiki, Shingo; Sasaki, Shugo; Suganuma, Akihiko; Imamura, Akifumi; Ajisawa, Atsushi

    2016-01-01

    We herein report the case of a 25-year-old man who was referred to our hospital due to acute cytomegalovirus (CMV) colitis. The initial blood tests showed that the patient had concurrent primary human immunodeficiency virus (HIV) infection and severe thrombocytopenia. Raltegravir-based antiretroviral therapy (ART) was initiated without the use of ganciclovir or corticosteroids and resulted in a rapid clinical improvement. Platelet transfusions were only necessary for a short period, and subsequent colonoscopy revealed a completely healed ulcer. This case implies that ART alone could be effective for treating severe thrombocytopenia during primary HIV and CMV coinfection. PMID:27980271

  18. Sequestration of human cytomegalovirus by human renal and mammary epithelial cells

    SciTech Connect

    Twite, Nicolas; Andrei, Graciela; Kummert, Caroline; Donner, Catherine; Perez-Morga, David; De Vos, Rita; Snoeck, Robert; Marchant, Arnaud

    2014-07-15

    Urine and breast milk represent the main routes of human cytomegalovirus (HCMV) transmission but the contribution of renal and mammary epithelial cells to viral excretion remains unclear. We observed that kidney and mammary epithelial cells were permissive to HCMV infection and expressed immediate early, early and late antigens within 72 h of infection. During the first 24 h after infection, high titers of infectious virus were measured associated to the cells and in culture supernatants, independently of de novo synthesis of virus progeny. This phenomenon was not observed in HCMV-infected fibroblasts and suggested the sequestration and the release of HCMV by epithelial cells. This hypothesis was supported by confocal and electron microscopy analyses. The sequestration and progressive release of HCMV by kidney and mammary epithelial cells may play an important role in the excretion of the virus in urine and breast milk and may thereby contribute to HCMV transmission. - Highlights: • Primary renal and mammary epithelial cells are permissive to HCMV infection. • HCMV is sequestered by epithelial cells and this phenomenon does not require viral replication. • HCMV sequestration by epithelial cells is reduced by antibodies and IFN-γ.

  19. Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains.

    PubMed Central

    Stenberg, R M; Fortney, J; Barlow, S W; Magrane, B P; Nelson, J A; Ghazal, P

    1990-01-01

    trans activation of promoters by viral regulatory proteins provides a useful tool to study coordinate control of gene expression. Immediate-early (IE) regions 1 and 2 of human cytomegalovirus (CMV) code for a series of proteins that originate from differentially spliced mRNAs. These IE proteins are proposed to regulate the temporal expression of the viral genome. To examine the structure and function of the IE proteins, we used linker insertion mutagenesis of the IE gene region as well as cDNA expression vector cloning of the abundant IE mRNAs. We showed that IE1 and IE2 proteins of CMV exhibit promoter-specific differences in their modes of action by either trans activating early and IE promoters or repressing the major IE promoter (MIEP). Transient cotransfection experiments with permissive human cells revealed a synergistic interaction between the 72- and the 86-kilodalton (kDa) IE proteins in trans activating an early promoter. In addition, transfection studies revealed that the 72-kDa protein was capable of trans activating the MIEP. In contrast, the 86-kDa protein specifically repressed the MIEP and this repression was suppressed by the 72-kDa protein. Furthermore, observations based on the primary sequence structure revealed a modular arrangement of putative regulatory motifs that could either potentiate or repress gene expression. These modular domains are either shared or unique among the IE proteins. From these data, we propose a model for IE protein function in the coordinate control of CMV gene expression. Images PMID:2157043

  20. A Small Covalent Allosteric Inhibitor of Human Cytomegalovirus DNA Polymerase Subunit Interactions.

    PubMed

    Chen, Han; Coseno, Molly; Ficarro, Scott B; Mansueto, My Sam; Komazin-Meredith, Gloria; Boissel, Sandrine; Filman, David J; Marto, Jarrod A; Hogle, James M; Coen, Donald M

    2017-02-10

    Human cytomegalovirus DNA polymerase comprises a catalytic subunit, UL54, and an accessory subunit, UL44, the interaction of which may serve as a target for the development of new antiviral drugs. Using a high-throughput screen, we identified a small molecule, (5-((dimethylamino)methylene-3-(methylthio)-6,7-dihydrobenzo[c]thiophen-4(5H)-one), that selectively inhibits the interaction of UL44 with a UL54-derived peptide in a time-dependent manner, full-length UL54, and UL44-dependent long-chain DNA synthesis. A crystal structure of the compound bound to UL44 revealed a covalent reaction with lysine residue 60 and additional noncovalent interactions that cause steric conflicts that would prevent the UL44 connector loop from interacting with UL54. Analyses of the reaction of the compound with model substrates supported a resonance-stabilized conjugation mechanism, and substitution of the lysine reduced the ability of the compound to inhibit UL44-UL54 peptide interactions. This novel covalent inhibitor of polymerase subunit interactions may serve as a starting point for new, needed drugs to treat human cytomegalovirus infections.

  1. Presence of antibodies to human cytomegalovirus in patients with different forms of cancer and in other categories of subjects.

    PubMed

    Stoian, M; Hozoc, M; Iosipenco, M; Bolocan, J; Nastac, E

    1982-01-01

    Complement fixing (CF) antibodies to the AD--129 strain of human cytomegalovirus (HCMV) were detected in patients with different forms of cancer, as well as in blood donors, in a proportion of 16.6% and 73.2%, respectively. The prevalence of CF antibodies to HCMV, strain AT--129, in the population of Romania is similar to that reported in other countries.

  2. Partial Functional Complementation between Human and Mouse Cytomegalovirus Chemokine Receptor Homologues▿

    PubMed Central

    Farrell, Helen E.; Abraham, Alexander M.; Cardin, Rhonda D.; Sparre-Ulrich, Alexander H.; Rosenkilde, Mette M.; Spiess, Katja; Jensen, Tine H.; Kledal, Thomas N.; Davis-Poynter, Nicholas

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-mediated G protein-coupled signaling is critical for the salivary gland phenotype. In this report, we demonstrate that US28 and (to a lesser degree) UL33 restore reactivation from tissue explants and partially restore replication in salivary glands (compared to a signaling-deficient M33 mutant). These studies provide a novel small animal model for evaluation of therapies targeting the human CMV CKRs. PMID:21490099

  3. [Possible role of cytomegalovirus infection in the pathogenesis of human vascular diseases].

    PubMed

    Yonemitsu, Y; Komori, K; Sueishi, K; Sugimachi, K

    1998-01-01

    In order to evaluate the pathogenic role of human cytomegalovirus(CMV) infection in human vascular disease, we first examined the role of CMV immediate early gene (CMV-IE) expression in vascular smooth muscle cell (VSMC) proliferation. The in vitro IE gene transfer stimulated VSMC proliferation. The in vivo IE gene transfer showed neointimal thickening while the control arteries did not. In the wall of "so-called" inflammatory abdominal aortic aneurysm (IAAA), CMV infected cells were more frequently encountered than in that of AA and control cases. CMV infected cells were largely identified as macrophages or fibroblasts, and these cells frequently expressed CMV-IE gene. These findings thus suggest that the persistent expression of CMV-IE gene in the vessel wall may play a role in the vascular cellular responses, including progression of atherosclerosis or vasculitis, in vivo.

  4. Inhibition of ganciclovir-resistant human cytomegalovirus replication by Kampo (Japanese herbal medicine).

    PubMed

    Murayama, Tsugiya; Yamaguchi, Nobuo; Iwamoto, Kozo; Eizuru, Yoshito

    2006-01-01

    We examined the effect of Kampo on the replication of ganciclovir (GCV)-resistant human cytomegalovirus (HCMV) in the human embryonic fibroblast cell line MRC-5. Treatment of HCMV-infected cells with Sho-seiryu-to (SST; Xiao-Qing-Long-Tang in Chinese) resulted in the inhibition of viral replication without affecting the cell growth. SST treatment decreased the synthesis of viral DNA, but had no virucidal effect on cell-free HCMV. However, the inhibitory effect of SST on HCMV replication was ablated by anti-interferon-beta (IFN-beta) antibody suggesting that SST inhibits the replication of GCV-resistant HCMV through the induction of IFN-beta. These results suggest that SST is a novel compund with potential as an anti-HCMV.

  5. Characteristics and functions of human cytomegalovirus UL128 gene/protein.

    PubMed

    Tao, R; Xu, J; Gao, H -H; Zhao, W -T; Shang, S -Q

    2014-01-01

    Human cytomegalovirus (HCMV) ORF UL128 protein is highly conserved among viral field isolates and functions in two different molecular forms, monomeric UL128 protein and in a complex with glycoproteins gH, gL, UL130, and UL131A protein. Monomeric UL128 protein works as soluble chemokine analogue to attract peripheral blood mononuclear cells (PBMCs) and selectively induces expression of interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α) in PBMCs. The gH/gL/UL128/UL130/UL131A complex is indispensable for entry into both endothelial and epithelial cells. In conclusion, UL128 plays an important role in HCMV infection.

  6. Evaluating Human T-Cell Therapy of Cytomegalovirus Organ Disease in HLA-Transgenic Mice

    PubMed Central

    Thomas, Simone; Klobuch, Sebastian; Podlech, Jürgen; Plachter, Bodo; Hoffmann, Petra; Renzaho, Angelique; Theobald, Matthias

    2015-01-01

    Reactivation of human cytomegalovirus (HCMV) can cause severe disease in recipients of hematopoietic stem cell transplantation. Although preclinical research in murine models as well as clinical trials have provided 'proof of concept' for infection control by pre-emptive CD8 T-cell immunotherapy, there exists no predictive model to experimentally evaluate parameters that determine antiviral efficacy of human T cells in terms of virus control in functional organs, prevention of organ disease, and host survival benefit. We here introduce a novel mouse model for testing HCMV epitope-specific human T cells. The HCMV UL83/pp65-derived NLV-peptide was presented by transgenic HLA-A2.1 in the context of a lethal infection of NOD/SCID/IL-2rg-/- mice with a chimeric murine CMV, mCMV-NLV. Scenarios of HCMV-seropositive and -seronegative human T-cell donors were modeled by testing peptide-restimulated and T-cell receptor-transduced human T cells, respectively. Upon transfer, the T cells infiltrated host tissues in an epitope-specific manner, confining the infection to nodular inflammatory foci. This resulted in a significant reduction of viral load, diminished organ pathology, and prolonged survival. The model has thus proven its potential for a preclinical testing of the protective antiviral efficacy of HCMV epitope-specific human T cells in the evaluation of new approaches to an immunotherapy of CMV disease. PMID:26181057

  7. Murine Cytomegalovirus Abortively Infects Human Dendritic Cells, Leading to Expression and Presentation of Virally Vectored Genes

    PubMed Central

    Wang, Xiuqing; Messerle, Martin; Sapinoro, Ramil; Santos, Kathlyn; Hocknell, Peter K.; Jin, Xia; Dewhurst, Stephen

    2003-01-01

    Dendritic cells (DC) are potent antigen-presenting cells that play a crucial role in antigen-specific immune responses. Thus, the targeting of exogenous antigens to DC has become a popular approach for cancer immunotherapy and vaccine development. In this report, we studied the interplay between murine cytomegalovirus (MCMV) and human monocyte-derived DC. The results showed that an enhanced green fluorescent protein (EGFP)-encoding, replication-competent MCMV vector underwent abortive infection in human DC; this was accompanied by the efficient expression of EGFP. Infection of human DC by this vector resulted in a modest increase in the expression of cell surface proteins associated with DC maturation and has no significant effect on the immunostimulatory function of the cells, as reflected by their ability to support T-cell proliferation in a mixed-lymphocyte reaction. Finally, an MCMV vector encoding the human immunodeficiency virus type 1 (HIV-1) gp120 envelope glycoprotein was constructed and used to infect cultured human DC. The infected DC were shown to be capable of stimulating the expansion of autologous, gp120-specific, class I-restricted T lymphocytes from an HIV-1-negative donor, as determined by tetramer staining and enzyme-linked immunospot analysis. Taken together, these results suggest that MCMV may have potential utility as a vector for human vaccine development. PMID:12805417

  8. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands.

  9. Cytomegalovirus Survival and Transferability and the Effectiveness of Common Hand-Washing Agents against Cytomegalovirus on Live Human Hands

    PubMed Central

    Stowell, Jennifer D.; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L.; Dollard, Sheila C.; Bialek, Stephanie R.; Cannon, Michael J.

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 105 infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands. PMID:24185855

  10. Human cytomegalovirus and mucoepidermoid carcinoma of salivary glands: cell-specific localization of active viral and oncogenic signaling proteins is confirmatory of a causal relationship.

    PubMed

    Melnick, Michael; Sedghizadeh, Parish P; Allen, Carl M; Jaskoll, Tina

    2012-02-01

    Human cytomegalovirus (hCMV) infection is common. Although still controversial, there is growing evidence that active hCMV infection is associated with a variety of malignancies, including brain, breast, lung, colon, and prostate. Given that hCMV is frequently resident in salivary gland (SG) ductal epithelium, we hypothesized that hCMV would be important to the pathogenesis of SG mucoepidermoid carcinoma (MEC). This was initially supported by our finding that purified CMV induces malignant transformation in SG cells in an in vitro mouse model, and utilizes a pathogenic pathway previously reported for human MEC. Here we present the histologic and molecular characterizations of 39 human SG MECs selected randomly from a repository of cases spanning 2004-2011. Serial sections were obtained from formalin-fixed, paraffin embedded, tissue blocks from previous incisional or excisional biopsies. Immunohistochemical assays were performed for active hCMV proteins (IE1 and pp65) and the activated COX/AREG/EGFR/ERK signaling pathway. All four prospective causal criteria for viruses and cancer are fully satisfied: (1) protein markers for active hCMV are present in 97% of MECs; (2) markers of active hCMV are absent in non-neoplastic SG tissues; (3) hCMV-specific proteins (IE1, pp65) are in specific cell types and expression is positively correlated with severity; (4) hCMV correlates and colocalizes with an upregulation and activation of an established oncogenic signaling pathway (COX/AREG/EGFR/ERK). Thus, the evidential support reported here and previously in a mouse model is strongly confirmatory of a causal relationship between hCMV and SG mucoepidermoid carcinoma. To our knowledge, this is the first demonstration of hCMV's role in human oncogenesis that fully responds to all of Koch's Postulates as revised for viruses and cancer. In the absence of any contrary evidence, hCMV can reasonably be designated an "oncovirus."

  11. Interactions between human immunodeficiency virus type 1 and human cytomegalovirus in human term syncytiotrophoblast cells coinfected with both viruses.

    PubMed Central

    Tóth, F D; Mosborg-Petersen, P; Kiss, J; Aboagye-Mathiesen, G; Hager, H; Juhl, C B; Gergely, L; Zdravkovic, M; Aranyosi, J; Lampé, L

    1995-01-01

    Human cytomegalovirus (HCMV) and human immunodeficiency virus type 1 (HIV-1) may interact in the pathogenesis of AIDS. The placental syncytiotrophoblast layer serves as the first line of defense of the fetus against viruses. We analyzed the patterns of replication of HIV-1 and HCMV in singly an dually infected human term syncytiotrophoblast cells cultured in vitro. Syncytiotrophoblast cells exhibited restricted permissiveness for HIV-1, while HCMV replication was restricted at the level of immediate-early and early gene products in the singly infected cells. We found that the syncytiotrophoblasts as an overlapping cell population could be coinfected with HIV-1 and HCMV. HIV-1 replication was markedly upregulated by previous or simultaneous infection of the cells with HCMV, whereas prior HIV-1 infection of the cells converted HCMV infection from a nonpermissive to a permissive one. No simultaneous enhancement of HCMV and HIV-1 expression was observed in the dually infected cell cultures. Major immediate-early proteins of HCMV were necessary for enhancement of HIV-1 replication, and interleukin-6 production induced by HCMV and further increased by replicating HIV-1 synergized with these proteins to produce this effect. Permissive replication cycle of HCMV was induced by the HIV-1 tat gene product. We were unable to detect HIV-1 (HCMV) or HCMV (HIV-1) pseudotypes in supernatant fluids from dually infected cell cultures. Our results suggest that interactions between HIV-1 and HCMV in coinfected syncytiotrophoblast cells may contribute to the transplacental transmission of both viruses. PMID:7884869

  12. Enhanced cytomegalovirus infection in human trabecular meshwork cells and its implication in glaucoma pathogenesis

    PubMed Central

    Choi, Jin A; Kim, Ju-Eun; Noh, Seung-Jun; Kyoung Kim, Eun; Park, Chan Kee; Paik, Soon-Young

    2017-01-01

    Cytomegalovirus (CMV) is one of the infectious causes of hypertensive anterior uveitis, which is characterized by recurrent episodes of elevated intraocular pressure (IOP) and mild anterior uveitis. Despite the potentially vision-threatening complications of this disease, the underlying mechanisms remain largely undefined. We aimed to investigate whether human trabecular meshwork (TM) cells, the key cell type that regulates IOP, could support CMV replication, as well as demonstrate the relevant pathological changes in TM. When human TM cells were infected with CMV AD169, immediate early antigens were detected 1 day post-infection (dpi); cytopathic changes including rounding, a ballooned appearance with disorganization, and a decreased number of stress fibers were noted in TM cells. The marked increase in viral DNA accumulation was observed most notably at 5 and 7 dpi, suggesting that the active viral infection in human TM cells could be the key mechanism underlying the elevation of IOP in anterior viral uveitis. Notably, CMV infection enhanced the production of transforming growth factor (TGF)-β1, an upstream molecule that increases the resistance of the outflow pathway in human TM cells. The increase of TGF-β1 was countervailed by additional treatment with corticosteroids. Our results provide a pathogenic mechanism for IOP elevation in viral anterior uveitis. PMID:28240260

  13. Open reading frame UL26 of human cytomegalovirus encodes a novel tegument protein that contains a strong transcriptional activation domain.

    PubMed

    Stamminger, Thomas; Gstaiger, Matthias; Weinzierl, Konstanze; Lorz, Kerstin; Winkler, Michael; Schaffner, Walter

    2002-05-01

    A selection strategy, the activator trap, was used in order to identify genes of human cytomegalovirus (HCMV) that encode strong transcriptional activation domains in mammalian cells. This approach is based on the isolation of activation domains from a GAL4 fusion library by means of selective plasmid replication, which is mediated in transfected cells by a GAL4-inducible T antigen gene. With this screening strategy, we were able to isolate two types of plasmids encoding transactivating fusion proteins from a library of random HCMV DNA inserts. One plasmid contained the exon 3 of the HCMV IE-1/2 gene region, which has previously been identified as a strong transcriptional activation domain. In the second type of plasmid, the open reading frame (ORF) UL26 of HCMV was fused to the GAL4 DNA-binding domain. By quantitative RNA mapping using S1 nuclease analysis, we were able to classify UL26 as a strong enhancer-type activation domain with no apparent homology to characterized transcriptional activators. Western blot analysis with a specific polyclonal antibody raised against a prokaryotic UL26 fusion protein revealed that two protein isoforms of 21 and 27 kDa are derived from the UL26 ORF in both infected and transfected cells. Both protein isoforms, which arise via alternative usage of two in-frame translational start codons, showed a nuclear localization and could be detected as early as 6 h after infection of primary human fibroblasts. By performing Western blot analysis with purified virions combined with fractionation experiments, we provide evidence that pUL26 is a novel tegument protein of HCMV that is imported during viral infection. Furthermore, we observed transactivation of the HCMV major immediate-early enhancer-promoter by pUL26, whereas several early and late promoters were not affected. Our data suggest that pUL26 is a novel tegument protein of HCMV with a strong transcriptional activation domain that could play an important role during initiation of

  14. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication.

    PubMed

    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanpin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang

    2016-06-01

    The interplay between the host and Human cytomegalovirus (HCMV) plays a pivotal role in the outcome of an infection. HCMV growth in endothelial and epithelial cells requires expression of viral proteins UL128, UL130, and UL131 proteins (UL128-131), of which UL130 is the largest gene and the only one that is not interrupted by introns.Mutation of the C terminus of the UL130 protein causes reduced tropism of endothelial cells (EC). However, very few host factors have been identified that interact with the UL130 protein. In this study, HCMV UL130 protein was shown to directly interact with the human protein Snapin in human embryonic kidney HEK293 cells by Yeast two-hybrid screening, in vitro glutathione S-transferase (GST) pull-down, and co-immunoprecipitation. Additionally, heterologous expression of protein UL130 revealed co-localization with Snapin in the cell membrane and cytoplasm of HEK293 cells using fluorescence confocal microscopy. Furthermore, decreasing the level of Snapin via specific small interfering RNAs decreased the number of viral DNA copies and titer inHCMV-infected U373-S cells. Taken together, these results suggest that Snapin, the pUL130 interacting protein, has a role in modulating HCMV DNA synthesis.

  15. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    PubMed Central

    Krömmelbein, Natascha; Wiebusch, Lüder; Schiedner, Gudrun; Büscher, Nicole; Sauer, Caroline; Florin, Luise; Sehn, Elisabeth; Wolfrum, Uwe; Plachter, Bodo

    2016-01-01

    The human cytomegalovirus (HCMV) replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP) is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production. PMID:26848680

  16. Protein-Protein Interactions Suggest Novel Activities of Human Cytomegalovirus Tegument Protein pUL103

    PubMed Central

    Ortiz, Daniel A.; Glassbrook, James E.

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is an enveloped double-stranded DNA virus that causes severe disease in newborns and immunocompromised patients. During infection, the host cell endosecretory system is remodeled to form the cytoplasmic virion assembly complex (cVAC). We and others previously identified the conserved, multifunctional HCMV virion tegument protein pUL103 as important for cVAC biogenesis and efficient secondary envelopment. To help define its mechanisms of action and predict additional functions, we used two complementary methods, coimmunoprecipitation (co-IP) and proximity biotinylation (BioID), to identify viral and cellular proteins that interact with pUL103. By using the two methods in parallel and applying stringent selection criteria, we identified potentially high-value interactions of pUL103 with 13 HCMV and 18 cellular proteins. Detection of the previously identified pUL103-pUL71 interaction, as well as verification of several interactions by reverse co-IP, supports the specificity of our screening process. As might be expected for a tegument protein, interactions were identified that suggest distinct roles for pUL103 across the arc of lytic infection, including interactions with proteins involved in cellular antiviral responses, nuclear activities, and biogenesis and transport of cytoplasmic vesicles. Further analysis of some of these interactions expands our understanding of the multifunctional repertoire of pUL103: we detected HCMV pUL103 in nuclei of infected cells and identified an ALIX-binding domain within the pUL103 sequence. IMPORTANCE Human cytomegalovirus (HCMV) is able to reconfigure the host cell machinery to establish a virion production factory, the cytoplasmic virion assembly complex (cVAC). cVAC biogenesis and operation represent targets for development of novel HCMV antivirals. We previously showed that the HCMV tegument protein pUL103 is required for cVAC biogenesis. Using pUL103 as bait, we investigated viral and

  17. Kissing as an evolutionary adaptation to protect against Human Cytomegalovirus-like teratogenesis.

    PubMed

    Hendrie, C A; Brewer, G

    2010-02-01

    Mouth to mouth sexual kissing is seen in more than 90% of human cultures. Various theories have been put forward to account for this but none offer a full explanation within an evolutionary framework. As mouth to mouth sexual kissing exposes each participant to the diseases of the other, it must confer significant benefit. Human Cytomegalovirus (HCMV) is a ubiquitous infection that carries a severe teratogenic risk if primary infection is acquired during certain critical periods. As HCMV is present in salivary gland epithelial cells and sheds from periodontitis induced lesions, female inoculation with a specific male's HCMV is most efficiently achieved through mouth to mouth contact and saliva exchange, particularly where the flow of saliva is from the male to the typically shorter female. The current hypothesis proposes that mouth to mouth sexual kissing enables females to control when they become infected with a particular male's HCMV and so protect their offspring from the threat of teratogenesis from primary infection during vulnerable times in their development. Females only gain this benefit if they also avoid becoming infected by other males. Hence HCMV induced teratogenesis is a strong viral pressure towards the development of monogamy as well as kissing as a behavioural strategy to protect against it.

  18. Induction of Pluripotent Protective Immunity Following Immunisation with a Chimeric Vaccine against Human Cytomegalovirus

    PubMed Central

    Zhong, Jie; Rist, Michael; Cooper, Leanne; Smith, Corey; Khanna, Rajiv

    2008-01-01

    Based on the life-time cost to the health care system, the Institute of Medicine has assigned the highest priority for a vaccine to control human cytomegalovirus (HCMV) disease in transplant patients and new born babies. In spite of numerous attempts successful licensure of a HCMV vaccine formulation remains elusive. Here we have developed a novel chimeric vaccine strategy based on a replication-deficient adenovirus which encodes the extracellular domain of gB protein and multiple HLA class I & II-restricted CTL epitopes from HCMV as a contiguous polypeptide. Immunisation with this chimeric vaccine consistently generated strong HCMV-specific CD8+ and CD4+ T-cells which co-expressed IFN-γ and TNF-α, while the humoral response induced by this vaccine showed strong virus neutralizing capacity. More importantly, immunization with adenoviral chimeric vaccine also afforded protection against challenge with recombinant vaccinia virus encoding HCMV antigens and this protection was associated with the induction of a pluripotent antigen-specific cellular and antibody response. Furthermore, in vitro stimulation with this adenoviral chimeric vaccine rapidly expanded multiple antigen-specific human CD8+ and CD4+ T-cells from healthy virus carriers. These studies demonstrate that the adenovirus chimeric HCMV vaccine provides an excellent platform for reconstituting protective immunity to prevent HCMV diseases in different clinical settings. PMID:18806877

  19. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway

    PubMed Central

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit

    2016-01-01

    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication. PMID:26830977

  20. Roles of host and viral microRNAs in human cytomegalovirus biology

    PubMed Central

    Dhuruvasan, Kavitha; Sivasubramanian, Geetha; Pellett, Philip E.

    2011-01-01

    Human cytomegalovirus (HCMV) has a relatively large and complex genome, a protracted lytic replication cycle, and employs a strategy of replicational latency as part of its lifelong persistence in the infected host. An important form of gene regulation in plants and animals revolves around a type of small RNA known as microRNA (miRNA). miRNAs can serve as major regulators of key developmental pathways, as well as provide subtle forms of regulatory control. The human genome encodes over 900 miRNAs, and miRNAs are also encoded by some viruses, including HCMV, which encodes at least 14 miRNAs. Some of the HCMV miRNAs are known to target both viral and cellular genes, including important immunomodulators. In addition to expressing their own miRNAs, infections with some viruses, including HCMV, can result in changes in the expression of cellular miRNAs that benefit virus replication. In this review, we summarize the connections between miRNAs and HCMV biology. We describe the nature of miRNA genes, miRNA biogenesis and modes of action, methods for studying miRNAs, HCMV-encoded miRNAs, effects of HCMV infection on cellular miRNA expression, roles of miRNAs in HCMV biology, and possible HCMV-related diagnostic and therapeutic applications of miRNAs. PMID:20969901

  1. Occupational trichloroethylene hypersensitivity syndrome with human herpesvirus-6 and cytomegalovirus reactivation.

    PubMed

    Watanabe, Hideaki; Tohyama, Mikiko; Kamijima, Michihiro; Nakajima, Tamie; Yoshida, Takemi; Hashimoto, Koji; Iijima, Masafumi

    2010-08-01

    Patients having a generalised rash with severe liver dysfunction associated with exposure to trichloroethylene (TCE) have been reported mainly in Asian countries. However, no case has been reported in Japan since the 1990s. Here, we describe a case of hypersensitivity syndrome (HS) caused by TCE in a 30-year-old Japanese man. The patient developed a rash, fever and liver dysfunction 21 days after he had been exposed to TCE at his workplace. Serum human herpesvirus (HHV)-6 and cytomegalovirus (CMV) DNA were detected 4 and 7 weeks, respectively, after the onset; the IgG antibody titres to HHV-6 and CMV were significantly elevated 6 and 9 weeks, respectively, after the onset. Patch testing was positive for the metabolites of TCE (i.e. trichloroethanol, trichloroacetic acid and chloral hydrate) but not for TCE itself; these results suggest that the TCE metabolites induced this disease. Human leucocyte antigen-B*1301, which has been reported to be strongly associated with TCE-induced HS, was identified in this patient. In addition, the clinical findings, laboratory data and period of virus reactivation after onset were quite similar to those of drug-induced hypersensitivity syndrome (DIHS). We also review TCE-induced HS from the viewpoint of the similarity to DIHS in this article.

  2. Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

    NASA Astrophysics Data System (ADS)

    Gaspar, Miguel; Shenk, Thomas

    2006-02-01

    The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway

  3. ACSS2-mediated acetyl-CoA synthesis from acetate is necessary for human cytomegalovirus infection.

    PubMed

    Vysochan, Anna; Sengupta, Arjun; Weljie, Aalim M; Alwine, James C; Yu, Yongjun

    2017-02-21

    Recent studies have shown that human cytomegalovirus (HCMV) can induce a robust increase in lipid synthesis which is critical for the success of infection. In mammalian cells the central precursor for lipid biosynthesis, cytosolic acetyl CoA (Ac-CoA), is produced by ATP-citrate lyase (ACLY) from mitochondria-derived citrate or by acetyl-CoA synthetase short-chain family member 2 (ACSS2) from acetate. It has been reported that ACLY is the primary enzyme involved in making cytosolic Ac-CoA in cells with abundant nutrients. However, using CRISPR/Cas9 technology, we have shown that ACLY is not essential for HCMV growth and virally induced lipogenesis. Instead, we found that in HCMV-infected cells glucose carbon can be used for lipid synthesis by both ACLY and ACSS2 reactions. Further, the ACSS2 reaction can compensate for the loss of ACLY. However, in ACSS2-KO human fibroblasts both HCMV-induced lipogenesis from glucose and viral growth were sharply reduced. This reduction suggests that glucose-derived acetate is being used to synthesize cytosolic Ac-CoA by ACSS2. Previous studies have not established a mechanism for the production of acetate directly from glucose metabolism. Here we show that HCMV-infected cells produce more glucose-derived pyruvate, which can be converted to acetate through a nonenzymatic mechanism.

  4. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway.

    PubMed

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit

    2016-02-02

    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication.

  5. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades.

    PubMed

    Stangherlin, Lucas Matheus; Castro, Fabiane Lucy Ferreira; Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; Dos Santos, Claudia Januário; Carlan Silva, Maria Cristina

    2016-01-01

    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties.

  6. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades

    PubMed Central

    Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; dos Santos, Claudia Januário; Carlan Silva, Maria Cristina

    2016-01-01

    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties. PMID:27458810

  7. Inhibition of UL54 and UL97 genes of human cytomegalovirus by RNA interference.

    PubMed

    Shin, M-C; Hong, S-K; Yoon, J-S; Park, S-S; Lee, S-G; Lee, D-G; Min, W-S; Shin, W-S; Paik, S-Y

    2006-01-01

    Short interfering RNAs (siRNAs), namely siUL54-1 and siU54-2 targeting UL54 (DNA polymerase) gene, and siUL97-1 and siUL97-2 targeting UL97 (phosphotransferase) gene, were used to inhibit respective genes of Human cytomegalovirus (HCMV) and consequently the virus infection process in human foreskin fibroblast (HFF) cultures. The virus infection was monitored by cell morphology (CPE), levels of UL83 and IE86 mRNAs, and virus antigen. The results showed that siUL97-2 remarkably inhibited viral CPE while other siRNAs were less inhibitory. The siRNAs reduced the levels of UL83 mRNA but not that of IE86 mRNA; again, siUL97-2 was most inhibitory. Particularly, siUL97-2 reduced the UL83 mRNA level 14, 19, 203, and 37 times at 24, 48, 72, and 96 hrs post infection (p.i.), respectively. When tested for the effect on viral antigen by immunofluorescent assay (IFA), UL97-2 exerted a marked inhibition. These results demonstrate the effectiveness of siRNAs against experimental HCMV infection and indicate their therapeutic potential.

  8. Upregulation of functionally active vascular endothelial growth factor by human cytomegalovirus.

    PubMed

    Reinhardt, Barbara; Schaarschmidt, Peter; Bossert, Andrea; Lüske, Anke; Finkenzeller, Günter; Mertens, Thomas; Michel, Detlef

    2005-01-01

    Human cytomegalovirus (HCMV) infection is known to modulate host gene expression and has been linked to the pathogenesis of vasculopathies; however, relevant pathomechanisms are still unclear. It was shown that HCMV infection leads to upregulation of vascular endothelial growth factor (VEGF) expression in human foreskin fibroblasts and coronary artery smooth muscle cells (SMC). Activation of VEGF transcription by HCMV infection was confirmed by transient-expression experiments, which revealed that a short promoter fragment, pLuc135 (-85 to +50), is sufficient for activation. Site-directed mutagenesis of Sp1-recognition sites within this fragment abolished the upregulation of transcription. Functional VEGF protein is released into the culture supernatant of infected SMC. Incubation of endothelial cells with supernatants from HCMV-infected SMC cultures induced upregulation of VEGF receptor-2 expression on endothelial cells, as well as a significant upregulation of DNA synthesis, implicating cell proliferation. The mean incline of DNA synthesis at 48 and 72 h post-infection was 148 and 197 %, respectively. Addition of neutralizing antibodies against VEGF completely abolished this effect. Supernatants from SMC cultures incubated with UV-inactivated virus induced a comparable effect. This virus-induced paracrine effect may represent a molecular mechanism for HCMV-induced pathogenesis, such as inflammatory vasculopathies, by inducing a proatherogenic phenotype in SMC.

  9. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  10. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  11. Human cytomegalovirus infection downregulates vitamin-D receptor in mammalian cells.

    PubMed

    Rieder, Franz J J; Gröschel, Charlotte; Kastner, Marie-Theres; Kosulin, Karin; Laengle, Johannes; Zadnikar, Rene; Marculescu, Rodrig; Schneider, Martina; Lion, Thomas; Bergmann, Michael; Kallay, Enikö; Steininger, Christoph

    2017-01-01

    Vitamin D (VD) is essential for the human body and involved in a wide variety of critical physiological processes including bone, muscle, and cardiovascular health, as well as innate immunity and antimicrobial responses. Here, we elucidated the significance of the VD system in cytomegalovirus (CMV) infection, which is one of the most common opportunistic infections in immunocompromised or -suppressed patients. We found that expression of vitamin D receptor (VDR) was downregulated in CMV-infected cells within 12h [hrs] post infection [p.i.] to 12% relative to VDR expression in mock-infected fibroblasts and did not recover during the CMV replication cycle of 96h. None of the biologically active metabolites of VD, cholecalciferol, calcidiol, or calcitriol, inhibit CMV replication significantly in human fibroblasts. In a feedback loop, expression of CYP24A1 dropped to 3% by 12h p.i. and expression of CYP27B1 increased gradually during the replication cycle of CMV to 970% probably as a consequence of VDR inhibition. VDR expression was not downregulated during influenza virus or adenovirus replication. The potent synthetic vitamin D analog EB-1089 was not able to inhibit CMV replication or antagonize its effect on VDR expression. Only CMV replication, and none of the other viral pathogens evaluated, inhibited the vitamin D system in vitro. In view of the pleiotropism of VDR, CMV-mediated downregulation may have far-reaching virological, immunological, and clinical implications and thus warrant further evaluations in vitro and in vivo.

  12. Evolution of the ability to modulate host chemokine networks via gene duplication in human cytomegalovirus (HCMV).

    PubMed

    Scarborough, Jessica A; Paul, John R; Spencer, Juliet V

    2017-03-14

    Human cytomegalovirus (HCMV) is a widespread pathogen that is particularly skillful at evading immune detection and defense mechanisms, largely due to extensive co-evolution with its host. One aspect of this co-evolution involves the acquisition of virally encoded G protein-coupled receptors (GPCRs) with homology to the chemokine receptor family. GPCRs are the largest family of cell surface proteins, found in organisms from yeast to humans, and they regulate a variety of cellular processes including development, sensory perception, and immune cell trafficking. The US27 and US28 genes are encoded by human and primate CMVs, but homologs are not found in the genomes of viruses infecting rodents or other species. Phylogenetic analysis was used to investigate the US27 and US28 genes, which are adjacent in the unique short (US) region of the HCMV genome, and their relationship to one another and to human chemokine receptor genes. The results indicate that both US27 and US28 share the same common ancestor with human chemokine receptor CX3CR1, suggesting that a single host gene was captured and a subsequent viral gene duplication event occurred. The US28 gene product (pUS28) has maintained the function of the ancestral gene and has the ability to bind and signal in response to CX3CL1/fractalkine, the natural ligand for CX3CR1. In contrast, pUS27 does not bind to any known chemokine ligand, and the sequence has diverged significantly, highlighted by the fact that pUS27 currently exhibits greater sequence similarity to human CCR1. While the evolutionary advantage of the gene duplication and neofunctionalization event remains unclear, the US27 and US28 genes are highly conserved among different HCMV strains and retained even in laboratory strains that have lost many virulence genes, suggesting that US27 and US28 have each evolved distinct, important functions during virus infection.

  13. Induction of chromosome aberrations and mitotic arrest by cytomegalovirus in human cells

    SciTech Connect

    AbuBakar, S.; Au, W.W.; Legator, M.S.; Albrecht, T.

    1988-01-01

    Human cytomegalovirus (CMV) is potentially an effective but often overlooked genotoxic agent in humans. We report here evidence that indicates that infection by CMV can induce chromosome alterations and mitotic inhibition. The frequency of chromosome aberrations induced was dependent on the input multiplicity of infection (m.o.i.) for human lung fibroblasts (LU), but not for human peripheral blood lymphocytes (PBLs) when both cell types were infected at the GO phase of the cell cycle. The aberrations induced by CMV were mostly chromatid breaks and chromosome pulverizations that resembled prematurely condensed S-phase chromatin. Pulverized chromosomes were not observed in LU cells infected with virus stocks that had been rendered nonlytic by UV-irradiation at 24,000 ergs/mm2 or from infection of human lymphocytes. In LU cells infected with UV-irradiated CMV, the frequency of aberrations induced was inversely dependent on the extent of the exposure of the CMV stock to the UV-light. In permissive CMV infection of proliferating LU cells at 24 hr after subculture, a high percentage (greater than 40%) of the metaphase cells were arrested at their first metaphase and displayed severely condensed chromosomes when harvested 48 hr later. A significant increase (p less than 0.05) in the chromosome aberration frequency was also observed. Our study shows that CMV infection is genotoxic to host cells. The types and extent of damage are dependent on the viral genome expression and on the cell cycle stage of the cells at the time of infection. The possible mechanisms for induction of chromosome damage by CMV are discussed.

  14. Human Cytomegalovirus miR-UL148D Facilitates Latent Viral Infection by Targeting Host Cell Immediate Early Response Gene 5

    PubMed Central

    Li, Limin; Li, Donghai; Liu, Fenyong; Zhang, Chen-Yu; Zen, Ke

    2016-01-01

    The mechanisms underlying human cytomegalovirus (HCMV) latency remain incompletely understood. Here, we showed that a HCMV-encoded miRNA, miR-UL148D, robustly accumulates during late stages of experimental latent HCMV infection in host cells and promotes HCMV latency by modulating the immediate early response gene 5 (IER5)-cell division cycle 25B (CDC25B) axis in host cells. miR-UL148D inhibited IER5 expression by directly targeting the three-prime untranslated region(3’UTR) of IER5 mRNA and thus rescued CDC25B expression during the establishment of viral latency. Infection with NR-1ΔmiR-UL148D, a derivative of the HCMV clinical strain NR-1 with a miR-UL148D knockout mutation, resulted in sustained induction of IER5 expression but decreased CDC25B expression in host cells. Mechanistically, we further showed that CDC25B plays an important role in suppressing HCMV IE1 and lytic gene transcription by activating cyclin-dependent kinase 1 (CDK-1). Both gain-of-function and lose-of-function assays demonstrated that miR-UL148D promotes HCMV latency by helping maintain CDC25B activity in host cells. These results provide a novel mechanism through which a HCMV miRNA regulates viral latency. PMID:27824944

  15. Proteomic analyses of human cytomegalovirus strain AD169 derivatives reveal highly conserved patterns of viral and cellular proteins in infected fibroblasts.

    PubMed

    Reyda, Sabine; Büscher, Nicole; Tenzer, Stefan; Plachter, Bodo

    2014-01-07

    Human cytomegalovirus (HCMV) particle morphogenesis in infected cells is an orchestrated process that eventually results in the release of enveloped virions. Proteomic analysis has been employed to reveal the complexity in the protein composition of these extracellular particles. Only limited information is however available regarding the proteome of infected cells preceding the release of HCMV virions. We used quantitative mass spectrometry to address the pattern of viral and cellular proteins in cells, infected with derivatives of the AD169 laboratory strain. Our analyses revealed a remarkable conservation in the patterns of viral and of abundant cellular proteins in cells, infected for 2 hours, 2 days, or 4 days. Most viral proteins increased in abundance as the infection progressed over time. Of the proteins that were reliably detectable by mass spectrometry, only IE1 (pUL123), pTRS1, and pIRS1 were downregulated at 4 days after infection. In addition, little variation of viral proteins in the virions of the different viruses was detectable, independent of the expression of the major tegument protein pp65. Taken together these data suggest that there is little variation in the expression program of viral and cellular proteins in cells infected with related HCMVs, resulting in a conserved pattern of viral proteins ultimately associated with extracellular virions.

  16. Nuclear trafficking of the human cytomegalovirus pp71 (ppUL82) tegument protein

    SciTech Connect

    Shen Weiping; Westgard, Elizabeth; Huang Liqun; Ward, Michael D.; Osborn, Jodi L.; Chau, Nha H.; Collins, Lindsay; Marcum, Benjamin; Koach, Margaret A.; Bibbs, Jennifer; Semmes, O. John; Kerry, Julie A.

    2008-06-20

    The human cytomegalovirus tegument protein pp71 localizes to the nucleus immediately upon infection, and functions to initiate viral gene expression. Analysis of a series of random insertion mutations revealed that sequences within the mid region (MR) of pp71 are important for localization to the nucleus. Fusion of MR sequences with eGFP revealed that amino acids 94 to 300 were sufficient to target proteins to the nucleus. Random substitution mutagenesis within this domain resulted in two double substitution mutants, pp71P203T/T223M and pp71T228M/L275Q, with a predominantly cytoplasmic localization. Disruption of nuclear targeting resulted in relocalization of the fusion proteins to a distinct perinuclear region. Using tandem mass spectrometry, we determined that threonine 223 can be phosphorylated. Mutation of this residue to a phosphomimetic amino acid resulted in abrogation of nuclear targeting. These results strongly suggest that the intracellular trafficking of pp71 is regulated by phosphorylation.

  17. Human cytomegalovirus US28 facilitates cell-to-cell viral dissemination.

    PubMed

    Noriega, Vanessa M; Gardner, Thomas J; Redmann, Veronika; Bongers, Gerold; Lira, Sergio A; Tortorella, Domenico

    2014-03-12

    Human cytomegalovirus (HCMV) encodes a number of viral proteins with homology to cellular G protein-coupled receptors (GPCRs). These viral GPCRs, including US27, US28, UL33, and UL78, have been ascribed numerous functions during infection, including activating diverse cellular pathways, binding to immunomodulatory chemokines, and impacting virus dissemination. To investigate the role of US28 during virus infection, two variants of the clinical isolate TB40/E were generated: TB40/E-US28(YFP) expressing a C-terminal yellow fluorescent protein tag, and TB40/E-FLAG(YFP) in which a FLAG-YFP cassette replaces the US28 coding region. The TB40/E-US28(YFP) protein localized as large perinuclear fluorescent structures at late times post-infection in fibroblasts, endothelial, and epithelial cells. Interestingly, US28(YFP) is a non-glycosylated membrane protein throughout the course of infection. US28 appears to impact cell-to-cell spread of virus, as the DUS28 virus (TB40/E-FLAG(YFP)) generated a log-greater yield of extracellular progeny whose spread could be significantly neutralized in fibroblasts. Most strikingly, in epithelial cells, where dissemination of virus occurs exclusively by the cell-to-cell route, TB40/E-FLAG(YFP) (DUS28) displayed a significant growth defect. The data demonstrates that HCMV US28 may contribute at a late stage of the viral life cycle to cell-to-cell dissemination of virus.

  18. Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci

    SciTech Connect

    Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En

    2009-09-30

    The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.

  19. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins.

    PubMed

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-06-24

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%-99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy.

  20. The immunology of human cytomegalovirus latency: could latent infection be cleared by novel immunotherapeutic strategies?

    PubMed

    Wills, Mark R; Poole, Emma; Lau, Betty; Krishna, Ben; Sinclair, John H

    2015-03-01

    While the host immune response following primary human cytomegalovirus (HCMV) infection is generally effective at stopping virus replication and dissemination, virus is never cleared by the host and like all herpesviruses, persists for life. At least in part, this persistence is known to be facilitated by the ability of HCMV to establish latency in myeloid cells in which infection is essentially silent with, importantly, a total lack of new virus production. However, although the viral transcription programme during latency is much suppressed, a number of viral genes are expressed during latent infection at the protein level and many of these have been shown to have profound effects on the latent cell and its environment. Intriguingly, many of these latency-associated genes are also expressed during lytic infection. Therefore, why the same potent host immune responses generated during lytic infection to these viral gene products are not recognized during latency, thereby allowing clearance of latently infected cells, is far from clear. Reactivation from latency is also a major cause of HCMV-mediated disease, particularly in the immune compromised and immune naive, and is also likely to be a major source of virus in chronic subclinical HCMV infection which has been suggested to be associated with long-term diseases such as atherosclerosis and some neoplasias. Consequently, understanding latency and why latently infected cells appear to be immunoprivileged is crucial for an understanding of the pathogenesis of HCMV and may help to design strategies to eliminate latent virus reservoirs, at least in certain clinical settings.

  1. Detection of human cytomegalovirus in plasma of AIDS patients during acute visceral disease by DNA amplification.

    PubMed Central

    Spector, S A; Merrill, R; Wolf, D; Dankner, W M

    1992-01-01

    By using the polymerase chain reaction (PCR) amplification procedure, 19 (83%) of 23 plasma specimens obtained from individuals with AIDS and human cytomegalovirus (HCMV) visceral disease were found to be positive for plasma viremia as detected by PCR (PV-PCR), whereas 78% of cultures of peripheral blood leukocytes from the same samples were found to be positive. All 11 specimens prospectively obtained from individuals with acute HCMV disease were positive by PV-PCR. Plasma specimens from patients who received ganciclovir therapy rapidly became both culture and PV-PCR negative, and there was an excellent correlation between the two procedures. DNA detected by PV-PCR was unaffected by filtering plasma through a 0.2-microns-pore-size filter, although a conserved cellular gene, HLA-DQ alpha, was undetectable by PCR following filtration. HCMV DNA in plasma could be quantitated by PV-PCR by using endpoint serial dilutions, with detectable virus being present in 10(1) to 10(-2) microliters of plasma. A low titer of infectious virus could be detected in 2 of 11 plasma samples. The detection of HCMV DNA in plasma by PV-PCR promises to be a useful procedure for monitoring patients with AIDS suspected of having impending, acute, or recurrent HCMV visceral disease and suggests an additional route by which virus may disseminate in the immunocompromised host. Images PMID:1328287

  2. Structural changes in human cytomegalovirus cytoplasmic assembly sites in the absence of UL97 kinase activity

    SciTech Connect

    Azzeh, Maysa; Honigman, Alik; Taraboulos, Albert; Rouvinski, Alexander; Wolf, Dana G. . E-mail: wolfd@md.huji.ac.il

    2006-10-10

    Studies of human cytomegalovirus (HCMV) UL97 kinase deletion mutant ({delta}UL97) indicated a multi-step role for this kinase in early and late phases of the viral life cycle, namely, in DNA replication, capsid maturation and nuclear egress. Here, we addressed its possible involvement in cytoplasmic steps of HCMV assembly. Using the {delta}UL97 and the UL97 kinase inhibitor NGIC-I, we demonstrate that the absence of UL97 kinase activity results in a modified subcellular distribution of the viral structural protein assembly sites, from compact structures impacting upon the nucleus to diffuse perinuclear structures punctuated by large vacuoles. Infection by either wild type or {delta}UL97 viruses induced a profound reorganization of wheat germ agglutinin (WGA)-positive Golgi-related structures. Importantly, the viral-induced Golgi remodeling along with the reorganization of the nuclear architecture was substantially altered in the absence of UL97 kinase activity. These findings suggest that UL97 kinase activity might contribute to organization of the viral cytoplasmic assembly sites.

  3. Synthetic lethal mutations in the cyclin A interface of human cytomegalovirus

    PubMed Central

    Vetter, Barbara

    2017-01-01

    Generally, the antagonism between host restriction factors and viral countermeasures decides on cellular permissiveness or resistance to virus infection. Human cytomegalovirus (HCMV) has evolved an additional level of self-imposed restriction by the viral tegument protein pp150. Depending on a cyclin A-binding motif, pp150 prevents the onset of viral gene expression in the S/G2 cell cycle phase of otherwise fully permissive cells. Here we address the physiological relevance of this restriction during productive HCMV infection by employing a cyclin A-binding deficient pp150 mutant virus. One consequence of unrestricted viral gene expression in S/G2 was the induction of a G2/M arrest. G2-arrested but not mitotic cells supported viral replication. Cyclin A destabilization by the viral gene product pUL21a was required to maintain the virus-permissive G2-arrest. An HCMV double-point mutant where both pp150 and pUL21a are disabled in cyclin A interaction forced mitotic entry of the majority of infected cells, with a severe negative impact on cell viability and virus growth. Thus, pp150 and pUL21a functionally cooperate, together building a cell cycle synchronization strategy of cyclin A targeting and avoidance that is essential for productive HCMV infection. PMID:28129404

  4. Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35

    SciTech Connect

    Salsman, Jayme; Wang Xueqi; Frappier, Lori

    2011-06-05

    The human cytomegalovirus (HCMV) UL35 gene encodes two proteins, UL35 and UL35a. Expression of UL35 in transfected cells results in the formation of UL35 nuclear bodies that associate with promyelocytic leukemia (PML) protein. PML forms the basis for PML nuclear bodies that are important for suppressing viral lytic gene expression. Given the important relationship between PML and viral infection, we have further investigated the association of UL35 with PML bodies. We demonstrate that UL35 bodies form independently of PML and subsequently recruit PML, Sp100 and Daxx. In contrast, UL35a did not form bodies; however, it could bind UL35 and inhibit the formation of UL35 bodies. The HCMV tegument protein pp71 promoted the formation of UL35 bodies and the cytoplasmic localization of UL35a. Similarly, UL35a shifted pp71 to the cytoplasm. These results indicate that the interplay between UL35, UL35a and pp71 affects their subcellular localization and likely their functions throughout infection.

  5. US28, a Virally-Encoded GPCR as an Antiviral Target for Human Cytomegalovirus Infection

    PubMed Central

    Lee, Sungjin; Chung, Yoon Hee; Lee, Choongho

    2017-01-01

    Viruses continue to evolve a new strategy to take advantage of every aspect of host cells in order to maximize their survival. Due to their central roles in transducing a variety of transmembrane signals, GPCRs seem to be a prime target for viruses to pirate for their own use. Incorporation of GPCR functionality into the genome of herpesviruses has been demonstrated to be essential for pathogenesis of many herpesviruses-induced diseases. Here, we introduce US28 of human cytomegalovirus (HCMV) as the best-studied example of virally-encoded GPCRs to manipulate host GPCR signaling. In this review, we wish to summarize a number of US28-related topics including its regulation of host signaling pathways, its constitutive internalization, its structural and functional analysis, its roles in HCMV biology and pathogenesis, its proliferative activities and role in oncogenesis, and pharmacological modulation of its biological activities. This review will aid in our understanding of how pathogenic viruses usurp the host GPCR signaling for successful viral infection. This kind of knowledge will enable us to build a better strategy to control viral infection by normalizing the virally-dysregulated host GPCR signaling. PMID:28035083

  6. The multi-targeted kinase inhibitor sorafenib inhibits human cytomegalovirus replication.

    PubMed

    Michaelis, Martin; Paulus, Christina; Löschmann, Nadine; Dauth, Stephanie; Stange, Elisabeth; Doerr, Hans Wilhelm; Nevels, Michael; Cinatl, Jindrich

    2011-03-01

    Human cytomegalovirus (HCMV) is a major pathogen in immunocompromised individuals. Here, non-toxic concentrations of the anti-cancer kinase inhibitor sorafenib were shown to inhibit replication of different HCMV strains (including a ganciclovir-resistant strain) in different cell types. In contrast to established anti-HCMV drugs, sorafenib inhibited HCMV major immediate early promoter activity and HCMV immediate early antigen (IEA) expression. Sorafenib is known to inhibit Raf. Comparison of sorafenib with the MEK inhibitor U0126 suggested that sorafenib inhibits HCMV IEA expression through inhibition of Raf but independently of signaling through the Raf downstream kinase MEK 1/2. In concordance, siRNA-mediated depletion of Raf but not of MEK-reduced IEA expression. In conclusion, sorafenib diminished HCMV replication in clinically relevant concentrations and inhibited HCMV IEA expression, a pathophysiologically relevant event that is not affected by established anti-HCMV drugs. Moreover, we demonstrated for the first time that Raf activation is involved in HCMV IEA expression.

  7. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  8. Virological and immunological characteristics of human cytomegalovirus infection associated with Alzheimer disease.

    PubMed

    Lurain, Nell S; Hanson, Barbara A; Martinson, Jeffrey; Leurgans, Sue E; Landay, Alan L; Bennett, David A; Schneider, Julie A

    2013-08-15

    Serum, cerebrospinal fluid (CSF), and cryopreserved lymphocytes from subjects in the Rush Alzheimer's Disease Center Religious Orders Study were analyzed for associations between cytomegalovirus (CMV) infection and clinical and pathological markers of Alzheimer disease. CMV antibody levels were associated with neurofibrillary tangles (NFTs). CSF interferon γ was only detected in seropositive subjects and was significantly associated with NFTs. The percentage of senescent T cells (CD4+ or CD8+CD28-CD57+) was significantly higher for CMV-seropositive as compared to CMV-seronegative subjects and was marginally associated with the pathologic diagnosis of Alzheimer disease (CD4+) or amyloid-β (CD8+). Immunocytochemical analysis showed induction of amyloid-β in human foreskin fibroblasts (HFFs) infected with each of 3 clinical CMV strains. In the same subjects, there was no association of herpes simplex virus type 1 (HSV-1) antibody levels with CMV antibody levels or clinical or pathological markers of Alzheimer disease. HSV-1 infection of HFFs did not induce amyloid-β. These data support an association between CMV and the development of Alzheimer disease.

  9. Human Cytomegalovirus Secretome Contains Factors That Induce Angiogenesis and Wound Healing

    SciTech Connect

    Dumortier, Jerome; Streblow, Daniel N.; Moses, Ashlee V.; Jacobs, Jon M.; Kreklywich, Craig N.; Camp, David G.; Smith, Richard D.; Orloff, Susan L.; Nelson, Jay

    2008-07-01

    Human cytomegalovirus (HCMV) is implicated in the acceleration of a number of vascular diseases including transplant vascular sclerosis (TVS), the lesion associated with chronic rejection (CR) of solid organ transplants. Although the virus persists in the allograft throughout the course of disease, few cells are directly infected by CMV. This observation is in contrast to the global effects that CMV has on the acceleration of TVS/CR, suggesting that CMV infection indirectly promotes the vascular disease process. Recent transcriptome analysis of CMV-infected heart allografts indicates that the virus induces cytokines and growth factors associated with angiogenesis (AG) and wound healing (WH), suggesting that CMV may accelerate TVS/CR through the induction and secretion of AG/WH factors from infected cells. We analyzed virus-free supernatants from HCMV-infected cells (HCMV secretomes) for growth factors, by mass spectrometry and immunoassays, and found that the HCMV secretome contains over 1,000 cellular proteins, many of which are involved in AG/WH. Importantly, functional assays demonstrated that CMV but not herpes simplex virus secretomes not only induce AG/WH but also promote neovessel stabilization and endothelial cell survival for 2 weeks. These findings suggest that CMV acceleration of TVS occurs through virus-induced growth factors and cytokines in the CMV secretome.

  10. The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication

    PubMed Central

    Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J.

    2016-01-01

    Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics. PMID:26773380

  11. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene.

    PubMed Central

    Heilbronn, R; Jahn, G; Bürkle, A; Freese, U K; Fleckenstein, B; zur Hausen, H

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSV-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at Tm - 25 degrees C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Epstein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein. Images PMID:3023689

  12. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  13. The effect of human cytomegalovirus on the formation of CFU-MK in vitro.

    PubMed

    Yao, Junxia; Song, Sanjun; Hu, Lihua

    2004-01-01

    To investigate the mechanism and the suppressive effect of human cytomegalovirus (HCMV) on colony forming unit-megakaryocyte (CFU-MK), semi-solid culture system was used to observe the effect of HCMV AD169 strain on CFU-MK's growth of 18 cord blood samples. HCMV DNA and immediate early (IE) protein mRNA in CFU-MK was detected by PCR and reverse transcription-polymerase chain reaction (RT-PCR). Our results showed that HCMV AD169 significantly suppressed the formation of CFU-MK in vitro. Compared with the mock group, the CFU-MK colonies decreased by 21.6%, 33.8% and 46.3%, respectively, in all the 3 infected groups (P<0.05), suggesting the suppression and the titer of the virus was dose-dependent. Both HCMV DNA and the expression of HCMV IE protein mRNA were positively detected in the colony cells of viral infected group. It is concluded that HCMV AD169 strain could inhibit the differentiation and proliferation of CFU-MK by directly infecting their progenitors. There was early transcription of HCMV IE protein in CFU-MK infected by virus.

  14. High frequency of Human Cytomegalovirus DNA in the Liver of Infants with Extrahepatic Neonatal Cholestasis

    PubMed Central

    De Tommaso, Adriana MA; Andrade, Paula D; Costa, Sandra CB; Escanhoela, Cecília AF; Hessel, Gabriel

    2005-01-01

    Background Biliary atresia (BA) is the most severe hepatic disorder in newborns and its etiopathogenesis remains unknown. Viral involvement has been proposed, including the human cytomegalovirus (HCMV). The aims of the study were to use the polymerase chain reaction (PCR) to screen the liver tissue of infants with extrahepatic cholestasis for HCMV and to correlate the results with serological antibodies against HCMV and histological findings. Methods A retrospective study in a tertiary care setting included 35 patients (31 BA, 1 BA associated with a choledochal cyst, 2 congenital stenosis of the distal common bile duct and 1 hepatic cyst). HCMV serology was determined by ELISA. Liver and porta hepatis were examined histologically. Liver samples from infants and a control group were screened for HCMV DNA. Results Twelve patients had HCMV negative serology, 9 were positive for IgG antibodies and 14 were positive for IgG and IgM. Nine liver and seven porta hepatis samples were positive for HCMV DNA but none of the control group were positive (general frequency of positivity was 34.3% – 12/35). There was no correlation between HCMV positivity by PCR and the histological findings. The accuracy of serology for detecting HCMV antibodies was low. Conclusion These results indicate an elevated frequency of HCMV in pediatric patients with extrahepatic neonatal cholestasis. They also show the low accuracy of serological tests for detecting active HCMV infection and the lack of correlation between HCMV positivity by PCR and the histopathological changes. PMID:16321152

  15. Sites and roles of phosphorylation of the human cytomegalovirus DNA polymerase subunit UL44

    SciTech Connect

    Silva, Laurie A.; Strang, Blair L.; Lin, Eric W.; Kamil, Jeremy P.; Coen, Donald M.

    2011-09-01

    The human cytomegalovirus DNA polymerase subunit UL44 is a phosphoprotein, but its sites and roles of phosphorylation have not been investigated. We compared sites of phosphorylation of UL44 in vitro by the viral protein kinase UL97 and cyclin-dependent kinase 1 with those in infected cells. Transient treatment of infected cells with a UL97 inhibitor greatly reduced labeling of two minor UL44 phosphopeptides. Viruses containing alanine substitutions of most UL44 residues that are phosphorylated in infected cells exhibited at most modest effects on viral DNA synthesis and yield. However, substitution of highly phosphorylated sites adjacent to the nuclear localization signal abolished viral replication. The results taken together are consistent with UL44 being phosphorylated directly by UL97 during infection, and a crucial role for phosphorylation-mediated nuclear localization of UL44 for viral replication, but lend little support to the widely held hypothesis that UL97-mediated phosphorylation of UL44 is crucial for viral DNA synthesis.

  16. Human cytomegalovirus (HCMV) replication dynamics in HCMV-naive and -experienced immunocompromised hosts.

    PubMed

    Emery, Vincent C; Hassan-Walker, Aycan F; Burroughs, Andrew K; Griffiths, Paul D

    2002-06-15

    Human cytomegalovirus (HCMV) can infect both HCMV-naive and -experienced transplant patients. In this study, the growth rate of HCMV in HCMV-naive hosts (1.82 units/day; 95% confidence interval [CI], 1.44-2.56 units/day) was shown to be significantly faster than the growth rate of virus in HCMV-experienced hosts undergoing recurrent infection (0.61 units/day; 95% CI, 0.55-0.7 units/day; P<.0001). The basic reproductive number (R(0)) for HCMV-naive liver transplant patients was 15.1 (95% CI, 8.9-44) but was only 2.4 (95% CI, 2.35-2.8) for HCMV-experienced transplant recipients, corresponding to an anti-HCMV immune efficacy of approximately 84%, despite immunosuppressive therapy. The R(0) values suggest that an anti-HCMV drug or vaccine with an efficacy of >93% (95% CI, 89%-98%) is required to eliminate viral growth during infection of HCMV-naive liver transplant recipients, whereas lower efficacy levels are sufficient to reduce the R(0) value to <1 in hosts with prior HCMV immunity.

  17. Divergent effects of human cytomegalovirus and herpes simplex virus-1 on cellular metabolism.

    PubMed

    Vastag, Livia; Koyuncu, Emre; Grady, Sarah L; Shenk, Thomas E; Rabinowitz, Joshua D

    2011-07-01

    Viruses rely on the metabolic network of the host cell to provide energy and macromolecular precursors to fuel viral replication. Here we used mass spectrometry to examine the impact of two related herpesviruses, human cytomegalovirus (HCMV) and herpes simplex virus type-1 (HSV-1), on the metabolism of fibroblast and epithelial host cells. Each virus triggered strong metabolic changes that were conserved across different host cell types. The metabolic effects of the two viruses were, however, largely distinct. HCMV but not HSV-1 increased glycolytic flux. HCMV profoundly increased TCA compound levels and flow of two carbon units required for TCA cycle turning and fatty acid synthesis. HSV-1 increased anapleurotic influx to the TCA cycle through pyruvate carboxylase, feeding pyrimidine biosynthesis. Thus, these two related herpesviruses drive diverse host cells to execute distinct, virus-specific metabolic programs. Current drugs target nucleotide metabolism for treatment of both viruses. Although our results confirm that this is a robust target for HSV-1, therapeutic interventions at other points in metabolism might prove more effective for treatment of HCMV.

  18. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  19. Cytomegalovirus iritis.

    PubMed

    Cheng, L; Rao, N A; Keefe, K S; Avila, C P; Macdonald, J C; Freeman, W R

    1998-11-01

    We describe a case of focal cytomegalovirus iritis in a patient with acquired immunodeficiency syndrome (AIDS) who had CMV retinitis. The autopsy showed histologic evidence of focal iritis in the left eye. This iritis was characterized by infiltration of acute inflammatory cells mixed with cytomegalic cells, which was confirmed by CMV-specific immunohistochemical staining. The case suggested that cytomegalovirus could be a direct causative agent of infectious iritis in AIDS patients.

  20. Human Cytomegalovirus (HCMV)-Specific CD4(+) T Cells Are Polyfunctional and Can Respond to HCMV-Infected Dendritic Cells In Vitro.

    PubMed

    Jackson, Sarah E; Sedikides, George X; Mason, Gavin M; Okecha, Georgina; Wills, Mark R

    2017-03-15

    Human cytomegalovirus (HCMV) infection and periodic reactivation are generally well controlled by the HCMV-specific T cell response in healthy people. While the CD8(+) T cell response to HCMV has been extensively studied, the HCMV-specific CD4(+) T cell effector response is not as well understood, especially in the context of direct interactions with HCMV-infected cells. We screened the gamma interferon (IFN-γ) and interleukin-10 (IL-10) responses to 6 HCMV peptide pools (pp65, pp71, IE1, IE2, gB, and US3, selected because they were the peptides most frequently responded to in our previous studies) in 84 donors aged 23 to 74 years. The HCMV-specific CD4(+) T cell response to pp65, IE1, IE2, and gB was predominantly Th1 biased, with neither the loss nor the accumulation of these responses occurring with increasing age. A larger proportion of donors produced an IL-10 response to pp71 and US3, but the IFN-γ response was still dominant. CD4(+) T cells specific to the HCMV proteins studied were predominantly effector memory cells and produced both cytotoxic (CD107a expression) and cytokine (macrophage inflammatory protein 1β secretion) effector responses. Importantly, when we measured the CD4(+) T cell response to cytomegalovirus (CMV)-infected dendritic cells in vitro, we observed that the CD4(+) T cells produced a range of cytotoxic and secretory effector functions, despite the presence of CMV-encoded immune evasion molecules. CD4(+) T cell responses to HCMV-infected dendritic cells were sufficient to control the dissemination of virus in an in vitro assay. Together, the results show that HCMV-specific CD4(+) T cell responses, even those from elderly individuals, are highly functional and are directly antiviral.IMPORTANCE Human cytomegalovirus (HCMV) infection is carried for a lifetime and in healthy people is kept under control by the immune system. HCMV has evolved many mechanisms to evade the immune response, possibly explaining why the virus is never eliminated

  1. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency.

  2. Human cytomegalovirus detection in gastric cancer and its possible association with lymphatic metastasis.

    PubMed

    Zhang, Liang; Guo, Gangqiang; Xu, Jianfeng; Sun, Xiangwei; Chen, Wenjing; Jin, Jinji; Hu, Changyuan; Zhang, Peichen; Shen, Xian; Xue, Xiangyang

    2017-02-08

    Increasing evidence suggests that human cytomegalovirus (HCMV) is associated with many human malignancies. However, its prevalence in gastric cancer (GC) and clinical association remain unknown. HCMV IgG and IgM antibodies in the sera of 80 GC patients and 80 healthy controls were detected using a microparticle enzyme immunoassay. The prevalence of HCMV UL47, UL55, UL56, and UL77 genes among 102 GC tumor tissues and adjacent normal specimens was measured by polymerase chain reaction (PCR) or nested PCR. Quantitative real-time PCR (Q-PCR) was used to determine viral load. Virus localization in neoplastic tissues was determined by immunohistochemistry. No significant difference of HCMV IgG and IgM seropositivity was found between GC patients and the healthy group. However, the overall HCMV DNA positivity rate was significantly higher in GC cancerous tissue compared with in paired normal tissue (P<0.01). HCMV infection was mainly localized in the tumorous epithelium. Q-PCR in HCMV-positive specimens indicated that the viral copy number was notably higher in GC tissues than in adjacent normal specimens (P<0.001). Clinical statistical analysis indicated that HCMV load in GC tumor tissue was positively associated with lymphatic metastasis (P=0.043), the area under the receiver operating characteristic (ROC) curve was 0.6638. Our data clearly provide the prevalence of HCMV in GC patients. We conclude that HCMV infection in malignant tissues might be associated with carcinogenesis or progression of GC and possibly relates to lymphatic metastasis.

  3. Electrophoretic analysis of polypeptides immune precipitated from cytomegalovirus-infected cell extracts by human sera.

    PubMed Central

    Pereira, L; Hoffman, M; Cremer, N

    1982-01-01

    Serodiagnosis of cytomegalovirus (CMV) infection by complement fixation tests depends on showing a fourfold rise in antibody titer from acute- to convalescent-phase sera. Freeze-thaw and glycine-extracted, infected cell culture antigens used for these tests give markedly different titers in reactions with the same sera. In this study, we characterized the CMV-infected cell polypeptides contained in freeze-thaw and glycine-extracted antigens and identified the proteins precipitated by 23 pairs of human acute and convalescent sera. Our results were as follows. First, freeze-thaw and glycine-extracted antigens prepared from infected cells radiolabeled with [35S]methionine and subjected to electrophoresis in sodium dodecyl sulfate-polyacrylamide gels yielded similar patterns, and the bulk of the label was contained in late structural proteins and glycoproteins. Glycine-extracted preparations contained a greater proportion of soluble 66,000- and 50,000-molecular-weight proteins than did freeze-thaw antigens. Second, convalescent sera precipitated proteins migrating with apparent molecular weights of 150,000, 130,000, 110,000, 96,000, 74,000, 66,000, 50,000, 34,000, 32,000, and 25,000. Of these the 130,000-, 110,000-, 96,000-, 66,000-, 50,000-, and 25,000-molecular-weight proteins comigrated with glucosamine-labeled polypeptides. Both immunoglobulin G and M antibodies in human sera precipitated these proteins from CMV-infected cell preparations. Implications of the results for serodiagnosis of CMV infections are discussed. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 FIG. 6 FIG. 7 FIG. 8 FIG. 9 FIG. 10 PMID:6284646

  4. Role of human cytomegalovirus in the proliferation and invasion of extravillous cytotrophoblasts isolated from early placentae

    PubMed Central

    Liu, Tao; Zheng, Xiaofei; Li, Qin; Chen, Juanjuan; Yin, Zongzhi; Xiao, Juan; Zhang, Dandan; Li, Wei; Qiao, Yuan; Chen, Suhua

    2015-01-01

    Aim: We investigated the role of human cytomegalovirus (HCMV) and its mechanism in extravillous cytotrophoblast (EVT) proliferation and invasion in vitro. Methods: Differential enzymatic digestion combined with gradient centrifugation, was used to isolate primary EVT from human chorionic villi collected from early placentae of healthy pregnant women. HCMV infection was determined by immunofluorescence staining of HCMVpp65 antigen expression. An MTT assay was used to examine the role of HCMV in the proliferation of EVT. Quantitative real-time polymerase chain reaction (qRT-PCR), immunocytochemical staining and Western blots were carried out in a control group (EVT) and a virus group (EVT+HCMV) to examine the expression of major genes and protein in TGF-β/Smad signaling pathways in EVT 48 h after inoculation with HCMV. An in vitro cell invasion assay was performed to analyze the influence of HCMV on EVT invasion. Results: HCMV significantly inhibited the proliferation of EVT 48 h after viral infection (P < 0.05). The expression of TGF-β1, Smad1, Smad2, Smad3, Smad4, and Smad5 genes was significantly increased (P < 0.05), but that of TGF-β2, TGF-β3, TGFβRI, TGFβRII, Smad7, MMP2, and MMP9 was significantly decreased in the virus group 48 h after HCMV infection (P < 0.05). Smad7, MMP-2 and MMP-9 protein levels were significantly decreased and the TGF-β1 protein level was significantly increased in infected EVT (all P < 0.05). Conclusions: HCMV may act on multiple steps of the TGF-β/Smad signaling pathway to impede EVT proliferation and invasion. PMID:26770317

  5. Human cytomegalovirus tropism for endothelial/epithelial cells: scientific background and clinical implications.

    PubMed

    Revello, M Grazia; Gerna, Giuseppe

    2010-05-01

    Human cytomegalovirus (HCMV) has been routinely isolated from and propagated in vitro in human embryonic lung fibroblast (HELF) cell cultures, while in vivo it is known to infect predominantly endothelial and epithelial cells. In recent years, genetic determinants of the HCMV tropism for endothelial/epithelial cells were identified in the UL131A/UL130/UL128 locus of HCMV genome of wild-type strains. UL131A-UL128 gene products form a complex with glycoprotein H (gH) and L (gL) resulting in a gH/gL/UL131A-UL128 complex that is required for HCMV entry into endothelial/epithelial cells. In contrast, virus entry into fibroblasts has its genetic determinants in the complex gH/gL/gO (or gH/gL). During primary HCMV infection, the neutralising antibody response measured in endothelial cells (EC) is potent, occurs very early and is directed mostly against combinations of two or three gene products of the UL131A-128 locus. On the contrary, neutralising antibodies measured in fibroblasts appear late, are relatively weak in potency and are directed against gH and gB. The T-cell immune response to UL131A-UL128 gene products remains to be investigated. Recently, a role has been proposed for neutralising antibody in conferring prevention/protection against HCMV infection/disease in pregnant women with primary HCMV infection. However, the level of cooperation between humoral immunity and the well-established T-cell protection remains to be defined.

  6. A Role for Nuclear F-Actin Induction in Human Cytomegalovirus Nuclear Egress

    PubMed Central

    Wilkie, Adrian R.; Lawler, Jessica L.

    2016-01-01

    ABSTRACT Herpesviruses, which include important pathogens, remodel the host cell nucleus to facilitate infection. This remodeling includes the formation of structures called replication compartments (RCs) in which herpesviruses replicate their DNA. During infection with the betaherpesvirus, human cytomegalovirus (HCMV), viral DNA synthesis occurs at the periphery of RCs within the nuclear interior, after which assembled capsids must reach the inner nuclear membrane (INM) for translocation to the cytoplasm (nuclear egress). The processes that facilitate movement of HCMV capsids to the INM during nuclear egress are unknown. Although an actin-based mechanism of alphaherpesvirus capsid trafficking to the INM has been proposed, it is controversial. Here, using a fluorescently-tagged, nucleus-localized actin-binding peptide, we show that HCMV, but not herpes simplex virus 1, strongly induced nuclear actin filaments (F-actin) in human fibroblasts. Based on studies using UV inactivation and inhibitors, this induction depended on viral gene expression. Interestingly, by 24 h postinfection, nuclear F-actin formed thicker structures that appeared by super-resolution microscopy to be bundles of filaments. Later in infection, nuclear F-actin primarily localized along the RC periphery and between the RC periphery and the nuclear rim. Importantly, a drug that depolymerized nuclear F-actin caused defects in production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization near the nuclear rim, without decreasing capsid accumulation in the nucleus. Thus, our results suggest that for at least one herpesvirus, nuclear F-actin promotes capsid movement to the nuclear periphery and nuclear egress. We discuss our results in terms of competing models for these processes. PMID:27555312

  7. High-Resolution Profiling and Analysis of Viral and Host Small RNAs during Human Cytomegalovirus Infection

    PubMed Central

    Stark, Thomas J.; Arnold, Justin D.; Spector, Deborah H.

    2012-01-01

    Human cytomegalovirus (HCMV) contributes its own set of microRNAs (miRNAs) during lytic infection of cells, likely fine-tuning conditions important for viral replication. To enhance our understanding of this component of the HCMV-host transcriptome, we have conducted deep-sequencing analysis of small RNAs (smRNA-seq) from infected human fibroblast cells. We found that HCMV-encoded miRNAs accumulate to ∼20% of the total smRNA population at late stages of infection, and our analysis led to improvements in viral miRNA annotations and identification of two novel HCMV miRNAs, miR-US22 and miR-US33as. Both of these miRNAs were capable of functionally repressing synthetic targets in transient transfection experiments. Additionally, through cross-linking and immunoprecipitation (CLIP) of Argonaute (Ago)-bound RNAs from infected cells, followed by high-throughput sequencing, we have obtained direct evidence for incorporation of all HCMV miRNAs into the endogenous host silencing machinery. Surprisingly, three HCMV miRNA precursors exhibited differential incorporation of their mature miRNA arms between Ago2 and Ago1 complexes. Host miRNA abundances were also affected by HCMV infection, with significant upregulation observed for an miRNA cluster containing miR-96, miR-182, and miR-183. In addition to miRNAs, we also identified novel forms of virus-derived smRNAs, revealing greater complexity within the smRNA population during HCMV infection. PMID:22013051

  8. Human Cytomegalovirus Requires Epidermal Growth Factor Receptor Signaling To Enter and Initiate the Early Steps in the Establishment of Latency in CD34(+) Human Progenitor Cells.

    PubMed

    Kim, Jung Heon; Collins-McMillen, Donna; Buehler, Jason C; Goodrum, Felicia D; Yurochko, Andrew D

    2017-03-01

    The establishment of human cytomegalovirus (HCMV) latency and persistence relies on the successful infection of hematopoietic cells, which serve as sites of viral persistence and contribute to viral spread. Here, using blocking antibodies and pharmacological inhibitors, we document that HCMV activation of the epidermal growth factor receptor (EGFR) and downstream phosphatidylinositol 3-kinase (PI3K) mediates viral entry into CD34(+) human progenitor cells (HPCs), resulting in distinct cellular trafficking and nuclear translocation of the virus compared to that in other immune cells, such as we have documented in monocytes. We argue that the EGFR allows HCMV to regulate the cellular functions of these replication-restricted cells via its signaling activity following viral binding. In addition to regulating HCMV entry/trafficking, EGFR signaling may also shape the early steps required for the successful establishment of viral latency in CD34(+) cells, as pharmacological inhibition of EGFR increases the transcription of lytic IE1/IE2 mRNA while curbing the expression of latency-associated UL138 mRNA. EGFR signaling following infection of CD34(+) HPCs may also contribute to changes in hematopoietic potential, as treatment with the EGFR kinase (EGFRK) inhibitor AG1478 alters the expression of the cellular hematopoietic cytokine interleukin 12 (IL-12) in HCMV-infected cells but not in mock-infected cells. These findings, along with our previous work with monocytes, suggest that EGFR likely serves as an important determinant of HCMV tropism for select subsets of hematopoietic cells. Moreover, our new data suggest that EGFR is a key receptor for efficient viral entry and that the ensuing signaling regulates important early events required for successful infection of CD34(+) HPCs by HCMV.IMPORTANCE HCMV establishes lifelong persistence within the majority of the human population without causing overt pathogenesis in healthy individuals. Despite this, reactivation of HCMV

  9. Human cytomegalovirus US3 modulates destruction of MHC class I molecules.

    PubMed

    Noriega, Vanessa M; Hesse, Julia; Gardner, Thomas J; Besold, Katrin; Plachter, Bodo; Tortorella, Domenico

    2012-06-01

    Human cytomegalovirus (HCMV), a member of the Herpesviridae family, is proficient at establishing lifelong persistence within the host in part due to immune modulating genes that limit immune recognition. HCMV encodes at least five glycoproteins within its unique short (US) genomic region that interfere with MHC class I antigen presentation, thus hindering viral clearance by cytotoxic T lymphocytes (CTL). Specifically, US3 retains class I within the endoplasmic reticulum (ER), while US2 and US11 induce class I heavy chain destruction. A cooperative effect on class I down-regulation during stable expression of HCMV US2 and US3 has been established. To address the impact of US3 on US11-mediated MHC class I down-regulation, the fate of class I molecules was examined in US3/US11-expressing cells and virus infection studies. Co-expression of US3 and US11 resulted in a decrease of surface expression of class I molecules. However, the class I molecules in US3/US11 cells were mostly retained in the ER with an attenuated rate of proteasome destruction. Analysis of class I levels from virus-infected cells using HCMV variants either expressing US3 or US11 revealed efficient surface class I down-regulation upon expression of both viral proteins. Cells infected with both US3 and US11 expressing viruses demonstrate enhanced retention of MHC class I complexes within the ER. Collectively, the data suggests a paradigm where HCMV-induced surface class I down-regulation occurs by diverse mechanisms dependent on the expression of specific US genes. These results validate the commitment of HCMV to limiting the surface expression of class I levels during infection.

  10. Identification of persistent RNA-DNA hybrid structures within the origin of replication of human cytomegalovirus.

    PubMed

    Prichard, M N; Jairath, S; Penfold, M E; St Jeor, S; Bohlman, M C; Pari, G S

    1998-09-01

    Human cytomegalovirus (HCMV) lytic-phase DNA replication initiates at the cis-acting origin of replication, oriLyt. oriLyt is a structurally complex region containing repeat elements and transcription factor binding sites. We identified two site-specific alkali-labile regions within oriLyt which flank an alkali-resistant DNA segment. These alkali-sensitive regions were the result of the degradation of two RNA species embedded within oriLyt and covalently linked to viral DNA. The virus-associated RNA, vRNA, was identified by DNase I treatment of HCMV DNA obtained from sucrose gradient purified virus. This heterogeneous population of vRNA was end labeled and used as a hybridization probe to map the exact location of vRNAs within oriLyt. vRNA-1 is localized between restriction endonuclease sites XhoI at nucleotide (nt) 93799 and SacI at nt 94631 and is approximately 500 bases long. The second vRNA, vRNA-2, lies within a region which exhibits a heterogeneous restriction pattern located between the SphI (nt 92636) and BamHI (nt 93513) and is approximately 300 bases long. This region was previously shown to be required for oriLyt replication (D. G. Anders, M. A. Kacica, G. S. Pari, and S. M. Punturieri, J. Virol. 66:3373-3384, 1992). RNase H analysis determined that vRNA-2 forms a persistent RNA-DNA hybrid structure in the context of the viral genome and in an oriLyt-containing plasmid used in the transient-replication assay.

  11. The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication

    SciTech Connect

    Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J.

    2016-02-15

    Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics. - Highlights: • The host eIF4AIII RNA helicase is required for efficient HCMV replication. • Depleting eIF4AIII inhibited the nuclear export of HCMV mRNAs. • HCMV mRNAs did not require eIF4AIII to associate with polyribosomes. • The eIF4A family helicases may be new targets for host-directed antiviral drugs.

  12. Inter-laboratory assessment of different digital PCR platforms for quantification of human cytomegalovirus DNA.

    PubMed

    Pavšič, Jernej; Devonshire, Alison; Blejec, Andrej; Foy, Carole A; Van Heuverswyn, Fran; Jones, Gerwyn M; Schimmel, Heinz; Žel, Jana; Huggett, Jim F; Redshaw, Nicholas; Karczmarczyk, Maria; Mozioğlu, Erkan; Akyürek, Sema; Akgöz, Müslüm; Milavec, Mojca

    2017-04-01

    Quantitative PCR (qPCR) is an important tool in pathogen detection. However, the use of different qPCR components, calibration materials and DNA extraction methods reduces comparability between laboratories, which can result in false diagnosis and discrepancies in patient care. The wider establishment of a metrological framework for nucleic acid tests could improve the degree of standardisation of pathogen detection and the quantification methods applied in the clinical context. To achieve this, accurate methods need to be developed and implemented as reference measurement procedures, and to facilitate characterisation of suitable certified reference materials. Digital PCR (dPCR) has already been used for pathogen quantification by analysing nucleic acids. Although dPCR has the potential to provide robust and accurate quantification of nucleic acids, further assessment of its actual performance characteristics is needed before it can be implemented in a metrological framework, and to allow adequate estimation of measurement uncertainties. Here, four laboratories demonstrated reproducibility (expanded measurement uncertainties below 15%) of dPCR for quantification of DNA from human cytomegalovirus, with no calibration to a common reference material. Using whole-virus material and extracted DNA, an intermediate precision (coefficients of variation below 25%) between three consecutive experiments was noted. Furthermore, discrepancies in estimated mean DNA copy number concentrations between laboratories were less than twofold, with DNA extraction as the main source of variability. These data demonstrate that dPCR offers a repeatable and reproducible method for quantification of viral DNA, and due to its satisfactory performance should be considered as candidate for reference methods for implementation in a metrological framework.

  13. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  14. Diagnosis and Management of Human Cytomegalovirus Infection in the Mother, Fetus, and Newborn Infant

    PubMed Central

    Revello, Maria Grazia; Gerna, Giuseppe

    2002-01-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection and mental retardation. HCMV infection, while causing asymptomatic infections in most immunocompetent subjects, can be transmitted during pregnancy from the mother with primary (and also recurrent) infection to the fetus. Hence, careful diagnosis of primary infection is required in the pregnant woman based on the most sensitive serologic assays (immunoglobulin M [IgM] and IgG avidity assays) and conventional virologic and molecular procedures for virus detection in blood. Maternal prognostic markers of fetal infection are still under investigation. If primary infection is diagnosed in a timely manner, prenatal diagnosis can be offered, including the search for virus and virus components in fetal blood and amniotic fluid, with fetal prognostic markers of HCMV disease still to be defined. However, the final step for definite diagnosis of congenital HCMV infection is detection of virus in the blood or urine in the first 1 to 2 weeks of life. To date, treatment of congenital infection with antiviral drugs is only palliative both prior to and after birth, whereas the only efficacious preventive measure seems to be the development of a safe and immunogenic vaccine, including recombinant, subunit, DNA, and peptide-based vaccines now under investigation. The following controversial issues are discussed in the light of the most recent advances in the field: the actual perception of the problem; universal serologic screening before pregnancy; the impact of correct counseling on decision making by the couple involved; the role of prenatal diagnosis in ascertaining transmission of virus to the fetus; the impact of preconceptional and periconceptional infections on the prevalence of congenital infection; and the prevalence of congenitally infected babies born to mothers who were immune prior to pregnancy compared to the number born to mothers undergoing primary infection during pregnancy. PMID

  15. Quantification of Epstein-Barr Virus and Human Cytomegalovirus in Chronic Periodontal Patients

    PubMed Central

    Khosropanah, Hengameh; Karandish, Maryam; Ziaeyan, Mazyar; Jamalidoust, Marzieh

    2015-01-01

    Background: Although studies focused mainly on the identification of periopathogenic bacteria, recent reports have suggested that various herpes viruses may also be involved in the occurrence and progression of different forms of periodontal diseases. Objectives: This study aimed to compare the prevalence and load of Epstein-Barr Virus (EBV) and Human Cytomegalovirus (HCMV) in subgingival tissue specimens between chronic periodontitis and healthy sites. Patients and Methods: A total of 60 samples from the systematically healthy patients with chronic periodontitis participated in this study (mean age, 35 ± 7). Clinical periodontal evaluation included the plaque index (PI) (Loe and Silness), bleeding on probing (BOP) (O’Leary), bleeding index, periodontal pocket depth (PPD) and clinical attachment level measurement. Tissue specimens harvested from > 6 mm periodontal pockets and from ≤ 3 mm sulcus depth in a quadrant of the same patient using periodontal curettes. Moreover, the unstimulated whole saliva was gathered as a shedding medium. A Taq-man Real-Time Polymerase Chain Reaction assay was used to identify genomic copies of periodontal HCMV and EBV. Data were analyzed by the Wilcoxon-signed ranks and Friedman tests using the SPSS 16 software. Results: Out of 60 samples of subgingival tissues taken from the patients with chronic periodontitis, EBV count was the highest in saliva and the least in the tissue sample with PD < 3 mm (P < 0.05). The highest HCMV count was in saliva and tissue samples with PD > 6 mm (P < 0.05). Conclusions: According to the results of this study, quantification of HCMV and EBV observed in this study is high in periodontal tissue samples of severe chronic periodontitis. PMID:26322203

  16. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism.

    PubMed

    Li, Gang; Nguyen, Christopher C; Ryckman, Brent J; Britt, William J; Kamil, Jeremy P

    2015-04-07

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes.

  17. Diagnostic value of amplification of human cytomegalovirus DNA from gastrointestinal biopsies from human immunodeficiency virus-infected patients.

    PubMed Central

    Cotte, L; Drouet, E; Bissuel, F; Denoyel, G A; Trepo, C

    1993-01-01

    In order to assess the value of human cytomegalovirus (HCMV) DNA amplification of gastrointestinal biopsies, we studied 57 human immunodeficiency virus-infected patients with and without gastrointestinal HCMV diseases. After DNA extraction, a 406-bp fragment from the unique short region of the HCMV genome was amplified by 35 cycles of polymerase chain reaction (PCR) and semiquantified from 80 to 80,000 HCMV genomic copies. Among 12 non-AIDS patients, the PCR assay was negative for 11 of 12 duodenal and 8 of 8 colorectal samples. It was also negative for 28 of 31 duodenal and 12 of 15 colorectal samples from 31 AIDS patients without gastrointestinal HCMV diseases. Among 14 AIDS patients with gastrointestinal HCMV diseases, the PCR assay was positive for 12 of 12 patients with HCMV duodenitis and for 13 of 13 patients with HCMV colitis. Results were dichotomized between high and low HCMV-DNA copy numbers. For duodenitis, sensitivity was 92% and specificity was 100%. For colitis, sensitivity was 92% and specificity was 93%. Specificity and sensitivity were not influenced by shedding status for HCMV or by other gastrointestinal infections. HCMV DNA amplification of gastrointestinal biopsies is a sensitive and specific tool for the diagnosis of gastrointestinal HCMV diseases in AIDS patients. Images PMID:8396587

  18. Human cytomegalovirus infection leads to elevated levels of transplant arteriosclerosis in a humanized mouse aortic xenograft model.

    PubMed

    Abele-Ohl, S; Leis, M; Wollin, M; Mahmoudian, S; Hoffmann, J; Müller, R; Heim, C; Spriewald, B M; Weyand, M; Stamminger, T; Ensminger, S M

    2012-07-01

    Recent findings emphasized an important role of human cytomegalovirus (HCMV) infection in the development of transplant arteriosclerosis. Therefore, the aim of this study was to develop a human peripheral blood lymphocyte (hu-PBL)/Rag-2(-/-) γc(-/-) mouse-xenograft-model to investigate both immunological as well as viral effector mechanisms in the progression of transplant arteriosclerosis. For this, sidebranches from the internal mammary artery were recovered during coronary artery bypass graft surgery, tissue-typed and infected with HCMV. Then, size-matched sidebranches were implanted into the infrarenal aorta of Rag-2(-/-) γc(-/-) mice. The animals were reconstituted with human peripheral blood mononuclear cells (PBMCs) 7 days after transplantation. HCMV-infection was confirmed by Taqman-PCR and immunofluorescence analyses. Arterial grafts were analyzed by histology on day 40 after transplantation. PBMC-reconstituted Rag-2(-/-) γc(-/-) animals showed splenic chimerism levels ranging from 1-16% human cells. After reconstitution, Rag-2(-/-) γc(-/-) mice developed human leukocyte infiltrates in their grafts and vascular lesions that were significantly elevated after infection. Cellular infiltration revealed significantly increased ICAM-1 and PDGF-R-β expression after HCMV-infection of the graft. Arterial grafts from unreconstituted Rag-2(-/-) γc(-/-) recipients showed no vascular lesions. These data demonstrate a causative relationship between HCMV-infection as an isolated risk factor and the development of transplant-arteriosclerosis in a humanized mouse arterial-transplant-model possibly by elevated ICAM-1 and PDGF-R-β expression.

  19. Xenotransplantation and porcine cytomegalovirus.

    PubMed

    Denner, Joachim

    2015-01-01

    Porcine microorganisms may be transmitted to the human recipient when xenotransplantation with pig cells, tissues, and organs will be performed. Most of such microorganisms can be eliminated from the donor pig by specified or designated pathogen-free production of the animals. As human cytomegalovirus causes severe transplant rejection in allotransplantation, considerable concern is warranted on the potential pathogenicity of porcine cytomegalovirus (PCMV) in the setting of xenotransplantation. On the other hand, despite having a similar name, PCMV is different from HCMV. The impact of PCMV infection on pigs is known; however, the influence of PCMV on the human transplant recipient is unclear. However, first transplantations of pig organs infected with PCMV into non-human primates were associated with a significant reduction of the survival time of the transplants. Sensitive detection methods and strategies for elimination of PCMV from donor herds are required.

  20. Human Cytomegalovirus Vaccine Based on the Envelope gH/gL Pentamer Complex

    PubMed Central

    Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A.; Diamond, Don J.

    2014-01-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  1. Human Cytomegalovirus Can Procure Deoxyribonucleotides for Viral DNA Replication in the Absence of Retinoblastoma Protein Phosphorylation

    PubMed Central

    Kuny, Chad V.

    2016-01-01

    ABSTRACT Viral DNA replication requires deoxyribonucleotide triphosphates (dNTPs). These molecules, which are found at low levels in noncycling cells, are generated either by salvage pathways or through de novo synthesis. Nucleotide synthesis utilizes the activity of a series of nucleotide-biosynthetic enzymes (NBEs) whose expression is repressed in noncycling cells by complexes between the E2F transcription factors and the retinoblastoma (Rb) tumor suppressor. Rb-E2F complexes are dissociated and NBE expression is activated during cell cycle transit by cyclin-dependent kinase (Cdk)-mediated Rb phosphorylation. The DNA virus human cytomegalovirus (HCMV) encodes a viral Cdk (v-Cdk) (the UL97 protein) that phosphorylates Rb, induces the expression of cellular NBEs, and is required for efficient viral DNA synthesis. A long-held hypothesis proposed that viral proteins with Rb-inactivating activities functionally similar to those of UL97 facilitated viral DNA replication in part by inducing the de novo production of dNTPs. However, we found that dNTPs were limiting even in cells infected with wild-type HCMV in which UL97 is expressed and Rb is phosphorylated. Furthermore, we revealed that both de novo and salvage pathway enzymes contribute to viral DNA replication during HCMV infection and that Rb phosphorylation by cellular Cdks does not correct the viral DNA replication defect observed in cells infected with a UL97-deficient virus. We conclude that HCMV can obtain dNTPs in the absence of Rb phosphorylation and that UL97 can contribute to the efficiency of DNA replication in an Rb phosphorylation-independent manner. IMPORTANCE Transforming viral oncoproteins, such as adenovirus E1A and papillomavirus E7, inactivate Rb. The standard hypothesis for how Rb inactivation facilitates infection with these viruses is that it is through an increase in the enzymes required for DNA synthesis, which include nucleotide-biosynthetic enzymes. However, HCMV UL97, which functionally

  2. Human cytomegalovirus UL49 encodes an early, virion-associated protein essential for virus growth in human foreskin fibroblasts.

    PubMed

    Zhu, Feng; Yuan, Jian; Li, Hong-Jian; Zeng, Zhi-Feng; Luo, Zhi-Wen; Li, Shi-Qian; He, Chi-Qiang; Jia, Xue-Fang; Zhang, Xin; Zuo, Hui; Liu, Yi-Min; Chang, Martin; Li, Yue-Qin; Zhou, Tian-Hong

    2016-05-01

    Despite recent results of deletion experiments showing that open reading frame (ORF) UL49 of human cytomegalovirus (HCMV) is essential, the expression, function and functional location of its encoded protein remain unknown. We generated an antibody specific for pUL49 to investigate the protein product encoded by the UL49 ORF and identified its function in HCMV-infected host foreskin fibroblasts. A bacterial artificial chromosome (BAC) of HCMV strain Towne (pRV-Towne) and the UL49-deleted mutant pRV-delUL49Towne were used to observe virus growth by plaque assay. Using a UL49-protein-binding antibody, we located pUL49 in the fibroblast cytoplasm. pUL49 exhibited expression kinetics resembling those of the class β-2 proteins and was detected in the virion tegument. Following deletion of UL49 ORF, the virus failed to replicate, but it could be recovered by addition of pUL49 from pCDNA3.1 (+)-UL49. Our findings indicate that UL49 ORF is essential for HCMV replication in host foreskin fibroblasts.

  3. RNA interference-mediated targeting of human cytomegalovirus immediate-early or early gene products inhibits viral replication with differential effects on cellular functions.

    PubMed

    Xiaofei, E; Stadler, Bradford M; Debatis, Michelle; Wang, Shixia; Lu, Shan; Kowalik, Timothy F

    2012-05-01

    Viral drug toxicity, resistance, and an increasing immunosuppressed population warrant continued research into new avenues for limiting diseases associated with human cytomegalovirus (HCMV). In this study, a small interfering RNA (siRNA), siX3, was designed to target coding sequences within shared exon 3 of UL123 and UL122 transcripts encoding IE1 and IE2 immediate-early proteins of HCMV. Pretreatment of cells with siX3 reduced the levels of viral protein expression, DNA replication, and progeny virus production compared to control siRNA. Two siRNAs against UL54 and overlapping transcripts (UL55-57) were compared to siX3 in HCMV infection and were also found to be effective at inhibiting HCMV replication. Further investigation into the effects of the siRNAs on viral replication showed that pretreatment with each of the siRNAs resulted in an inhibition in the formation of mature replication compartments. The ability of these siRNAs to prevent or reduce certain cytopathic effects associated with HCMV infection was also examined. Infected cells pretreated with siX3, but not siUL54, retained promyelocytic leukemia (PML) protein in cellular PML bodies, an essential component of this host intrinsic antiviral defense. DNA damage response proteins, which are localized in nuclear viral replication compartments, were reduced in the siX3- and siUL54-treated cells. siX3, but not siUL54, prevented DNA damage response signaling early after infection. Therapeutic efficacy was demonstrated by treating cells with siRNAs after HCMV replication had commenced. Together, these findings suggest that siRNAs targeting exon 3 of the major IE genes or the UL54-57 transcripts be further studied for their potential development into anti-HCMV therapeutics.

  4. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

    PubMed Central

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-01-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  5. High-Throughput Analysis of Human Cytomegalovirus Genome Diversity Highlights the Widespread Occurrence of Gene-Disrupting Mutations and Pervasive Recombination

    PubMed Central

    Thys, Kim; Mbong Ngwese, Mirabeau; Van Damme, Ellen; Dvorak, Jan; Van Loock, Marnix; Li, Guangdi; Tachezy, Ruth; Busson, Laurent; Aerssens, Jeroen; Van Ranst, Marc

    2015-01-01

    ABSTRACT Human cytomegalovirus is a widespread pathogen of major medical importance. It causes significant morbidity and mortality in immunocompromised individuals, and congenital infections can result in severe disabilities or stillbirth. Development of a vaccine is prioritized, but no candidate is close to release. Although correlations of viral genetic variability with pathogenicity are suspected, knowledge about the strain diversity of the 235-kb genome is still limited. In this study, 96 full-length human cytomegalovirus genomes from clinical isolates were characterized, quadrupling the amount of information available for full-genome analysis. These data provide the first high-resolution map of human cytomegalovirus interhost diversity and evolution. We show that cytomegalovirus is significantly more divergent than all other human herpesviruses and highlight hot spots of diversity in the genome. Importantly, 75% of strains are not genetically intact but contain disruptive mutations in a diverse set of 26 genes, including the immunomodulatory genes UL40 and UL111A. These mutants are independent of culture passage artifacts and circulate in natural populations. Pervasive recombination, which is linked to the widespread occurrence of multiple infections, was found throughout the genome. The recombination density was significantly higher than those of other human herpesviruses and correlated with strain diversity. While the overall effects of strong purifying selection on virus evolution are apparent, evidence of diversifying selection was found in several genes encoding proteins that interact with the host immune system, including UL18, UL40, UL142, and UL147. These residues may present phylogenetic signatures of past and ongoing virus-host interactions. IMPORTANCE Human cytomegalovirus has the largest genome of all viruses that infect humans. Currently, there is a great interest in establishing associations between genetic variants and strain pathogenicity of

  6. Quantitative analysis of human herpesvirus-6 and human cytomegalovirus in blood and saliva from patients with acute leukemia.

    PubMed

    Nefzi, Faten; Ben Salem, Nabil Abid; Khelif, Abderrahim; Feki, Salma; Aouni, Mahjoub; Gautheret-Dejean, Agnès

    2015-03-01

    Human herpesvirus-6 (HHV-6) and human cytomegalovirus (HCMV) DNAs were quantified by real-time PCR assays in blood and saliva obtained from 50 patients with acute leukemia at the time of diagnosis (50 of each matrix), aplasia (65 of each matrix), remission (55 of each matrix), and relapse (20 of each matrix) to evaluate which biological matrix was more suitable to identify a viral reactivation, search for a possible link between HHV-6 and HCMV reactivations, and evaluate the relations between viral loads and count of different leukocyte types in blood. The median HHV-6 loads were 136; 219; 226, and 75 copies/million cells in blood at diagnosis, aplasia, remission and relapse, respectively. The HCMV loads were 193 and 317 copies/million cells in blood at diagnosis and remission. In the saliva samples, the HHV-6 loads were 22,165; 15,238; 30,214, and 17,454 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HCMV loads were 8,991; 1,461; 2,980, and 4,283 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HHV-6 load in the blood was correlated to the counts of polymorphonuclear leukocytes (R(2)  = 0.5; P < 0.0001) and lymphocytes (R(2)  = 0.4; P = 0.001) and was not correlated to the monocyte counts (R(2)  = 0.07; P = 0.7). Saliva appears to be a more sensitive biological matrix than whole blood in the detection of HHV-6 or HCMV reactivations. The HHV-6 and HCMV reactivations were linked only in saliva.

  7. Modulation of Homology-Directed Repair in T98G Glioblastoma Cells Due to Interactions between Wildtype p53, Rad51 and HCMV IE1-72

    PubMed Central

    Kulkarni, Amit S.; Fortunato, Elizabeth A.

    2014-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous pathogen capable of causing life threatening consequences in neonates and immune-compromised individuals. HCMV inflicts site-specific double strand breaks (DSBs) in the cellular genome. DNA damage infliction raises the corollary question of virus modulation of DNA repair. We recently reported HDR was stimulated in wt human foreskin fibroblasts (HFFs) during fully permissive infection or expression of the HCMV protein IE1-72 (IE72). These studies have been extended into semi-permissive T98G glioblastoma cells. T98Gs encode a mutant p53, which may contribute to their high baseline rate of HDR. We fully expected HCMV infection to increase HDR in T98Gs, similar to its effects in HFFs. Surprisingly in T98Gs HCMV infection, or sole expression of IE72, decreased HDR by two-fold. Transient expression of wt p53 in T98Gs also reduced HDR by two-fold. Dual transient expression of wt p53 and IE72 restored high baseline HDR levels. GST pulldown experiments revealed that both IE72 and wt p53 bound the important HDR protein, Rad51. We conclude that the expression of certain HCMV proteins can modulate HDR in an infected cell, dependent upon p53 status. We propose a model of the protein interactions explaining this behavior. PMID:24576846

  8. Expression of human cytomegalovirus pp150 gene in transgenic Vicia faba L. and immunogenicity of pp150 protein in mice.

    PubMed

    Yan, Hua; Yan, Huishen; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

    2010-03-01

    The pp150 gene of human cytomegalovirus (HCMV) was transferred into Vicia faba plants by Agrobacterium tumefaciens-mediated transformation. Three of five hygromycin resistant V. faba plants were identified as positive by PCR and dot-blot hybridization. The ELISA results indicated that pp150 protein from three plants of transformed V. faba leaves and seeds made up 0.005-0.015% of the total soluble protein. The results of detection by immunoblot and inhibition of immunofluorescent assay (IFA) showed that pp150 soluble protein had immunity activity. HCMV pp150-specific antibody (IgG, IgA) and IFN-gamma producing T cells were detected in 100% of the mice immunized with pp150 transgenic V. faba seeds by ELISA and intracellular staining and flow cytometry analysis, respectively. The transgenic V. faba plants will provide new material for the development of edible vaccination against HCMV infection.

  9. Detection of human cytomegalovirus by slot-blot hybridization assay employing oligo-primed /sup 32/P-labelled probe

    SciTech Connect

    Agha, S.A.; Coleman, J.C.; Selwyn, S.; Mahmound, L.A.; Abd-Elaal, A.M.; Archard, L.C.

    1988-12-01

    A /sup 32/P-labelled Hind III-0 DNA fragment (nine Kilobases; Kb) from human cytomegalovirus AD-169 (HCMV) was used in slot-blot hybridization assay for the detection of HCMV in clinical samples. The results obtained with DNA hybridization assay (DNA HA) were compared with virus isolation using conventional tube cell culture (CTC) and centrifugation vial culture (CVC), immunofluorescence (IF), and complement fixation test (CFT). Of 15 CTC-positive samples, 13 were positive with DNA HA (sensitivity 86.7%). Also, 14 additional samples were DNA HA-positive but CTC-negative. CVC and/or IF confirmed the diagnosis in nine of 14; the remaining five samples were from three patients who showed fourfold rising antibody titre by CFT. Although DNA HA using /sup 32/P-labelled probes is relatively cumbersome and expensive, it is a valuable test for quantitation of viral shedding in patients with HCMV infections who may benefit from antiviral therapy.

  10. Use of recombination-mediated genetic engineering for construction of rescue human cytomegalovirus bacterial artificial chromosome clones.

    PubMed

    Dulal, Kalpana; Silver, Benjamin; Zhu, Hua

    2012-01-01

    Bacterial artificial chromosome (BAC) technology has contributed immensely to manipulation of larger genomes in many organisms including large DNA viruses like human cytomegalovirus (HCMV). The HCMV BAC clone propagated and maintained inside E. coli allows for accurate recombinant virus generation. Using this system, we have generated a panel of HCMV deletion mutants and their rescue clones. In this paper, we describe the construction of HCMV BAC mutants using a homologous recombination system. A gene capture method, or gap repair cloning, to seize large fragments of DNA from the virus BAC in order to generate rescue viruses, is described in detail. Construction of rescue clones using gap repair cloning is highly efficient and provides a novel use of the homologous recombination-based method in E. coli for molecular cloning, known colloquially as recombineering, when rescuing large BAC deletions. This method of excising large fragments of DNA provides important prospects for in vitro homologous recombination for genetic cloning.

  11. Structure of human cytomegalovirus UL141 binding to TRAIL-R2 reveals novel, non-canonical death receptor interactions.

    PubMed

    Nemčovičová, Ivana; Benedict, Chris A; Zajonc, Dirk M

    2013-03-01

    The TRAIL (TNF-related apoptosis inducing ligand) death receptors (DRs) of the tumor necrosis factor receptor superfamily (TNFRSF) can promote apoptosis and regulate antiviral immunity by maintaining immune homeostasis during infection. In turn, human cytomegalovirus (HCMV) expresses immunomodulatory proteins that down-regulate cell surface expression of TNFRSF members as well as poliovirus receptor-related proteins in an effort to inhibit host immune effector pathways that would lead to viral clearance. The UL141 glycoprotein of human cytomegalovirus inhibits host defenses by blocking cell surface expression of TRAIL DRs (by retention in ER) and poliovirus receptor CD155, a nectin-like Ig-fold molecule. Here we show that the immunomodulatory function of HCMV UL141 is associated with its ability to bind diverse proteins, while utilizing at least two distinct binding sites to selectively engage TRAIL DRs or CD155. Binding studies revealed high affinity interaction of UL141 with both TRAIL-R2 and CD155 and low affinity binding to TRAIL-R1. We determined the crystal structure of UL141 bound to TRAIL-R2 at 2.1 Å resolution, which revealed that UL141 forms a homodimer that engages two TRAIL-R2 monomers 90° apart to form a heterotetrameric complex. Our structural and biochemical data reveal that UL141 utilizes its Ig-domain to facilitate non-canonical death receptor interactions while UL141 partially mimics the binding site of TRAIL on TRAIL-R2, which we found to be distinct from that of CD155. Moreover, UL141 also binds to an additional surface patch on TRAIL-R2 that is distinct from the TRAIL binding site. Therefore, the breadth of UL141-mediated effects indicates that HCMV has evolved sophisticated strategies to evade the immune system by modulating multiple effector pathways.

  12. Human cytomegalovirus gene UL21a encodes a short-lived cytoplasmic protein and facilitates virus replication in fibroblasts.

    PubMed

    Fehr, Anthony R; Yu, Dong

    2010-01-01

    The human cytomegalovirus (HCMV) gene UL21a was recently annotated by its conservation in chimpanzee cytomegalovirus. Two large-scale mutagenic analyses showed that mutations in overlapping UL21a/UL21 resulted in a severe defect of virus growth in fibroblasts. Here, we characterized UL21a and demonstrated its role in HCMV infection. We mapped a UL21a-specific transcript of approximately 600 bp that was expressed with early kinetics. UL21a encoded pUL21a, a protein of approximately 15 kDa, which was unstable and localized predominantly to the cytoplasm during HCMV infection or when expressed alone. Interestingly, pUL21a was drastically stabilized in the presence of proteasome inhibitor MG132, but its instability was independent of a functional ubiquitin-mediated pathway, suggesting that pUL21a underwent proteasome-dependent, ubiquitin-independent degradation. A UL21a deletion virus was attenuated in primary human newborn foreskin fibroblasts (HFFs) and embryonic lung fibroblasts (MRC-5), whereas a marker-rescued virus and mutant viruses lacking the neighboring or overlapping genes UL20, UL21, or UL21.5-UL23 replicated at wild-type levels. The growth defect of UL21a-deficient virus in MRC-5 cells was more pronounced than that in HFFs. At a high multiplicity of infection, the UL21a deletion virus synthesized viral proteins with wild-type kinetics but had a two- to threefold defect in viral DNA replication. More importantly, although pUL21a was not detected in the virion, progeny virions produced by the mutant virus were approximately 10 times less infectious than wild-type virus, suggesting that UL21a is required for HCMV to establish efficient productive infection. We conclude that UL21a encodes a short-lived cytoplasmic protein and facilitates HCMV replication in fibroblasts.

  13. SPAM-8, a mouse-human heteromyeloma fusion partner in the production of human monoclonal antibodies. Establishment of a human monoclonal antibody against cytomegalovirus.

    PubMed

    Gustafsson, B; Jondal, M; Sundqvist, V A

    1991-01-01

    A heteromyeloma (mouse x human) cell line (SPAM-8) was produced by fusing mouse myeloma cells (SP2/0) with human peripheral blood lymphocytes. The cells were sensitive to aminopterin and resistant to ouabain. The cells showed a doubling time of about 19 hours and a cloning efficiency of 0.8 cells/well (to obtain growth in 50% of wells seeded) using mouse thymocytes as feeder cells. The number of chromosomes was about 86 and 1% of the total DNA was of human origin. Fusion of SPAM-8 cells with lymphocytes prepared from human spleens resulted in approximately one hybridoma per 10(5) seeded lymphocytes. A trioma (human x [mouse x human]) cell line was established by fusing cells of an Epstein-Barr virus-transformed B cell line with SPAM-8 cells. The trioma cells produced antibodies (IgG1, K) against cytomegalovirus, in a concentration of 7 micrograms/ml in spent medium, over a period of six months of continuous culture. The results obtained indicate that the heteromyeloma SPAM-8 may be used as a fusion partner in the production of human monoclonal antibodies.

  14. Cervical shedding of cytomegalovirus in human immunodeficiency virus type 1-infected women.

    PubMed

    Mostad, S B; Kreiss, J K; Ryncarz, A J; Overbaugh, J; Mandaliya, K; Chohan, B; Ndinya-Achola, J; Bwayo, J J; Corey, L

    1999-12-01

    Cervical shedding of cytomegalovirus (CMV) is important in transmission of CMV to exposed sexual partners and neonates. We evaluated prevalence and correlates of CMV DNA shedding in cervical secretions from a large cohort of HIV-1-seropositive women. Using polymerase chain reaction (PCR) assays, CMV DNA was detected in 183 (59%) cervical swab samples from 311 women. Cervical shedding of CMV DNA was significantly associated with shedding of HIV-1 DNA (odds ratio 1.8; 95% confidence interval 1.1-2.8). CMV shedding was also more frequent in women with Neisseria gonorrhoeae and Trichomonas vaginalis infections, but these associations were not statistically significant. Cervical shedding of CMV in HIV-1-infected women is very frequent and may reflect higher risk of transmission to sexual partners and neonates than previously appreciated.

  15. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture.

    PubMed

    Gardner, Thomas J; Hernandez, Rosmel E; Noriega, Vanessa M; Tortorella, Domenico

    2016-03-30

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV.

  16. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture

    PubMed Central

    Gardner, Thomas J.; Hernandez, Rosmel E.; Noriega, Vanessa M.; Tortorella, Domenico

    2016-01-01

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV. PMID:27026399

  17. Letermovir and inhibitors of the terminase complex: a promising new class of investigational antiviral drugs against human cytomegalovirus

    PubMed Central

    Melendez, Dante P; Razonable, Raymund R

    2015-01-01

    Infection with cytomegalovirus is prevalent in immunosuppressed patients. In solid organ transplant and hematopoietic stem cell transplant recipients, cytomegalovirus infection is associated with high morbidity and preventable mortality. Prevention and treatment of cytomegalovirus with currently approved antiviral drugs is often associated with side effects that sometimes preclude their use. Moreover, cytomegalovirus has developed mutations that confer resistance to standard antiviral drugs. During the last decade, there have been calls to develop novel antiviral drugs that could provide better options for prevention and treatment of cytomegalovirus. Letermovir (AIC246) is a highly specific antiviral drug that is currently undergoing clinical development for the management of cytomegalovirus infection. It acts by inhibiting the viral terminase complex. Letermovir is highly potent in vitro and in vivo against cytomegalovirus. Because of a distinct mechanism of action, it does not exhibit cross-resistance with other antiviral drugs. It is predicted to be active against strains that are resistant to ganciclovir, foscarnet, and cidofovir. To date, early-phase clinical trials suggest a very low incidence of adverse effects. Herein, we present a comprehensive review on letermovir, from its postulated novel mechanism of action to the results of most recent clinical studies. PMID:26345608

  18. The sequence and antiapoptotic functional domains of the human cytomegalovirus UL37 exon 1 immediate early protein are conserved in multiple primary strains.

    PubMed

    Hayajneh, W A; Colberg-Poley, A M; Skaletskaya, A; Bartle, L M; Lesperance, M M; Contopoulos-Ioannidis, D G; Kedersha, N L; Goldmacher, V S

    2001-01-05

    The human cytomegalovirus UL37 exon 1 gene encodes the immediate early protein pUL37x1 that has antiapoptotic and regulatory activities. Deletion mutagenesis analysis of the open reading frame of UL37x1 identified two domains that are necessary and sufficient for its antiapoptotic activity. These domains are confined within the segments between amino acids 5 to 34, and 118 to 147, respectively. The first domain provides the targeting of the protein to mitochondria. Direct PCR sequencing of UL37 exon 1 amplified from 26 primary strains of human cytomegalovirus demonstrated that the promoter, polyadenylation signal, and the two segments of pUL37x1 required for its antiapoptotic function were invariant in all sequenced strains and identical to those in AD169 pUL37x1. In total, UL37 exon 1 varies between 0.0 and 1.6% at the nucleotide level from strain AD169. Only 11 amino acids were found to vary in one or more viral strains, and these variations occurred only in the domains of pUL37x1 dispensable for its antiapoptotic function. We infer from this remarkable conservation of pUL37x1 in primary strains that this protein and, probably, its antiapoptotic function are required for productive replication of human cytomegalovirus in humans.

  19. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  20. Human Cytomegalovirus-Encoded Human Interleukin-10 (IL-10) Homolog Amplifies Its Immunomodulatory Potential by Upregulating Human IL-10 in Monocytes

    PubMed Central

    Avdic, Selmir; McSharry, Brian P.; Steain, Megan; Poole, Emma; Sinclair, John; Abendroth, Allison

    2016-01-01

    ABSTRACT The human cytomegalovirus (HCMV) gene UL111A encodes cytomegalovirus-encoded human interleukin-10 (cmvIL-10), a homolog of the potent immunomodulatory cytokine human interleukin 10 (hIL-10). This viral homolog exhibits a range of immunomodulatory functions, including suppression of proinflammatory cytokine production and dendritic cell (DC) maturation, as well as inhibition of major histocompatibility complex (MHC) class I and class II. Here, we present data showing that cmvIL-10 upregulates hIL-10, and we identify CD14+ monocytes and monocyte-derived macrophages and DCs as major sources of hIL-10 secretion in response to cmvIL-10. Monocyte activation was not a prerequisite for cmvIL-10-mediated upregulation of hIL-10, which was dose dependent and controlled at the transcriptional level. Furthermore, cmvIL-10 upregulated expression of tumor progression locus 2 (TPL2), which is a regulator of the positive hIL-10 feedback loop, whereas expression of a negative regulator of the hIL-10 feedback loop, dual-specificity phosphatase 1 (DUSP1), remained unchanged. Engagement of the hIL-10 receptor (hIL-10R) by cmvIL-10 led to upregulation of heme oxygenase 1 (HO-1), an enzyme linked with suppression of inflammatory responses, and this upregulation was required for cmvIL-10-mediated upregulation of hIL-10. We also demonstrate an important role for both phosphatidylinositol 3-kinase (PI3K) and STAT3 in the upregulation of HO-1 and hIL-10 by cmvIL-10. In addition to upregulating hIL-10, cmvIL-10 could exert a direct immunomodulatory function, as demonstrated by its capacity to upregulate expression of cell surface CD163 when hIL-10 was neutralized. This study identifies a mechanistic basis for cmvIL-10 function, including the capacity of this viral cytokine to potentially amplify its immunosuppressive impact by upregulating hIL-10 expression. IMPORTANCE Human cytomegalovirus (HCMV) is a large, double-stranded DNA virus that causes significant human disease

  1. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model.

    PubMed

    Slavuljica, Irena; Kveštak, Daria; Huszthy, Peter Csaba; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-03-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8(+) T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed.

  2. Human Cytomegaloviruses Expressing Yellow Fluorescent Fusion Proteins - Characterization and Use in Antiviral Screening

    PubMed Central

    Straschewski, Sarah; Warmer, Martin; Frascaroli, Giada; Hohenberg, Heinrich; Mertens, Thomas; Winkler, Michael

    2010-01-01

    Recombinant viruses labelled with fluorescent proteins are useful tools in molecular virology with multiple applications (e.g., studies on intracellular trafficking, protein localization, or gene activity). We generated by homologous recombination three recombinant cytomegaloviruses carrying the enhanced yellow fluorescent protein (EYFP) fused with the viral proteins IE-2, ppUL32 (pp150), and ppUL83 (pp65). In growth kinetics, the three viruses behaved all like wild type, even at low multiplicity of infection (MOI). The expression of all three fusion proteins was detected, and their respective localizations were the same as for the unmodified proteins in wild-type virus–infected cells. We established the in vivo measurement of fluorescence intensity and used the recombinant viruses to measure inhibition of viral replication by neutralizing antibodies or antiviral substances. The use of these viruses in a pilot screen based on fluorescence intensity and high-content analysis identified cellular kinase inhibitors that block viral replication. In summary, these viruses with individually EYFP-tagged proteins will be useful to study antiviral substances and the dynamics of viral infection in cell culture. PMID:20161802

  3. Detection of human cytomegalovirus in clinical specimens by centrifugation culture with a nonhuman cell line.

    PubMed Central

    Gleaves, C A; Hursh, D A; Meyers, J D

    1992-01-01

    The sensitivities of MRC-5 and mink lung (ML) cells in centrifugation culture were compared simultaneously for the detection of cytomegalovirus (CMV) IE antigen (immediate-early antigen) from clinical specimens. Of 413 samples assayed, 51 (12%) were positive for CMV by both centrifugation and standard cell culture. At 20 h postinoculation (p.i.), 46 of 51 (90.2%) CMV-positive specimens were detected in ML cells. At 40 h p.i., 50 of 51 (98.0%) CMV-positive specimens were detected in ML cells, compared with 48 of 51 (94.0%) in MRC-5 cells. There was no significant difference in the detection of CMV in either cell line by centrifugation culture. However, in 19 of 23 positive samples that had countable foci at 20 h p.i., there was a 25% increase in the number of positive foci observed for ML cells compared with MRC-5 cells. Less toxicity was also noted for ML cells than for MRC cells, particularly in viral blood specimens. These data suggest that ML cells are comparable to MRC-5 cells for the rapid detection of CMV by centrifugation culture. PMID:1315330

  4. Dynamic and Nucleolin-Dependent Localization of Human Cytomegalovirus UL84 to the Periphery of Viral Replication Compartments and Nucleoli

    PubMed Central

    Bender, Brian J.

    2014-01-01

    ABSTRACT Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. IMPORTANCE The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and

  5. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  6. Preparation and identification of HLA-A*1101 tetramer loading with human cytomegalovirus pp65 antigen peptide.

    PubMed

    Li, Fengyao; Xu, Lihui; Zha, Qingbing; Chi, Xiaoyun; Jia, Qiantao; He, Xianhui

    2007-04-01

    MHC/peptide tetramer technology has been widely used to study antigen-specific T cells, especially for identifying virus-specific CD8+ T cells in humans. The tetramer molecule is composed of HLA heavy chain, beta2-microglobulin (beta2m), an antigenic peptide, and fluorescent-labeled streptavidin. To further investigate the HLA-A*1101-restricted CD8+ T cell responses against human cytomegalovirus (HCMV), we established an approach to prepare HLA-A*1101 tetramer complexed with a peptide from HCMV. The cDNA encoding HLA-A*1101 heavy chain was cloned and the prokaryotic expression vector for the ectodomain of HLA-A*1101 fused with a BirA substrate peptide (HLA-A*1101-BSP) at its carboxyl terminus was constructed. The fusion protein was highly expressed as inclusion bodies under optimized conditions in Escherichia coli. Moreover, HLA-A*1101-BSP protein was refolded in the presence of beta2m and an HCMV peptide pp65(16-24) (GPISGHVLK, GPI). Soluble HLA-A*1101-GPI monomer was biotinylated and purified to a purity of 95%, which was subsequently combined with streptavidin to form tetramers at a yield of > 80%. The HLA-A*1101-GPI tetramers could bind to virus-specific CD8+ T cells, suggesting soluble HLA-A*1101-GPI tetramers were biologically functional. This study provides the basis for further evaluation of HLA-A*1101-restricted CD8+ T cell responses against HCMV infection.

  7. Novel human cytomegalovirus viral chemokines, vCXCL-1s, display functional selectivity for neutrophil signaling and function

    PubMed Central

    Heo, Jinho; Dogra, Pranay; Masi, Tom J.; Pitt, Elisabeth A.; de Kruijf, Petra; Smit, Martine J.; Sparer, Tim E.

    2015-01-01

    Human cytomegalovirus (HCMV) uses members of the hematopoietic system including neutrophils for dissemination throughout the body. HCMV encodes a viral chemokine, vCXCL-1, that is postulated to attract neutrophils for dissemination within the host. The gene encoding vCXCL-1, UL146, is one of the most variable genes in the HCMV genome. Why HCMV has evolved this hypervariability and how this affects the virus’ dissemination/pathogenesis is unknown. Because the vCXCL-1 hypervariability maps to important binding and activation domains, we hypothesized that vCXCL-1s differentially activate neutrophils, which could contribute to HCMV dissemination and/or pathogenesis. In order to test whether these viral chemokines affect neutrophil function, we generated vCXCL-1 proteins from 11 different clades from clinical isolates from HCMV-congenitally infected infants. All vCXCL-1s were able to induce calcium flux at a concentration of 100 nM and integrin expression on human peripheral blood neutrophils (PBNs) in spite of differences in affinity for the CXCR1 and CXCR2 receptors. In fact their affinity for CXCR1 or CXCR2 did not directly correlate with chemotaxis, G protein-dependent and independent (β-arrestin2) activation, or secondary chemokine (CCL22) expression. Our data suggest that vCXCL-1 polymorphisms impact the binding affinity, receptor usage, and differential PBN activation that could contribute to HCMV dissemination and/or pathogenesis. PMID:25987741

  8. Human cytomegalovirus TRS1 protein associates with the 7-methylguanosine mRNA cap and facilitates translation.

    PubMed

    Ziehr, Benjamin; Lenarcic, Erik; Vincent, Heather A; Cecil, Chad; Garcia, Benjamin; Shenk, Thomas; Moorman, Nathaniel J

    2015-06-01

    Viruses rely on the host translation machinery for the synthesis of viral proteins. Human cells have evolved sensors that recognize viral RNAs and inhibit mRNA translation in order to limit virus replication. Understanding how viruses manipulate the host translation machinery to gain access to ribosomes and disable the antiviral response is therefore a critical aspect of the host/pathogen interface. In this study, we used a proteomics approach to identify human cytomegalovirus (HCMV) proteins that might contribute to viral mRNA translation. The HCMV TRS1 protein (pTRS1) associated with the 7-methylguanosine mRNA cap, increased the total level of protein synthesis, and colocalized with mRNAs undergoing translation initiation during infection. pTRS1 stimulated translation of a nonviral reporter gene and increased the translation of a reporter containing an HCMV 5' untranslated region (5'UTR) to a greater extent. The preferential effect of pTRS1 on translation of an mRNA containing a viral 5'UTR required the pTRS1 RNA and double-stranded RNA-dependent protein kinase (PKR)-binding domains, and was likely the result of PKR inhibition. However, pTRS1 also stimulated the total level of protein synthesis and translation directed by an HCMV 5'UTR in cells lacking PKR. Thus our results demonstrate that pTRS1 stimulates translation through both PKR-dependent and PKR-independent mechanisms.

  9. The antiviral restriction factors IFITM1, 2 and 3 do not inhibit infection of human papillomavirus, cytomegalovirus and adenovirus.

    PubMed

    Warren, Cody J; Griffin, Laura M; Little, Alexander S; Huang, I-Chueh; Farzan, Michael; Pyeon, Dohun

    2014-01-01

    Type I interferons (IFN-α and β) induce dynamic host defense mechanisms to inhibit viral infections. It has been recently recognized that the interferon-inducible transmembrane proteins (IFITM) 1, 2 and 3 can block entry of a broad spectrum of RNA viruses. However, no study to date has focused on the role of IFITM proteins in DNA virus restriction. Here, we demonstrate that IFN-α or -β treatment of keratinocytes substantially decreases human papillomavirus 16 (HPV16) infection while robustly inducing IFITM1, 2 and 3 expression. However, IFITM1, 2 and 3 overexpression did not inhibit HPV16 infection; rather, IFITM1 and IFITM3 modestly enhanced HPV16 infection in various cell types including primary keratinocytes. Moreover, IFITM1, 2 and 3 did not inhibit infection by two other DNA viruses, human cytomegalovirus (HCMV) and adenovirus type 5 (Ad5). Taken together, we reveal that the entry of several DNA viruses, including HPV, HCMV, and Ad5 is not affected by IFITM1, 2 and 3 expression. These results imply that HPV, and other DNA viruses, may bypass IFITM restriction during intracellular trafficking.

  10. A novel flow cytometry-based tool for determining the efficiency of human cytomegalovirus infection in THP-1 derived macrophages.

    PubMed

    Li, Huifen; Mao, Genxiang; Carlson, Joshua; Leng, Sean X

    2015-09-01

    Human cytomegalovirus (hCMV) is a ubiquitous pathogen that causes congenital infection and severe infections in immunocompromised patients. Chronic hCMV infection may also play an important role in immunosenescence and adverse health outcomes in older adults. THP-1, a human monocytic cell line and its derived macrophages serve as a useful cell culture model for mechanistic studies of hCMV infection and its underlying biology. A major methodological challenge is the lack of a quick and reliable tool to accurately determine the efficiency of hCMV infection in THP-1 derived macrophages. In this study, we developed a flow cytometry based method using commercially available monoclonal antibody (MAb) against hCMV immediate early (IE) antigen that can accurately determine infection efficiency. We used 0.5% formaldehyde for fixation, 90% methanol for permeabilization, and incubation with FITC conjugated MAb at 37°C. The method was tested by hCMV infection with laboratory Towne strain in the presence or absence of hydrocortisone. It was also compared with the routine flow cytometry protocol using Cytofix/Cytoperm solution and with immunofluorescence. The results indicate that this new method is reliable and time saving for accurate determination of infection efficiency. It may facilitate further investigations into the underlying biological mechanisms of hCMV infection.

  11. Multidrug resistance conferred by novel DNA polymerase mutations in human cytomegalovirus isolates.

    PubMed

    Scott, Gillian M; Weinberg, Adriana; Rawlinson, William D; Chou, Sunwen

    2007-01-01

    The emergence of antiviral-resistant cytomegalovirus (CMV) strains is a continuing clinical problem, with increased numbers of immunocompromised patients given longer-duration antiviral prophylaxis. Two previously unrecognized CMV DNA polymerase mutations (N408K and A834P) identified separately and together in at-risk lung and kidney transplant recipients and a third mutation (L737M) identified in a liver transplant recipient were characterized by marker transfer to antiviral-sensitive laboratory strains AD169 and Towne. Subsequent phenotypic analyses of recombinant strains demonstrated the ability of mutation N408K to confer ganciclovir (GCV) and cidofovir (CDV) resistance and of mutation A834P to confer GCV, foscarnet, and CDV resistance. Mutation L737M did not confer resistance to any of the antiviral agents tested. A recombinant strain containing both N408K and A834P demonstrated increased GCV and CDV resistance compared to the levels of resistance of the virus containing only the A834P mutation. The addition of mutation N408K in combination with A834P also partially reconstituted the replication impairment of recombinant virus containing only A834P. This suggests that perturbation of both DNA polymerization (A834P) and exonuclease (N408K) activities contributes to antiviral resistance and altered replication kinetics in these mutant strains. The identification of these multidrug-resistant CMV strains in at-risk seronegative recipients of organs from seropositive donors suggests that improved prophylactic and treatment strategies are required. The additive effect of multiple mutations on antiviral susceptibility suggests that increasing antiviral-resistant phenotypes can result from different virus-antiviral interactions.

  12. Clinical correlations of human cytomegalovirus strains and viral load in kidney transplant recipients.

    PubMed

    Nogueira, Eliana; Ozaki, Kikumi Suzete; Tomiyama, Helena; Câmara, Niels Olsen Saraiva; Granato, Celso Francisco Hernandes

    2009-01-01

    Little is known about clinical differences associated with cytomegalovirus (CMV) infection by distinct strains in renal transplant patients. Different clinical pictures may be associated with specific viral genotypes, viral load, as well as host factors. The objective of this study was to identify CMV strains to determine viral load (antigenemia), and their correlation with clinical data in renal transplant recipients. Seventy-one patients were enrolled, comprising 91 samples. After selection, polymorphonuclear cells were used to amplify and sequence the gB region of CMV DNA. The sequences were analyzed to ascertain the frequency of different genotypes. Additionally, the results of this study showed that the gB coding gene presents a great variability, revealing a variety of patterns: classical gB1 (1.4%), gB1V (46.4%), classical gB2 (35.2%), gB2V (2.8%), gB3 (1.4%), classical gB4 (4.9%) and gB4V (4.9%). The mean viral load in kidney transplant patient was 75.1 positive cells (1-1000). A higher viral load was observed in patients with genotype 4 infection. Statistically significant differences were detected between gB1 and gB4 (p=0.010), and between gB2 and gB4 (p=0.021). The average numbers of positive cells in relation to clinical presentation were: 34.5 in asymptomatic, 49.5 in CMV associated syndrome and 120.7 in patients with invasive disease (p=0.048). As a group, gB1 was the most frequent strain and revealed a potential risk for developing invasive disease. Viral load also seemed to be important as a marker associated with clinical presentation of the disease.

  13. Effect of human cytomegalovirus (HCMV) US27 on CXCR4 receptor internalization measured by fluorogen-activating protein (FAP) biosensors.

    PubMed

    Boeck, Jordan M; Spencer, Juliet V

    2017-01-01

    Human cytomegalovirus (HCMV) is a widespread pathogen and a member of the Herpesviridae family. HCMV has a large genome that encodes many genes that are non-essential for virus replication but instead play roles in manipulation of the host immune environment. One of these is the US27 gene, which encodes a protein with homology to the chemokine receptor family of G protein-coupled receptors (GPCRs). The US27 protein has no known chemokine ligands but can modulate the signaling activity of host receptor CXCR4. We investigated the mechanism for enhanced CXCR4 signaling in the presence of US27 using a novel biosensor system comprised of fluorogen activating proteins (FAPs). FAP-tagged CXCR4 and US27 were used to explore receptor internalization and recovery dynamics, and the results demonstrate that significantly more CXCR4 internalization was observed in the presence of US27 compared to CXCR4 alone upon stimulation with CXCL12. While ligand-induced endocytosis rates were higher, steady state internalization of CXCR4 was not affected by US27. Additionally, US27 underwent rapid endocytosis at a rate that was independent of either CXCR4 expression or CXCL12 stimulation. These results demonstrate that one mechanism by which US27 can enhance CXCR4 signaling is to alter receptor internalization dynamics, which could ultimately have the effect of promoting virus dissemination by increasing trafficking of HCMV-infected cells to tissues where CXCL12 is highly expressed.

  14. Activation of Langerhans-Type Dendritic Cells Alters Human Cytomegalovirus Infection and Reactivation in a Stimulus-Dependent Manner

    PubMed Central

    Coronel, Roxanne; Jesus, Desyree M.; Dalle Ore, Lucia; Mymryk, Joe S.; Hertel, Laura

    2016-01-01

    Oral mucosal Langerhans cells (LC) are likely to play important roles in host defense against infection by human cytomegalovirus (CMV). We previously showed that in vitro-differentiated immature LC (iLC) populations contain smaller amounts of infected cells but produce higher yields than mature LC (mLC) cultures, obtained by iLC stimulation with fetal bovine serum (FBS), CD40 ligand (CD40L) and lipopolysaccharide (LPS). Here, we sought to determine if exposure to select stimuli can improve LC permissiveness to infection, if specific components of the mLC cocktail are responsible for lowering viral yields, if this is due to defects in progeny production or release, and if these restrictions are also effective against reactivated virus. None of the stimuli tested extended the proportion of infected cells to 100%, suggesting that the block to infection onset cannot be fully removed. While CD40L and FBS exerted positive effects on viral progeny production per cell, stimulation with LPS alone or in combination with CD40L was detrimental. Reductions in viral titers were not due to defects in progeny release, and the permissive or restrictive intracellular environment established upon exposure to each stimulus appeared to act in a somewhat similar way toward lytic and latent infections. PMID:27683575

  15. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins.

    PubMed

    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R; Brune, Wolfram; Geballe, Adam P; Beau, Isabelle; Esclatine, Audrey

    2016-01-01

    Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus.

  16. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins

    PubMed Central

    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R.; Brune, Wolfram; Geballe, Adam P.; Beau, Isabelle; Esclatine, Audrey

    2016-01-01

    ABSTRACT Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus. PMID:26654401

  17. The highly conserved human cytomegalovirus UL136 ORF generates multiple Golgi-localizing protein isoforms through differential translation initiation.

    PubMed

    Liao, Huanan; Lee, Jung-Hyun; Kondo, Rikita; Katata, Marei; Imadome, Ken-Ichi; Miyado, Kenji; Inoue, Naoki; Fujiwara, Shigeyoshi; Nakamura, Hiroyuki

    2014-01-22

    The UL133-UL138 locus in the unique long b' (ULb') region of the human cytomegalovirus (HCMV) genome is considered to play certain roles in viral replication, dissemination and latency in a host cell type-dependent manner. Here we characterized the proteins encoded by UL136, one of the open reading frames (ORFs) in the locus. Comparative sequence analysis of UL136 among clinical isolates and laboratory strains indicates that its predicted amino-acid sequence is highly conserved. A polyclonal antibody against UL136 proteins (pUL136s) was raised against its carboxy-terminal region and this antibody specifically recognized at least five UL136-encoded protein isoforms of 29-17 kDa both in HCMV-infected cells and in cells transfected with a construct expressing pUL136. Immunofluorescence analysis with this antibody revealed localization of pUL136 in the Golgi apparatus. Analysis of several pUL136 mutants indicated that the putative transmembrane domain of pUL136 is required for its Golgi localization. Mutational analysis of multiple AUG codons in UL136 demonstrated that translation initiation from these AUG codons contributes in the generation of pUL136 isoforms.

  18. Effect of human cytomegalovirus (HCMV) US27 on CXCR4 receptor internalization measured by fluorogen-activating protein (FAP) biosensors

    PubMed Central

    Boeck, Jordan M.; Spencer, Juliet V.

    2017-01-01

    Human cytomegalovirus (HCMV) is a widespread pathogen and a member of the Herpesviridae family. HCMV has a large genome that encodes many genes that are non-essential for virus replication but instead play roles in manipulation of the host immune environment. One of these is the US27 gene, which encodes a protein with homology to the chemokine receptor family of G protein-coupled receptors (GPCRs). The US27 protein has no known chemokine ligands but can modulate the signaling activity of host receptor CXCR4. We investigated the mechanism for enhanced CXCR4 signaling in the presence of US27 using a novel biosensor system comprised of fluorogen activating proteins (FAPs). FAP-tagged CXCR4 and US27 were used to explore receptor internalization and recovery dynamics, and the results demonstrate that significantly more CXCR4 internalization was observed in the presence of US27 compared to CXCR4 alone upon stimulation with CXCL12. While ligand-induced endocytosis rates were higher, steady state internalization of CXCR4 was not affected by US27. Additionally, US27 underwent rapid endocytosis at a rate that was independent of either CXCR4 expression or CXCL12 stimulation. These results demonstrate that one mechanism by which US27 can enhance CXCR4 signaling is to alter receptor internalization dynamics, which could ultimately have the effect of promoting virus dissemination by increasing trafficking of HCMV-infected cells to tissues where CXCL12 is highly expressed. PMID:28207860

  19. A collaborative study to establish the 1st WHO International Standard for human cytomegalovirus for nucleic acid amplification technology.

    PubMed

    Fryer, Jacqueline F; Heath, Alan B; Minor, Philip D

    2016-07-01

    Variability in the performance of nucleic acid amplification technology (NAT)-based assays presents a significant problem in the diagnosis and management of human cytomegalovirus (HCMV) infections. Here we describe a collaborative study to evaluate the suitability of candidate reference materials to harmonize HCMV viral load measurements in a wide range of NAT assays. Candidate materials comprised lyophilized Merlin virus, liquid Merlin virus, liquid AD169 virus, and purified HCMV Merlin DNA cloned into a bacterial artificial chromosome. Variability in the laboratory mean HCMV concentrations determined for virus samples across the different assays was 2 log10. Variability for the purified DNA sample was higher (>3 log10). The agreement between laboratories was markedly improved when the potencies of the liquid virus samples were expressed relative to the lyophilized virus candidate. In contrast, the agreement between laboratories for the purified DNA sample was not improved. Results indicated the suitability of the lyophilized Merlin virus preparation as the 1st WHO International Standard for HCMV for NAT. It was established in October 2010, with an assigned potency of 5 × 10(6) International Units (IU) (NIBSC code 09/162). It is intended to be used to calibrate secondary references, used in HCMV NAT assays, in IU.

  20. Active human cytomegalovirus infection and glycoprotein b genotypes in brazilian pediatric renal or hematopoietic stem cell transplantation patients

    PubMed Central

    de Campos Dieamant, Débora; Bonon, Sandra Helena Alves; Prates, Liliane Cury; Belangelo, Vera Maria Santoro; Pontes, Erika R.; Costa, Sandra Cecília Botelho

    2010-01-01

    A prospective analysis of active Human Cytomegalovirus infection (HCMV) was conducted on 33 pediatric renal or hematopoietic stem cell post-transplant patients. The HCMV-DNA positive samples were evaluated for the prevalence of different gB subtypes and their subsequent correlation with clinical signs. The surveillance of HCMV active infection was based on the monitoring of antigenemia (AGM) and on a nested polymerase chain reaction (N-PCR) for the detection of HCMV in the patients studied. Using restriction analysis of the gB gene sequence by PCR-RFLP (Restriction Fragment Length Polymorphism), different HCMV strains could be detected and classified in at least four HCMV genotypes. Thirty-three pediatric recipients of renal or bone marrow transplantation were monitored. Twenty out of thirty-three (60.6%) patients demonstrated active HCMV infection. gB1 and gB2 genotypes were more frequent in this population. In this study, we observed that gB2 had correlation with reactivation of HCMV infection and that patients with mixture of genotypes did not show any symptoms of HCMV disease. Future studies has been made to confirm this. PMID:24031463

  1. Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line.

    PubMed

    Ioudinkova, Elena; Arcangeletti, Maria Cristina; Rynditch, Alla; De Conto, Flora; Motta, Federica; Covan, Silvia; Pinardi, Federica; Razin, Sergey V; Chezzi, Carlo

    2006-12-15

    Non-differentiated THP-1 cells can be infected by human cytomegalovirus (HCMV) Towne strain, which persists in these cells in a non-active (latent) form without undergoing a productive cycle. The same cells become permissive for HCMV lytic infection after induction of cell differentiation by treatment with 12-O-tetradecanoylphorbol-13-acetate. We used this cellular model to study the possible role of histone modifications in the control of HCMV latency. Using chromatin immunoprecipitation with antibodies against histone H3 acetylated or dimethylated in position K9, we demonstrated that in lytically infected cells the HCMV enhancer was associated with heavy acetylated but not dimethylated H3. In the case of latent infection, the HCMV enhancer was associated with neither acetylated nor dimethylated H3. HCMV genes encoding DNA polymerase (early), pp65 (early-late) and pp150 (late) proteins were associated preferentially with acetylated H3 in lytically infected cells and with dimethylated H3 in latently infected cells. These data strongly suggest that K9 methylation of H3 is involved in HCMV gene repression, while association of the above genes with acetylated histones is likely to be necessary for active transcription. It can be postulated that the same histone modifications are used to mark active and repressed genes in both cellular and viral chromatin.

  2. Activation of Innate and Adaptive Immunity by a Recombinant Human Cytomegalovirus Strain Expressing an NKG2D Ligand

    PubMed Central

    Tomić, Adriana; Varanasi, Pavankumar R.; Golemac, Mijo; Malić, Suzana; Riese, Peggy; Borst, Eva M.; Guzmán, Carlos A.; Krmpotić, Astrid

    2016-01-01

    Development of an effective vaccine against human cytomegalovirus (HCMV) is a need of utmost medical importance. Generally, it is believed that a live attenuated vaccine would best provide protective immunity against this tenacious pathogen. Here, we propose a strategy for an HCMV vaccine that aims at the simultaneous activation of innate and adaptive immune responses. An HCMV strain expressing the host ligand ULBP2 for the NKG2D receptor was found to be susceptible to control by natural killer (NK) cells, and preserved the ability to stimulate HCMV-specific T cells. Infection with the ULBP2-expressing HCMV strain caused diminished cell surface levels of MHC class I molecules. While expression of the NKG2D ligand increased the cytolytic activity of NK cells, NKG2D engagement in CD8+ T cells provided co-stimulation and compensated for lower MHC class I expression. Altogether, our data indicate that triggering of both arms of the immune system is a promising approach applicable to the generation of a live attenuated HCMV vaccine. PMID:27907183

  3. Human cytomegalovirus encoded chemokine receptor US28 activates the HIF-1α/PKM2 axis in glioblastoma cells

    PubMed Central

    van Senten, Jeffrey R.; Fraile-Ramos, Alberto; Siderius, Marco; Smit, Martine J.

    2016-01-01

    The human cytomegalovirus (HCMV) encoded chemokine receptor US28 promotes tumorigenesis through activation of various proliferative and angiogenic signaling pathways. Upon infection, US28 displays constitutive activity and signals in a G protein-dependent manner, hijacking the host's cellular machinery. In tumor cells, the hypoxia inducible factor-1α/pyruvate kinase M2 (HIF-1α/PKM2) axis plays an important role by supporting proliferation, angiogenesis and reprogramming of energy metabolism. In this study we show that US28 signaling results in activation of the HIF-1α/PKM2 feedforward loop in fibroblasts and glioblastoma cells. The constitutive activity of US28 increases HIF-1 protein stability through a Gαq-, CaMKII- and Akt/mTOR-dependent mechanism. Furthermore, we found that VEGF and lactate secretion are increased and HIF-1 target genes, glucose transporter type 1 (GLUT1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), involved in glucose metabolism, are upregulated in US28 expressing cells. In addition, PKM2 is phosphorylated and found to be in a tumor-associated dimeric state upon US28 expression. Also in HCMV-infected cells HIF-1 activity is enhanced, which in part is US28-dependent. Finally, increased proliferation of cells expressing US28 is abolished upon inhibition of the HIF-1α/PKM2 cascade. These data highlight the importance of HIF-1α and PKM2 in US28-induced proliferation, angiogenesis and metabolic reprogramming. PMID:27602585

  4. Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus.

    PubMed Central

    Roby, C; Gibson, W

    1986-01-01

    Phosphorylation of the proteins of human cytomegalovirus (CMV) virions, noninfectious enveloped particles (NIEPs), and dense bodies was investigated. Analyses of particles phosphorylated in vivo showed the following. Virions contain three predominant phosphoproteins (i.e., basic phosphoprotein and upper and lower matrix proteins) and at least nine minor phosphorylated species. NIEPs contain all of these and one additional major species, the assembly protein. Dense bodies contain only one (i.e., lower matrix) of the predominant and four of the minor virion phosphoproteins. Two-dimensional (charge-size) separations in denaturing polyacrylamide gels showed that the relative net charges of the predominant phosphorylated species ranged from the basic phosphoprotein to the more neutral upper matrix protein. In vitro assays showed that purified virions of human CMV have an associated protein kinase activity. The activity was detected only after disrupting the envelope; it had a pH optimum of approximately 9 to 9.5 and required a divalent cation, preferring magnesium to manganese. In vitro, this activity catalyzed phosphorylation of the virion proteins observed to be phosphorylated in vivo. Peptide comparisons indicated that the sites phosphorylated in vitro are a subset of those phosphorylated in vivo, underscoring the probable biological relevance of the kinase activity. Casein, phosvitin, and to a minor extent lysine-rich histones served as exogenous phosphate acceptors. Arginine-rich and lysine-rich histones and protamine sulfate, as well as the polyamines spermine and spermidine, stimulated incorporation of phosphate into the endogenous viral proteins. Virions of all human and simian CMV strains tested showed this activity. Analyses of other virus particles, including three intracellular capsid forms (i.e., A, B, and C capsids), NIEPs, and dense bodies, indicated that the active enzyme was not present in the capsid. Rate-velocity sedimentation of disrupted virions

  5. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  6. Human cytomegalovirus interleukin-10 polarizes monocytes toward a deactivated M2c phenotype to repress host immune responses.

    PubMed

    Avdic, Selmir; Cao, John Z; McSharry, Brian P; Clancy, Leighton E; Brown, Rebecca; Steain, Megan; Gottlieb, David J; Abendroth, Allison; Slobedman, Barry

    2013-09-01

    Several human cytomegalovirus (HCMV) genes encode products that modulate cellular functions in a manner likely to enhance viral pathogenesis. This includes UL111A, which encodes homologs of human interleukin-10 (hIL-10). Depending upon signals received, monocytes and macrophages become polarized to either classically activated (M1 proinflammatory) or alternatively activated (M2 anti-inflammatory) subsets. Skewing of polarization toward an M2 subset may benefit the virus by limiting the proinflammatory responses to infection, and so we determined whether HCMV-encoded viral IL-10 influenced monocyte polarization. Recombinant viral IL-10 protein polarized CD14(+) monocytes toward an anti-inflammatory M2 subset with an M2c phenotype, as demonstrated by high expression of CD163 and CD14 and suppression of major histocompatibility complex (MHC) class II. Significantly, in the context of productive HCMV infection, viral IL-10 produced by infected cells polarized uninfected monocytes toward an M2c phenotype. We also assessed the impact of viral IL-10 on heme oxygenase 1 (HO-1), which is an enzyme linked with suppression of inflammatory responses. Polarization of monocytes by viral IL-10 resulted in upregulation of HO-1, and inhibition of HO-1 function resulted in a loss of capacity of viral IL-10 to suppress tumor necrosis factor alpha (TNF-α) and IL-1β, implicating HO-1 in viral IL-10-induced suppression of proinflammatory cytokines by M2c monocytes. In addition, a functional consequence of monocytes polarized with viral IL-10 was a decreased capacity to activate CD4(+) T cells. This study identifies a novel role for viral IL-10 in driving M2c polarization, which may limit virus clearance by restricting proinflammatory and CD4(+) T cell responses at sites of infection.

  7. Human cytomegalovirus inhibits apoptosis by proteasome-mediated degradation of Bax at endoplasmic reticulum-mitochondrion contacts.

    PubMed

    Zhang, Aiping; Hildreth, Richard L; Colberg-Poley, Anamaris M

    2013-05-01

    Human cytomegalovirus (HCMV) encodes the UL37 exon 1 protein (pUL37x1), which is the potent viral mitochondrion-localized inhibitor of apoptosis (vMIA), to increase survival of infected cells. HCMV vMIA traffics from the endoplasmic reticulum (ER) to ER subdomains, which are physically linked to mitochondria known as mitochondrion-associated membranes (MAM), and to mitochondria. The antiapoptotic function of vMIA is thought to primarily result from its ability to inhibit Bax-mediated permeabilization of the outer mitochondrial membrane (OMM). Here, we establish that vMIA retargets Bax to the MAM as well as to the OMM from immediate early through late times of infection. However, MAM localization of Bax results in its increased ubiquitination and proteasome-mediated degradation. Surprisingly, HCMV infection does not increase OMM-associated degradation (OMMAD) of Bax, even though the ER and mitochondria are physically connected at the MAM. It was recently found that lipid rafts at the plasma membrane can connect extrinsic and intrinsic apoptotic pathways and can serve as sites of apoptosome assembly. In transfected permissive human fibroblasts, vMIA mediates, through its cholesterol affinity, association of Bax and apoptosome components with MAM lipid rafts. While Bax association with MAM lipid rafts was detected in HCMV-infected cells, association of apoptosome components was not. These results establish that Bax recruitment to the MAM and its MAM-associated degradation (MAMAD) are a newly described antiapoptotic mechanism used by HCMV infection to increase cell survival for its growth.

  8. Palmitoylation Strengthens Cholesterol-dependent Multimerization and Fusion Activity of Human Cytomegalovirus Glycoprotein B (gB)*

    PubMed Central

    Patrone, Marco; Coroadinha, Ana Sofia; Teixeira, Ana P.; Alves, Paula M.

    2016-01-01

    Herpesviruses are a large order of animal enveloped viruses displaying a virion fusion mechanism of unusual complexity. Their multipartite machinery has a conserved core made of the gH/gL ancillary complexes and the homo-trimeric fusion protein glycoprotein B (gB). Despite its essential role in starting the viral infection, gB interaction with membrane lipids is still poorly understood. Here, evidence is provided demonstrating that human cytomegalovirus (HCMV) gB depends on the S-palmitoylation of its endodomain for an efficient interaction with cholesterol-rich membrane patches. We found that, unique among herpesviral gB proteins, the HCMV fusion factor has a Cys residue in the C-terminal region that is palmitoylated and mediates methyl-β-cyclodextrin-sensitive self-association of purified gB. A cholesterol-dependent virus-like particle trap assay, based on co-expression of the HIV Gag protein, confirmed that this post-translational modification is functional in the context of cellular membranes. Mutation of the palmitoylated Cys residue to Ala or inhibition of protein palmitoylation decreased HCMV gB export via Gag particles. Moreover, purified gBC777A showed an increased kinetic sensitivity in a cholesterol depletion test, demonstrating that palmitoyl-gB limits outward cholesterol diffusion. Finally, gB palmitoylation was required for full fusogenic activity in human epithelial cells. Altogether, these results uncover the palmitoylation of HCMV gB and its role in gB multimerization and activity. PMID:26694613

  9. Human cytomegalovirus decreases constitutive transcription of MHC class II genes in mature Langerhans cells by reducing CIITA transcript levels.

    PubMed

    Lee, Andrew W; Wang, Nan; Hornell, Tara M C; Harding, James J; Deshpande, Chetan; Hertel, Laura; Lacaille, Vashti; Pashine, Achal; Macaubas, Claudia; Mocarski, Edward S; Mellins, Elizabeth D

    2011-05-01

    Human cytomegalovirus (HCMV) productively infects CD34(+) progenitor-derived, mature Langerhans-type dendritic cells (matLC) and reduces surface expression of MHC class II complexes (MHC II) by increasing intracellular retention of these molecules. To determine whether HCMV also inhibits MHC II expression by other mechanisms, we assessed mRNA levels of the class II transcriptional regulator, CIITA, and several of its target genes in infected matLC. Levels of CIITA, HLA-DRA (DRA) and DRB transcripts, and new DR protein synthesis were compared in mock-infected and HCMV-infected cells by quantitative PCR and pulse-chase immunoprecipitation analyses, respectively. CIITA mRNA levels were significantly lower in HCMV-infected matLC as compared to mock-infected cells. When assessed in the presence of Actinomycin D, the stability of CIITA transcripts was not diminished by HCMV. Analysis of promoter-specific CIITA isoforms revealed that types I, III and IV all were decreased by HCMV, a result that differs from changes after incubation of these cells with lipopolysaccharide (LPS). Exposure to UV-inactivated virus failed to reduce CIITA mRNA levels, implicating de novo viral gene expression in this effect. HCMV-infected matLC also expressed lower levels of DR transcripts and reduced DR protein synthesis rates compared to mock-infected matLC. In summary, we demonstrate that HCMV infection of a human dendritic cell subset inhibits constitutive CIITA expression, most likely at the transcriptional level, resulting in reduced MHC II biosynthesis. We suggest this represents a new mechanism of modulation of mature LC by HCMV.

  10. Inactivation of retinoblastoma protein does not overcome the requirement for human cytomegalovirus UL97 in lamina disruption and nuclear egress.

    PubMed

    Reim, Natalia I; Kamil, Jeremy P; Wang, Depeng; Lin, Alison; Sharma, Mayuri; Ericsson, Maria; Pesola, Jean M; Golan, David E; Coen, Donald M

    2013-05-01

    Human cytomegalovirus (HCMV) encodes one conventional protein kinase, UL97. During infection, UL97 phosphorylates the retinoblastoma tumor suppressor protein (pRb) on sites ordinarily phosphorylated by cyclin-dependent kinases (CDK), inactivating the ability of pRb to repress host genes required for cell cycle progression to S phase. UL97 is important for viral DNA synthesis in quiescent cells, but this function can be replaced by human papillomavirus type 16 E7, which targets pRb for degradation. However, viruses in which E7 replaces UL97 are still defective for virus production. UL97 is also required for efficient nuclear egress of viral nucleocapsids, which is associated with disruption of the nuclear lamina during infection, and phosphorylation of lamin A/C on serine 22, which antagonizes lamin polymerization. We investigated whether inactivation of pRb might overcome the requirement of UL97 for these roles, as pRb inactivation induces CDK1, and CDK1 phosphorylates lamin A/C on serine 22. We found that lamin A/C serine 22 phosphorylation during HCMV infection correlated with expression of UL97 and was considerably delayed in UL97-null mutants, even when E7 was expressed. E7 failed to restore gaps in the nuclear lamina seen in wild-type but not UL97-null virus infections. In electron microscopy analyses, a UL97-null virus expressing E7 was as impaired as a UL97-null mutant in cytoplasmic accumulation of viral nucleocapsids. Our results demonstrate that pRb inactivation is insufficient to restore efficient viral nuclear egress of HCMV in the absence of UL97 and instead argue further for a direct role of UL97 in this stage of the infectious cycle.

  11. Nucleosome maps of the human cytomegalovirus genome reveal a temporal switch in chromatin organization linked to a major IE protein.

    PubMed

    Zalckvar, Einat; Paulus, Christina; Tillo, Desiree; Asbach-Nitzsche, Alexandra; Lubling, Yaniv; Winterling, Carla; Strieder, Nicholas; Mücke, Katrin; Goodrum, Felicia; Segal, Eran; Nevels, Michael

    2013-08-06

    Human CMV (hCMV) establishes lifelong infections in most of us, causing developmental defects in human embryos and life-threatening disease in immunocompromised individuals. During productive infection, the viral >230,000-bp dsDNA genome is expressed widely and in a temporal cascade. The hCMV genome does not carry histones when encapsidated but has been proposed to form nucleosomes after release into the host cell nucleus. Here, we present hCMV genome-wide nucleosome occupancy and nascent transcript maps during infection of permissive human primary cells. We show that nucleosomes occupy nuclear viral DNA in a nonrandom and highly predictable fashion. At early times of infection, nucleosomes associate with the hCMV genome largely according to their intrinsic DNA sequence preferences, indicating that initial nucleosome formation is genetically encoded in the virus. However, as infection proceeds to the late phase, nucleosomes redistribute extensively to establish patterns mostly determined by nongenetic factors. We propose that these factors include key regulators of viral gene expression encoded at the hCMV major immediate-early (IE) locus. Indeed, mutant virus genomes deficient for IE1 expression exhibit globally increased nucleosome loads and reduced nucleosome dynamics compared with WT genomes. The temporal nucleosome occupancy differences between IE1-deficient and WT viruses correlate inversely with changes in the pattern of viral nascent and total transcript accumulation. These results provide a framework of spatial and temporal nucleosome organization across the genome of a major human pathogen and suggest that an hCMV major IE protein governs overall viral chromatin structure and function.

  12. Human cytomegalovirus glycoprotein complex gH/gL/gO uses PDGFR-α as a key for entry.

    PubMed

    Wu, Yiquan; Prager, Adrian; Boos, Simone; Resch, Moritz; Brizic, Ilija; Mach, Michael; Wildner, Sabrina; Scrivano, Laura; Adler, Barbara

    2017-04-01

    Herpesvirus gH/gL envelope glycoprotein complexes are key players in virus entry as ligands for host cell receptors and by promoting fusion of viral envelopes with cellular membranes. Human cytomegalovirus (HCMV) has two alternative gH/gL complexes, gH/gL/gO and gH/gL/UL128,130,131A which both shape the HCMV tropism. By studying binding of HCMV particles to fibroblasts, we could for the first time show that virion gH/gL/gO binds to platelet-derived growth factor-α (PDGFR-α) on the surface of fibroblasts and that gH/gL/gO either directly or indirectly recruits gB to this complex. PDGFR-α functions as an entry receptor for HCMV expressing gH/gL/gO, but not for HCMV mutants lacking the gH/gL/gO complex. PDGFR-α-dependent entry is not dependent on activation of PDGFR-α. We could also show that the gH/gL/gO-PDGFR-α interaction starts the predominant entry pathway for infection of fibroblasts with free virus. Cell-associated virus spread is either driven by gH/gL/gO interacting with PDGFR-α or by the gH/gL/UL128,130,131A complex. PDGFR-α-positive cells may thus be preferred first target cells for infections with free virus which might have implications for the design of future HCMV vaccines or anti-HCMV drugs.

  13. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  14. Latent cytomegalovirus infection enhances anti-tumour cytotoxicity through accumulation of NKG2C+ NK cells in healthy humans.

    PubMed

    Bigley, A B; Rezvani, K; Shah, N; Sekine, T; Balneger, N; Pistillo, M; Agha, N; Kunz, H; O'Connor, D P; Bollard, C M; Simpson, R J

    2016-08-01

    Cytomegalovirus (CMV) infection markedly expands NKG2C+/NKG2A- NK cells, which are potent killers of infected cells expressing human leucocyte antigen (HLA)-E. As HLA-E is also over-expressed in several haematological malignancies and CMV has been linked to a reduced risk of leukaemic relapse, we determined the impact of latent CMV infection on NK cell cytotoxicity against four tumour target cell lines with varying levels of HLA-E expression. NK cell cytotoxicity against K562 (leukaemia origin) and U266 (multiple myeloma origin) target cells was strikingly greater in healthy CMV-seropositive donors than seronegative donors and was associated strongly with target cell HLA-E and NK cell NKG2C expression. NK cell cytotoxicity against HLA-E transfected lymphoma target cells (221.AEH) was ∼threefold higher with CMV, while NK cell cytotoxicity against non-transfected 721.221 cells was identical between the CMV groups. NK cell degranulation (CD107a(+) ) and interferon (IFN)-γ production to 221.AEH cells was localized almost exclusively to the NKG2C subset, and antibody blocking of NKG2C completely eliminated the effect of CMV on NK cell cytotoxicity against 221.AEH cells. Moreover, 221.AEH feeder cells and interleukin (IL)-15 were found to expand NKG2C(+) /NKG2A(-) NK cells preferentially from CMV-seronegative donors and increase NK cell cytotoxicity against HLA-E(+) tumour cell lines. We conclude that latent CMV infection enhances NK cell cytotoxicity through accumulation of NKG2C(+) NK cells, which may be beneficial in preventing the initiation and progression of haematological malignancies characterized by high HLA-E expression.

  15. Human cytomegalovirus UL7, a homologue of the SLAM-family receptor CD229, impairs cytokine production.

    PubMed

    Engel, Pablo; Pérez-Carmona, Natàlia; Albà, M Mar; Robertson, Kevin; Ghazal, Peter; Angulo, Ana

    2011-10-01

    Human cytomegalovirus (HCMV), the β-herpesvirus prototype, has evolved a wide spectrum of mechanisms to counteract host immunity. Among them, HCMV uses cellular captured genes encoding molecules capable of interfering with the original host function or of fulfilling new immunomodulatory tasks. Here, we report on UL7, a novel HCMV heavily glycosylated transmembrane protein, containing an Ig-like domain that exhibits remarkable amino acid similarity to CD229, a cell-surface molecule of the signalling lymphocyte-activation molecule (SLAM) family involved in leukocyte activation. The UL7 Ig-like domain, which is well-preserved in all HCMV strains, structurally resembles the SLAM-family N-terminal Ig-variable domain responsible for the homophilic and heterophilic interactions that trigger signalling. UL7 is transcribed with early-late kinetics during the lytic infectious cycle. Using a mAb generated against the viral protein, we show that it is constitutively shed, through its mucine-like stalk, from the cell-surface. Production of soluble UL7 is enhanced by PMA and reduced by a broad-spectrum metalloproteinase inhibitor. Although UL7 does not hold the ability to interact with CD229 or other SLAM-family members, it shares with them the capacity to mediate adhesion to leukocytes, specifically to monocyte-derived DCs. Furthermore, we demonstrate that UL7 expression attenuates the production of proinflammatory cytokines TNF, IL-8 and IL-6 in DCs and myeloid cell lines. Thus, the ability of UL7 to interfere with cellular proinflammatory responses may contribute to viral persistence. These results enhance our understanding of those HCMV-encoded molecules involved in sustaining the balance between HCMV and the host immune system.

  16. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  17. Sequence of protein synthesis in cells infected by human cytomegalovirus: early and late virus-induced polypeptides.

    PubMed Central

    Stinski, M F

    1978-01-01

    At least 10 distinct early virus-induced polypeptides were synthesized within 0 to 6 h after infection of permissive cells with cytomegalovirus. These virus-induced polypeptides were synthesized before and independently of viral DNA replication. A majority of these early virus-induced polypeptides were also synthesized in nonpermissive cells, which do not permit viral DNA replication. The virus-induced polypeptides synthesized before viral DNA replication were hypothesized to be nonstructural proteins coded for by the cytomegalovirus genome. Their synthesis was found to be a sequential process, since three proteins preceded the synthesis of the others. Synthesis of all early cytomegalovirus-induced proteins was a transient process; the proteins reached their highest molar ratios before the onset of viral DNA replication. Late viral proteins were synthesized at the time of the onset of viral DNA replication, which was approximately 15 h after infection. Their synthesis was continuous and increased in molar ratios with the accumulation of newly synthesized viral DNA in the cells. The presence of the amino acid analog canavanine or azetadine during the early stage of infection suppressed viral DNA replication. The amount of viral DNA synthesis was directly correlated to the relative amount of late viral protein synthesis. Because synthesis of late viral proteins depended upon viral DNA replication, the proteins were not detected in permissive cells treated with an inhibitor of viral DNA synthesis or in nonpermissive cells that are restrictive for cytomegalovirus DNA replication. Images PMID:209215

  18. Latent infection of myeloid progenitors by human cytomegalovirus protects cells from FAS-mediated apoptosis through the cellular IL-10/PEA-15 pathway.

    PubMed

    Poole, Emma; Lau, Jonathan C H; Sinclair, John

    2015-08-01

    Latent infection of primary CD34(+) progenitor cells by human cytomegalovirus (HCMV) results in their increased survival in the face of pro-apoptotic signals. For instance, we have shown previously that primary myeloid cells are refractory to FAS-mediated killing and that cellular IL-10 (cIL-10) is an important survival factor for this effect. However, how cIL-10 mediates this protection is unclear. Here, we have shown that cIL-10 signalling leading to upregulation of the cellular factor PEA-15 mediates latency-associated protection of CD34(+) progenitor cells from the extrinsic death pathway.

  19. Expression of a human cytomegalovirus late gene is posttranscriptionally regulated by a 3'-end-processing event occurring exclusively late after infection.

    PubMed Central

    Goins, W F; Stinski, M F

    1986-01-01

    A phenomenon of posttranscriptional regulation has been previously identified in cytomegalovirus-infected human fibroblast cells (Wathen and Stinski, J. Virol. 41:462, 1982). A region typifying this phenomenon has been located within the large unique component of the viral genome (map units 0.408 to 0.423). Even though this transcriptional unit was highly transcribed at early times after infection, mRNAs from this region were only detectable on the polyribosomes after viral DNA replication. Thus, this region is believed to code for a late gene. Single-strand-specific nuclease mapping experiments of viral transcripts established that the transcriptional initiation sites and the 5' ends of a downstream exon were identical at early and late times. However, the late transcripts differed from the early transcripts by the processing of the 3' end of the viral RNAs. This involved either the removal of a distinct region of the transcript by the selection of an upstream cleavage and polyadenylation site or the differential splicing of the RNA molecule. The upstream cleavage and polyadenylation site was identified by nuclease mapping analyses and DNA sequencing. The 3'-end processing of these transcripts is necessary for the detection of these viral RNAs within the cytoplasm of the infected cell. We propose that human cytomegalovirus either codes for a factor(s) that is involved in the 3'-end-processing event at late times after infection or stimulates the synthesis of a host cell factor(s) involved in this complex regulatory event. This level of regulation may have an influence on the types of cells that permit productive cytomegalovirus replication. Images PMID:3025644

  20. Human Cytomegalovirus Infant Infection Adversely Affects Growth and Development in Maternally HIV-Exposed and Unexposed Infants in Zambia

    PubMed Central

    Larke, N.; Sanz-Ramos, M.; Bates, M.; Musonda, K.; Manno, D.; Siame, J.; Monze, M.; Filteau, S.

    2012-01-01

    Background. Human immunodeficiency virus (HIV) and human cytomegalovirus (HCMV) coinfections have been shown to increase infant morbidity, mortality, and AIDS progression. In HIV-endemic regions, maternal HIV-exposed but HIV-uninfected infants, which is the majority of children affected by HIV, also show poor growth and increased morbidity. Although nutrition has been examined, the effects of HCMV infection have not been evaluated. We studied the effects of HCMV infection on the growth, development, and health of maternally HIV-exposed and unexposed infants in Zambia. Methods. Infants were examined in a cohort recruited to a trial of micronutrient-fortified complementary foods. HIV-infected mothers and infants had received perinatal antiretroviral therapy to prevent mother-to-child HIV transmission. Growth, development, and morbidity were analyzed by linear regression analyses in relation to maternal HIV exposure and HCMV infection, as screened by sera DNA for viremia at 6 months of age and by antibody for infection at 18 months. Results. All HCMV-seropositive infants had decreased length-for-age by 18 months compared with seronegative infants (standard deviation [z]-score difference: −0.44 [95% confidence interval {CI}, −.72 to −.17]; P = .002). In HIV-exposed infants, those who were HCMV positive compared with those who were negative, also had reduced head size (mean z-score difference: −0.72 [95% CI, −1.23 to −.22]; P = .01) and lower psychomotor development (Bayley test score difference: −4.1 [95% CI, −7.8 to −.5]; P = .03). HIV-exposed, HCMV-viremic infants were more commonly referred for hospital treatment than HCMV-negative infants. The effects of HCMV were unaffected by micronutrient fortification. Conclusion. HCMV affects child growth, development, and morbidity of African infants, particularly in those maternally exposed to HIV. HCMV is therefore a risk factor for child health in this region. PMID:22247303

  1. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  2. Baculoviruses deficient in ie1 gene function abrogate viral gene expression in transduced mammalian cells

    SciTech Connect

    Efrose, Rodica; Swevers, Luc; Iatrou, Kostas

    2010-10-25

    One of the newest niches for baculoviruses-based technologies is their use as vectors for mammalian cell transduction and gene therapy applications. However, an outstanding safety issue related to such use is the residual expression of viral genes in infected mammalian cells. Here we show that infectious baculoviruses lacking the major transcriptional regulator, IE1, can be produced in insect host cells stably transformed with IE1 expression constructs lacking targets of homologous recombination that could promote the generation of wt-like revertants. Such ie1-deficient baculoviruses are unable to direct viral gene transcription to any appreciable degree and do not replicate in normal insect host cells. Most importantly, the residual viral gene expression, which occurs in mammalian cells infected with wt baculoviruses is reduced 10 to 100 fold in cells infected with ie1-deficient baculoviruses. Thus, ie1-deficient baculoviruses offer enhanced safety features to baculovirus-based vector systems destined for use in gene therapy applications.

  3. Transmission of murine cytomegalovirus in breast milk: a model of natural infection in neonates.

    PubMed

    Wu, Carol A; Paveglio, Sara A; Lingenheld, Elizabeth G; Zhu, Li; Lefrançois, Leo; Puddington, Lynn

    2011-05-01

    Vertical transmission of viruses in breast milk can expose neonates to infectious pathogens at a time when the capacity of their immune system to control infections is limited. We developed a mouse model to study the outcomes of acquisition of murine cytomegalovirus (MCMV) when neonates are breastfed by mothers with acute or latent infection. Breast milk leukocytes collected from lactating mice were examined for the presence of MCMV IE-1 mRNA by reverse transcription-PCR (RT-PCR) with Southern analysis. As determined by this criterion, breast milk leukocytes from both acute and latent mothers were positive for MCMV. This mimics the outcome seen in humans with latent cytomegalovirus infection, where reactivation of virus occurs specifically in the lactating mammary gland. Interestingly, intraperitoneal injection of breast milk collected from mothers with latent infection was sufficient to transfer MCMV to neonatal mice, demonstrating that breast milk was a source of virus. Furthermore, we found that MCMV was transmitted from infected mothers to breastfed neonates, with MCMV IE-1 mRNA or infectious virus present in multiple organs, including the brain. In fact, 1 day of nursing was sufficient to transmit MCMV from latent mothers to breastfed neonatal mice. Together, these data validate this mouse model of vertical transmission of MCMV from mothers with acute or latent MCMV infection to breastfed neonates. Its relevance to human disease should prove useful in future studies designed to elucidate the immunological and pathological ramifications of neonatal infection acquired via this natural route.

  4. Replacement of the human cytomegalovirus promoter with fish enhancer and core elements to control the expression of the G gene of viral haemorrhagic septicemia virus (VHSV).

    PubMed

    Martinez-Lopez, A; Chinchilla, B; Encinas, P; Gomez-Casado, E; Estepa, A; Coll, J M

    2012-12-15

    This work explores some of the possibilities to replace human cytomegalovirus (CMV) core and/or enhancer promoter control elements to create new expression vectors for use with fish. The work is relevant to fish vaccination, since DNA vaccines use eukaryotic expression plasmids controlled by the human cytomegalovirus (CMV) promoter to be effective against novirhabdoviruses, such as viral haemorrhagic septicemia virus (VHSV), one of the most devastating fish viral European diseases. To reduce possible homologous recombination with fish genome, core and enhancer sequences from fish origin, such as trout interferon-inducible myxovirus protein (Mx), zebrafish retrovirus long terminal repeat (LTR) and carp β-actin (AE6), were combined with those of CMV to design alternative hybrid promoters. The substitution of CMV core and/or enhancer with the corresponding elements of Mx or the LTR core maintained a similar in vitro protein G expression level than that obtained by using the CMV promoter. Vectors using the dsRNA-inducible Mx enhancer followed either by the LTR or the AE6 cores showed the highest in vitro protein G expression levels. Furthermore, synthetic constructs using the Mx enhancer maintained their polyI:C induction capabilities despite the core used. Some of these hybrid promoters might contribute to the development of all-fish-vectors for DNA vaccines while others might be useful for more basic studies.

  5. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  6. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  7. Detection of Human Cytomegalovirus pp67 Late Gene Transcripts in Cerebrospinal Fluid of Human Immunodeficiency Virus Type 1-Infected Patients by Nucleic Acid Sequence-Based Amplification

    PubMed Central

    Zhang, Fan; Tetali, Surya; Wang, Xue Ping; Kaplan, Mark H.; Cromme, Frans V.; Ginocchio, Christine C.

    2000-01-01

    This study examined the clinical correlation between the presence of human cytomegalovirus (HCMV) pp67 mRNA in cerebrospinal fluid (CSF) and active HCMV central nervous system (CNS) disease in patients with human immunodeficiency virus type 1 (HIV-1). In total, 76 CSF specimens collected from 65 HIV-1-positive patients diagnosed with HCMV CNS disease, other non-HCMV-related CNS diseases, or no CNS disease were tested for the presence of HCMV pp67 mRNA using the NucliSens cytomegalovirus (CMV) pp67 assay (Organon Teknika, Durham, N.C.). The results were compared to those of a nested PCR for the detection of HCMV glycoprotein B DNA and to those obtained by viral culture (54 samples). CSF specimens collected from patients without HCMV CNS disease yielded the following results: pp67 assay negative, 62 of 62 specimens; culture negative, 41 of 41 specimens; and PCR negative, 56 of 62 specimens (6 specimens were positive). CSF specimens collected from patients with HCMV CNS disease yielded the following results: pp67 assay positive, 9 of 13 specimens; PCR positive, 13 of 13 specimens; and culture positive, 2 of 13 specimens. After resolution of the discordant results, the following positive and negative predictive values (PPV and NPV, respectively) for the diagnosis of HCMV CNS disease were determined. The PPV for PCR, pp67 assay, and culture were 68.4, 100, and 100%, respectively, and the NPV for PCR, pp67 assay, and culture were 100, 97.0, and 82.7%, respectively. The sensitivities for DNA PCR, pp67 assay, and culture for the detection of HCMV were 100, 84.6, and 18%, respectively, and the clinical specificities were 90.5, 100, and 100%, respectively. This study indicates that the detection of HCMV pp67 mRNA in CSF has good correlation with active HCMV CNS disease, whereas CSF culture is insensitive and qualitative DNA PCR may detect latent nonreplicating virus in CSF from patients without HCMV CNS disease. PMID:10790122

  8. Detection of human cytomegalovirus pp67 late gene transcripts in cerebrospinal fluid of human immunodeficiency virus type 1-infected patients by nucleic acid sequence-based amplification.

    PubMed

    Zhang, F; Tetali, S; Wang, X P; Kaplan, M H; Cromme, F V; Ginocchio, C C

    2000-05-01

    This study examined the clinical correlation between the presence of human cytomegalovirus (HCMV) pp67 mRNA in cerebrospinal fluid (CSF) and active HCMV central nervous system (CNS) disease in patients with human immunodeficiency virus type 1 (HIV-1). In total, 76 CSF specimens collected from 65 HIV-1-positive patients diagnosed with HCMV CNS disease, other non-HCMV-related CNS diseases, or no CNS disease were tested for the presence of HCMV pp67 mRNA using the NucliSens cytomegalovirus (CMV) pp67 assay (Organon Teknika, Durham, N.C.). The results were compared to those of a nested PCR for the detection of HCMV glycoprotein B DNA and to those obtained by viral culture (54 samples). CSF specimens collected from patients without HCMV CNS disease yielded the following results: pp67 assay negative, 62 of 62 specimens; culture negative, 41 of 41 specimens; and PCR negative, 56 of 62 specimens (6 specimens were positive). CSF specimens collected from patients with HCMV CNS disease yielded the following results: pp67 assay positive, 9 of 13 specimens; PCR positive, 13 of 13 specimens; and culture positive, 2 of 13 specimens. After resolution of the discordant results, the following positive and negative predictive values (PPV and NPV, respectively) for the diagnosis of HCMV CNS disease were determined. The PPV for PCR, pp67 assay, and culture were 68.4, 100, and 100%, respectively, and the NPV for PCR, pp67 assay, and culture were 100, 97.0, and 82. 7%, respectively. The sensitivities for DNA PCR, pp67 assay, and culture for the detection of HCMV were 100, 84.6, and 18%, respectively, and the clinical specificities were 90.5, 100, and 100%, respectively. This study indicates that the detection of HCMV pp67 mRNA in CSF has good correlation with active HCMV CNS disease, whereas CSF culture is insensitive and qualitative DNA PCR may detect latent nonreplicating virus in CSF from patients without HCMV CNS disease.

  9. Regulation and Gene Expression Profiling of NKG2D Positive Human Cytomegalovirus-Primed CD4+ T-Cells

    PubMed Central

    Jensen, Helle; Folkersen, Lasse; Skov, Søren

    2012-01-01

    NKG2D is a stimulatory receptor expressed by natural killer (NK) cells, CD8+ T-cells, and γδ T-cells. NKG2D expression is normally absent from CD4+ T-cells, however recently a subset of NKG2D+ CD4+ T-cells has been found, which is specific for human cytomegalovirus (HCMV). This particular subset of HCMV-specific NKG2D+ CD4+ T-cells possesses effector-like functions, thus resembling the subsets of NKG2D+ CD4+ T-cells found in other chronic inflammations. However, the precise mechanism leading to NKG2D expression on HCMV-specific CD4+ T-cells is currently not known. In this study we used genome-wide analysis of individual genes and gene set enrichment analysis (GSEA) to investigate the gene expression profile of NKG2D+ CD4+ T-cells, generated from HCMV-primed CD4+ T-cells. We show that the HCMV-primed NKG2D+ CD4+ T-cells possess a higher differentiated phenotype than the NKG2D– CD4+ T-cells, both at the gene expression profile and cytokine profile. The ability to express NKG2D at the cell surface was primarily determined by the activation or differentiation status of the CD4+ T-cells and not by the antigen presenting cells. We observed a correlation between CD94 and NKG2D expression in the CD4+ T-cells following HCMV stimulation. However, knock-down of CD94 did not affect NKG2D cell surface expression or signaling. In addition, we show that NKG2D is recycled at the cell surface of activated CD4+ T-cells, whereas it is produced de novo in resting CD4+ T-cells. These findings provide novel information about the gene expression profile of HCMV-primed NKG2D+ CD4+ T-cells, as well as the mechanisms regulating NKG2D cell surface expression. PMID:22870231

  10. Site-specific glycosylation of the human cytomegalovirus tegument basic phosphoprotein (UL32) at serine 921 and serine 952.

    PubMed Central

    Greis, K D; Gibson, W; Hart, G W

    1994-01-01

    The virion basic phosphoprotein (BPP), UL32, of the human cytomegalovirus (HCMV) is a 149-kDa tegument protein that represents about 15% of the virion protein mass and is modified by O-linked N-acetylglucosamine (O-GlcNAc). O-GlcNAc has been postulated to mediate subunit-subunit interaction in many different types of intracellular protein complexes, while BPP may play a role in viral assembly and/or envelopment. This report describes the identification of the major O-GlcNAc attachment sites on the HCMV (AD169) BPP. Because the amount of BPP isolated from infectious virions was insufficient to determine the site(s) of glycosylation, the full-length protein has been characterized following overexpression in recombinant baculovirus-infected insect cells. The recombinant protein (rBPP) was electrophoretically (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and immunologically (by Western immunoassaying) indistinguishable from the BPP isolated from HCMV virions. In addition, the rBPP was modified by O-GlcNAc, and a comparison of the tryptic glycopeptides from the rBPP and native virion BPP indicated that their O-GlcNAc sites are the same. Furthermore, the major sites of O-GlcNAc attachment to the rBPP were mapped on high-performance liquid chromatography-purified glycopeptides by gas phase microsequencing, manual Edman degradation, and electrospray-mass spectrometry. The results demonstrate that the major sites of O-GlcNAc attachment to the BPP are Ser-921 and Ser-952. Identification of these sites will now enable mutagenesis studies to determine the influence of O-GlcNAc on the intracellular location, protein-protein interaction, and biological function of BPP. Finally, the fidelity of the addition of O-GlcNAc to rBPP in insect cells compared with native virion BPP is documented to demonstrate the possible general applicability of the baculovirus expression system to study O-GlcNAc on other low-abundance proteins. Images PMID:7966627

  11. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients

  12. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions.

    PubMed

    Vanarsdall, Adam L; Howard, Paul W; Wisner, Todd W; Johnson, David C

    2016-04-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16-50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB.

  13. Human cytomegalovirus pUL79 is an elongation factor of RNA polymerase II for viral gene transcription.

    PubMed

    Perng, Yi-Chieh; Campbell, Jessica A; Lenschow, Deborah J; Yu, Dong

    2014-08-01

    In this study, we have identified a unique mechanism in which human cytomegalovirus (HCMV) protein pUL79 acts as an elongation factor to direct cellular RNA polymerase II for viral transcription during late times of infection. We and others previously reported that pUL79 and its homologues are required for viral transcript accumulation after viral DNA synthesis. We hypothesized that pUL79 represented a unique mechanism to regulate viral transcription at late times during HCMV infection. To test this hypothesis, we analyzed the proteome associated with pUL79 during virus infection by mass spectrometry. We identified both cellular transcriptional factors, including multiple RNA polymerase II (RNAP II) subunits, and novel viral transactivators, including pUL87 and pUL95, as protein binding partners of pUL79. Co-immunoprecipitation (co-IP) followed by immunoblot analysis confirmed the pUL79-RNAP II interaction, and this interaction was independent of any other viral proteins. Using a recombinant HCMV virus where pUL79 protein is conditionally regulated by a protein destabilization domain ddFKBP, we showed that this interaction did not alter the total levels of RNAP II or its recruitment to viral late promoters. Furthermore, pUL79 did not alter the phosphorylation profiles of the RNAP II C-terminal domain, which was critical for transcriptional regulation. Rather, a nuclear run-on assay indicated that, in the absence of pUL79, RNAP II failed to elongate and stalled on the viral DNA. pUL79-dependent RNAP II elongation was required for transcription from all three kinetic classes of viral genes (i.e. immediate-early, early, and late) at late times during virus infection. In contrast, host gene transcription during HCMV infection was independent of pUL79. In summary, we have identified a novel viral mechanism by which pUL79, and potentially other viral factors, regulates the rate of RNAP II transcription machinery on viral transcription during late stages of HCMV infection.

  14. Diagnostic significance and clinical impact of quantitative assays for diagnosis of human cytomegalovirus infection/disease in immunocompromised patients.

    PubMed

    Gerna, G; Percivalle, E; Baldanti, F; Sarasini, A; Zavattoni, M; Furione, M; Torsellini, M; Revello, M G

    1998-07-01

    In recent years several assays have been developed for quantitation of human cytomegalovirus (HCMV) in blood of immunocompromised (transplanted and AIDS) patients. It is currently agreed that the only reliable indication of the degree of dissemination of HCMV infection/disease is the measurement of HCMV in blood. Diagnosis of HCMV end-organ disease (organ localizations) often does not benefit from quantitation of virus in blood, but requires detection and quantification of virus in samples taken locally. The most important and clinically useful diagnostic assays for HCMV quantitation in blood are: i) viremia, quantifying infectious HCMV carried by peripheral blood leukocytes (PBL); ii) pp65-antigenemia, quantifying the number of PBL positive for HCMV pp65 in the nucleus; iii) circulating cytomegalic endothelial cell (CEC) viremia (CEC-viremia) measuring the number of circulating CEC carrying infectious HCMV (during the antigenemia assay); iv) leuko- and plasma-DNAemia, quantifying the number of HCMV genome equivalents present in PBL or plasma, respectively, by quantitative polymerase chain reaction (Q-PCR). Other less widely used assays are: i) determination of immediate early and late gene transcripts (mRNA) to detect active viral infection; ii) in situ hybridization to detect viral nucleic acid (DNA or RNA) in tissue sections or cell smears; iii) in situ PCR to detect a low DNA copy number in single cells. Monitoring of HCMV infection/disease in transplant recipients and AIDS patients has established threshold values for different assays above which HCMV-related clinical symptoms are likely to appear. These values are approximately 10 for viremia, 100 for antigenemia and 1,000 GE for leukoDNAemia, and are valid for both solid organ and bone marrow transplant recipients as well as AIDS patients, whereas presence of even a single circulating CEC is sufficient to suggest the presence of a disseminated HCMV infection with potential organ involvement. Monitoring of

  15. Structural Basis for Clonal Diversity of the Public T Cell Response to a Dominant Human Cytomegalovirus Epitope*

    PubMed Central

    Yang, Xinbo; Gao, Mingming; Chen, Guobing; Pierce, Brian G.; Lu, Jinghua; Weng, Nan-ping; Mariuzza, Roy A.

    2015-01-01

    Cytomegalovirus (CMV) is a ubiquitous and persistent human pathogen that is kept in check by CD8+ cytotoxic T lymphocytes. Individuals expressing the major histocompatibility complex (MHC) class I molecule HLA-A2 produce cytotoxic T lymphocytes bearing T cell receptors (TCRs) that recognize the immunodominant CMV epitope NLVPMVATV (NLV). The NLV-specific T cell repertoire is characterized by a high prevalence of TCRs that are frequently observed in multiple unrelated individuals. These public TCRs feature identical, or nearly identical, complementarity-determining region 3α (CDR3α) and/or CDR3β sequences. The TCRs may express public CDR3α motifs alone, public CDR3β motifs alone, or dual public CDR3αβ motifs. In addition, the same public CDR3α motif may pair with different CDR3β motifs (and the reverse), giving rise to highly diverse NLV-specific TCR repertoires. To investigate the structural underpinnings of this clonal diversity, we determined crystal structures of two public TCRs (C7 and C25) in complex with NLV·HLA-A2. These TCRs utilize completely different CDR3α and CDR3β motifs that, in addition, can associate with multiple variable α and variable β regions in NLV-specific T cell repertoires. The C7·NLV·HLA-A2 and C25·NLV·HLA-A2 complexes exhibit divergent TCR footprints on peptide-MHC such that C25 is more focused on the central portion of the NLV peptide than is C7. These structures combined with molecular modeling show how the public CDR3α motif of C25 may associate with different variable α regions and how the public CDR3α motif of C7 may pair with different CDR3β motifs. This interchangeability of TCR V regions and CDR3 motifs permits multiple structural solutions to binding an identical peptide-MHC ligand and thereby the generation of a clonally diverse public T cell response to CMV. PMID:26429912

  16. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  17. Novel Method Based on Real-Time Cell Analysis for Drug Susceptibility Testing of Herpes Simplex Virus and Human Cytomegalovirus

    PubMed Central

    Piret, Jocelyne; Goyette, Nathalie

    2016-01-01

    The plaque reduction assay (PRA) is the gold standard phenotypic method to determine herpes simplex virus (HSV) and human cytomegalovirus (HCMV) susceptibilities to antiviral drugs. However, this assay is subjective and labor intensive. Here, we describe a novel antiviral phenotypic method based on real-time cell analysis (RTCA) that measures electronic impedance over time. The effective drug concentrations that reduced by 50% (EC50s) the cytopathic effects induced by HSV-1 and HCMV were evaluated by both methods. The EC50s of acyclovir and foscarnet against a reference wild-type (WT) HSV-1 strain in Vero cells were, respectively, 0.5 μM and 32.6 μM by PRA and 0.8 μM and 93.6 μM by RTCA. The EC50 ratios for acyclovir against several HSV-1 thymidine kinase (TK) mutants were 101.8×, 73.4×, 28.8×, and 35.4× (PRA) and 18.0×, 52.0×, 5.5×, and 87.8× (RTCA) compared to those for the WT. The EC50 ratios for acyclovir and foscarnet against the HSV-1 TK/DNA polymerase mutant were 182.8× and 9.7× (PRA) and >125.0× and 10.8× (RTCA) compared to the WT. The EC50s of ganciclovir and foscarnet against WT HCMV strain AD169 in fibroblasts were, respectively, 1.6 μM and 27.8 μM by PRA and 5.0 μM and 111.4 μM by RTCA. The EC50 ratios of ganciclovir against the HCMV UL97 mutant were 3.8× (PRA) and 8.2× (RTCA) compared to those for the WT. The EC50 ratios of ganciclovir and foscarnet against the HCMV UL97/DNA polymerase mutant were 17.1× and 12.1× (PRA) and 14.7× and 4.6× (RTCA) compared to those for the WT. RTCA allows objective drug susceptibility testing of HSV and HCMV and could permit high-throughput screening of new antivirals. PMID:27252463

  18. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions

    PubMed Central

    Vanarsdall, Adam L.; Howard, Paul W.; Wisner, Todd W.; Johnson, David C.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16–50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB. PMID:27082872

  19. Identification and characterization of a putative baculoviral transcriptional factor IE-1 from Choristoneura fumiferana granulovirus.

    PubMed

    Rashidan, Kianoush Khajeh; Nassoury, Nasha; Merzouki, Abderrazzak; Guertin, Claude

    2002-11-30

    A gene that encodes a protein homologue to baculoviral IE-1 was identified and sequenced in the genome of the Choristoneura fumiferana granulovirus (ChfuGV). The gene has an 1278 nucleotide (nt) open-reading frame (ORF) that encodes 426 amino acids with an estimated molecular weight of 50.33 kDa. At the nucleotide level, several cis-acting regulatory elements were detected within the promoter region of the ie-1 gene of ChfuGV along with other studied granuloviruses (GVs). Two putative CCAAT elements were detected within the noncoding leader region of this gene; one was located on the opposite strand at -92 and the other at -420 nt from the putative start triplet. Two baculoviral late promoter motifs (TAAG) were also detected within the promoter region of the ie-1 gene of ChfuGV. A single polyadenylation signal, AATAAA, was located 18nt downstream of the putative translational stop codon of ie-1 from ChfuGV. At the protein level, the amino acid sequence data that was derived from the nucleotide sequence in ChfuGV IE-1 was compared to those of the Cydia pomonella granulovirus (CpGV), Xestia c-nigrum granulovirus (XcGV) and Plutella xylostella granulovirus (PxGV). The C-terminal regions of the granuloviral IE-1 sequences appeared to be more conserved when compared to the N-terminal regions. A domain, similar to the basic helix-loop-helix like (bHLH-like) domain in NPVs, was detected at the C-terminal region of IE-1 from ChfuGV (residues 387 to 414). A phylogenetic tree for baculoviral IE-1 was constructed using a maximum parsimony analysis. A phylogenetic estimation demonstrates that ChfuGV IE-1 is most closely related to that of CpGV.

  20. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  1. Human cytomegalovirus alters localization of MHC class II and dendrite morphology in mature Langerhans cells.

    PubMed

    Lee, Andrew W; Hertel, Laura; Louie, Ryan K; Burster, Timo; Lacaille, Vashti; Pashine, Achal; Abate, Davide A; Mocarski, Edward S; Mellins, Elizabeth D

    2006-09-15

    Hemopoietic stem cell-derived mature Langerhans-type dendritic cells (LC) are susceptible to productive infection by human CMV (HCMV). To investigate the impact of infection on this cell type, we examined HLA-DR biosynthesis and trafficking in mature LC cultures exposed to HCMV. We found decreased surface HLA-DR levels in viral Ag-positive as well as in Ag-negative mature LC. Inhibition of HLA-DR was independent of expression of unique short US2-US11 region gene products by HCMV. Indeed, exposure to UV-inactivated virus, but not to conditioned medium from infected cells, was sufficient to reduce HLA-DR on mature LC, implicating particle binding/penetration in this effect. Reduced surface levels reflected an altered distribution of HLA-DR because total cellular HLA-DR was not diminished. Accumulation of HLA-DR was not explained by altered cathepsin S activity. Mature, peptide-loaded HLA-DR molecules were retained within cells, as assessed by the proportion of SDS-stable HLA-DR dimers. A block in egress was implicated, as endocytosis of surface HLA-DR was not increased. Immunofluorescence microscopy corroborated the intracellular retention of HLA-DR and revealed markedly fewer HLA-DR-positive dendritic projections in infected mature LC. Unexpectedly, light microscopic analyses showed a dramatic loss of the dendrites themselves and immunofluorescence revealed that cytoskeletal elements crucial for the formation and maintenance of dendrites are disrupted in viral Ag-positive cells. Consistent with these dendrite effects, HCMV-infected mature LC exhibit markedly reduced chemotaxis in response to lymphoid chemokines. Thus, HCMV impedes MHC class II molecule trafficking, dendritic projections, and migration of mature LC. These changes likely contribute to the reduced activation of CD4+ T cells by HCMV-infected mature LC.

  2. Analysis of memory-like natural killer cells in human cytomegalovirus-infected children undergoing αβ+T and B cell-depleted hematopoietic stem cell transplantation for hematological malignancies.

    PubMed

    Muccio, Letizia; Bertaina, Alice; Falco, Michela; Pende, Daniela; Meazza, Raffaella; Lopez-Botet, Miguel; Moretta, Lorenzo; Locatelli, Franco; Moretta, Alessandro; Della Chiesa, Mariella

    2016-03-01

    We analyzed the impact of human cytomegalovirus infection on the development of natural killer cells in 27 pediatric patients affected by hematological malignancies, who had received a HLA-haploidentical hematopoietic stem cell transplantation, depleted of both α/β+ T cells and B cells. In line with previous studies in adult recipients of umbilical cord blood transplantation, we found that human cytomegalovirus reactivation accelerated the emergence of mature natural killer cells. Thus, most children displayed a progressive expansion of a memory-like natural killer cell subset expressing NKG2C, a putative receptor for human cytomegalovirus, and CD57, a marker of terminal natural killer cell differentiation. NKG2C(+)CD57(+) natural killer cells were detectable by month 3 following hematopoietic stem cell transplantation and expanded until at least month 12. These cells were characterized by high killer Ig-like receptors (KIRs) and leukocyte inhibitory receptor 1 (LIR-1) and low Siglec-7, NKG2A and Interleukin-18Rα expression, killed tumor targets and responded to cells expressing HLA-E (a NKG2C ligand). In addition, they were poor Interferon-γ producers in response to Interleukin-12 and Interleukin-18. The impaired response to these cytokines, together with their highly differentiated profile, may reflect their skewing toward an adaptive condition specialized in controlling human cytomegalovirus. In conclusion, in pediatric patients receiving a type of allograft different from umbilical cord blood transplantation, human cytomegalovirus also induced memory-like natural killer cells, possibly contributing to controlling infections and reinforcing anti-leukemia effects.

  3. MORC3, a Component of PML Nuclear Bodies, Has a Role in Restricting Herpes Simplex Virus 1 and Human Cytomegalovirus

    PubMed Central

    Orr, Anne; Everett, Roger D.

    2016-01-01

    ABSTRACT We previously reported that MORC3, a protein associated with promyelocytic leukemia nuclear bodies (PML NBs), is a target of herpes simplex virus 1 (HSV-1) ICP0-mediated degradation (E. Sloan, et al., PLoS Pathog 11:e1005059, 2015, http://dx.doi.org/10.1371/journal.ppat.1005059). Since it is well known that certain other components of the PML NB complex play an important role during an intrinsic immune response to HSV-1 and are also degraded or inactivated by ICP0, here we further investigate the role of MORC3 during HSV-1 infection. We demonstrate that MORC3 has antiviral activity during HSV-1 infection and that this antiviral role is counteracted by ICP0. In addition, MORC3's antiviral role extends to wild-type (wt) human cytomegalovirus (HCMV) infection, as its plaque-forming efficiency increased in MORC3-depleted cells. We found that MORC3 is recruited to sites associated with HSV-1 genomes after their entry into the nucleus of an infected cell, and in wt infections this is followed by its association with ICP0 foci prior to its degradation. The RING finger domain of ICP0 was required for degradation of MORC3, and we confirmed that no other HSV-1 protein is required for the loss of MORC3. We also found that MORC3 is required for fully efficient recruitment of PML, Sp100, hDaxx, and γH2AX to sites associated with HSV-1 genomes entering the host cell nucleus. This study further unravels the intricate ways in which HSV-1 has evolved to counteract the host immune response and reveals a novel function for MORC3 during the host intrinsic immune response. IMPORTANCE Herpesviruses have devised ways to manipulate the host intrinsic immune response to promote their own survival and persistence within the human population. One way in which this is achieved is through degradation or functional inactivation of PML NB proteins, which are recruited to viral genomes in order to repress viral transcription. Because MORC3 associates with PML NBs in uninfected cells and

  4. Human cytomegalovirus and human umbilical vein endothelial cells: restriction of primary isolation to blood samples and susceptibilities of clinical isolates from other sources to adaptation.

    PubMed

    Gerna, Giuseppe; Percivalle, Elena; Sarasini, Antonella; Revello, M Grazia

    2002-01-01

    In immunocompromised patients with disseminated infection, human cytomegalovirus (HCMV) is widespread in the microvascular endothelium of multiple organs. Human umbilical vein endothelial cells (HUVEC) were used in parallel to human embryonic lung fibroblasts (HELF) to recover HCMV from blood samples of immunocompromised patients. Using the shell vial technique, comparable median numbers of p72-positive HUVEC and HELF cells were found with the 26 HCMV-positive buffy coat samples out of 150 examined. Analysis of other clinical samples inoculated as controls revealed, in the presence of highly infected HELF monolayers, either the presence of very few infected HUVEC with urine specimens (n = 10 samples) or the lack of infected HUVEC with throat washes (n = 3) or amniotic fluid samples (n = 2). Thus, peripheral blood leukocytes (PBL) appear essential for primary isolation of HCMV in HUVEC. In this respect, HCMV strains, recovered from clinical samples other than buffy coats in HELF only, could be readily adapted to growth in HUVEC by coculturing PBL from healthy blood donors with infected HELF and then inoculating infected PBL onto HUVEC. Recently elucidated mechanisms of interaction of leukocytes and HUVEC with bidirectional transfer of virus seem to provide the basis for the restriction of HCMV primary isolation in HUVEC to blood samples. However, virus strains recovered from only HELF could be adapted to growth in HUVEC when inoculated with HELF-derived (either cell-associated or cell-free) HCMV strains upon primary isolation. In conclusion, due to the in vitro selection of virus variants provided with both PBL tropism and HUVEC tropism, HCMV recovery in HUVEC is PBL mediated and substantially restricted to blood samples. Lack of HCMV recovery in HUVEC from clinical samples other than blood leads to the assumption that epithelial cells, such as urinary, amniotic, or pharyngeal cells, do not possess adequate adhesion molecules to establish close contacts with HUVEC.

  5. Use of 5-ethynyl-2'-deoxyuridine labelling and flow cytometry to study cell cycle-dependent regulation of human cytomegalovirus gene expression.

    PubMed

    Wiebusch, Lüder; Hagemeier, Christian

    2014-01-01

    The cell cycle position at the time of infection has a profound influence on human cytomegalovirus (HCMV) gene expression and therefore needs consideration in the design and control of HCMV experiments. While G0/G1 cells support the immediate onset of viral transcription, cells progressing through the S and G2 cell cycle phases prevent HCMV from entering the lytic replication cycle. Here, we provide two fast and reliable protocols that allow one to determine the cell cycle distribution of the designated host cells and monitor viral protein expression as a function of the cell cycle state. Both protocols make use of the thymidine analogue 5-ethynyl-2'-deoxyuridine and "click" chemistry to label HCMV-non-permissive S phase cells in a gentle and sensitive way.

  6. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner.

    PubMed

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state.

  7. The Smallest Capsid Protein Mediates Binding of the Essential Tegument Protein pp150 to Stabilize DNA-Containing Capsids in Human Cytomegalovirus

    PubMed Central

    Dai, Xinghong; Yu, Xuekui; Gong, Hao; Jiang, Xiaohong; Abenes, Gerrado; Liu, Hongrong; Shivakoti, Sakar; Britt, William J.; Zhu, Hua; Liu, Fenyong; Zhou, Z. Hong

    2013-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that causes birth defects in newborns and life-threatening complications in immunocompromised individuals. Among all human herpesviruses, HCMV contains a much larger dsDNA genome within a similarly-sized capsid compared to the others, and it was proposed to require pp150, a tegument protein only found in cytomegaloviruses, to stabilize its genome-containing capsid. However, little is known about how pp150 interacts with the underlying capsid. Moreover, the smallest capsid protein (SCP), while dispensable in herpes simplex virus type 1, was shown to play essential, yet undefined, role in HCMV infection. Here, by cryo electron microscopy (cryoEM), we determine three-dimensional structures of HCMV capsid (no pp150) and virion (with pp150) at sub-nanometer resolution. Comparison of these two structures reveals that each pp150 tegument density is composed of two helix bundles connected by a long central helix. Correlation between the resolved helices and sequence-based secondary structure prediction maps the tegument density to the N-terminal half of pp150. The structures also show that SCP mediates interactions between the capsid and pp150 at the upper helix bundle of pp150. Consistent with this structural observation, ribozyme inhibition of SCP expression in HCMV-infected cells impairs the formation of DNA-containing viral particles and reduces viral yield by 10,000 fold. By cryoEM reconstruction of the resulting “SCP-deficient” viral particles, we further demonstrate that SCP is required for pp150 functionally binding to the capsid. Together, our structural and biochemical results point to a mechanism whereby SCP recruits pp150 to stabilize genome-containing capsid for the production of infectious HCMV virion. PMID:23966856

  8. Refining human T-cell immunotherapy of cytomegalovirus disease: a mouse model with 'humanized' antigen presentation as a new preclinical study tool.

    PubMed

    Lemmermann, Niels A W; Reddehase, Matthias J

    2016-12-01

    With the cover headline 'T cells on the attack,' the journal Science celebrated individualized cancer immunotherapy by adoptive transfer of T cells as the 'Breakthrough of the Year' 2013 (J. Couzin-Frankel in Science 342:1432-1433, 2013). It is less well recognized and appreciated that individualized T cell immunotherapy of cytomegalovirus (CMV) infection is approaching clinical application for preventing CMV organ manifestations, interstitial CMV pneumonia in particular. This coincident medical development is particularly interesting as reactivated CMV infection is a major viral complication in the state of transient immunodeficiency after the therapy of hematopoietic malignancies by hematopoietic cell transplantation (HCT). It may thus be attractive to combine T cell immunotherapy of 'minimal residual disease/leukemia (MRD)' and CMV-specific T cell immunotherapy to combat both risks in HCT recipients simultaneously, and ideally with T cells derived from the respective HLA-matched HCT donor. Although clinical trials of human CMV-specific T cell immunotherapy were promising in that the incidence of virus reactivation and disease was found to be reduced with statistical significance, animal models are still instrumental for providing 'proof of concept' by directly documenting the prevention of viral multiple-organ histopathology and organ failure under controlled conditions of the absence versus presence of the therapy, which obviously is not feasible in an individual human patient. Further, animal models can make predictions regarding parameters that determine the efficacy of T cell immunotherapy for improved study design in clinical investigations, and they allow for manipulating host and virus genetics. The latter is of particular value as it opens the possibility for epitope specificity controls that are inherently missing in clinical trials. Here, we review a recently developed new mouse model that is more approximated to human CMV-specific T cell immunotherapy

  9. Cytomegalovirus Colitis in Immunocompetent Patients

    PubMed Central

    Hussain, Qulsoom; Shafique, Khurram; Tasleem, Syed H; Hurairah, Abu

    2016-01-01

    Cytomegalovirus colitis is common in immunocompromised patients, but rare in immunocompetent patients. The present study not only represents the colonoscopy and pathological findings, but also applies the method of diagnosing and treating cytomegalovirus colitis in immunocompetent patients. PMID:27980888

  10. Recombinant human monoclonal antibodies to human cytomegalovirus glycoprotein B neutralize virus in a complement-dependent manner.

    PubMed

    Ohta, Akane; Fujita, Ayano; Murayama, Tsugiya; Iba, Yoshitaka; Kurosawa, Yoshikazu; Yoshikawa, Tetsushi; Asano, Yoshizo

    2009-11-01

    Human antibodies specific for HCMV are currently considered as potential anti-HCMV therapeutic agents. In this study, we used a combinatorial human antibody library to isolate and characterize complete human monoclonal antibodies that effectively neutralize HCMV in a complement-dependent manner. One hundred and six clones were isolated in two independent screens using HCMV virions and recombinant glycoprotein B, gB654, as antigens. All of the clones recognized the same molecule gB and were classified into 14 groups based on the amino acid sequence of the V(H) region. Seven representative clones from these 14 groups had a strong gB654 binding affinity by surface plasmon resonance (SPR). A pairwise binding competition analysis suggested that there were three groups based on differences in the gB recognition sites. Although Fab fragments of the seven groups showed strong affinity for gB, none of the Fab fragments neutralized HCMV infectivity in vitro. In contrast, complete human IgG(1) antibodies of at least three groups neutralized HCMV in a complement-dependent manner. These data suggest that potent therapeutic antibodies can be obtained from a human antibody library, including most of the functional antibodies that mediate humoral immunity to the selected pathogen.

  11. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex.

    PubMed

    Stegmann, Cora; Abdellatif, Mohamed E A; Laib Sampaio, Kerstin; Walther, Paul; Sinzger, Christian

    2017-01-01

    The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection.

  12. Evaluation of T Cell Immunity against Human Cytomegalovirus: Impact on Patient Management and Risk Assessment of Vertical Transmission

    PubMed Central

    Quaranta, Paola; Pistello, Mauro

    2016-01-01

    Cytomegalovirus (CMV) is one of the most common infectious agents, infecting the general population at an early age without causing morbidity most of the time. However, on particular occasions, it may represent a serious risk, as active infection is associated with rejection and disease after solid organ transplantation or fetal transmission during pregnancy. Several methods for CMV diagnosis are available on the market, but because infection is so common, careful selection is needed to discriminate primary infection from reactivation. This review focuses on methods based on CMV-specific T cell reactivity to help monitor the consequences of CMV infection/reactivation in specific categories of patients. This review makes an attempt at discussing the pros and cons of the methods available. PMID:28044143

  13. Development and preclinical evaluation of an alphavirus replicon particle vaccine for cytomegalovirus.

    PubMed

    Reap, Elizabeth A; Morris, John; Dryga, Sergey A; Maughan, Maureen; Talarico, Todd; Esch, Robert E; Negri, Sarah; Burnett, Bruce; Graham, Andrew; Olmsted, Robert A; Chulay, Jeffrey D

    2007-10-16

    We used a replication-incompetent, single-cycle, alphavirus replicon vector system to produce virus-like replicon particles (VRP) expressing the extracellular domain of human cytomegalovirus (CMV) glycoprotein B or a pp65/IE1 fusion protein. Efficient production methods were scaled to produce pilot lots and clinical lots of each alphavirus replicon vaccine component. The vaccine induced high-titered antibody responses in mice and rabbits, as measured by ELISA and CMV neutralization assays, and robust T-cell responses in mice, as measured by IFN-gamma ELISPOT assay. A toxicity study in rabbits showed no adverse effects in any toxicology parameter. These studies support clinical testing of this novel CMV alphavirus replicon vaccine in humans.

  14. Preliminary exploration of HLA-A 1101-restricted human cytomegalovirus glycoprotein B-specific CD8⁺ T cells in allogeneic stem-cell transplant recipients.

    PubMed

    Liu, Anbing; Hu, Jianhua; Wu, Wei; Huang, Yaping; Liang, Hanying; Wang, Huiqi; Yang, Rong; Fan, Jun

    2014-08-08

    T-cell responses directed against human cytomegalovirus (HCMV) glycoprotein B (gB) contribute to protective immunity against HCMV infection in both animal models and humans. However, the gB-specific human CD8(+) T cell responses remain poorly understood. gB antigen-specific CD8(+) T cells were stained with seven major histocompatibility complex (MHC)-peptide pentamers in 16 human leukocyte antigen (HLA)-A 1101-positive, HCMV-seropositive patients following hematopoietic stem cell transplantation (HSCT). Of these seven pentamers, the most frequent CD8(+) T-cell responses were directed against the gB332-340 peptide. These gB332-340-specific CD8(+) T cells were strongly associated with the presence of plasma HCMV immunoglobulin M in all HSCT recipients and exhibited a probable causal relationship with the level of pp65 antigenemia. Together, these data suggest a role for gB332-340-specific CD8(+) T cells in HCMV reactivation after HSCT. Furthermore, the pentamer assay may be valuable in detecting antigen-specific CD8(+) T cells.

  15. Failure to detect human herpes simplex virus, cytomegalovirus, and Epstein-Barr virus viral genomes in giant cell arteritis biopsy specimens by real-time quantitative polymerase chain reaction.

    PubMed

    Cankovic, Milena; Zarbo, Richard J

    2006-01-01

    A study provided evidence of human herpes simplex virus (HSV) DNA in giant cell arteritis (GCA) biopsy specimens. This prompted us to study our own GCA biopsy specimens using real-time quantitative polymerase chain reaction for the detection of HSV1, cytomegalovirus, and Epstein-Barr virus DNAs. Our study failed to confirm an association between HSV1 and GCA, revealing no viral genome in 35 biopsy specimens of histologically positive temporal arteries.

  16. Natural Killer Cells Can Inhibit the Transmission of Human Cytomegalovirus in Cell Culture by Using Mechanisms from Innate and Adaptive Immune Responses

    PubMed Central

    Wu, Zeguang; Sinzger, Christian; Reichel, Johanna Julia; Just, Marlies

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) transmission within the host is important for the pathogenesis of HCMV diseases. Natural killer (NK) cells are well known to provide a first line of host defense against virus infections. However, the role of NK cells in the control of HCMV transmission is still unknown. Here, we provide the first experimental evidence that NK cells can efficiently control HCMV transmission in different cell types. NK cells engage different mechanisms to control the HCMV transmission both via soluble factors and by cell contact. NK cell-produced interferon gamma (IFN-γ) suppresses HCMV production and induces resistance of bystander cells to HCMV infection. The UL16 viral gene contributes to an immune evasion from the NK cell-mediated control of HCMV transmission. Furthermore, the efficacy of the antibody-dependent NK cell-mediated control of HCMV transmission is dependent on a CD16-158V/F polymorphism. Our findings indicate that NK cells may have a clinical relevance in HCMV infection and highlight the need to consider potential therapeutic strategies based on the manipulation of NK cells. IMPORTANCE Human cytomegalovirus (HCMV) infects 40% to 100% of the human population worldwide. After primary infection, mainly in childhood, the virus establishes a lifelong persistence with possible reactivations. Most infections remain asymptomatic; however, HCMV represents a major health problem since it is the most frequent cause of infection-induced birth defects and is responsible for high morbidity and mortality in immunocompromised patients. The immune system normally controls the infection by antibodies and immune effector cells. One type of effector cells are the natural killer (NK) cells, which provide a rapid response to virus-infected cells. NK cells participate in viral clearance by inducing the death of infected cells. NK cells also secrete antiviral cytokines as a consequence of the interaction with an infected cell. In this study, we

  17. Neutralization of Diverse Human Cytomegalovirus Strains Conferred by Antibodies Targeting Viral gH/gL/pUL128-131 Pentameric Complex

    PubMed Central

    Ha, Sha; Li, Fengsheng; Troutman, Matthew C.; Freed, Daniel C.; Tang, Aimin; Loughney, John W.; Wang, I-Ming; Vlasak, Josef; Nickle, David C.; Rustandi, Richard R.; Hamm, Melissa; DePhillips, Pete A.; Zhang, Ningyan; McLellan, Jason S.; Zhu, Hua; Adler, Stuart P.; McVoy, Michael A.; An, Zhiqiang

    2017-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection, and developing a prophylactic vaccine is of high priority to public health. We recently reported a replication-defective human cytomegalovirus with restored pentameric complex glycoprotein H (gH)/gL/pUL128-131 for prevention of congenital HCMV infection. While the quantity of vaccine-induced antibody responses can be measured in a viral neutralization assay, assessing the quality of such responses, including the ability of vaccine-induced antibodies to cross-neutralize the field strains of HCMV, remains a challenge. In this study, with a panel of neutralizing antibodies from three healthy human donors with natural HCMV infection or a vaccinated animal, we mapped eight sites on the dominant virus-neutralizing antigen—the pentameric complex of glycoprotein H (gH), gL, and pUL128, pUL130, and pUL131. By evaluating the site-specific antibodies in vaccine immune sera, we demonstrated that vaccination elicited functional antiviral antibodies to multiple neutralizing sites in rhesus macaques, with quality attributes comparable to those of CMV hyperimmune globulin. Furthermore, these immune sera showed antiviral activities against a panel of genetically distinct HCMV clinical isolates. These results highlighted the importance of understanding the quality of vaccine-induced antibody responses, which includes not only the neutralizing potency in key cell types but also the ability to protect against the genetically diverse field strains. IMPORTANCE HCMV is the leading cause of congenital viral infection, and development of a preventive vaccine is a high public health priority. To understand the strain coverage of vaccine-induced immune responses in comparison with natural immunity, we used a panel of broadly neutralizing antibodies to identify the immunogenic sites of a dominant viral antigen—the pentameric complex. We further demonstrated that following vaccination of a replication

  18. Human Cytomegalovirus Stimulates the Synthesis of Select Akt-Dependent Antiapoptotic Proteins during Viral Entry To Promote Survival of Infected Monocytes

    PubMed Central

    Peppenelli, Megan A.; Arend, Kyle C.; Cojohari, Olesea; Moorman, Nathaniel J.

    2016-01-01

    ABSTRACT Primary peripheral blood monocytes are responsible for the hematogenous dissemination of human cytomegalovirus (HCMV) following a primary infection. To facilitate viral spread, we have previously shown HCMV to extend the short 48-h life span of monocytes. Mechanistically, HCMV upregulated two specific cellular antiapoptotic proteins, myeloid leukemia sequence 1 (Mcl-1) and heat shock protein 27 (HSP27), to block the two proteolytic cleavages necessary for the formation of fully active caspase 3 and the subsequent initiation of apoptosis. We now show that HCMV more robustly upregulated Mcl-1 than normal myeloid growth factors and that Mcl-1 was the only myeloid survival factor to rapidly induce HSP27 prior to the 48-h cell fate checkpoint. We determined that HCMV glycoproteins gB and gH signal through the cellular epidermal growth factor receptor (EGFR) and αvβ3 integrin, respectively, during viral entry in order to drive the increase of Mcl-1 and HSP27 in an Akt-dependent manner. Although Akt is known to regulate protein stability and transcription, we found that gB- and gH-initiated signaling preferentially and cooperatively stimulated the synthesis of Mcl-1 and HSP27 through mTOR-mediated translation. Overall, these data suggest that the unique signaling network generated during the viral entry process stimulates the upregulation of select antiapoptotic proteins allowing for the differentiation of short-lived monocytes into long-lived macrophages, a key step in the viral dissemination strategy. IMPORTANCE Human cytomegalovirus (HCMV) infection is endemic within the human population. Although primary infection is generally asymptomatic in immunocompetent individuals, HCMV is a significant cause of morbidity and mortality in the immunocompromised. The multiorgan inflammatory diseases associated with symptomatic HCMV infection are a direct consequence of the monocyte-mediated systemic spread of the virus. In order for peripheral blood monocytes to

  19. Hearing Loss and Cytomegalovirus.

    ERIC Educational Resources Information Center

    Strauss, Melvin

    1997-01-01

    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  20. High-Throughput Small Interfering RNA Screening Identifies Phosphatidylinositol 3-Kinase Class II Alpha as Important for Production of Human Cytomegalovirus Virions

    PubMed Central

    Polachek, William S.; Moshrif, Hanan F.; Franti, Michael; Coen, Donald M.; Sreenu, Vattipally B.

    2016-01-01

    ABSTRACT High-throughput small interfering RNA (siRNA) screening is a useful methodology to identify cellular factors required for virus replication. Here we utilized a high-throughput siRNA screen based on detection of a viral antigen by microscopy to interrogate cellular protein kinases and phosphatases for their importance during human cytomegalovirus (HCMV) replication and identified the class II phosphatidylinositol 3-kinase class II alpha (PI3K-C2A) as being involved in HCMV replication. Confirming this observation, infected cells treated with either pooled or individual siRNAs targeting PI3K-C2A mRNA produced approximately 10-fold less infectious virus than the controls. Western blotting and quantitative PCR analysis of infected cells treated with siRNAs indicated that depletion of PI3K-C2A slightly reduced the accumulation of late but not immediate early or early viral antigens and had no appreciable effect on viral DNA synthesis. Analysis of siRNA-treated cells by electron microscopy and Western blotting indicated that PI3K-C2A was not required for the production of viral capsids but did lead to increased numbers of enveloped capsids in the cytoplasm that had undergone secondary envelopment and a reduction in the amount of viral particles exiting the cell. Therefore, PI3K-C2A is a factor important for HCMV replication and has a role in the production of HCMV virions. IMPORTANCE There is limited information about the cellular factors required for human cytomegalovirus (HCMV) replication. Therefore, to identify proteins involved in HCMV replication, we developed a methodology to conduct a high-throughput siRNA screen of HCMV-infected cells. From our screening data, we focused our studies on the top hit from our screen, the lipid kinase phosphatidylinositol 3-kinase class II alpha (PI3K-C2A), as its role in HCMV replication was unknown. Interestingly, we found that PI3K-C2A is important for the production of HCMV virions and is involved in virion production

  1. Human cytomegalovirus specifically controls the levels of the endoplasmic reticulum chaperone BiP/GRP78, which is required for virion assembly.

    PubMed

    Buchkovich, Nicholas J; Maguire, Tobi G; Yu, Yongjun; Paton, Adrienne W; Paton, James C; Alwine, James C

    2008-01-01

    The endoplasmic reticulum (ER) chaperone BiP/GRP78 regulates ER function and the unfolded protein response (UPR). Human cytomegalovirus infection of human fibroblasts induces the UPR but modifies it to benefit viral replication. BiP/GRP78 protein levels are tightly regulated during infection, rising after 36 h postinfection (hpi), peaking at 60 hpi, and decreasing thereafter. To determine the effects of this regulation on viral replication, BiP/GRP78 was depleted using the SubAB subtilase cytotoxin, which rapidly and specifically cleaves BiP/GRP78. Toxin treatment of infected cells for 12-h periods beginning at 36, 48, 60, and 84 hpi caused complete loss of BiP but had little effect on viral protein synthesis. However, progeny virion formation was significantly inhibited, suggesting that BiP/GRP78 is important for virion formation. Electron microscopic analysis showed that infected cells were resistant to the toxin and showed none of the cytotoxic effects seen in uninfected cells. However, all viral activity in the cytoplasm ceased, with nucleocapsids remaining in the nucleus or concentrated in the cytoplasmic space just outside of the outer nuclear membrane. These data suggest that one effect of the controlled expression of BiP/GRP78 in infected cells is to aid in cytoplasmic virion assembly and egress.

  2. Development and optimization of a sensitive TaqMan® real-time PCR with synthetic homologous extrinsic control for quantitation of Human cytomegalovirus viral load.

    PubMed

    Slavov, Svetoslav Nanev; Otaguiri, Katia Kaori; de Figueiredo, Glauciane Garcia; Yamamoto, Aparecida Yulie; Mussi-Pinhata, Marisa Marcia; Kashima, Simone; Covas, Dimas Tadeu

    2016-09-01

    Human cytomegalovirus (Human herpesvirus 5, HCMV) causes frequent asymptomatic infections in the general population. However, in immunosuppressed patients or congenitally infected infants, HCMV is related to high morbidity and mortality. In such cases, a rapid viral detection is crucial for monitoring the clinical outcome and the antiviral treatment. In this study, we optimized a sensitive biplex TaqMan® real-time PCR for the simultaneous detection and differentiation of a partial HCMV UL97 sequence and homologous extrinsic control (HEC) in the same tube. HEC was represented by a plasmid containing a modified HCMV sequence retaining the original primer binding sites, while the probe sequence was substituted by a phylogenetically divergent one (chloroplast CF0 subunit plant gene). It was estimated that the optimal HEC concentration, which did not influence the HCMV amplification is 1,000 copies/reaction. The optimized TaqMan® PCR demonstrated high analytical sensitivity (6.97 copies/reaction, CI = 95%) and specificity (100%). Moreover, the reaction showed adequate precision (repeatability, CV = 0.03; reproducibility, CV = 0.0027) and robustness (no carry-over or cross-contamination). The diagnostic sensitivity (100%) and specificity (97.8%) were adequate for the clinical application of the molecular platform. The optimized TaqMan® real-time PCR is suitable for HCMV detection and quantitation in predisposed patients and monitoring of the applied antiviral therapy. J. Med. Virol. 88:1604-1612, 2016. © 2016 Wiley Periodicals, Inc.

  3. Distinct functional domains within the acidic cluster of tegument protein pp28 required for trafficking and cytoplasmic envelopment of human cytomegalovirus.

    PubMed

    Seo, Jun-Young; Jeon, Hyejin; Hong, Sookyung; Britt, William J

    2016-10-01

    Human cytomegalovirus UL99-encoded tegument protein pp28 contains a 16 aa acidic cluster that is required for pp28 trafficking to the assembly compartment (AC) and the virus assembly. However, functional signals within the acidic cluster of pp28 remain undefined. Here, we demonstrated that an acidic cluster rather than specific sorting signals was required for trafficking to the AC. Recombinant viruses with chimeric pp28 proteins expressing non-native acidic clusters exhibited delayed viral growth kinetics and decreased production of infectious virus, indicating that the native acidic cluster of pp28 was essential for wild-type virus assembly. These results suggested that the acidic cluster of pp28 has distinct functional domains required for trafficking and for efficient virus assembly. The first half (aa 44-50) of the acidic cluster was sufficient for pp28 trafficking, whereas the native acidic cluster consisting of aa 51-59 was required for the assembly of wild-type levels of infectious virus.

  4. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  5. Dynamics of the Emergence of a Human Cytomegalovirus UL97 Mutant Strain Conferring Ganciclovir Resistance in a Pediatric Stem-Cell Transplant Recipient

    PubMed Central

    Göhring, Katharina; Feuchtinger, Tobias; Mikeler, Elfriede; Lang, Peter; Jahn, Gerhard; Handgretinger, Rupert; Hamprecht, Klaus

    2009-01-01

    Stem-cell transplant recipients are at risk of developing ganciclovir-resistant human cytomegalovirus (HCMV) infection caused by mutations in the viral UL97 gene. Knowledge of the relative proportions of coexisting HCMV wild-type and mutant strains may contribute to a better understanding of the dynamics of in vivo mutant strain selection under ganciclovir. Currently, genotype resistance screening for UL97 is routinely performed by restriction fragment length polymorphism detection and sequencing. We present here the longitudinal course of a pediatric recipient of an allogeneic stem-cell transplant infected with a ganciclovir-resistant HCMV strain. EDTA-treated blood samples were analyzed longitudinally. The patient acquired a primary HCMV infection shortly before transplantation and reactivated the virus following allogeneic hematopoietic stem cell transplantation, thus receiving an intensive antiviral treatment schedule. Three different methods for UL97 mutation analysis, restriction fragment length polymorphism detection, sequencing, and a new, real-time PCR approach were performed. In conclusion, for our pediatric patient, during peak viral load, the UL97 wild-type strain predominates, while during clinical deterioration with low viral load, the predominant mutant strain persists. PMID:19477945

  6. Human cytomegalovirus-induced NKG2C(hi) CD57(hi) natural killer cells are effectors dependent on humoral antiviral immunity.

    PubMed

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold; Mertens, Thomas

    2013-07-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2C(hi) CD57(hi) NK cells gated on CD3(neg) CD56(dim) cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2C(hi) CD57(hi) NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2C(hi) CD57(hi) NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2C(hi) CD57(hi) NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy.

  7. Comparison of Real-time PCR to ELISA for the detection of human cytomegalovirus infection in renal transplant patients in the Sudan

    PubMed Central

    2011-01-01

    Background This study was carried out to detect human cytomegalovirus (HCMV) IgG and IgM antibodies using an Enzyme-linked immunosorbent assay (ELISA) in renal transplant patients in Khartoum state, Sudan and to improve the diagnosis of HCMV through the introduction of Real-time Polymerase Chain Reaction (PCR) testing. A total of 98 plasma samples were collected randomly from renal transplant patients at Ibin Sina Hospital and Salma Centre for Transplantation and Haemodialysis during the period from August to September 2006. Results Among the 98 renal transplant patients, 65 were males and 33 females. The results revealed that HCMV IgG was present in all patients' plasma 98/98 (100%), while only 6/98 (6.1%) had IgM antibodies in their plasma. HCMV DNA viral loads were detected in 32 patients 32/98 (32.7%) using Real-time PCR. Conclusions The HCMV IgG results indicate a high prevalence of past HCMV infection in all tested groups, while the finding of IgM may reflect a recent infection or reactivation. HCMV detection by real-time PCR in the present study indicated a high prevalence among renal transplant patients in Khartoum. In conclusion, the prevalence of HCMV in Khartoum State was documented through detection of HCMV-specific antibodies. Further study using various diagnostic methods should be considered to determine the prevalence of HCMV disease at the national level. PMID:21569506

  8. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  9. Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with immunity prior to pregnancy.

    PubMed

    Britt, William

    2015-06-01

    Human cytomegalovirus (HCMV) is the most common virus infection in the developing fetus. A fraction of infants infected in utero develop significant life-threatening and organ-threatening disease with over 90% of infected infants exhibiting no clinical evidence of infection in the newborn period. However, about 10% of all infected infants will develop long-term sequelae. Early studies stressed the importance of primary maternal HCMV infection during pregnancy as a critical determinant of intrauterine transmission and outcome. This concept serves as the foundation for the development of prophylactic vaccines and biologics such as HCMV immune globulins. More recently, studies in maternal populations with high HCMV seroprevalence have challenged the concept of protective maternal immunity. Findings from multiple studies suggest that preexisting maternal HCMV immunity provides at best, partial protection from disease in the infected offspring and similarly may have limited impact on intrauterine transmission. This brief review will provide some considerations about the apparent paradox of maternal HCMV immunity and congenital infection.

  10. Phosphorylation of Golgi Peripheral Membrane Protein Grasp65 Is an Integral Step in the Formation of the Human Cytomegalovirus Cytoplasmic Assembly Compartment.

    PubMed

    Rebmann, G Michael; Grabski, Robert; Sanchez, Veronica; Britt, William J

    2016-10-04

    Human cytomegalovirus (HCMV) is the largest member of the Herpesviridae and represents a significant cause of disease. During virus replication, HCMV alters cellular functions to facilitate its replication, including significant reorganization of the secretory and endocytic pathways of the infected cell. A defining morphologic change of the infected cell is the formation of a membranous structure in the cytoplasm that is designated the virion assembly compartment (AC), which consists of virion structural proteins surrounded by cellular membranes. The loss of normal Golgi compartment morphology and its relocalization from a juxtanuclear ribbonlike structure to a series of concentric rings on the periphery of the AC represents a readily recognized reorganization of cellular membranes in the HCMV-infected cell. Although trafficking of viral proteins to this compartment is required for the assembly of infectious virions, the functional significance of the reorganization of intracellular membranes like the Golgi membranes into the AC in the assembly of infectious virus remains understudied. In this study, we determined that Golgi membrane ribbon fragmentation increased during the early cytoplasmic phase of virion assembly and that Golgi membrane fragmentation in infected cells was dependent on the phosphorylation of an integral cis-Golgi protein, Grasp65. Inhibition of Golgi membrane fragmentation and of its reorganization into the AC resulted in decreased production of infectious particles and alteration of the incorporation of an essential protein into the envelope of the mature virion. These results demonstrated the complexity of the virus-host cell interactions required for efficient assembly of this large DNA virus.

  11. Antibody Treatment Promotes Compensation for Human Cytomegalovirus-Induced Pathogenesis and a Hypoxia-Like Condition in Placentas with Congenital Infection

    PubMed Central

    Maidji, Ekaterina; Nigro, Giovanni; Tabata, Takako; McDonagh, Susan; Nozawa, Naoki; Shiboski, Stephen; Muci, Stefania; Anceschi, Maurizio M.; Aziz, Natali; Adler, Stuart P.; Pereira, Lenore

    2010-01-01

    Human cytomegalovirus (HCMV) is the major viral cause of birth defects worldwide. Affected infants can have temporary symptoms that resolve soon after birth, such as growth restriction, and permanent disabilities, including neurological impairment. Passive immunization of pregnant women with primary HCMV infection is a promising treatment to prevent congenital disease. To understand the effects of sustained viral replication on the placenta and passive transfer of protective antibodies, we performed immunohistological analysis of placental specimens from women with untreated congenital infection, HCMV-specific hyperimmune globulin treatment, and uninfected controls. In untreated infection, viral replication proteins were found in trophoblasts and endothelial cells of chorionic villi and uterine arteries. Associated damage included extensive fibrinoid deposits, fibrosis, avascular villi, and edema, which could impair placental functions. Vascular endothelial growth factor and its receptor fms-like tyrosine kinase 1 (Flt1) were up-regulated, and amniotic fluid contained elevated levels of soluble Flt1 (sFlt1), an antiangiogenic protein, relative to placental growth factor. With hyperimmune globulin treatment, placentas appeared uninfected, vascular endothelial growth factor and Flt1 expression was reduced, and sFlt1 levels in amniotic fluid were lower. An increase in the number of chorionic villi and blood vessels over that in controls suggested compensatory development for a hypoxia-like condition. Taken together the results indicate that antibody treatment can suppress HCMV replication and prevent placental dysfunction, thus improving fetal outcome. PMID:20651234

  12. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts.

    PubMed

    Williamson, Chad D; Wong, Daniel S; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M

    2015-09-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondrial network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients.

  13. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts

    PubMed Central

    Williamson, Chad D.; Wong, Daniel S.; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M.

    2015-01-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondria network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients. PMID:26331984

  14. Isolation of human cytomegalovirus intranuclear capsids, characterization of their protein constituents, and demonstration that the B-capsid assembly protein is also abundant in noninfectious enveloped particles.

    PubMed Central

    Irmiere, A; Gibson, W

    1985-01-01

    Two types of intranuclear capsids have been recovered from human cytomegalovirus (HCMV, strain AD169)-infected cells. By analogy with strain Colburn (simian CMV) particles, these have been designated as A- and B-capsids. Both types of capsids are composed of proteins with molecular weights of 153,000 (major capsid protein), 34,000 (minor capsid protein), 28,000, and 11,000 (smallest capsid protein). In addition to these species, B-capsids contain a 36,000-molecular-weight (36K) protein which has been designated as the HCMV "assembly protein," based on its similarities to counterparts in strain Colburn CMV (i.e., 37K protein) and herpes simplex virus (i.e., VP22a/p40/NC-3/ICP35e). Peptide comparisons established that the assembly protein of HCMV B-capsids and the 36K protein that distinguishes HCMV noninfectious enveloped particles from virions are the same, providing direct evidence that noninfectious enveloped particles are enveloped B-capsids. Images PMID:2993655

  15. Human cytomegalovirus miR-US33-5p inhibits viral DNA synthesis and viral replication by down-regulating expression of the host Syntaxin3.

    PubMed

    Guo, Xin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Ma, Yanping; Shao, Yaozhong; Jiang, Shujuan; Sun, Zhengrong; Ruan, Qiang

    2015-02-13

    During infection with human cytomegalovirus (HCMV), overexpression of hcmv-miR-US33 can inhibit the lytic viral replication and down-regulate US29 mRNA. However, it remains unknown whether inhibition of viral replication by miR-US33 is mediated by down-regulation of expression of US29 or another host gene. Here, we identified the host gene Syntaxin3 (STX3) to be a direct target of hcmv-miR-US33-5p using Hybrid-PCR and luciferase-reporter assays. It was further demonstrated that the levels of STX3 protein were down-regulated in hcmv-miR-US33-5p-overexpressing cells. Experiments with STX3-specific siRNA, or with an inhibitor of hcmv-miR-US33-5p confirmed that hcmv-miR-US33-5p-mediated inhibition of HCMV DNA synthesis and of viral replication are specifically mediated by down-regulation of STX3 expression.

  16. Human Cytomegalovirus Tegument Protein pp65 Is Detected in All Intra- and Extra-Axial Brain Tumours Independent of the Tumour Type or Grade

    PubMed Central

    Libard, Sylwia; Popova, Svetlana N.; Amini, Rose-Marie; Kärjä, Vesa; Pietiläinen, Timo; Hämäläinen, Kirsi M.; Sundström, Christer; Hesselager, Göran; Bergqvist, Michael; Ekman, Simon; Zetterling, Maria; Smits, Anja; Nilsson, Pelle; Pfeifer, Susan; de Ståhl, Teresita Diaz; Enblad, Gunilla; Ponten, Fredrik; Alafuzoff, Irina

    2014-01-01

    Human cytomegalovirus (HCMV) has been indicated being a significant oncomodulator. Recent reports have suggested that an antiviral treatment alters the outcome of a glioblastoma. We analysed the performance of commercial HCMV-antibodies applying the immunohistochemical (IHC) methods on brain sample obtained from a subject with a verified HCMV infection, on samples obtained from 14 control subjects, and on a tissue microarray block containing cores of various brain tumours. Based on these trials, we selected the best performing antibody and analysed a cohort of 417 extra- and intra-axial brain tumours such as gliomas, medulloblastomas, primary diffuse large B-cell lymphomas, and meningiomas. HCMV protein pp65 immunoreactivity was observed in all types of tumours analysed, and the IHC expression did not depend on the patient's age, gender, tumour type, or grade. The labelling pattern observed in the tumours differed from the labelling pattern observed in the tissue with an active HCMV infection. The HCMV protein was expressed in up to 90% of all the tumours investigated. Our results are in accordance with previous reports regarding the HCMV protein expression in glioblastomas and medulloblastomas. In addition, the HCMV protein expression was seen in primary brain lymphomas, low-grade gliomas, and in meningiomas. Our results indicate that the HCMV protein pp65 expression is common in intra- and extra-axial brain tumours. Thus, the assessment of the HCMV expression in tumours of various origins and pathologically altered tissue in conditions such as inflammation, infection, and even degeneration should certainly be facilitated. PMID:25268364

  17. In situ detection of frequent and active infection of human cytomegalovirus in inflammatory abdominal aortic aneurysms: possible pathogenic role in sustained chronic inflammatory reaction.

    PubMed

    Yonemitsu, Y; Nakagawa, K; Tanaka, S; Mori, R; Sugimachi, K; Sueishi, K

    1996-04-01

    Inflammatory abdominal aortic aneurysm (IAAA) is histopathologically characterized by extensive adventitial fibrosis, mononuclear cell infiltration with lymph follicle formation, and severe atheromatous changes in the aneurysmal wall. We previously reported a frequent prevalence and immediate early gene expression of human cytomegalovirus (CMV) in IAAA by solution-phase PCR and reverse transcription PCR, respectively, and suggested that this virus might play a role in chronic inflammatory reaction in IAAA. To evaluate the pathogenic role of CMV infection, the frequency and distribution of CMV infected cells in IAAA were examined by in situ PCR, and compared with those in atherosclerotic aneurysms (AA) and control cases with minimal atherosclerotic changes. Human leukocyte antigen (HLA)-DR was simultaneously evaluated as a marker for immune response related to CMV infection. Immediate early gene expression was also detected by reverse transcription PCR and in situ hybridization, to certify whether the CMV infection in IAAA is active or latent. In the fibrously thickened adventitia of IAAA, CMV infected cells and HLA-DR-positive cells were more frequently encountered than in that of AA and control cases (p < 0.01). CMV infected cells were largely identified as macrophages, fibroblasts, endothelial cells, and lymphocytes. The expression of CMV immediate early mRNA, which suggests an active infection inducing active inflammatory reaction, was detected in most of the macrophages, endothelial cells, and fibroblasts. Our results strongly suggest that frequent and active infection of CMV in IAAA plays a significant role in the induction and acceleration of chronic inflammatory reaction in aortas of IAAA.

  18. The Memory Cytotoxic T-Lymphocyte (CTL) Response to Human Cytomegalovirus Infection Contains Individual Peptide-Specific CTL Clones That Have Undergone Extensive Expansion In Vivo

    PubMed Central

    Weekes, Michael P.; Wills, Mark R.; Mynard, Kim; Carmichael, Andrew J.; Sissons, J. G. Patrick

    1999-01-01

    Human cytomegalovirus (HCMV)-specific CD8+ cytotoxic T lymphocytes (CTL) appear to play an important role in the control of virus replication and in protection against HCMV-related disease. We have previously reported high frequencies of memory CTL precursors (CTLp) specific to the HCMV tegument protein pp65 in the peripheral blood of healthy virus carriers. In some individuals, the CTL response to this protein is focused on only a single epitope, whereas in other virus carriers CTL recognized multiple epitopes which we identified by using synthetic peptides. We have analyzed the clonal composition of the memory CTL response to four of these pp65 epitopes by sequencing the T-cell receptors (TCR) of multiple independently derived epitope-specific CTL clones, which were derived by formal single-cell cloning or from clonal CTL microcultures. In all cases, we have observed a high degree of clonal focusing: the majority of CTL clones specific to a defined pp65 peptide from any one virus carrier use only one or two different TCRs at the level of the nucleotide sequence. Among virus carriers who have the same major histocompatibility complex (MHC) class I allele, we observed that CTL from different donors that recognize the same peptide-MHC complex often used the same Vβ segment, although other TCR gene segments and CDR3 length were not in general conserved. We have also examined the clonal composition of CTL specific to pp65 peptides in asymptomatic human immunodeficiency virus-infected individuals. We have observed a similarly focused peptide-specific CTL response. Thus, the large population of circulating HCMV peptide-specific memory CTLp in virus carriers in fact contains individual CTL clones that have undergone extensive clonal expansion in vivo. PMID:9971792

  19. The Major Immediate-Early Protein IE2 of Human Cytomegalovirus Is Sufficient to Induce Proteasomal Degradation of CD83 on Mature Dendritic Cells

    PubMed Central

    Heilingloh, Christiane S.; Grosche, Linda; Kummer, Mirko; Mühl-Zürbes, Petra; Kamm, Lisa; Scherer, Myriam; Latzko, Melanie; Stamminger, Thomas; Steinkasserer, Alexander

    2017-01-01

    Human cytomegalovirus (HCMV) is the prototypic beta-herpesvirus and widespread throughout the human population. While infection is asymptomatic in healthy individuals, it can lead to high morbidity and mortality in immunocompromised persons. Importantly, HCMV evolved multiple strategies to interfere with immune cell function in order to establish latency in infected individuals. As mature DCs (mDCs) are antigen-presenting cells able to activate naïve T cells they play a crucial role during induction of effective antiviral immune responses. Interestingly, earlier studies demonstrated that the functionally important mDC surface molecule CD83 is down-regulated upon HCMV infection resulting in a reduced T cell stimulatory capacity of the infected cells. However, the viral effector protein and the precise mechanism of HCMV-mediated CD83 reduction remain to be discovered. Using flow cytometric analyses, we observed significant down-modulation of CD83 surface expression becoming significant already 12 h after HCMV infection. Moreover, Western bot analyses revealed that, in sharp contrast to previous studies, loss of CD83 is not restricted to the membrane-bound molecule, but also occurs intracellularly. Furthermore, inhibition of the proteasome almost completely restored CD83 surface expression during HCMV infection. Results of infection kinetics and cycloheximide-actinomycin D-chase experiments, strongly suggested that an HCMV immediate early gene product is responsible for the induction of CD83 down-modulation. Consequently, we were able to identify the major immediate early protein IE2 as the viral effector protein that induces proteasomal CD83 degradation. PMID:28203230

  20. Requirement of the N-terminal residues of human cytomegalovirus UL112-113 proteins for viral growth and oriLyt-dependent DNA replication.

    PubMed

    Kim, Young-Eui; Park, Mi Young; Kang, Kyeong Jin; Han, Tae Hee; Lee, Chan Hee; Ahn, Jin-Hyun

    2015-08-01

    The UL112-113 region of the human cytomegalovirus (HCMV) genome encodes four phosphoproteins of 34, 43, 50, and 84 kDa that promote viral DNA replication. Co-transfection assays have demonstrated that self-interaction of these proteins via the shared N-termini is necessary for their intranuclear distribution as foci and for the efficient relocation of a viral DNA polymerase processivity factor (UL44) to the viral replication sites. However, the requirement of UL112-113 N-terminal residues for viral growth and DNA replication has not been fully elucidated. Here, we investigated the effect of deletion of the N-terminal regions of UL112-113 proteins on viral growth and oriLyt-dependent DNA replication. A deletion of the entire UL112 region or the region encoding the 25 N-terminal amino-acid residues from the HCMV (Towne strain) bacmid impaired viral growth in bacmid-transfected human fibroblast cells, indicating their requirement for viral growth. In co-immunoprecipitation assays using the genomic gene expressing the four UL112-113 proteins together, the 25 N-terminal amino-acid residues were found to be necessary for stable expression of UL112-113 proteins and their self-interaction. These residues were also required for efficient binding to and relocation of UL44, but not for interaction with IE2, an origin-binding transcription factor. In co-transfection/replication assays, replication of the oriLyt-containing plasmid was promoted by expression of intact UL112-113 proteins, but not by the expression of 25-amino-acid residue-deleted proteins. Our results demonstrate that the 25 N-terminal amino-acid residues of UL112-113 proteins that mediate self-interaction contribute to viral growth by promoting their binding to UL44 and the initiation of oriLyt-dependent DNA replication.

  1. UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression.

    PubMed Central

    Winkler, M; Rice, S A; Stamminger, T

    1994-01-01

    The UL69 open reading frame of human cytomegalovirus (HCMV) is homologous to the immediate-early protein ICP27 of herpes simplex virus, an essential viral regulatory protein involved in the transition from early to late gene expression. Genes with homology to ICP27 have been detected in all subclasses of herpesviruses so far. While the respective proteins in alpha- and gammaherpesviruses have been defined as trans-regulatory molecules, nothing is known about these genes in betaherpesviruses. This study was therefore undertaken in order to investigate expression from the UL69 gene locus of HCMV. Northern (RNA) blot experiments revealed a complex pattern of transcripts that changed during the time course of the HCMV replicative cycle: two transcripts of 2.7 and 3.5 kb that were regulated differentially could be detected as early as 7 h after infection. However, these transcripts could not be detected in the presence of cycloheximide. Additional, larger transcripts were present exclusively at late times after infection. To analyze protein expression from the UL69 gene region, the UL69 open reading frame was expressed as a histidine-tagged protein in Escherichia coli. A specific antiserum was generated and used to detect the UL69 protein in HCMV-infected cells which revealed its localization within the intranuclear inclusions that are characteristic for HCMV infection. In cotransfection experiments, an HCMV true late promoter could not be activated by UL69, whereas an early promoter and several heterologous promoters were stimulated about 10-fold. Complementation studies showed that the UL69 protein cannot substitute for ICP27 in the context of the HSV infection, suggesting functional differences between these two proteins. In summary, these experiments define a novel regulatory protein encoded by HCMV that is expressed as an early-late gene and appears to exert a broad stimulatory effect on gene expression. Images PMID:8189530

  2. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  3. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients

    PubMed Central

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R− group. PMID:25312585

  4. Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope.

    PubMed

    Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe

    2016-03-10

    In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.

  5. Human cytomegalovirus detection by real-time PCR and pp65-antigen test in hematopoietic stem cell transplant recipients: a challenge in low and middle-income countries

    PubMed Central

    Breda, Giovanni; Almeida, Bernado; Carstensen, Suzana; Bonfim, Carmem M; Nogueira, Meri B; Vidal, Luine R; Almeida, Sergio M; Raboni, Sonia M

    2013-01-01

    Aim: Cytomegalovirus (CMV) infection is one of the most common complications in patients submitted to hematopoietic stem cell transplant (HSCT). Pre-emptive therapy has been indicated in patients with laboratory evidence of CMV replication. The aims of this study were to compare real-time PCR or pp65 antigen assay methodologies to detect CMV replication in HSCT patients, define a viral load threshold for initiation of pre-emptive therapy, and assess the feasibility of its implementation in hospitals of countries with low and middle income. Material and methods: Human CMV detection by real-time PCR and pp65 antigen assay was carried out in blood and plasma samples of HSCT patients collected weekly during 3 months. Pre-emptive therapy was based on CMV antigenemia results. Results: Twenty-one patients were monitored with a total of 227 samples collected; 13 (62%) patients were children. A poor correlation was observed between qualitative results, though quantitative results showed statistically significant difference, with higher viral loads detected in patients with positive antigenemia. Compared to a positive antigenemia, a cutoff value of 1067.5 copies/ml, 3.03 log10/ml, for viral load was obtained with 100% sensitivity and 71% specificity. Conclusion: CMV real-time PCR in whole blood was suitable for monitoring HSCT patients. However, its high cost is a limiting factor, and it could be used to monitor selected patients, those with prolonged leukopenia and underweight children, and subsequently switched to pp65 antigen test. Further studies involving larger numbers of patients should be performed to confirm this statement. PMID:24188241

  6. Phosphorylation of Golgi Peripheral Membrane Protein Grasp65 Is an Integral Step in the Formation of the Human Cytomegalovirus Cytoplasmic Assembly Compartment

    PubMed Central

    Rebmann, G. Michael; Grabski, Robert; Sanchez, Veronica

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the largest member of the Herpesviridae and represents a significant cause of disease. During virus replication, HCMV alters cellular functions to facilitate its replication, including significant reorganization of the secretory and endocytic pathways of the infected cell. A defining morphologic change of the infected cell is the formation of a membranous structure in the cytoplasm that is designated the virion assembly compartment (AC), which consists of virion structural proteins surrounded by cellular membranes. The loss of normal Golgi compartment morphology and its relocalization from a juxtanuclear ribbonlike structure to a series of concentric rings on the periphery of the AC represents a readily recognized reorganization of cellular membranes in the HCMV-infected cell. Although trafficking of viral proteins to this compartment is required for the assembly of infectious virions, the functional significance of the reorganization of intracellular membranes like the Golgi membranes into the AC in the assembly of infectious virus remains understudied. In this study, we determined that Golgi membrane ribbon fragmentation increased during the early cytoplasmic phase of virion assembly and that Golgi membrane fragmentation in infected cells was dependent on the phosphorylation of an integral cis-Golgi protein, Grasp65. Inhibition of Golgi membrane fragmentation and of its reorganization into the AC resulted in decreased production of infectious particles and alteration of the incorporation of an essential protein into the envelope of the mature virion. These results demonstrated the complexity of the virus-host cell interactions required for efficient assembly of this large DNA virus. PMID:27703074

  7. Human cytomegalovirus induces the endoplasmic reticulum chaperone BiP through increased transcription and activation of translation by using the BiP internal ribosome entry site.

    PubMed

    Buchkovich, Nicholas J; Yu, Yongjun; Pierciey, Francis J; Alwine, James C

    2010-11-01

    The endoplasmic reticulum (ER) chaperone BiP (immunoglobulin binding protein) plays a major role in the control of the unfolded protein response. We have previously shown that BiP levels are dramatically increased during human cytomegalovirus (HCMV) infection, where BiP performs unique roles in viral assembly and egress. We show that BiP mRNA levels increase during infection due to activation of the BiP promoter by the major immediate-early (MIE) proteins. The BiP promoter, like other ER stress-activated promoters, contains endoplasmic reticulum stress elements (ERSEs), which are activated by unfolded protein response (UPR)-induced transcription factors. However, these elements are not needed for MIE protein-mediated transcriptional activation; thus, a virus-specific transcriptional activation mechanism is used. Transcriptional activation results in only a 3- to 4-fold increase in BiP mRNA, suggesting that additional mechanisms for BiP production are utilized. The BiP mRNA contains an internal ribosome entry site (IRES) which increases the level of BiP mRNA translation. We show that utilization of the BiP IRES is dramatically increased in HCMV-infected cells. Utilization of the BiP IRES can be activated by the La autoantigen, also called Sjögren's syndrome antigen B (SSB). We show that SSB/La levels are significantly increased during HCMV infection, and SSB/La depletion causes the loss of BiP IRES utilization and lowers endogenous BiP levels in infected cells. Our data show that BiP levels increase in HCMV-infected cells through the combination of increased BiP gene transcription mediated by the MIE proteins and increased BiP mRNA translation due to SSB/La-induced utilization of the BiP IRES.

  8. A mutation deleting sequences encoding the amino terminus of human cytomegalovirus UL84 impairs interaction with UL44 and capsid localization.

    PubMed

    Strang, Blair L; Bender, Brian J; Sharma, Mayuri; Pesola, Jean M; Sanders, Rebecca L; Spector, Deborah H; Coen, Donald M

    2012-10-01

    Protein-protein interactions are required for many biological functions. Previous work has demonstrated an interaction between the human cytomegalovirus DNA polymerase subunit UL44 and the viral replication factor UL84. In this study, glutathione S-transferase pulldown assays indicated that residues 1 to 68 of UL84 are both necessary and sufficient for efficient interaction of UL84 with UL44 in vitro. We created a mutant virus in which sequences encoding these residues were deleted. This mutant displayed decreased virus replication compared to wild-type virus. Immunoprecipitation assays showed that the mutation decreased but did not abrogate association of UL84 with UL44 in infected cell lysate, suggesting that the association in the infected cell can involve other protein-protein interactions. Further immunoprecipitation assays indicated that IRS1, TRS1, and nucleolin are candidates for such interactions in infected cells. Quantitative real-time PCR analysis of viral DNA indicated that the absence of the UL84 amino terminus does not notably affect viral DNA synthesis. Western blotting experiments and pulse labeling of infected cells with [(35)S]methionine demonstrated a rather modest downregulation of levels of multiple proteins and particularly decreased levels of the minor capsid protein UL85. Electron microscopy demonstrated that viral capsids assemble but are mislocalized in nuclei of cells infected with the mutant virus, with fewer cytoplasmic capsids detected. In sum, deletion of the sequences encoding the amino terminus of UL84 affects interaction with UL44 and virus replication unexpectedly, not viral DNA synthesis. Mislocalization of viral capsids in infected cell nuclei likely contributes to the observed decrease in virus replication.

  9. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group.

  10. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  11. Cytomegalovirus hepatitis and myopericarditis.

    PubMed

    Zubiaurre, Leire; Zapata, Eva; Bujanda, Luis; Castillo, María; Oyarzabal, Igor; Gutiérrez-Stampa, Maria A; Cosme, Angel

    2007-01-28

    Cytomegalovirus (CMV) infection in inmunocompetent hosts generally is asymptomatic or may present as a mononucleosis syndrome but rarely can lead to severe organ complications. We report a case of simultaneous hepatic and pericardic CMV infection in a 36-year old immunocompetent man. He was admitted to coronary unit with fever, chest pain radiated to shoulders, changes on electrocardiogram with diffuse ST elevation and modest laboratory elevations in the MB fraction of creatine kinase (CK-MB) of 33.77 microg/L (0.1-6.73), serum cardiac troponin T of 0.904 ng/mL (0-0.4), creatine kinase of 454 U/L (20-195) and myoglobin of 480.4 microg/L (28-72). Routine laboratory test detected an elevation of aminotransferase level: alanine aminotransferase 1445 U/L, aspartate aminotransferase 601 U/L. We ruled out other causes of hepatitis with normal results except IgM CMV. The patient was diagnosed with myopericarditis and hepatitis caused by cytomegalovirus and started symptomatic treatment with salicylic acid. In few days the laboratory findings became normal and the patient was discharged.

  12. Acute appendicitis due to Cytomegalovirus in an apparently immunocompetent patient: a case report

    PubMed Central

    2014-01-01

    Introduction In healthy subjects, Cytomegalovirus infection can be asymptomatic or manifest as mononucleosis syndrome, but organ disease has also been reported. However, in immunocompromised patients this infection can lead to its most significant and severe disease and even mortality. When Cytomegalovirus causes a gastrointestinal tract infection, it more commonly manifests with luminal tract disease and is usually characterized by ulcerative lesions. Appendicitis is a rare manifestation, and has been reported mainly in human immunodeficiency virus-infected patients or patients with other causes of immunocompromise. Case presentation The authors report on a case of acute primary Cytomegalovirus infection complicated with acute appendicitis due to Cytomegalovirus in an apparently immunocompetent 24-year-old Caucasian man also suffering from primary sclerosing cholangitis and ulcerative colitis. Diagnosis was based on clinical manifestations, serology results, as well as microbiological and histological findings. Treatment consisted of surgery and anti-Cytomegalovirus therapy. Conclusions Cytomegalovirus should be included among the etiologic agents of acute appendicitis in patients with primary sclerosing cholangitis and ulcerative colitis. Currently, there are no definitive data regarding the frequency of Cytomegalovirus appendicitis and the role of anti-Cytomegalovirus treatment in human immunodeficiency virus-negative and apparently immunocompetent subjects. PMID:24612821

  13. Human Cytomegalovirus miR-UL112-3p Targets TLR2 and Modulates the TLR2/IRAK1/NFκB Signaling Pathway

    PubMed Central

    Landais, Igor; Pelton, Chantel; Streblow, Daniel; DeFilippis, Victor; McWeeney, Shannon; Nelson, Jay A.

    2015-01-01

    Human Cytomegalovirus (HCMV) encodes multiple microRNAs (miRNAs) whose functions are just beginning to be uncovered. Using in silico approaches, we identified the Toll-Like Receptor (TLR) innate immunity pathway as a possible target of HCMV miRNAs. Luciferase reporter assay screens further identified TLR2 as a target of HCMV miR-UL112-3p. TLR2 plays a major role in innate immune response by detecting both bacterial and viral ligands, including HCMV envelope proteins gB and gH. TLR2 activates a variety of signal transduction routes including the NFκB pathway. Furthermore, TLR2 plays an important role in controlling CMV infection both in humans and in mice. Immunoblot analysis of cells transfected with a miR-UL112-3p mimic revealed that endogenous TLR2 is down-regulated by miR-UL112-3p with similar efficiency as a TLR2-targeting siRNA (siTLR2). We next found that TLR2 protein level decreases at late times during HCMV infection and correlates with miR-UL112-3p accumulation in fibroblasts and monocytic THP1 cells. Confirming direct miR-UL112-3p targeting, down-regulation of endogenous TLR2 was not observed in cells infected with HCMV mutants deficient in miR-UL112-3p expression, but transfection of miR-UL112-3p in these cells restored TLR2 down-regulation. Using a NFκB reporter cell line, we found that miR-UL112-3p transfection significantly inhibited NFκB-dependent luciferase activity with similar efficiency as siTLR2. Consistent with this observation, miR-UL112-3p transfection significantly reduced the expression of multiple cytokines (IL-1β, IL-6 and IL-8) upon stimulation with a TLR2 agonist. Finally, miR-UL112-3p transfection significantly inhibited the TLR2-induced post-translational activation of IRAK1, a kinase located in the upstream section of the TLR2/NFκB signaling axis. To our knowledge, this is the first identified mechanism of TLR2 modulation by HCMV and is the first report of functional targeting of TLR2 by a viral miRNA. These results provide a

  14. 11 CFR 300.62 - Non-Federal elections (2 U.S.C. 441i(e)(1)(B)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Non-Federal elections (2 U.S.C. 441i(e)(1)(B)). 300.62 Section 300.62 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT OF... elections (2 U.S.C. 441i(e)(1)(B)). A person described in 11 CFR 300.60 may solicit, receive,...

  15. 11 CFR 300.61 - Federal elections (2 U.S.C. 441i(e)(1)(A)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Federal elections (2 U.S.C. 441i(e)(1)(A)). 300.61 Section 300.61 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT OF... elections (2 U.S.C. 441i(e)(1)(A)). No person described in 11 CFR 300.60 shall solicit, receive,...

  16. Neurological Consequences of Cytomegalovirus Infection

    MedlinePlus

    ... an uninfected person, but the virus can also pass from mother to fetus during pregnancy. × Definition Cytomegalovirus ( ... an uninfected person, but the virus can also pass from mother to fetus during pregnancy. View Full ...

  17. Contribution of the Major ND10 Proteins PML, hDaxx and Sp100 to the Regulation of Human Cytomegalovirus Latency and Lytic Replication in the Monocytic Cell Line THP-1

    PubMed Central

    Wagenknecht, Nadine; Reuter, Nina; Scherer, Myriam; Reichel, Anna; Müller, Regina; Stamminger, Thomas

    2015-01-01

    Promyelocytic leukemia nuclear bodies, also termed nuclear domain 10 (ND10), have emerged as nuclear protein accumulations mediating an intrinsic cellular defense against viral infections via chromatin-based mechanisms, however, their contribution to the control of herpesviral latency is still controversial. In this study, we utilized the monocytic cell line THP-1 as an in vitro latency model for human cytomegalovirus infection (HCMV). Characterization of THP-1 cells by immunofluorescence and Western blot analysis confirmed the expression of all major ND10 components. THP-1 cells with a stable, individual knockdown of PML, hDaxx or Sp100 were generated. Importantly, depletion of the major ND10 proteins did not prevent the terminal cellular differentiation of THP-1 monocytes. After construction of a recombinant, endotheliotropic human cytomegalovirus expressing IE2-EYFP, we investigated whether the depletion of ND10 proteins affects the onset of viral IE gene expression. While after infection of differentiated, THP-1-derived macrophages as well as during differentiation-induced reactivation from latency an increase in the number of IE-expressing cells was readily detectable in the absence of the major ND10 proteins, no effect was observed in non-differentiated monocytes. We conclude that PML, hDaxx and Sp100 primarily act as cellular restriction factors during lytic HCMV replication and during the dynamic process of reactivation but do not serve as key determinants for the establishment of HCMV latency. PMID:26057166

  18. Temporal profiling of the coding and noncoding murine cytomegalovirus transcriptomes.

    PubMed

    Lacaze, Paul; Forster, Thorsten; Ross, Alan; Kerr, Lorraine E; Salvo-Chirnside, Eliane; Lisnic, Vanda Juranic; López-Campos, Guillermo H; García-Ramírez, José J; Messerle, Martin; Trgovcich, Joanne; Angulo, Ana; Ghazal, Peter

    2011-06-01

    The global transcriptional program of murine cytomegalovirus (MCMV), involving coding, noncoding, and antisense transcription, remains unknown. Here we report an oligonucleotide custom microarray platform capable of measuring both coding and noncoding transcription on a genome-wide scale. By profiling MCMV wild-type and immediate-early mutant strains in fibroblasts, we found rapid activation of the transcriptome by 6.5 h postinfection, with absolute dependency on ie3, but not ie1 or ie2, for genomic programming of viral gene expression. Evidence is also presented to show, for the first time, genome-wide noncoding and bidirectional transcription at late stages of MCMV infection.

  19. Human cytomegalovirus maturational proteinase: expression in Escherichia coli, purification, and enzymatic characterization by using peptide substrate mimics of natural cleavage sites.

    PubMed Central

    Burck, P J; Berg, D H; Luk, T P; Sassmannshausen, L M; Wakulchik, M; Smith, D P; Hsiung, H M; Becker, G W; Gibson, W; Villarreal, E C

    1994-01-01

    The proteolytic processing of the human cytomegalovirus (HCMV) assembly protein, resulting in truncation of its C terminus, is an essential step in virion maturation. The proteinase responsible for this cleavage is the amino-terminal half of the protein encoded by the UL80a open reading fame. We have obtained high expression levels of this 256-amino-acid HCMV proteinase, assemblin, in Escherichia coli. In addition to the 28-kDa proteinase, a 15-kDa protein comprising the first 143 amino acids and a 13-kDa protein comprising the last 113 amino acids of the 28-kDa HCMV proteinase were present. Both the 28-kDa proteinase and the 15-kDa protein were purified by a two-step chromatographic procedure utilizing anion exchange in urea and dithiothreitol and size exclusion in NaSCN and dithiothreitol. Activation of the purified 28-kDa proteinase required denaturation in urea as well as complete reduction of all five cysteine residues in the molecule. Removal of the urea by dialysis with retention of the reducing agent yielded an active proteinase. Addition of glycerol to 50% enhanced the activity. The HCMV proteinase cleaved the peptides RGVVNASSRLAK and SYVKASVSPE, which are mimics of the maturational (M)- and release (R)-site sequences, respectively, in the UL80a-encoded protein. The cleavage site in the peptides was at the same Ala-Ser scissile bond as observed in the UL80a protein. The Km value for the cleavage of RGVVNASSRLAK (M-site mimic) by the proteinase was similar to that for SYVKASVSPE (R-site mimic), but the turnover (kcat) of the M-site peptide mimic substrate by the proteinase was six to eight times faster. The peptide homologs of the herpes simplex virus type 1 M- and R-site sequences in the UL26-encoded protein were also cleaved by the HCMV proteinase, although at rates slower than those for the HCMV substrates. The HCMV proteinase was inhibited by Zn2+ and by alkylating agents, but only at very high inhibitor concentrations. The purified 15-kDa protein

  20. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  1. Clinical significance of expression of human cytomegalovirus pp67 late transcript in heart, lung, and bone marrow transplant recipients as determined by nucleic acid sequence-based amplification.

    PubMed

    Gerna, G; Baldanti, F; Middeldorp, J M; Furione, M; Zavattoni, M; Lilleri, D; Revello, M G

    1999-04-01

    Human cytomegalovirus (HCMV) infection was monitored retrospectively by qualitative determination of pp67 mRNA (a late viral transcript) by nucleic acid sequence-based amplification (NASBA) in a series of 50 transplant recipients, including 26 solid-organ (11 heart and 15 lung) transplant recipients (SOTRs) and 24 bone marrow transplant recipients (BMTRs). NASBA results were compared with those obtained by prospective quantitation of HCMV viremia and antigenemia and retrospective quantitation of DNA in leukocytes (leukoDNAemia). On the whole, 29 patients were NASBA positive, whereas 10 were NASBA negative, and the blood of 11 patients remained HCMV negative. NASBA detected HCMV infection before quantitation of viremia did but after quantitation of leukoDNAemia and antigenemia did. In NASBA-positive blood samples, median levels of viremia, antigenemia, and leukoDNAemia were significantly higher than the relevant levels detected in NASBA-negative HCMV-positive blood samples. By using the quantitation of leukoDNAemia as the "gold standard," the analytical sensitivity (47.3%), as well as the negative predictive value (68. 3%), of NASBA for the diagnosis of HCMV infection intermediate between that of antigenemia quantitation (analytical sensitivity, 72. 3%) and that of viremia quantitation (analytical sensitivity, 28.7%), while the specificity and the positive predictive value were high (90 to 100%). However, with respect to the clinically relevant antigenemia cutoff of >/=100 used in this study for the initiation of preemptive therapy in SOTRs with reactivated HCMV infection, the clinical sensitivity of NASBA reached 100%, with a specificity of 68. 9%. Upon the initiation of antigenemia quantitation-guided treatment, the actual median antigenemia level was 158 (range, 124 to 580) in SOTRs who had reactivated infection and who presented with NASBA positivity 3.5 +/- 2.6 days in advance and 13.5 (range, 1 to 270) in the group that included BMTRs and SOTRs who had primary

  2. Comparison of human coagulation factor VIII expression directed by cytomegalovirus and mammary gland-specific promoters in HC11 cells and transgenic mice.

    PubMed

    Wang, Qing; Hao, Siguo; Ma, Liyuan; Zhang, Wenhao; Wan, Jiangbo; Deng, Xiaohui

    2015-10-01

    Hemophilia A is an inherited X-linked recessive bleeding disorder caused by coagulant factor VIII (FVIII) deficiency. The conventional treatment involves the administration of recombinant human FVIII (rhFVIII) preparations. In this study, the mammary gland 'bioreactor' is designed to specifically and efficiently express a foreign protein hFVIII in the mammary glands of transgenic mice. We constructed a P1A3-hFVIIIBD vector directed by the mammary gland-specific P1A3 promoter, and transiently transfected HC11 cells and mouse mammary glands with P1A3-hFVIIIBD or CMV-hFVIIIBD vectors directed by a ubiquitous cytomegalovirus (CMV) promoter, respectively. We also generated P1A3-hFVIIIBD and CMV-hFVIIIBD transgenic mice by microinjection, respectively. Our data indicated that both vectors effectively expressed hFVIIIBD in HC11 cells at the transcription level, and hFVIIIBD protein was efficiently expressed in mouse milk after the injection of the hFVIIIBD vectors into mouse mammary glands during lactation. In both CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice, hFVIIIBD proteins were efficiently expressed in the mammary glands at the mRNA and protein levels. No significant difference was observed in hFVIIIBD levels between the CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice (P > 0.05). However, the activity of hFVIII in CMV-directed transgenic mice was slightly higher than that in P1A3-directed transgenic mice (P < 0.05). While hFVIIIBD was present in multiple organs in CMV-hFVIIIBD mice, P1A3-hFVIIIBD mice showed negligible hFVIIIBD expression in organs other than the mammary glands. This study demonstrated that the mammary gland-specific P1A3-hFVIIIBD vector was more suitable for the generation of hFVIIIBD mammary gland bioreactor.

  3. Evaluation and mapping of the DNA binding and oligomerization domains of the IE2 regulatory protein of human cytomegalovirus using yeast one and two hybrid interaction assays.

    PubMed

    Ahn, J H; Chiou, C J; Hayward, G S

    1998-03-27

    The 86-kDa IE2 nuclear phosphoprotein encoded by the human cytomegalovirus (HCMV) major immediate-early (MIE) gene behaves as both a non-specific transactivator of viral and cellular gene expression and as a specific DNA-binding protein targeted to the cis-repression sequence (CRS) at the cap site of its own promoter/enhancer region. Although the IE2 protein produced in bacteria has been shown to bind to the 14-bp palindromic CRS motif and IE2 synthesized in vitro forms stable dimers in solution through the conserved C-terminus of the protein, there is no direct evidence as yet that the intracellular mammalian forms of IE2 do so. Here, we show that the intact HCMV IE2 protein both binds to CRS DNA and dimerizes in yeast cells. In a one-hybrid assay system, a GAL4/IE2 fusion protein expressed in yeast cells activated target HIS3 expression only when CRS sites were located upstream of the GAL1 minimal promoter, but failed to do so on mutant CRS sites, demonstrating a requirement for sequence-specific DNA-binding by IE2. Examination of a series of deletion and triple amino acid point mutations in the C-terminal half of IE2 mapped the domains required for DNA-binding in yeast to the entire region between codons 313 and 579, whereas in the previous in-vitro study with truncated bacterial GST fusion proteins, it was mapped to between codons 346 and 579. Transient co-transfection assays with deleted IE2 effector genes in Vero cells showed that the extra segment of IE2 between codons 313 and 346 is also required for both autoregulation and transactivation activity in mammalian cells. In a two-hybrid assay to study IE2 self-interations, we generated both GAL4 DNA-binding (DB) and activation domain (A)/IE2 fusion proteins and showed that IE2 could also dimerize or oligomerize through the C-terminus of the protein in yeast cells. Domains required for this interaction were all mapped to within the region between codons 388 and 542, which is coincident with the domain mapped

  4. Dual-color bioluminescent assay using infected HepG2 cells sheds new light on Chlamydia pneumoniae and human cytomegalovirus effects on human cholesterol 7α-hydroxylase (CYP7A1) transcription.

    PubMed

    Michelini, Elisa; Donati, Manuela; Aldini, Rita; Cevenini, Luca; Mezzanotte, Laura; Nardini, Paola; Foschi, Claudio; Zvi, Ido Ben; Cevenini, Monica; Montagnani, Marco; Marangoni, Antonella; Roda, Aldo; Cevenini, Roberto

    2012-11-01

    Chlamydia pneumoniae and human cytomegalovirus (HCMV) are intracellular pathogens able to infect hepatocytes, causing an increase in serum triglycerides and cholesterol levels due to the production of inflammatory cytokines. We investigated whether these pathogens could interfere with cholesterol metabolism by affecting activity of hepatic cholesterol 7α-hydroxylase (CYP7A1) promoter. CYP7A1 is the rate-limiting enzyme responsible for conversion of cholesterol to bile acids, which represents the main route of cholesterol catabolism. A straightforward dual-reporter bioluminescent assay was developed to simultaneously monitor CYP7A1 transcriptional regulation and cell viability in infected human hepatoblastoma HepG2 cells. C. pneumoniae and HCMV infection significantly decreased CYP7A1 promoter activity in a dose-dependent manner, with maximal inhibitions of 33±10% and 32±4%, respectively, at a multiplicity of infection of 1. To support in vitro experiments, serum cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides and glucose levels were also measured in Balb/c mice infected with C. pneumoniae. Serum cholesterol and triglycerides also increased in infected mice compared with controls. Although further investigation is required, this work presents the first experimental evidence that C. pneumoniae and HCMV inhibit CYP7A1 gene transcription in the cultured human hepatoblastoma cell line.

  5. The Human Cytomegalovirus MHC Class I Homolog UL18 Inhibits LIR-1+ but Activates LIR-1− NK Cells1

    PubMed Central

    Prod’homme, Virginie; Griffin, Cora; Aicheler, Rebecca J.; Wang, Eddie C. Y.; McSharry, Brian P.; Rickards, Carole R.; Stanton, Richard J.; Borysiewicz, Leszek K.; López-Botet, Miguel; Wilkinson, Gavin W. G.; Tomasec, Peter

    2010-01-01

    The inhibitory leukocyte Ig-like receptor 1 (LIR-1, also known as ILT2, CD85j, or LILRB1) was identified by its high affinity for the human CMV (HCMV) MHC class I homolog gpUL18. The role of this LIR-1-gpUL18 interaction in modulating NK recognition during HCMV infection has previously not been clearly defined. In this study, LIR-1+ NKL cell-mediated cytotoxicity was shown to be inhibited by transduction of targets with a replication-deficient adenovirus vector encoding UL18 (RAd-UL18). Fibroblasts infected with an HCMV UL18 mutant (ΔUL18) also exhibited enhanced susceptibility to NKL killing relative to cells infected with the parental virus. In additional cytolysis assays, UL18-mediated protection was also evident in the context of adenovirus vector transduction and HCMV infection of autologous fibroblast targets using IFN-α-activated NK bulk cultures derived from a donor with a high frequency of LIR-1+ NK cells. A single LIR-1high NK clone derived from this donor was inhibited by UL18, while 3 of 24 clones were activated. CD107 mobilization assays revealed that LIR-1+ NK cells were consistently inhibited by UL18 in all tested donors, but this effect was often masked in the global response by UL18-mediated activation of a subset of LIR-1− NK cells. Although Ab-blocking experiments support UL18 inhibition being induced by a direct interaction with LIR-1, the UL18-mediated activation is LIR-1 independent. PMID:17372005

  6. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  7. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  8. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  9. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  10. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  11. Alveolar Macrophages Are a Prominent but Nonessential Target for Murine Cytomegalovirus Infecting the Lungs

    PubMed Central

    Farrell, Helen E.; Lawler, Clara; Oliveira, Martha T.; Davis-Poynter, Nick

    2015-01-01

    ABSTRACT Cytomegaloviruses (CMVs) infect the lungs and cause pathological damage there in immunocompromised hosts. How lung infection starts is unknown. Inhaled murine CMV (MCMV) directly infected alveolar macrophages (AMs) and type 2 alveolar epithelial cells (AEC2s) but not type 1 alveolar epithelial cells (AEC1s). In contrast, herpes simplex virus 1 infected AEC1s and murid herpesvirus 4 (MuHV-4) infected AEC1s via AMs. MCMV-infected AMs prominently expressed viral reporter genes from a human CMV IE1 promoter; but most IE1-positive cells were AEC2s, and CD11c-cre mice, which express cre in AMs, switched the fluorochrome expression of <5% of floxed MCMV in the lungs. In contrast, CD11C-cre mice exhibited fluorochrome switching in >90% of floxed MuHV-4 in the lungs and 50% of floxed MCMV in the blood. AM depletion increased MCMV titers in the lung during the acute phase of infection. Thus, the influence of AMs was more restrictive than permissive. Circulating monocytes entered infected lungs in large numbers and became infected, but not directly; infection occurred mainly via AEC2s. Mice infected with an MCMV mutant lacking its m131/m129 chemokine homolog, which promotes macrophage infection, showed levels of lung infection equivalent to those of wild-type MCMV-infected mice. The level of lung infiltration by Gr-1-positive cells infected with the MCMV m131/m129-null mutant was modestly different from that for wild-type MCMV-infected lungs. These results are consistent with myeloid cells mainly disseminating MCMV from the lungs, whereas AEC2s provide local amplification. IMPORTANCE Cytomegaloviruses (CMVs) chronically and systemically infect most mammals. Human CMV infection is usually asymptomatic but causes lung disease in people with poor immune function. As human infection is hard to analyze, studies with related animal viruses provide important insights. We show that murine CMV has two targets in the lungs: macrophages and surfactant-secreting epithelial cells

  12. The Essential Human Cytomegalovirus Proteins pUL77 and pUL93 Are Structural Components Necessary for Viral Genome Encapsidation

    PubMed Central

    Bauerfeind, Rudolf; Binz, Anne; Stephan, Thomas Min; Neuber, Sebastian; Wagner, Karen; Steinbrück, Lars; Sodeik, Beate; Lenac Roviš, Tihana; Jonjić, Stipan

    2016-01-01

    ABSTRACT Several essential viral proteins are proposed to participate in genome encapsidation of human cytomegalovirus (HCMV), among them pUL77 and pUL93, which remain largely uncharacterized. To gain insight into their properties, we generated an HCMV mutant expressing a pUL77-monomeric enhanced green fluorescent protein (mGFP) fusion protein and a pUL93-specific antibody. Immunoblotting demonstrated that both proteins are incorporated into capsids and virions. Conversely to data suggesting internal translation initiation sites within the UL93 open reading frame (ORF), we provide evidence that pUL93 synthesis commences at the first start codon. In infected cells, pUL77-mGFP was found in nuclear replication compartments and dot-like structures, colocalizing with capsid proteins. Immunogold labeling of nuclear capsids revealed that pUL77 is present on A, B, and C capsids. Pulldown of pUL77-mGFP revealed copurification of pUL93, indicating interaction between these proteins, which still occurred when capsid formation was prevented. Correct subnuclear distribution of pUL77-mGFP required pUL93 as well as the major capsid protein (and thus probably the presence of capsids), but not the tegument protein pp150 or the encapsidation protein pUL52, demonstrating that pUL77 nuclear targeting occurs independently of the formation of DNA-filled capsids. When pUL77 or pUL93 was missing, generation of unit-length genomes was not observed, and only empty B capsids were produced. Taken together, these results show that pUL77 and pUL93 are capsid constituents needed for HCMV genome encapsidation. Therefore, the task of pUL77 seems to differ from that of its alphaherpesvirus orthologue pUL25, which exerts its function subsequent to genome cleavage-packaging. IMPORTANCE The essential HCMV proteins pUL77 and pUL93 were suggested to be involved in viral genome cleavage-packaging but are poorly characterized both biochemically and functionally. By producing a monoclonal antibody against

  13. Human Cytomegalovirus Immediate-Early mRNA Detection by Nucleic Acid Sequence-Based Amplification as a New Parameter for Preemptive Therapy in Bone Marrow Transplant Recipients

    PubMed Central

    Gerna, Giuseppe; Baldanti, Fausto; Lilleri, Daniele; Parea, Maurizio; Alessandrino, Emilio; Pagani, Ambrogio; Locatelli, Franco; Middeldorp, Jaap; Revello, M. Grazia

    2000-01-01

    Human cytomegalovirus (HCMV) infection was monitored retrospectively by qualitative determination of immediate-early (IE) mRNA by nucleic acid sequence-based amplification (NASBA) in a series of 51 bone marrow transplant (BMT) recipients. The qualitative results for IE mRNA obtained by NASBA were compared with those obtained by prospective quantitation of HCMV viremia and antigenemia and retrospective quantitation of DNA in blood (DNAemia) by PCR as well as by qualitative determination of late pp67 mRNA by NASBA. On the whole, of the 39 HCMV-positive patients (all asymptomatic), HCMV was detected in 14 (35.9%) by quantitation of viremia, 15 (38.5%) by detection of pp67 mRNA by NASBA, 32 (82.1%) by quantitation of DNAemia, and 33 (84.6%) by quantitation of antigenemia, while HCMV was detected in 38 (97.4%) patients by detection of IE mRNA by NASBA. In the immunocompetent host, IE mRNA was not detected by NASBA in 100 blood donors or during reactivated infections in 30 breast-feeding mothers. Likewise, NASBA did not detect IE mRNA in 56 solid-organ transplant recipients in the first 21 days after transplantation. By using NASBA for detection of IE mRNA as the reference standard for detection of HCMV infection in blood samples, the diagnostic sensitivities were 67.7% for quantitation of DNAemia, 59.0% for quantitation of antigenemia, 18.3% for detection of pp67 mRNA by NASBA, and 16.0% for quantitation of viremia. Specificities and negative and positive predictive values were >90.0, >70.0, and >80.0%, respectively, for all four assays. The mean times to first HCMV detection after bone marrow transplantation were 37.7 ± 15.4 days for detection of IE mRNA by NASBA, 39.6 ± 15.6 days for quantitation of antigenemia, 40.9 ± 15.2 days for quantitation of DNAemia, and 43.7 ± 16.3 or 43.7 ± 17.5 days for quantitation of viremia and detection of pp67 mRNA by NASBA, respectively. On the whole, 31 BMT recipients received preemptive therapy by using confirmed antigenemia

  14. Phenotypic characterization of two naturally occurring human Cytomegalovirus sequence polymorphisms located in a distinct region of ORF UL56 known to be involved in in vitro resistance to letermovir.

    PubMed

    Goldner, Thomas; Zimmermann, Holger; Lischka, Peter

    2015-04-01

    Letermovir is a new drug in Phase 3 clinical development for the prevention of human Cytomegalovirus (HCMV) infections in hematopoietic-stem-cell transplant recipients (HSCT). In contrast to marketed anti-HCMV drugs which all target the viral DNA polymerase, letermovir's novel mode of action targets the UL56 subunit of the viral terminase complex. Consistently letermovir resistance has mapped in vitro to a distinct region within ORF UL56 (amino acid 230-370). Here we used marker transfer to demonstrate that two naturally occurring UL56 sequence variants within this region, located directly adjacent to sites known to mediate letermovir resistance in vitro (D242G and A327V) represent normal interstrain polymorphisms unrelated to drug-resistance.

  15. Δγ₁134.5 herpes simplex viruses encoding human cytomegalovirus IRS1 or TRS1 induce interferon regulatory factor 3 phosphorylation and an interferon-stimulated gene response.

    PubMed

    Cassady, Kevin A; Saunders, Ute; Shimamura, Masako

    2012-01-01

    The chimeric herpes simplex viruses (HSV) are Δγ₁34.5 vectors encoding the human cytomegalovirus (HCMV) IRS1 or TRS1 genes. They are capable of late viral protein synthesis and are superior to Δγ₁34.5 HSVs in oncolytic activity. The interferon (IFN) response limits efficient HSV gene expression and replication. HCMV TRS1 and IRS1 restore one γ₁34.5 gene function: evasion of IFN-inducible protein kinase R, allowing late viral protein synthesis. Here we show that, unlike wild-type HSV, the chimeric HSV do not restore another γ₁34.5 function, the suppression of early IFN signaling mediated by IFN regulatory factor 3 (IRF3).

  16. Dissection of the interaction of the human cytomegalovirus-derived US2 protein with major histocompatibility complex class I molecules: prominent role of a single arginine residue in human leukocyte antigen-A2.

    PubMed

    Thilo, Claudia; Berglund, Peter; Applequist, Steven E; Yewdell, Jonathan W; Ljunggren, Hans-Gustaf; Achour, Adnane

    2006-03-31

    Human cytomegalovirus encodes several proteins that interfere with expression of major histocompatibility complex (MHC) class I molecules on the surface of infected cells. The unique short protein 2 (US2) binds to many MHC class I allomorphs in the endoplasmic reticulum, preventing cell surface expression of the class I molecule in question. The molecular interactions underlying US2 binding to MHC class I molecules and its allele specificity have not been fully clarified. In the present study, we first compared the sequences and the structures of US2 retained versus non-retained human leukocyte antigen (HLA) class I allomorphs to identify MHC residues of potential importance for US2 binding. On the basis of this analysis, 18 individual HLA-A2 mutants were generated and the ability of full-length US2 to bind wild-type and mutated HLA-A2 complexes was assessed. We demonstrate that Arg181 plays a critical role in US2-mediated inhibition of HLA-A2 cell surface expression. The structural comparison of all known crystal structures of HLA-A2 either alone, or in complex with T cell receptor or the CD8 co-receptor, indicates that binding of US2 to HLA-A2 results in a unique, large conformational change of the side chain of Arg181. However, although the presence of Arg181 seems to be a prerequisite for US2 binding to HLA-A2, it is not sufficient for binding to all MHC class I alleles.

  17. History of the molecular biology of cytomegaloviruses.

    PubMed

    Stinski, Mark F

    2014-01-01

    The history of the molecular biology of cytomegaloviruses from the purification of the virus and the viral DNA to the cloning and expression of the viral genes is reviewed. A key genetic element of cytomegalovirus (the CMV promoter) contributed to our understanding of eukaryotic cell molecular biology and to the development of lifesaving therapeutic proteins. The study of the molecular biology of cytomegaloviruses also contributed to the development of antivirals to control the viral infection.

  18. Innate Nuclear Sensor IFI16 Translocates into the Cytoplasm during the Early Stage of In Vitro Human Cytomegalovirus Infection and Is Entrapped in the Egressing Virions during the Late Stage

    PubMed Central

    Dell'Oste, Valentina; Gatti, Deborah; Gugliesi, Francesca; De Andrea, Marco; Bawadekar, Mandar; Lo Cigno, Irene; Biolatti, Matteo; Vallino, Marta; Marschall, Manfred; Gariglio, Marisa

    2014-01-01

    ABSTRACT Intrinsic immune mechanisms mediated by constitutively expressed proteins termed “restriction factors” provide frontline antiviral defense. We recently demonstrated that the DNA sensor IFI16 restricts human cytomegalovirus (HCMV) replication by downregulating viral early and late but not immediate-early mRNAs and their protein expression. We show here that at an early time point during the in vitro infection of low-passage-number human embryonic lung fibroblasts, IFI16 binds to HCMV DNA. However, during a later phase following infection, IFI16 is mislocalized to the cytoplasmic virus assembly complex (AC), where it colocalizes with viral structural proteins. Indeed, upon its binding to pUL97, IFI16 undergoes phosphorylation and relocalizes to the cytoplasm of HCMV-infected cells. ESCRT (endosomal sorting complex required for transport) machinery regulates the translocation of IFI16 into the virus AC by sorting and trafficking IFI16 into multivesicular bodies (MVB), as demonstrated by the interaction of IFI16 with two MVB markers: Vps4 and TGN46. Finally, IFI16 becomes incorporated into the newly assembled virions as demonstrated by Western blotting of purified virions and electron microscopy. Together, these results suggest that HCMV has evolved mechanisms to mislocalize and hijack IFI16, trapping it within mature virions. However, the significance of this IFI16 trapping following nuclear mislocalization remains to be established. IMPORTANCE Intracellular viral DNA sensors and restriction factors are critical components of host defense, which alarm and sensitize immune system against intruding pathogens. We have recently demonstrated that the DNA sensor IFI16 restricts human cytomegalovirus (HCMV) replication by downregulating viral early and late but not immediate-early mRNAs and their protein expression. However, viruses are known to evolve numerous strategies to cope and counteract such restriction factors and neutralize the first line of host

  19. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  20. Cloning of the genomes of human cytomegalovirus strains Toledo, TownevarRIT3, and Towne long as BACs and site-directed mutagenesis using a PCR-based technique.

    PubMed

    Hahn, Gabriele; Rose, Dietlind; Wagner, Markus; Rhiel, Sylvia; McVoy, Michael A

    2003-03-01

    The 230-kb human cytomegalovirus genome is among the largest of the known viruses. Experiments to determine the genetic determinants of attenuation, pathogenesis, and tissue tropism are underway; however, a lack of complete sequence data for multiple strains and substantial problems with genetic instability during in vitro propagation create serious complications for such studies. For example, recent findings suggest that common laboratory strains Towne and AD169 passaged in cultured human fibroblasts are missing up to 15 kb of genetic information relative to clinical isolates. To establish standard, genetically stable genomes that can be sequenced, disseminated, and repeatedly reconstituted to produce virus stocks, we have undertaken to clone two variants of Towne, designated Towne(long) and Towne(short) (referred to as TownevarRIT3) (A., Proc. Natl. Acad. Sci. USA 98, 7829-7834), and the pathogenic strain Toledo into bacterial artificial chromosomes (BACs). We further demonstrate the ease with which mutagenesis can be achieved by deleting 13.5 kb from the Toledo genome using a PCR-based technique.

  1. Stepwise adaptation of murine cytomegalovirus to cells of a foreign host for identification of host range determinants.

    PubMed

    Ostermann, Eleonore; Pawletko, Kerstin; Indenbirken, Daniela; Schumacher, Uwe; Brune, Wolfram

    2015-06-01

    Ever since their first isolation 60 years ago, cytomegaloviruses have been recognized as being highly species specific. They replicate only in cells of their own or a closely related host species, while cells of phylogenetically more distant hosts are usually not permissive for viral replication. For instance, human cytomegalovirus replicates in human and chimpanzee fibroblasts but not in rodent cells, and murine cytomegalovirus (MCMV) replicates in cells of mice and rats but not in primate cells. However, the viral and cellular factors determining the narrow host range of cytomegaloviruses have remained largely unknown. We show that MCMV can be adapted stepwise to replicate in cultured human retinal pigment epithelial (RPE-1) cells and human fibroblasts. The human RPE-1 cells used for the initial adaptation step showed a pronounced contact inhibition and produced very low level of interferon-β transcripts upon cytomegalovirus infection, suggesting that these cells provide a particularly favorable environment for adaptation. By whole genome sequencing of the 230 kbp viral genomes of several adapted mutants, a limited number of mutations were detected. Comparison of several human cell-adapted MCMV clones and introduction of specific mutations into the wild-type MCMV genome by site-directed mutagenesis allows for the identification of viral host range determinants and provides the basis for elucidating the molecular basis of the cytomegalovirus host species specificity.

  2. Novel [2',5'-bis-O-(tert-butyldimethylsilyl)-beta-D-ribofuranosyl]- 3'-spiro-5''-(4''-amino-1'',2''-oxathiole-2'',2" -dioxide) derivatives with anti-HIV-1 and anti-human-cytomegalovirus activity.

    PubMed

    de Castro, Sonia; Lobatón, Esther; Pérez-Pérez, María-Jesús; San-Félix, Ana; Cordeiro, Alessandra; Andrei, Graciela; Snoeck, Robert; De Clercq, Erik; Balzarini, Jan; Camarasa, María-José; Velázquez, Sonsoles

    2005-02-24

    New [2',5'-bis-O-(tert-butyldimethylsilyl)-beta-d-ribofuranosyl]-3'-spiro-5' '-(4''-amino-1'',2''-oxathiole-2'',2''-dioxide) (TSAO) derivatives substituted at the 4' '-amino group of the spiro moiety with different carbonyl functionalities have been designed and synthesized. Various synthetic procedures, on the scarcely studied reactivity of the 3'-spiroaminooxathioledioxide moiety, have been explored. The compounds were evaluated for their inhibitory effect on both wild-type and TSAO-resistant HIV-1 strains, in cell culture. The presence of a methyl ester (10) or amide groups (12) at the 4''-position conferred the highest anti-HIV-1 activity, while the free oxalyl acid derivative (11) was 10- to 20-fold less active against the virus. In contrast, the presence at this position of (un)substituted ureido or acyl groups markedly diminished or annihilated the anti-HIV-1 activity. Surprisingly, some of the target compounds also showed inhibition of human cytomegalovirus (HCMV) replication at subtoxic concentrations. This has never been observed previously for TSAO derivatives. In particular, compound 26 represents the first TSAO derivative with dual anti-HIV-1 and -HCMV activity.

  3. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  4. Murine cytomegalovirus regulation of NKG2D ligands.

    PubMed

    Lenac, Tihana; Arapović, Jurica; Traven, Luka; Krmpotić, Astrid; Jonjić, Stipan

    2008-06-01

    Human cytomegalovirus (HCMV) is a ubiquitous pathogen that causes morbidity risk in immunologically suppressed and immunodeficient patients including congenital infections. Approaches to curb the consequences of HCMV infections are restricted by a lack of complete understanding of viral pathogenesis. The infection of mice with murine cytomegalovirus (MCMV) as a model of HCMV infection has been particularly useful in elucidating the role of innate and adaptive immune response mechanisms. A large number of cytomegalovirus genes modulate the innate and the adaptive host immune response. The products of several MCMV genes are involved in subverting the natural killer (NK) cell response by down-modulating cellular ligands for the NKG2D receptor expressed on NK cells and CD8(+) T cells. Mutant viruses lacking these immunoevasion genes are attenuated with respect to virus growth in vivo. Given the importance of the NKG2D receptor in controlling both NK- and T cell-mediated immunity, it is of tremendous importance to understand the molecular mechanisms and consequences of viral regulation of the NKG2D ligands.

  5. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process.

  6. Comparative efficacy of handwashing agents against cytomegalovirus.

    PubMed

    Faix, R G

    1987-04-01

    Conscientious handwashing is often recommended as an important method for limiting transmission of cytomegalovirus (CMV) from infected individuals to health, education, and child care professionals. To assess the efficacy of handwashing, fingertips of radiation-sterilized latex gloves were inoculated with 0.2 mL of ten different CMV strains. Virus in each inoculum was quantitated by plaque assay. After five minutes, viral inocula were allowed to remain (control), or were washed away by dropwise application of 10 mL of distilled water (DI), 5 mL of 0.08% soap followed by 5 mL of DI, 5 mL of 0.01% chlorhexidine gluconate followed by 5 mL of DI, or 5 mL of 0.025% povidone-iodine solution followed by 5 mL of DI. Separate glove fingertips were sampled 5, 15, 30, 60, 120 and 240 minutes after washing and cultured in duplicate for CMV. Similar studies were performed using human cadaver skin. Ordinary soap was as effective at preventing CMV recovery as other more expensive agents. For inocula with less than 5 log10 pfu CMV/mL, washing with water alone was as effective as other agents. This was confirmed in similar studies with human hands using five CMV stains. Handwashing is probably an effective method for removing CMV from contaminated hands.

  7. Intracellular Trafficking of the Human Cytomegalovirus-Encoded 7-trans-Membrane Protein Homologs pUS27 and pUL78 during Viral Infection: A Comparative Analysis

    PubMed Central

    Niemann, Ina; Reichel, Anna; Stamminger, Thomas

    2014-01-01

    Human cytomegalovirus (HCMV) encodes four G protein-coupled receptor (GPCR) homologs, termed pUS27, pUS28, pUL33, and pUL78. In contrast to the extensively characterized vGPCRs pUS28 and pUL33, knowledge concerning pUS27 and pUL78 is limited. Previous studies already demonstrated constitutive internalization of pUS27 and pUL78, as well as an association with the endosomal machinery, however, these results were mainly obtained using transiently transfected cells. To explore the subcellular localization of both receptors during viral infection, we constructed recombinant HCMVs expressing tagged vGPCRs. Colocalization analyses revealed a predominant association of pUS27 or pUL78 with the trans-Golgi network or the endoplasmic reticulum, respectively. Intriguingly, our data emphasize that protein sorting is highly regulated by viral functions as we detected dramatic changes in the colocalization of pUS27 and pUL78 with endosomal markers during progression of HCMV replication. Furthermore, we observed cell type-dependent differences in trafficking of both vGPCRs between fibroblasts and epithelial cells. Most importantly, infection experiments with a recombinant HCMV carrying tagged versions of pUS27 and pUL78 simultaneously, revealed that these two proteins do not colocalize during viral infection. This contrasts to results of transient expression experiments. In conclusion, our results highlight the importance to investigate vGPCR trafficking in a viral context. PMID:24517969

  8. Predictive value of human cytomegalovirus (HCMV) T-cell response in the control of HCMV infection by seropositive solid-organ transplant recipients according to different assays and stimuli.

    PubMed

    Gabanti, Elisa; Bruno, Francesca; Scaramuzzi, Lucia; Mangione, Filippo; Zelini, Paola; Gerna, Giuseppe; Lilleri, Daniele

    2016-10-01

    Human cytomegalovirus (HCMV) is still the most common viral infection in solid-organ transplant recipients (SOTR). Our study aimed to identify the predictive values of the T-cell response able to protect from HCMV disease, according to different assays. Viral DNA was determined by real-time PCR. The T-cell immune response to HCMV infection was investigated in SOTR according to the following assays and stimuli: cytokine flow cytometry (CFC) after peripheral blood mononuclear cell (PBMC) stimulation with autologous HCMV-infected dendritic cells (iDC) vs three ELISPOT assays using PBMCs stimulated with: 1. HCMV-infected cell lysate (iCL); 2. a pool of 34 epitopic peptides (PP) from different HCMV proteins; 3. a commercial pp65 peptide pool (CPM). ELISPOT results were normalized to T-cell counts. Overall, 51 SOTR were enrolled: 29 (57%) had low viral load (LVL) self-resolving infections, 19 (37%) high viral load (HVL) infections treated with antiviral drugs, and 3 (6%) tissue-invasive disease (TID). At DNAemia peak, ROC analysis showed that CFC-iDC CD4+ and the ELISPOT-iCL assays yielded overlapping area under the curve (AUC) results. The time needed to reconstitute protective T-cell immunity in SOTR with HVL infections was significantly longer with each assay compared to LVL infections. Using the CFC-iDC assay as a reference test (requiring 7 days to complete), the 24h ELISPOT-iCL assay provides similar results in terms of protection prediction from HCMV infection.

  9. In Vitro Drug Combination Studies of Letermovir (AIC246, MK-8228) with Approved Anti-Human Cytomegalovirus (HCMV) and Anti-HIV Compounds in Inhibition of HCMV and HIV Replication

    PubMed Central

    Wildum, Steffen; Zimmermann, Holger

    2015-01-01

    Despite modern prevention and treatment strategies, human cytomegalovirus (HCMV) remains a common opportunistic pathogen associated with serious morbidity and mortality in immunocompromised individuals, such as transplant recipients and AIDS patients. All drugs currently licensed for the treatment of HCMV infection target the viral DNA polymerase and are associated with severe toxicity issues and the emergence of drug resistance. Letermovir (AIC246, MK-8228) is a new anti-HCMV agent in clinical development that acts via a novel mode of action and has demonstrated anti-HCMV activity in vitro and in vivo. For the future, drug combination therapies, including letermovir, might be indicated under special medical conditions, such as the emergence of multidrug-resistant virus strains in transplant recipients or in HCMV-HIV-coinfected patients. Accordingly, knowledge of the compatibility of letermovir with other HCMV or HIV antivirals is of medical importance. Here, we evaluated the inhibition of HCMV replication by letermovir in combination with all currently approved HCMV antivirals using cell culture checkerboard assays. In addition, the effects of letermovir on the antiviral activities of selected HIV drugs, and vice versa, were analyzed. Using two different mathematical techniques to analyze the experimental data, (i) additive effects were observed for the combination of letermovir with anti-HCMV drugs and (ii) no interaction was found between letermovir and anti-HIV drugs. Since none of the tested drug combinations significantly antagonized letermovir efficacy (or vice versa), our findings suggest that letermovir may offer the potential for combination therapy with the tested HCMV and HIV drugs. PMID:25779572

  10. Reconstitution of Human Cytomegalovirus-Specific CD4+ T Cells is Critical for Control of Virus Reactivation in Hematopoietic Stem Cell Transplant Recipients but Does Not Prevent Organ Infection.

    PubMed

    Gabanti, Elisa; Lilleri, Daniele; Ripamonti, Francesco; Bruno, Francesca; Zelini, Paola; Furione, Milena; Colombo, Anna A; Alessandrino, Emilio P; Gerna, Giuseppe

    2015-12-01

    The relative contribution of human cytomegalovirus (HMCV)-specific CD4(+) and CD8(+) T cells to the control of HCMV infection in hematopoietic stem cell transplant (HSCT) recipients is still controversial. HCMV reactivation and HCMV-specific CD4(+) and CD8(+) T cell reconstitution were monitored for 1 year in 63 HCMV-seropositive patients receiving HSCT. HCMV reactivation was detected in all but 2 patients. In 20 of 63 (31.7%) patients (group 1) HCMV infection resolved spontaneously, whereas 32 of 63 (50.8%) patients (group 2) controlled the infection after a single short-course of pre-emptive therapy and the remaining 9 (14.3%) patients (group 3) suffered from relapsing episodes of HCMV infection, requiring multiple courses of antiviral therapy. The kinetics and magnitude of HCMV-specific CD8(+) T cell reconstitution were comparable among the 3 groups, but HCMV-specific CD4(+) T cells were lower in number in patients requiring antiviral treatment. HCMV-seronegative donors, as well as unrelated donors (receiving antithymocyte globulin) and acute graft-versus-host disease (GVHD) were associated with both delayed HCMV-specific CD4(+) T cell reconstitution and severity of infection. Conversely, these risk factors had no impact on HCMV-specific CD8(+) T cells. Eight patients with previous GVHD suffered from HCMV gastrointestinal disease, although in the presence of HCMV-specific CD4(+) and CD8(+) systemic immunity and undetectable HCMV DNA in blood. Reconstitution of systemic HCMV-specific CD4(+) T cell immunity is required for control of HCMV reactivation in adult HSCT recipients, but it may not be sufficient to prevent late-onset organ localization in patients with GVHD. HCMV-specific CD8(+) T cells contribute to control of HCMV infection, but only after HCMV-specific CD4(+) T cell reconstitution.

  11. The C-Terminal Amino Acid of the MHC-I Heavy Chain Is Critical for Binding to Derlin-1 in Human Cytomegalovirus US11-Induced MHC-I Degradation

    PubMed Central

    Cho, Sunglim; Kim, Bo Young; Ahn, Kwangseog; Jun, Youngsoo

    2013-01-01

    Derlin-1 plays a critical role in endoplasmic reticulum-associated protein degradation (ERAD) of a particular subset of proteins. Although it is generally accepted that Derlin-1 mediates the export of ERAD substrates from the ER to the cytosol, little is known about how Derlin-1 interacts with these substrates. Human cytomegalovirus (HCMV) US11 exploits Derlin-1-dependent ERAD to degrade major histocompatibility complex class I (MHC-I) molecules and evade immune surveillance. US11 requires the cytosolic tail of the MHC-I heavy chain to divert MHC-I molecules into the ERAD pathway for degradation; however, the underlying mechanisms remain unknown. Here, we show that the cytosolic tail of the MHC-I heavy chain, although not required for interaction with US11, is required for tight binding to Derlin-1 and thus for US11-induced dislocation of the MHC-I heavy chain to the cytosol for proteasomal degradation. Surprisingly, deletion of a single C-terminal amino acid from the cytosolic tail disrupted the interaction between MHC-I molecules and Derlin-1, rendering mutant MHC-I molecules resistant to US11-induced degradation. Consistently, deleting the C-terminal cytosolic region of Derlin-1 prevented it from binding to MHC-I molecules. Taken together, these results suggest that the cytosolic region of Derlin-1 is involved in ERAD substrate binding and that this interaction is critical for the Derlin-1-mediated dislocation of the MHC-I heavy chain to the cytosol during US11-induced MHC-I degradation. PMID:23951315

  12. A fusion protein of HCMV IE1 exon4 and IE2 exon5 stimulates potent cellular immunity in an MVA vaccine vector

    SciTech Connect

    Wang, Z.; Zhou, W.; Srivastava, T.; La Rosa, C.; Mandarino, A.; Forman, S.J.; Zaia, J.A.; Britt, W.J.; Diamond, D.J.

    2008-08-01

    A therapeutic CMV vaccine incorporating an antigenic repertoire capable of eliciting a cellular immune response has yet to be successfully implemented for patients who already have acquired an infection. To address this problem, we have developed a vaccine candidate derived from modified vaccinia Ankara (MVA) that expresses three immunodominant antigens (pp65, IE1, IE2) from CMV. The novelty of this vaccine is the fusion of two adjacent exons from the immediate-early region of CMV, their successful expression in MVA, and robust immunogenicity in both primary and memory response models. Evaluation of the immunogenicity of the viral vaccine in mouse models shows that it can stimulate primary immunity against all three antigens in both the CD4{sup +} and CD8{sup +} T cell subsets. Evaluation of human PBMC from healthy CMV-positive donors or patients within 6 months of receiving hematopoietic cell transplant shows robust stimulation of existing CMV-specific CD4{sup +} and CD8{sup +} T cell subsets.

  13. Induction of a subnuclear structure by the simultaneous expression of baculovirus proteins, IE1, LEF3, and P143 in the presence of hr

    SciTech Connect

    Nagamine, Toshihiro . E-mail: tnaga@riken.jp; Kawasaki, Yu; Matsumoto, Shogo

    2006-09-01

    Baculoviruses elicit the formation of a nuclear domain, called the virogenic stroma, in which viral DNA replication and nucleocapsid assembly occur. We had previously reported that nuclear focus formation of a transcriptional activator, IE1, is triggered by its binding to a viral DNA element, hr, and predicted that this hr-induced IE1 focus is an initial scaffold for the virogenic stroma. However, LEF3, a component of the virogenic stroma, did not localize to the IE1 foci. In exploring a mediator for its localization, we found that a baculovirus DNA helicase (P143), in combination with IE1 and hr, induced a subnuclear structure to which LEF3 localized and also that another component of the virogenic stroma, DBP, is able to localize to this structure. These results reveal that only four viral molecules are necessary to establish a nuclear domain which possesses a recruiting ability for a component of the virogenic stroma.

  14. 11 CFR 300.52 - Fundraising by Federal candidates and Federal officeholders (2 U.S.C. 441i(e)(1)&(4)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Fundraising by Federal candidates and Federal officeholders (2 U.S.C. 441i(e)(1)&(4)). 300.52 Section 300.52 Federal Elections FEDERAL ELECTION COMMISSION... Fundraising by Federal candidates and Federal officeholders (2 U.S.C. 441i(e)(1)&(4)). A Federal candidate,...

  15. Cytomegalovirus

    MedlinePlus

    ... virus, your doctor may suggest a test called amniocentesis. During this test, a needle is inserted into ... familydoctor.org editorial staff Tags: Allergy and Immunologic, Amniocentesis, child, fever, infant, jaundice, newborn, Throat Pain, weakness ...

  16. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention

    PubMed Central

    van Zuylen, Wendy J; Hamilton, Stuart T; Naing, Zin; Hall, Beverly; Shand, Antonia

    2014-01-01

    Cytomegalovirus is the most common congenital infection causing serious disease in infants. It is the leading infectious cause of sensorineural hearing loss and neurodevelopmental disability in developed countries. Despite the clinical importance of congenital cytomegalovirus, surveys show there is limited awareness and knowledge in the medical and general community about congenital cytomegalovirus infection. This article reviews the clinical features, global epidemiology, transmission and risk factors for cytomegalovirus infections. It also highlights several major advances made in recent years in the diagnosis and prevention of cytomegalovirus infection during pregnancy. Although research is ongoing, no therapy is currently proven to prevent or treat maternal, fetal or neonatal cytomegalovirus infection. Education of women regarding hygiene measures can help prevent cytomegalovirus infection and are currently the best strategy to prevent congenital cytomegalovirus disease. PMID:27512442

  17. Cytomegalovirus infection: the state of the art.

    PubMed

    Mosca, F; Pugni, L

    2007-10-01

    Cytomegalovirus (CMV) is the leading cause of congenital infection in humans and constitutes a major public health problem. Congenitally infected infants, both symptomatic and asymptomatic at birth, may develop sequelae, particularly sensorineural hearing loss (SNHL) and brain damage. Transmission of the virus from mother to fetus can occur during either primary or recurrent maternal infection; however it is much higher in primary infected mothers than in mothers with preconceptional immunity. Routine CMV screening for primary infection during pregnancy constitutes a controversial issue, because of the lack of prenatal recommended therapy for congenital CMV infection. Ganciclovir may be used to treat neonates with symptoms at birth. Despite advances in antiviral therapy, congenitally infected infants, both symptomatic and asymptomatic at birth, need a follow up evaluation to detect sequelae. Congenital CMV infection cna be diagnosed at birth by using a test based on detection of viral DNA by PCR in dried blood spots (Guthrie card) collected on filter paper in the first days of life. Therefore, universal newborn screening for CMV by using DBS test should be recommended to detect sequelae as early as possible, so that infants can receive intervention promptly.

  18. Leflunomide for cytomegalovirus: bench to bedside.

    PubMed

    Chacko, B; John, G T

    2012-04-01

    Cytomegalovirus (CMV) remains a major cause of morbidity and mortality among transplant recipients, frequently engaging the clinician in a struggle to balance graft preservation with control of CMV disease. Leflunomide has been shown to have immunosuppressive activity in experimental allograft models together with antiviral activity inhibiting CMV both in vitro and in vivo. Data are emerging about its potential role in ganciclovir-sensitive and -resistant CMV, primarily by virtue of a unique mechanism inhibiting virion assembly, as opposed to inhibition of viral DNA synthesis by current agents. This review aims to put in perspective, the knowledge acquired in the last decade or so on leflunomide for CMV. Evidence suggests that it might have activity against human CMV with good oral bioavailability and, more importantly in the resource-poor setting, is economical. Although the data presented here are not from randomized trials, several relevant observations have been made that could influence future, more structured assessments of the drug. An immune suppressive compound with antiviral features and experimental activity in chronic rejection is an attractive combination for organ transplantation, and it appears that leflunomide may just fit that niche.

  19. Protection against lethal cytomegalovirus infection by a recombinant vaccine containing a single nonameric T-cell epitope.

    PubMed Central

    Del Val, M; Schlicht, H J; Volkmer, H; Messerle, M; Reddehase, M J; Koszinowski, U H

    1991-01-01

    The regulatory immediate-early (IE) protein pp89 of murine cytomegalovirus induces CD8+ T lymphocytes that protect against lethal murine cytomegalovirus infection. The IE1 epitope is the only epitope of pp89 that is recognized by BALB/c cytolytic T lymphocytes (CTL). Using synthetic peptides, the optimal and minimal antigenic sequences of the IE1 epitope have been defined. To evaluate the predictive value of data obtained with synthetic peptides, recombinant vaccines encoding this single T-cell epitope were constructed using as a vector the hepatitis B virus core antigen encoded in recombinant vaccinia virus. In infected cells expressing the chimeric proteins, only IE1 epitope sequences that were recognized as synthetic peptides at concentrations lower than 10(-6) M were presented to CTL. Vaccination of mice with the recombinant vaccinia virus that encoded a chimeric protein carrying the optimal 9-amino-acid IE1 epitope sequence elicited CD8+ T lymphocytes with antiviral activity and, furthermore, protected against lethal disease. The results thus show for the first time that recombinant vaccines containing a single foreign nonameric CTL epitope can induce T-lymphocyte-mediated protective immunity. Images PMID:1710286

  20. Role of Litopenaeus vannamei Yin Yang 1 in the Regulation of the White Spot Syndrome Virus Immediate Early Gene ie1.

    PubMed

    Huang, Ping-Han; Huang, Ting-Yi; Cai, Pei-Si; Chang, Li-Kwan

    2017-03-15

    Yin Yang 1 (YY1) is a multifunctional zinc finger transcription factor that regulates many key cellular processes. In this study, we report the cloning of YY1 from Litopenaeus vannamei shrimp (LvYY1). This study shows that LvYY1 is ubiquitously expressed in shrimp tissues, and knockdown of LvYY1 expression by double-stranded RNA (dsRNA) injection in white spot syndrome virus (WSSV)-infected shrimp reduced both mRNA levels of the WSSV immediate early gene ie1 as well as overall copy numbers of the WSSV genome. The cumulative mortality rate of infected shrimp also declined with LvYY1 dsRNA injection. Using an insect cell model, we observed that LvYY1 activates ie1 expression, and a mutation introduced into the ie1 promoter subsequently repressed this capability. Moreover, reporter assay results suggested that LvYY1 is involved in basal transcriptional regulation via an interaction with L. vannamei TATA-binding protein (LvTBP). Electrophoretic mobility shift assay (EMSA) results further indicated that LvYY1 binds to a YY1-binding site in the region between positions -119 and -126 in the ie1 promoter. Chromatin immunoprecipitation analysis also confirmed that LvYY1 binds to the ie1 promoter in WSSV-infected shrimp. Taken together, these results indicate that WSSV uses host LvYY1 to enhance ie1 expression via a YY1-binding site and the TATA box in the ie1 promoter, thereby facilitating lytic activation and viral replication.IMPORTANCE WSSV has long been a scourge of the shrimp industry and remains a serious global threat. Thus, there is a pressing need to understand how the interactions between WSSV and its host drive infection, lytic development, pathogenesis, and mortality. Our successful cloning of L. vannamei YY1 (LvYY1) led to the elucidation of a critical virus-host interaction between LvYY1 and the WSSV immediate early gene ie1 We observed that LvYY1 regulates ie1 expression via a consensus YY1-binding site and TATA box. LvYY1 was also found to interact with L

  1. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators

    PubMed Central

    Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-01-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  2. Horizontal In Utero Acquisition of Cytomegalovirus Infection in a Twin Pregnancy

    PubMed Central

    Gabrielli, Liliana; Lazzarotto, Tiziana; Foschini, Maria Pia; Lanari, Marcello; Guerra, Brunella; Eusebi, Vincenzo; Landini, Maria Paola

    2003-01-01

    It is generally accepted that viral infections can be transmitted horizontally by direct or indirect contact with virus-excreting persons, and some viral infections can be transmitted vertically, either prenatally or perinatally, from mother to child. This report presents data strongly supporting a prenatal horizontal acquisition of human cytomegalovirus infection in a twin pregnancy. PMID:12624079

  3. Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes.

    PubMed

    Yao, Defu; Ruan, Lingwei; Lu, Huasong; Shi, Hong; Xu, Xun

    2016-12-01

    STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediate-early genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway.

  4. Rare Presentations of Cytomegalovirus Infection in Renal Allograft Recipients

    PubMed Central

    Ardalan, Mohammadreza

    2012-01-01

    Cytomegalovirus is the most common viral infection after kidney transplantation. Clinical presentations of cytomegalovirus infection range from asymptomatic infection to organ-specific involvement. Most symptomatic infections manifest as fever and cytopenia. The gastrointestinal tract is the most common site of tissue-invasive infection, often presenting as diarrhea or gastrointestinal bleeding. Gastrointestinal obstruction, perforation, thrombosis of large gastrointestinal veins, splenic artery thrombosis, and pancreatitis are rare gastrointestinal presentations of cytomegalovirus infection. Renal-allograft ureteral stricture and skin involvement are other rare presentations of cytomegalovirus infection. hemophagocytic syndrome, thrombotic microangiopathy, adrenal insufficiency, and renal allograft artery stenosis are other rare symptoms of cytomegalovirus infection. PMID:23573461

  5. Sensitivity of the Cytomegalovirus Antigenemia Assay to Diagnose Cytomegalovirus Retinitis

    PubMed Central

    Lee, Joo Yong; Chong, Yong Phil; Sung, Heungsup; Lee, Sang-Oh; Choi, Sang-Ho; Kim, Yang Soo; Woo, Jun Hee

    2016-01-01

    Background Cytomegalovirus (CMV) retinitis is one of the most important tissue-invasive CMV diseases in immunocompromised patients. Since 1980, non-invasive diagnostic methods, notably the CMV antigenemia assay, have been widely used as adjunct tests to diagnose tissue-invasive CMV diseases. However, there are limited data on the diagnostic value of the CMV antigenemia assay for diagnosing CMV retinitis. Materials and Methods We performed a retrospective review of all cases of CMV retinitis at Asan Medical Center, Seoul, South Korea over a 9-year period. The diagnosis of CMV retinitis was made by experienced ophthalmologists according to medical history and an ophthalmoscopic appearance of typical retinopathy, together with absence of an alternative diagnosis. Results We analyzed 44 patients with CMV retinitis (affecting 57 eyes) for whom the CMV antigenemia assay was performed. Of the 44 patients, 31 (70%) were HIV-uninfected and 13 (30%) were HIV-infected. The overall sensitivity of the CMV antigenemia assay was 66% (95% confidence interval [CI] 50–80%). The test’s sensitivity showed a non-significant trend towards being higher in HIV-infected patients than in HIV-uninfected patients (sensitivity 85% vs 58%, respectively, P = 0.16). In a subgroup analysis of the 35 patients without other concurrent tissue-invasive CMV disease, the sensitivity of the CMV antigenemia assay was 57% (95% CI 40–74%). Conclusions The CMV antigenemia assay has limited value as a non-invasive diagnostic adjunct test for CMV retinitis. Therefore, the results of the assay need to be interpreted in the context of underlying disease, clinical presentation, and ophthalmoscopic findings. PMID:27883376

  6. Human cytomegalovirus capsid assembly protein precursor (pUL80.5) interacts with itself and with the major capsid protein (pUL86) through two different domains.

    PubMed Central

    Wood, L J; Baxter, M K; Plafker, S M; Gibson, W

    1997-01-01

    We have used the yeast GAL4 two-hybrid system to examine interactions between the human cytomegalovirus (HCMV) major capsid protein (MCP, encoded by UL86) and the precursor assembly protein (pAP, encoded by UL80.5 and cleaved at its carboxyl end to yield AP) and found that (i) the pAP interacts with the MCP through residues located within the carboxy-terminal 21 amino acids of the pAP, called the carboxyl conserved domain (CCD); (ii) the pAP interacts with itself through a separate region, called the amino conserved domain (ACD), located between amino acids His34 and Arg52 near the amino end of the molecule; (iii) the simian CMV (SCMV) pAP and AP can interact with or replace their HCMV counterparts in these interactions, whereas the herpes simplex virus pAP and AP homologs cannot; and (iv) the HCMV and SCMV maturational proteinase precursors (ACpra, encoded by UL80a and APNG1, respectively) can interact with the pAP and MCP. The ACD and CCD amino acid sequences are highly conserved among members of the betaherpesvirus group and appear to have counterparts in the alpha- and gammaherpesvirus pAP homologs. Deleting the ACD from the HCMV pAP, or substituting Ala for a conserved Leu in the ACD, eliminated detectable pAP self-interaction and also substantially reduced MCP binding in the two-hybrid assay. This finding indicates that the pAP self-interaction influences the pAP-MCP interaction. Immunofluorescence studies corroborated the pAP-MCP interaction detected in the GAL4 two-hybrid experiments and showed that nuclear transport of the MCP was mediated by pAP but not AP. We conclude that the pAP interacts with the MCP, that this interaction is mediated by the CCD and is influenced by pAP self-interaction, and that one function of the pAP-MCP interaction may be to provide a controlled mechanism for transporting the MCP into the nucleus. PMID:8985337

  7. Functional interaction of nuclear domain 10 and its components with cytomegalovirus after infections: cross-species host cells versus native cells.

    PubMed

    Cosme, Ruth Cruz; Martínez, Francisco Puerta; Tang, Qiyi

    2011-04-28

    Species-specificity is one of the major characteristics of cytomegaloviruses (CMVs) and is the primary reason for the lack of a mouse model for the direct infection of human CMV (HCMV). It has been determined that CMV cross-species infections are blocked at the post-entry level by intrinsic cellular defense mechanisms, but few details are known. It is important to explore how CMVs interact with the subnuclear structure of the cross-species host cell. In our present study, we discovered that nuclear domain 10 (ND10) of human cells was not disrupted by murine CMV (MCMV) and that the ND10 of mouse cells was not disrupted by HCMV, although the ND10-disrupting protein, immediate-early protein 1 (IE1), also colocalized with ND10 in cross-species infections. In addition, we found that the UL131-repaired HCMV strain AD169 (vDW215-BADrUL131) can infect mouse cells to produce immediate-early (IE) and early (E) proteins but that neither DNA replication nor viral particles were detectable in mouse cells. Unrepaired AD169 can express IE1 only in mouse cells. In both HCMV-infected mouse cells and MCMV-infected human cells, the knocking-down of ND10 components (PML, Daxx, and SP100) resulted in significantly increased viral-protein production. Our observations provide evidence to support our hypothesis that ND10 and ND10 components might be important defensive factors against the CMV cross-species infection.

  8. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation

    PubMed Central

    Cloarec, Robin; Bauer, Sylvian; Luche, Hervé; Buhler, Emmanuelle; Pallesi-Pocachard, Emilie; Salmi, Manal; Courtens, Sandra; Massacrier, Annick; Grenot, Pierre; Teissier, Natacha; Watrin, Françoise; Schaller, Fabienne; Adle-Biassette, Homa; Gressens, Pierre; Malissen, Marie; Stamminger, Thomas; Streblow, Daniel N.; Bruneau, Nadine; Szepetowski, Pierre

    2016-01-01

    Background Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells. Objectives and Methods In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15) and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments. Results Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b– lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1. Conclusion In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which

  9. Mechanisms Underlying T Cell Immunosenescence: Aging and Cytomegalovirus Infection

    PubMed Central

    Tu, Wenjuan; Rao, Sudha

    2016-01-01

    The ability of the human immune system to protect against infectious disease declines with age and efficacy of vaccination reduces significantly in the elderly. Aging of the immune system, also termed as immunosenescence, involves many changes in human T cell immunity that is characterized by a loss in naïve T cell population and an increase in highly differentiated CD28- memory T cell subset. There is extensive data showing that latent persistent human cytomegalovirus (HCMV) infection is also associated with age-related immune dysfunction in the T cells, which might enhance immunosenescence. Understanding the molecular mechanisms underlying age-related and HCMV-related immunosenescence is critical for the development of effective age-targeted vaccines and immunotherapies. In this review, we will address the role of both aging and HCMV infection that contribute to the T cell senescence and discuss the potential molecular mechanisms in aged T cells. PMID:28082969

  10. Congenital cytomegalovirus infection – An update

    PubMed Central

    Friedman, Smadar; Ford-Jones, E Lee

    1999-01-01

    Cytomegalovirus is estimated to be the leading infectious cause of nonheriditary sensorneural loss and a significant cause of mental retardation. Approximately 1% of newborn infants are congenitally infected with the virus. This review summarizes recent developments concerning this infection, including clinical outcome, risk factors for aquisition diagnosis and therapy. PMID:20212987

  11. Cytomegalovirus appendicitis in an immunocompetent host.

    PubMed

    Canterino, Joseph E; McCormack, Michael; Gurung, Ananta; Passarelli, James; Landry, Marie L; Golden, Marjorie

    2016-05-01

    Cytomegalovirus (CMV) is a common viral pathogen. Asymptomatic infection or a mononucleosis syndrome are the most common manifestations in otherwise healthy individuals. End-organ disease is rare in immunocompetent individuals. Here, we describe a case of CMV appendicitis in a patient without an immune-compromising condition.

  12. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  13. Complete Sequence and Genomic Analysis of Rhesus Cytomegalovirus

    PubMed Central

    Hansen, Scott G.; Strelow, Lisa I.; Franchi, David C.; Anders, David G.; Wong, Scott W.

    2003-01-01

    The complete DNA sequence of rhesus cytomegalovirus (RhCMV) strain 68-1 was determined with the whole-genome shotgun approach on virion DNA. The RhCMV genome is 221,459 bp in length and possesses a 49% G+C base composition. The genome contains 230 potential open reading frames (ORFs) of 100 or more codons that are arranged colinearly with counterparts of previously sequenced betaherpesviruses such as human cytomegalovirus (HCMV). Of the 230 RhCMV ORFs, 138 (60%) are homologous to known HCMV proteins. The conserved ORFs include the structural, replicative, and transcriptional regulatory proteins, immune evasion elements, G protein-coupled receptors, and immunoglobulin homologues. Interestingly, the RhCMV genome also contains sequences with homology to cyclooxygenase-2, an enzyme associated with inflammatory processes. Closer examination identified a series of candidate exons with the capacity to encode a full-length cyclooxygenase-2 protein. Counterparts of cyclooxygenase-2 have not been found in other sequenced herpesviruses. The availability of the complete RhCMV sequence along with the ability to grow RhCMV in vitro will facilitate the construction of recombinant viral strains for identifying viral determinants of CMV pathogenicity in the experimentally infected rhesus macaque and to the development of CMV as a vaccine vector. PMID:12767982

  14. [Visual and auditory impairment in children with congenital cytomegalovirus and Toxoplasma gondii infection].

    PubMed

    Lipka, Bozena; Milewska-Bobula, Bogumiła; Idzik, Mirosława; Marciński, Paweł; Dunin-Wasowicz, Dorota; Kassur-Siemieńska, Barbara; Bauer, Anna; Sebiguli Marishekome, Augustin; Hautz, Wojciech; Radziszewska, Marzanna

    2002-01-01

    Intrauterine infections are an important cause of hearing and visual impairment in children. The aim of this paper was to evaluate the character and frequency of hearing and visual disturbances in children with congenital toxoplasmosis and cytomegalovirus infection. 38 out of 54 children with congenital toxoplasmosis as well as 34 out of 403 children with congenital human cytomegalovirus disease, with visual/auditory impairment, hospitalized in Infant Department in Children's Memorial Health Institute between 1995-2001 were enrolled in this study. Visual impairment was observed in all children with toxoplasmosis (with visual dysfunction rate of 74%), but there was no deafness found. Vision impairment had been observed in 18% of children with congenital cytomegalovirus infection compared to 35% of children with auditory impairment (bilateral deafness had been found in half of them). Neurological deficits' rate was much higher in children with toxoplasmosis (52% vs. 4%). Because of common hearing impairment in children with congenital cytomegalovirus infection and vision impairment in children with congenital toxoplasmosis, it is essential to start the prophylaxis to decrease the percentage of handicapped children.

  15. White spot syndrome virus IE1 and WSV056 modulate the G1/S transition by binding to the host retinoblastoma protein.

    PubMed

    Ran, Xiaozhuo; Bian, Xiaofang; Ji, Yongchang; Yan, Xiumin; Yang, Feng; Li, Fang

    2013-12-01

    DNA viruses often target cellular proteins to modulate host cell cycles and facilitate viral genome replication. However, whether proliferation of white spot syndrome virus (WSSV) requires regulation of the host cell cycle remains unclear. In the present study, we show that two WSSV paralogs, IE1 and WSV056, can interact with Litopenaeus vannamei retinoblastoma (Rb)-like protein (lv-RBL) through the conserved LxCxE motif. Further investigation revealed that IE1 and WSV056 could also bind to Drosophila retinoblastoma family protein 1 (RBF1) in a manner similar to how they bind to lv-RBL. Using the Drosophila RBF-E2F pathway as a model system, we demonstrated that both IE1 and WSV056 could sequester RBF1 from Drosophila E2F transcription factor 1 (E2F1) and subsequently activate E2F1 to stimulate the G1/S transition. Our findings provide the first evidence that WSSV may regulate cell cycle progression by targeting the Rb-E2F pathway.

  16. Cytomegalovirus-targeted immunotherapy and glioblastoma: hype or hope?

    PubMed

    Ferguson, Sherise D; Srinivasan, Visish M; Ghali, Michael Gz; Heimberger, Amy B

    2016-01-01

    Malignant gliomas, including glioblastoma (GBM), are the most common primary brain tumors. Despite extensive research only modest gains have been made in long-term survival. Standard of care involves maximizing safe surgical resection followed by concurrent chemoradiation with temozolomide. Immunotherapy for GBM is an area of intense research in recent years. New immunotherapies, although promising, have not been integrated into standard practice. Human cytomegalovirus (HCMV) is a DNA virus of the family Herpesviridae. Human seroprevalence is approximately 80%, and in most cases, is associated with asymptomatic infection. HCMV may be an important agent in the initiation, promotion and/or progression of tumorigenesis. Regardless of a possible etiologic role in GBM, interest has centered on exploiting this association for development of immunomodulatory therapies.

  17. Seroprevalence and Seroconversion Rates of Cytomegalovirus pp65 Antigen and Cord Blood Screening of Pregnant Women in Malatya, Turkey

    PubMed Central

    Dogan, Keziban; Kafkasli, Ayse; Kaya, Cihan; Cengiz, Huseyin

    2013-01-01

    Objective: The rates of seropositivity, seroconversion and fetal infection with human cytomegalovirus were analyzed in pregnant women and newborn cord blood in this study. The relationships between maternal age, parity, cytomegalovirus serology and polymerase chain reaction results were evaluated. Materials and Methods: A total of 217 pregnant women attended our pregnancy clinic between April 2004 and October 2005. During each trimester, 5 cc of maternal blood was obtained and 5 cc of cord blood was collected after birth. An enzyme-linked immunosorbent assay (ELISA) was used to assess these samples for the presence of human cytomegalovirus protein pp65 antigen (in leukocytes) and cytomegalovirus DNA (in plasma). Results: The mean age of the pregnant women in our study was 28.1±5.3 years. No seroconversion was observed. Among the pregnant women, 212 (97.7%) were IgG positive, and 29 (13.4%) were IgM positive. Five of the pregnant women were positive for IgM alone (2.3%), whereas 24 (11.3%) were positive for both IgM and IgG. The 29 IgM-positive patients were reevaluated using the polymerase chain reaction, and no seropositivity was found. None of the cord blood samples were IgM positive, whereas 211 (97.3%) were IgG positive. There was no significant correlation between parity and seropositivity (p=0.487). The relationship between human cytomegalovirus seropositivity and maternal age was evaluated by dividing the pregnant women into two groups, with a cut-off age of 35 years. There was a significant difference in seropositivity between these two groups (p=0.045). Conclusion: Clearly, there is no need to screen pregnant women for Human cytomegalovirus (HCMV) in the Malatya region. Confirming serology results using the polymerase chain reaction and antigenemia testing to detect false positive results offers the advantage of avoiding unnecessary invasive interventions. PMID:25610259

  18. Thrombosis associated with acute cytomegalovirus infection: a narrative review

    PubMed Central

    Sherman, Shany; Eytan, Ori

    2014-01-01

    Thrombosis associated with acute cytomegalovirus infection has been reported many times in the literature since the mid 1980s – mainly in case reports and in small case series, but also in four controlled studies. Still, many physicians are unaware of this association although acute cytomegalovirus infection diagnosis in a thrombosis patient may warrant antiviral therapy and may affect anticoagulation therapy duration. Accordingly, the clinical characteristics of patients with thrombosis and acute cytomegalovirus infection are reviewed, and the current knowledge concerning this unique association is presented herein. We believe it is time to add acute cytomegalovirus infection to the list of thrombosis triggers. PMID:25624857

  19. Cytomegalovirus UL103 controls virion and dense body egress.

    PubMed

    Ahlqvist, Jenny; Mocarski, Edward

    2011-05-01

    Human cytomegalovirus UL103 encodes a tegument protein that is conserved across herpesvirus subgroups. Mutant viruses lacking this gene product exhibit dramatically reduced accumulation of cell-free virus progeny and poor cell-to-cell spread. Given that viral proteins and viral DNA accumulate with normal kinetics in cells infected with mutant virus, UL103 appears to function during the late phase of replication, playing a critical role in egress of capsidless dense bodies and virions. Few dense bodies were observed in the extracellular space in mutant virus-infected cells in the presence or absence of the DNA encapsidation inhibitor 2-bromo-5,6-dichloro-1-(β-d-ribofuranosyl)benzimidazole. Upon reversal of encapsidation inhibition, UL103 had a striking impact on accumulation of cell-free virus, but not on accumulation of cell-associated virus. Thus, UL103 plays a novel and important role during maturation, regulating virus particle and dense body egress from infected cells.

  20. Pneumocystis carinii, Toxoplasma gondii, Cytomegalovirus and the Compromised Host

    PubMed Central

    Ryning, Frank W.; Mills, John

    1979-01-01

    Pneumocystis carinii and Toxoplasma gondii are the two major parasitic protozoan pathogens in the immunocompromised host. Both organisms cause latent infection in humans and many animals. Cats are the definitive hosts for toxoplasmosis; the animal vector for pneumocystis (if any) has not been defined. Toxoplasma is an obligate intracellular parasite, whereas the available evidence suggests that Pneumocystis carinii exists primarily extracellularly. In compromised hosts, pneumocystis infection usually involves only lungs, whereas toxoplasma causes a generalized infection with encephalitis being the principal clinical manifestation. Both types of infection are treated with combinations of folate antagonists (trimethoprim or pyrimethamine with sulfonamide). Both parasites are associated with cytomegalovirus infection in immunosuppressed hosts, an association which may be due to symbiosis between parasites, or to an additive immunosuppressive effect of dual infection on the hosts. ImagesFigure 1.Figure 3.Figure 4.Figure 7.Figure 8.Figure 9. PMID:217182

  1. Transient antiphospholipid syndrome associated with primary cytomegalovirus infection: a case report and literature review.

    PubMed

    Nakayama, Tsuyoshi; Akahoshi, Mitsuteru; Irino, Kensuke; Kimoto, Yasutaka; Arinobu, Yojiro; Niiro, Hiroaki; Tsukamoto, Hiroshi; Horiuchi, Takahiko; Akashi, Koichi

    2014-01-01

    Viral infection is known to induce transient autoimmunity in humans. Acute cytomegalovirus (CMV) infection is implicated in occasional thrombosis formation. We here, for the first time, report a 19-year-old female who had an acute CMV infection, leading to a deep venous thrombosis and a pulmonary embolism along with transient appearance of lupus anticoagulant. The pathological role of antiphospholipid antibodies in CMV-mediated thrombosis is discussed.

  2. Evaluation of a quantitative plasma PCR plate assay for detecting cytomegalovirus infection in marrow transplant recipients.

    PubMed Central

    Gallez-Hawkins, G M; Tegtmeier, B R; ter Veer, A; Niland, J C; Forman, S J; Zaia, J A

    1997-01-01

    A plasma PCR test, using a nonradioactive PCR plate assay, was evaluated for detection of human cytomegalovirus reactivation. This assay was compared to Southern blotting and found to perform well. As a noncompetitive method of quantitation, it was similar to a competitive method for detecting the number of genome copies per milliliter of plasma in marrow transplant recipients. This is a technically simplified assay with potential for adaptation to automation. PMID:9041438

  3. Severe Cytomegalovirus Gastritis During Natalizumab-Mediated Immunosuppression

    PubMed Central

    Hassan, Adil; Hassan, Anjum; Hassan, Tariq

    2017-01-01

    We report a 35-year-old female receiving natalizumab as monotherapy for multiple sclerosis who subsequently developed severe cytomegalovirus gastritis. As cytomegalovirus gastritis has not been previously described during natalizumab treatment, we discuss the biological plausibility of this potential association and avenues for further study. PMID:28331881

  4. PCR detection of cytomegalovirus DNA in serum as a diagnostic test for congenital cytomegalovirus infection.

    PubMed Central

    Nelson, C T; Istas, A S; Wilkerson, M K; Demmler, G J

    1995-01-01

    PCR detected cytomegalovirus (CMV) DNA in the serum of 18 of 18 infants with symptomatic congenital CMV infection, 1 of 2 infants with asymptomatic congenital CMV infection, and 0 of 32 controls. Serum CMV PCR provided a rapid, sensitive, and specific method for diagnosis of congenital CMV infection in infants who were symptomatic at birth. PMID:8586726

  5. Dataset of aqueous humor cytokine profile in HIV patients with Cytomegalovirus (CMV) retinitis.

    PubMed

    Iyer, Jayant Venkatramani; Agrawal, Rupesh; Yeo, Tun Kuan; Gunasekeran, Dinesh V; Balne, Praveen Kumar; Lee, Bernett; Au, Veonice Bijin; Connolly, John; Teoh, Stephen C B

    2016-09-01

    The data shows the aqueous humor cytokine profiling results acquired in a small cohort of 17 HIV patients clinically diagnosed with Cytomegalovirus retinitis using the FlexMAP 3D (Luminex®) platform using the Milliplex Human Cytokine® kit. Aqueous humor samples were collected from these patients at different time points (pre-treatment and at 4-weekly intervals through the 12-week course of intravitreal ganciclovir treatment) and 41 cytokine levels were analyzed at each time point. CMV DNA viral load was assessed in 8 patients at different time points throughout the course of ganciclovir treatment. The data described herein is related to the research article entitled "Aqueous humor immune factors and cytomegalovirus (CMV) levels in CMV retinitis through treatment - The CRIGSS study" (Iyer et al., 2016) [1]. Cytokine levels against the different time points which indicate the response to the given treatment and against the CMV viral load were analyzed.

  6. Role for Tumor Necrosis Factor Alpha in Murine Cytomegalovirus Transcriptional Reactivation in Latently Infected Lungs

    PubMed Central

    Simon, Christian O.; Seckert, Christof K.; Dreis, Doris; Reddehase, Matthias J.; Grzimek, Natascha K. A.

    2005-01-01

    Interstitial pneumonia is a major clinical manifestation of primary or recurrent cytomegalovirus (CMV) infection in immunocompromised recipients of a bone marrow transplant. In a murine model, lungs were identified as a prominent site of CMV latency and recurrence. Pulmonary latency of murine CMV is characterized by high viral genome burden and a low incidence of variegated immediate-early (IE) gene expression, reflecting a sporadic activity of the major IE promoters (MIEPs) and enhancer. The enhancer-flanking promoters MIEP1/3 and MIEP2 are switched on and off during latency in a ratio of ∼2:1. MIEP1/3 latency-associated activity generates the IE1 transcript of the ie1/3 transcription unit but not the alternative splicing product IE3 that encodes the essential transactivator of early gene expression. Splicing thus appeared to be an important checkpoint for maintenance of latency. In accordance with previous work of others, we show here that signaling by the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) activates IE1/3 transcription in vivo. As an addition to current knowledge, Poisson distribution analysis revealed an increased incidence of IE1/3 transcriptional events as well as a higher amount of transcripts per event. Notably, TNF-α promoted the splicing to IE3 transcripts, but transcription did not proceed to the M55/gB early gene. Moreover, the activated transcriptional state induced by TNF-α did not predispose latently infected mice to a higher incidence of virus recurrence after hematoablative treatment. In conclusion, TNF-α is an important inductor of IE gene transcriptional reactivation, whereas early genes downstream in the viral replicative cycle appear to be the rate-limiting checkpoint(s) for virus recurrence. PMID:15596827

  7. Strongyloides Hyperinfection Syndrome Combined with Cytomegalovirus Infection

    PubMed Central

    Alsaeed, Mohammed; Ballool, Sulafa; Attia, Ashraf

    2016-01-01

    The mortality in Strongyloides hyperinfection syndrome (SHS) is alarmingly high. This is particularly common in bone marrow, renal, and other solid organ transplant (SOT) patients, where figures may reach up to 50–85%. Immunosuppressives, principally corticosteroids, are the primary triggering factor. In general, the clinical features of Strongyloides stercoralis hyperinfection are nonspecific; therefore, a high index of suspicion is required for early diagnosis and starting appropriate therapy. Although recurrent Gram-negative sepsis and meningitis have been previously reported, the combination of both cytomegalovirus (CMV) and strongyloidiasis had rarely been associated. We here describe a patient who survived SHS with recurrent Escherichia coli (E. coli) urosepsis and CMV infection. PMID:27703835

  8. [Morphological fibroblastic changes in cytomegalovirus infection].

    PubMed

    Parkhomenko, Iu V; Solnyshkova, T G; Tishkivich, O A; Shakhgil'dian, V I; Nikonova, E A

    2006-01-01

    Cytomegalovirus (CMV) infection is widely spread among population. While immunocompetent patients suffer rarely from this virus, it can lead to a lethal outcome in immunocompromised patients. An electron microscopic study has detected fibroblastic morphological changes of a definite cytodestructive character. The nuclei of some fibroblasts have chromatine condensation. A clear zone arising due to vacuolization near this inclusion may reflect nuclear rearrangement leading to further CMV metamorphosis of the cell. This metamorphosis is characteristic of the changes developing in the cells of different parenchymatous organs.

  9. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions.

    PubMed

    Walzer, Sascha A; Egerer-Sieber, Claudia; Sticht, Heinrich; Sevvana, Madhumati; Hohl, Katharina; Milbradt, Jens; Muller, Yves A; Marschall, Manfred

    2015-11-13

    Nuclear replication of cytomegalovirus relies on elaborate mechanisms of nucleocytoplasmic egress of viral particles. Thus, the role of two essential and conserved viral nuclear egress proteins, pUL50 and pUL53, is pivotal. pUL50 and pUL53 heterodimerize and form a core nuclear egress complex (NEC), which is anchored to the inner nuclear membrane and provides a scaffold for the assembly of a multimeric viral-cellular NEC. Here, we report the crystal structure of the pUL50-pUL53 heterodimer (amino acids 1-175 and 50-292, respectively) at 2.44 Å resolution. Both proteins adopt a globular fold with mixed α and β secondary structure elements. pUL53-specific features include a zinc-binding site and a hook-like N-terminal extension, the latter representing a hallmark element of the pUL50-pUL53 interaction. The hook-like extension (amino acids 59-87) embraces pUL50 and contributes 1510 Å(2) to the total interface area (1880 Å(2)). The pUL50 structure overall resembles the recently published NMR structure of the murine cytomegalovirus homolog pM50 but reveals a considerable repositioning of the very C-terminal α-helix of pUL50 upon pUL53 binding. pUL53 shows structural resemblance with the GHKL domain of bacterial sensory histidine kinases. A close examination of the crystal structure indicates partial assembly of pUL50-pUL53 heterodimers to hexameric ring-like structures possibly providing additional scaffolding opportunities for NEC. In combination, the structural information on pUL50-pUL53 considerably improves our understanding of the mechanism of HCMV nuclear egress. It may also accelerate the validation of the NEC as a unique target for developing a novel type of antiviral drug and improved options of broad-spectrum antiherpesviral therapy.

  10. Murine cytomegalovirus infection of cultured mouse embryos.

    PubMed Central

    Tsutsui, Y.; Naruse, I.

    1987-01-01

    Isolated mouse whole embryos of 7.5 days' gestation were infected with murine cytomegalovirus (MCMV) and cultured in pure rat serum. Although the MCMV infection had little effect on the survival and development of the embryos during 3 days of cultivation, immunohistochemical analysis of their serial sections using monoclonal antibody showed MCMV-infected cells in various portions of the embryos. This monoclonal antibody, when tested with the use of infected cultured mouse fibroblasts, reacted with nuclear antigen within 2 hours after infection and also reacted with nuclear inclusions in the late phase of infection. The viral antigen-positive cells detected by the monoclonal antibody were present in almost all of the ectoplacental cone and the yolk sac and in about 82% of the embryos. In the embryos, antigen-positive cells were frequently observed in the epithelium of the digestive tracts, endothelial cells of the blood vessels, and the mesodermal cells. In some of the embryos, viral antigen-positive cells were clearly observed in a small percentage of the blood cells. These findings indicate that blood cells, in addition to cell migration during embryogenesis, may play an important role in transmission of infectious virus into the embryos. Mouse whole embryo culture infected with MCMV can provide a model for the study of cellular tropism related to congenital infection by cytomegalovirus. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:3034066

  11. Report from the second cytomegalovirus and immunosenescence workshop.

    PubMed

    Wills, Mark; Akbar, Arne; Beswick, Mark; Bosch, Jos A; Caruso, Calogero; Colonna-Romano, Giuseppina; Dutta, Ambarish; Franceschi, Claudio; Fulop, Tamas; Gkrania-Klotsas, Effrossyni; Goronzy, Joerg; Griffiths, Stephen J; Henson, Sian; Herndler-Brandstetter, Dietmar; Hill, Ann; Kern, Florian; Klenerman, Paul; Macallan, Derek; Macualay, Richard; Maier, Andrea B; Mason, Gavin; Melzer, David; Morgan, Matthew; Moss, Paul; Nikolich-Zugich, Janko; Pachnio, Annette; Riddell, Natalie; Roberts, Ryan; Sansoni, Paolo; Sauce, Delphine; Sinclair, John; Solana, Rafael; Strindhall, Jan; Trzonkowski, Piotr; van Lier, Rene; Vescovini, Rosanna; Wang, George; Westendorp, Rudi; Pawelec, Graham

    2011-10-28

    The Second International Workshop on CMV & Immunosenescence was held in Cambridge, UK, 2-4th December, 2010. The presentations covered four separate sessions: cytomegalovirus and T cell phenotypes; T cell memory frequency, inflation and immunosenescence; cytomegalovirus in aging, mortality and disease states; and the immunobiology of cytomegalovirus-specific T cells and effects of the virus on vaccination. This commentary summarizes the major findings of these presentations and references subsequently published work from the presenter laboratory where appropriate and draws together major themes that were subsequently discussed along with new areas of interest that were highlighted by this discussion.

  12. Growth of Murine Cytomegalovirus in Various Cell Lines

    PubMed Central

    Kim, Kwang Soo; Carp, Richard I.

    1971-01-01

    Murine cytomegalovirus (MCMV) was capable of infecting and replicating in both primary and continuous cell lines obtained from various species. In African green monkey kidney (BSC-1) cells, primary rabbit kidney cells, and baby hamster kidney (BHK-21) cells, there were cytopathic effects (CPE) and virus replication upon initial exposure of cells to virus. In primary fetal sheep brain (FSB) cells, L cells, and rabbit kidney (RK-13) cells, it was necessary to subculture the infected cells one or more times before appearance of CPE and replication of virus. In the case of the infected FSB cultures, it was found that the virus effect could be induced if subculturing were accomplished by trypsinization but did not occur if cells were subcultured by scraping. FSB-grown virus replicated better in FSB than in mouse embryo fibroblast (MEF) cells. The CPE produced in all of the above cell lines was similar to that observed in MEF infected with MCMV. The virus grown in different cell lines was completely neutralized when mixed with several reference sera prepared in rabbits or mice. The populations of virions released from infected MEF and FSB cells were compared by isopycnic centrifugation in potassium tartrate, and no differences were revealed in the buoyant densities of the populations. Human embryonic brain cells, human embryonic kidney cells, a human lung fibroblast cell strain (WI-38), HeLa, and Hep-2 were not susceptible to MCMV. PMID:4327583

  13. Cytomegalovirus Reinfections Stimulate CD8 T-Memory Inflation

    PubMed Central

    Trgovcich, Joanne; Kincaid, Michelle; Thomas, Alicia; Griessl, Marion; Zimmerman, Peter; Dwivedi, Varun; Bergdall, Valerie; Klenerman, Paul

    2016-01-01

    Cytomegalovirus (CMV) has been shown to induce large populations of CD8 T-effector memory cells that unlike central memory persist in large quantities following infection, a phenomenon commonly termed “memory inflation”. Although murine models to date have shown very large and persistent CMV-specific T-cell expansions following infection, there is considerable variability in CMV-specific T-memory responses in humans. Historically such memory inflation in humans has been assumed a consequence of reactivation events during the life of the host. Because basic information about CMV infection/re-infection and reactivation in immune competent humans is not available, we used a murine model to test how primary infection, reinfection, and reactivation stimuli influence memory inflation. We show that low titer infections induce “partial” memory inflation of both mCMV specific CD8 T-cells and antibody. We show further that reinfection with different strains can boost partial memory inflation. Finally, we show preliminary results suggesting that a single strong reactivation stimulus does not stimulate memory inflation. Altogether, our results suggest that while high titer primary infections can induce memory inflation, reinfections during the life of a host may be more important than previously appreciated. PMID:27870919

  14. Pseudoneoplastic appearance of cytomegalovirus-associated colitis in nonimmunocompromised patients: report of 2 cases.

    PubMed

    Maiorana, Antonio; Torricelli, Pietro; Giusti, Federica; Bellini, Nicola

    2003-09-01

    Two cases of human cytomegalovirus (HCMV) colitis with pseudoneoplastic appearance are described. Patients presented with abdominal pain, fever, and diarrhea. Colonoscopy revealed a stenosing lesion in one patient and a broad-based, vegetant mass in the other patient, and histopathological examination of colectomy specimens revealed exuberant inflammatory masses with infiltration of mononuclear cells and ulcers with granulation tissue. Typical intranuclear HCMV inclusions were numerous. Peculiar to both patients was the lack of any apparent causes of immunodeficiency, such as human immunodeficiency virus infection or previous organ transplantation.

  15. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... serum. The identification aids in the diagnosis of diseases caused by cytomegaloviruses (principally cytomegalic inclusion disease) and provides epidemiological information on these diseases. Cytomegalic inclusion disease is a generalized infection of infants and is caused by intrauterine or early...

  16. Severe acquired cytomegalovirus infection in a full-term, formula-fed infant: Case Report

    PubMed Central

    2011-01-01

    Background Cases of cytomegalovirus colitis are exceptionally reported in immuno-competent infant. The pathogenesis is uncertain but breast-feeding is considered as a main source of postnatal infection. Case Presentation Here we report a full-term, formula-fed infant who developed a severe cytomegalovirus anaemia and colitis when aged 2 months. Conclusion Even if the molecular identity between the cytomegalovirus-isolate of the infant and the maternal virus could not be demonstrated, we confirmed through laboratory investigation that cytomegalovirus infection was acquired postnatally. However, the source of cytomegalovirus infection remained unclear. Alternative modes of cytomegalovirus transmission are discussed. PMID:21645352

  17. Developmental analysis of the cytomegalovirus enhancer in transgenic animals.

    PubMed

    Baskar, J F; Smith, P P; Ciment, G S; Hoffmann, S; Tucker, C; Tenney, D J; Colberg-Poley, A M; Nelson, J A; Ghazal, P

    1996-05-01

    The major immediate-early promoter (MIEP) of human, cytomegalovirus (HCMV) constitutes a primary genetic switch for viral activation. In this study, regulation of the enhancer-containing segment (nucleotides -670 to +54) of the HCMV MIEP attached to the 1acZ reporter gene was examined in the developing embryos of transgenic mice to identify temporal and tissue-specific expression. We find that the transgene reporter is first detected as a dorsal stripe of expression in the neural folds of embryos at day 8.5 postcoitum (p.c.). A broad expression pattern is exhibited in embryos at day 9.5 p.c. This pattern becomes more restricted by day 10.5 p.c. as organogenesis progresses. By day 14.5 p.c., prominent expression is observed in a subpopulation of central nervous system cells and spinal ganglia, endothelial cells, muscle, skin, thyroid, parathyroid, kidney, lung, liver, and gut cells, and the pancreas and submandibular and pituitary glands. This distribution pattern is discussed in relation to human congenital HCMV infection. These results suggest that the transcriptional activity of the HCMV MIEP may determine in part, the ability of the virus to specifically target developing fetal tissues in utero.

  18. Controlling cytomegalovirus: helping the immune system take the lead.

    PubMed

    Hanley, Patrick J; Bollard, Catherine M

    2014-05-27

    Cytomegalovirus, of the Herpesviridae family, has evolved alongside humans for thousands of years with an intricate balance of latency, immune evasion, and transmission. While upwards of 70% of humans have evidence of CMV infection, the majority of healthy people show little to no clinical symptoms of primary infection and CMV disease is rarely observed during persistent infection in immunocompetent hosts. Despite the fact that the majority of infected individuals are asymptomatic, immunologically, CMV hijacks the immune system by infecting and remaining latent in antigen-presenting cells that occasionally reactivate subclinically and present antigen to T cells, eventually causing the inflation of CMV-specific T cells until they can compromise up to 10% of the entire T cell repertoire. Because of this impact on the immune system, as well as its importance in fields such as stem cell and organ transplant, the relationship between CMV and the immune response has been studied in depth. Here we provide a review of many of these studies and insights into how CMV-specific T cells are currently being used therapeutically.

  19. Evaluation of a standardised real-time PCR based DNA-detection method (Realstar®) in whole blood for the diagnosis of primary human cytomegalovirus (CMV) infections in immunocompetent patients.

    PubMed

    Berth, M; Benoy, I; Christensen, N

    2016-02-01

    Cytomegalovirus (CMV) DNA detection in blood could, as a supplementary test to serology, improve the accuracy and speed of diagnosis of an acute CMV infection. In this study we evaluated the performance of a commercially available and standardised CMV PCR assay in whole blood for the diagnosis of a primary infection in immunocompetent adults. Moreover, the kinetics of viral DNA was evaluated in order to provide a time frame in which viral DNA could be detected during an acute primary infection. Whole blood samples were collected from 66 patients with an acute CMV infection, 65 patients with an acute Epstein-Barr virus infection, 27 patients with various other acute infections (parvovirus B19, HIV, Toxoplasma gondii), 20 patients with past CMV infections (>1 year) and 20 apparently healthy persons. For CMV DNA detection and quantification a commercially available real-time PCR was applied (RealStar®, altona Diagnostics). The clinical sensitivity of CMV PCR in whole blood for the diagnosis of a recent primary CMV infection was 93.9 % and the diagnostic specificity 99.2 %. In the majority of the patients CMV DNA was not detectable anymore approximately within 4 weeks after the first blood sample was taken. From these data we concluded that, together with a suggestive serological profile, a positive CMV PCR result in whole blood can be regarded as a diagnostic confirmation of a recent CMV infection on a single blood sample in an immunocompetent patient. However, a negative CMV PCR result does not exclude a recent CMV infection.

  20. Cytomegalovirus in pregnancy and the neonate

    PubMed Central

    Emery, Vincent C.; Lazzarotto, Tiziana

    2017-01-01

    Congenital cytomegalovirus (CMV) remains a leading cause of disability in children. Understanding the pathogenesis of infection from the mother via the placenta to the neonate is crucial if we are to produce new interventions and provide supportive mechanisms to improve the outcome of congenitally infected children. In recent years, some major goals have been achieved, including the diagnosis of primary maternal CMV infection in pregnant women by using the anti-CMV IgG avidity test and the diagnosis and prognosis of foetal CMV infection by using polymerase chain reaction real-time tests to detect and quantify the virus in amniotic fluid. This review summarises recent advances in our understanding and highlights where challenges remain, especially in vaccine development and anti-viral therapy of the pregnant woman and the neonate. Currently, no therapeutic options during pregnancy are available except those undergoing clinical trials, whereas valganciclovir treatment is recommended for congenitally infected neonates with moderately to severely symptomatic disease. PMID:28299191

  1. Cytomegalovirus myelitis in perinatally acquired HIV.

    PubMed Central

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W

    1993-01-01

    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, neurons, macrophages, ependymal, endothelial, and Schwann cells. Other organs had no signs of CMV infection. Central nervous spinal CMV infection was most probably due to insufficient penetration of the blood-brain barrier by the CMV hyper-immunoglobulin. In suspicious cases early spinal magnetic resonance imaging (1.5 tesla) combined with an examination of urine and cerebrospinal fluid for CMV is recommended. Images Figure 1 Figure 2 Figure 3 PMID:8385439

  2. The history of vaccination against cytomegalovirus.

    PubMed

    Plotkin, Stanley

    2015-06-01

    Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.

  3. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant

    MedlinePlus

    ... Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a ... weakened by medicines that you must take after stem cell transplant and by the transplant itself. Your body ...

  4. AcMNPV AC16 (DA26, BV/ODV-E26) regulates the levels of IE0 and IE1 and binds to both proteins via a domain located within the acidic transcriptional activation domain.

    PubMed

    Nie, Yingchao; Fang, Minggang; Theilmann, David A

    2009-03-15

    IE0 and IE1 are the primary viral regulatory proteins of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) involved in the transactivation of early genes, stimulation of late gene expression, and viral DNA replication. The protein interactions required for IE0 or IE1 to achieve these varied roles are not well defined, so to identify proteins that interact with IE0 and IE1, tandem affinity purification (TAP) and LC-MS/MS was used. Analysis of purified proteins identified AC16 (DA26, BV/ODV-E26) from TAP tagged IE0 virus infected Sf9 cells. Co-immunoprecipitation confirmed that AC16 interacts with both IE0 and IE1 and yeast 2-hybrid analysis mapped the domain required for interaction with AC16. Mutation of the AC16 binding domain enhanced BV production by viruses expressing only IE0 but had no effect if only IE1 is expressed. An ac16 deletion virus was constructed and was shown not to affect the temporal expression of IE0 and IE1; however the relative level of IE0 to IE1 was significantly increased.

  5. Methylenetetrahydrofolate reductase (MTHFR) deficiency enhances resistance against cytomegalovirus infection.

    PubMed

    Fodil-Cornu, N; Kozij, N; Wu, Q; Rozen, R; Vidal, S M

    2009-10-01

    Folates provide one-carbon units for nucleotide synthesis and methylation reactions. A common polymorphism in the MTHFR gene (677C --> T) results in reduced enzymatic activity, and is associated with an increased risk for neural tube defects and cardiovascular disease. The high prevalence of this polymorphism suggests that it may have experienced a selective advantage under environmental pressure, possibly an infectious agent. To test the hypothesis that methylenetetrahydrofolate reductase (MTHFR) genotype influences the outcome of infectious disease, we examined the response of Mthfr-deficient mice against mouse cytomegalovirus (MCMV) infection. Acute MCMV infection of Mthfr(-/-) mice resulted in early control of cytokine secretion, decreased viral titer and preservation of spleen immune cells, in contrast to Mthfr wild-type littermates. The phenotype was abolished in MTHFR transgenic mice carrying an extra copy of the gene. Infection of primary fibroblasts with MCMV showed a decrease in viral replication and in the number of productively infected cells in Mthfr(+/-) fibroblasts compared with wild-type cells. These results indicate that Mthfr deficiency protects against MCMV infection in vivo and in vitro, suggesting that human genetic variants may provide an advantage in the host response against certain pathogens.

  6. [Giant gastric ulcer by cytomegalovirus in infection VIH/SIDA].

    PubMed

    Pérez-Pereyra, Julia; Morales, Domingo; Díaz, Ramiro; Yoza, Max; Frisancho, Oscar

    2008-01-01

    Cytomegalovirus infection is an important cause of morbidity in immunosupressed patients with Human Immunodeficiency Virus (HIV). In this paper we present a 43 years old man with renal failure under hemodialysis, several blood transfusions because of anemia and three months of disease characterized by epigastric pain, specially at nights, ameliorated with antacid drugs. Other symptoms were early satisfy, vomits and weigh loss (18Kg). At clinical exam, the patient was pallid, presented adenopathies at cervical and inguinal regions and had a pain at epigastric region in profound touch palpation. The most important exams were HB: 10mg/dl, CMV: 83.5, leukocytes 7000, lymphocytes: 1715, erythrocyte sedimentation rate 49mm/h, the venon test (-), and Giardia lamblia trophozoites in stools. The studies demonstrated the patient was seropositive for HIV and the tests for IgG CMV and IgG Herpes virus resulted seropositives too. At endoscopy the esophagus mucosa was covered by a white plaque which suggests candida infection. In the stomach, over the body gastric, we found a big and deep ulcerated lesion (45 x 41mm), with defined rims and white fund. Biopsy from the edges of the gastric ulcer had the characteristic CMV intranuclear and intracytoplasmic inclusions; we confirmed the diagnosis by immunohystochemistry. The patient receives ganciclovir an then HAART and is getting well.

  7. Clonotype analysis of cytomegalovirus-specific cytotoxic T lymphocytes.

    PubMed

    Babel, Nina; Brestrich, Gordon; Gondek, Lukasz P; Sattler, Arne; Wlodarski, Marcin W; Poliak, Nina; Bethke, Nicole; Thiel, Andreas; Hammer, Markus H; Reinke, Petra; Maciejewski, Jaroslaw P

    2009-02-01

    Cytotoxic T lymphocytes (CTL) control the replication of human cytomegalovirus (CMV). Previous studies assessed the clonotypic composition of CTL specific for individual immunodominant peptides within a certain HLA context. Such an approach has inherent limitations and may not assess the true clonal CTL response in vivo. Here, the clonotypic composition of CMV-specific CTL was determined in HLA-A2, CMV-seropositive kidney transplant recipients and healthy blood donors after stimulation of peripheral blood mononuclear cells with either a pp65 whole-peptide pool or a single immunodominant peptide. Even after stimulation with the whole peptide pool, CMV-specific CTL remained monoclonal or oligoclonal. Regarding intraindividual variation, the CDR3 motifs of the dominant clones were identical to those observed in CTL generated by the single immunodominant peptide. Sequencing of the CDR3 regions demonstrated significant interindividual variation; however, structural homology was observed for immunodominant clonotypes in three individuals. In conclusion, the highly focused T cell receptor repertoire found after stimulation with either a single immunodominant peptide or a peptide pool demonstrates a pivotal role for immunodominant epitopes in the generation of a clonal repertoire. These results provide new insights into the regulation of CMV clonal dominance and may contribute to the design and monitoring of adoptive immunotherapy.

  8. Viral loads in dual infection with HIV-1 and cytomegalovirus

    PubMed Central

    Boriskin, Y.; Sharland, M.; Dalton, R.; duMont, G.; Booth, J.

    1999-01-01

    OBJECTIVE—A one year study of the relation between cytomegalovirus (CMV) and human immunodeficiency virus (HIV) viral loads in a cohort of children with vertically acquired HIV-1 infection.
DESIGN—Comparative analysis of viral load measurements for CMV and HIV-1 in peripheral blood leucocytes (PBLs) of individual children in relation to age and clinical staging.
METHODS—Nested polymerase chain reaction (PCR) was used to measure HIV-1 proviral DNA and CMV genomic DNA in PBLs of 56children.
RESULTS—The CMV load was highest in 0-2 year old HIV positive children with stage C disease (range, 1-7143 copies/100 ng DNA; median, 125) and was significantly lower in older children. Although higher in young children, HIV-1 viral load did not show the same marked reduction with age that is seen with CMV. Over a one year period, testing of serial samples for both viruses in a subgroup of children revealed a discordant relation between viral loads for CMV and HIV-1.
CONCLUSIONS—CMV viral load falls much faster than HIV viral load in dually infected children. Screening for clinical CMV disease is most likely to be of benefit in children under 2 years of age with stage C disease. In the few children studied, levels of CMV and HIV replication appear to be independent.

 PMID:10325727

  9. Design of cocktail peptide vaccine against Cytomegalovirus infection

    PubMed Central

    Tabaei, Samira; Mashkani, Baratali; Esmaili, Arezoo; Karimi, Reza; Jamehdar, Saeid Amel

    2016-01-01

    Objective(s): Human Cytomegalovirus (HCMV) remains a major morbidity and mortality cause in immuno suppressed patients. Therefore, significant effort has been made towards the development of a vaccine. In this study, the expression of the pp65 and gB fusion peptides and Fc domain of mouse IgG2a as a novel delivery system for selective uptake of antigens by antigen-presenting cells (APCs) in Pichia pastoris yeast system were studied. Materials and Method: In this study, four immune dominant sequences in pp65 protein and 3 immuno dominant sequences in gB protein were selected according to literature review. Peptide linker -GGGGS- was used for construction of fusion peptide. This fusion peptide was cloned in the pPICZαA expression vector and transfected into P. pastoris host cells. Results: Dot blot and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) techniques showed that a high level of pp65-gB-Fc fusion peptide was expressed. Conclusion: This CMV pp65-gB-Fc fusion peptide could be a promising candidate for the development of a novel peptide vaccine. PMID:27279990

  10. Coexisting cytomegalovirus infection in immunocompetent patients with Clostridium difficile colitis.

    PubMed

    Chan, Khee-Siang; Lee, Wen-Ying; Yu, Wen-Liang

    2016-12-01

    Cytomegalovirus (CMV) colitis usually occurs in immunocompromised patients with human immunodeficiency virus infection, organ transplantation, and malignancy receiving chemotherapy or ulcerative colitis receiving immunosuppressive agents. However, CMV colitis is increasingly recognized in immunocompetent hosts. Notably, CMV colitis coexisting with Clostridium difficile infection (CDI) in apparently healthy individuals has been published in recent years, which could result in high morbidity and mortality. CMV colitis is a rare but possible differential diagnosis in immunocompetent patients with abdominal pain, watery, or especially bloody diarrhea, which could be refractory to standard treatment for CDI. As a characteristic of CDI, however, pseudomembranous colitis may be only caused by CMV infection. Real-time CMV-polymerase chain reaction (PCR) for blood and stool samples may be a useful and noninvasive diagnostic strategy to identify CMV infection when treatment of CDI eventually fails to show significant benefits. Quantitative CMV-PCR in mucosal biopsies may increase the diagnostic yield of traditional histopathology. CMV colitis is potentially life-threatening if severe complications occur, such as sepsis secondary to colitis, massive colorectal bleeding, toxic megacolon, and colonic perforation, so that may necessitate pre-emptive antiviral treatment for those who are positive for CMV-PCR in blood and/or stool samples while pending histological diagnosis.

  11. Cytomegalovirus infection enhances the immune response to influenza.

    PubMed

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-04-01

    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species.

  12. Monoclonal Antibodies to Different Components of the Human Cytomegalovirus (HCMV) Pentamer gH/gL/pUL128L and Trimer gH/gL/gO as well as Antibodies Elicited during Primary HCMV Infection Prevent Epithelial Cell Syncytium Formation

    PubMed Central

    Percivalle, Elena; Perez, Laurent; Lanzavecchia, Antonio; Lilleri, Daniele

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) may cause disseminated/end-organ disease in congenitally infected newborns and immunosuppressed transplant recipients. Two glycoprotein complexes, gH/gL/gO and gH/gL/pUL128/pUL130/pUL131 (gH/gL/pUL128L; referred to as the pentamer), are required for HCMV entry into fibroblasts and endothelial/epithelial cells, respectively, in the presence of the viral fusion protein gB. In addition, gH/gL/gO was recently reported to also be required for infection of endothelial/epithelial cells. Virus entry into human fibroblasts involves fusion of the virus envelope with the plasma membrane, whereas entry into endothelial/epithelial cells involves macropinocytosis or endocytosis and low-pH-dependent fusion with endosomes. A large set of neutralizing monoclonal antibodies (MAbs), directed to gH, gB, and multiple components of the pentamer, was developed. In addition, novel anti-gO human monoclonal antibodies were recently isolated. It is known that epithelial cell infection with a wild HCMV strain at a high multiplicity of infection produces a large number of syncytia. Incubation of heavily HCMV VR1814-infected ARPE-19 epithelial cells with neutralizing MAbs to one, two, or three components of the pUL128L portion of the pentamer blocked syncytium formation at an antibody concentration of 10 μg/ml, whereas only a partial inhibitory effect was displayed for MAbs to gO, gH, or gB at the same concentration. A blocking effect was also exhibited by convalescent-phase sera from primary HCMV infections. These findings indicate that the pentamer is required for syncytium formation in epithelial cells. IMPORTANCE Human cytomegalovirus (HCMV) mostly infects epithelial and endothelial cells in vivo. Recently, the pentamer protein complex (gH/gL/pUL128L) was identified as being required for infection of these cells, in association with the other protein complex, gH/gL/gO. In primary infections, HCMV migrates to endothelial cells and then to leukocytes

  13. Cytomegalovirus enterocolitis in a patient with diffuse large B-cell lymphoma after chemotherapy with rituximab.

    PubMed

    Seewoodhary, Jason

    2006-12-07

    Rituximab has been associated with the development of cytomegalovirus enterocolitis in immunosuppressed patients. A 51-year-old patient with diffuse large B-cell lymphoma who received a conditioning chemotherapy regimen (RCVP and RICE) consisting of rituximab before bone marrow transplantation went on to develop cytomegalovirus enterocolitis. This supports evidence from previously described cases that rituximab may be associated with cytomegalovirus enterocolitis.

  14. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.

    PubMed

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-03-01

    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation.

  15. Specific remodeling of splenic architecture by cytomegalovirus.

    PubMed

    Benedict, Chris A; De Trez, Carl; Schneider, Kirsten; Ha, Sukwon; Patterson, Ginelle; Ware, Carl F

    2006-03-01

    Efficient immune defenses are facilitated by the organized microarchitecture of lymphoid organs, and this organization is regulated by the compartmentalized expression of lymphoid tissue chemokines. Mouse cytomegalovirus (MCMV) infection induces significant remodeling of splenic microarchitecture, including loss of marginal zone macrophage populations and dissolution of T and B cell compartmentalization. MCMV preferentially infected the splenic stroma, targeting endothelial cells (EC) as revealed using MCMV-expressing green fluorescent protein. MCMV infection caused a specific, but transient transcriptional suppression of secondary lymphoid chemokine (CCL21). The loss of CCL21 was associated with the failure of T lymphocytes to locate within the T cell zone, although trafficking to the spleen was unaltered. Expression of CCL21 in lymphotoxin (LT)-alpha-deficient mice is dramatically reduced, however MCMV infection further reduced CCL21 levels, suggesting that viral modulation of CCL21 was independent of LTalpha signaling. Activation of LTbeta-receptor signaling with an agonistic antibody partially restored CCL21 mRNA expression and redirected transferred T cells to the splenic T cell zone in MCMV-infected mice. These results indicate that virus-induced alterations in lymphoid tissues can occur through an LT-independent modulation of chemokine transcription, and targeting of the LT cytokine system can counteract lymphoid tissue remodeling by MCMV.

  16. Cytomegalovirus Infection After Intestinal Transplantation in Children

    PubMed Central

    Bueno, Javier; Green, Michael; Kocoshis, Samuel; Furukawa, Hiroyuki; Ahu-Elmagd, Kareem; Yunis, Eduardo; Irish, William; Todo, Satoru; Reyes, Jorge; Starzl, Thomas E.

    2010-01-01

    Sixteen episodes of cytomegalovirus (CMV) disease occurred in 10 of 41 children undergoing intestinal transplantation from 1990 to 1995. Stratification of CMV disease by donor (D)/recipient (R) serological status was as follows: 3 of 8, D+/R−; 3 of 9, D+/R+; 4 of 9, D−/R+; and 0 of 15, D−/R−. Treatment resulted in resolution of CMV disease in 93.3% of episodes. No deaths attributable to CMV disease occurred in this series. CMV in D+/R− children resulted in more extensive and persistent disease. However, patient and graft survival rates were similar in the different D/R subgroups and between children with and without CMV disease. Cumulative dose of steroid boluses (relative risk [RR]. 1.59; 95% confidence interval [CI]. 1.14–2.21) and history of steroid recycles (RR, 2.72; 95% CI, 1.21–6.13) were associated with CMV disease. These results suggest that although CMV-associated morbidity in pediatric intestinal transplant recipients was substantial, it was not associated with an increased rate of mortality or graft loss, even among high-risk D+/R− patients. PMID:9402361

  17. Cytomegalovirus infection improves immune responses to influenza

    PubMed Central

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai; Angel, Cesar J Lopez; Onengut-Gumuscu, Suna; Kidd, Brian; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-01-01

    Cytomegalovirus (CMV) is a beta-herpes virus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV serostatus. In contrast, CMV-infected young adults exhibited an overall up-regulation of immune components including enhanced antibody responses to influenza vaccination, increased CD8+ T cell sensitivity, and elevated levels of circulating IFN-γ compared to uninfected individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the continued coexistence of CMV and mammals throughout their evolution. PMID:25834109

  18. Cytomegalovirus pneumonia in transplant patients: CT findings

    SciTech Connect

    Eun-Young Kang; Patz, E.F. Jr.; Mueller, N.L.

    1996-03-01

    Our goal was to assess the CT findings of cytomegalovirus (CMV) pneumonia in transplant patients. The study included 10 transplant patients who had chest CT scan and pathologically proven isolated pulmonary CMV infection. Five patients had bone marrow transplant and five had solid organ transplant. The CT scans were retrospectively reviewed for pattern and distribution of disease and the CT findings compared with the findings on open lung biopsy (n = 9) and autopsy (n = 1). Nine of 10 patients had parenchymal abnormalities apparent at CT and I had normal CT scans. The findings in the nine patients included small nodules (n = 6), consolidation (n = 4), ground-glass attenuation (n = 4), and irregular lines (n = 1). The nodules had a bilateral and symmetric distribution and involved all lung zones. The consolidation was most marked in the lower lung zones. The CT findings of CMV pneumonia in transplant patients are heterogeneous. The most common patterns include small nodules and areas of consolidation. 13 refs., 4 figs., 1 tab.

  19. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus

    PubMed Central

    Sturgill, Elizabeth R.; Malouli, Daniel; Hansen, Scott G.; Burwitz, Benjamin J.; Schneider, Christine L.; Womack, Jennie L.; Verweij, Marieke C.; Ventura, Abigail B.; Bhusari, Amruta; Jeffries, Krystal M.; Legasse, Alfred W.; Axthelm, Michael K.; Hudson, Amy W.; Sacha, Jonah B.; Picker, Louis J.; Früh, Klaus

    2016-01-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  20. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4⁺ and CD8⁺ T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.

    PubMed

    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele

    2016-07-01

    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+)) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy.

  1. Human Cytomegalovirus MicroRNAs miR-US5-1 and miR-UL112-3p Block Proinflammatory Cytokine Production in Response to NF-κB-Activating Factors through Direct Downregulation of IKKα and IKKβ

    PubMed Central

    Hancock, Meaghan H.; Hook, Lauren M.; Mitchell, Jennifer

    2017-01-01

    ABSTRACT Emerging evidence indicates that human cytomegalovirus (HCMV) manipulates host cell signaling pathways using both proteins and noncoding RNAs. Several studies have shown that HCMV induces NF-κB signaling early in infection, resulting in the induction of antiviral proinflammatory cytokines with a subsequent reduction of these cytokines late in infection. The mechanism for late cytokine reduction is unknown. In this study, we show that HCMV microRNAs (miRNAs) miR-US5-1 and miR-UL112-3p target the IκB kinase (IKK) complex components IKKα and IKKβ to limit production of proinflammatory cytokines in response to interleukin 1β (IL-1β) and tumor necrosis factor alpha (TNF-α). Transfection of miR-UL112-3p and miR-US5-1 mimics reduced endogenous IKKα and IKKβ protein levels, and site-directed mutagenesis of the 3′ untranslated regions (UTRs) identified the binding sites for each miRNA. Infection with mutant viruses lacking these miRNAs resulted in increased levels of IKKα and IKKβ proteins, an impaired ability to control NF-κB signaling at late times of lytic infection, and increased production of proinflammatory cytokines compared to wild-type virus in cell types relevant to HCMV infection in vivo. These phenotypes were rescued by preexpression of miR-US5-1 and miR-UL112-3p in infected cells or by a miR-US5-1/miR-UL112-3p double mutant virus that expresses short hairpin RNAs (shRNAs) targeting IKKα and IKKβ, demonstrating the gene specificity of the miRNAs. These observations describe a mechanism through which HCMV miRNAs expressed late in the infectious cycle downregulate proinflammatory cytokine production to create a cellular proviral environment. PMID:28270578

  2. Prognostic markers of symptomatic congenital cytomegalovirus infection.

    PubMed

    Romanelli, Roberta Maia de Castro; Magny, Jean François; Jacquemard, François

    2008-02-01

    The objective of this research was to identify maternal and fetal characteristics as prognostic markers of congenital cytomegalovirus (CMV) infection. This is a descriptive study of 13 cases of congenital CMV infection referred to Institute de Puericulture et Perinatologie de Paris (IPP) from January 2005 to October 2006. Amniotic fluid puncture was performed to research CMV polimerase chain reaction (PCR). Cordocentesis and cord blood samples at delivery were also analyzed to determinate fetal platelets count, GGT, ASAT, ALAT, CMV-DNA and IgM antibody. Variables of symptomatic and asymptomatic infants were then compared. Data were analyzed by SPSS--15.0. Mean gestational age of amniocentesis was 24.6 weeks and there was no difference of mean viral load in amniotic fluid considering infant features. Mean gestational age of cordocentesis was 26.1 weeks. There were no statistical differences of fetal viral load, IgM, platelets, GGT, ASAT and ALAT analyzed at cordocentesis samples, but at delivery, mean values of IgM and ASAT of fetal blood were increased in symptomatic ones (p= 0.03 for both parameters). When considering groups with normal and abnormal parameters, ASAT of cordon samples was also increased in symptomatic infants (p= 0.02). Sensibility, specificity, positive and negative predictive value of fetal ultrasound anomalies to detect symptomatic infants were, respectively, 80%, 62.5%, 57.1% and 83.3%. Thus, identification of markers of CMV symptomatic infants should be aimed. Prenatal diagnosis, identification and follow up of congenital CMV infected infants are important to consider treatment for symptomatic infants, trying to avoid or reducing some possible sequels.

  3. Quantitation of Cytomegalovirus: Methodologic Aspects and Clinical Applications

    PubMed Central

    Boeckh, Michael; Boivin, Guy

    1998-01-01

    Cytomegalovirus (CMV) is an important pathogen in transplant recipients and human immunodeficiency virus (HIV)-infected individuals. Major progress has been made in developing quantitative detection methods for CMV in recent years. Due to their high sensitivity, these assays can detect CMV early, and quantitation may be useful in predicting the patient’s risk for disease and in monitoring the effect of antiviral therapy. This review discusses methodological aspects of currently used quantitative assays for CMV (i.e., viral culture techniques, antigen detection assays, DNA detection assays including PCR, branched-DNA assay, and the DNA hybrid capture assay) and addresses the correlation of systemic and site-specific CMV load and CMV disease in different populations of immunosuppressed patients as well as the response to antiviral treatment. To date, direct antigen detection and molecular techniques have largely replaced traditional culture-based techniques for CMV quantitation. In general, a high systemic CMV load is correlated with CMV disease. This correlation is strong in the HIV-infected population and in solid-organ transplant recipients but less clear in allogeneic marrow transplant recipients. Measuring the viral load at specific anatomic sites may be an alternative way to assess disease activity in situations where the systemic viral load correlates poorly with disease activity. A reduction of the systemic CMV load also correlates with a response to antiviral treatment, but more research is needed to evaluate the role of viral load as a surrogate marker for drug resistance. Due to the widespread use of quantitative CMV detection techniques to direct and monitor antiviral treatment, there is a great need for an assessment of the reproducibility of test results and better standardization of the assays. PMID:9665982

  4. Rapid detection and quantitation of ganciclovir resistance in cytomegalovirus quasispecies.

    PubMed

    Ruiz-Carrascoso, Guillermo; Romero-Gómez, María Pilar; Plaza, Diego; Mingorance, Jesús

    2013-07-01

    Human cytomegalovirus (HCMV) may cause severe or fatal disease among immunocompromised patients. The first line prophylaxis and systemic HCMV disease therapy is ganciclovir (GCV). The presence of GCV-resistant virus has been linked to fatal HCMV disease. The implementation of rapid and sensitive techniques for the early detection and monitoring of GCV-resistance may be helpful to support antiviral therapy management. A pyrosequencing assay for the detection and quantitation of the most frequent mutations conferring moderate- and high-grade GCV resistance was implemented. The pyrosequencing achieved an analytical sensitivity for adequate interpretation of ≥10(3)  copies/ml. The assay was validated with 18 whole blood samples taken over a 6-month period from an umbilical cord blood recipient infected persistently with HCMV and allowed the detection and monitoring of the M460I and A594V GCV-resistant mutations. The percentage of resistant quasispecies ranged from 7.9% to 55.2% for the M460I mutation and from 19.8% to 43% for the A594V mutation. Clearance of the M460I mutation occurred in parallel with a decrease in the HCMV viremia, while the A594V mutation persisted. The pyrosequencing method for detection of GCV is sensitive enough to be used directly on clinical samples for the early identification of resistance mutations and allows the quantitation of resistant and wild type virus quasispecies within hours. The quantitation of minor resistant variants is an important issue to understand their relationship with viral load modification, and potentially anticipate treatment adjustment.

  5. Cross-Species Rhesus Cytomegalovirus Infection of Cynomolgus Macaques

    PubMed Central

    Bimber, Benjamin N.; Reed, Jason S.; Uebelhoer, Luke S.; Bhusari, Amruta; Hammond, Katherine B.; Klug, Alex; Legasse, Alfred W.; Axthelm, Michael K.; Nelson, Jay A.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus; Sacha, Jonah B.

    2016-01-01

    Cytomegaloviruses (CMV) are highly species-specific due to millennia of co-evolution and adaptation to their host, with no successful experimental cross-species infection in primates reported to date. Accordingly, full genome phylogenetic analysis of multiple new CMV field isolates derived from two closely related nonhuman primate species, Indian-origin rhesus macaques (RM) and Mauritian-origin cynomolgus macaques (MCM), revealed distinct and tight lineage clustering according to the species of origin, with MCM CMV isolates mirroring the limited genetic diversity of their primate host that underwent a population bottleneck 400 years ago. Despite the ability of Rhesus CMV (RhCMV) laboratory strain 68–1 to replicate efficiently in MCM fibroblasts and potently inhibit antigen presentation to MCM T cells in vitro, RhCMV 68–1 failed to productively infect MCM in vivo, even in the absence of host CD8+ T and NK cells. In contrast, RhCMV clone 68–1.2, genetically repaired to express the homologues of the HCMV anti-apoptosis gene UL36 and epithelial cell tropism genes UL128 and UL130 absent in 68–1, efficiently infected MCM as evidenced by the induction of transgene-specific T cells and virus shedding. Recombinant variants of RhCMV 68–1 and 68–1.2 revealed that expression of either UL36 or UL128 together with UL130 enabled productive MCM infection, indicating that multiple layers of cross-species restriction operate even between closely related hosts. Cumulatively, these results implicate cell tropism and evasion of apoptosis as critical determinants of CMV transmission across primate species barriers, and extend the macaque model of human CMV infection and immunology to MCM, a nonhuman primate species with uniquely simplified host immunogenetics. PMID:27829026

  6. Seropositivity of cytomegalovirus in patients with recurrent pregnancy loss

    PubMed Central

    Sherkat, Roya; Meidani, Mohsen; Zarabian, Hossein; Rezaei, Abbas; Gholamrezaei, Ali

    2014-01-01

    Background: Some evidence has shown a relationship between human cytomegalovirus (CMV) infection and pregnancy loss. However, whether recurrent or latent CMV infection or altered immune response to CMV is related to recurrent pregnancy loss (RPL) is unclear. We evaluated CMV infection and avidity of antibodies to CMV in women with RPL. Materials and Methods: This case-control study was conducted on 43 women with RPL referred to a clinical immunology out-patient clinic in Isfahan (Iran), and 43 age-matched multiparous women without history of abortion as control subjects. Patients and controls were evaluated for anti-CMV IgG and IgM antibodies and IgG avidity index (AI) using the enzyme linked immunosorbent assay method. Student's t-test and Chi-square test were used to analyze the data. Results: One case (2.3%) of positive anti-CMV IgM was detected in each group. Anti-CMV IgG positivity was more frequent in patients than in controls (90.6% vs. 69.8%, P = 0.014), but there was no difference between the two groups in anti-CMV IgG AI (79.4 ± 11.4 vs. 80.1 ± 10.2, P = 0.781). IgG titer was significantly higher in seropositive cases with RPL than seropositive controls (5.18 ± 1.99 vs. 2.00 ± 0.81, P < 0.001). Conclusion: We found that previous exposure to CMV was significantly higher in patients with RPL than the control group. However, no association was found between IgG AI and RPL. Further investigations are needed to find whether latent CMV infection starts an indirect process of autoimmune etiology in RPL or women with RPL have recurrent or reactivation of CMV infection. PMID:25002889

  7. Anti-cytomegalovirus activity of the anthraquinone atanyl blue PRL.

    PubMed

    Alam, Zohaib; Al-Mahdi, Zainab; Zhu, Yali; McKee, Zachary; Parris, Deborah S; Parikh, Hardik I; Kellogg, Glen E; Kuchta, Alison; McVoy, Michael A

    2015-02-01

    Human cytomegalovirus (CMV) causes significant disease in immunocompromised patients and serious birth defects if acquired in utero. Available CMV antivirals target the viral DNA polymerase, have significant toxicities, and suffer from resistance. New drugs targeting different pathways would be beneficial. The anthraquinone emodin is proposed to inhibit herpes simplex virus by blocking the viral nuclease. Emodin and related anthraquinones are also reported to inhibit CMV. In the present study, emodin reduced CMV infectious yield with an EC50 of 4.9μM but was cytotoxic at concentrations only twofold higher. Related anthraquinones acid blue 40 and alizarin violet R inhibited CMV at only high concentrations (238-265μM) that were also cytotoxic. However, atanyl blue PRL inhibited infectious yield of CMV with an EC50 of 6.3μM, significantly below its 50% cytotoxic concentration of 216μM. Atanyl blue PRL reduced CMV infectivity and inhibited spread. When added up to 1h after infection, it dramatically reduced CMV immediate early protein expression and blocked viral DNA synthesis. However, it had no antiviral activity when added 24h after infection. Interestingly, atanyl blue PRL inhibited nuclease activities of purified CMV UL98 protein with IC50 of 4.5 and 9.3μM. These results indicate that atanyl blue PRL targets very early post-entry events in CMV replication and suggest it may act through inhibition of UL98, making it a novel CMV inhibitor. This compound may provide valuable insights into molecular events that occur at the earliest times post-infection and serve as a lead structure for antiviral development.

  8. Development of subunit preparations of cytomegalovirus antigen by aqueous extraction for immunization against cytomegalovirus infection.

    PubMed

    Billstrom, M A; Davies, J A; Buchan, A; Skinner, G R

    1993-01-01

    This study has examined different methods of preparation of a subunit vaccine from cytomegalovirus (CMV)-infected MRC cells in terms of protein and DNA content, antigenicity and immunogenicity. Two preparations have been developed where CMV proteins were obtained by extraction of infected cells with water. Virus particles were removed from the preparations by ultracentrifugation and residual virus was inactivated by formaldehyde in the WUF preparations or by chloroform in the WUCh preparations. The preparations contained CMV proteins which may play a role in protective immune responses, and the preparations were antigenic as determined by immunodiffusion, ELISA and immunoblotting. Immunogenicity as evaluated in rabbits indicated that the preparations stimulated neutralizing and immunoprecipitating antibody. These results suggest that the gentle method of water extraction of viral antigens may be a useful protocol for vaccine preparation.

  9. Polymorphisms and features of cytomegalovirus UL144 and UL146 in congenitally infected neonates with hepatic involvement.

    PubMed

    Guo, Gangqiang; Zhang, Liang; Ye, Sisi; Hu, Yingying; Li, Baoqing; Sun, Xiangwei; Mao, Chenchen; Xu, Jianfeng; Chen, Yiping; Zhang, Lifang; Xue, Xiangyang

    2017-01-01

    Human cytomegalovirus is a significant agent of hepatic involvement in neonates. In this study, we investigated the polymorphisms and features of the viral genes UL144 and UL146 as well as their significance to congenital hepatic involvement. In 79 neonates with congenital cytomegalovirus infection and hepatic involvement, full length UL144 and UL146 were successfully amplified in 73.42% and 60.76% of cases, respectively. Sequencing indicated that both genes were hypervariable. Notably, UL144 genotype B was highly associated with aspartate aminotransferase (P = 0.028) and lactate dehydrogenase (P = 0.046). Similarly, UL146 genotype G1 and G13 were significantly associated with CMV IgM (P = 0.026), CMV IgG (P = 0.034), alanine aminotransferase (P = 0.019), and aspartate aminotransferase (P = 0.032). In conclusion, dominant UL144 (genotype B) and UL146 (genotype G1 and G13) genotypes are associated with elevated levels of enzymes and CMV IgM and IgG of cytomegalovirus infection.

  10. Polymorphisms and features of cytomegalovirus UL144 and UL146 in congenitally infected neonates with hepatic involvement

    PubMed Central

    Ye, Sisi; Hu, Yingying; Li, Baoqing; Sun, Xiangwei; Mao, Chenchen; Xu, Jianfeng; Chen, Yiping; Zhang, Lifang; Xue, Xiangyang

    2017-01-01

    Human cytomegalovirus is a significant agent of hepatic involvement in neonates. In this study, we investigated the polymorphisms and features of the viral genes UL144 and UL146 as well as their significance to congenital hepatic involvement. In 79 neonates with congenital cytomegalovirus infection and hepatic involvement, full length UL144 and UL146 were successfully amplified in 73.42% and 60.76% of cases, respectively. Sequencing indicated that both genes were hypervariable. Notably, UL144 genotype B was highly associated with aspartate aminotransferase (P = 0.028) and lactate dehydrogenase (P = 0.046). Similarly, UL146 genotype G1 and G13 were significantly associated with CMV IgM (P = 0.026), CMV IgG (P = 0.034), alanine aminotransferase (P = 0.019), and aspartate aminotransferase (P = 0.032). In conclusion, dominant UL144 (genotype B) and UL146 (genotype G1 and G13) genotypes are associated with elevated levels of enzymes and CMV IgM and IgG of cytomegalovirus infection. PMID:28222150

  11. Infantile Spasms and Cytomegalovirus Infection: Antiviral and Antiepileptic Treatment

    ERIC Educational Resources Information Center

    Dunin-Wasowicz, Dorota; Kasprzyk-Obara, Jolanta; Jurkiewicz, Elzbieta; Kapusta, Monika; Milewska-Bobula, Bogumila

    2007-01-01

    From 1 January 1995 to 31 December 2004, 22 patients (13 males, nine females; age range 2-12mo) with infantile spasms and cytomegalovirus (CMV) infection were treated with intravenous ganciclovir (GCV) and antiepileptic drugs. GCV was given for 3 to 12 weeks with a 1-month interval (one, two, or three courses). Epileptic spasms occurred before…

  12. Brief Report: Autistic Disorder in Three Children with Cytomegalovirus Infection

    ERIC Educational Resources Information Center

    Sweeten, Thayne L.; Posey, David J.; McDougle, Christopher J.

    2004-01-01

    Previous research has identified a relationship between autistic disorder (autism) and specific congenital infections. Three cases of congenital or perinatal cytomegalovirus (CMV) infection occurring in association with autism are described. Hypothetical mechanisms relating congenital infection, such as CMV, to the development of autism are…

  13. Autism in a Child with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Markowitz, Phillip I.

    1983-01-01

    A case study is described in which early infantile autism was diagnosed in a child with congenital cytomegalovirus (CMU) infection. It is suggested that congenital infection should be considered as an etiological agent in autism. The case's synergistic effect of CMU-induced brain damage, deafness, and maternal deprivation in noted. (CL)

  14. The latent cytomegalovirus decreases telomere length by microcompetition

    PubMed Central

    Javaherian, Adrian

    2015-01-01

    Reduced telomere length has been associated with aging and age-related diseases. Latent infection with the Cytomegalovirus (CMV) induces telomere shortening in the infected cells. Latent CMV infection may cause reduced telomere length via GABP transcription factor deficiency, according to the Microcompetition Theory. Microcompetition and viral-induced transcription factor deficiency is important since most people harbor a latent viral infection.

  15. Effective Detection of Porcine Cytomegalovirus Using Non-Invasively Taken Samples from Piglets.

    PubMed

    Morozov, Vladimir A; Heinrichs, Gerd; Denner, Joachim

    2017-01-12

    Shortage of human organs forced the development of xenotransplantation using cells, tissues, and organs from pigs. Xenotransplantation may be associated with the transmission of porcine zoonotic microorganisms, among them the porcine cytomegalovirus (PCMV). To prevent virus transmission, pigs have to be screened using sensitive methods. In order to perform regular follow-ups and further breeding of the animals, samples for testing should be collected by low-invasive or non-invasive methods. Sera, ear biopsies, as well as oral and anal swabs were collected from ten 10-day-old Aachen minipigs (AaMP) and tested for PCMV using sensitive nested polymerase chain reaction (PCR) as well as uniplex and duplex real-time PCR. Porcine cytomegalovirus DNA was detected most frequently in oral and anal swabs. Comparison of duplex and uniplex real-time PCR systems for PCMV detection demonstrated a lower sensitivity of duplex real-time PCR when the copy numbers of the target genes were low (less 200). Therefore, to increase the efficacy of PCMV detection in piglets, early testing of oral and anal swabs by uniplex real-time PCR is recommended.

  16. Effective Detection of Porcine Cytomegalovirus Using Non-Invasively Taken Samples from Piglets

    PubMed Central

    Morozov, Vladimir A.; Heinrichs, Gerd; Denner, Joachim

    2017-01-01

    Shortage of human organs forced the development of xenotransplantation using cells, tissues, and organs from pigs. Xenotransplantation may be associated with the transmission of porcine zoonotic microorganisms, among them the porcine cytomegalovirus (PCMV). To prevent virus transmission, pigs have to be screened using sensitive methods. In order to perform regular follow-ups and further breeding of the animals, samples for testing should be collected by low-invasive or non-invasive methods. Sera, ear biopsies, as well as oral and anal swabs were collected from ten 10-day-old Aachen minipigs (AaMP) and tested for PCMV using sensitive nested polymerase chain reaction (PCR) as well as uniplex and duplex real-time PCR. Porcine cytomegalovirus DNA was detected most frequently in oral and anal swabs. Comparison of duplex and uniplex real-time PCR systems for PCMV detection demonstrated a lower sensitivity of duplex real-time PCR when the copy numbers of the target genes were low (less 200). Therefore, to increase the efficacy of PCMV detection in piglets, early testing of oral and anal swabs by uniplex real-time PCR is recommended. PMID:28085106

  17. Detection of a Gene Cluster That Is Dispensable for Human Herpesvirus 6 Replication and Latency

    PubMed Central

    Kondo, Kazuhiro; Nozaki, Hideo; Shimada, Kazuya; Yamanishi, Koichi

    2003-01-01

    The U3-U7 gene cluster of human herpesvirus 6 (HHV-6) was replaced with an enhanced green fluorescent protein-puromycin gene cassette containing the cytomegalovirus major immediate-early promoter. Neither viral replication in T cells nor latency and reactivation in macrophages was impaired. During HHV-6 latency, the cytomegalovirus promoter used the transcription start sites employed in cytomegalovirus latency. PMID:12970461

  18. Prevention of Primary Cytomegalovirus Infection in Pregnancy☆

    PubMed Central

    Revello, Maria Grazia; Tibaldi, Cecilia; Masuelli, Giulia; Frisina, Valentina; Sacchi, Alessandra; Furione, Milena; Arossa, Alessia; Spinillo, Arsenio; Klersy, Catherine; Ceccarelli, Manuela; Gerna, Giuseppe; Todros, Tullia

    2015-01-01

    Background Cytomegalovirus (CMV) is the leading infectious agent causing congenital sensorineural hearing loss and psychomotor retardation. CMV vaccine is currently unavailable and treatment options in pregnancy are limited. Susceptible pregnant women caring for children are at high risk for primary infection. CMV educational and hygienic measures have the potential to prevent primary maternal infection. Methods A mixed interventional and observational controlled study was conducted to investigate the effectiveness of hygiene information among pregnant women at risk for primary CMV infection for personal/occupational reasons. In the intervention arm, CMV-seronegative women, identified at the time of maternal serum screening for fetal aneuploidy at 11–12 weeks of gestation, were given hygiene information and prospectively tested for CMV until delivery. The comparison arm consisted of women enrolled at delivery who were neither tested for nor informed about CMV during pregnancy, and who had a serum sample stored at the screening for fetal aneuploidy. By design, groups were homogeneous for age, parity, education, and exposure to at least one risk factor. The primary outcome was CMV seroconversion. Acceptance of hygiene recommendations was a secondary objective and was measured by a self-report. Findings Four out of 331 (1.2%) women seroconverted in the intervention group compared to 24/315 (7.6%) in the comparison group (delta = 6.4%; 95% CI 3.2–9.6; P < 0.001). There were 3 newborns with congenital infection in the intervention group and 8 in the comparison group (1 with cerebral ultrasound abnormalities at birth). Ninety-three percent of women felt hygiene recommendations were worth suggesting to all pregnant women at risk for infection. Interpretation This controlled study provides evidence that an intervention based on the identification and hygiene counseling of CMV-seronegative pregnant women significantly prevents maternal infection. While waiting for

  19. Valganciclovir for Symptomatic Congenital Cytomegalovirus Disease

    PubMed Central

    Kimberlin, D.W.; Jester, P.M.; Sánchez, P.J.; Ahmed, A.; Arav-Boger, R.; Michaels, M.G.; Ashouri, N.; Englund, J.A.; Estrada, B.; Jacobs, R.F.; Romero, J.R.; Sood, S.K.; Whitworth, M.S.; Abzug, M.J.; Caserta, M.T.; Fowler, S.; Lujan-Zilbermann, J.; Storch, G.A.; DeBiasi, R.L.; Han, J.-Y.; Palmer, A.; Weiner, L.B.; Bocchini, J.A.; Dennehy, P.H.; Finn, A.; Griffiths, P.D.; Luck, S.; Gutierrez, K.; Halasa, N.; Homans, J.; Shane, A.L.; Sharland, M.; Simonsen, K.; Vanchiere, J.A.; Woods, C.R.; Sabo, D.L.; Aban, I.; Kuo, H.; James, S.H.; Prichard, M.N.; Griffin, J.; Giles, D.; Acosta, E.P.; Whitley, R.J.

    2015-01-01

    BACKGROUND The treatment of symptomatic congenital cytomegalovirus (CMV) disease with intravenous ganciclovir for 6 weeks has been shown to improve audiologic outcomes at 6 months, but the benefits wane over time. METHODS We conducted a randomized, placebo-controlled trial of valganciclovir therapy in neonates with symptomatic congenital CMV disease, comparing 6 months of therapy with 6 weeks of therapy. The primary end point was the change in hearing in the better ear (“best-ear” hearing) from baseline to 6 months. Secondary end points included the change in hearing from baseline to follow-up at 12 and 24 months and neurodevelopmental outcomes, with each end point adjusted for central nervous system involvement at baseline. RESULTS A total of 96 neonates underwent randomization, of whom 86 had follow-up data at 6 months that could be evaluated. Best-ear hearing at 6 months was similar in the 6-month group and the 6-week group (2 and 3 participants, respectively, had improvement; 36 and 37 had no change; and 5 and 3 had worsening; P = 0.41). Total-ear hearing (hearing in one or both ears that could be evaluated) was more likely to be improved or to remain normal at 12 months in the 6-month group than in the 6-week group (73% vs. 57%, P = 0.01). The benefit in total-ear hearing was maintained at 24 months (77% vs. 64%, P = 0.04). At 24 months, the 6-month group, as compared with the 6-week group, had better neurodevelopmental scores on the Bayley Scales of Infant and Toddler Development, third edition, on the language-composite component (P = 0.004) and on the receptive-communication scale (P = 0.003). Grade 3 or 4 neutropenia occurred in 19% of the participants during the first 6 weeks. During the next 4.5 months of the study, grade 3 or 4 neutropenia occurred in 21% of the participants in the 6-month group and in 27% of those in the 6-week group (P = 0.64). CONCLUSIONS Treating symptomatic congenital CMV disease with valganciclovir for 6 months, as compared

  20. In Vitro Anti-Cytomegalovirus Activity of Kampo (Japanese Herbal) Medicine

    PubMed Central

    2004-01-01

    We examined the effect of three types of Kampo medicines on human cytomegalovirus (CMV) replication in the human embryonic fibroblast cell line, MRC-5. Treatment of cells with at least 0.01 μg/ml of Kampo medicines inhibited the cytopathic effects of CMV-infected MRC-5 cells. Moreover, Kampo medicine decreased the replication of CMV without affecting the inhibition of host cells, with a concomitant decrease in CMV DNA levels. However, Kampo medicine demonstrated no virocidal effect on cell-free CMV. Furthermore, western blotting analysis demonstrated that the Kampo medicine decreased the amount of 65 kDa late antigen expression in the infected cells. These results suggest that Kampo medicine may be sufficient to inhibit viral DNA replication and late protein synthesis, resulting in anti-CMV effects. Therefore, these three Kampo medicines have the potential of being a source of new powerful anti-CMV compounds. PMID:15841262

  1. Cutaneous involvement by cytomegalovirus in a renal transplant recipient as an indicator of severe systemic infection*

    PubMed Central

    Neumann, Antonielle Borges Faria; Daxbacher, Egon Luiz Rodrigues; Chiaratti, Francielle Chiavelli; Jeunon, Thiago

    2016-01-01

    Cytomegalovirus is an opportunistic virus that commonly affects immunosuppressed patients. Cutaneous involvement by this virus is rare and occurs in significantly immunocompromised hosts, with a poor prognosis. Skin ulcers may represent the first sign of systemic infection by cytomegalovirus in these patients. Herein, a case of a systemic infection by Cytomegalovirus presenting as genital and oral ulcers in a kidney-transplant recipient is reported. PMID:26982783

  2. [Cytomegalovirus in ulcerative colitis in "Hospital Nacional 2 de Mayo"].

    PubMed

    Arévalo Suarez, F; Cerrillo Sánchez, G; Sandoval Campos, J

    2007-01-01

    The association between cytomegalovirus and ulcerative colitis has been reported by many authors, but the exact pathogenesis of this relationship remains unclear. We reviewed all ulcerative colitis cases whose diagnosis were made in Hospital dos de Mayo, during period 2000-2005, these cases were evaluated for Cytomegalovirus using inmunohistochemistry, also we described histological features of our cases. CMV was identified in 22.2% of all cases, none of them had been treated with inmunosuppressants previously, histological activity was reported in all positive cases and 42.8% negative cases for CMV; Crypt architectural abnormality was the most often histological finding, and the frequency of ulcerative colitis was 1.5 per year. Our findings are similar to those reported by foreign authors and is consistent with theory which maintains inflammatory changes of UC would help CMV's activation without using inmunosuppressants.

  3. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    SciTech Connect

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  4. Esophageal ulcer caused by cytomegalovirus: resolution during combination antiretroviral therapy for acquired immunodeficiency syndrome.

    PubMed

    Mönkemüller, K E; Wilcox, C M

    2000-08-01

    A 36-year-old man with a 5-year history of untreated human immunodeficiency virus (HIV) infection had odynophagia for 14 days. Fifteen days earlier, he had begun taking trimethoprim-sulphamethoxazole and combination antiretroviral therapy that included lamivudine, zidovudine, and nelfinavir. He had no history of opportunistic infection. The CD4 lymphocyte count was 67/microL and HIV-RNA level was 359,396 copies/mL. Esophagogastroduodenoscopy revealed a large, well-circumscribed esophageal ulceration 31 cm from the incisors. Histopathologic examination of esophageal biopsy specimens showed cytopathic changes diagnostic of cytomegalovirus (CMV). In situ DNA hybridization was positive for CMV. While combination antiretroviral therapy was continued, the esophageal symptoms resolved within 4 days of endoscopy without specific therapy for CMV. Follow-up endoscopy 4 weeks later revealed a normal-appearing esophagus, and the patient has remained symptom-free for 10 months.

  5. Mother-to-Child Transmission of Cytomegalovirus and Prevention of Congenital Infection.

    PubMed

    Pass, Robert F; Anderson, Brenna

    2014-09-01

    Mother-to-child transmission (MTCT) of cytomegalovirus (CMV) occurs transplacentally (congenital infection), during birth and through breast milk, although the latter 2 modes of transmission are not associated with the central nervous system sequelae that occur with congenital infection. CMV persists indefinitely in its human host, and MTCT can occur if the mother was infected in the past or during the current pregnancy. The goal of efforts to prevent MTCT of CMV is to prevent congenital infection, an important cause of disability due to hearing loss, impaired vision, cognitive impairment, and neuromotor deficits. Vaccines for prevention of maternal and congenital CMV infection are being developed but will not likely be available for at least a decade. Rather than waiting for an effective vaccine to solve the problem, more effort must be devoted to defining the potential for public health measures to prevent congenital CMV infection by reducing rates of maternal infection during pregnancy.

  6. Control of immune ligands by members of a cytomegalovirus gene expansion suppresses natural killer cell activation

    PubMed Central

    Fielding, Ceri A; Weekes, Michael P; Nobre, Luis V; Ruckova, Eva; Wilkie, Gavin S; Paulo, Joao A; Chang, Chiwen; Suárez, Nicolás M; Davies, James A; Antrobus, Robin; Stanton, Richard J; Aicheler, Rebecca J; Nichols, Hester; Vojtesek, Borek; Trowsdale, John; Davison, Andrew J; Gygi, Steven P

    2017-01-01

    The human cytomegalovirus (HCMV) US12 family consists of ten sequentially arranged genes (US12-21) with poorly characterized function. We now identify novel natural killer (NK) cell evasion functions for four members: US12, US14, US18 and US20. Using a systematic multiplexed proteomics approach to quantify ~1300 cell surface and ~7200 whole cell proteins, we demonstrate that the US12 family selectively targets plasma membrane proteins and plays key roles in regulating NK ligands, adhesion molecules and cytokine receptors. US18 and US20 work in concert to suppress cell surface expression of the critical NKp30 ligand B7-H6 thus inhibiting NK cell activation. The US12 family is therefore identified as a major new hub of immune regulation. DOI: http://dx.doi.org/10.7554/eLife.22206.001 PMID:28186488

  7. Manipulation of NKG2D Ligands by Cytomegaloviruses: Impact on Innate and Adaptive Immune Response

    PubMed Central

    Slavuljica, Irena; Krmpotić, Astrid; Jonjić, Stipan

    2011-01-01

    NKG2D is a potent activating receptor expressed on NK cells, NKT cells, γδ T cells, and CD8 T cells. NKG2D recognizes cell surface molecules structurally related to MHC class I proteins induced by infection or other type of cellular stress. The engagement of NKG2D leads to NK cell cytotoxicity and cytokine secretion or to a co-stimulation of CD8 T cells. Both human and mouse cytomegalovirus (CMV) have evolved numerous mechanisms to evade NKG2D-mediated immune response. This review describes the mechanisms used by CMV to inhibit NKG2D ligand expression and the recent advances in exploiting the NKG2D recognition pathway for mounting efficient and long-lasting immune response. PMID:22566874

  8. Cytomegalovirus enteritis in immunocompetent subjects: a case report and review of the literature.

    PubMed

    Karigane, Daiki; Takaya, Saho; Seki, Yuki; Mastumoto, Yuka; Onose, Akira; Kosakai, Arifumi; Sugaya, Norio; Mori, Takehiko

    2014-05-01

    Cytomegalovirus (CMV) enteritis (or colitis) is generally diagnosed in immunocompromised patients in association with human immunodeficiency virus infection as well as in recipients of solid organ or hematopoietic stem cell transplant. CMV enteritis has been reported only sporadically in immunocompetent individuals. We encountered a 76-year-old woman who developed CMV enteritis without any previously identified immunocompromised states. An extensive literature review of 33 cases of CMV enteritis or colitis diagnosed in immunocompetent individuals, including the present case, revealed that the median age of the patients was 68, the accompanying symptoms were diarrhea (76%), abdominal pain (52%), and hematochezia or melena (27%), and that the outcome was generally favorable, including resolution without any treatment in 24% of the patients. CMV enteritis should be recognized more widely as a disease entity not only in immunocompromised patients but also in immunocompetent individuals, especially in elderly populations.

  9. Comparison of plasma PCR and bronchoalveolar lavage fluid culture for detection of cytomegalovirus infection in adult bone marrow transplant recipients.

    PubMed Central

    Aspin, M M; Gallez-Hawkins, G M; Giugni, T D; Tegtmeier, B; Lang, D J; Schmidt, G M; Forman, S J; Zaia, J A

    1994-01-01

    Plasma PCR for human cytomegalovirus (CMV) DNA was compared with bronchoalveolar lavage (BAL) fluid culture as an indicator for disseminated CMV infection. Thirteen (32.5%) of 40 consecutive bone marrow transplant (BMT) recipients were BAL fluid culture positive for CMV on day 35 post-BMT, and 9 (69%) of the 13 had positive plasma PCRs between days 28 and 49. Of the 27 with negative BAL fluid cultures, 2 (7%) had positive plasma PCRs (P < 0.001). Plasma CMV DNA in BMT recipients is a useful clinical marker for serious infection. Images PMID:7814556

  10. 2-(2,4-Dioxy-1,2,3,4-Tetrahydropyrimidin-1-yl)-N-(4-Phenoxyphenyl)-Acetamides as a Novel Class of Cytomegalovirus Replication Inhibitors

    PubMed Central

    Babkov, D. A.; Paramonova, M. P.; Ozerov, A. A.; Khandazhinskaya, A. L.; Snoeck, R.; Andrei, G.; Novikov, M. S.

    2015-01-01

    A series of novel uracil derivatives, bearing N-(4-phenoxyphenyl)acetamide moiety at N3 of a pyrimidine ring, has been synthesized. Their antiviral activity has been evaluated. It has been found that the novel compounds possess high inhibitory activity against replication of human cytomegalovirus (AD-169 and Davis strains) in HEL cell cultures. In addition, some of the derivatives proved to be inhibitory against varicella zoster virus. PMID:26798502

  11. Signal peptide-dependent inhibition of MHC class I heavy chain translation by rhesus cytomegalovirus.

    PubMed

    Powers, Colin J; Früh, Klaus

    2008-10-03

    The US2-11 region of human and rhesus cytomegalovirus encodes a conserved family of glycoproteins that inhibit MHC-I assembly with viral peptides, thus preventing cytotoxic T cell recognition. Since HCMV lacking US2-11 is no longer able to block assembly and transport of MHC-I, we examined whether this is also observed for RhCMV lacking the corresponding region. Unexpectedly, recombinant RhCMV lacking US2-11 was still able to inhibit MHC-I expression in infected fibroblasts, suggesting the presence of an additional MHC-I evasion mechanism. Progressive deletion analysis of RhCMV-specific genomic regions revealed that MHC-I expression is fully restored upon additional deletion of rh178. The protein encoded by this RhCMV-specific open reading frame is anchored in the endoplasmic reticulum membrane. In the presence of rh178, RhCMV prevented MHC-I heavy chain (HC) expression, but did not inhibit mRNA transcription or association of HC mRNA with translating ribosomes. Proteasome inhibitors stabilized a HC degradation intermediate in the absence of rh178, but not in its presence, suggesting that rh178 prevents completion of HC translation. This interference was signal sequence-dependent since replacing the signal peptide with that of CD4 or murine HC rendered human HCs resistant to rh178. We have identified an inhibitor of antigen presentation encoded by rhesus cytomegalovirus unique in both its lack of homology to any other known protein and in its mechanism of action. By preventing signal sequence-dependent HC translocation, rh178 acts prior to US2, US3 and US11 which attack MHC-I proteins after protein synthesis is completed. Rh178 is the first viral protein known to interfere at this step of the MHC-I pathway, thus taking advantage of the conserved nature of HC leader peptides, and represents a new mechanism of translational interference.

  12. Dual Intravitreal Injections With Foscarnet and Ganciclovir for Ganciclovir-Resistant Recurrent Cytomegalovirus Retinitis in a Congenitally Infected Infant.

    PubMed

    Boss, Joseph D; Rosenberg, Kevin; Shah, Rajiv

    2016-10-22

    Resistant strains of cytomegalovirus can be difficult to treat in cases of congenital cytomegalovirus retinitis. The authors describe a case of recurrent bilateral congenital cytomegalovirus retinitis in an immunocompetent newborn with ganciclovir resistance successfully treated uniquely with dual therapy of intravenous ganciclovir and foscarnet and dual intravitreal injections with ganciclovir and foscarnet. [J Pediatr Ophthalmol Strabismus. 2016;53:e58-e60.].

  13. Killer-cell immunoglobulin-like receptors and cytomegalovirus reactivation during late pregnancy.

    PubMed

    Alvarado-Hernández, D L; Benítez-Sánchez, A; Rodríguez-Cuevas, J S; Rosales-Saavedra, T; Guerra-Palomares, S E; Comas-García, A; Noyola, D E; García-Sepúlveda, C A

    2016-08-01

    Human cytomegalovirus (CMV) represents an important public health concern as it is associated with severe morbidity and mortality in transplant recipients, HIV-infected individuals and pregnant women given the risk of congenital infection. Congenital CMV is a leading cause of neurological sequelae, developmental delay and birth defects worldwide. Cytomegalovirus can be transmitted to the foetus following maternal infection or reactivation. NK cells expressing killer-cell immunoglobulin-like receptors (KIR) are part of the innate immune system and the first line of defence against viral incursions. Previous reports have shown that KIR genes are associated with CMV infections in the post-transplant setting. In this study, we set out to determine whether a protective effect of KIR genes over CMV infection is seen in Mexican pregnant women. Cytomegalovirus infection was assessed through nucleic acid testing in 200 pregnant women and 600 healthy blood donors comprising the Mexican mestizo reference population. Killer-cell immunoglobulin-like receptors and HLA-C genotypes were obtained from 200 pregnant women and 300 reference samples using a comprehensive PCR-SSP approach. We observed statistically lower carrier frequencies of cB03|tA01 gene-content haplotype, of cB03 haplotype motif, of the KIR2DL5 + 2DS3/2DS5 gene pair and of KIR2DL5 amongst CMV-positive pregnant women in comparison with those CMV negative. None of these were associated with CMV status in the reference population. Logistic regression analysis revealed that the most important factor determining CMV status during third-trimester pregnancies was the KIR2DL5 + 2DS3/2DS5 gene pair (OR 0.376 (95%CI 0.174, 0.811, P = 0.013). Our results indicate that CMV-protective KIR gene associations described in Caucasoid populations are also present in the genetically distinct Mexican mestizo population. Our results suggest that certain KIR gene combinations provide protection against CMV infections occurring

  14. Subdominant CD8 T-cell epitopes account for protection against cytomegalovirus independent of immunodomination.

    PubMed

    Holtappels, Rafaela; Simon, Christian O; Munks, Michael W; Thomas, Doris; Deegen, Petra; Kühnapfel, Birgit; Däubner, Torsten; Emde, Simone F; Podlech, Jürgen; Grzimek, Natascha K A; Oehrlein-Karpi, Silke A; Hill, Ann B; Reddehase, Matthias J

    2008-06-01

    Cytomegalovirus (CMV) infection continues to be a complication in recipients of hematopoietic stem cell transplantation (HSCT). Preexisting donor immunity is recognized as a favorable prognostic factor for the reconstitution of protective antiviral immunity mediated primarily by CD8 T cells. Furthermore, adoptive transfer of CMV-specific memory CD8 T (CD8-T(M)) cells is a therapeutic option for preventing CMV disease in HSCT recipients. Given the different CMV infection histories of donor and recipient, a problem may arise from an antigenic mismatch between the CMV variant that has primed donor immunity and the CMV variant acquired by the recipient. Here, we have used the BALB/c mouse model of CMV infection in the immunocompromised host to evaluate the importance of donor-recipient CMV matching in immundominant epitopes (IDEs). For this, we generated the murine CMV (mCMV) recombinant virus mCMV-DeltaIDE, in which the two memory repertoire IDEs, the IE1-derived peptide 168-YPHFMPTNL-176 presented by the major histocompatibility complex class I (MHC-I) molecule L(d) and the m164-derived peptide 257-AGPPRYSRI-265 presented by the MHC-I molecule D(d), are both functionally deleted. Upon adoptive transfer, polyclonal donor CD8-T(M) cells primed by mCMV-DeltaIDE and the corresponding revertant virus mCMV-revDeltaIDE controlled infection of immunocompromised recipients with comparable efficacy and regardless of whether or not IDEs were presented in the recipients. Importantly, CD8-T(M) cells primed under conditions of immunodomination by IDEs protected recipients in which IDEs were absent. This shows that protection does not depend on compensatory expansion of non-IDE-specific CD8-T(M) cells liberated from immunodomination by the deletion of IDEs. We conclude that protection is, rather, based on the collective antiviral potential of non-IDEs independent of the presence or absence of IDE-mediated immunodomination.

  15. A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA in murine cytomegalovirus.

    PubMed Central

    Dorsch-Häsler, K; Keil, G M; Weber, F; Jasin, M; Schaffner, W; Koszinowski, U H

    1985-01-01

    Using the simian virus 40 "enhancer trap" approach, we have identified a transcription enhancer located just upstream of the major immediate early gene of murine cytomegalovirus. This enhancer has several striking properties. (i) Together with the enhancer of human cytomegalovirus, it is the strongest transcription enhancer found to date. (ii) It is an extremely long enhancer, spanning greater than 700 base pairs. (iii) It consists of a rather complex pattern of sequence repeats, the longest of which is 181 base pairs. Also, several types of short sequence motifs are scattered throughout the enhancer in monomeric, heterodimeric, or homodimeric (palindromic) form. These motifs have been identified to be components of other enhancers and promoters, and they are presumably binding sites for specific nuclear factors. Our analysis suggests that enhancers are composed of a modular arrangement of short conserved sequence motifs and that enhancer strength is correlated with the redundancy of these motifs. Images PMID:3001696

  16. Guillain-Barré syndrome and cytomegalovirus infection during pregnancy.

    PubMed

    Lupo, Julien; Germi, Raphaële; Jean, Dominique; Baccard-Longère, Monique; Casez, Olivier; Besson, Gérard; Rougé, Alain; Boutonnat, Jean; Schwebel, Carole; Hoffmann, Pascale; Morand, Patrice

    2016-06-01

    Guillain-Barré syndrome (GBS) is an immune-mediated disorder which can be triggered by cytomegalovirus (CMV) infection. GBS following CMV primary infection is a rare event during pregnancy, which raises the question of maternal and fetal management. We describe an unusual case of GBS after CMV primary infection in a pregnant woman. The mother was successfully treated with standard immunoglobulins but in utero fetal death caused by CMV congenital infection unfortunately occurred. Similar cases have rarely been reported in the literature.

  17. Characterization of Cytomegalovirus Disease in Solid Organ Transplant Recipients by Markers of Inflammation in Plasma

    PubMed Central

    Rollag, Halvor; Ueland, Thor; Åsberg, Anders; Hartmann, Anders; Jardine, Alan G.; Humar, Atul; Pescovitz, Mark D.; Bignamini, Angelo A.; Aukrust, Pål

    2013-01-01

    Background While several studies have examined the general inflammatory responses in relation to cytomegalovirus infection, the identification of the various inflammatory mediators as well as their relative importance is far from clear. Patients and Methods Solid organ recipients enrolled in an international multicenter trial of cytomegalovirus disease treatment (the VICTOR study) were analyzed (n = 289) (ClinicalTrials.gov NCT00431353). Plasma markers of inflammation and endothelial cell activation were assessed at baseline by enzyme immunoassays. Results The major findings were: (i) Plasma levels of the CXC-chemokine interferon-inducible protein-10 (P<0.001) and C-reactive protein (P = 0.046) were independently associated with the presence of cytomegalovirus DNAemia above lower level of quantification. (ii) High levels of CC-chemokine ligand 21 (P = 0.027) and pentraxin 3 (P = 0.033) were independently associated with tissue invasive cytomegalovirus disease as opposed to cytomegalovirus syndrome. Conclusion Our findings illustrate the complex interaction between cytomegalovirus and the immune system, involving a wide range of inflammatory mediators that could be associated to disease manifestations in cytomegalovirus related disease. PMID:23593305

  18. cGAS-STING Signaling Regulates Initial Innate Control of Cytomegalovirus Infection

    PubMed Central

    McDonald, Bryan; Takahashi, Mariko; Dhanwani, Rekha; Sharma, Nikita; Huang, Jenny; Pham, Elise; Benedict, Chris A.

    2016-01-01

    ABSTRACT Several innate sensing pathways contribute to the control of early cytomegalovirus (CMV) infection, leading to a multiphasic type I interferon (IFN-I) response that limits viral replication and promotes host defenses. Toll-like receptor (TLR)-dependent pathways induce IFN-I production in CMV-infected plasmacytoid dendritic cells; however, the initial burst of IFN-I that occurs within the first few hours in vivo is TLR independent and emanates from stromal cells. Here we show that primary human endothelial cells mount robust IFN-I responses to human CMV that are dependent upon cyclic GMP-AMP synthase (cGAS), STING, and interferon regulatory factor 3 (IRF3) signaling. Disruption of STING expression in endothelial cells by clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 revealed that it is essential for the induction of IFN-I and restriction of CMV replication. Consistently, STING was necessary to mount the first phase of IFN-I production and curb CMV replication in infected mice. Thus, DNA sensing through STING is critical for primary detection of both human and mouse CMV in nonhematopoietic cells and drives the initial wave of IFN-I that is key for controlling early viral replication in vivo. IMPORTANCE Cytomegalovirus (CMV) is one of the most common viral pathogens, with the majority of people contracting the virus in their lifetime. Although acute infection is mostly asymptomatic in healthy persons, significant pathology is observed in immunocompromised individuals, and chronic CMV infection may exacerbate a myriad of inflammatory conditions. Here we show that primary human endothelial cells mount robust IFN-I responses against CMV via a cGAS/STING/IRF3 pathway. Disruption of STING expression by CRISPRs revealed an essential role in eliciting IFN-I responses and restricting CMV replication. Consistently, in mice, STING is necessary for the first phase of IFN-I production that limits early CMV replication. Our results demonstrate a

  19. Alopecia in mice infected with murine cytomegalovirus (MCMV).

    PubMed Central

    Mims, C. A.

    1985-01-01

    When mouse cytomegalovirus was injected subcutaneously into 4-12 day old CDI mice there was infection of dermal cells and the dermal papillae of hair follicles. Infected cells were never seen in the epidermis nor in the epithelium of hair follicles. When larger doses of virus (5 X 10(4) pfu) were given, dermal infection led to gross necrosis of the skin, ulceration, scabbing and healing with alopecia. Smaller doses (10(4) pfu) did not cause gross necrosis but damage to follicles resulted in alopecia or sparse hair growth. Skin lesions were not seen after infection of 4-8 week old mice, even when the inoculated skin area had been epilated, or when hyaluronidase was mixed with the virus inoculum. These experiments show that cytomegalovirus, in contrast to herpes simplex and varicella-zoster viruses, infects dermal but not epidermal cells, and that dermal tropism is age-restricted. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:3002414

  20. Cytomegalovirus as an occupational risk in daycare educators

    PubMed Central

    Joseph, Serene A; Béliveau, Claire; Muecke, Cristin J; Rahme, Elham; Soto, Julio C; Flowerdew, Gordon; Johnston, Lynn; Langille, Donald; Gyorkos, Theresa W

    2006-01-01

    BACKGROUND Cytomegalovirus (CMV) infection continues to be an important occupational risk in the daycare setting. A comprehensive update of scientific evidence is timely to inform and promote appropriate preventive measures. METHODS A review of the literature was conducted to examine the evidence for an occupational risk of CMV infection in daycare educators. Sources included Medline, government documents and additional references from published bibliographies. The key words used for searches were ‘child day care centres’ or ‘nurseries’ and ‘cytomegalovirus’ or ‘cytomegalovirus infection’. RESULTS Eight CMV seroprevalence studies on daycare educators in industrialized countries were found: four in the United States, three in Canada and one in Italy. Risk factors for seropositivity were older age, nonwhite race, foreign birth, birth in a low- or middle-income country, diaper changing, having children at home, and a child to educator ratio greater than 6:1 in children 18 to 35 months of age. Risk factors for seroconversion were younger age and working with young children. These studies suggest that daycare centres may be a high-risk setting for CMV infection. DISCUSSION Recommendations to prevent CMV infection in this setting include handwashing, selective serological screening, avoiding work with younger children if pregnant and, in some cases, preventive leave from work. Evaluation and expert opinion of the effectiveness of various preventive options for CMV acquisition are needed to ensure that recommendations are evidence-based. PMID:19030309

  1. Acquired chemotactic inhibitors during infection with guinea pig cytomegalovirus.

    PubMed Central

    Tannous, R; Myers, M G

    1983-01-01

    Factors involved in neutrophil and monocyte migrations were serially studied in strain 2 guinea pigs undergoing initial cytomegalovirus infection and sham-inoculated controls. All studies remained unchanged in uninfected animals. Monocyte migrations and neutrophil spontaneous migration remained unchanged in infected animals. However, transient abnormalities occurred early in infection, comprising a decrease in neutrophil-directed migration towards C5-derived chemotactic fractions (C5-fr) and a decrease in the chemotactic activity of zymosan-activated plasma. Consequently, the presence of neutrophil- and chemotaxin-directed inhibitors in plasma was investigated. Normal neutrophils, C5-fr, Escherichia coli-derived bacterial factor, and the synthetic peptide F-met-leu-phe were first incubated with control or infected plasmas and then assayed for directed migration and lysosomal enzyme release. Results indicated the de novo appearance of both neutrophil- and chemotaxin-directed inhibitory activities in plasma during early infection. The neutrophil-directed inhibition was heat stable (56 degrees C for 120 min) and nonspecific (responses to all chemotaxins were inhibited). The chemotaxin-directed inhibition was heat stable and C5-fr specific. The cytomegalovirus-induced inhibitors may be important in the enhanced susceptibility to concurrent opportunistic infections. PMID:6305847

  2. Analysis of cytomegalovirus genomes with restriction endonucleases Hin D III and EcoR-1.

    PubMed

    Kilpatrick, B A; Huang, E S; Pagano, J S

    1976-06-01

    Cleavage of genomes of eleven human, one simian, and one simian-related cytomegalovirus (CMV) isolate by the restriction endonucleases HinD III and EcoR-1 generated reproducible DNA fragments. The size range of CMV DNA fragments as estimated by contour length measurements in comparison with simian virus 40 form II DNA and by coelectrophoresis with EcoR-1 fragments of herpes simplex virus DNA varied between 15 X 10(6) and 0.5 X 10(6) daltons. Comparison of the cleavage products of each isolate in 1% agarose slab gels showed extensive comigration of fragments among the human CMV isolates. In the HinD III digests, three fragment bands comigrated among all human CMV isolates, and six fragments comigrated among most, but not all, human CMV isolates. In the EcoR-1 digests, nine fragment bands comigrated among all human CMV isolates, and five bands comigrated among most, but not all human isolates. Each isolate had a distinctive electrophoretic profile with either HinD III or EcoR-1 digests. No two isolates had identical HinD III or EcoR-1 patterns although some isolates did share more general pattern similarities than others. No clear-cut subgrouping of isolates based on cleavage pattern characteristics could be discerned. Comparison of HinD III and EcoR-1 patterns showed that human isolates differ greatly from nonhuman CMV isolates. HinD III and EcoR-1 digests of each isolate contained both major and minor molar classes of DNA fragments that ranged from about 1 and multiples of 1 M down to about 0.25 M; however, the summed molecular weights for major molar fragments resulting from HinD III or EcoR-1 digests of several isolates closely approximated the molecular weight of 10(8) of the intact genome.

  3. Disseminated Cytomegalovirus Infection and Protein Losing Enteropathy as Presenting Feature of Pediatric Patient with Crohn's Disease

    PubMed Central

    Ersoz, Safak; Akbulut, Ulas Emre

    2015-01-01

    We report a pediatric patient admitted with abdominal pain, diffuse lower extremity edema and watery diarrhea for two months. Laboratory findings including complete blood count, serum albumin, lipid and immunoglobulin levels were compatible with protein losing enteropathy. Colonoscopic examination revealed diffuse ulcers with smooth raised edge (like "punched out holes") in the colon and terminal ileum. Histopathological examination showed active colitis, ulcerations and inclusion bodies. Immunostaining for cytomegalovirus was positive. Despite supportive management, antiviral therapy, the clinical condition of the patient worsened and developed disseminated cytomegalovirus infection and the patient died. Protein losing enteropathy and disseminated cytomegalovirus infection a presenting of feature in steroid-naive patient with inflammatory bowel disease is very rare. Hypogammaglobulinemia associated with protein losing enteropathy in Crohn's disease may predispose the cytomegalovirus infection in previously healthy children. PMID:25866735

  4. [Acute abdomen due to cytomegalovirus in AIDS patients. Apropos 2 cases].

    PubMed

    Ferré, C; Mascaró, J; Benasco, C; Ramos, E; Pérez, J L; Podzamczer, D

    1994-07-09

    Two cases of acute abdomen--because of acute appendicitis and paralytic ileus--due to cytomegalovirus infection in AIDS patients are reported. In both patients evolution was subacute and cytomegalic inclusions were seen in the histologic examination of the surgical samples. The two patients died after surgery. The possibility of cytomegalovirus infection must be kept in mind in AIDS patients who undergo urgent abdominal laparatomy and early treatment should be instituted.

  5. Cytomegalovirus Antibody in Cerebrospinal Fluid of Schizophrenic Patients Detected by Enzyme Immunoassay

    NASA Astrophysics Data System (ADS)

    Fuller Torrey, E.; Yolken, Robert H.; Winfrey, C. Jack

    1982-05-01

    By means of enzyme immunoassay techniques to detect the presence of antibody to cytomegalovirus, the cerebrospinal fluid of 178 patients with schizophrenia, 17 patients with bipolar disorders, and 11 other psychiatric patients was compared with that of 79 neurological patients and 41 normal control subjects. The cerebrospinal fluid of 20 of the schizophrenic patients and 3 of the patients with bipolar disorders showed significant increases in immunoglobulin M antibody to cytomegalovirus; no difference was found in patients on or off psychotropic medications.

  6. Cytomegalovirus (CMV) inactivation in breast milk: reassessment of pasteurization and freeze-thawing.

    PubMed

    Hamprecht, Klaus; Maschmann, Jens; Müller, Denise; Dietz, Klaus; Besenthal, Ingo; Goelz, Rangmar; Middeldorp, Jaap M; Speer, Christian P; Jahn, Gerhard

    2004-10-01

    Breast-feeding mothers frequently transmit cytomegalovirus (CMV) to preterm infants of very low birth weight. Current recommendations for prevention of virus transmission are based on data published 20 y ago in the context of human milk banking. Two recent clinical trials examined storage of breast milk at -20 degrees Celsius to reduce virus transmission. However, in both studies, CMV transmission occurred. Using sensitive tools like quantitative PCR, CMV pp67 late mRNA assay, and a high-speed, centrifugation-based microculture assay for quantification of CMV infectivity, we reassessed the virological and biochemical characteristics of freeze-storing breast milk at -20 degrees Celsius, compared it with traditional Holder pasteurization (30 min at 62.5 degrees Celsius), and a new short-term pasteurization (5 s at 72 degrees Celsius) based on the generation of a milk film. Both heat treatment procedures were able to destroy viral infectivity and pp67 RNA completely. Preliminary results showed short-term heat inactivation below 72 degrees Celsius was less harmful in reducing the activity of marker enzymes than Holder pasteurization. Freezing breast milk preserved the biochemical and immunologic quality of the milk; however, late viral RNA and viral infectivity was also preserved. Compared with viral DNA, CMV-RNA more directly reflects infectious CMV in human milk samples. Further studies are necessary to evaluate short-term heat treatment below 72 degrees Celsius as an effective tool for prevention of CMV transmission.

  7. An in vitro mouse model of congenital cytomegalovirus-induced pathogenesis of the inner ear cochlea.

    PubMed

    Melnick, Michael; Jaskoll, Tina

    2013-02-01

    Congenital human cytomegalovirus (CMV) infection is the leading nongenetic etiology of sensorineural hearing loss (SNHL) at birth and prelingual SNHL not expressed at birth. The paucity of temporal bone autopsy specimens from infants with congenital CMV infection has hindered the critical correlation of histopathology with pathogenesis. Here, we present an in vitro embryonic mouse model of CMV-infected cochleas that mimics the human sites of viral infection and associated pathology. There is a striking dysplasia/hyperplasia in mouse CMV-infected cochlear epithelium and mesenchyme, including organ of Corti hair and supporting cells and stria vascularis. This is concomitant with significant dysregulation of p19, p21, p27, and Pcna gene expression, as well as proliferating cell nuclear antigen (PCNA) protein expression. Other pathologies similar to those arising from known deafness gene mutations include downregulation of KCNQ1 protein expression in the stria vascularis, as well as hypoplastic and dysmorphic melanocytes. Thus, this model provides a relevant and reliable platform within which the detailed cell and molecular biology of CMV-induced deafness may be studied.

  8. Herpetic (non-cytomegalovirus) retinal infections in patients with the acquired immunodeficiency syndrome.

    PubMed

    Stewart, Michael W

    2013-04-01

    Human herpes viruses cause significant morbidity in patients with the acquired immunodeficiency syndrome. Even after the introduction of highly active anti-retroviral therapy (HAART), herpes viruses remain the leading causes of blindness in AIDS patients. Cytomegalovirus (CMV) retinitis and the closely-related immune reconstitution uveitis syndrome are the most common causes of blindness, but progressive outer retinal necrosis and acute retinal necrosis due to varicella zoster and herpes simplex are also important causes of vision loss. Successful treatment of these conditions requires an aggressive approach with multi-drug intravenous therapy or repeated intravitreal antiviral injections. Since the rate of retinal detachment is alarmingly high despite successful antiviral therapy, internists and ophthalmologists must work closely together to recognize and treat complications as they arise. Fortunately, Epstein-Barr virus is a rare cause of retinal infection and human herpes virus (HHV)-6, HHV-7, and HHV-8 do not appear to be primary pathogens. However, increasing evidence suggests that HHV-6 and HHV-7 play important roles in modulating the immune system and potentiating infection by CMV.

  9. Replication inhibition by nucleoside analogues of a recombinant Autographa californica multicapsid nuclear polyhedrosis virus harboring the herpes thymidine kinase gene driven by the IE-1(0) promoter: a new way to select recombinant baculoviruses.

    PubMed Central

    Godeau, F; Saucier, C; Kourilsky, P

    1992-01-01

    The expression of the thymidine-thymidylate kinase (HSV1-TK), (ATP: thymidine 5'-phosphotransferase; EC 2.7.1.21) of herpes simplex virus type 1 endows the host cell with a conditional lethal phenotype which depends on the presence of nucleoside analogues metabolized by this enzyme into toxic inhibitors of DNA replication. To generate a recombinant baculovirus that could be selected against by nucleoside analogs, the HSV1-tk coding sequence was placed under the control of the Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV) immediate early promoterm IE-1(0), and this construction was introduced via homologous recombination into the polyhedrin locus of AcMNPV. Two recombinant baculoviruses harboring this gene construct at the polyhedrin locus were isolated and tested for their ability to replicate in the presence of various concentrations of the nucleoside analog 9-(1,3-Dihydroxy-2-propoxymethyl)guanine (Ganciclovir). Neither Sf9 lepidopteran cell viability nor replication of wild type or beta-Galactosidase-expressing recombinant AcMNPVs were affected by concentrations of Ganciclovir up to 100 microM. In contrast, replication of the recombinant AcMNPV virus harboring the HSV1-tk gene was inhibited by Ganciclovir in a dose-dependent manner. The inhibition was detectable at 2 microM and complete at 100 microM. This property was exploited in model isolations aimed at purifying new recombinant viruses having lost this counter-selectable gene marker as a result of homologous recombination at the polyhedrin locus after cotransfection of the viral DNA with a replacement vector. After being propagated in the presence of Ganciclovir, the progeny of such co-transfections contained over 85% recombinant viruses, demonstrating that counter-selection of parental HSV1-tk-containing viruses by Ganciclovir constitutes a novel approach for recombinant baculovirus isolation. Images PMID:1335569

  10. Acute cervicitis and vulvovaginitis may be associated with Cytomegalovirus

    PubMed Central

    Abou, Magali; Dällenbach, Patrick

    2013-01-01

    Cytomegalovirus (CMV) infection in immunocompetent hosts is generally asymptomatic or may present as a mononucleosic syndrome. Its association with acute cervicitis and vulvovaginitis has rarely been reported. A 24-year-old woman presented with pelvic pain, vulvodynia, abnormal vaginal discharge, burning with urination, fatigue, fever, vomiting and diarrhoea. The vulva and cervix were red with vesicular lesions on the cervix. Genital herpes simplex infection (HSV) was suspected and valacyclovir was given orally. However, serial viral cultures performed 7 weeks apart did not isolate HSV as suspected, but CMV was confirmed by immunofluorescence and early antigen research. Blood tests confirmed an acute CMV infection. Typical inclusions were found at histology. Symptoms resolved slowly with persistence of cervical lesions at 7 weeks from diagnosis. The frequency of CMV genital infection is probably underestimated. The infection is not always asymptomatic and might be confused with genital HSV infection. The clinical course is longer. PMID:23606387

  11. Acute cervicitis and vulvovaginitis may be associated with Cytomegalovirus.

    PubMed

    Abou, Magali; Dällenbach, Patrick

    2013-04-19

    Cytomegalovirus (CMV) infection in immunocompetent hosts is generally asymptomatic or may present as a mononucleosic syndrome. Its association with acute cervicitis and vulvovaginitis has rarely been reported. A 24-year-old woman presented with pelvic pain, vulvodynia, abnormal vaginal discharge, burning with urination, fatigue, fever, vomiting and diarrhoea. The vulva and cervix were red with vesicular lesions on the cervix. Genital herpes simplex infection (HSV) was suspected and valacyclovir was given orally. However, serial viral cultures performed 7 weeks apart did not isolate HSV as suspected, but CMV was confirmed by immunofluorescence and early antigen research. Blood tests confirmed an acute CMV infection. Typical inclusions were found at histology. Symptoms resolved slowly with persistence of cervical lesions at 7 weeks from diagnosis. The frequency of CMV genital infection is probably underestimated. The infection is not always asymptomatic and might be confused with genital HSV infection. The clinical course is longer.

  12. Reactivation and shedding of cytomegalovirus in astronauts during spaceflight

    NASA Technical Reports Server (NTRS)

    Mehta, S. K.; Stowe, R. P.; Feiveson, A. H.; Tyring, S. K.; Pierson, D. L.

    2000-01-01

    The reactivation of cytomegalovirus (CMV) in 71 astronauts was investigated, using polymerase chain reaction. A significantly greater (P<.0001) shedding frequency was found in urine samples from astronauts before spaceflight (10.6%) than in urine from the healthy control subject group (1.2%). Two of 4 astronauts studied during spaceflight shed CMV in urine. A significant increase (P<.0001) in CMV antibody titer, compared with baseline values, was also found 10 days before spaceflight. CMV antibody titer was further increased (P<.001) 3 days after landing, compared with 10 days before the mission. Significant increases in stress hormones were also found after landing. These results demonstrate that CMV reactivation occurred in astronauts before spaceflight and indicate that CMV may further reactivate during spaceflight.

  13. Properties and mechanisms of immunoglobulins for congenital cytomegalovirus disease.

    PubMed

    Parruti, Giustino; Polilli, Ennio; Ursini, Tamara; Tontodonati, Monica

    2013-12-01

    Immunoglobulins are one major component of adaptive immunity to external and resident microorganisms, evolving very early in phylogenesis. They help eukaryotes in controlling infections, mainly through their neutralizing activity, which quenches both the cytopathic and inflammatory potential of invading microorganisms. Cytomegalovirus (CMV)-related disease is generally blunted in seropositive subjects with conserved specific humoral responses. CMV-seropositive pregnant women, in accordance with such evidence, suffer little or no fetal damage when reexposed to CMV. Several seminal experiences and early experimental models confirmed that repeated infusions of immunoglobulins, either with hyperimmune or standard preparations, may help to reduce maternal-fetal CMV transmission, as well as to quench fetal disease upon transmission. This review focused on experimental evidence supporting the potential role of immunoglobulins as a tool to control fetal CMV-related disease in pregnant women.

  14. Knowledge and Awareness of Congenital Cytomegalovirus Among Women

    DOE PAGES

    Jeon, Jiyeon; Victor, Marcia; Adler, Stuart P.; ...

    2006-01-01

    Bmore » ackground . Congenital cytomegalovirus (CMV) infection is a leading cause of disabilities in children, yet the general public appears to have little awareness of CMV. Methods . Women were surveyed about newborn infections at 7 different geographic locations. Results . Of the 643 women surveyed, 142 ( 22 % ) had heard of congenital CMV. Awareness increased with increasing levels of education ( P < .0001 ). Women who had worked as a healthcare professional had a higher prevalence of awareness of CMV than had other women ( 56 % versus 16 % , P < .0001 ). Women who were aware of CMV were most likely to have heard about it from a healthcare provider ( 54 % ), but most could not correctly identify modes of CMV transmission or prevention. Among common causes of birth defects and childhood illnesses, women's awareness of CMV ranked last. Conclusion . Despite its large public health burden, few women had heard of congenital CMV, and even fewer were aware of prevention strategies.« less

  15. Congenital Cytomegalovirus: a "Now" Problem-No Really, Now.

    PubMed

    Bernstein, David I

    2017-01-01

    Despite the clear need, progress toward a vaccine for congenital cytomegalovirus (CMV) has been slow. However, recent events have provided new interest, and several vaccine candidates are either in clinical trials or the trials are close to starting. In this issue of Clinical and Vaccine Immunology, Schleiss and colleagues show that a nonreplicating lymphocytic choriomeningitis virus (rLCMV)-vectored vaccine expressing CMV glycoprotein B (gB) and/or pp65 induces B and T cells and improves pup survival in a guinea pig model of congenital CMV infection (Clin Vaccine Immunol 24:e00300-16, 2017, https://doi.org/10.1128/CVI.00300-16). The combination vaccine appeared to be the most effective.

  16. Hepatic involvement in congenital cytomegalovirus infection - infrequent yet significant.

    PubMed

    Bilavsky, E; Schwarz, M; Bar-Sever, Z; Pardo, J; Amir, J

    2015-09-01

    Congenital cytomegalovirus (cCMV) infection can reside in many organ systems; however, the virus has a particular predilection towards inhabiting the reticuloendothelial system, especially the liver. Specific studies focusing only on hepatic involvement in infants with cCMV are lacking. We report our experience with a large cohort of infants treated in our hospital clinic due to cCMV and hepatic involvement. Hepatic involvement was defined either as hepatitis (elevated alanine transaminases (ALT) >80 units/L without cholestatic disease) or cholestatic disease (elevated ALT >80 units/L combined with direct bilirubin >2 mg/dL). During the study period, 198 infants were diagnosed with symptomatic cCMV in our clinic. Hepatic involvement was observed in 13 infants (6.6%); 7 (3.5%) with hepatitis and 6 (3%) with cholestatic disease. Maternal primary infection with cytomegalovirus during pregnancy was diagnosed in 7 (53.8%) of the 13 infants, nonprimary in 3 (23.1%) and unknown in 3 (23.1%). Among these 13 infants, central nervous system (CNS) involvement was observed in 11 (84.6%) and hearing impairment in 7 (53.8%). Treatment with an antiviral agent was initiated in all cases. Gradual improvement of hepatic enzymes and cholestasis was observed over a prolonged period. We found that the incidence of hepatic involvement in infants with cCMV is much less frequent than previously reported. The hepatic involvement in these infants may manifest in two different ways, and thus, a high index of suspicion and a stepwise approach will help in correctly diagnosing these infants. Antiviral treatment due to CNS involvement is warranted and prognosis is excellent.

  17. Active cytomegalovirus infection in patients with atopic dermatitis.

    PubMed

    Hafez, Shereen F; Shehata, Iman H; Abdel Aziz, Ghada A; Kamal, Mahmoud M

    2005-01-01

    Atopic dermatitis (AD) is a complex immunologic skin disorder that is expressed when genetically predisposed individuals are exposed to certain environmental stimuli. Inspite of the high prevalence of cytomegalovirus (CMV) infection and its potent immunomodulatory activities, the relation of CMV to AD is still poorly understood and is still to be clarified. The aim of the present study was to evaluate the frequency of active CMV infection in patients with AD and its possible etiologic role in the pathogenesis of the disease. Also, we tried to find if a relation between active CMV infection and disease severity exists. The present study was carried on 31 patients with AD with various degrees of disease severity. Ten apparently healthy subjects were enrolled in the study as a control group. Anti CMV IgG antibodies were estimated by quantitative enzyme immunoassay to discriminate between recent CMV infection and CMV reactivation. Active CMV infection was diagnosed by using nested PCR to detect CMV DNA in the sera of the studied subjects. The detection rate of CMV genome was higher in patients with AD in comparison to the control group. Cytomegalovirus genome was detected in the sera of 52% (16/31) of patients with AD (87.5% of them were seropositive for anti-CMV IgG antibodies). On the other hand no CMV DNA was detected in any of the serum samples of the control subjects. The difference was statistically significant. No significant relation was found between active CMV infection and disease severity. Also, no significant statistical difference was found between the two studied groups as regards the prevalence of latent CMV infection. In addition, no significant difference was detected between anti-CMV IgG antibody levels in all seropositive subjects. Our results denote that active subclinical CMV infection is more frequent in patients with AD and may have possible immunomodulatory role in the etiopathogenesis of AD but it is not related to disease severity.

  18. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus

    PubMed Central

    Maddux, Sarah; Choi, K. Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  19. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus.

    PubMed

    Coleman, Stewart; Hornig, Julia; Maddux, Sarah; Choi, K Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  20. Complexity of Host Micro-RNA Response to Cytomegalovirus Reactivation After Organ Transplantation.

    PubMed

    Egli, A; Lisboa, L F; O'Shea, D; Asberg, A; Mueller, T; Emery, V; Kumar, D; Humar, A

    2016-02-01

    Human (Homo sapiens) micro-RNAs (hsa-miRNAs) regulate virus and host-gene translation, but the biological impact in patients with human cytomegalovirus (hCMV) infection is not well defined in a clinically relevant model. First, we compared hsa-miRNA expression profiles in peripheral blood mononuclear cells from 35 transplant recipients with and without CMV viremia by using a microarray chip covering 847 hsa-miRNAs. This approach demonstrated a set of 142 differentially expressed hsa-miRNAs. Next, we examined the effect of each of these miRNAs on viral growth by using human fibroblasts (human foreskin fibroblast-1) infected with the hCMV Towne strain, identifying a subset of proviral and antiviral hsa-miRNAs. miRNA-target prediction software indicated potential binding sites within the hCMV genome (e.g., hCMV-UL52 and -UL100 [UL = unique long]) and host-genes (e.g., interleukin-1 receptor, IRF1). Luciferase-expressing plasmid constructs and immunoblotting confirmed several predicted miRNA targets. Finally, we determined the expression of selected proviral and antiviral hsa-miRNAs in 242 transplant recipients with hCMV-viremia. We measured hsa-miRNAs before and after antiviral therapy and correlated hsa-miRNA expression levels to hCMV-replication dynamics. One of six antiviral hsa-miRNAs showed a significant increase during treatment, concurrent with viral decline. In contrast, six of eight proviral hsa-miRNAs showed a decrease during viral decline. Our results indicate that a complex and multitargeted hsa-miRNA response occurs during CMV replication in immunosuppressed patients. This study provides mechanistic insight and potential novel biomarkers for CMV replication.

  1. Novel Chemokine-Based Immunotoxins for Potent and Selective Targeting of Cytomegalovirus Infected Cells

    PubMed Central

    Spiess, Katja; Jeppesen, Mads G.; Malmgaard-Clausen, Mikkel; Krzywkowski, Karen

    2017-01-01

    Immunotoxins as antiviral therapeutics are largely unexplored but have promising prospective due to their high selectivity potential and their unparalleled efficiency. One recent example targeted the virus-encoded G protein-coupled receptor US28 as a strategy for specific and efficient treatment of human cytomegalovirus (HCMV) infections. US28 is expressed on virus-infected cells and scavenge chemokines by rapid internalization. The chemokine-based fusion-toxin protein (FTP) consisted of a variant (F49A) of CX3CL1 specifically targeting US28 linked to the catalytic domain of Pseudomonas exotoxin A (PE). Here, we systematically seek to improve F49A-FTP by modifications in its three structural domains; we generated variants with (1) altered chemokine sequence (K14A, F49L, and F49E), (2) shortened and elongated linker region, and (3) modified toxin domain. Only F49L-FTP displayed higher selectivity in its binding to US28 versus CX3CR1, the endogenous receptor for CX3CL1, but this was not matched by a more selective killing of US28-expressing cells. A longer linker and different toxin variants decreased US28 affinity and selective killing. Thereby, F49A-FTP represents the best candidate for HCMV treatment. Many viruses encode internalizing receptors suggesting that not only HCMV but also, for instance, Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus may be targeted by FTPs. PMID:28251165

  2. The Cytomegalovirus protein pUL37×1 targets mitochondria to mediate neuroprotection

    PubMed Central

    Hong, Chien Tai; Chau, Kai-Yin; Schapira, Anthony H. V.

    2016-01-01

    There is substantial evidence that mitochondrial dysfunction plays a significant role in the pathogenesis of Parkinson disease (PD). This contribution probably encompasses defects of oxidative phosphorylation, mitochondrial turnover (mitophagy), mitochondrial derived oxidative stress, and apoptotic signalling. Human cytomegalovirus immediate-early protein pUL37 × 1 induces Bax mitochondrial translocation and inactivation to prevent apoptosis. Over-expressing pUL37 × 1 in neuronal cells protects against staurosporin and 6-hydroxydopamine induced apoptosis and cell death. Protection is not enhanced by bax silencing in pUL37 × 1 over-expressing cells, suggesting a bax-dependent mechanism of action. pUL37 × 1 increases glycolysis and induces mitochondrial hyperpolarization, a bax independent anti-apoptotic action. pUL37 × 1 increases glycolysis through activation of phosphofructokinase by a calcium-dependent pathway. The dual anti-apoptotic mechanism of pUL37 × 1 may be considered a novel neuroprotective strategy in diseases where mitochondrial dysfunction and apoptotic pathways are involved. PMID:27562039

  3. Construction of a cytomegalovirus-based amplicon: a vector with a unique transfer capacity.

    PubMed

    Borst, Eva Maria; Messerle, Martin

    2003-07-01

    Cytomegalovirus (CMV) has a number of interesting properties that qualifies it as a vector for gene transfer. Especially appealing is the ability of the CMV genome to persist in hematopoietic progenitor cells and the packaging capacity of the viral capsid that accommodates a DNA genome of 230 kbp. In order to exploit the packaging capacity of the CMV capsid we investigated whether the principles of an amplicon vector can be applied to CMV. Amplicons are herpesviral vectors, which contain only the cis-active sequences required for replication and packaging of the vector genome. For construction of a CMV amplicon the sequences comprising the lytic origin of replication (orilyt) and the cleavage packaging recognition sites (pac) of human CMV were cloned onto a plasmid. A gene encoding the green fluorescent protein was used as a model transgene. The amplicon plasmid replicated in the presence of a CMV helper virus and was packaged into CMV particles, with replication and packaging being dependent on the presence of the orilyt and pac sequences. The packaged amplicon could be transferred to recipient cells and reisolated from the transduced cells. Analysis of the DNA isolated from CMV capsids revealed that the CMV amplicon was packaged as a concatemer with a size of approximately 210 kbp. The CMV amplicon vector has the potential to transfer therapeutic genes with a size of more than 200 kbp and thus provides a unique transfer capacity among viral vectors.

  4. Immunological Signaling During Herpes Simplex Virus-2 and Cytomegalovirus Vaginal Shedding After Initiation of Antiretroviral Treatment.

    PubMed

    Nason, Martha C; Patel, Eshan U; Kirkpatrick, Allison R; Prodger, Jessica L; Shahabi, Kamnoosh; Tobian, Aaron A R; Gianella, Sara; Kalibbala, Sarah; Ssebbowa, Paschal; Kaul, Rupert; Gray, Ronald H; Quinn, Thomas C; Serwadda, David; Reynolds, Steven J; Redd, Andrew D

    2016-03-01

    Vaginal proinflammatory cytokine expression during herpes virus reactivation was examined in human immunodeficiency virus-infected women before and after initiation of antiretroviral therapy (ART). Vaginal swabs were screened for levels of cytokines interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p70, IL-13, tumor necrosis factor (TNF)-α, and interferon-γ. The relative risk (RR) of herpes simplex virus-2 or cytomegalovirus (CMV) shedding being associated with cytokine levels above the median were estimated. Herpes simplex virus-2 shedding was significantly associated with higher levels of IL-6 (RR = 1.4, P = .003) and TNF-α (RR = 1.3, P = .010), whereas CMV shedding was associated with higher IL-6 (RR = 1.3, P = .006) and IL-2 (RR = 1.4, P = .01). The association of viral shedding with higher IL-6 levels suggests that herpes virus reactivation may be playing a role in immune activation after ART initiation.

  5. Interstitial pneumonia and subclinical infection after intranasal inoculation of murine cytomegalovirus.

    PubMed Central

    Jordan, M C

    1978-01-01

    Although cytomegalovirus (CMV) infections are common throughout the world, little is known about the means of person-to-person transmission. To determine whether infection could be established by a respiratory route, studies were conducted in a murine CMV (MCMV) model by using intranasal inoculation. The infectious dose which resulted in pulmonary and systemic infection of half the mice was 100 plaque-forming units of MCMV. Here, infection was subclinical, but virus replicated in the lungs and subsequently disseminated via the blood to other organs within 7 days. The serum immunofluorescence antibody titer peaked by day 21. None of these mice died, although focal peribronchial interstitial pneumonitis was found in infected animals. In mice given greater than or equal to 10(4) plaque-forming units of MCMV intranasally, severe diffuse interstitial pneumonitis resulted uniformly, closely resembling that seen in immunocompromised patients and in newborn infants, and 20% of the animals died. Normal pulmonary architecture was obliterated by sheets of histiocytes, many containing MCMV intranuclear inclusions, and by accumulation of proteinaceous fluid in the interstitial and alveolar spaces. Of relevance to human disease, these experiments show that MCMV as a sole pathogen can cause severe interstitial pneumonitis in normal mice and that subclinical systemic infection results from respiratory inoculation of small amounts of virus. Images PMID:213384

  6. Awareness of Cytomegalovirus Infection among Pregnant Women in Geneva, Switzerland: A Cross-sectional Study

    PubMed Central

    Willame, Alexia; Blanchard-Rohner, Geraldine; Combescure, Christophe; Irion, Olivier; Posfay-Barbe, Klara; Martinez de Tejada, Begoña

    2015-01-01

    Background: Cytomegalovirus (CMV) is the most frequent cause of congenital infection and commonly associated with sensorineural deficit. At present, there is neither prophylaxis nor treatment during pregnancy. The objective of this study was to evaluate the level of awareness regarding CMV infection and its consequences in women delivering at the University of Geneva Hospitals (Geneva, Switzerland). Methods: The study consisted of a validated questionnaire completed by women in the immediate postpartum period. Results: The questionnaire was completed by 59% (314/528) of delivering women. Only 39% (123/314) knew about CMV and 19.7% (62/314) had received information about preventive measures. Women were more aware about other congenital diseases, such as toxoplasmosis (87%); human immunodeficiency virus (99%); syphilis (85.5%); rubella (92.3%); and group B Streptococcus (63%). Factors associated with CMV awareness were Swiss nationality, high education level, employment in health care or with children, and being followed by an obstetrician. Regarding quality of information, few were aware of the main CMV complications (deafness, 25.2%; mental retardation, 34.5%). Among those informed about CMV, most (74.6%) knew about preventive measures. Among these, 82.5% thought that these were easily applicable. Conclusions: Most women are unaware of CMV infection and its potential risks during pregnancy. It is crucial to improve CMV information given to pregnant women to prevent the risks for the fetus/newborn. PMID:26633451

  7. Inhibition of cytomegalovirus infection and photothermolysis of infected cells using bioconjugated gold nanoparticles

    PubMed Central

    DeRussy, Bernadette M.; Aylward, Madeline A.; Fan, Zhen; Ray, Paresh C.; Tandon, Ritesh

    2014-01-01

    Human cytomegalovirus (CMV) is a herpesvirus that causes major health problems in neonates as well as in immunocompromised individuals1. At present, a vaccine is not available for CMV infection and the available antiviral drugs suffer from toxicity, poor efficacy and resistance12. Here, we chemically conjugated a monoclonal antibody raised against CMV surface glycoprotein (gB) with gold nanoparticles (GNP) and characterized the potential of this gB-GNP conjugate for antiviral activity against CMV. The gB-GNP blocks viral replication, virus-induced cytopathogenic effects and virus spread in cell culture without inducing cytotoxicity. High concentrations of gB-GNP that coat the surface of virus particles block virus entry, whereas lower concentrations block a later stage of virus life cycle. Also, cells treated with gB-GNP gain resistance to CMV infection. In addition, infected cells when bound to gB-GNP can be selectively lysed after exposing them to specific wavelength of laser (nanophotothermolysis). Thus, we have not only designed a potential antiviral strategy that specifically blocks CMV infection at multiple stages of virus life cycle, but we have also characterized a technique that can potentially be useful in eliminating CMV infected cells from donor tissue during transplant or transfusion. PMID:24989498

  8. [Cytomegalovirus-induced colitis in HIV infection. Considerations on its diagnosis, treatment and complications].

    PubMed

    Sousa, A E; Lucas, M; Palhano, M J; de Deus, J; Damião, J; Victorino, R M

    1995-04-01

    The diagnosis of cytomegalovirus intestinal disease in patients with HIV (human immunodeficiency virus) infection frequently raises diagnostic problems in view of the absence of definite pathological, serological or virological markers of active CMV infection. We describe the case of a 47-year-old man with a CMV colitis which illustrates several diagnostic and therapeutic problems and that was complicated by an intestinal perforation. We emphasize that in HIV+ patients with chronic diarrhea, the presence of abdominal pain should suggest the possibility of a CMV colitis and that in such cases a colonoscopy with biopsies of the right colon should be performed, in view of the higher frequency of the typical histopathological changes at this level. On the other hand, this case presented a marked thickening of the colon wall, simulating pseudotumoral images on CAT scans, as recently described in literature. The therapeutic possibilities as well as the complications of CMV colitis are discussed in the context of the occurrence of an ileal perforation, which represents the first report of this complication in Portuguese literature and which had the particularity of having a long survival after surgery in comparison with the previous cases described in international literature.

  9. Targeting the latent cytomegalovirus reservoir with an antiviral fusion toxin protein

    PubMed Central

    Krishna, B. A.; Spiess, K.; Poole, E. L.; Lau, B.; Voigt, S.; Kledal, T. N.; Rosenkilde, M. M.; Sinclair, J. H.

    2017-01-01

    Reactivation of human cytomegalovirus (HCMV) in transplant recipients can cause life-threatening disease. Consequently, for transplant recipients, killing latently infected cells could have far-reaching clinical benefits. In vivo, myeloid cells and their progenitors are an important site of HCMV latency, and one viral gene expressed by latently infected myeloid cells is US28. This viral gene encodes a cell surface G protein-coupled receptor (GPCR) that binds chemokines, triggering its endocytosis. We show that the expression of US28 on the surface of latently infected cells allows monocytes and their progenitor CD34+ cells to be targeted and killed by F49A-FTP, a highly specific fusion toxin protein that binds this viral GPCR. As expected, this specific targeting of latently infected cells by F49A-FTP also robustly reduces virus reactivation in vitro. Consequently, such specific fusion toxin proteins could form the basis of a therapeutic strategy for eliminating latently infected cells before haematopoietic stem cell transplantation. PMID:28148951

  10. Comparative analysis of NK cell receptor repertoire in adults and very elderly subjects with cytomegalovirus infection.

    PubMed

    Juárez-Vega, Guillermo; Rangel-Ramírez, Velia; Monsiváis-Urenda, Adriana; Niño-Moreno, Perla; Garcia-Sepúlveda, Christian; Noyola, Daniel E; González-Amaro, Roberto

    2017-01-16

    Human cytomegalovirus (HCMV) infection in children and young adults has been associated with changes in the innate immune system. We herein analyzed the possible effect of very long term HCMV infection on the expression of several NK cell receptors. Ninety HCMV-seropositive individuals were included and classified as young adults (n=30), elderly (n=30) and very elderly subjects (n=30). A peripheral blood sample was obtained and the expression of NK cell receptors (NKG2A, NKG2C, ILT2, CD161, KIR2DL1, KIR3DL1, and KIR3DL2) by NK and other lymphocyte subsets was assessed by flow cytometry. In addition, the frequency of the sixteen KIR genes was analyzed by polymerase chain reaction. We found a significant increase in the number of NKG2C+ NK and T cells in elderly individuals compared to young adults accompanied by an opposite trend in the number of NKG2A+ lymphocytes, and ILT2+ cells were also increased in elderly individuals. A significant increase in the levels of CD3-CD56+NKG2C+CD57+ cells was also detected in the elderly groups. Finally, KIR gene analysis revealed that the KIR genotype 2 was significantly less frequent in the elderly individuals. Our results support that long-term infection by HCMV exerts a significant progressive effect on the innate immune system.

  11. Novel Chemokine-Based Immunotoxins for Potent and Selective Targeting of Cytomegalovirus Infected Cells.

    PubMed

    Spiess, Katja; Jeppesen, Mads G; Malmgaard-Clausen, Mikkel; Krzywkowski, Karen; Kledal, Thomas N; Rosenkilde, Mette M

    2017-01-01

    Immunotoxins as antiviral therapeutics are largely unexplored but have promising prospective due to their high selectivity potential and their unparalleled efficiency. One recent example targeted the virus-encoded G protein-coupled receptor US28 as a strategy for specific and efficient treatment of human cytomegalovirus (HCMV) infections. US28 is expressed on virus-infected cells and scavenge chemokines by rapid internalization. The chemokine-based fusion-toxin protein (FTP) consisted of a variant (F49A) of CX3CL1 specifically targeting US28 linked to the catalytic domain of Pseudomonas exotoxin A (PE). Here, we systematically seek to improve F49A-FTP by modifications in its three structural domains; we generated variants with (1) altered chemokine sequence (K14A, F49L, and F49E), (2) shortened and elongated linker region, and (3) modified toxin domain. Only F49L-FTP displayed higher selectivity in its binding to US28 versus CX3CR1, the endogenous receptor for CX3CL1, but this was not matched by a more selective killing of US28-expressing cells. A longer linker and different toxin variants decreased US28 affinity and selective killing. Thereby, F49A-FTP represents the best candidate for HCMV treatment. Many viruses encode internalizing receptors suggesting that not only HCMV but also, for instance, Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus may be targeted by FTPs.

  12. Clinical significance of cytomegalovirus infection in patients with inflammatory bowel disease.

    PubMed

    Garrido, Elena; Carrera, Elisa; Manzano, Rebeca; Lopez-Sanroman, Antonio

    2013-01-07

    Cytomegalovirus (CMV) infection is common in humans. The virus then enters a "latency phase" and can reactivate to different stimuli such as immunosuppression. The clinical significance of CMV infection in inflammatory bowel disease is different in Crohn's disease (CD) and ulcerative colitis (UC). CMV does not interfere in the clinical course of CD. However, CMV reactivation is frequent in severe or steroid-resistant UC. It is not known whether the virus exacerbates the disease or simply appears as a bystander of a severe disease. Different methods are used to diagnose CMV colitis. Diagnosis is classically based on histopathological identification of viral-infected cells or CMV antigens in biopsied tissues using haematoxylin-eosin or immunohistochemistry, other tests on blood or tissue samples are currently being investigated. Polymerase chain reaction performed in colonic mucosa has a high sensitivity and a positive result could be associated with a worse prognosis disease; further studies are needed to determine the most appropriate strategy with positive CMV-DNA in colonic mucosa. Specific endoscopic features have not been described in active UC and CMV infection. CMV colitis is usually treated with ganciclovir for several weeks, there are different opinions about whether or not to stop immunosuppressive therapy. Other antiviral drugs may be used. Multicenter controlled studies would needed to determine which subgroup of UC patients would benefit from early antiviral treatment.

  13. Factors affecting the detection of cytomegalovirus in urine by sandwich enzyme immunoassays.

    PubMed

    el-Mekki, A; Al-Nakib, W; Bibi, R

    1987-01-01

    Some factors influencing the detection of human cytomegalovirus (HCMV) in urine were investigated employing 2 enzyme-linked immunosorbent assays (ELISAs); one utilised anti-CMV DNA polymerase while the other anti-CMV mouse monoclonals as the detecting antibodies. The use of anti-CMV DNA polymerase was found to be superior in detecting HCMV in both urine and tissue culture fluids than anti-CMV monoclonals. Furthermore, alkaline phosphatase conjugates produced much lower background than did peroxidase conjugates. In reconstruction experiments, the extremes of pH in the urine clearly had an adverse effect on the detection rate of extracellular virus. pH correction of urines to neutrality improved the detection rate considerably. On the other hand, pH correction had little effect on the detection rate of intracellular HCMV in urine, although it was improved when specimens were subjected to repeated cycles of freeze-thawing, ultrasonication, and storage at 4 degrees C. It was concluded that, in addition to the factors investigated which all appear to affect virus detection rate, there may well be additional factors that interfere with CMV detection in the urine by ELISA particularly with intracellular virus.

  14. Construction and Evaluation of Cytomegalovirus DNA Quantification System with Real-Time Detection Polymerase Chain Reaction

    PubMed Central

    Hatayama, Yuki; Hashimoto, Yuki; Hara, Ayako; Motokura, Toru

    2016-01-01

    Background For patients with reactivation of human cytomegalovirus (CMV), a highly sensitive and accurate CMV quantification system is essential to monitor viral load. Methods We constructed a real-time detection PCR (RTD-PCR) system for CMV DNA and evaluated its linearity, lower detection limit, dynamic range and accuracy using two CMV standards. We used 219 clinical samples derived from 101 patients to compare the system with the pp65 antigen test. Results The 95% detection limit was determined to be 556 IU/mL (95% CI, 440–797 IU/mL), and the quantification range was between 102 and 106 copies or IU/mL (r = 0.996, 0.999, respectively). The coefficients of variation of inter-assay reproducibility assessed in each three different runs were 2.5% at 1,000 IU/mL and 1.6% at 10,000 IU/mL. The coefficients of variation of intra-assay variability by testing the same samples three times in a single run were 1.8–3.6% and 0.4–1.9%, respectively. The concordance between antigenemia and plasma or serum CMV DNA levels was a good correlation (r = 0.695, P < 0.01). Conclusion We constructed the RTD-PCR system which enables accurate evaluation of CMV reactivation by monitoring of viral load in immunosuppressed or immunocompromised patients. PMID:27708537

  15. Diagnosis of children’s attention deficit hyperactivity disorder (ADHD) and its association with cytomegalovirus infection with ADHD: a historical review

    PubMed Central

    Zhou, Rui; Xia, Qun; Shen, Huaiyun; Yang, Xiaoyun; Zhang, Yongli; Xu, Jiali

    2015-01-01

    As the most common mental disorder identified in children and teenagers, attention deficit hyperactivity disorder (ADHD) affects millions of children and their families, making it a critical health issue worldwide. This article reviewed the historical opinions about the diagnosis of ADHD and defined different subtypes of this disorder. It also summarized the current diagnostic criteria and available medications. After re-visiting the etiology of ADHD in the sense of both genetic and environment factors, it was further hypothesized that viral infection might be involved in ADHD pathogenesis. Human cytomegalovirus (HCMV) infection may be associated with ADHD, although both clinical observations and animal studies need to be performed for validation. PMID:26550354

  16. Reevaluation of the Coding Potential and Proteomic Analysis of the BAC Derived Rhesus Cytomegalovirus Strain 68-1

    SciTech Connect

    Malouli, Daniel; Nakayasu, Ernesto S.; Viswanathan, Kasinath; Camp, David G.; Chang, W. L.; Barry, Peter A.; Smith, Richard D.; Fruh, Klaus

    2012-09-01

    Cytomegaloviruses are highly host restricted resulting in co-speciation with their hosts. As a natural pathogen of rhesus macaques (RM), Rhesus Cytomegalovirus (RhCMV) has therefore emerged as a highly relevant experimental model for pathogenesis and vaccine development due to its close evolutionary relationship to human CMV (HCMV). To date, most in vivo experiments performed with RhCMV employed strain 68-1 cloned as bacterial artificial chromosome (BAC). However, the complete genome sequence of the 68-1 BAC has not been determined. Furthermore, the gene content of the RhCMV genome is unknown and previous open reading frame (ORF) predictions relied solely on uninterrupted ORFs with an arbitrary cutoff of 300bp. To obtain a more precise picture of the actual proteins encoded by the most commonly used molecular clone of RhCMV we re-evaluated the RhCMV 68-1 BAC-genome by whole genome shotgun sequencing and determined the protein content of the resulting RhCMV virions by proteomics. By additionally comparing the RhCMV genome to that of several closely related Old World Monkey (OWM) CMVs we were able to filter out many unlikely ORFs and obtain a simplified map of the RhCMV genome. This comparative genomics analysis eliminated many genes previously characterized as RhCMV-specific while consolidating a high conservation of ORFs among OWM-CMVs and between RhCMV and HCMV. Moreover, virion proteomics independently validated the revised ORF predictions since only proteins encoded by predicted ORFs could be detected. Taken together these data suggest a much higher conservation of genome and virion structure between CMVs of humans, apes and OWMs than previously assumed. Remarkably, BAC-derived RhCMV is able to establish and maintain persistent infection despite the lack of multiple genes homologous to HCMV genes involved in tissue tropism.

  17. Murine cytomegalovirus infection of mouse macrophages stimulates early expression of suppressor of cytokine signaling (SOCS)1 and SOCS3

    PubMed Central

    Alston, Christine I.; Dix, Richard D.

    2017-01-01

    Human cytomegalovirus (HCMV) is a species-specific β-herpesvirus that infects for life up to 80% of the world’s population and causes severe morbidity in at-risk immunocompromised populations. Suppressors of cytokine signaling (SOCS)1 and SOCS3 are host proteins that act as inducible negative feedback regulators of cytokine signaling and have been implicated in several ocular diseases and viral infections. We recently found in our mouse model of experimental cytomegalovirus retinitis that subretinally-injected murine cytomegalovirus (MCMV) stimulates ocular SOCS1 and SOCS3 during retrovirus-induced immune suppression of murine AIDS (MAIDS), and that infiltrating macrophages are prominent cellular sources of retinal SOCS1 and SOCS3 expression. Herein we investigate possible virologic mechanisms whereby MCMV infection may stimulate SOCS1 and/or SOCS3 expression in cell culture. We report that infection of IC-21 mouse macrophages with MCMV propagated through the salivary glands of BALB/c mice, but not from tissue culture in C57BL/6 fibroblasts, transiently stimulates SOCS1 and SOCS3 mRNA transcripts, but not SOCS5 mRNA. Viral tegument proteins are insufficient for this stimulation, as replication-d