Sample records for human cytomegalovirus ie1

  1. Human Cytomegalovirus IE1 Protein Disrupts Interleukin-6 Signaling by Sequestering STAT3 in the Nucleus

    PubMed Central

    Reitsma, Justin M.; Sato, Hiromi; Nevels, Michael


    In the canonical STAT3 signaling pathway, binding of agonist to receptors activates Janus kinases that phosphorylate cytoplasmic STAT3 at tyrosine 705 (Y705). Phosphorylated STAT3 dimers accumulate in the nucleus and drive the expression of genes involved in inflammation, angiogenesis, invasion, and proliferation. Here, we demonstrate that human cytomegalovirus (HCMV) infection rapidly promotes nuclear localization of STAT3 in the absence of robust phosphorylation at Y705. Furthermore, infection disrupts interleukin-6 (IL-6)-induced phosphorylation of STAT3 and expression of a subset of IL-6-induced STAT3-regulated genes, including SOCS3. We show that the HCMV 72-kDa immediate-early 1 (IE1) protein associates with STAT3 and is necessary to localize STAT3 to the nucleus during infection. Furthermore, expression of IE1 is sufficient to disrupt IL-6-induced phosphorylation of STAT3, binding of STAT3 to the SOCS3 promoter, and SOCS3 gene expression. Finally, inhibition of STAT3 nuclear localization or STAT3 expression during infection is linked to diminished HCMV genome replication. Viral gene expression is also disrupted, with the greatest impact seen following viral DNA synthesis. Our study identifies IE1 as a new regulator of STAT3 intracellular localization and IL-6 signaling and points to an unanticipated role of STAT3 in HCMV infection. PMID:23903834

  2. Physical requirements and functional consequences of complex formation between the cytomegalovirus IE1 protein and human STAT2.


    Krauss, Steffen; Kaps, Julia; Czech, Nathalie; Paulus, Christina; Nevels, Michael


    Our previous work has shown that efficient evasion from type I interferon responses by human cytomegalovirus (hCMV) requires expression of the 72-kDa immediate-early 1 (IE1) protein. It has been suggested that IE1 inhibits interferon signaling through intranuclear sequestration of the signal transducer and activator of transcription 2 (STAT2) protein. Here we show that physical association and subnuclear colocalization of IE1 and STAT2 depend on short acidic and serine/proline-rich low-complexity motifs in the carboxy-terminal region of the 491-amino-acid viral polypeptide. These motifs compose an essential core (amino acids 373 to 420) and an adjacent ancillary site (amino acids 421 to 445) for STAT2 interaction that are predicted to form part of a natively unstructured domain. The presence of presumably "disordered" carboxy-terminal domains enriched in low-complexity motifs is evolutionarily highly conserved across all examined mammalian IE1 orthologs, and the murine cytomegalovirus IE1 protein appears to interact with STAT2 just like the human counterpart. A recombinant hCMV specifically mutated in the IE1 core STAT2 binding site displays hypersensitivity to alpha interferon, delayed early viral protein accumulation, and attenuated growth in fibroblasts. However, replication of this mutant virus is specifically restored by knockdown of STAT2 expression. Interestingly, complex formation with STAT2 proved to be entirely separable from disruption of nuclear domain 10 (ND10), another key activity of IE1. Finally, our results demonstrate that IE1 counteracts the antiviral interferon response and promotes viral replication by at least two distinct mechanisms, one depending on sequestration of STAT2 and the other one likely involving ND10 interaction. PMID:19812155

  3. N-terminal determinants of human cytomegalovirus IE1 protein in nuclear targeting and disrupting PML-associated subnuclear structures

    SciTech Connect

    Lee, Hye-Ra; Huh, Yong Ho; Kim, Young-Eui; Lee, Karim; Kim, Sunyoung; Ahn, Jin-Hyun . E-mail:


    The 72-kDa IE1 protein of human cytomegalovirus disrupts PML-associated subnuclear structures (PODs) by inducing PML desumoylation. This process correlates with the functions of IE1 in transcriptional regulation and efficient viral replication. Here, we defined the N-terminal regions of IE1 required for nuclear targeting and POD-disrupting activity. Although the 24 N-terminal amino acids encoded by exon 2, which were previously shown to be essential for nuclear targeting, did not appear to contain typical basic nuclear localization signals, these residues were able to efficiently convey the GFP protein into the nucleus, suggesting a role in promoting nuclear translocation. In assays using a series of N-terminal truncation IE1 mutants, which were forced to enter the nucleus, exon 2 was completely dispensable for POD disruption. However, the predicted two {alpha}-helix regions in exon 3 were identified as important structural determinants for protein stability and for the correlating activities in POD disruption and PML desumoylation.

  4. Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones specifically activated by IE1 peptides in vitro.

    PubMed Central

    Davignon, J L; Castanié, P; Yorke, J A; Gautier, N; Clément, D; Davrinche, C


    The control of latent cytomegalovirus (CMV) infections by the immune system is poorly understood. We have previously shown that CD4+ T cells specific for the human CMV major regulatory protein IE1 are frequent in latently infected healthy blood donors. In order to learn about the possible role of these cells, we have developed IE1-specific CD4+ T-cell clones and, in this study, analyzed their epitope specificity and function in vitro. We measured their cytokine production when stimulated with specific IE1 peptides or whole recombinant IE1 protein. Their cytokine profiles, as deduced from gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), and interleukin-4 (IL-4) and IL-6 production, were of the Th0- and Th1-like phenotypes. Supernatants from IE1-specific clones producing IFN-gamma and TNF-alpha were shown to inhibit CMV replication in U373 MG cells. This effect was due, as found by using cytokine-specific neutralizing antibodies, mostly to IFN-gamma, which was secreted at higher levels than TNF-alpha. To better assess the anti-CMV activity of cytokines, recombinant IFN-gamma and TNF-alpha were used and shown to have a synergistic effect on the inhibition of CMV replication and protein expression. Thus, IE1-specific CD4+ T cells display in vitro anti-CMV activity through cytokine secretion and may play a role in the control of in vivo latent infections. PMID:8642638

  5. Characterization of Recombinant Human Cytomegaloviruses Encoding IE1 Mutants L174P and 1-382 Reveals that Viral Targeting of PML Bodies Perturbs both Intrinsic and Innate Immune Responses

    PubMed Central

    Scherer, Myriam; Otto, Victoria; Stump, Joachim D.; Klingl, Stefan; Müller, Regina; Reuter, Nina; Muller, Yves A.; Sticht, Heinrich


    ABSTRACT PML is the organizer of cellular structures termed nuclear domain 10 (ND10) or PML-nuclear bodies (PML-NBs) that act as key mediators of intrinsic immunity against human cytomegalovirus (HCMV) and other viruses. The antiviral function of ND10 is antagonized by viral regulatory proteins such as the immediate early protein IE1 of HCMV. IE1 interacts with PML through its globular core domain (IE1CORE) and induces ND10 disruption in order to initiate lytic HCMV infection. Here, we investigate the consequences of a point mutation (L174P) in IE1CORE, which was shown to abrogate the interaction with PML, for lytic HCMV infection. We found that a recombinant HCMV encoding IE1-L174P displays a severe growth defect similar to that of an IE1 deletion virus. Bioinformatic modeling based on the crystal structure of IE1CORE suggested that insertion of proline into the highly alpha-helical domain severely affects its structural integrity. Consistently, L174P mutation abrogates the functionality of IE1CORE and results in degradation of the IE1 protein during infection. In addition, our data provide evidence that IE1CORE as expressed by a recombinant HCMV encoding IE1 1-382 not only is required to antagonize PML-mediated intrinsic immunity but also affects a recently described function of PML in innate immune signaling. We demonstrate a coregulatory role of PML in type I and type II interferon-induced gene expression and provide evidence that upregulation of interferon-induced genes is inhibited by IE1CORE. In conclusion, our data suggest that targeting PML by viral regulatory proteins represents a strategy to antagonize both intrinsic and innate immune mechanisms. IMPORTANCE PML nuclear bodies (PML-NBs), which represent nuclear multiprotein complexes consisting of PML and additional proteins, represent important cellular structures that mediate intrinsic resistance against many viruses, including human cytomegalovirus (HCMV). During HCMV infection, the major immediate

  6. Crystal Structure of Cytomegalovirus IE1 Protein Reveals Targeting of TRIM Family Member PML via Coiled-Coil Interactions

    PubMed Central

    Sevvana, Madhumati; Otto, Victoria; Schilling, Eva-Maria; Stump, Joachim D.; Müller, Regina; Reuter, Nina; Sticht, Heinrich; Muller, Yves A.; Stamminger, Thomas


    PML nuclear bodies (PML-NBs) are enigmatic structures of the cell nucleus that act as key mediators of intrinsic immunity against viral pathogens. PML itself is a member of the E3-ligase TRIM family of proteins that regulates a variety of innate immune signaling pathways. Consequently, viruses have evolved effector proteins to modify PML-NBs; however, little is known concerning structure-function relationships of viral antagonists. The herpesvirus human cytomegalovirus (HCMV) expresses the abundant immediate-early protein IE1 that colocalizes with PML-NBs and induces their dispersal, which correlates with the antagonization of NB-mediated intrinsic immunity. Here, we delineate the molecular basis for this antagonization by presenting the first crystal structure for the evolutionary conserved primate cytomegalovirus IE1 proteins. We show that IE1 consists of a globular core (IE1CORE) flanked by intrinsically disordered regions. The 2.3 Å crystal structure of IE1CORE displays an all α-helical, femur-shaped fold, which lacks overall fold similarity with known protein structures, but shares secondary structure features recently observed in the coiled-coil domain of TRIM proteins. Yeast two-hybrid and coimmunoprecipitation experiments demonstrate that IE1CORE binds efficiently to the TRIM family member PML, and is able to induce PML deSUMOylation. Intriguingly, this results in the release of NB-associated proteins into the nucleoplasm, but not of PML itself. Importantly, we show that PML deSUMOylation by IE1CORE is sufficient to antagonize PML-NB-instituted intrinsic immunity. Moreover, co-immunoprecipitation experiments demonstrate that IE1CORE binds via the coiled-coil domain to PML and also interacts with TRIM5α We propose that IE1CORE sequesters PML and possibly other TRIM family members via structural mimicry using an extended binding surface formed by the coiled-coil region. This mode of interaction might render the antagonizing activity less susceptible to

  7. Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells

    PubMed Central

    Yu, Yuefei; Pilgrim, Petra; Yan, Juqiang; Zhou, Wei; Jenkins, Marjorie; Gagliano, Nicoletta; Bumm, Klaus; Cannon, Martin; Milzani, Aldo; Dalle-Donne, Isabella; Kast, W Martin; Cobos, Everardo; Chiriva-Internati, Maurizio


    Background Recent studies demonstrate that recombinant adeno-associated virus (rAAV)-based antigen loading of dendritic cells (DCs) generates in vitro, significant and rapid cytotoxic T-lymphocyte (CTL) responses against viral antigens. Methods We used the rAAV system to induce specific CTLs against CVM antigens for the development of cytomegalovirus HCMV) gene therapy. As an extension of the versatility of the rAAV system, we incorporated immediate-early 1 (IE1), expressed in HCMV. Our rAAV vector induced a strong stimulation of CTLs directed against the HCMV antigen IE1. We then investigated the efficiency of the CTLs in killing IE1 targeted cells. Results A significant MHC Class I-restricted, anti-IE1-specific CTL killing was demonstrated against IE1 positive peripheral blood mononuclear cells (PBMC) after one, in vitro, stimulation. Conclusion In summary, single PBMC stimulation with rAAV/IE1 pulsed DCs induces strong antigen specific-CTL generation. CTLs were capable to lyse low doses of peptides pulsed into target cells. These data suggest that AAV-based antigen loading of DCs is highly effective for generating human CTL responses against HCMV antigens. PMID:18834548

  8. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.


    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A


    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell. PMID:26143921

  9. Human Cytomegalovirus Inhibits Erythropoietin Production

    PubMed Central

    Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia


    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients. PMID:24722450

  10. Human cytomegalovirus induces JC virus DNA replication in human fibroblasts.

    PubMed Central

    Heilbronn, R; Albrecht, I; Stephan, S; Bürkle, A; zur Hausen, H


    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248262

  11. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K


    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  12. Animal cytomegaloviruses.

    PubMed Central

    Staczek, J


    Cytomegaloviruses are agents that infect a variety of animals. Human cytomegalovirus is associated with infections that may be inapparent or may result in severe body malformation. More recently, human cytomegalovirus infections have been recognized as causing severe complications in immunosuppressed individuals. In other animals, cytomegaloviruses are often associated with infections having relatively mild sequelae. Many of these sequelae parallel symptoms associated with human cytomegalovirus infections. Recent advances in biotechnology have permitted the study of many of the animal cytomegaloviruses in vitro. Consequently, animal cytomegaloviruses can be used as model systems for studying the pathogenesis, immunobiology, and molecular biology of cytomegalovirus-host and cytomegalovirus-cell interactions. PMID:2170830

  13. Diverse immune evasion strategies by human cytomegalovirus.


    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico


    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  14. An animal model of human cytomegalovirus infection.


    Gao, L; Qian, S; Zeng, L; Wang, R; Wei, G; Fan, J; Zheng, S


    To develop a rat model that allowed in vivo progressive human cytomegalovirus (HCMV) infection, allogeneic liver transplantation was performed across a rat combination of Dark Agouti (DA) to Brown Norway (BN). AD169, a well-characterized laboratory strain of HCMV, was used to establish a rat model of HCMV infection by injection of 0.4 mL (30.0 logTCID50) supernate into the rat peritoneum. Histological and blood specimens were obtained from animals sacrificed at predetermined timepoints. We performed immunohistochemical staining in liver, heart, kidney, spleen, and lung for HCMV immediate-early antigen (IE), lower matrix protein (pp65) detection in peripheral blood leukocytes, and HCMV early antigen (EA) and late antigen (LA). We compared survival rates. Our results showed positive HCMV IE and pp65 antigenemia detected in peripheral blood leukocytes in transplanted recipients from day 1 to day 30. Positive HCMV EA and LA staining cells were only detected in sections 10 days after liver transplantation, namely, in hepatocytes, mononuclear cells, bile duct epithelial cells, and endothelial cells. Successful HCMV replication was due to the combination of liver transplantation and cyclosporine (CsA) immunosuppression. Survival analysis showed no significant differences between the HCMV-infected group and HCMV-uninfected group. This new rat model of HCMV infection may be helpful to understand immune system modulation of HCMV infection. PMID:18089401

  15. A Diverse Repertoire of CD4 T Cells Targets the Immediate-Early 1 Protein of Human Cytomegalovirus

    PubMed Central

    Ameres, Stefanie; Liang, Xiaoling; Wiesner, Martina; Mautner, Josef; Moosmann, Andreas


    T-cell responses to the immediate-early 1 (IE-1) protein of human cytomegalovirus (HCMV) are associated with protection from viral disease. Thus, IE-1 is a promising target for immunotherapy. CD8 T-cell responses to IE-1 are generally strong. In contrast, CD4 T-cell responses to IE-1 were described to be comparatively infrequent or undetectable in HCMV carriers, and information on their target epitopes and their function has been limited. To analyze the repertoire of IE-1-specific CD4 T cells, we expanded them from healthy donors with autologous IE-1-expressing mini-Epstein–Barr virus-transformed B-cell lines and established IE-1-specific CD4 T-cell clones. Clones from seven out of seven HCMV-positive donors recognized endogenously processed IE-1 epitopes restricted through HLA-DR, DQ, or DP. Three to seven IE-1 epitopes were recognized per donor. Cumulatively, about 27 different HLA/peptide class II complexes were recognized by 117 IE-1-specific clones. Our results suggest that a highly diversified repertoire of IE-1-specific CD4 T cells targeting multiple epitopes is usually present in healthy HCMV carriers. Therefore, multiepitope approaches to immunomonitoring and immunotherapy will make optimal use of this potentially important class of HCMV-specific effector cells. PMID:26635812

  16. Peptide inhibition of human cytomegalovirus infection

    PubMed Central


    Background Human cytomegalovirus (HCMV) is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV)- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB), a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS), several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF) were infected with the Towne-GFP strain of HCMV (0.5 MOI), preincubated with peptides at a range of concentrations (78 nm to 100 μM), and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100 μM and 50 μM, respectively

  17. Infrequency of cytomegalovirus genome in coronary arteriopathy of human heart allografts.

    PubMed Central

    Gulizia, J. M.; Kandolf, R.; Kendall, T. J.; Thieszen, S. L.; Wilson, J. E.; Radio, S. J.; Costanzo, M. R.; Winters, G. L.; Miller, L. L.; McManus, B. M.


    In heart transplantation, long-term engraftment success is severely limited by the rapid development of obliterative disease of the coronary arteries. Data from various groups have been suggestive of a pathogenetic role of herpesviruses, particularly human cytomegalovirus, in accelerated allograft coronary artery disease; however, results are not yet conclusive. This study examines the hypothesis that human cytomegalovirus infection of allograft tissues is related pathogenetically and directly to accelerated coronary artery disease. Using in situ DNA hybridization and polymerase chain reaction, we examined particular coronary artery segments from 41 human heart allografts (ranging from 4 days to greater than 4 years after transplantation; mean, 457 days) and 22 donor age- and gender-comparable, coronary site-matched trauma victims for presence of human cytomegalovirus DNA. Human cytomegalovirus genome was detected in 8 of 41 (19.5%) allografts and in 1 of 22 (4.5%) control hearts. This difference in positivity was not statistically significant (P = 0.10). In the human cytomegalovirus-positive hearts, viral genome was localized to perivascular myocardium or coronary artery media or adventitia. Human cytomegalovirus genome was not detected in arterial intima of any allograft or control heart, although human cytomegalovirus genome was readily identified within intima of small pulmonary arteries from lung tissue with human cytomegalovirus pneumonitis. By statistical analyses, the presence of human cytomegalovirus genome was not associated with the nature or digitized extent of transplant arteriopathy, evidence of rejection, allograft recipient or donor serological data suggestive of human cytomegalovirus infection, duration of allograft implantation, or causes of death or retransplantation. Thus, our data indicate a low frequency of detectable human cytomegalovirus genome in accelerated coronary artery disease and do not support a direct role for human cytomegalovirus

  18. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi


    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  19. Cutaneous Co-infected Cytomegalovirus and Herpes Simplex Virus Perigenital Ulcers in Human Immunodeficiency Virus Patients.


    Schoenfeld, Jason; Cannon, Sarah; Cam, Kristin; Keller, Matthew


    There is uncertainty regarding the pathogenic nature of cytomegalovirus in cutaneous lesions co-infected with herpes simplex virus. It is widely believed that herpes simplex virus is the main pathogenic factor in such lesions and that cytomegalovirus plays little if any role. There are, however, isolated case reports that describe cytomegalovirus as an important driving pathogen in such lesions. The authors present two human immunodeficiency virus patients who have cytomegalovirus and herpes simplex virus co-infected perigenital ulcers, one of whom improved on valacyclovir, while the other, who was already on valacyclovir for chronic herpes simplex virus suppression, showed no improvement with a single dose of cidofovir. He only showed rapid improvement when treated with valganciclovir. The latter patient underscores the viewpoint that at least in some cases, cytomegalovirus may be an important driving force behind the formation of such lesions. The authors therefore recommend that clinicians be aware of the possible pathogenic role of cytomegalovirus in these ulcers, and, in nonhealing ulcers, use anti-cytomegalovirus agents to prevent the onset of systemic disease. These results warrant further study of the pathogenesis of cytomegalovirus in co-infected herpes simplex virus ulcers. PMID:24155993

  20. Autoimmunity induced by human cytomegalovirus in patients with systemic lupus erythematosus

    PubMed Central


    Human cytomegalovirus is a common herpesvirus that is linked to autoimmunity, especially in genetically predisposed persons. The article by Hsieh and colleagues in a previous issue of Arthritis Research & Therapy suggests that a C-terminal peptide of the human cytomegalovirus protein pp65 is highly immunogenic in patients with systemic lupus erythematosus and that antibodies against this peptide cross-react with nuclear proteins and double-stranded DNA, which are highly frequent autoantibodies in systemic lupus erythematosus patients. These observations highlight the fact that immunization with one small cytomegalovirus-specific peptide results in multiple autoreactive antibodies, probably through molecular mimicry and epitope spreading, in genetically predisposed persons. PMID:22277352

  1. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.


    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  2. Acute Human Cytomegalovirus Infection with Bleeding in Iran

    PubMed Central

    Pourhossein, Behzad; Yaghmaei, Farhad; Esmaeili, Saber; Banafshi, Omid; Afrasiabian, Shahla; Shirzadi, Mohammad Reza; Schleiss, Mark; Mostafavi, Ehsan


    In December 2011, a 42-year-old male farmer was admitted to a hospital in Sanandaj (Western Iran) with fever and anemia in order to check whether he suffered from some infectious diseases. During the first 3 days after admission, the patient gradually developed progressive oliguria, fever, abdominal pain in the right upper quadrant, leukocytosis with toxic granulation, petechiae and ecchymosis, oral bleeding, and vomiting. The sonographic findings revealed splenomegaly and an increase in the thickness of the gall bladder wall. In order to manage the patient and taking into consideration the most probable differential diagnoses, diagnostic tests were performed on two blood samples collected from him, and real-time polymerase chain reaction for human cytomegalovirus was positive. PMID:25562049

  3. Is human cytomegalovirus associated with breast cancer progression?

    PubMed Central


    Background It has been hypothesized that human cytomegalovirus (HCMV) may be associated with breast cancer progression. However, the role of HCMV infection in breast cancer remains controversial. We aimed to assess whether HCMV genes (UL122 and UL83) could be detected in breast carcinomas and reinvestigated their possible association with breast cancer progression. DNA from paraffin-embedded tissues was analyzed by real-time PCR. We investigated 20 fibroadenomas and 27 primary breast carcinomas (stages II, III, and IV). Findings Two carcinomas were positive for HCMV, one was positive for two TaqMan viral detection probes, and one was positive for a sole TaqMan viral detection probe (UL83), whereas the remainder of the samples was negative. Conclusions Samples studied showed no association between HCMV infection and breast cancer progression. PMID:23557440

  4. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.


    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg


    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity. PMID:27595792

  5. Positive Role of Promyelocytic Leukemia Protein in Type I Interferon Response and Its Regulation by Human Cytomegalovirus

    PubMed Central

    Kim, Young-Eui; Ahn, Jin-Hyun


    Promyelocytic leukemia protein (PML), a major component of PML nuclear bodies (also known as nuclear domain 10), is involved in diverse cellular processes such as cell proliferation, apoptosis, gene regulation, and DNA damage response. PML also acts as a restriction factor that suppresses incoming viral genomes, therefore playing an important role in intrinsic defense. Here, we show that PML positively regulates type I interferon response by promoting transcription of interferon-stimulated genes (ISGs) and that this regulation by PML is counteracted by human cytomegalovirus (HCMV) IE1 protein. Small hairpin RNA-mediated PML knockdown in human fibroblasts reduced ISG induction by treatment of interferon-β or infection with UV-inactivated HCMV. PML was required for accumulation of activated STAT1 and STAT2, interacted with them and HDAC1 and HDAC2, and was associated with ISG promoters after HCMV infection. During HCMV infection, viral IE1 protein interacted with PML, STAT1, STAT2, and HDACs. Analysis of IE1 mutant viruses revealed that, in addition to the STAT2-binding domain, the PML-binding domain of IE1 was necessary for suppression of interferon-β-mediated ISG transcription, and that IE1 inhibited ISG transcription by sequestering interferon-stimulated gene factor 3 (ISGF3) in a manner requiring its binding of PML and STAT2, but not of HDACs. In conclusion, our results demonstrate that PML participates in type I interferon-induced ISG expression by regulating ISGF3, and that this regulation by PML is counteracted by HCMV IE1, highlighting a widely shared viral strategy targeting PML to evade intrinsic and innate defense mechanisms. PMID:25812002

  6. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.


    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  7. Cytomegalovirus Replicates in Differentiated but not in Undifferentiated Human Embryonal Carcinoma Cells

    NASA Astrophysics Data System (ADS)

    Gonczol, Eva; Andrews, Peter W.; Plotkin, Stanley A.


    To study the mode of action of human cytomegalovirus, an important teratogenic agent in human populations, the susceptibility of a pluripotent human embryonal carcinoma cell line to the virus was investigated. Viral antigens were not expressed nor was infectious virus produced by human embryonal carcinoma cells after infection, although the virus was able to penetrate these cells. In contrast, retinoic acid-induced differentiated derivatives of embryonal carcinoma cells were permissive for antigen expression and infectious virus production. Replication of human cytomegalovirus in human teratocarcinoma cells may therefore depend on cellular functions associated with differentiation.

  8. Human cytomegalovirus (CMV) in Africa: a neglected but important pathogen.


    Bates, Matthew; Brantsaeter, Arne Broch


    In Africa, human cytomegalovirus (CMV) is an important pathogen in a diverse range of patient groups. Congenital CMV infection is common, and most children undergo primary infection during the first year of life. Preliminary studies suggest that these early primary CMV infections could have population-wide effects on growth and development. In most studies of adults, CMV seroprevalence is close to 100%, but some studies have found that significant minorities of adults are seronegative. CMV is a common cause of pneumonia and meningitis in hospitalised immunosuppressed patient groups, and CMV DNAemia may be an important marker of rapid progression and poor outcomes of HIV infection, despite roll-out of antiretroviral therapy (ART). Diagnosis and treatment of CMV-related disease is broadly neglected in Africa, and no randomised clinical trials of anti-CMV drugs have been conducted to date. Autopsy is rarely performed in Africa, but identifies CMV as a frequent pathogen when it is carried out. Here we review the available literature on CMV in Africa, primarily in adult patients, and discuss this in the context of contemporary understanding of CMV as a human pathogen. PMID:27482452

  9. Absence of human cytomegalovirus infection in childhood brain tumors.


    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio


    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients' neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  10. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio


    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  11. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto


    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  12. Leukocyte Responsiveness to Exercise in Individuals Positive for Human Cytomegalovirus.


    Wilson, J N; Navalta, J W


    Human cytomegalovirus (HCMV) infects 50% of adults in the United States. HCMV can become a cause for concern in individuals who have a compromised immune system, which may occur after high-intensity exercise. The purpose of this preliminary study was to characterize the lymphocyte, monocyte, and neutrophil responses to exercise in HCMV+individuals. Participants were either positive (HCMV +) or negative (HCMV-) for HCMV. Participants visited the laboratory on 3 separate occasions: HCMV screening, 100% VO2max test, and 80% VO2max run. Mixed-model factorial ANOVA procedures with repeated measures on sampling condition were performed on absolute and relative circulating lymphocytes, monocytes, and neutrophils. Significant main effects for time for both absolute and relative values were seen for all leukocyte subsets regardless of virus status. Significant differences for absolute and relative values were seen between sampling conditions for all leukocyte subsets. We report for the first time that HCMV status does not affect circulating neutrophil responses to high-intensity exercise, though exercise-induced neutrocytosis is seen during the post-exercise and 60 min post-exercise sampling conditions, regardless of HCMV status. There is no HCMV effect on circulating monocyte responses to exercise, though exercise-induced monocytosis was seen during the post-exercise sampling condition regardless of HCMV status. PMID:26837931

  13. Use of recombinant approaches to construct human cytomegalovirus mutants.


    Dekhtiarenko, Iryna; Cičin-Šain, Luka; Messerle, Martin


    To fully understand the function of cytomegalovirus (CMV) genes, it is imperative that they be studied in the context of infection. Therefore, the targeted deletion of individual viral genes and the comparison of loss of function viral mutants to the wild-type virus allow the identification of the relevance and role for a particular gene in the viral replication cycle. Targeted CMV mutagenesis has made huge advances over the past 15 years. The cloning of CMV genomes into (E. coli) as bacterial artificial chromosomes (BAC) allows not only quick and efficient deletion of viral genomic regions, individual genes, or single nucleotide exchanges in the viral genome but also the insertion of heterologous genetic sequences for gain of function approaches. The conceptual advantage of this strategy is that it overcomes the restrictions of recombinant technologies in cell culture systems. Namely, recombination in infected cells occurs only in a few clones, and their selection is not possible if the targeted genes are relevant for virus replication and are not able to compete for growth against the unrecombined viruses. On the other hand, BAC mutagenesis enables the selection for antibiotic resistance in E. coli, allowing a selective growth advantage to the recombined genomes. Here we describe the methods used for the generation of a CMV BAC, targeted mutagenesis of BAC clones, and transfection of human cells with CMV BAC DNA in order to reconstitute the viral infection process. PMID:24639218

  14. Manipulation of dendritic cell functions by human cytomegalovirus.


    Sinclair, John


    Dendritic cells are the most potent antigen-presenting cells of the mammalian immune system and are central to the initiation and maintenance of the adaptive immune response. They are crucial for the presentation of antigen to T cells and B cells, as well as the induction of chemokines and proinflammatory cytokines, which orchestrate the balance of the cell-mediated (Th1) and antibody (Th2) response. This ability of dendritic cells to present antigen and release chemokines and cytokines also bridges the innate and adaptive immune responses by driving T cell activation. These cells thus possess key immunological functions that make them the front line of defence for the targeting and clearance of any invading pathogen and, as such, they underpin the host immune response to infection. For efficient infection, invading pathogens often need to overcome these sentinel immune functions. It is therefore not surprising that pathogens have evolved numerous mechanisms to target dendritic cell functions directly or indirectly during infection, and at least one herpesvirus--human cytomegalovirus--has evolved a life cycle that hijacks dendritic cells for its long-term persistence in the infected host. PMID:19025715

  15. The Oncogenic Potential of Human Cytomegalovirus and Breast Cancer

    PubMed Central

    Herbein, Georges; Kumar, Amit


    Breast cancer is the leading causes of cancer-related death among women. The vast majority of breast cancers are carcinomas that originate from cells lining the milk-forming ducts of the mammary gland. Numerous articles indicate that breast tumors exhibit diverse phenotypes depending on their distinct physiopathological signatures, clinical courses, and therapeutic possibilities. The human cytomegalovirus (HCMV) is a multifaceted highly host specific betaherpesvirus that is regarded as asymptomatic or mildly pathogenic virus in immunocompetent host. HCMV may cause serious in utero infections as well as acute and chronic complications in immunocompromised individual. The involvement of HCMV in late inflammatory complications underscores its possible role in inflammatory diseases and cancer. HCMV targets a variety of cell types in vivo, including macrophages, epithelial cells, endothelial cells, fibroblasts, stromal cells, neuronal cells, smooth muscle cells, and hepatocytes. HCMV can be detected in the milk after delivery and thereby HCMV could spread to adjacent mammary epithelial cells. HCMV also infects macrophages and induces an atypical M1/M2 phenotype, close to the tumor-associated macrophage phenotype, which is associated with the release of cytokines involved in cancer initiation or promotion and breast cancer of poor prognosis. HCMV antigens and DNA have been detected in tissue biopsies of breast cancers and elevation in serum HCMV IgG antibody levels has been reported to precede the development of breast cancer in some women. In this review, we will discuss the potential role of HCMV in the initiation and progression of breast cancer. PMID:25202681

  16. Clinical Utility of Droplet Digital PCR for Human Cytomegalovirus

    PubMed Central

    Sedlak, Ruth Hall; Cook, Linda; Cheng, Anqi; Magaret, Amalia


    Human cytomegalovirus (CMV) has historically been the major infectious cause of morbidity and mortality among patients receiving hematopoietic cell or organ transplant. Standard care in a transplant setting involves frequent monitoring of CMV viral load over weeks to months to determine when antiviral treatment may be required. Quantitative PCR (qPCR) is the standard molecular diagnostic method for monitoring. Recently, digital PCR (dPCR) has shown promise in viral diagnostics, although current dPCR systems have lower throughput than qPCR systems. Here, we compare qPCR and droplet digital PCR (ddPCR) for CMV detection in patient plasma samples. Droplet digital PCR exhibits increased precision over qPCR at viral loads of ≥4 log10 with equivalent sensitivity. However, retrospective analysis of longitudinal samples from transplant patients with CMV viral loads near therapeutic thresholds did not provide evidence that the improved precision of ddPCR would be of clinical benefit. Given the throughput advantages of current qPCR systems, a widespread switch to dPCR for CMV monitoring would appear premature. PMID:24871214

  17. Induction of cellular hsp70 expression by human cytomegalovirus.

    PubMed Central

    Santomenna, L D; Colberg-Poley, A M


    Expression of the cellular heat shock protein 70 gene (hsp70) is transiently induced by human cytomegalovirus (HCMV) infection of permissive human diploid fibroblasts. Induction of the cellular heat shock response during critical times of infection had previously been reported to alter the growth of HCMV in vitro. Thus, a potential interaction between heat shock proteins and HCMV expression was indicated. HCMV dramatically increased expression of hsp70 RNA within 8 h of infection. hsp70 RNA remained elevated at 24 and 48 h postinfection and decreased to low levels of 72 h postinfection. Induction of HSP70 protein occurred more slowly; inducible HSP70 protein encoded by this RNA increased within 16 h postinfection and continued to increase throughout infection until 72 h postinfection, when the highest abundance of inducible HSP70 protein was observed. Cells that received both heat (43 degrees C for 70 min) treatment and HCMV infection expressed hsp70 RNA to levels above the sum of levels present in cells given either treatment alone. Furthermore, hsp70 RNA induction occurred earlier and remained elevated longer than in cells infected with HCMV alone or in cells treated with heat alone, respectively. Nevertheless, the pattern of HCMV immediate-early transcript expression at 2, 4, and 6 h postinfection appeared to be unchanged by this prior heat treatment. Our results suggest that heat shock treatment and HCMV infection can act additively in stimulating hsp70 RNA expression. The previously reported stimulation of HCMV growth in vitro following the heat shock response apparently does not result from alterations in the steady-state expression of HCMV immediate-early transcripts. Images PMID:2157870

  18. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.


    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  19. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei


    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  20. Terminal structure and heterogeneity in human cytomegalovirus strain AD169.

    PubMed Central

    Tamashiro, J C; Spector, D H


    We have characterized the heterogeneity occurring at the junction of the long (L) and short (S) segments and at the termini of the strain AD169 human cytomegalovirus (HCMV) genome by restriction endonuclease mapping and nucleotide sequence analyses. The HCMV a sequence was identified by its position at both termini and inverted orientation at the L-S junction. Heterogeneity at both termini and the L-S junction was generated by the presence of fused and tandem a sequences. Some S termini lacked an a sequence. In addition, near the L terminus and at the L-S junction there were a variable number of 217-base-pair (bp) XhoI fragments arranged in tandem. The 217-bp fragments consisted of a portion of the a and adjacent b sequences (in the L-segment repeat) bounded by the same direct repeats (DR1) found at the boundaries of the a sequence. A model for the generation of these heterogeneous fragments is presented. We also determined the sequence of seven cloned terminal fragments, five from the L terminus and two from the S terminus. All L termini contained identical terminal sequences ending with base 32 of a 33-bp DR1. The S termini differed from each other and from the L-segment termini. One S terminus lacked an a sequence and terminated within S-segment repeat (c) sequences. The second S terminus contained an a sequence and terminated with bases 20 to 33 of a 33-bp DR1. A comparison of the cloned L and S terminal sequences with cloned L-S junction sequences suggested that the termini contained 3' single base extensions which were removed during the cloning. We also show that the herpesvirus conserved sequence is in a similar position relative to the termini of HCMV and several other herpesviruses, thus adding further support for the role of the sequence in the maturation of viral DNA. Images PMID:3016322

  1. Human fetal inner ear involvement in congenital cytomegalovirus infection

    PubMed Central


    Background Congenital cytomegalovirus (CMV) infection is a leading cause of sensorineural hearing loss (SNHL). The mechanisms of pathogenesis of CMV-related SNHL are still unclear. The aim is to study congenital CMV-related damage in the fetal inner ear, in order to better understand the underlying pathophysiology behind CMV-SNHL. Results We studied inner ears and brains of 20 human fetuses, all at 21 week gestational age, with a high viral load in the amniotic fluid, with and without ultrasound (US) brain abnormalities. We evaluated histological brain damage, inner ear infection, local inflammatory response and tissue viral load. Immunohistochemistry revealed that CMV was positive in 14/20 brains (70%) and in the inner ears of 9/20 fetuses (45%). In the cases with inner ear infection, the marginal cell layer of the stria vascularis was always infected, followed by infection in the Reissner’s membrane. The highest tissue viral load was observed in the inner ear with infected Organ of Corti. Vestibular labyrinth showed CMV infection of sensory cells in the utricle and in the crista ampullaris. US cerebral anomalies were detected in 6 cases, and in all those cases, the inner ear was always involved. In the other 14 cases with normal brain scan, histological brain damage was present in 8 fetuses and 3 of them presented inner ear infection. Conclusions CMV-infection of the marginal cell layer of the stria vascularis may alter potassium and ion circulation, dissipating the endocochlear potential with consequent SNHL. Although abnormal cerebral US is highly predictive of brain and inner ear damage, normal US findings cannot exclude them either. PMID:24252374

  2. Two Novel Human Cytomegalovirus NK Cell Evasion Functions Target MICA for Lysosomal Degradation

    PubMed Central

    Fielding, Ceri A.; Aicheler, Rebecca; Stanton, Richard J.; Wang, Eddie C. Y.; Han, Song; Seirafian, Sepehr; Davies, James; McSharry, Brian P.; Weekes, Michael P.; Antrobus, P. Robin; Prod'homme, Virginie; Blanchet, Fabien P.; Sugrue, Daniel; Cuff, Simone; Roberts, Dawn; Davison, Andrew J.; Lehner, Paul J.; Wilkinson, Gavin W. G.; Tomasec, Peter


    NKG2D plays a major role in controlling immune responses through the regulation of natural killer (NK) cells, αβ and γδ T-cell function. This activating receptor recognizes eight distinct ligands (the MHC Class I polypeptide-related sequences (MIC) A andB, and UL16-binding proteins (ULBP)1–6) induced by cellular stress to promote recognition cells perturbed by malignant transformation or microbial infection. Studies into human cytomegalovirus (HCMV) have aided both the identification and characterization of NKG2D ligands (NKG2DLs). HCMV immediate early (IE) gene up regulates NKGDLs, and we now describe the differential activation of ULBP2 and MICA/B by IE1 and IE2 respectively. Despite activation by IE functions, HCMV effectively suppressed cell surface expression of NKGDLs through both the early and late phases of infection. The immune evasion functions UL16, UL142, and microRNA(miR)-UL112 are known to target NKG2DLs. While infection with a UL16 deletion mutant caused the expected increase in MICB and ULBP2 cell surface expression, deletion of UL142 did not have a similar impact on its target, MICA. We therefore performed a systematic screen of the viral genome to search of addition functions that targeted MICA. US18 and US20 were identified as novel NK cell evasion functions capable of acting independently to promote MICA degradation by lysosomal degradation. The most dramatic effect on MICA expression was achieved when US18 and US20 acted in concert. US18 and US20 are the first members of the US12 gene family to have been assigned a function. The US12 family has 10 members encoded sequentially through US12–US21; a genetic arrangement, which is suggestive of an ‘accordion’ expansion of an ancestral gene in response to a selective pressure. This expansion must have be an ancient event as the whole family is conserved across simian cytomegaloviruses from old world monkeys. The evolutionary benefit bestowed by the combinatorial effect of US18 and US20 on

  3. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio


    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  4. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.


    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio


    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  5. Human Leukocyte Antigen Alleles and Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Futohi, Farzaneh; Saber, Azadeh; Nemati, Eglim; Einollahi, Behzad; Rostami, Zohre


    Background: Several studies have been conducted on the relationship between a number of human leukocyte antigen (HLA) alleles and cytomegalovirus infection (CMV), in kidney transplant recipients, after transplantation. However, only a limited number of HLAs have been investigated, so far, and the results have been contradictory. Objectives: This study aimed to investigate the relationship between 59 HLA alleles and the CMV infection, in transplant recipients, after kidney transplantation. Patients and Methods: This retrospective cohort study was conducted on 200 patients, receiving a kidney transplant, in Baqiyatallah Hospital, in Tehran, during 2013. Throughout a one-year follow-up of kidney transplant recipients, in case of detecting the CMV antigen in patients’ blood, at any time, they were placed in the group of patients with CMV infection, whereas, if no CMV-specific antigen was developed, over a year, patients were placed in the group of patients without CMV infection, after transplantation. This study investigated the relationship between CMV infection in kidney transplant recipients and 59 HLA alleles, including 14 HLA-A, 28 HLA-B, and 17 HLA-DRB1 cases. Results: Of all participants, 104 patients (52%) were diagnosed with CMV infection. There was no significant difference between the two groups, with and without CMV infection, in terms of patient’s characteristics. The CMV infection, in patients receiving a transplanted organ from deceased donor, was significantly more prevalent than in those receiving kidney transplant from living donor (63% vs. 39%, respectively, P = 0.001). Recipients with HLA-B44 were more infected with CMV compared with patients without this allele (80% vs. 50%, respectively, P = 0.024); on the contrary, kidney recipients with HLA-DRB1-1 were less infected with CMV than patients without this allele (31% vs. 55%, respectively, P = 0.020). There was no significant relationship between CMV infection and other HLA alleles. Results of

  6. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape

    PubMed Central

    Landolfo, Santo; De Andrea, Marco; Dell’Oste, Valentina; Gugliesi, Francesca


    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed “restriction factors” (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell’s intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  7. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape.


    Landolfo, Santo; De Andrea, Marco; Dell'Oste, Valentina; Gugliesi, Francesca


    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed "restriction factors" (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell's intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  8. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela


    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  9. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina


    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  10. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response.


    Harwardt, Thomas; Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C; Nevels, Michael; Paulus, Christina


    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  11. Human cytomegalovirus and transplantation: drug development and regulatory issues.


    McIntosh, Megan; Hauschild, Benjamin; Miller, Veronica


    Cytomegalovirus (CMV) infection is highly prevalent worldwide and can cause serious disease among immunocompromised individuals, including persons with HIV and transplant recipients on immunosuppressive therapies. It can also result in congenital cytomegalovirus when women are infected during pregnancy. Treatment and prevention of CMV in solid organ and haematopoietic stem cell transplant recipients is accomplished in one of three ways: (1) prophylactic therapy to prevent CMV viraemia; (2) pre-emptive therapy for those with low levels of replicating virus; and (3) treatment for established disease. Despite the high prevalence of CMV, there are few available approved drug therapies, and those that are available are hampered by toxicity and less-than-optimal efficacy. New therapies are being developed and tested; however, inconsistency in standardisation of virus levels and questions about potential endpoints in clinical trials present regulatory hurdles that must be addressed. This review covers the current state of CMV therapy, drugs currently under investigation, and clinical trial issues and questions that are in need of resolution. PMID:27482453

  12. Molecular dissection of the human B cell response against cytomegalovirus infection by lambda display.


    Beghetto, Elisa; Paolis, Francesca De; Spadoni, Andrea; Del Porto, Paola; Buffolano, Wilma; Gargano, Nicola


    Human cytomegalovirus (HCMV), a ubiquitous herpesvirus, is the main cause of congenital abnormalities and mental retardation in newborns and is also responsible for severe life-threatening complications in immunocompromised individuals, including AIDS patients and transplant recipients. The disorders generated by cytomegalovirus are closely associated with the competence of the host immune system and both humoral and cell-mediated mechanisms are involved in the response to viral infection. To identify viral proteins recognized by host antibody responses, a cytomegalovirus genome library was created and displayed on lambda bacteriophage. The challenge of such a library with sera from individuals with congenital or acquired infection allowed the identification of a wide panel of recombinant bacteriophages carrying cytomegalovirus B cell epitopes. Epitope-containing fragments within the families of tegument proteins (pUL25, pUL32), structural proteins (pUL48, pUL56) and glycoproteins (pUL55) were identified. Moreover, library screening permitted isolation of phage clones carrying an antigenic region of an uncharacterized HCMV protein encoded by the UL71 open reading frame (ORF), highlighting the potential of lambda display technology in antigen and epitope discovery. PMID:18499273

  13. Expanding role of cytomegalovirus as a human pathogen.


    Navarro, David


    Cytomegalovirus (CMV) continues to be a leading cause of morbidity and mortality in transplant recipients, despite major advancements in preventative strategies. Antiviral prophylaxis and pre-emptive antiviral therapeutic regimens are associated with a high incidence of late-onset end-organ disease and cause drug-related toxicity when overused. Therefore, the identification of risk factors for CMV replication is required. Genetic and immunological factors that predispose individuals to CMV-related clinical complications have been identified and may be instrumental for optimizing CMV treatment in the future. Evidence suggests a causal pathogenetic link between CMV-related complications and inflammatory diseases in non-canonically immunosuppressed individuals such as patients with lung injury and critically ill and cancer patients. However, a randomized clinical trial is required to determine if a causal relationship exists. J. Med. Virol. 88:1103-1112, 2016. © 2015 Wiley Periodicals, Inc. PMID:26681168

  14. The human fibroblast receptor for gp86 of human cytomegalovirus is a phosphorylated glycoprotein.

    PubMed Central

    Keay, S; Baldwin, B


    A human embryonic lung (HEL) cell receptor for gp86 of human cytomegalovirus that functions in virus-cell fusion was further characterized. Anti-idiotype antibodies that mimic gp86 were used to immunoprecipitate the 92.5-kDa fibroblast membrane receptor for gp86, which was preincubated with various endoglycosidases. The receptor, which has a pI ranging from 5.3 to 5.6, appears to be a glycoprotein with primarily N-linked sugar residues, some of which have high concentrations of mannose and some of which are complex oligosaccharides. Western blots (immunoblots) of electrophoretically transferred receptor incubated with various biotinylated lectins confirmed the presence of sugar moieties, including N-acetylglucosamine, glucose or mannose, and galactose, but not fucose or N-acetylgalactosamine. This gp86 receptor from uninfected HEL cells also incorporated radiolabeled phosphate from orthophosphoric acid, indicating that it is a constitutively phosphorylated receptor. Images PMID:1321272

  15. Estrogen-related receptor α is required for efficient human cytomegalovirus replication

    PubMed Central

    Hwang, Jesse; Purdy, John G.; Wu, Kai; Rabinowitz, Joshua D.; Shenk, Thomas


    An shRNA-mediated screen of the 48 human nuclear receptor genes identified multiple candidates likely to influence the production of human cytomegalovirus in cultured human fibroblasts, including the estrogen-related receptor α (ERRα), an orphan nuclear receptor. The 50-kDa receptor and a 76-kDa variant were induced posttranscriptionally following infection. Genetic and pharmacological suppression of the receptor reduced viral RNA, protein, and DNA accumulation, as well as the yield of infectious progeny. In addition, RNAs encoding multiple metabolic enzymes, including enzymes sponsoring glycolysis (enolase 1, triosephosphate isomerase 1, and hexokinase 2), were reduced when the function of ERRα was inhibited in infected cells. Consistent with the effect on RNAs, a substantial number of metabolites, which are normally induced by infection, were either not increased or were increased to a reduced extent in the absence of normal ERRα activity. We conclude that ERRα is needed for the efficient production of cytomegalovirus progeny, and we propose that the nuclear receptor contributes importantly to the induction of a metabolic environment that supports optimal cytomegalovirus replication. PMID:25512541

  16. Host cellular annexin II is associated with cytomegalovirus particles isolated from cultured human fibroblasts.

    PubMed Central

    Wright, J F; Kurosky, A; Pryzdial, E L; Wasi, S


    A significant amount of host cellular annexin II was found to be associated with human cytomegalovirus isolated from cultured human fibroblasts (approximately 1,160 molecules per virion). This composition was established by four different analytical approaches that included (i) Western blot (immunoblot) analysis of gradient-purified virions with a monoclonal antibody specific for annexin II, (ii) peptide mapping and sequence analysis of virus-associated proteins and proteins dissociated from virus following EDTA treatment, (iii) electron microscopic immunocytochemistry of gradient-purified virions, and (iv) labeling of virus-associated proteins by lactoperoxidase-catalyzed radioiodination. These results indicated that annexin II was primarily localized to the viral surface, where it bound in a divalent cation-dependent manner. In functional experiments, a rabbit antiserum raised against annexin II inhibited cytomegalovirus plaque formation in human foreskin fibroblast monolayers in a concentration-dependent manner. Cumulatively, these studies demonstrate an association of host annexin II with cytomegalovirus particles and provide evidence for the involvement of this cellular protein in virus infectivity. PMID:7609045

  17. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.


    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  18. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang


    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  19. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T


    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  20. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.


    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  1. In vitro activity evaluation of Parkia pendula seed lectin against human cytomegalovirus and herpes virus 6.


    Favacho, Alexsandra R M; Cintra, Elizabete A; Coelho, Luana C B B; Linhares, Maria Iêda S


    Human cytomegalovirus (HCMV) in vitro infectivity was inhibited by Parkia pendula seed lectin (PpeL) in contrast to human herpes virus 6 (HHV-6) which was not affected. The antiviral activity was detected for HCMV in human embryo lung (HEL) cells using a microtechnique in culture plates. The assay showed a reduction of cellular infectivity from approximately 95%, at a concentration of 150microg/mL with minimal cytotoxicity (25%). Also, a reduction of 75% was observed in HEL cells at a concentration of 75microg/mL without toxic effect. The reduction on infectivity was observed even after virus pre-adsorption to cells suggesting that this action should occur after virus penetration, in the intracellular replication phase. MT4 lymphocytes and cord blood mononuclear cells (CBMC) were used to evaluate the lectin effect on HHV-6 following the same technique. Lectin concentrations with few or no toxic effects on lymphocytes did not show inhibitory action of HHV-6 cytopathic effect. The results obtained with PpeL demonstrate that it may have an impact in the design of pharmacological strategies to infection of cytomegalovirus. PMID:17254798

  2. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.


    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  3. Sequestration of human cytomegalovirus by human renal and mammary epithelial cells

    SciTech Connect

    Twite, Nicolas; Andrei, Graciela; Kummert, Caroline; Donner, Catherine; Perez-Morga, David; De Vos, Rita; Snoeck, Robert; Marchant, Arnaud


    Urine and breast milk represent the main routes of human cytomegalovirus (HCMV) transmission but the contribution of renal and mammary epithelial cells to viral excretion remains unclear. We observed that kidney and mammary epithelial cells were permissive to HCMV infection and expressed immediate early, early and late antigens within 72 h of infection. During the first 24 h after infection, high titers of infectious virus were measured associated to the cells and in culture supernatants, independently of de novo synthesis of virus progeny. This phenomenon was not observed in HCMV-infected fibroblasts and suggested the sequestration and the release of HCMV by epithelial cells. This hypothesis was supported by confocal and electron microscopy analyses. The sequestration and progressive release of HCMV by kidney and mammary epithelial cells may play an important role in the excretion of the virus in urine and breast milk and may thereby contribute to HCMV transmission. - Highlights: • Primary renal and mammary epithelial cells are permissive to HCMV infection. • HCMV is sequestered by epithelial cells and this phenomenon does not require viral replication. • HCMV sequestration by epithelial cells is reduced by antibodies and IFN-γ.

  4. Comparison of simian and human cytomegalovirus reactivities in an enzyme-linked immunospecific assay: effect of antigen preparation on cross-reactive antigens.

    PubMed Central

    Tinghitella, T J; Swack, N; Baumgarten, A; Hsiung, G D


    Simian cytomegalovirus was substituted for human cytomegalovirus in an enzyme-linked immunoassay. Unlike the indirect immunofluorescence assay which demonstrates a two-way cross-reactivity, only one-way cross-reactivity was observed. Altering the method of simian antigen preparation gave some insight other this different reactivity. PMID:6288573

  5. A High-Affinity Native Human Antibody Neutralizes Human Cytomegalovirus Infection of Diverse Cell Types

    PubMed Central

    Liu, Keyi; Park, Minha; DeChene, Neal; Stephenson, Robert; Tenorio, Edgar; Ellsworth, Stote L.; Tabata, Takako; Petitt, Matthew; Tsuge, Mitsuru; Fang-Hoover, June; Adler, Stuart P.; Cui, Xiaohong; McVoy, Michael A.; Pereira, Lenore


    Human cytomegalovirus (HCMV) is the most common infection causing poor outcomes among transplant recipients. Maternal infection and transplacental transmission are major causes of permanent birth defects. Although no active vaccines to prevent HCMV infection have been approved, passive immunization with HCMV-specific immunoglobulin has shown promise in the treatment of both transplant and congenital indications. Antibodies targeting the viral glycoprotein B (gB) surface protein are known to neutralize HCMV infectivity, with high-affinity binding being a desirable trait, both to compete with low-affinity antibodies that promote the transmission of virus across the placenta and to displace nonneutralizing antibodies binding nearby epitopes. Using a miniaturized screening technology to characterize secreted IgG from single human B lymphocytes, 30 antibodies directed against gB were previously cloned. The most potent clone, TRL345, is described here. Its measured affinity was 1 pM for the highly conserved site I of the AD-2 epitope of gB. Strain-independent neutralization was confirmed for 15 primary HCMV clinical isolates. TRL345 prevented HCMV infection of placental fibroblasts, smooth muscle cells, endothelial cells, and epithelial cells, and it inhibited postinfection HCMV spread in epithelial cells. The potential utility for preventing congenital transmission is supported by the blockage of HCMV infection of placental cell types central to virus transmission to the fetus, including differentiating cytotrophoblasts, trophoblast progenitor cells, and placental fibroblasts. Further, TRL345 was effective at controlling an ex vivo infection of human placental anchoring villi. TRL345 has been utilized on a commercial scale and is a candidate for clinical evaluation. PMID:25534746

  6. Cytomegalovirus retinitis


    ... to prevent its return. Alternative Names Cytomegalovirus retinitis Images Eye CMV retinitis CMV (cytomegalovirus) References Crumpacker CS. ... 5. Read More Antibody HIV/AIDS Immune response Retinal detachment Systemic WBC count Update Date 12/10/ ...

  7. Impact of persistent cytomegalovirus infection on human neuroblastoma cell gene expression.


    Hoever, Gerold; Vogel, Jens-Uwe; Lukashenko, Polina; Hofmann, Wolf-Karsten; Komor, Martina; Doerr, Hans Wilhelm; Cinatl, Jindrich


    In a model of human neuroblastoma (NB) cell lines persistently infected with human cytomegalovirus (HCMV) we previously showed that persistent HCMV infection is associated with an increased malignant phenotype, enhanced drug resistance, and invasive properties. To gain insights into the mechanisms of increased malignancy we analyzed the global changes in cellular gene expression induced by persistent HCMV infection of human neuroblastoma cells by use of high-density oligonucleotide microarrays (HG-U133A, Affymetrix) and RT-PCR. Comparing the gene expression of different NB cell lines with persistently infected cell sub-lines revealed 11 host cell genes regulated in a similar manner throughout all infected samples. Nine of these 11 genes may contribute to the previously observed changes in malignant phenotype of persistently HCMV infected NB cells by influencing invasive growth, apoptosis, angiogenesis, and proliferation. Thus, this work provides the basis for further functional studies. PMID:15582591

  8. Human cytomegalovirus tropism for mucosal myeloid dendritic cells

    PubMed Central

    Hertel, Laura


    SUMMARY Human CMV infections are a serious source of morbidity and mortality for immunocompromised patients and for the developing fetus. Because of this, the development of new strategies to prevent CMV acquisition and transmission is a top priority. Myeloid dendritic cells (DC) residing in the oral and nasal mucosae are among the first immune cells to encounter CMV during entry, and greatly contribute to virus dissemination, reactivation from latency, and horizontal spread. Albeit affected by the immunoevasive tactics of CMV, mucosal DC remain potent inducers of cellular and humoral immune responses against this virus. Their natural functions could thus be exploited to generate long-lasting protective immunity against CMV by vaccination via the oro-nasal mucosae. Although related, epithelial Langerhans-type DC (LC) and dermal monocyte-derived DC (MDDC) interact with CMV in dramatically different ways. While immature MDDC are fully permissive to infection, for instance, immature LC are completely resistant. Understanding these differences is essential to design innovative vaccines and new antiviral compounds to protect these cells from CMV infection in vivo. PMID:24888709

  9. Effects of donor/recipient human leukocyte antigen mismatch on human cytomegalovirus replication following liver transplantation

    PubMed Central

    Aldridge, RW; Mattes, FM; Rolando, N; Rolles, K; Smith, C; Shirling, G; Atkinson, C; Burroughs, AK; Milne, RSB; Emery, VC; Griffiths, PD


    Background Natural immunity against cytomegalovirus (CMV) can control virus replication after solid organ transplantation; however, it is not known which components of the adaptive immune system mediate this protection. We investigated whether this protection requires human leukocyte antigen (HLA) matching between donor and recipient by exploiting the fact that, unlike transplantation of other solid organs, liver transplantation does not require HLA matching, but some donor and recipient pairs may nevertheless be matched by chance. Methods To further investigate this immune control, we determined whether chance HLA matching between donor (D) and recipient (R) in liver transplants affected a range of viral replication parameters. Results In total, 274 liver transplant recipients were stratified according to matches at the HLA A, HLA B, and HLA DR loci. The incidence of CMV viremia, kinetics of replication, and peak viral load were similar between the HLA matched and mismatched patients in the D+/R+ and D−/R+ transplant groups. D+/R− transplants with 1 or 2 mismatches at the HLA DR locus had a higher incidence of CMV viremia >3000 genomes/mL blood compared to patients matched at this locus (78% vs. 17%; P = 0.01). Evidence was seen that matching at the HLA A locus had a small effect on peak viral loads in D+/R− patients, with median peak loads of 3540 and 14,706 genomes/mL in the 0 and combined (1 and 2) mismatch groups, respectively (P = 0.03). Conclusion Overall, our data indicate that, in the setting of liver transplantation, prevention of CMV infection and control of CMV replication by adaptive immunity is minimally influenced by HLA matching of the donor and recipient. Our data raise questions about immune control of CMV in the liver and also about the cells in which the virus is amplified to give rise to CMV viremia. PMID:25572799

  10. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.


    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  11. Cytomegalovirus in human brain tumors: Role in pathogenesis and potential treatment options

    PubMed Central

    Söderberg-Nauclér, Cecilia; Johnsen, John Inge


    During the last years increasing evidence implies that human cytomegalovirus (CMV) can be attributed to human malignancies arising from numerous tissues. In this perspective, we will review and discuss the potential mechanisms through which CMV infection may contribute to brain tumors by affecting tumor cell initiation, progression and metastasis formation. Recent evidence also suggests that anti-CMV treatment results in impaired tumor growth of CMV positive xenografts in animal models and potentially increased survival in CMV positive glioblastoma patients. Based on these observations and the high tumor promoting capacity of this virus, the classical and novel antiviral therapies against CMV should be revisited as they may represent a great promise for halting tumor progression and lower cancer deaths. PMID:25699229

  12. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian


    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  13. Development of the adaptive NK cell response to human cytomegalovirus in the context of aging.


    López-Botet, Miguel; Muntasell, Aura; Martínez-Rodríguez, José E; López-Montañés, María; Costa-García, Marcel; Pupuleku, Aldi


    Human cytomegalovirus (HCMV) establishes a highly prevalent life-long latent infection. Though generally subclinical, HCMV infection may have severe consequences during fetal development and in immunocompromised individuals. Based on epidemiological studies HCMV(+) serology has been associated with the development of atherosclerosis, immune senescence and an increase mortality rate in elderly people. Such long-term detrimental effects of the viral infection presumably result from an inefficient immune control of the pathogen, depending on the quality and evolution of the individual host-pathogen relationship. Together with antigen-specific T lymphocytes, NK cells play an important role in anti-viral immune defense. HCMV promotes in some individuals the differentiation and persistent steady state expansion of an NK cell subset bearing the CD94/NKG2C activating receptor. The relationship between this adaptive NK cell response to HCMV and aging is overviewed. PMID:27349430

  14. Cellular defense against latent colonization foiled by human cytomegalovirus UL138 protein

    PubMed Central

    Lee, Song Hee; Albright, Emily R.; Lee, Jeong-Hee; Jacobs, Derek; Kalejta, Robert F.


    Intrinsic immune defenses mediated by restriction factors inhibit productive viral infections. Select viruses rapidly establish latent infections and, with gene expression profiles that imply cell-autonomous intrinsic defenses, may be the most effective immune control measure against latent reservoirs. We illustrate that lysine-specific demethylases (KDMs) are restriction factors that prevent human cytomegalovirus from establishing latency by removing repressive epigenetic modifications from histones associated with the viral major immediate early promoter (MIEP), stimulating the expression of a viral lytic phase target of cell-mediated adaptive immunity. The viral UL138 protein negates this defense by preventing KDM association with the MIEP. The presence of an intrinsic defense against latency and the emergence of a cognate neutralizing viral factor indicate that “arms races” between hosts and viruses over lifelong colonization exist at the cellular level. PMID:26702450

  15. Strategies to control human cytomegalovirus infection in adult hematopoietic stem cell transplant recipients.


    Lilleri, Daniele; Gerna, Giuseppe


    Human cytomegalovirus (HCMV) represents the major viral complication after hematopoietic stem cell transplantation. HCMV infection may be controlled by the reconstituting immune system and remain subclinical or can lead to severe systemic and/or organ disease (mainly pneumonia and gastroenteritis) when immune reconstitution is delayed or impaired. In order to prevent the occurrence of HCMV disease, a prompt diagnosis of HCMV infection is mandatory. The adoption of pre-emptive therapy strategies guided by virological monitoring dramatically reduced the occurrence of HCMV disease. However, late-onset end-organ disease may occur in some patients with apparent immune reconstitution. In the near future, introduction of immunological monitoring and immunotherapies could markedly improve management of HCMV infection. PMID:27485084

  16. Human Cytomegalovirus Up-Regulates Endothelin Receptor Type B: Implication for Vasculopathies?

    PubMed Central

    Yaiw, Koon-Chu; Mohammad, Abdul-Aleem; Costa, Helena; Taher, Chato; Badrnya, Sigrun; Assinger, Alice; Wilhelmi, Vanessa; Ananthaseshan, Sharan; Estekizadeh, Atosa; Davoudi, Belghis; Ovchinnikova, Olga; Shlyakhto, Eugene; Rafnsson, Arnar; Khan, Zahidul; Butler, Lynn; Rahbar, Afsar; Pernow, John; Söderberg-Nauclér, Cecilia


    Background. Both endothelin receptor type B ([ETBR], a G protein-coupled receptor that mediates the vascular effects of the potent vasoconstrictor endothelin-1) and human cytomegalovirus ([HCMV], a ubiquitous herpesvirus) have been implicated in the pathogenesis of cardiovascular disease (CVD). The effects of HCMV infection on ETBR expression are unknown. We hypothesized that HCMV may contribute to the pathogenesis of CVD via ETBR modulation. Methods. Human CMV effects on ETBR were studied in vitro in endothelial cells (ECs) and smooth muscle cells (SMCs) and ex vivo in human carotid plaque tissue specimens. Expression of ETBR and viral immediate-early were quantified using quantitative polymerase chain reaction. Functional consequences after ETBR blockade in ECs were examined by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide proliferation, wound healing, tube formation, and flow adhesion assays. Results. Human CMV is capable of upregulating both ETBR mRNA and protein expression in ECs and SMCs. The ETBR was also abundantly expressed in ECs, foam cells, and SMCs, and, more importantly, in HCMV-positive cells in human carotid plaques. Endothelin receptor type B blockade led to decreased proliferation and reduced tumor necrosis factor α-mediated leukocyte recruitment in both uninfected and HCMV-infected ECs. Direct HCMV infection was antimigratory and antiangiogenic in ECs. Conclusions. Human CMV may contribute to CVD via ETBR induction. PMID:26719843

  17. Evaluating Human T-Cell Therapy of Cytomegalovirus Organ Disease in HLA-Transgenic Mice

    PubMed Central

    Thomas, Simone; Klobuch, Sebastian; Podlech, Jürgen; Plachter, Bodo; Hoffmann, Petra; Renzaho, Angelique; Theobald, Matthias


    Reactivation of human cytomegalovirus (HCMV) can cause severe disease in recipients of hematopoietic stem cell transplantation. Although preclinical research in murine models as well as clinical trials have provided 'proof of concept' for infection control by pre-emptive CD8 T-cell immunotherapy, there exists no predictive model to experimentally evaluate parameters that determine antiviral efficacy of human T cells in terms of virus control in functional organs, prevention of organ disease, and host survival benefit. We here introduce a novel mouse model for testing HCMV epitope-specific human T cells. The HCMV UL83/pp65-derived NLV-peptide was presented by transgenic HLA-A2.1 in the context of a lethal infection of NOD/SCID/IL-2rg-/- mice with a chimeric murine CMV, mCMV-NLV. Scenarios of HCMV-seropositive and -seronegative human T-cell donors were modeled by testing peptide-restimulated and T-cell receptor-transduced human T cells, respectively. Upon transfer, the T cells infiltrated host tissues in an epitope-specific manner, confining the infection to nodular inflammatory foci. This resulted in a significant reduction of viral load, diminished organ pathology, and prolonged survival. The model has thus proven its potential for a preclinical testing of the protective antiviral efficacy of HCMV epitope-specific human T cells in the evaluation of new approaches to an immunotherapy of CMV disease. PMID:26181057

  18. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.


    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott


    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands. PMID:24185855

  19. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    PubMed Central

    Krömmelbein, Natascha; Wiebusch, Lüder; Schiedner, Gudrun; Büscher, Nicole; Sauer, Caroline; Florin, Luise; Sehn, Elisabeth; Wolfrum, Uwe; Plachter, Bodo


    The human cytomegalovirus (HCMV) replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP) is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production. PMID:26848680

  20. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges


    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  1. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication.


    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanpin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang


    The interplay between the host and Human cytomegalovirus (HCMV) plays a pivotal role in the outcome of an infection. HCMV growth in endothelial and epithelial cells requires expression of viral proteins UL128, UL130, and UL131 proteins (UL128-131), of which UL130 is the largest gene and the only one that is not interrupted by introns.Mutation of the C terminus of the UL130 protein causes reduced tropism of endothelial cells (EC). However, very few host factors have been identified that interact with the UL130 protein. In this study, HCMV UL130 protein was shown to directly interact with the human protein Snapin in human embryonic kidney HEK293 cells by Yeast two-hybrid screening, in vitro glutathione S-transferase (GST) pull-down, and co-immunoprecipitation. Additionally, heterologous expression of protein UL130 revealed co-localization with Snapin in the cell membrane and cytoplasm of HEK293 cells using fluorescence confocal microscopy. Furthermore, decreasing the level of Snapin via specific small interfering RNAs decreased the number of viral DNA copies and titer inHCMV-infected U373-S cells. Taken together, these results suggest that Snapin, the pUL130 interacting protein, has a role in modulating HCMV DNA synthesis. PMID:27240978

  2. Human cytomegalovirus RL13 protein interacts with host NUDT14 protein affecting viral DNA replication.


    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanping; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang


    The interaction between the host and human cytomegalovirus (HCMV) is important in determining the outcome of a viral infection. The HCMV RL13 gene product exerts independent, inhibitory effects on viral growth in fibroblasts and epithelial cells. At present, there are few reports on the interactions between the HCMV RL13 protein and human host proteins. The present study provided direct evidence for the specific interaction between HCMV RL13 and host nucleoside diphosphate linked moiety X (nudix)‑type motif 14 (NUDT14), a UDP‑glucose pyrophosphatase, using two‑hybrid screening, an in vitro glutathione S‑transferase pull‑down assay, and co‑immunoprecipitation in human embryonic kidney HEK293 cells. Additionally, the RL13 protein was shown to co‑localize with the NUDT14 protein in the HEK293 cell membrane and cytoplasm, demonstrated using fluorescence confocal microscopy. Decreasing the expression level of NUDT14 via NUDT14‑specific small interfering RNAs increased the number of viral DNA copies in the HCMV‑infected cells. However, the overexpression of NUDT14 in a stably expressing cell line did not affect viral DNA levels significantly in the HCMV infected cells. Based on the known functions of NUDT14, the results of the present study suggested that the interaction between the RL13 protein and NUDT14 protein may be involved in HCMV DNA replication, and that NUDT14 may offer potential in the modulation of viral infection. PMID:26781650

  3. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.


    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges


    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  4. Identification of domains within the human cytomegalovirus major immediate-early 86-kilodalton protein and the retinoblastoma protein required for physical and functional interaction with each other.

    PubMed Central

    Fortunato, E A; Sommer, M H; Yoder, K; Spector, D H


    The human cytomegalovirus major immediate-early 86-kDa protein (IE2 86) plays an important role in the trans activation and regulation of HCMV gene expression. Previously, we demonstrated that IE2 86 contains three regions (amino acids [aa] 86 to 135, 136 to 290, and 291 to 364) that can independently bind to in vitro-translated Rb when IE2 86 is produced as a glutathione S-transferase fusion protein (M. H. Sommer, A. L. Scully, and D. H. Spector, J. Virol. 68:6223-6231, 1994). In this report, we have elucidated the regions of Rb involved in binding to IE2 86 and have further analyzed the functional nature of the interaction between these two proteins. We find that two domains on Rb, the A/B pocket and the carboxy terminus, can each independently form a complex with IE2 86. In functional assays, we demonstrate that IE2 86 and another IE protein, IE1 72, can counter the enlarged flat cell phenotype, but not the G1/S block, which results from expression of wild-type Rb in the human osteosarcoma cell line Saos-2. Mutational analysis reveals that there are two domains on IE2 86 that can independently affect Rb function. One region (aa 241 to 369) includes the major Rb-binding domain, while the second maps to the amino-terminal region (aa 1 to 85) common to both IE2 86 and IE1 72. These data show that Rb and IE2 86 physically and functionally interact with each other via at least two separate domains and provide further support for the hypothesis that IE2 86 may exert its pleiotropic effects through the formation of multimeric protein complexes. PMID:9343168

  5. Inactivation of the Human Cytomegalovirus US20 Gene Hampers Productive Viral Replication in Endothelial Cells

    PubMed Central

    Cavaletto, Noemi; Luganini, Anna


    ABSTRACT The human cytomegalovirus (HCMV) US12 gene family includes a group of 10 contiguous genes (US12 to US21) encoding predicted seven-transmembrane-domain (7TMD) proteins that are nonessential for replication within cultured fibroblasts. Nevertheless, inactivation of some US12 family members affects virus replication in other cell types; e.g., deletion of US16 or US18 abrogates virus growth in endothelial and epithelial cells or in human gingival tissue, respectively, suggesting a role for some US12 proteins in HCMV cell tropism. Here, we provide evidence that another member, US20, impacts the ability of a clinical strain of HCMV to replicate in endothelial cells. Through the use of recombinant HCMV encoding tagged versions of the US20 protein, we investigated the expression pattern, localization, and topology of the US20-encoded protein (pUS20). We show that pUS20 is expressed as a partially glycosylated 7TMD protein which accumulates late in infection in endoplasmic reticulum-derived peripheral structures localized outside the cytoplasmic virus assembly compartment (cVAC). US20-deficient mutants generated in the TR clinical strain of HCMV exhibited major growth defects in different types of endothelial cells, whereas they replicated normally in fibroblasts and epithelial cells. While the attachment and entry phases in endothelial cells were not significantly affected by the absence of US20 protein, US20-null viruses failed to replicate viral DNA and express representative E and L mRNAs and proteins. Taken together, these results indicate that US20 sustains the HCMV replication cycle at a stage subsequent to entry but prior to E gene expression and viral DNA synthesis in endothelial cells. IMPORTANCE Human cytomegalovirus (HCMV) is a major pathogen in newborns and immunocompromised individuals. A hallmark of HCMV pathogenesis is its ability to productively replicate in an exceptionally broad range of target cells, including endothelial cells, which represent

  6. Human Cytomegalovirus Inhibition by Cardiac Glycosides: Evidence for Involvement of the hERG Gene

    PubMed Central

    Kapoor, Arun; Cai, Hongyi; Forman, Michael; He, Ran; Shamay, Meir


    Infection with human cytomegalovirus (HCMV) continues to be a major threat for pregnant women and the immunocompromised population. Although several anti-HCMV therapies are available, the development of new anti-HCMV agents is highly desired. There is growing interest in identifying compounds that might inhibit HCMV by modulating the cellular milieu. Interest in cardiac glycosides (CG), used in patients with congestive heart failure, has increased because of their established anticancer and their suggested antiviral activities. We report that the several CG—digoxin, digitoxin, and ouabain—are potent inhibitors of HCMV at nM concentrations. HCMV inhibition occurred prior to DNA replication, but following binding to its cellular receptors. The levels of immediate early, early, and late viral proteins and cellular NF-κB were significantly reduced in CG-treated cells. The activity of CG in infected cells correlated with the expression of the potassium channel gene, hERG. CMV infection upregulated hERG, whereas CG significantly downregulated its expression. Infection with mouse CMV upregulated mouse ERG (mERG), but treatment with CG did not inhibit virus replication or mERG transcription. These findings suggest that CG may inhibit HCMV by modulating human cellular targets associated with hERG and that these compounds should be studied for their antiviral activities. PMID:22777050

  7. Germline V-genes sculpt the binding site of a family of antibodies neutralizing human cytomegalovirus

    SciTech Connect

    Thomson, Christy A.; Bryson, Steve; McLean, Gary R.; Creagh, A. Louise; Pai, Emil F.; Schrader, John W.


    Immunoglobulin genes are generated somatically through specialized mechanisms resulting in a vast repertoire of antigen-binding sites. Despite the stochastic nature of these processes, the V-genes that encode most of the antigen-combining site are under positive evolutionary selection, raising the possibility that V-genes have been selected to encode key structural features of binding sites of protective antibodies against certain pathogens. Human, neutralizing antibodies to human cytomegalovirus that bind the AD-2S1 epitope on its gB envelope protein repeatedly use a pair of well-conserved, germline V-genes IGHV3-30 and IGKV3-11. Here, we present crystallographic, kinetic and thermodynamic analyses of the binding site of such an antibody and that of its primary immunoglobulin ancestor. These show that these germline V-genes encode key side chain contacts with the viral antigen and thereby dictate key structural features of the hypermutated, high-affinity neutralizing antibody. V-genes may thus encode an innate, protective immunological memory that targets vulnerable, invariant sites on multiple pathogens.

  8. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades

    PubMed Central

    Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; dos Santos, Claudia Januário; Carlan Silva, Maria Cristina


    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties. PMID:27458810

  9. Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

    NASA Astrophysics Data System (ADS)

    Gaspar, Miguel; Shenk, Thomas


    The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway

  10. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway

    PubMed Central

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit


    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication. PMID:26830977

  11. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.


    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  12. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.


    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  13. Virion Glycoprotein-Mediated Immune Evasion by Human Cytomegalovirus: a Sticky Virus Makes a Slick Getaway.


    Gardner, Thomas J; Tortorella, Domenico


    The prototypic herpesvirus human cytomegalovirus (CMV) exhibits the extraordinary ability to establish latency and maintain a chronic infection throughout the life of its human host. This is even more remarkable considering the robust adaptive immune response elicited by infection and reactivation from latency. In addition to the ability of CMV to exist in a quiescent latent state, its persistence is enabled by a large repertoire of viral proteins that subvert immune defense mechanisms, such as NK cell activation and major histocompatibility complex antigen presentation, within the cell. However, dissemination outside the cell presents a unique existential challenge to the CMV virion, which is studded with antigenic glycoprotein complexes targeted by a potent neutralizing antibody response. The CMV virion envelope proteins, which are critical mediators of cell attachment and entry, possess various characteristics that can mitigate the humoral immune response and prevent viral clearance. Here we review the CMV glycoprotein complexes crucial for cell attachment and entry and propose inherent properties of these proteins involved in evading the CMV humoral immune response. These include viral glycoprotein polymorphism, epitope competition, Fc receptor-mediated endocytosis, glycan shielding, and cell-to-cell spread. The consequences of CMV virion glycoprotein-mediated immune evasion have a major impact on persistence of the virus in the population, and a comprehensive understanding of these evasion strategies will assist in designing effective CMV biologics and vaccines to limit CMV-associated disease. PMID:27307580

  14. Polyfunctional T cells accumulate in large human cytomegalovirus-specific T cell responses.


    Lachmann, Raskit; Bajwa, Martha; Vita, Serena; Smith, Helen; Cheek, Elizabeth; Akbar, Arne; Kern, Florian


    Large cytomegalovirus (CMV)-specific CD8 T-cell responses are observed in both young and, somewhat more often, old people. Frequent CMV reactivation is thought to exhaust these cells and render them dysfunctional so that larger numbers of them are needed to control CMV. Expansions of CMV-specific CD4 T cells are also seen but are less well studied. In this study, we examined the T-cell response to the dominant CMV pp65 and IE-1 antigens in healthy CMV-infected people across a wide age range (20 to 84 years) by using multicolor flow cytometry. CMV-specific T cells were characterized by the activation markers CD40 ligand (CD40L), interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-α), and gamma interferon (IFN-γ) and the memory markers CD27 and CD45RA. The proportions of effector memory T cells increased in large responses, as did the proportions of polyfunctional CD8 (IFN-γ(+) IL-2(+/-) TNF-α(+)) and CD4 (CD40L(+/-) IFN-γ(+) IL-2(+) TNF-α(+)) T-cell subsets, while the proportion of naïve T cells decreased. The bigger the CD4 or CD8 T-cell response to pp65, the larger was the proportion of T cells with an advanced memory phenotype in the entire (including non-CMV-specific) T-cell compartment. In addition, the number of activation markers per cell correlated with the degree of T-cell receptor downregulation, suggesting increased antigen sensitivity in polyfunctional cells. In summary, our findings show that polyfunctional CMV-specific T cells were not superseded by dysfunctional cells, even in very large responses. At the same time, however, the memory subset composition of the entire T-cell compartment correlated with the size of the T-cell response to CMV pp65, confirming a strong effect of CMV infection on the immune systems of some, but not all, infected people. PMID:22072753

  15. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.


    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam


    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  16. Human Cytomegalovirus in Oral Squamous Cell Carcinoma in Southeast of Iran

    PubMed Central

    Saravani, Shirin; Kadeh, Hamideh; Miri-Moghaddam, Ebrahim; Zekri, Ali; Sanadgol, Nima; Gholami, Aliye


    Background: Carcinogenesis is a multi-step process and the role of infectious agents in this progression has not been fully identified. Since human cytomegalovirus (HCMV) is frequently presented in the gingival sulcus fluid, we hypothesized that this virus would be important in the pathogenesis of oral squamous cell carcinoma (OSCC). Objectives: The aim of this study was to investigate the presence of active HCMV in different histopathological grades of OSCC in southeast of Iran. Materials and Methods: Forty eight individual specimens were evaluated in this study. Serial sections were obtained from paraffin-embedded tissue samples of OSCC biopsies. The frequency of HCMV was investigated using the real-time polymerase change reaction method after DNA extraction from biopsies. Results: The mean age of the patients (66.7% female and 33.3% male) was 58.6 years. Only three cases (6.3%) of the grade I, OSCC biopsies, were positive for active HCMV with average load of 57.7 × 103. Conclusions: According to the low prevalence of HCMV in OSCC, it seems that this virus plays a minor role in this kind of cancer at least in southeast of Iran. More comprehensive studies are needed to investigate the oncomodulatory effect of this virus on OSCC. PMID:26464768

  17. The intimate relationship between human cytomegalovirus and the dendritic cell lineage

    PubMed Central

    Sinclair, John; Reeves, Matthew


    Primary infection of healthy individuals with human cytomegalovirus (HCMV) is normally asymptomatic but results in the establishment of a lifelong infection of the host. One important cellular reservoir of HCMV latency is the CD34+ haematopoietic progenitor cells resident in the bone marrow. Viral gene expression is highly restricted in these cells with an absence of viral progeny production. However, cellular differentiation into mature myeloid cells is concomitant with the induction of a full lytic transcription program, DNA replication and, ultimately, the production of infectious viral progeny. Such reactivation of HCMV is a major cause of morbidity and mortality in a number of immune-suppressed patient populations. Our current understanding of HCMV carriage and reactivation is that cellular differentiation of the CD34+ progenitor cells through the myeloid lineage, resulting in terminal differentiation to either a macrophage or dendritic cell (DC) phenotype, is crucial for the reactivation event. In this mini-review, we focus on the interaction of HCMV with DCs, with a particular emphasis on their role in reactivation, and discuss how the critical regulation of viral major immediate-early gene expression appears to be delicately entwined with the activation of cellular pathways in differentiating DCs. Furthermore, we also explore the possible immune consequences associated with reactivation in a professional antigen presenting cell and potential countermeasures HCMV employs to abrogate these. PMID:25147545

  18. Human cytomegalovirus UL97 kinase confers ganciclovir susceptibility to recombinant vaccinia virus.

    PubMed Central

    Metzger, C; Michel, D; Schneider, K; Lüske, A; Schlicht, H J; Mertens, T


    We analyzed whether the phosphotransferase encoded by the UL97 open reading frame of human cytomegalovirus (HCMV) alone is sufficient to confer ganciclovir (GCV) susceptibility to a foreign virus. Two vaccinia virus recombinants (T1 and A5) containing the UL97 open reading frames from a GCV-sensitive HCMV and from a GCV-resistant strain were constructed. T1 exhibited a GCV-sensitive phenotype in plaque reduction assays, whereas A5 did not. Moreover, T1-infected cell cultures showed a strongly increased incorporation of [14C]GCV triphosphate into macromolecular DNA, compared with recombinant A5 or vaccinia virus controls, which could be inhibited by the addition of guanosine. This shows that UL97 kinase is the only additional gene product required to make vaccinia virus susceptible to GCV, and guanosine seems to be one natural substrate for the enzyme. The system described here should be very helpful for fast and detailed functional analyses of UL97 mutations found in GCV-resistant HCMV isolates. Images PMID:7966639

  19. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.


    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E


    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  20. Virological and Immunological Characteristics of Human Cytomegalovirus Infection Associated With Alzheimer Disease

    PubMed Central

    Lurain, Nell S.; Hanson, Barbara A.; Martinson, Jeffrey; Leurgans, Sue E.; Landay, Alan L.; Bennett, David A.; Schneider, Julie A.


    Serum, cerebrospinal fluid (CSF), and cryopreserved lymphocytes from subjects in the Rush Alzheimer's Disease Center Religious Orders Study were analyzed for associations between cytomegalovirus (CMV) infection and clinical and pathological markers of Alzheimer disease. CMV antibody levels were associated with neurofibrillary tangles (NFTs). CSF interferon γ was only detected in seropositive subjects and was significantly associated with NFTs. The percentage of senescent T cells (CD4+ or CD8+CD28−CD57+) was significantly higher for CMV-seropositive as compared to CMV-seronegative subjects and was marginally associated with the pathologic diagnosis of Alzheimer disease (CD4+) or amyloid-β (CD8+). Immunocytochemical analysis showed induction of amyloid-β in human foreskin fibroblasts (HFFs) infected with each of 3 clinical CMV strains. In the same subjects, there was no association of herpes simplex virus type 1 (HSV-1) antibody levels with CMV antibody levels or clinical or pathological markers of Alzheimer disease. HSV-1 infection of HFFs did not induce amyloid-β. These data support an association between CMV and the development of Alzheimer disease. PMID:23661800

  1. Use of flow cytometry for characterization of human cytomegalovirus vaccine particles.


    Vlasak, Josef; Hoang, Van M; Christanti, Sianny; Peluso, Richard; Li, Fengsheng; Culp, Timothy D


    Despite a 40-year effort, an effective vaccine against human cytomegalovirus (HCMV) remains an unmet medical need. The discovery of potent neutralizing epitopes on the pentameric gH complex (gH/gL/UL128/130/131) has reenergized HCMV vaccine development. Our whole-virus vaccine candidate, currently in a Phase I clinical trial, is based on the attenuated AD169 strain with restored expression of the pentameric gH complex. Given the complexity of a whole-virus vaccine, improved analytical methods have been developed to better characterize heterogeneous viral particles released from infected cells during vaccine production. Here we show the utility of a commercial flow cytometer for the detection of individual HCMV particles, either via light scattering or using fluorescence after labeling of specific antigens. Rapid measurements requiring minimal material provide near real-time information on particle concentration, distributions of different particle types, and product purity. Additionally, utilizing immunoreagents has allowed us to characterize the distribution of key antigens across individual particles and particle types. PMID:27020711

  2. Commutability of the First World Health Organization International Standard for Human Cytomegalovirus

    PubMed Central

    Preiksaitis, J.; Tong, Y.; Pang, X.; Sun, Y.; Tang, L.; Cook, L.; Pounds, S.; Fryer, J.; Caliendo, A. M.


    Quantitative detection of cytomegalovirus (CMV) DNA has become a standard part of care for many groups of immunocompromised patients; recent development of the first WHO international standard for human CMV DNA has raised hopes of reducing interlaboratory variability of results. Commutability of reference material has been shown to be necessary if such material is to reduce variability among laboratories. Here we evaluated the commutability of the WHO standard using 10 different real-time quantitative CMV PCR assays run by eight different laboratories. Test panels, including aliquots of 50 patient samples (40 positive samples and 10 negative samples) and lyophilized CMV standard, were run, with each testing center using its own quantitative calibrators, reagents, and nucleic acid extraction methods. Commutability was assessed both on a pairwise basis and over the entire group of assays, using linear regression and correspondence analyses. Commutability of the WHO material differed among the tests that were evaluated, and these differences appeared to vary depending on the method of statistical analysis used and the cohort of assays included in the analysis. Depending on the methodology used, the WHO material showed poor or absent commutability with up to 50% of assays. Determination of commutability may require a multifaceted approach; the lack of commutability seen when using the WHO standard with several of the assays here suggests that further work is needed to bring us toward true consensus. PMID:26269622

  3. Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35

    SciTech Connect

    Salsman, Jayme; Wang Xueqi; Frappier, Lori


    The human cytomegalovirus (HCMV) UL35 gene encodes two proteins, UL35 and UL35a. Expression of UL35 in transfected cells results in the formation of UL35 nuclear bodies that associate with promyelocytic leukemia (PML) protein. PML forms the basis for PML nuclear bodies that are important for suppressing viral lytic gene expression. Given the important relationship between PML and viral infection, we have further investigated the association of UL35 with PML bodies. We demonstrate that UL35 bodies form independently of PML and subsequently recruit PML, Sp100 and Daxx. In contrast, UL35a did not form bodies; however, it could bind UL35 and inhibit the formation of UL35 bodies. The HCMV tegument protein pp71 promoted the formation of UL35 bodies and the cytoplasmic localization of UL35a. Similarly, UL35a shifted pp71 to the cytoplasm. These results indicate that the interplay between UL35, UL35a and pp71 affects their subcellular localization and likely their functions throughout infection.

  4. Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci

    SciTech Connect

    Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En


    The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.

  5. Human Cytomegalovirus Antigens in Malignant Gliomas as Targets for Adoptive Cellular Therapy

    PubMed Central

    Landi, Daniel; Hegde, Meenakshi; Ahmed, Nabil


    Malignant gliomas are the most common primary brain tumor in adults, with over 12,000 new cases diagnosed in the United States each year. Over the last decade, investigators have reliably identified human cytomegalovirus (HCMV) proteins, nucleic acids, and virions in most high-grade gliomas, including glioblastoma (GBM). This discovery is significant because HCMV gene products can be targeted by immune-based therapies. In this review, we describe the current level of understanding regarding the presence and role in pathogenesis of HCMV in GBM. We describe our success detecting and expanding HCMV-specific cytotoxic T lymphocytes to kill GBM cells and explain how these cells can be used as a platform for enhanced cellular therapies. We discuss alternative approaches that capitalize on HCMV infection to treat patients with HCMV-positive tumors. Adoptive cellular therapy for HCMV-positive GBM has been tried in a small number of patients with some benefit, but we reason why, to date, these approaches generally fail to generate long-term remission or cure. We conjecture how cellular therapy for GBM can be improved and describe the barriers that must be overcome to cure these patients. PMID:25505736

  6. Nuclear trafficking of the human cytomegalovirus pp71 (ppUL82) tegument protein

    SciTech Connect

    Shen Weiping; Westgard, Elizabeth; Huang Liqun; Ward, Michael D.; Osborn, Jodi L.; Chau, Nha H.; Collins, Lindsay; Marcum, Benjamin; Koach, Margaret A.; Bibbs, Jennifer; Semmes, O. John; Kerry, Julie A.


    The human cytomegalovirus tegument protein pp71 localizes to the nucleus immediately upon infection, and functions to initiate viral gene expression. Analysis of a series of random insertion mutations revealed that sequences within the mid region (MR) of pp71 are important for localization to the nucleus. Fusion of MR sequences with eGFP revealed that amino acids 94 to 300 were sufficient to target proteins to the nucleus. Random substitution mutagenesis within this domain resulted in two double substitution mutants, pp71P203T/T223M and pp71T228M/L275Q, with a predominantly cytoplasmic localization. Disruption of nuclear targeting resulted in relocalization of the fusion proteins to a distinct perinuclear region. Using tandem mass spectrometry, we determined that threonine 223 can be phosphorylated. Mutation of this residue to a phosphomimetic amino acid resulted in abrogation of nuclear targeting. These results strongly suggest that the intracellular trafficking of pp71 is regulated by phosphorylation.

  7. Cytomegalovirus infection impairs immunosuppressive and antimicrobial effector functions of human multipotent mesenchymal stromal cells.


    Meisel, Roland; Heseler, Kathrin; Nau, Julia; Schmidt, Silvia Kathrin; Leineweber, Margret; Pudelko, Sabine; Wenning, Johannes; Zimmermann, Albert; Hengel, Hartmut; Sinzger, Christian; Degistirici, Özer; Sorg, Rüdiger Volker; Däubener, Walter


    Human mesenchymal stromal cells (MSC) possess immunosuppressive and antimicrobial effects that are partly mediated by the tryptophan-catabolizing enzyme indoleamine-2,3-dioxygenase (IDO). Therefore MSC represent a promising novel cellular immunosuppressant which has the potential to control steroid-refractory acute graft versus host disease (GvHD). In addition, MSC are capable of reducing the risk of infection in patients after haematopoietic stem cell transplantation (HST). Recent data indicate that signals from the microenvironment including those from microbes may modulate MSC effector functions. As Cytomegalovirus (CMV) represents a prominent pathogen in immunocompromised hosts, especially in patients following HST, we investigated the impact of CMV infection on MSC-mediated effects on the immune system. We demonstrate that CMV-infected MSC lose their cytokine-induced immunosuppressive capacity and are no longer able to restrict microbial growth. IDO expression is substantially impaired following CMV infection of MSC and this interaction critically depends on intact virus and the number of MSC as well as the viral load. Since overt CMV infection may undermine the clinical efficacy of MSC in the treatment of GvHD in transplant patients, we recommend that patients scheduled for MSC therapy should undergo thorough evaluation for an active CMV infection and receive CMV-directed antiviral therapy prior to the administration of MSC. PMID:24782599

  8. Human Cytomegalovirus Secretome Contains Factors That Induce Angiogenesis and Wound Healing

    SciTech Connect

    Dumortier, Jerome; Streblow, Daniel N.; Moses, Ashlee V.; Jacobs, Jon M.; Kreklywich, Craig N.; Camp, David G.; Smith, Richard D.; Orloff, Susan L.; Nelson, Jay


    Human cytomegalovirus (HCMV) is implicated in the acceleration of a number of vascular diseases including transplant vascular sclerosis (TVS), the lesion associated with chronic rejection (CR) of solid organ transplants. Although the virus persists in the allograft throughout the course of disease, few cells are directly infected by CMV. This observation is in contrast to the global effects that CMV has on the acceleration of TVS/CR, suggesting that CMV infection indirectly promotes the vascular disease process. Recent transcriptome analysis of CMV-infected heart allografts indicates that the virus induces cytokines and growth factors associated with angiogenesis (AG) and wound healing (WH), suggesting that CMV may accelerate TVS/CR through the induction and secretion of AG/WH factors from infected cells. We analyzed virus-free supernatants from HCMV-infected cells (HCMV secretomes) for growth factors, by mass spectrometry and immunoassays, and found that the HCMV secretome contains over 1,000 cellular proteins, many of which are involved in AG/WH. Importantly, functional assays demonstrated that CMV but not herpes simplex virus secretomes not only induce AG/WH but also promote neovessel stabilization and endothelial cell survival for 2 weeks. These findings suggest that CMV acceleration of TVS occurs through virus-induced growth factors and cytokines in the CMV secretome.

  9. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene.

    PubMed Central

    Heilbronn, R; Jahn, G; Bürkle, A; Freese, U K; Fleckenstein, B; zur Hausen, H


    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSV-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at Tm - 25 degrees C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Epstein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein. Images PMID:3023689

  10. Sites and roles of phosphorylation of the human cytomegalovirus DNA polymerase subunit UL44

    SciTech Connect

    Silva, Laurie A.; Strang, Blair L.; Lin, Eric W.; Kamil, Jeremy P.; Coen, Donald M.


    The human cytomegalovirus DNA polymerase subunit UL44 is a phosphoprotein, but its sites and roles of phosphorylation have not been investigated. We compared sites of phosphorylation of UL44 in vitro by the viral protein kinase UL97 and cyclin-dependent kinase 1 with those in infected cells. Transient treatment of infected cells with a UL97 inhibitor greatly reduced labeling of two minor UL44 phosphopeptides. Viruses containing alanine substitutions of most UL44 residues that are phosphorylated in infected cells exhibited at most modest effects on viral DNA synthesis and yield. However, substitution of highly phosphorylated sites adjacent to the nuclear localization signal abolished viral replication. The results taken together are consistent with UL44 being phosphorylated directly by UL97 during infection, and a crucial role for phosphorylation-mediated nuclear localization of UL44 for viral replication, but lend little support to the widely held hypothesis that UL97-mediated phosphorylation of UL44 is crucial for viral DNA synthesis.

  11. Superresolution Imaging of Human Cytomegalovirus vMIA Localization in Sub-Mitochondrial Compartments

    PubMed Central

    Bhuvanendran, Shivaprasad; Salka, Kyle; Rainey, Kristin; Sreetama, Sen Chandra; Williams, Elizabeth; Leeker, Margretha; Prasad, Vidhya; Boyd, Jonathan; Patterson, George H.; Jaiswal, Jyoti K.; Colberg-Poley, Anamaris M.


    The human cytomegalovirus (HCMV) viral mitochondria-localized inhibitor of apoptosis (vMIA) protein, traffics to mitochondria-associated membranes (MAM), where the endoplasmic reticulum (ER) contacts the outer mitochondrial membrane (OMM). vMIA association with the MAM has not been visualized by imaging. Here, we have visualized this by using a combination of confocal and superresolution imaging. Deconvolution of confocal microscopy images shows vMIA localizes away from mitochondrial matrix at the Mitochondria-ER interface. By gated stimulated emission depletion (GSTED) imaging, we show that along this interface vMIA is distributed in clusters. Through multicolor, multifocal structured illumination microscopy (MSIM), we find vMIA clusters localize away from MitoTracker Red, indicating its OMM localization. GSTED and MSIM imaging show vMIA exists in clusters of ~100–150 nm, which is consistent with the cluster size determined by Photoactivated Localization Microscopy (PALM). With these diverse superresolution approaches, we have imaged the clustered distribution of vMIA at the OMM adjacent to the ER. Our findings directly compare the relative advantages of each of these superresolution imaging modalities for imaging components of the MAM and sub-mitochondrial compartments. These studies establish the ability of superresolution imaging to provide valuable insight into viral protein location, particularly in the sub-mitochondrial compartments, and into their clustered organization. PMID:24721787

  12. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins

    PubMed Central

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong


    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%–99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy. PMID:26114473

  13. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam


    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  14. On the relative roles of background selection and genetic hitchhiking in shaping human cytomegalovirus genetic diversity.


    Renzette, Nicholas; Kowalik, Timothy F; Jensen, Jeffrey D


    A central focus of population genetics has been examining the contribution of selective and neutral processes in shaping patterns of intraspecies diversity. In terms of selection specifically, surveys of higher organisms have shown considerable variation in the relative contributions of background selection and genetic hitchhiking in shaping the distribution of polymorphisms, although these analyses have rarely been extended to bacteria and viruses. Here, we study the evolution of a ubiquitous, viral pathogen, human cytomegalovirus (HCMV), by analysing the relationship among intraspecies diversity, interspecies divergence and rates of recombination. We show that there is a strong correlation between diversity and divergence, consistent with expectations of neutral evolution. However, after correcting for divergence, there remains a significant correlation between intraspecies diversity and recombination rates, with additional analyses suggesting that this correlation is largely due to the effects of background selection. In addition, a small number of loci, centred on long noncoding RNAs, also show evidence of selective sweeps. These data suggest that HCMV evolution is dominated by neutral mechanisms as well as background selection, expanding our understanding of linked selection to a novel class of organisms. PMID:26211679

  15. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.


    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  16. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.


    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  17. Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169

    SciTech Connect

    Wright, D.A.; Staprans, S.I.; Spector, D.H.


    In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the (/sup 35/S)methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region.

  18. Human cytomegalovirus antiviral drug resistance in hematopoietic stem cell transplantation: current state of the art.


    Campos, Ana Bela; Ribeiro, Joana; Boutolleau, David; Sousa, Hugo


    Human cytomegalovirus (HCMV) infection is a major cause of morbidity and mortality in allogeneic hematopoietic stem cell transplant recipients. The significant clinical impact of HCMV infection and progression to HCMV disease among allogeneic hematopoietic stem cell transplant recipients has been reduced by prophylactic, preemptive, and curative treatments using ganciclovir, valganciclovir, foscarnet, and cidofovir. Resistance to (val)ganciclovir results from mutations localized in HCMV UL97 gene (encoding the pUL97 phosphotransferase), UL54 gene (encoding the pUL54 DNA polymerase), or both genes, whereas foscarnet and cidofovir resistance results from mutations localized within UL54 gene only. This review is focused on HCMV antiviral drug resistance, including the functions of target genes of antivirals, the mechanisms of antiviral resistance, the different mutations in pUL97 and pUL54 that have been identified in either clinical isolates or laboratory strains, and their impact on HCMV susceptibility to antiviral drugs. It emphasizes the importance of proving that observed genetic changes confer resistance so they can be distinguished from polymorphisms. Because of the emergence of HCMV resistance to currently available drugs, novel drugs are urgently needed for the therapeutic management of HCMV-resistant infections in hematopoietic stem cell transplant patients. PMID:26990717

  19. Human cytomegalovirus-encoded US28 may act as a tumor promoter in colorectal cancer

    PubMed Central

    Cai, Zhen-Zhai; Xu, Jian-Gang; Zhou, Yu-Hui; Zheng, Ji-Hang; Lin, Ke-Zhi; Zheng, Shu-Zhi; Ye, Meng-Si; He, Yun; Liu, Chang-Bao; Xue, Zhan-Xiong


    AIM: To assess human cytomegalovirus-encoded US28 gene function in colorectal cancer (CRC) pathogenesis. METHODS: Immunohistochemical analysis was performed to determine US28 expression in 103 CRC patient samples and 98 corresponding adjacent noncancerous samples. Patient data were compared by age, sex, tumor location, histological grade, Dukes’ stage, and overall mean survival time. In addition, the US28 gene was transiently transfected into the CRC LOVO cell line, and cell proliferation was assessed using a cell counting kit-8 assay. Cell cycle analysis by flow cytometry and a cell invasion transwell assay were also carried out. RESULTS: US28 levels were clearly higher in CRC tissues (38.8%) than in adjacent noncancerous samples (7.1%) (P = 0.000). Interestingly, elevated US28 amounts in CRC tissues were significantly associated with histological grade, metastasis, Dukes’ stage, and overall survival (all P < 0.05); meanwhile, US28 expression was not significantly correlated with age, sex or tumor location. In addition, multivariate Cox regression data revealed US28 level as an independent CRC prognostic marker (P = 0.000). LOVO cells successfully transfected with the US28 gene exhibited higher viability, greater chemotherapy resistance, accelerated cell cycle progression, and increased invasion ability. CONCLUSION: US28 expression is predictive of poor prognosis and may promote CRC. PMID:26973417

  20. Neutralizing antibodies are unable to inhibit direct viral cell-to-cell spread of human cytomegalovirus.


    Jacob, Christian L; Lamorte, Louie; Sepulveda, Eliud; Lorenz, Ivo C; Gauthier, Annick; Franti, Michael


    Infection with human cytomegalovirus (CMV) during pregnancy is the most common cause of congenital disorders, and can lead to severe life-long disabilities with associated high cost of care. Since there is no vaccine or effective treatment, current efforts are focused on identifying potent neutralizing antibodies. A panel of CMV monoclonal antibodies identified from patent applications, was synthesized and expressed in order to reproduce data from the literature showing that anti-glycoprotein B antibodies neutralized virus entry into all cell types and that anti-pentameric complex antibodies are highly potent in preventing virus entry into epithelial cells. It had not been established whether antibodies could prevent subsequent rounds of infection that are mediated primarily by direct cell-to-cell transmission. A thorough validation of a plaque reduction assay to monitor cell-to-cell spread led to the conclusion that neutralizing antibodies do not significantly inhibit plaque formation or reduce plaque size when they are added post-infection. PMID:23849792

  1. The Intracellular DNA Sensor IFI16 Gene Acts as Restriction Factor for Human Cytomegalovirus Replication

    PubMed Central

    Gariano, Grazia Rosaria; Dell'Oste, Valentina; Bronzini, Matteo; Gatti, Deborah; Luganini, Anna; De Andrea, Marco; Gribaudo, Giorgio; Gariglio, Marisa; Landolfo, Santo


    Human interferon (IFN)-inducible IFI16 protein, an innate immune sensor of intracellular DNA, modulates various cell functions, however, its role in regulating virus growth remains unresolved. Here, we adopt two approaches to investigate whether IFI16 exerts pro- and/or anti-viral actions. First, the IFI16 gene was silenced using specific small interfering RNAs (siRNA) in human embryo lung fibroblasts (HELF) and replication of DNA and RNA viruses evaluated. IFI16-knockdown resulted in enhanced replication of Herpesviruses, in particular, Human Cytomegalovirus (HCMV). Consistent with this, HELF transduction with a dominant negative form of IFI16 lacking the PYRIN domain (PYD) enhanced the replication of HCMV. Second, HCMV replication was compared between HELFs overexpressing either the IFI16 gene or the LacZ gene. IFI16 overexpression decreased both virus yield and viral DNA copy number. Early and late, but not immediate-early, mRNAs and proteins were strongly down-regulated, thus IFI16 may exert its antiviral effect by impairing viral DNA synthesis. Constructs with the luciferase reporter gene driven by deleted or site-specific mutated forms of the HCMV DNA polymerase (UL54) promoter demonstrated that the inverted repeat element 1 (IR-1), located between −54 and −43 relative to the transcription start site, is the target of IFI16 suppression. Indeed, electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated that suppression of the UL54 promoter is mediated by IFI16-induced blocking of Sp1-like factors. Consistent with these results, deletion of the putative Sp1 responsive element from the HCMV UL44 promoter also relieved IFI16 suppression. Together, these data implicate IFI16 as a novel restriction factor against HCMV replication and provide new insight into the physiological functions of the IFN-inducible gene IFI16 as a viral restriction factor. PMID:22291595

  2. Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

    PubMed Central

    Zheng, Xiaoqun; Gao, Yan; Zhang, Qi; Liu, Yanqing; Peng, Ying; Fu, Miao; Ji, Yanhong


    Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies. PMID:25658598

  3. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.


    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer


    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  4. A Role for Nuclear F-Actin Induction in Human Cytomegalovirus Nuclear Egress

    PubMed Central

    Wilkie, Adrian R.; Lawler, Jessica L.


    ABSTRACT Herpesviruses, which include important pathogens, remodel the host cell nucleus to facilitate infection. This remodeling includes the formation of structures called replication compartments (RCs) in which herpesviruses replicate their DNA. During infection with the betaherpesvirus, human cytomegalovirus (HCMV), viral DNA synthesis occurs at the periphery of RCs within the nuclear interior, after which assembled capsids must reach the inner nuclear membrane (INM) for translocation to the cytoplasm (nuclear egress). The processes that facilitate movement of HCMV capsids to the INM during nuclear egress are unknown. Although an actin-based mechanism of alphaherpesvirus capsid trafficking to the INM has been proposed, it is controversial. Here, using a fluorescently-tagged, nucleus-localized actin-binding peptide, we show that HCMV, but not herpes simplex virus 1, strongly induced nuclear actin filaments (F-actin) in human fibroblasts. Based on studies using UV inactivation and inhibitors, this induction depended on viral gene expression. Interestingly, by 24 h postinfection, nuclear F-actin formed thicker structures that appeared by super-resolution microscopy to be bundles of filaments. Later in infection, nuclear F-actin primarily localized along the RC periphery and between the RC periphery and the nuclear rim. Importantly, a drug that depolymerized nuclear F-actin caused defects in production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization near the nuclear rim, without decreasing capsid accumulation in the nucleus. Thus, our results suggest that for at least one herpesvirus, nuclear F-actin promotes capsid movement to the nuclear periphery and nuclear egress. We discuss our results in terms of competing models for these processes. PMID:27555312

  5. Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection.


    Sinclair, John


    Infection of cells with human cytomegalovirus (HCMV) has two potential outcomes. For instance, infection of fibroblasts results in extensive viral gene expression, viral DNA replication and release of progeny virus. In contrast, in undifferentiated myeloid cells, the lytic transcription programme of HCMV is effectively suppressed and cells undergo latent infection. It is now accepted that the suppression of viral lytic gene expression observed during latency in myeloid cells is a result of the inability of undifferentiated cell types to support robust viral immediate early (IE) gene expression--crucial genes responsible for driving the lytic cycle. The repression of IE gene expression in undifferentiated myeloid cells, at least in part, results from specific post-translational modifications of histones associated with the viral major immediate early promoter (MIEP). In cells of the early myeloid lineage, the histone modifications present on the MIEP impart on it a repressive chromatin structure preventing transcriptional activity. Reactivation of HCMV lytic infection is correlated to changes in histone modifications around the MIEP resulting in a chromatin structure conducive to transcriptional activity. These changes are intimately linked with the differentiation of myeloid cells - a phenomenon known to reactivate latent virus in vivo. Chromatin structure of the viral MIEP, therefore, plays a crucial role in latency and reactivation of this persistent human herpesvirus. Whether chromatin-mediated regulation of viral lytic gene expression also occurs, is only beginning to be addressed. However, recent work suggests that all classes of lytic HCMV promoters are subjected to regulation by post-translational modification of their associated histones throughout the time course of infection. Incoming viral genomes appear to be the targets of intrinsic cellular defence mechanisms which attempt to silence viral gene expression through chromatinisation. Viral functions

  6. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane


    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  7. Functional analysis of human cytomegalovirus UL/b' region using SCID-hu mouse model.


    Dulal, Kalpana; Cheng, Tong; Yang, Lianwei; Wang, Wei; Huang, Ying; Silver, Benjamin; Selariu, Anca; Xie, Cynthia; Wang, Dai; Espeseth, Amy; Lin, Yanzhen; Wen, Lanling; Xia, Ningshao; Fu, Tong-Ming; Zhu, Hua


    Human cytomegalovirus (HCMV) attenuated strains, Towne, and AD169, differ from prototypic pathogenic strains, such as Toledo, in that they are missing a ∼15-kb segment in the UL/b' region. In contrast to the attenuated strains, Toledo can replicate in human tissue implants in SCID (SCID-hu) mice. Thus, this model provides a unique in vivo system to study the mechanism of viral pathogenesis. Twenty-two ORFs have been annotated in the UL/b' region, including tissue-tropic genes encoded in a pentameric gH/gl complex. To differentiate the role of the pentameric gH/gl complex versus the functions of other ORFs in the 15-kb region in supporting viral growth in vivo, a series of recombinant viral strains were constructed and their ability to replicate in SCID-hu mice was tested. The mutations in the Towne and AD169 strains were repaired to restore their pentameric gH/gl complex and it was found that these changes did not rescue their inability to replicate in the SCID-hu mice. Subsequently four deletion viruses (D1, D2, D3, and D4) in the 15-kb region from the Toledo strain were created. It was demonstrated that D2 and D3 were able to grow in SCID-hu mice, while D1 and D4 were not viable. Interestingly, co-infection of the implant with the D1 and D4 viruses could compensate their respective growth defect in vivo. The results demonstrated that rescuing viral epithelial tropism is not sufficient to revert the attenuation phenotype of AD169 or Towne, and pathogenic genes are located in the segments missing in D1 and D4 viruses. J. Med. Virol. 88:1417-1426, 2016. © 2016 Wiley Periodicals, Inc. PMID:27249069

  8. Proteomic Analysis of the Multimeric Nuclear Egress Complex of Human Cytomegalovirus*

    PubMed Central

    Milbradt, Jens; Kraut, Alexandra; Hutterer, Corina; Sonntag, Eric; Schmeiser, Cathrin; Ferro, Myriam; Wagner, Sabrina; Lenac, Tihana; Claus, Claudia; Pinkert, Sandra; Hamilton, Stuart T.; Rawlinson, William D.; Sticht, Heinrich; Couté, Yohann; Marschall, Manfred


    Herpesviral capsids are assembled in the host cell nucleus before being translocated into the cytoplasm for further maturation. The crossing of the nuclear envelope represents a major event that requires the formation of the nuclear egress complex (NEC). Previous studies demonstrated that human cytomegalovirus (HCMV) proteins pUL50 and pUL53, as well as their homologs in all members of Herpesviridae, interact with each other at the nuclear envelope and form the heterodimeric core of the NEC. In order to characterize further the viral and cellular protein content of the multimeric NEC, the native complex was isolated from HCMV-infected human primary fibroblasts at various time points and analyzed using quantitative proteomics. Previously postulated components of the HCMV-specific NEC, as well as novel potential NEC-associated proteins such as emerin, were identified. In this regard, interaction and colocalization between emerin and pUL50 were confirmed by coimmunoprecipitation and confocal microscopy analyses, respectively. A functional validation of viral and cellular NEC constituents was achieved through siRNA-mediated knockdown experiments. The important role of emerin in NEC functionality was demonstrated by a reduction of viral replication when emerin expression was down-regulated. Moreover, under such conditions, reduced production of viral proteins and deregulation of viral late cytoplasmic maturation were observed. Combined, these data prove the functional importance of emerin as an NEC component, associated with pUL50, pUL53, pUL97, p32/gC1qR, and further regulatory proteins. Summarized, our findings provide the first proteomics-based characterization and functional validation of the HCMV-specific multimeric NEC. PMID:24969177

  9. Role of human cytomegalovirus in the proliferation and invasion of extravillous cytotrophoblasts isolated from early placentae

    PubMed Central

    Liu, Tao; Zheng, Xiaofei; Li, Qin; Chen, Juanjuan; Yin, Zongzhi; Xiao, Juan; Zhang, Dandan; Li, Wei; Qiao, Yuan; Chen, Suhua


    Aim: We investigated the role of human cytomegalovirus (HCMV) and its mechanism in extravillous cytotrophoblast (EVT) proliferation and invasion in vitro. Methods: Differential enzymatic digestion combined with gradient centrifugation, was used to isolate primary EVT from human chorionic villi collected from early placentae of healthy pregnant women. HCMV infection was determined by immunofluorescence staining of HCMVpp65 antigen expression. An MTT assay was used to examine the role of HCMV in the proliferation of EVT. Quantitative real-time polymerase chain reaction (qRT-PCR), immunocytochemical staining and Western blots were carried out in a control group (EVT) and a virus group (EVT+HCMV) to examine the expression of major genes and protein in TGF-β/Smad signaling pathways in EVT 48 h after inoculation with HCMV. An in vitro cell invasion assay was performed to analyze the influence of HCMV on EVT invasion. Results: HCMV significantly inhibited the proliferation of EVT 48 h after viral infection (P < 0.05). The expression of TGF-β1, Smad1, Smad2, Smad3, Smad4, and Smad5 genes was significantly increased (P < 0.05), but that of TGF-β2, TGF-β3, TGFβRI, TGFβRII, Smad7, MMP2, and MMP9 was significantly decreased in the virus group 48 h after HCMV infection (P < 0.05). Smad7, MMP-2 and MMP-9 protein levels were significantly decreased and the TGF-β1 protein level was significantly increased in infected EVT (all P < 0.05). Conclusions: HCMV may act on multiple steps of the TGF-β/Smad signaling pathway to impede EVT proliferation and invasion. PMID:26770317

  10. Identification of Human Cytomegalovirus Genes Important for Biogenesis of the Cytoplasmic Virion Assembly Complex

    PubMed Central

    Das, Subhendu; Ortiz, Daniel A.; Gurczynski, Stephen J.; Khan, Fatin


    ABSTRACT Human cytomegalovirus (HCMV) has many effects on cells, including remodeling the cytoplasm to form the cytoplasmic virion assembly complex (cVAC), the site of final virion assembly. Viral tegument, envelope, and some nonstructural proteins localize to the cVAC, and cytoskeletal filaments radiate from a microtubule organizing center in the cVAC. The endoplasmic reticulum (ER)-to-Golgi intermediate compartment, Golgi apparatus, and trans-Golgi network form a ring that outlines the cVAC. The center of the cVAC ring is occupied by numerous vesicles that share properties with recycling endosomes. In prior studies, we described the three-dimensional structure and the extensive remodeling of the cytoplasm and shifts in organelle identity that occur during development of the cVAC. The objective of this work was to identify HCMV proteins that regulate cVAC biogenesis. Because the cVAC does not form in the absence of viral DNA synthesis, we employed HCMV-infected cells transfected with synthetic small interfering RNAs (siRNAs) that targeted 26 candidate early-late and late protein-coding genes required for efficient virus replication. We identified three HCMV genes (UL48, UL94, and UL103) whose silencing had major effects on cVAC development, including failure to form the Golgi ring and dispersal of markers of early and recycling endosomes. To confirm and extend the siRNA results, we constructed recombinant viruses in which pUL48 and pUL103 are fused with a regulatable protein destabilization domain (dd-FKBP). In the presence of a stabilizing ligand (Shield-1), the cVAC appeared to develop normally. In its absence, cVAC development was abrogated, verifying roles for pUL48 and pUL103 in cVAC biogenesis. IMPORTANCE Human cytomegalovirus (HCMV) is an important human pathogen that causes disease and disability in immunocompromised individuals and in children infected before birth. Few drugs are available for treatment of HCMV infections. HCMV remodels the interior of

  11. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.


    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  12. Detection of human cytomegalovirus antigenaemia: a rapid diagnostic technique for predicting cytomegalovirus infection/pneumonitis in lung and heart transplant recipients.

    PubMed Central

    Egan, J. J.; Barber, L.; Lomax, J.; Fox, A.; Yonan, N.; Rahman, A. N.; Campbell, C. S.; Deiraniya, A. K.; Carroll, K. B.; Craske, J.


    BACKGROUND--New rapid diagnostic techniques offer the opportunity of early diagnosis of human cytomegalovirus (CMV) infection in immunocompromised patients at risk of developing CMV disease. The use of human CMV antigenaemia as a predictor of clinical CMV infection and disease in lung and heart transplant recipients was studied prospectively. METHODS--Twenty three heart and nine lung transplant recipients who survived 40 days were observed by standard CMV surveillance with serological testing, culture, and by sequential testing for CMV antigenaemia. CMV antigenaemia testing is a rapid and quantifiable technique in which a viral lower matrix protein is detected in cytospin preparations of peripheral blood polymorphonuclear leucocytes (PMNLs) by immunofluorescent staining. RESULTS--Eleven patients developed CMV infection and five developed CMV disease (four pneumonitis, one duodenitis). These clinical events occurred at a median of 65 days following transplantation. CMV antigenaemia occurred in 17 patients at a median of 35 days following transplantation. Detection of CMV antigenaemia had a sensitivity of 100%, a specificity of 93.7%, and a positive predictive value of 94.1% for CMV related illness. CMV antigenaemia was positive at a significant interval before the clinical event. High levels of CMV antigenaemia (> 50 CMV antigen positive cells/2 x 10(5) PMNLs) occurred in 11 patients and five of these developed disease. CMV antigenaemia of > 50 CMV antigen positive cells/2 x 10(5) PMNLs had a positive predictive value of 45.5% for disease but a negative predictive value of 100%. Patients with disease had higher levels of antigenaemia than those without disease. CONCLUSIONS--CMV antigenaemia is a rapid diagnostic technique which can identify patients likely to develop CMV disease, potentially allowing early treatment. Images PMID:7886659

  13. Human Cytomegalovirus Infection Interferes with the Maintenance and Differentiation of Trophoblast Progenitor Cells of the Human Placenta

    PubMed Central

    Tabata, Takako; Petitt, Matthew; Zydek, Martin; Fang-Hoover, June; Larocque, Nicholas; Tsuge, Mitsuru; Gormley, Matthew; Kauvar, Lawrence M.


    ABSTRACT Human cytomegalovirus (HCMV) is a major cause of birth defects that include severe neurological deficits, hearing and vision loss, and intrauterine growth restriction. Viral infection of the placenta leads to development of avascular villi, edema, and hypoxia associated with symptomatic congenital infection. Studies of primary cytotrophoblasts (CTBs) revealed that HCMV infection impedes terminal stages of differentiation and invasion by various molecular mechanisms. We recently discovered that HCMV arrests earlier stages involving development of human trophoblast progenitor cells (TBPCs), which give rise to the mature cell types of chorionic villi—syncytiotrophoblasts on the surfaces of floating villi and invasive CTBs that remodel the uterine vasculature. Here, we show that viral proteins are present in TBPCs of the chorion in cases of symptomatic congenital infection. In vitro studies revealed that HCMV replicates in continuously self-renewing TBPC lines derived from the chorion and alters expression and subcellular localization of proteins required for cell cycle progression, pluripotency, and early differentiation. In addition, treatment with a human monoclonal antibody to HCMV glycoprotein B rescues differentiation capacity, and thus, TBPCs have potential utility for evaluation of the efficacies of novel antiviral antibodies in protecting and restoring placental development. Our results suggest that HCMV replicates in TBPCs in the chorion in vivo, interfering with the earliest steps in the growth of new villi, contributing to virus transmission and impairing compensatory development. In cases of congenital infection, reduced responsiveness of the placenta to hypoxia limits the transport of substances from maternal blood and contributes to fetal growth restriction. IMPORTANCE Human cytomegalovirus (HCMV) is a leading cause of birth defects in the United States. Congenital infection can result in permanent neurological defects, mental retardation

  14. Biochemical, Biophysical, and Mutational Analyses of Subunit Interactions of the Human Cytomegalovirus Nuclear Egress Complex▿

    PubMed Central

    Sam, My D.; Evans, Brady T.; Coen, Donald M.; Hogle, James M.


    Nuclear egress, the trafficking of herpesvirus nucleocapsids from the nucleus to the cytoplasm, involves two conserved viral proteins that form a complex at the nuclear envelope, referred to as the nuclear egress complex. In human cytomegalovirus, these two proteins are called UL50 and UL53. To study UL50 and UL53 in molecular detail, these proteins were expressed in bacteria and purified. To obtain highly expressed, pure proteins, it was necessary to truncate both constructs based on sequence conservation and predicted secondary structural elements. Size exclusion chromatography and analytical ultracentrifugation studies indicated that the truncated form of UL50 is a monomer in solution, that the truncated form of UL53 is a homodimer, and that, when mixed, the two proteins form a heterodimer. To identify residues of UL53 crucial for homodimerization and for heterodimerization with UL50, we constructed and expressed mutant forms of UL53 containing alanine substitutions in a predicted helix. Isothermal titration calorimetry was used to measure the binding affinities of the UL53 mutants to UL50. UL53 residues, the replacement of which reduced binding to UL50, form a surface on one face of the predicted helix. Moreover, most of the substitutions that reduce UL53-UL50 interactions also reduced homodimerization. Substitutions that reduced the interaction between UL50 and UL53 in vitro also reduced colocalization of full-length UL50 and UL53 at the nuclear rim in transfected cells. These results demonstrate direct protein-protein interactions between these proteins that are likely to be mediated by a helix, and they have implications for understanding nuclear egress and for drug discovery. PMID:19153235

  15. Human cytomegalovirus gene expression in long-term infected glioma stem cells.


    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana


    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  16. Modeling of Human Cytomegalovirus Maternal-Fetal Transmission in a Novel Decidual Organ Culture ▿

    PubMed Central

    Weisblum, Yiska; Panet, Amos; Zakay-Rones, Zichria; Haimov-Kochman, Ronit; Goldman-Wohl, Debra; Ariel, Ilana; Falk, Haya; Natanson-Yaron, Shira; Goldberg, Miri D.; Gilad, Ronit; Lurain, Nell S.; Greenfield, Caryn; Yagel, Simcha; Wolf, Dana G.


    Human cytomegalovirus (HCMV) is the leading cause of congenital infection, associated with severe birth defects and intrauterine growth retardation. The mechanism of HCMV transmission via the maternal-fetal interface is largely unknown, and there are no animal models for HCMV. The initial stages of infection are believed to occur in the maternal decidua. Here we employed a novel decidual organ culture, using both clinically derived and laboratory-derived viral strains, for the ex vivo modeling of HCMV transmission in the maternal-fetal interface. Viral spread in the tissue was demonstrated by the progression of infected-cell foci, with a 1.3- to 2-log increase in HCMV DNA and RNA levels between days 2 and 9 postinfection, the expression of immediate-early and late proteins, the appearance of typical histopathological features of natural infection, and dose-dependent inhibition of infection by ganciclovir and acyclovir. HCMV infected a wide range of cells in the decidua, including invasive cytotrophoblasts, macrophages, and endothelial, decidual, and dendritic cells. Cell-to-cell viral spread was revealed by focal extension of infected-cell clusters, inability to recover infectious extracellular virus, and high relative proportions (88 to 93%) of cell-associated viral DNA. Intriguingly, neutralizing HCMV hyperimmune globulins exhibited inhibitory activity against viral spread in the decidua even when added at 24 h postinfection—providing a mechanistic basis for their clinical use in prenatal prevention. The ex vivo-infected decidual cultures offer unique insight into patterns of viral tropism and spread, defining initial stages of congenital HCMV transmission, and can facilitate evaluation of the effects of new antiviral interventions within the maternal-fetal interface milieu. PMID:21976654

  17. Diagnosis and management of human cytomegalovirus infection in the mother, fetus, and newborn infant.


    Revello, Maria Grazia; Gerna, Giuseppe


    Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection and mental retardation. HCMV infection, while causing asymptomatic infections in most immunocompetent subjects, can be transmitted during pregnancy from the mother with primary (and also recurrent) infection to the fetus. Hence, careful diagnosis of primary infection is required in the pregnant woman based on the most sensitive serologic assays (immunoglobulin M [IgM] and IgG avidity assays) and conventional virologic and molecular procedures for virus detection in blood. Maternal prognostic markers of fetal infection are still under investigation. If primary infection is diagnosed in a timely manner, prenatal diagnosis can be offered, including the search for virus and virus components in fetal blood and amniotic fluid, with fetal prognostic markers of HCMV disease still to be defined. However, the final step for definite diagnosis of congenital HCMV infection is detection of virus in the blood or urine in the first 1 to 2 weeks of life. To date, treatment of congenital infection with antiviral drugs is only palliative both prior to and after birth, whereas the only efficacious preventive measure seems to be the development of a safe and immunogenic vaccine, including recombinant, subunit, DNA, and peptide-based vaccines now under investigation. The following controversial issues are discussed in the light of the most recent advances in the field: the actual perception of the problem; universal serologic screening before pregnancy; the impact of correct counseling on decision making by the couple involved; the role of prenatal diagnosis in ascertaining transmission of virus to the fetus; the impact of preconceptional and periconceptional infections on the prevalence of congenital infection; and the prevalence of congenitally infected babies born to mothers who were immune prior to pregnancy compared to the number born to mothers undergoing primary infection during pregnancy. PMID

  18. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.


    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong


    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  19. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay


    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  20. The human cytomegalovirus UL97 protein is a protein kinase that autophosphorylates on serines and threonines.

    PubMed Central

    He, Z; He, Y S; Kim, Y; Chu, L; Ohmstede, C; Biron, K K; Coen, D M


    The product of the human cytomegalovirus (CMV) UL97 gene, which controls ganciclovir phosphorylation in virus-infected cells, is homologous to known protein kinases but diverges from them at a number of positions that are functionally important. To investigate UL97, we raised an antibody against it and overexpressed it in baculovirus-infected insect cells. Recombinant baculovirus expressing full-length UL97 directed the phosphorylation of ganciclovir in insect cells, which was abolished by a four-codon deletion that confers ganciclovir resistance to CMV. When incubated with [gamma-32P]ATP, full-length UL97 was phosphorylated on serine and threonine residues. Phosphorylation was severely impaired by a point mutation that alters lysine-355 in a motif that aligns with subdomain II of protein kinases. However, phosphorylation was impaired much less severely by the four-codon deletion. A UL97 fusion protein expressed from recombinant baculovirus was purified to near homogeneity. It too was phosphorylated upon incubation with [gamma-32P]ATP in vitro. This phosphorylation, which was abolished by the lysine 355 mutation, was optimal at high NaCl and high pH. The activity required either Mn2+ or Mg2+, with a preference for Mn2+, and utilized either ATP or GTP as a phosphate donor, with Kms of 2 and 4 microM, respectively. The phosphorylation rate was first order with protein concentration, consistent with autophosphorylation. These data strongly argue that UL97 is a serine/threonine protein kinase that autophosphorylates and suggest that the four-codon deletion affects its substrate specificity. PMID:8985364

  1. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism

    PubMed Central

    Li, Gang; Nguyen, Christopher C.; Ryckman, Brent J.; Britt, William J.; Kamil, Jeremy P.


    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes. PMID:25831500

  2. Human cytomegalovirus elicits fetal γδ T cell responses in utero

    PubMed Central

    Brouwer, Margreet; Donner, Catherine; Liesnard, Corinne; Tackoen, Marie; Van Rysselberge, Michel; Twité, Nicolas; Goldman, Michel; Marchant, Arnaud; Willems, Fabienne


    The fetus and infant are highly susceptible to viral infections. Several viruses, including human cytomegalovirus (CMV), cause more severe disease in early life compared with later life. It is generally accepted that this is a result of the immaturity of the immune system. γδ T cells are unconventional T cells that can react rapidly upon activation and show major histocompatibility complex–unrestricted activity. We show that upon CMV infection in utero, fetal γδ T cells expand and become differentiated. The expansion was restricted to Vγ9-negative γδ T cells, irrespective of their Vδ chain expression. Differentiated γδ T cells expressed high levels of IFN-γ, transcription factors T-bet and eomes, natural killer receptors, and cytotoxic mediators. CMV infection induced a striking enrichment of a public Vγ8Vδ1-TCR, containing the germline-encoded complementary-determining-region-3 (CDR3) δ1–CALGELGDDKLIF/CDR3γ8–CATWDTTGWFKIF. Public Vγ8Vδ1-TCR–expressing cell clones produced IFN-γ upon coincubation with CMV-infected target cells in a TCR/CD3-dependent manner and showed antiviral activity. Differentiated γδ T cells and public Vγ8Vδ1-TCR were detected as early as after 21 wk of gestation. Our results indicate that functional fetal γδ T cell responses can be generated during development in utero and suggest that this T cell subset could participate in antiviral defense in early life. PMID:20368575

  3. Human cytomegalovirus inhibits maturation and impairs function of monocyte-derived dendritic cells.


    Moutaftsi, Magdalena; Mehl, Anja M; Borysiewicz, Leszek K; Tabi, Zsuzsanna


    Dendritic cells (DCs) play a pivotal role in the generation of virus-specific cytotoxic T-cell responses, but some viruses can render DCs inefficient in stimulating T cells. We studied whether infection of DCs with human cytomegalovirus (HCMV) results in a suppression of DC function which may assist HCMV in establishing persistence. The effect of HCMV infection on the phenotype and function of monocyte-derived DCs and on their ability to mature following infection with an endothelial cell-adapted clinical HCMV isolate were studied. HCMV infection induced no maturation of DCs; instead, it efficiently down-regulated the expression of surface major histocompatibility complex (MHC) class I, CD40, and CD80 molecules. Slight down-regulation of MHC class II and CD86 molecules was also observed. Lipopolysaccharide (LPS)-induced maturation of infected DCs was strongly inhibited, as indicated by lower levels of surface expression of MHC class I, class II, costimulatory, and CD83 molecules. The down-regulation or inhibition of these surface markers occurred only in HCMV antigen-positive DCs. DCs produced no interleukin 12 (IL-12) and only low levels of tumor necrosis factor alpha (TNF-alpha) upon HCMV infection. Furthermore, cytokine production upon stimulation with LPS or CD40L was significantly impaired. Inhibition of cytokine production did not depend on viral gene expression as UV-irradiated HCMV resulted in the same effect. Proliferation and cytotoxicity of T cells specific to a recall antigen presented by DCs were also reduced when DCs were HCMV infected. This study shows that HCMV inhibits DC function, revealing a powerful viral strategy to delay or prevent the generation of virus-specific cytotoxic T cells. PMID:11929782

  4. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H


    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  5. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )


    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  6. Combinations of 3'-azido-3'-deoxythymidine (zidovudine) and phosphonoformate (foscarnet) against human immunodeficiency virus type 1 and cytomegalovirus replication in vitro.

    PubMed Central

    Eriksson, B F; Schinazi, R F


    Combinations of 3'-azido-3'-deoxythymidine and phosphonoformate produced a moderate synergistic inhibitory effect against human immunodeficiency virus type 1 in vitro at concentrations that are easily achieved in humans. The synergistic effect was more pronounced with increasing concentrations and was not secondary to toxic effects of the drugs. 3'-Azido-3'-deoxythymidine neither inhibited the replication of human cytomegalovirus in human embryonic lung fibroblasts nor interfered with the anticytomegalovirus effect of phosphonoformate. By using partially purified reverse transcriptase of human immunodeficiency virus type 1 and human cytomegalovirus DNA polymerase, various combinations of 3'-azido-3'-deoxythymidine-5'-triphosphate and phosphonoformate produced strong indications of additive interactions. The synergistic interactions in infected cells and the additive effects observed at the reverse transcriptase level indicate that mechanisms other than the reverse transcriptase may be of importance for the inhibition of human immunodeficiency virus replication by these two compounds. A concomitant treatment of cytomegalovirus infections, such as cytomegalovirus retinitis, with phosphonoformate in patients with acquired immunodeficiency syndrome receiving 3'-azido-3'-deoxythymidine may be appropriate, and this combination may also be useful in controlling human immunodeficiency virus infection. PMID:2546487

  7. Human Cytomegalovirus Modulates Expression of Noncanonical Wnt Receptor ROR2 To Alter Trophoblast Migration

    PubMed Central

    van Zuylen, Wendy J.; Ford, Caroline E.; Wong, Diana D. Y.


    ABSTRACT Maternal primary cytomegalovirus (CMV) infection, reactivation, or reinfection with a different viral strain may cause fetal injury and adverse pregnancy outcomes. Increasing evidence indicates that fetal injury results not only from direct viral cytopathic damage to the CMV-infected fetus but also from indirect effects through placental infection and dysfunction. CMV alters Wingless (Wnt) signaling, an essential cellular pathway involved in placentation, as evidenced by reduced transcription of canonical Wnt target genes and decreased Wnt3a-induced trophoblast migration. Whether CMV affects the noncanonical Wnt signaling pathway has been unclear. This study demonstrates for the first time that CMV infection inhibits Wnt5a-stimulated migration of human SGHPL-4 trophoblasts and that inhibition of the pathway restores normal migration of CMV-infected cells. Western blot and real-time PCR analyses show increased expression of noncanonical Wnt receptor ROR2 in CMV-infected trophoblasts. Mimicking the CMV-induced ROR2 protein expression via ectopic expression inhibited Wnt5a-induced trophoblast migration and reduced T cell-specific factor (TCF)/lymphoid enhancer-binding factor (LEF)-mediated transcription as measured using luciferase reporter assays. Gene silencing using small interfering RNA (siRNA) duplexes decreased ROR2 transcript and protein levels. In contrast, proliferation of SGHPL-4 trophoblasts, measured by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was not affected. The siRNA-mediated downregulation of ROR2 in trophoblasts rescued CMV-induced reduction in trophoblast migration. These data suggest a mechanism where CMV alters the expression of the Wnt receptor ROR2 to alter Wnt5a-mediated signaling and inhibit trophoblast motility. Inhibition of this mechanism may be a target for therapeutic intervention for CMV-induced placental damage and consequent fetal damage in congenital CMV infections. IMPORTANCE Maternal

  8. Early detection of cytomegalovirus-specific cytotoxic T lymphocytes against cytomegalovirus antigenemia in human leukocyte antigen haploidentical hematopoietic stem cell transplantation.


    Kato, Ruri; Tamaki, Hiroya; Ikegame, Kazuhiro; Yoshihara, Satoshi; Kaida, Katsuji; Taniguchi, Kyoko; Inoue, Takayuki; Ishii, Shinichi; Nakata, Jun; Fujioka, Tatsuya; Eguchi, Ryoji; Soma, Toshihiro; Okada, Masaya; Ogawa, Hiroyasu


    Human leukocyte antigen (HLA)-haploidentical stem cell transplantation (haplo-SCT) is associated with a high incidence of cytomegalovirus (CMV) infection, probably originating from the delayed reconstitution of CMV-specific T cell immunity. There have been few reports on the presence of CMV-specific cytotoxic T lymphocytes (CMV-CTLs) after haplo-SCT. We have studied CMV-specific immune reconstitution by measuring the absolute number of CMV-CTLs using a flow cytometry method with HLA-A2-restricted NLVPMVATV peptide dextramers. We examined the association between reconstitution patterns of CMV-CTLs and the duration of CMV antigenemia in 15 patients who underwent first allogeneic SCT from HLA-haploidentical-related donors with HLA-A2. In seven and eight patients, CMV antigenemia consecutively resolved for more than 4 weeks (the CMV antigenemia 'resolved' group) and intermittently persisted (the CMV antigenemia 'persistent' group) during a 100-day observation period, respectively. The group of the seven patients, in whom levels of CMV antigenemia were reduced to zero, had a significantly lower maximum level of CMV antigenemia than the CMV antigenemia persistent group. In contrast, the CMV antigenemia persistent group had a significantly higher maximum level of CMV-CTLs, but the levels took longer to peak. Despite no difference in general lymphocyte recovery between the two groups, the CMV antigenemia resolved group had significantly higher median CMV-CTL counts than the CMV antigenemia persistent group at 6 weeks after onset of CMV infection. Flow cytometry analysis of CMV-CTLs is a convenient method of monitoring reconstitution of CMV-specific lymphocyte immunity following haplo-SCT. PMID:26193851

  9. Classical and non-classical MHC I molecule manipulation by human cytomegalovirus: so many targets—but how many arrows in the quiver?

    PubMed Central

    Halenius, Anne; Gerke, Carolin; Hengel, Hartmut


    Major mechanisms for the recognition of pathogens by immune cells have evolved to employ classical and non-classical major histocompatibility complex class I (MHC I) molecules. Classical MHC I molecules present antigenic peptide ligands on infected cells to CD8+ T cells, whereas a key function for non-classical MHC I molecules is to mediate inhibitory or activating stimuli in natural killer (NK) cells. The structural diversity of MHC I puts immense pressure on persisting viruses, including cytomegaloviruses. The very large coding capacity of the human cytomegalovirus allows it to express a whole arsenal of immunoevasive factors assigned to individual MHC class I targets. This review summarizes achievements from more than two decades of intense research on how human cytomegalovirus manipulates MHC I molecules and escapes elimination by the immune system. PMID:25418469

  10. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.


    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  11. PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter.


    Chao, Sheng-Hao; Harada, Josephine N; Hyndman, Francie; Gao, Xiaoqi; Nelson, Christian G; Chanda, Sumit K; Caldwell, Jeremy S


    Cellular homeoproteins have been shown to regulate the transcription of several viruses, including herpes simplex viruses, human papillomaviruses, and mouse mammary tumor viruses. Previous studies investigating the anti-viral mechanisms of several cyclin-dependent kinase inhibitors showed that the homeoproteins, pre B-cell leukemia transcription factor 1 (PBX1) and PBX-regulating protein-1 (PREP1), function as transcriptional activators of Moloney murine leukemia virus. Here, we examined the involvement of cellular homeoproteins in regulating the activity of the human cytomegalovirus immediate early (CMV IE) promoter. We identified a 45-bp element located at position -593 to -549 upstream of the transcription start site of the CMV IE gene, which contains multiple putative homeoprotein binding motifs. Gel shift assays demonstrated the physical association between a homeodomain protein, pancreatic-duodenal homeobox factor-1 (PDX1) and the 45-bp cytomegalovirus (CMV) region. We further determined that PDX1 represses the CMV IE promoter activity in 293 cells. Overexpression of PDX1 resulted in a decrease in transcription of the CMV IE gene. Conversely, blocking PDX1 protein synthesis and mutating the PDX1 binding sites enhanced CMV IE-dependent transcription. Collectively, our results represent the first work demonstrating that a cellular homeoprotein, PDX1, may be a repressor involved in regulation of human CMV gene expression. PMID:14764605

  12. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus

    PubMed Central

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q.; Xu, Xin; Dulcey, Andrés E.; Marugan, Juan J.; Ferrer, Marc; Arav-Boger, Ravit


    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50−40±1.72 nM, CC50−8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected

  13. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.


    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J


    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  14. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus.


    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q; Xu, Xin; Dulcey, Andrés E; Marugan, Juan J; Ferrer, Marc; Arav-Boger, Ravit


    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50-40±1.72 nM, CC50-8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected RPS14

  15. Metabolism of Cyclopropavir and Ganciclovir in Human Cytomegalovirus-Infected Cells

    PubMed Central

    Drach, John C.


    Human cytomegalovirus (HCMV) is a widespread pathogen that can cause severe disease in immunologically immature and immunocompromised patients. The current standard of therapy for the treatment of HCMV infections is ganciclovir (GCV). However, high incidence rates of adverse effects are prevalent and limit the use of this drug. Cyclopropavir (CPV) is 10-fold more effective against HCMV in vitro than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively) without any observed increase in cytotoxicity (S. Zhou, J. M. Breitenbach, K. Z. Borysko, J. C. Drach, E. R. Kern, E. Gullen, Y. C. Cheng, and J. Zemlicka, J. Med. Chem. 47:566–575, 2004, doi:10.1021/jm030316s). We have previously determined that the viral protein kinase pUL97 and endogenous cellular kinases are responsible for the conversion of CPV to a triphosphate (TP), the active compound responsible for inhibiting viral DNA synthesis and viral replication. However, this conversion has not been observed in HCMV-infected cells. To that end, we subjected HCMV-infected cells to equivalently effective concentrations (∼5 times the EC50) of either CPV or GCV and observed a time-dependent increase in triphosphate levels for both compounds (CPV-TP = 121 ± 11 pmol/106 cells; GCV-TP = 43.7 ± 0.4 pmol/106 cells). A longer half-life was observed for GCV-TP (48.2 ± 5.7 h) than for CPV-TP (23.8 ± 5.1 h). The area under the curve for CPV-TP produced from incubation with 2.5 μM CPV was 8,680 ± 930 pmol · h/106 cells, approximately 2-fold greater than the area under the curve for GCV-TP of 4,520 ± 420 pmol · h/106 cells produced from incubation with 25 μM GCV. We therefore conclude that the exposure of HCMV-infected cells to CPV-TP is greater than that of GCV-TP under these experimental conditions. PMID:24514084

  16. Human Cytomegalovirus-Induces Cytokine Changes in the Placenta with Implications for Adverse Pregnancy Outcomes

    PubMed Central

    Hamilton, Stuart T.; Scott, Gillian; Naing, Zin; Iwasenko, Jenna; Hall, Beverley; Graf, Nicole; Arbuckle, Susan; Craig, Maria E.; Rawlinson, William D.


    Human cytomegalovirus (CMV) infection of the developing fetus can result in adverse pregnancy outcomes including death in utero. Fetal injury results from direct viral cytopathic damage to the CMV-infected fetus, although evidence suggests CMV placental infection may indirectly cause injury to the fetus, possibly via immune dysregulation with placental dysfunction. This study investigated the effects of CMV infection on expression of the chemokine MCP-1 (CCL2) and cytokine TNF-α in placentae from naturally infected stillborn babies, and compared these changes with those found in placental villous explant histocultures acutely infected with CMV ex vivo. Tissue cytokine protein levels were assessed using quantitative immunohistochemistry. CMV-infected placentae from stillborn babies had significantly elevated MCP-1 and TNF-α levels compared with uninfected placentae (p = 0.001 and p = 0.007), which was not observed in placentae infected with other microorganisms (p = 0.62 and p = 0.71) (n = 7 per group). Modelling acute clinical infection using ex vivo placental explant histocultures showed infection with CMV laboratory strain AD169 (0.2 pfu/ml) caused significantly elevated expression of MCP-1 and TNF-α compared with uninfected explants (p = 0.0003 and p<0.0001) (n = 25 per group). Explant infection with wild-type Merlin at a tenfold lower multiplicity of infection (0.02 pfu/ml), caused a significant positive correlation between increased explant infection and upregulation of MCP-1 and TNF-α expression (p = 0.0001 and p = 0.017). Cytokine dysregulation has been associated with adverse outcomes of pregnancy, and can negatively affect placental development and function. These novel findings demonstrate CMV infection modulates the placental immune environment in vivo and in a multicellular ex vivo model, suggesting CMV-induced cytokine modulation as a potential initiator and/or exacerbator of placental and fetal injury. PMID

  17. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.


    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich


    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  18. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

    PubMed Central

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich


    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  19. PUL21a-Cyclin A2 Interaction is Required to Protect Human Cytomegalovirus-Infected Cells from the Deleterious Consequences of Mitotic Entry

    PubMed Central

    Eifler, Martin; Uecker, Ralf; Weisbach, Henry; Bogdanow, Boris; Richter, Ellen; König, Lydia; Vetter, Barbara; Lenac-Rovis, Tihana; Jonjic, Stipan; Neitzel, Heidemarie; Hagemeier, Christian; Wiebusch, Lüder


    Entry into mitosis is accompanied by dramatic changes in cellular architecture, metabolism and gene expression. Many viruses have evolved cell cycle arrest strategies to prevent mitotic entry, presumably to ensure sustained, uninterrupted viral replication. Here we show for human cytomegalovirus (HCMV) what happens if the viral cell cycle arrest mechanism is disabled and cells engaged in viral replication enter into unscheduled mitosis. We made use of an HCMV mutant that, due to a defective Cyclin A2 binding motif in its UL21a gene product (pUL21a), has lost its ability to down-regulate Cyclin A2 and, therefore, to arrest cells at the G1/S transition. Cyclin A2 up-regulation in infected cells not only triggered the onset of cellular DNA synthesis, but also promoted the accumulation and nuclear translocation of Cyclin B1-CDK1, premature chromatin condensation and mitotic entry. The infected cells were able to enter metaphase as shown by nuclear lamina disassembly and, often irregular, metaphase spindle formation. However, anaphase onset was blocked by the still intact anaphase promoting complex/cyclosome (APC/C) inhibitory function of pUL21a. Remarkably, the essential viral IE2, but not the related chromosome-associated IE1 protein, disappeared upon mitotic entry, suggesting an inherent instability of IE2 under mitotic conditions. Viral DNA synthesis was impaired in mitosis, as demonstrated by the abnormal morphology and strongly reduced BrdU incorporation rates of viral replication compartments. The prolonged metaphase arrest in infected cells coincided with precocious sister chromatid separation and progressive fragmentation of the chromosomal material. We conclude that the Cyclin A2-binding function of pUL21a contributes to the maintenance of a cell cycle state conducive for the completion of the HCMV replication cycle. Unscheduled mitotic entry during the course of the HCMV replication has fatal consequences, leading to abortive infection and cell death. PMID

  20. Induction of protective cytotoxic T cells to murine cytomegalovirus by using a nonapeptide and a human-compatible adjuvant (Montanide ISA 720).

    PubMed Central

    Scalzo, A A; Elliott, S L; Cox, J; Gardner, J; Moss, D J; Suhrbier, A


    The use of synthetic peptides representing cytotoxic T-cell (CTL) epitopes for human vaccination requires the identification of a suitable adjuvant formulation. A single immunization with Montanide ISA720/tetanus toxoid/YPHFMPTNL protected mice against murine cytomegalovirus and induced epitope-specific CTL. Such formulations will find application in peptide-based CTL anti-viral vaccines. PMID:7815511

  1. High-Throughput Analysis of Human Cytomegalovirus Genome Diversity Highlights the Widespread Occurrence of Gene-Disrupting Mutations and Pervasive Recombination

    PubMed Central

    Thys, Kim; Mbong Ngwese, Mirabeau; Van Damme, Ellen; Dvorak, Jan; Van Loock, Marnix; Li, Guangdi; Tachezy, Ruth; Busson, Laurent; Aerssens, Jeroen; Van Ranst, Marc


    ABSTRACT Human cytomegalovirus is a widespread pathogen of major medical importance. It causes significant morbidity and mortality in immunocompromised individuals, and congenital infections can result in severe disabilities or stillbirth. Development of a vaccine is prioritized, but no candidate is close to release. Although correlations of viral genetic variability with pathogenicity are suspected, knowledge about the strain diversity of the 235-kb genome is still limited. In this study, 96 full-length human cytomegalovirus genomes from clinical isolates were characterized, quadrupling the amount of information available for full-genome analysis. These data provide the first high-resolution map of human cytomegalovirus interhost diversity and evolution. We show that cytomegalovirus is significantly more divergent than all other human herpesviruses and highlight hot spots of diversity in the genome. Importantly, 75% of strains are not genetically intact but contain disruptive mutations in a diverse set of 26 genes, including the immunomodulatory genes UL40 and UL111A. These mutants are independent of culture passage artifacts and circulate in natural populations. Pervasive recombination, which is linked to the widespread occurrence of multiple infections, was found throughout the genome. The recombination density was significantly higher than those of other human herpesviruses and correlated with strain diversity. While the overall effects of strong purifying selection on virus evolution are apparent, evidence of diversifying selection was found in several genes encoding proteins that interact with the host immune system, including UL18, UL40, UL142, and UL147. These residues may present phylogenetic signatures of past and ongoing virus-host interactions. IMPORTANCE Human cytomegalovirus has the largest genome of all viruses that infect humans. Currently, there is a great interest in establishing associations between genetic variants and strain pathogenicity of

  2. Pathogenesis of Experimental Rhesus Cytomegalovirus Infection

    PubMed Central

    Lockridge, Kristen M.; Sequar, Getachew; Zhou, Shan Shan; Yue, Yujuan; Mandell, Carol P.; Barry, Peter A.


    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v.), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  3. The Human Cytomegalovirus-Specific UL1 Gene Encodes a Late-Phase Glycoprotein Incorporated in the Virion Envelope

    PubMed Central

    Shikhagaie, Medya; Mercé-Maldonado, Eva; Isern, Elena; Muntasell, Aura; Albà, M. Mar; López-Botet, Miguel; Hengel, Hartmut


    We have investigated the previously uncharacterized human cytomegalovirus (HCMV) UL1 open reading frame (ORF), a member of the rapidly evolving HCMV RL11 family. UL1 is HCMV specific; the absence of UL1 in chimpanzee cytomegalovirus (CCMV) and sequence analysis studies suggest that UL1 may have originated by the duplication of an ancestor gene from the RL11-TRL cluster (TRL11, TRL12, and TRL13). Sequence similarity searches against human immunoglobulin (Ig)-containing proteins revealed that HCMV pUL1 shows significant similarity to the cellular carcinoembryonic antigen-related (CEA) protein family N-terminal Ig domain, which is responsible for CEA ligand recognition. Northern blot analysis revealed that UL1 is transcribed during the late phase of the viral replication cycle in both fibroblast-adapted and endotheliotropic strains of HCMV. We characterized the protein encoded by hemagglutinin (HA)-tagged UL1 in the AD169-derived HB5 background. UL1 is expressed as a 224-amino-acid type I transmembrane glycoprotein which becomes detectable at 48 h postinfection. In infected human fibroblasts, pUL1 colocalized at the cytoplasmic site of virion assembly and secondary envelopment together with TGN-46, a marker for the trans-Golgi network, and viral structural proteins, including the envelope glycoprotein gB and the tegument phosphoprotein pp28. Furthermore, analyses of highly purified AD169 UL1-HA epitope-tagged virions revealed that pUL1 is a novel constituent of the HCMV envelope. Importantly, the deletion of UL1 in HCMV TB40/E resulted in reduced growth in a cell type-specific manner, suggesting that pUL1 may be implicated in regulating HCMV cell tropism. PMID:22345456

  4. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie


    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  5. Genetic Stability of Bacterial Artificial Chromosome-Derived Human Cytomegalovirus during Culture In Vitro

    PubMed Central

    Murrell, Isa; Wilkie, Gavin S.; Davison, Andrew J.; Statkute, Evelina; Fielding, Ceri A.; Tomasec, Peter; Wilkinson, Gavin W. G.


    ABSTRACT Clinical human cytomegalovirus (HCMV) strains invariably mutate when propagated in vitro. Mutations in gene RL13 are selected in all cell types, whereas in fibroblasts mutants in the UL128 locus (UL128L; genes UL128, UL130, and UL131A) are also selected. In addition, sporadic mutations are selected elsewhere in the genome in all cell types. We sought to investigate conditions under which HCMV can be propagated without incurring genetic defects. Bacterial artificial chromosomes (BACs) provide a stable, genetically defined source of viral genome. Viruses were generated from BACs containing the genomes of strains TR, TB40, FIX, and Merlin, as well as from Merlin-BAC recombinants containing variant nucleotides in UL128L from TB40-BAC4 or FIX-BAC. Propagation of viruses derived from TR-BAC, TB40-BAC4, and FIX-BAC in either fibroblast or epithelial cells was associated with the generation of defects around the prokaryotic vector, which is retained in the unique short (US) region of viruses. This was not observed for Merlin-BAC, from which the vector is excised in derived viruses; however, propagation in epithelial cells was consistently associated with mutations in the unique long b′ (UL/b′) region, all impacting on gene UL141. Viruses derived from Merlin-BAC in fibroblasts had mutations in UL128L, but mutations occurred less frequently with recombinants containing UL128L nucleotides from TB40-BAC4 or FIX-BAC. Viruses derived from a Merlin-BAC derivative in which RL13 and UL128L were either mutated or repressed were remarkably stable in fibroblasts. Thus, HCMV containing a wild-type gene complement can be generated in vitro by deriving virus from a self-excising BAC in fibroblasts and repressing RL13 and UL128L. IMPORTANCE Researchers should aim to study viruses that accurately represent the causative agents of disease. This is problematic for HCMV because clinical strains mutate rapidly when propagated in vitro, becoming less cell associated, altered in

  6. Scanning Mutagenesis of Human Cytomegalovirus Glycoprotein gH/gL

    PubMed Central

    Schultz, Eric P.; Lanchy, Jean-Marc; Ellerbeck, Erin E.


    ABSTRACT The core, conserved function of the herpesvirus gH/gL is to promote gB-mediated membrane fusion during entry, although the mechanism is poorly understood. The human cytomegalovirus (HCMV) gH/gL can exist as either the gH/gL/gO trimer or the gH/gL/UL128/UL130/UL131 (gH/gL/UL128-131) pentamer. One model suggests that gH/gL/gO provides the core fusion role during entry into all cells within the broad tropism of HCMV, whereas gH/gL/UL128-131 acts at an earlier stage, by a distinct receptor-binding mechanism to enhance infection of select cell types, such as epithelial cells, endothelial cells, and monocytes/macrophages. To further study the distinct functions of these complexes, mutants with individual charged cluster-to-alanine (CCTA) mutations of gH and gL were combined to generate a library of 80 mutant gH/gL heterodimers. The majority of the mutant gH/gL complexes were unable to facilitate gB-mediated membrane fusion in transient-expression cell-cell fusion experiments. In contrast, these mutants supported the formation of gH/gL/UL128-131 complexes that could block HCMV infection in receptor interference experiments. These results suggest that receptor interactions with gH/gL/UL128-131 involve surfaces contained on the UL128-131 proteins but not on gH/gL. gH/gL/UL128-131 receptor interference could be blocked with anti-gH antibodies, suggesting that interference is a cell surface phenomenon and that anti-gH antibodies can block gH/gL/UL128-131 in a manner that is distinct from that for gH/gL/gO. IMPORTANCE Interest in the gH/gL complexes of HCMV (especially gH/gL/UL128-131) as vaccine targets has far outpaced our understanding of the mechanism by which they facilitate entry and contribute to broad cellular tropism. For Epstein-Barr virus (EBV), gH/gL and gH/gL/gp42 are both capable of promoting gB fusion for entry into epithelial cells and B cells, respectively. In contrast, HCMV gH/gL/gO appears to be the sole fusion cofactor that promotes gB fusion

  7. Human Cytomegalovirus pUL47 Modulates Tegumentation and Capsid Accumulation at the Viral Assembly Complex

    PubMed Central

    Cappadona, Ilaria; Villinger, Clarissa; Schutzius, Gabi; Mertens, Thomas


    ABSTRACT Human cytomegalovirus (HCMV) tegument protein pUL47 is an interaction partner of pUL48 and highly conserved among herpesviruses. It is closely associated with the capsid and has an important function early in infection. Here, we report a specific role of pUL47 in the tegumentation of capsids in the cytoplasm. A newly generated mutant virus (TB-47stop), in which expression of pUL47 is blocked, exhibited a severe impairment in cell-to-cell spread and release of infectivity from infected cells. Ultrastructural analysis of TB-47stop-infected cells clearly showed cytoplasmic accumulations of nonenveloped capsids that were only partially tegumented, indicating that these capsids failed to complete tegumentation. Nevertheless, these accumulations were positive for HCMV inner tegument proteins pp150 and pUL48, suggesting that their attachment to capsids occurs independently of pUL47. Despite these morphological alterations, fully enveloped virus particles were found in the extracellular space and at the viral assembly complex (vAC) of TB-47stop-infected cells, indicating that pUL47 is not essential for the generation of virions. We confirmed findings that incorporation of pUL48 into virions is impaired in the absence of pUL47. Interestingly, pUL47 exhibited a strong nuclear localization in transfected cells, whereas it was found exclusively at the vAC in the context of virus infection. Colocalization of pUL47 and pUL48 at the vAC is consistent with their interaction. We also found a shift to a more nuclear localization of pUL47 when the expression of pUL48 was reduced. Summarizing our results, we hypothesize that pUL48 directs pUL47 to the vAC to promote tegumentation and secondary envelopment of capsids. IMPORTANCE Generation of infectious HCMV particles requires an organized and multistep process involving the action of several viral and cellular proteins as well as protein-protein interactions. A better understanding of these processes is important for

  8. In vitro antiviral efficacy of the ganciclovir complexed with beta-cyclodextrin on human cytomegalovirus clinical strains.


    Nicolazzi, Céline; Venard, Véronique; Le Faou, Alain; Finance, Chantal


    The toxicity of the compounds currently used in the treatment of human cytomegalovirus (HCMV) infections in immunocompromised hosts may force the treatment to be discontinued. The aim of this study was to improve the antiviral activity of ganciclovir (GCV), one the most widely used drug, by complexing it with beta-cyclodextrin. Cyclodextrins (cds) have the property to form inclusion complexes with a great number of molecules and to enhance bioavailability and biological properties of these molecules. In this study, we investigated the in vitro antiviral activity of complexed GCV against several strains of HCMV: AD169, a reference strain, RCL-1, a laboratory mutant resistant to GCV, and four clinical isolates. The complexed GCV was more effective than free GCV against all HCMV strains tested. Cds as carriers for antiviral drugs would represent a useful adjunct to classical treatment procedures. They may make it possible to administer lower doses, thus reducing the toxic side effects of the drugs. PMID:12062397

  9. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.


    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E


    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  10. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.


    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  11. Development of flavonoid-based inverse agonists of the key signaling receptor US28 of human cytomegalovirus.


    Kralj, Ana; Nguyen, Mai-Thao; Tschammer, Nuska; Ocampo, Nicolette; Gesiotto, Quinto; Heinrich, Markus R; Phanstiel, Otto


    A series of 31 chalcone- and flavonoid-based derivatives were synthesized in good overall yields and screened for their inverse agonist activity on the US28 receptor of human cytomegalovirus (HCMV). With one exception (e.g., 2-(5-bromo-2-methoxyphenyl)-3-hydroxy-4H-chromen-4-one), halogen-substituted flavonoids were typically more potent inverse agonists than their related hydro derivatives. While toxicity could be used to partially explain the inverse agonist activity of some members of the series, 5-(benzyloxy)-2-(5-bromo-2-methoxyphenyl)-4H-chromen-4-one (11b) acted on the US28 receptor as a nontoxic, inverse agonist. The full inverse agonism (efficacy, -89%) and potency (EC50 = 3.5 μM) observed with flavonoid 11b is especially important as it provides both a new tool to study US28 signaling and a potential platform for the future development of HCMV-targeting drugs. PMID:23768434

  12. Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements

    PubMed Central

    Yuan, Jinxiang; Li, Ming; Torres, Yasaira Rodriguez; Galle, Courtney S.


    ABSTRACT Triggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation. IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of

  13. Interleukin-2 from Adaptive T Cells Enhances Natural Killer Cell Activity against Human Cytomegalovirus-Infected Macrophages

    PubMed Central

    Wu, Zeguang; Frascaroli, Giada; Bayer, Carina; Schmal, Tatjana


    ABSTRACT Control of human cytomegalovirus (HCMV) requires a continuous immune surveillance, thus HCMV is the most important viral pathogen in severely immunocompromised individuals. Both innate and adaptive immunity contribute to the control of HCMV. Here, we report that peripheral blood natural killer cells (PBNKs) from HCMV-seropositive donors showed an enhanced activity toward HCMV-infected autologous macrophages. However, this enhanced response was abolished when purified NK cells were applied as effectors. We demonstrate that this enhanced PBNK activity was dependent on the interleukin-2 (IL-2) secretion of CD4+ T cells when reexposed to the virus. Purified T cells enhanced the activity of purified NK cells in response to HCMV-infected macrophages. This effect could be suppressed by IL-2 blocking. Our findings not only extend the knowledge on the immune surveillance in HCMV—namely, that NK cell-mediated innate immunity can be enhanced by a preexisting T cell antiviral immunity—but also indicate a potential clinical implication for patients at risk for severe HCMV manifestations due to immunosuppressive drugs, which mainly suppress IL-2 production and T cell responsiveness. IMPORTANCE Human cytomegalovirus (HCMV) is never cleared by the host after primary infection but instead establishes a lifelong latent infection with possible reactivations when the host′s immunity becomes suppressed. Both innate immunity and adaptive immunity are important for the control of viral infections. Natural killer (NK) cells are main innate effectors providing a rapid response to virus-infected cells. Virus-specific T cells are the main adaptive effectors that are critical for the control of the latent infection and limitation of reinfection. In this study, we found that IL-2 secreted by adaptive CD4+ T cells after reexposure to HCMV enhances the activity of NK cells in response to HCMV-infected target cells. This is the first direct evidence that the adaptive T cells can

  14. Sequence homology and immunologic cross-reactivity of human cytomegalovirus with HLA-DR beta chain: a means for graft rejection and immunosuppression.

    PubMed Central

    Fujinami, R S; Nelson, J A; Walker, L; Oldstone, M B


    A peptide (Leu-Gly-Arg-Pro-Asp-Glu-Asp-Ser-Ser-Ser-Ser-Ser-Ser-Ser-Cys) that was identical to residues 82 through 96 of a predicted protein of 208 amino acids from the immediate-early region (IE-2) nucleic acid sequence of human cytomegalovirus was chemically synthesized. By computer analysis, the first five amino acids of this peptide showed sequence homology to the beta chain of the human histocompatibility complex HLA-DR. The homologous amino acids, 53 through 57, were located in a region that is conserved between the human DR beta chain and the beta chain of the H-2 class II histocompatibility antigen for mice. The shared region between the IE-2 protein and DR beta chain were similar in both hydrophilicity and predicted beta-turn potential. The IE-2 viral peptide induced antibodies that specifically recognized the human DR beta chain. These observations describe a protein encoded by the IE-2 region of human cytomegalovirus that contains sequence homology and shows immunologic cross-reactivity with a conserved domain of HLA-DR and suggest a mechanism to explain how human cytomegalovirus infection contributes to graft rejection after transplantation. Images PMID:2446012

  15. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J


    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  16. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture

    PubMed Central

    Gardner, Thomas J.; Hernandez, Rosmel E.; Noriega, Vanessa M.; Tortorella, Domenico


    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV. PMID:27026399

  17. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture.


    Gardner, Thomas J; Hernandez, Rosmel E; Noriega, Vanessa M; Tortorella, Domenico


    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV. PMID:27026399

  18. Phenotypic and functional heterogeneity of human NK cells developing after umbilical cord blood transplantation: a role for human cytomegalovirus?


    Della Chiesa, Mariella; Falco, Michela; Podestà, Marina; Locatelli, Franco; Moretta, Lorenzo; Frassoni, Francesco; Moretta, Alessandro


    Natural killer (NK) cells play a crucial role in early immunity after hematopoietic stem cell transplantation because they are the first lymphocyte subset recovering after the allograft. In this study, we analyzed the development of NK cells after intrabone umbilical cord blood (CB) transplantation in 18 adult patients with hematologic malignancies. Our data indicate that, also in this transplantation setting, NK cells are the first lymphoid population detectable in peripheral blood. However, different patterns of NK-cell development could be identified. Indeed, in a group of patients, a relevant fraction of NK cells expressed a mature phenotype characterized by the KIR(+)NKG2A(-) signature 3-6 months after transplantation. In other patients, most NK cells maintained an immature phenotype even after 12 months. A possible role for cytomegalovirus in the promotion of NK-cell development was suggested by the observation that a more rapid NK-cell maturation together with expansion of NKG2C(+) NK cells was confined to patients experiencing cytomegalovirus reactivation. In a fraction of these patients, an aberrant and hyporesponsive CD56(-)CD16(+)p75/AIRM1(-) NK-cell subset (mostly KIR(+)NKG2A(-)) reminiscent of that described in patients with viremic HIV was detected. Our data support the concept that cytomegalovirus infection may drive NK-cell development after umbilical CB transplantation. PMID:22096237

  19. Polymorphism in human cytomegalovirus UL40 impacts on recognition of human leukocyte antigen-E (HLA-E) by natural killer cells.


    Heatley, Susan L; Pietra, Gabriella; Lin, Jie; Widjaja, Jacqueline M L; Harpur, Christopher M; Lester, Sue; Rossjohn, Jamie; Szer, Jeff; Schwarer, Anthony; Bradstock, Kenneth; Bardy, Peter G; Mingari, Maria Cristina; Moretta, Lorenzo; Sullivan, Lucy C; Brooks, Andrew G


    Natural killer (NK) cell recognition of the nonclassical human leukocyte antigen (HLA) molecule HLA-E is dependent on the presentation of a nonamer peptide derived from the leader sequence of other HLA molecules to CD94-NKG2 receptors. However, human cytomegalovirus can manipulate this central innate interaction through the provision of a "mimic" of the HLA-encoded peptide derived from the immunomodulatory glycoprotein UL40. Here, we analyzed UL40 sequences isolated from 32 hematopoietic stem cell transplantation recipients experiencing cytomegalovirus reactivation. The UL40 protein showed a "polymorphic hot spot" within the region that encodes the HLA leader sequence mimic. Although all sequences that were identical to those encoded within HLA-I genes permitted the interaction between HLA-E and CD94-NKG2 receptors, other UL40 polymorphisms reduced the affinity of the interaction between HLA-E and CD94-NKG2 receptors. Furthermore, functional studies using NK cell clones expressing either the inhibitory receptor CD94-NKG2A or the activating receptor CD94-NKG2C identified UL40-encoded peptides that were capable of inhibiting target cell lysis via interaction with CD94-NKG2A, yet had little capacity to activate NK cells through CD94-NKG2C. The data suggest that UL40 polymorphisms may aid evasion of NK cell immunosurveillance by modulating the affinity of the interaction with CD94-NKG2 receptors. PMID:23335510

  20. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.


    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A


    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  1. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects.


    Sylwester, Andrew W; Mitchell, Bridget L; Edgar, John B; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R; Grabstein, Kenneth H; Hosken, Nancy A; Kern, Florian; Nelson, Jay A; Picker, Louis J


    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4(+) and/or CD8(+) T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average approximately 10% of both the CD4(+) and CD8(+) memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8(+) T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  2. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects

    PubMed Central

    Sylwester, Andrew W.; Mitchell, Bridget L.; Edgar, John B.; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R.; Grabstein, Kenneth H.; Hosken, Nancy A.; Kern, Florian; Nelson, Jay A.; Picker, Louis J.


    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4+ and/or CD8+ T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average ∼10% of both the CD4+ and CD8+ memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8+ T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  3. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.


    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  4. A novel flow cytometry-based tool for determining the efficiency of human cytomegalovirus infection in THP-1 derived macrophages.


    Li, Huifen; Mao, Genxiang; Carlson, Joshua; Leng, Sean X


    Human cytomegalovirus (hCMV) is a ubiquitous pathogen that causes congenital infection and severe infections in immunocompromised patients. Chronic hCMV infection may also play an important role in immunosenescence and adverse health outcomes in older adults. THP-1, a human monocytic cell line and its derived macrophages serve as a useful cell culture model for mechanistic studies of hCMV infection and its underlying biology. A major methodological challenge is the lack of a quick and reliable tool to accurately determine the efficiency of hCMV infection in THP-1 derived macrophages. In this study, we developed a flow cytometry based method using commercially available monoclonal antibody (MAb) against hCMV immediate early (IE) antigen that can accurately determine infection efficiency. We used 0.5% formaldehyde for fixation, 90% methanol for permeabilization, and incubation with FITC conjugated MAb at 37°C. The method was tested by hCMV infection with laboratory Towne strain in the presence or absence of hydrocortisone. It was also compared with the routine flow cytometry protocol using Cytofix/Cytoperm solution and with immunofluorescence. The results indicate that this new method is reliable and time saving for accurate determination of infection efficiency. It may facilitate further investigations into the underlying biological mechanisms of hCMV infection. PMID:25958130

  5. Drug Repurposing Approach Identifies Inhibitors of the Prototypic Viral Transcription Factor IE2 that Block Human Cytomegalovirus Replication.


    Mercorelli, Beatrice; Luganini, Anna; Nannetti, Giulio; Tabarrini, Oriana; Palù, Giorgio; Gribaudo, Giorgio; Loregian, Arianna


    New targets for antiviral strategies are needed against human cytomegalovirus (HCMV), a major human pathogen. A cell-based screen aimed at finding inhibitors of the viral transcription factor Immediate-Early 2 (IE2) was performed in HCMV-infected cells expressing EGFP under the control of an IE2-inducible viral promoter. Screening of a library of bioactive small molecules led to the identification of several compounds able to inhibit EGFP expression and also HCMV replication with potency in the low-micromolar range. Follow-up studies with four selected hits indicated that they all block viral DNA synthesis as well as viral Early and Late gene expression. Furthermore, mechanistic studies confirmed that the compounds specifically act via inhibition of IE2 transactivating activity, thus blocking viral Early gene expression and the progression of virus replication. These results provide proof of concept for identifying small molecules that modulate the activity of a microbial transcription factor to control pathogen replication. PMID:26877023

  6. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.


    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  7. Molecular Imprint of Exposure to Naturally Occurring Genetic Variants of Human Cytomegalovirus on the T cell Repertoire

    NASA Astrophysics Data System (ADS)

    Smith, Corey; Gras, Stephanie; Brennan, Rebekah M.; Bird, Nicola L.; Valkenburg, Sophie A.; Twist, Kelly-Anne; Burrows, Jacqueline M.; Miles, John J.; Chambers, Daniel; Bell, Scott; Campbell, Scott; Kedzierska, Katherine; Burrows, Scott R.; Rossjohn, Jamie; Khanna, Rajiv


    Exposure to naturally occurring variants of herpesviruses in clinical settings can have a dramatic impact on anti-viral immunity. Here we have evaluated the molecular imprint of variant peptide-MHC complexes on the T-cell repertoire during human cytomegalovirus (CMV) infection and demonstrate that primary co-infection with genetic variants of CMV was coincident with development of strain-specific T-cell immunity followed by emergence of cross-reactive virus-specific T-cells. Cross-reactive CMV-specific T cells exhibited a highly conserved public T cell repertoire, while T cells directed towards specific genetic variants displayed oligoclonal repertoires, unique to each individual. T cell recognition foot-print and pMHC-I structural analyses revealed that the cross-reactive T cells accommodate alterations in the pMHC complex with a broader foot-print focussing on the core of the peptide epitope. These findings provide novel molecular insight into how infection with naturally occurring genetic variants of persistent human herpesviruses imprints on the evolution of the anti-viral T-cell repertoire.

  8. Dynamic and Nucleolin-Dependent Localization of Human Cytomegalovirus UL84 to the Periphery of Viral Replication Compartments and Nucleoli

    PubMed Central

    Bender, Brian J.


    ABSTRACT Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. IMPORTANCE The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and

  9. Dynamic and nucleolin-dependent localization of human cytomegalovirus UL84 to the periphery of viral replication compartments and nucleoli.


    Bender, Brian J; Coen, Donald M; Strang, Blair L


    Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. Importance: The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and cellular

  10. Human T-lymphotropic virus tax activates human cytomegalovirus major-immediate early promoter and improves production of recombinant proteins in HEK293 cells.


    Lwa, Teng Rhui; Lee, Jialing; Ng, Chew Har; Lew, Qiao Jing; Hia, Hui Ching; Chao, Sheng-Hao


    The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter. PMID:21425252

  11. Valvular Cytomegalovirus Endocarditis.


    Stear, Timothy J; Shersher, David; Kim, George J; Smego, Douglas R


    Endocarditis is a rare presentation for cytomegalovirus (CMV) infection. We present the case of a 49-year-old man who underwent mitral and tricuspid valve replacement for valvular CMV endocarditis. The patient's past medical history was significant for human immunodeficiency virus, intravenous drug abuse, and chronic hepatitis B. During his clinical course, he was found to have tricuspid and mitral valve vegetations. After progressive valvular destruction despite antibiotic therapy, he underwent successful mitral and tricuspid valve replacement. Pathologic analysis of the culture-negative valve specimens were found to contain inclusion bodies consistent with CMV, and quantitative serum polymerase chain reaction returned a highly elevated CMV DNA count. PMID:27449440

  12. Human Cytomegalovirus Infection is Associated with Essential Hypertension in Kazakh and Han Chinese Populations

    PubMed Central

    Tang, Na; Li, Jia-wei; Liu, Yong-min; Zhong, Hua; Wang, La-mei; Deng, Feng-mei; Qu, Yuan-yuan; Hui, Jing; Cheng, Jiang; Tang, Bin; Huang, Gang; Guo, Shu-xia; Li, Xin-zhi; Wei, Li-li; He, Fang


    Background We aimed to study the association between cytomegalovirus (CMV) infection and hypertension in Kazakh and Han populations from Xinjiang Province, China. Material/Methods We analyzed data on 800 Kazakhs (467 hypertension patients and 333 healthy control participants) and 800 Hans (482 hypertension patients and 318 healthy control participants) aged 18–84 years old. ELISA and real-time quantitative PCR coupled with restriction fragment length polymorphism analysis were applied for determining CMV infection and glycoprotein B (gB) genotypes, respectively. Results Serologic evidence of CMV infection was obtained for 95.4% and 90.1% of the Kazakhs and Hans, respectively. The CMV seroprevalence rates among the Kazakh and Han participants with hypertension were 96.8% and 89.8%, respectively. Multiple logistic regression analyses revealed statistically significant independent associations between CMV seropositivity and hypertension in Kazakh males and between CMV antibody titers and hypertension in Hans; significant relationships also existed between CMV antibody titers and blood pressure in Hans. In Kazakhs, 3 CMV gB genotypes were identified: gB2 and genotype mixtures gB1+gB2 and gB2+gB3. In Hans, 4 CMV gB genotypes were identified: gB1, gB2, gB1+gB2, and gB2+gB3. Of the 4 studied genotypes, gB2+gB3 showed a significant independent association with hypertension in Kazakh females. Conclusions CMV infection is associated with essential hypertension in Kazakh males and Hans in Xinjiang. CMV seropositivity is associated with hypertension in Kazakh males, and CMV antibody titers are associated with blood pressure and hypertension in Han males and females. Moreover, the CMV gB2+gB3 genotype mixture is associated independently with essential hypertension in Kazakh females. PMID:25448630

  13. Active human cytomegalovirus infection and glycoprotein b genotypes in brazilian pediatric renal or hematopoietic stem cell transplantation patients.


    de Campos Dieamant, Débora; Bonon, Sandra Helena Alves; Prates, Liliane Cury; Belangelo, Vera Maria Santoro; Pontes, Erika R; Costa, Sandra Cecília Botelho


    A prospective analysis of active Human Cytomegalovirus infection (HCMV) was conducted on 33 pediatric renal or hematopoietic stem cell post-transplant patients. The HCMV-DNA positive samples were evaluated for the prevalence of different gB subtypes and their subsequent correlation with clinical signs. The surveillance of HCMV active infection was based on the monitoring of antigenemia (AGM) and on a nested polymerase chain reaction (N-PCR) for the detection of HCMV in the patients studied. Using restriction analysis of the gB gene sequence by PCR-RFLP (Restriction Fragment Length Polymorphism), different HCMV strains could be detected and classified in at least four HCMV genotypes. Thirty-three pediatric recipients of renal or bone marrow transplantation were monitored. Twenty out of thirty-three (60.6%) patients demonstrated active HCMV infection. gB1 and gB2 genotypes were more frequent in this population. In this study, we observed that gB2 had correlation with reactivation of HCMV infection and that patients with mixture of genotypes did not show any symptoms of HCMV disease. Future studies has been made to confirm this. PMID:24031463

  14. Poly(A) binding protein abundance regulates eukaryotic translation initiation factor 4F assembly in human cytomegalovirus-infected cells.


    McKinney, Caleb; Perez, Cesar; Mohr, Ian


    By commandeering cellular translation initiation factors, or destroying those dispensable for viral mRNA translation, viruses often suppress host protein synthesis. In contrast, cellular protein synthesis proceeds in human cytomegalovirus (HCMV)-infected cells, forcing viral and cellular mRNAs to compete for limiting translation initiation factors. Curiously, inactivating the host translational repressor 4E-BP1 in HCMV-infected cells stimulates synthesis of the cellular poly(A) binding protein (PABP), significantly increasing PABP abundance. Here, we establish that new PABP synthesis is translationally controlled by the HCMV-encoded UL38 mammalian target of rapamycin complex 1-activator. The 5' UTR within the mRNA encoding PABP contains a terminal oligopyrimidine (TOP) element found in mRNAs, the translation of which is stimulated in response to mitogenic, growth, and nutritional stimuli, and proteins encoded by TOP-containing mRNAs accumulated in HCMV-infected cells. Furthermore, UL38 expression was necessary and sufficient to regulate expression of a PABP TOP-containing reporter. Remarkably, preventing the rise in PABP abundance by RNAi impaired eIF4E binding to eIF4G, thereby reducing assembly of the multisubunit initiation factor eIF4F, viral protein production, and replication. This finding demonstrates that viruses can increase host translation initiation factor concentration to foster their replication and defines a unique mechanism whereby control of PABP abundance regulates eIF4F assembly. PMID:22431630

  15. Alveolar Macrophages Isolated Directly From Human Cytomegalovirus (HCMV)–Seropositive Individuals Are Sites of HCMV Reactivation In Vivo

    PubMed Central

    Poole, Emma; Juss, Jatinder K.; Krishna, Benjamin; Herre, Jurgen; Chilvers, Edwin R.; Sinclair, John


    Human cytomegalovirus (HCMV) causes significant morbidity in the immunocompromised host. Following primary infection, the virus establishes latent infection in progenitor cells of the myeloid lineage. These cells exhibit limited viral gene transcription and no evidence of de novo virion production. It is well recognized that differentiation of latently infected myeloid progenitor cells to dendritic or macrophage-like cells permits viral reactivation in vitro. This has been used to support the concept that viral reactivation in HCMV carriers routinely occurs from such terminally differentiated myeloid cells in vivo. However, to date this has not been shown for in vivo–differentiated macrophages. This study is the first to demonstrate that alveolar macrophages from HCMV carriers express immediate early lytic genes and produce infectious virus. This supports the view, until now based on in vitro data, that terminally differentiated myeloid cells in vivo are sites of HCMV reactivation and potential centers of viral dissemination in latently infected individuals with no evidence of virus disease or dissemination. PMID:25552371

  16. Human Cytomegalovirus-Induced NKG2Chi CD57hi Natural Killer Cells Are Effectors Dependent on Humoral Antiviral Immunity

    PubMed Central

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold


    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2Chi CD57hi NK cells gated on CD3neg CD56dim cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2Chi CD57hi NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2Chi CD57hi NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2Chi CD57hi NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy. PMID:23637420

  17. Assessment of the Human Cytomegalovirus UL97 Gene for Identification of Resistance to Ganciclovir in Iranian Immunosuppressed Patients

    PubMed Central

    Keyvani, Hossein; Taghinezhad Saroukalaei, Sedigheh; Mohseni, Amir Hossein


    Background Human cytomegalovirus (HCMV) infections are a major cause of morbidity and mortality among immunocompromised patients. Prolonged antiviral therapy is a cause of mutation and drug resistance in the HCMV genome. Objectives The aim of this study was to identify resistance to ganciclovir (GCV) in Iranian immunosuppressed patients at two different stages of the disease: early (before GCV is initiated) and late (after six months of GCV therapy). Patients and Methods In this study, 87 specimens from Iranian patients were amplified using nested PCR amplification of the UL97 gene. Sequence analyses of products were performed for identifying the mutated codons. Results The present study show that the most frequent GCV-resistant mutations occurred in codons A594V (26.43%), H520Q (18.39%), and M460V (13.79%), consequently occurring at a low frequency in the L595S (2.29%), E596G (1.14%), and Del 594 (1.14%) codons, and with intermediate frequency in the C592G (10.34%), M460I (9.19%), and C603W (6.89%) codons. We describe for the first time a new GCV-resistance mutation, the deletion of codon 594, in the UL97 gene of Iranian HCMV patients after GCV therapy, following renal transplantation. Conclusions The findings of the present study can be utilized to detect GCV resistance patterns among Iranian immunocompromised patients and to treat HCMV infections accordingly. PMID:27540455

  18. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins.


    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R; Brune, Wolfram; Geballe, Adam P; Beau, Isabelle; Esclatine, Audrey


    Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus. PMID:26654401

  19. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase—A Potential Strategy for Suppression of the Wnt Pathway

    PubMed Central

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit


    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS’ activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes. PMID:26729153

  20. Human cytomegalovirus mediates cell cycle progression through G(1) into early S phase in terminally differentiated cells.


    Sinclair, J; Baillie, J; Bryant, L; Caswell, R


    Terminal differentiation of embryonal carcinoma cells and monocytes has been shown to be important for their permissiveness for human cytomegalovirus (HCMV) infection, even though such terminally differentiated cells have withdrawn from the cell cycle and are, essentially, in G(0) arrest. Recently, data from a number of laboratories have shown that productive infection with HCMV of quiescent fibroblasts held reversibly in G(0) of the cell cycle can result in cell cycle progression, which results eventually in cycle arrest. In contrast to quiescent fibroblasts, the effect of HCMV on cells that have withdrawn irreversibly from the cell cycle due to terminal differentiation has not, so far, been addressed. Here, it is shown that, in cells that have arrested in G(0) as a result of terminal differentiation, HCMV is able to induce cell functions associated with progression of the cell cycle through G(1) into early S phase. This progression is correlated with a direct physical and functional interaction between the HCMV 86 kDa major immediate-early protein (IE86) and the cyclin-dependent kinase inhibitor p21(Cip1). PMID:10811939

  1. (S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine, a potent and selective inhibitor of human cytomegalovirus replication.

    PubMed Central

    Snoeck, R; Sakuma, T; De Clercq, E; Rosenberg, I; Holy, A


    From a series of phosphonylmethoxyalkylpurine and -pyrimidine derivatives, (S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine [(S)-HPMPC] emerged as a particularly potent and selective inhibitor of the replication of human cytomegalovirus (CMV). Its potency against CMV was similar to that of the structurally related adenine derivative (S)-HPMPA but higher than that of the reference compounds phosphonoformate and 9-(1,3-dihydroxy-2-propoxymethyl)guanine (DHPG). The minimum concentrations of phosphonoformate, DHPG, (S)-HPMPA, and (S)-HPMPC required to inhibit CMV plaque formation by 50% were 15, 0.7, 0.1, and 0.07 microgram/ml, respectively. The selectivity indices of phosphonoformate, DHPG, (S)-HPMPA, and (S)-HPMPC, as determined by the ratio of the 50% inhibitory concentration for cell growth to the 50% inhibitory concentration for plaque formation for CMV (AD-169 strain), were 14, 150, 200 and 1,500, respectively. Corresponding values for the CMV Davis strain were 20, 200, 100, and 1,000, respectively. (S)-HPMPC was inhibitory to CMV plaque formation even when added to the cells at 24 or 48 h postinfection. When (S)-HPMPC was added immediately postinfection, a 24- or 48-h incubation time sufficed to obtain a marked inhibitory effect on CMV replication. Such limited incubation time was insufficient for DHPG to achieve any protection against CMV. PMID:2854454

  2. Seroprevalence of Hepatitis C, Hepatitis B, Cytomegalovirus, and Human Immunodeficiency Viruses in Multitransfused Thalassemic Children in Upper Egypt

    PubMed Central

    Mahmoud, Ramadan A.; El-Mazary, Abdel-Azeem M.; Khodeary, Ashraf


    Background. Frequent blood transfusions in thalassemia major children expose them to the risk of transfusion-transmitted infections (TTIs). The aim of this study was to estimate the prevalence of hepatitis C virus (HCV), hepatitis B virus (HBV), human immunodeficiency virus (HIV), and cytomegalovirus (CMV) in thalassemic children attending the Pediatrics Departments of both Sohag and Minia Universities of Upper Egypt, during the period from May 2014 to May 2015. Methods. Serum samples were screened for hepatitis B surface antigen (HBsAg), anti-HCV, anti-CMV, and anti-HIV type 1 and type 2 using the Vitek Immunodiagnostic Assay System. Results. The frequencies of anti-HCV, HBsAg, anti-CMV, and anti-HIV type 1 and type 2 were found to be 37.11%, 4.12%, 4.12%, 0.00%, and 0.00%, respectively. Seropositivity for anti-HCV, HBsAg, and anti-CMV increased with increasing age of the patients, duration of the disease, serum ferritin level (ng/mL), and liver enzymes (U/L), while it was not significantly associated with gender, frequency of blood transfusion, or the status of splenectomy operation (P > 0.05). Conclusion. The frequency of TTIs, especially HCV, is considerably high among Egyptian children with thalassemia major. It is therefore important to implement measures to improve blood transfusion screening, such as polymerase chain reaction, in order to reduce TTIs from blood donor units. PMID:26989417

  3. Human cytomegalovirus carries serine/threonine protein phosphatases PP1 and a host-cell derived PP2A.

    PubMed Central

    Michelson, S; Turowski, P; Picard, L; Goris, J; Landini, M P; Topilko, A; Hemmings, B; Bessia, C; Garcia, A; Virelizier, J L


    Human cytomegalovirus (CMV), a herpesvirus, is an important cause of morbidity and mortality in immunocompromised patients. When studying hyper-immediate-early events after contact between CMV virions and the cell membrane, we observed a hypophosphorylation of cellular proteins within 10 min. This can be explained in part by our finding that purified CMV contains serine/threonine protein phosphatase activities. Biochemical analyses indicate that this protein phosphatase activity has all characteristics of type 1 and 2A protein phosphatases (PP1 and PP2A). Specifically, PP1 accounts for approximately 30% and PP2A accounts for the remaining 70% of the phosphorylase phosphatase activity found. CMV produced in astrocytoma cells stably expressing an amino-terminally tagged PP2A catalytic subunit contained tagged enzyme, thus demonstrating the cellular origin of CMV-associated PP2A. PP2A is specifically found inside the virus, associated with the nucleocapsid fraction. Western blot (immunoblot) analysis of purified virus revealed the presence of the catalytic subunits of PP2A and PP1. Furthermore, the catalytic subunit of PP2A appears to be complexed to the regulatory subunits PR65 and PR55, which is also the most abundant configuration of this enzyme found in the host cells. Incubation of virus with okadaic acid before contact of CMV with cells prevented hypophosphorylation of cellular proteins, thus demonstrating the role of CMV-associated phosphatases in this phenomenon. CMV can thus transport an active enzyme from one cell to another. PMID:8627658

  4. Mutations in human cytomegalovirus UL97 gene confer clinical resistance to ganciclovir and can be detected directly in patient plasma.

    PubMed Central

    Wolf, D G; Smith, I L; Lee, D J; Freeman, W R; Flores-Aguilar, M; Spector, S A


    Specific mutations in the UL97 region of human cytomegalovirus (HCMV) have been found to confer resistance to laboratory-adapted strains subjected to ganciclovir selection. In this study, mutations in the UL97 region of HCMV isolates obtained from patients receiving ganciclovir therapy were examined to determine whether they would confer ganciclovir resistance, and if these mutations could be detected directly in the plasma of AIDS patients with progressive HCMV disease despite ganciclovir treatment. A single nucleotide change within a conserved region of UL97 was found in five resistant isolates, resulting in an amino acid substitution in residue 595: from leucine to phenylalanine in one, and from leucine to serine in four resistant isolates. A sixth resistant isolate demonstrated a single nucleotide change, leading to a threonine to isoleucine substitution in residue 659. The role of the 595 amino acid substitution in conferring ganciclovir resistance was confirmed by marker transfer experiments. In further studies, direct sequencing of HCMV DNA present in plasma obtained from persons with resistant viruses revealed the identical amino acid substitutions in plasma as those present in the cultured viruses. These findings indicate that clinical resistance to ganciclovir can result from specific point mutations in the UL97 gene, and that the emergence of the resistant genotype can be detected directly in patient plasma. Images PMID:7814623

  5. Spatial relationships between markers for secretory and endosomal machinery in human cytomegalovirus-infected cells versus those in uninfected cells.


    Das, Subhendu; Pellett, Philip E


    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  6. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.


    Lee, Junsub; Kim, Sunyoung


    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  7. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins

    PubMed Central

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred


    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  8. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.


    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred


    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  9. Activation of Nucleotide Oligomerization Domain 2 (NOD2) by Human Cytomegalovirus Initiates Innate Immune Responses and Restricts Virus Replication

    PubMed Central

    Kapoor, Arun; Forman, Michael; Arav-Boger, Ravit


    Nucleotide-binding oligomerization domain 2 (NOD2) is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV) results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs) and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β) and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease. PMID:24671169

  10. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana


    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  11. Cytomegalovirus infection: an Indian perspective.


    Chakravarti, A; Kashyap, B; Matlani, M


    Human cytomegalovirus (CMV) poses an important public health problem as it may cause serious morbidity and mortality in congenitally infected newborns and immunocompromised patients, most notably transplant recipients and HIV-infected persons. It is probably one of the most common infections known to humans and is characterized by a self-limiting infection in healthy individuals. CMV infection is the single most frequent cause of infectious complications in the early period following kidney transplantation Post-transfusion cytomegalovirus infection is of concern in the immunocompetent as well as in certain categories of immunocompromised individuals such as neonates, pregnant women, recipients of bone marrow and other organ transplants and individuals with immunodeficiency disorders. The emergence of AIDS in India has necessitated the establishment of reliable tests for diagnosis of cytomegalovirus infection as a damaged immune system permits cytomegalovirus reactivation. The magnitude of this problem in India and the various diagnostic modalities used have not been adequately investigated and, hence, CMV infection is still a major health problem warranting strong preventive measures. The ultimate goal of the prevention program is to develop a vaccine that can be administered to seronegative women of childbearing age to prevent primary infection during pregnancy. PMID:19172051

  12. Inactivation of Retinoblastoma Protein Does Not Overcome the Requirement for Human Cytomegalovirus UL97 in Lamina Disruption and Nuclear Egress

    PubMed Central

    Reim, Natalia I.; Wang, Depeng; Lin, Alison; Sharma, Mayuri; Ericsson, Maria; Pesola, Jean M.; Golan, David E.


    Human cytomegalovirus (HCMV) encodes one conventional protein kinase, UL97. During infection, UL97 phosphorylates the retinoblastoma tumor suppressor protein (pRb) on sites ordinarily phosphorylated by cyclin-dependent kinases (CDK), inactivating the ability of pRb to repress host genes required for cell cycle progression to S phase. UL97 is important for viral DNA synthesis in quiescent cells, but this function can be replaced by human papillomavirus type 16 E7, which targets pRb for degradation. However, viruses in which E7 replaces UL97 are still defective for virus production. UL97 is also required for efficient nuclear egress of viral nucleocapsids, which is associated with disruption of the nuclear lamina during infection, and phosphorylation of lamin A/C on serine 22, which antagonizes lamin polymerization. We investigated whether inactivation of pRb might overcome the requirement of UL97 for these roles, as pRb inactivation induces CDK1, and CDK1 phosphorylates lamin A/C on serine 22. We found that lamin A/C serine 22 phosphorylation during HCMV infection correlated with expression of UL97 and was considerably delayed in UL97-null mutants, even when E7 was expressed. E7 failed to restore gaps in the nuclear lamina seen in wild-type but not UL97-null virus infections. In electron microscopy analyses, a UL97-null virus expressing E7 was as impaired as a UL97-null mutant in cytoplasmic accumulation of viral nucleocapsids. Our results demonstrate that pRb inactivation is insufficient to restore efficient viral nuclear egress of HCMV in the absence of UL97 and instead argue further for a direct role of UL97 in this stage of the infectious cycle. PMID:23427156

  13. Human cytomegalovirus glycoprotein B contains autonomous determinants for vectorial targeting to apical membranes of polarized epithelial cells.


    Tugizov, S; Maidji, E; Xiao, J; Zheng, Z; Pereira, L


    We previously reported that human cytomegalovirus (CMV) glycoprotein B (gB) is vectorially transported to apical membranes of CMV-infected polarized human retinal pigment epithelial cells propagated on permeable filter supports and that virions egress predominantly from the apical membrane domain. In the present study, we investigated whether gB itself contains autonomous information for apical transport by expressing the molecule in stably transfected Madine-Darby canine kidney (MDCK) cells grown on permeable filter supports. Laser scanning confocal immunofluorescence microscopy and domain-selective biotinylation of surface membrane domains showed that CMV gB was transported to apical membranes independently of other envelope glycoproteins and that it colocalized with proteins in transport vesicles of the biosynthetic and endocytic pathways. Determinants for trafficking to apical membranes were located by evaluating the targeting of gB derivatives with deletions in the lumen, transmembrane (TM) anchor, and carboxyl terminus. Derivative gB(Delta717-747), with an internal deletion in the luminal juxtamembrane sequence that preserved the N- and O-glycosylation sites, retained vectorial transport to apical membranes. In contrast, derivatives that lacked the TM anchor and cytosolic domain (gBDelta646-906) or the TM anchor alone (gBDelta751-771) underwent considerable basolateral targeting. Likewise, derivatives lacking the entire cytosolic domain (gBDelta772-906) or the last 73 amino acids (gBDelta834-906) showed disrupted apical transport. Site-specific mutations that deleted or altered the cluster of acidic residues with a casein kinase II phosphorylation site at the extreme carboxyl terminus, which can serve as an internalization signal, caused partial missorting of gB to basolateral membranes. Our studies indicate that CMV gB contains autonomous information for apical targeting in luminal, TM anchor, and cytosolic domain sequences, forming distinct structural

  14. Human Cytomegalovirus Glycoprotein B Contains Autonomous Determinants for Vectorial Targeting to Apical Membranes of Polarized Epithelial Cells

    PubMed Central

    Tugizov, Sharof; Maidji, Ekaterina; Xiao, Jianqiao; Zheng, Zhenwei; Pereira, Lenore


    We previously reported that human cytomegalovirus (CMV) glycoprotein B (gB) is vectorially transported to apical membranes of CMV-infected polarized human retinal pigment epithelial cells propagated on permeable filter supports and that virions egress predominantly from the apical membrane domain. In the present study, we investigated whether gB itself contains autonomous information for apical transport by expressing the molecule in stably transfected Madine-Darby canine kidney (MDCK) cells grown on permeable filter supports. Laser scanning confocal immunofluorescence microscopy and domain-selective biotinylation of surface membrane domains showed that CMV gB was transported to apical membranes independently of other envelope glycoproteins and that it colocalized with proteins in transport vesicles of the biosynthetic and endocytic pathways. Determinants for trafficking to apical membranes were located by evaluating the targeting of gB derivatives with deletions in the lumen, transmembrane (TM) anchor, and carboxyl terminus. Derivative gB(Δ717-747), with an internal deletion in the luminal juxtamembrane sequence that preserved the N- and O-glycosylation sites, retained vectorial transport to apical membranes. In contrast, derivatives that lacked the TM anchor and cytosolic domain (gBΔ646-906) or the TM anchor alone (gBΔ751-771) underwent considerable basolateral targeting. Likewise, derivatives lacking the entire cytosolic domain (gBΔ772-906) or the last 73 amino acids (gBΔ834-906) showed disrupted apical transport. Site-specific mutations that deleted or altered the cluster of acidic residues with a casein kinase II phosphorylation site at the extreme carboxyl terminus, which can serve as an internalization signal, caused partial missorting of gB to basolateral membranes. Our studies indicate that CMV gB contains autonomous information for apical targeting in luminal, TM anchor, and cytosolic domain sequences, forming distinct structural elements that

  15. Tumor necrosis factor receptor p75 mediates cell-specific activation of nuclear factor kappa B and induction of human cytomegalovirus enhancer.


    Laegreid, A; Medvedev, A; Nonstad, U; Bombara, M P; Ranges, G; Sundan, A; Espevik, T


    The functional role of human tumor necrosis factor receptor (TNFR) p75 was studied by the use of TNFR p75-specific agonistic antibodies. Human SW480T adenocarcinoma cells, stably transfected with a reporter construct containing beta-galactosidase under the control of human cytomegalovirus immediate early enhancer, were stimulated with anti-TNFR p75 polyclonal antiserum or monoclonal antibodies followed by measurement of beta-galactosidase activity and analysis by electrophoretic mobility shift assays. It was found that cross-linking of TNFR p75 led to strong induction of the human cytomegalovirus enhancer as well as activation of nuclear factor-kappa B (NF-kappa B). Stimulation of TNFR p75 also mediated activation of NF-kappa B in human KYM-1 rhabdomyosarcoma cells but not in other cell types such as U937 and HL-60 monocytic cells or in Eahy 926 endothelial cells. NF-kappa B activation induced by TNFR p75 was delayed approximately 15 min compared with NF-kappa B activation induced by TNFR p55, indicating that the two TNFRs activate NF-kappa B through different signaling pathways. The data presented in this study identify intracellular responses mediated by TNFR p75 which have not been reported previously and suggest that TNFR p75-induced activation of NF-kappa B is strictly cell type-specific. PMID:8126005

  16. Cytomegalovirus infection induces a stem cell phenotype in human primary glioblastoma cells: prognostic significance and biological impact.


    Fornara, O; Bartek, J; Rahbar, A; Odeberg, J; Khan, Z; Peredo, I; Hamerlik, P; Bartek, J; Stragliotto, G; Landázuri, N; Söderberg-Nauclér, C


    Glioblastoma (GBM) is associated with poor prognosis despite aggressive surgical resection, chemotherapy, and radiation therapy. Unfortunately, this standard therapy does not target glioma cancer stem cells (GCSCs), a subpopulation of GBM cells that can give rise to recurrent tumors. GBMs express human cytomegalovirus (HCMV) proteins, and previously we found that the level of expression of HCMV immediate-early (IE) protein in GBMs is a prognostic factor for poor patient survival. In this study, we investigated the relation between HCMV infection of GBM cells and the presence of GCSCs. Primary GBMs were characterized by their expression of HCMV-IE and GCSCs marker CD133 and by patient survival. The extent to which HCMV infection of primary GBM cells induced a GCSC phenotype was evaluated in vitro. In primary GBMs, a large fraction of CD133-positive cells expressed HCMV-IE, and higher co-expression of these two proteins predicted poor patient survival. Infection of GBM cells with HCMV led to upregulation of CD133 and other GSCS markers (Notch1, Sox2, Oct4, Nestin). HCMV infection also promoted the growth of GBM cells as neurospheres, a behavior typically displayed by GCSCs, and this phenotype was prevented by either chemical inhibition of the Notch1 pathway or by treatment with the anti-viral drug ganciclovir. GBM cells that maintained expression of HCMV-IE failed to differentiate into neuronal or astrocytic phenotypes. Our findings imply that HCMV infection induces phenotypic plasticity of GBM cells to promote GCSC features and may thereby increase the aggressiveness of this tumor. PMID:26138445

  17. RhoB is a component of the human cytomegalovirus assembly complex and is required for efficient viral production

    PubMed Central

    Goulidaki, Nektaria; Alarifi, Saud; Alkahtani, Saad H; Al-Qahtani, Ahmed; Spandidos, Demetrios A; Stournaras, Christos; Sourvinos, George


    Human Cytomegalovirus (HCMV), an ubiquitous β-herpesvirus, is a significant pathogen that causes medically severe diseases in immunocompromised individuals and in congenitally infected neonates. RhoB belongs to the family of Rho GTPases, which regulates diverse cellular processes. Rho proteins are implicated in the entry and egress from the host cell of mainly α- and γ-herpesviruses, whereas β-herpesviruses are the least studied in this regard. Here, we studied the role of RhoB GTPase during HCMV lytic infection. Microscopy analysis, both in fixed and live infected cells showed that RhoB was translocated to the assembly complex/compartment (AC) of HCMV, a cytoplasmic zone in infected cells where many viral structural proteins are known to accumulate and assembly of new virions takes place. Furthermore, RhoB was localized at the AC even when the expression of the late HCMV AC proteins was inhibited. At the very late stages of infection, cellular projections were formed containing RhoB and HCMV virions, potentially contributing to the successful viral spread. Interestingly, the knockdown of RhoB in HCMV-infected cells resulted in a significant reduction of the virus titer and could also affect the accumulation of AC viral proteins at this subcellular compartment. RhoB knockdown also affected actin fibers' structure. Actin reorganization was observed at late stages of infection originating from the viral AC and surrounding the cellular projections, implying a potential interplay between RhoB and actin during HCMV assembly and egress. In conclusion, our results demonstrate for the first time that RhoB is a constituent of the viral AC and is required for HCMV productive infection. PMID:26114383

  18. Global Mapping of O-Glycosylation of Varicella Zoster Virus, Human Cytomegalovirus, and Epstein-Barr Virus.


    Bagdonaite, Ieva; Nordén, Rickard; Joshi, Hiren J; King, Sarah L; Vakhrushev, Sergey Y; Olofsson, Sigvard; Wandall, Hans H


    Herpesviruses are among the most complex and widespread viruses, infection and propagation of which depend on envelope proteins. These proteins serve as mediators of cell entry as well as modulators of the immune response and are attractive vaccine targets. Although envelope proteins are known to carry glycans, little is known about the distribution, nature, and functions of these modifications. This is particularly true for O-glycans; thus we have recently developed a "bottom up" mass spectrometry-based technique for mapping O-glycosylation sites on herpes simplex virus type 1. We found wide distribution of O-glycans on herpes simplex virus type 1 glycoproteins and demonstrated that elongated O-glycans were essential for the propagation of the virus. Here, we applied our proteome-wide discovery platform for mapping O-glycosites on representative and clinically significant members of the herpesvirus family: varicella zoster virus, human cytomegalovirus, and Epstein-Barr virus. We identified a large number of O-glycosites distributed on most envelope proteins in all viruses and further demonstrated conserved patterns of O-glycans on distinct homologous proteins. Because glycosylation is highly dependent on the host cell, we tested varicella zoster virus-infected cell lysates and clinically isolated virus and found evidence of consistent O-glycosites. These results present a comprehensive view of herpesvirus O-glycosylation and point to the widespread occurrence of O-glycans in regions of envelope proteins important for virus entry, formation, and recognition by the host immune system. This knowledge enables dissection of specific functional roles of individual glycosites and, moreover, provides a framework for design of glycoprotein vaccines with representative glycosylation. PMID:27129252

  19. Bicaudal D1-Dependent Trafficking of Human Cytomegalovirus Tegument Protein pp150 in Virus-Infected Cells ▿

    PubMed Central

    Indran, Sabarish V.; Ballestas, Mary E.; Britt, William J.


    Human cytomegalovirus (HCMV) virion assembly takes place in the nucleus and cytoplasm of infected cells. The HCMV virion tegument protein pp150 (ppUL32) is an essential protein of HCMV and has been suggested to play a role in the cytoplasmic phase of HCMV assembly. To further define its role in viral assembly and to identify host cell proteins that interact with pp150 during viral assembly, we utilized yeast two-hybrid analyses to detect an interaction between pp150 and Bicaudal D1 (BicD1), a protein thought to play a role in trafficking within the secretory pathway. BicD1 is known to interact with the dynein motor complex and the Rab6 GTPase. The interaction between pp150 and BicD1 was confirmed by coimmunoprecipitation and fluorescence resonance energy transfer. Depletion of BicD1 with short hairpin RNA (shRNA) caused decreased virus yield and a defect in trafficking of pp150 to the cytoplasmic viral assembly compartment (AC), without altering trafficking to the AC of another essential tegument protein, pp28, or the viral glycoprotein complex gM/gN. The C terminus of BicD1 has been previously shown to interact with the GTPase Rab6, suggesting a potential role for Rab6-mediated vesicular trafficking in HCMV assembly. Finally, overexpression of the N terminus of truncated BicD1 acts in a dominant-negative manner and leads to disruption of the AC and a decrease in the assembly of infectious virus. This phenotype was similar to that observed following overexpression of dynamitin (p50) and provided additional evidence that morphogenesis of the AC and virus assembly were dynein dependent. PMID:20089649

  20. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.


    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  1. Latent cytomegalovirus infection enhances anti-tumour cytotoxicity through accumulation of NKG2C+ NK cells in healthy humans.


    Bigley, A B; Rezvani, K; Shah, N; Sekine, T; Balneger, N; Pistillo, M; Agha, N; Kunz, H; O'Connor, D P; Bollard, C M; Simpson, R J


    Cytomegalovirus (CMV) infection markedly expands NKG2C+/NKG2A- NK cells, which are potent killers of infected cells expressing human leucocyte antigen (HLA)-E. As HLA-E is also over-expressed in several haematological malignancies and CMV has been linked to a reduced risk of leukaemic relapse, we determined the impact of latent CMV infection on NK cell cytotoxicity against four tumour target cell lines with varying levels of HLA-E expression. NK cell cytotoxicity against K562 (leukaemia origin) and U266 (multiple myeloma origin) target cells was strikingly greater in healthy CMV-seropositive donors than seronegative donors and was associated strongly with target cell HLA-E and NK cell NKG2C expression. NK cell cytotoxicity against HLA-E transfected lymphoma target cells (221.AEH) was ∼threefold higher with CMV, while NK cell cytotoxicity against non-transfected 721.221 cells was identical between the CMV groups. NK cell degranulation (CD107a(+) ) and interferon (IFN)-γ production to 221.AEH cells was localized almost exclusively to the NKG2C subset, and antibody blocking of NKG2C completely eliminated the effect of CMV on NK cell cytotoxicity against 221.AEH cells. Moreover, 221.AEH feeder cells and interleukin (IL)-15 were found to expand NKG2C(+) /NKG2A(-) NK cells preferentially from CMV-seronegative donors and increase NK cell cytotoxicity against HLA-E(+) tumour cell lines. We conclude that latent CMV infection enhances NK cell cytotoxicity through accumulation of NKG2C(+) NK cells, which may be beneficial in preventing the initiation and progression of haematological malignancies characterized by high HLA-E expression. PMID:26940026

  2. Effect of the complexation with cyclodextrins on the in vitro antiviral activity of ganciclovir against human cytomegalovirus.


    Nicolazzi, C; Abdou, S; Collomb, J; Marsura, A; Finance, C


    The toxicity of the molecules currently used in the treatment of human cytomegalovirus (HCMV) in immunocompromised hosts often causes interruption of the therapy. Cyclodextrins (Cds), oligosaccharides possessing a hydrophobic cavity, have the property of forming inclusion complexes with a great number of molecules, improving their bioavailability and their biological properties. In this study, we have tested the ability of three native Cds to improve the antiviral effect of ganciclovir (GCV) on two HCMV strains: AD169, a reference susceptible strain, and RC11, a GCV resistant strain. The efficacy of the GCV, expressed in IC50 values, showed no improvement in the presence of alpha-Cd, while the use of beta- and gamma-Cd improved by 6- and 4-fold, respectively, its antiviral activity tested on AD169 strain. The influence of beta- or gamma-Cd on GCV efficiency evaluated on RC11 strain showed a decrease of the IC50. Parallel NMR studies were undertaken in order to characterize formation of [GCV:Cd] complexes. The results showed that complexation between alpha- or gamma-Cd and GCV did not occur. In contrast, spectra proved that beta-Cd formed an inclusion complex with GCV. This complex was characterized in UV-Visible spectrophotometry and the influence of the beta-Cd on the GCV penetration in cells was measured. The use of Cds as carriers of antiviral drugs would be a good alternative to traditional treatment, because it may allow the administration of lower doses and so continuous treatment by reducing the toxic effects of drugs. PMID:11249120

  3. NKG2D ligand MICA is retained in the cis-Golgi apparatus by human cytomegalovirus protein UL142.


    Ashiru, Omodele; Bennett, Neil J; Boyle, Louise H; Thomas, Mair; Trowsdale, John; Wills, Mark R


    Human cytomegalovirus (HCMV) evades T-cell recognition by down-regulating expression of major histocompatibility complex (MHC) class I and II molecules on the surfaces of infected cells. Contrary to the "missing-self" hypothesis, HCMV-infected cells are refractory to lysis by natural killer (NK) cells. Inhibition of NK cell function is mediated by a number of HCMV immune evasion molecules, which operate by delivering inhibitory signals to NK cells and preventing engagement of activating ligands. One such molecule is UL142, which is an MHC class I-related glycoprotein encoded by clinical isolates and low-passage-number strains of HCMV. UL142 is known to down-modulate surface expression of MHC class I-related chain A (MICA), which is a ligand of the activating NK receptor NKG2D. However, the mechanism by which UL142 interferes with MICA is unknown. Here, we show that UL142 localizes predominantly to the endoplasmic reticulum (ER) and cis-Golgi apparatus. The transmembrane domain of UL142 mediates its ER localization, while we propose that the UL142 luminal domain is involved in its cis-Golgi localization. We also confirm that UL142 down-modulates surface expression of full-length MICA alleles while having no effect on the truncated allele MICA*008. However, we demonstrate for the first time that UL142 retains full-length MICA alleles in the cis-Golgi apparatus. In addition, we propose that UL142 interacts with nascent MICA en route to the cell surface but not mature MICA at the cell surface. Our data also demonstrate that the UL142 luminal and transmembrane domains are involved in recognition and intracellular sequestration of full-length MICA alleles. PMID:19793804

  4. Nucleolin associates with the human cytomegalovirus DNA polymerase accessory subunit UL44 and is necessary for efficient viral replication.


    Strang, Blair L; Boulant, Steeve; Coen, Donald M


    In the eukaryotic cell, DNA replication entails the interaction of multiple proteins with the DNA polymerase processivity factor PCNA. As the structure of the presumptive human cytomegalovirus (HCMV) DNA polymerase processivity factor UL44 is highly homologous to that of PCNA, we hypothesized that UL44 also interacts with numerous proteins. To investigate this possibility, recombinant HCMV expressing FLAG-tagged UL44 was generated and used to immunoprecipitate UL44 and associated proteins from infected cell lysates. Unexpectedly, nucleolin, a major protein component of the nucleolus, was identified among these proteins by mass spectrometry and Western blotting. The association of nucleolin and UL44 in infected cell lysate was confirmed by reciprocal coimmunoprecipitation in the presence and absence of nuclease. Western blotting and immunofluorescence assays demonstrated that the level of nucleolin increases during infection and that nucleolin becomes distributed throughout the nucleus. Furthermore, the colocalization of nucleolin and UL44 in infected cell nuclei was observed by immunofluorescence assays. Assays of HCMV-infected cells treated with small interfering RNA (siRNA) targeting nucleolin mRNA indicated that nucleolin was required for efficient virus production, viral DNA synthesis, and the expression of a late viral protein, with a correlation between the efficacy of knockdown and the effect on virus replication. In contrast, the level of neither global protein synthesis nor the replication of an unrelated virus (reovirus) was reduced in siRNA-treated cells. Taken together, our results indicate an association of nucleolin and UL44 in HCMV-infected cells and a role for nucleolin in viral DNA synthesis. PMID:20007282

  5. Preclinical evaluation of the immunogenicity and safety of plasmid DNA-based prophylactic vaccines for human cytomegalovirus

    PubMed Central

    Hartikka, Jukka; Bozoukova, Vesselina; Morrow, Jane; Rusalov, Denis; Shlapobersky, Mark; Wei, Qun; Boutsaboualoy, Sou; Ye, Ming; Wloch, Mary K.; Doukas, John; Sullivan, Sean; Rolland, Alain; Smith, Larry R.


    Human cytomegalovirus (CMV) establishes a lifelong persistent infection characterized by periods of latency and sporadic viral replication and is a major infectious cause of birth defects following congenital infection. Currently, no licensed vaccine is available that would prevent CMV infection. In an effort to develop a prophylactic CMV vaccine, the effects of different formulations, immunization routes and delivery devices on the immunogenicity of plasmid DNA (pDNA)-based vaccines were evaluated in rabbits and mice. Compared with PBS- and poloxamer-based formulations, significantly higher antibody responses were obtained with pDNA formulated with Vaxfectin®, a cationic lipid-based adjuvant. With low vaccine doses, the intradermal (ID) route resulted in higher antibody responses than obtained when the same dose was administered intramuscularly (IM). Since the IM route allowed injection of larger volumes and higher doses than could be administered at a single ID site, better antibody responses were obtained using the IM route. The needle-free injection system Biojector® 2000 and electroporation devices enhanced antibody responses only marginally compared with responses obtained with Vaxfectin®-formulated pDNA injected IM with a needle. A single-vial Vaxfectin® formulation was developed in a dosage form ready for use after thawing at room temperature. Finally, in a GLP-compliant repeat-dose toxicology study conducted in rabbits, single-vial Vaxfectin®-formulated vaccines, containing pDNA and Vaxfectin® up to 4.5 mg and 2 mg/injection, respectively, showed a favorable safety profile and were judged as well-tolerated. The results support further development of a Vaxfectin®-formulated pDNA vaccine to target congenital CMV infection. PMID:22922766

  6. Baculoviruses deficient in ie1 gene function abrogate viral gene expression in transduced mammalian cells

    SciTech Connect

    Efrose, Rodica; Swevers, Luc; Iatrou, Kostas


    One of the newest niches for baculoviruses-based technologies is their use as vectors for mammalian cell transduction and gene therapy applications. However, an outstanding safety issue related to such use is the residual expression of viral genes in infected mammalian cells. Here we show that infectious baculoviruses lacking the major transcriptional regulator, IE1, can be produced in insect host cells stably transformed with IE1 expression constructs lacking targets of homologous recombination that could promote the generation of wt-like revertants. Such ie1-deficient baculoviruses are unable to direct viral gene transcription to any appreciable degree and do not replicate in normal insect host cells. Most importantly, the residual viral gene expression, which occurs in mammalian cells infected with wt baculoviruses is reduced 10 to 100 fold in cells infected with ie1-deficient baculoviruses. Thus, ie1-deficient baculoviruses offer enhanced safety features to baculovirus-based vector systems destined for use in gene therapy applications.

  7. Latent infection of myeloid progenitors by human cytomegalovirus protects cells from FAS-mediated apoptosis through the cellular IL-10/PEA-15 pathway

    PubMed Central

    Lau, Jonathan C. H.; Sinclair, John


    Latent infection of primary CD34+ progenitor cells by human cytomegalovirus (HCMV) results in their increased survival in the face of pro-apoptotic signals. For instance, we have shown previously that primary myeloid cells are refractory to FAS-mediated killing and that cellular IL-10 (cIL-10) is an important survival factor for this effect. However, how cIL-10 mediates this protection is unclear. Here, we have shown that cIL-10 signalling leading to upregulation of the cellular factor PEA-15 mediates latency-associated protection of CD34+ progenitor cells from the extrinsic death pathway. PMID:25957098

  8. Trehalose, an mTOR-Independent Inducer of Autophagy, Inhibits Human Cytomegalovirus Infection in Multiple Cell Types

    PubMed Central

    Belzile, Jean-Philippe; Sabalza, Maite; Craig, Megan; Clark, Elizabeth; Morello, Christopher S.


    ABSTRACT Human cytomegalovirus (HCMV) is the major viral cause of birth defects and a serious problem in immunocompromised individuals and has been associated with atherosclerosis. Previous studies have shown that the induction of autophagy can inhibit the replication of several different types of DNA and RNA viruses. The goal of the work presented here was to determine whether constitutive activation of autophagy would also block replication of HCMV. Most prior studies have used agents that induce autophagy via inhibition of the mTOR pathway. However, since HCMV infection alters the sensitivity of mTOR kinase-containing complexes to inhibitors, we sought an alternative method of inducing autophagy. We chose to use trehalose, a nontoxic naturally occurring disaccharide that is found in plants, insects, microorganisms, and invertebrates but not in mammals and that induces autophagy by an mTOR-independent mechanism. Given the many different cell targets of HCMV, we proceeded to determine whether trehalose would inhibit HCMV infection in human fibroblasts, aortic artery endothelial cells, and neural cells derived from human embryonic stem cells. We found that in all of these cell types, trehalose induces autophagy and inhibits HCMV gene expression and production of cell-free virus. Treatment of HCMV-infected neural cells with trehalose also inhibited production of cell-associated virus and partially blocked the reduction in neurite growth and cytomegaly. These results suggest that activation of autophagy by the natural sugar trehalose or other safe mTOR-independent agents might provide a novel therapeutic approach for treating HCMV disease. IMPORTANCE HCMV infects multiple cell types in vivo, establishes lifelong persistence in the host, and can cause serious health problems for fetuses and immunocompromised individuals. HCMV, like all other persistent pathogens, has to finely tune its interplay with the host cellular machinery to replicate efficiently and evade

  9. Cytomegalovirus Colitis: An Uncommon Mimicker of Common Colitides.


    Baniak, Nick; Kanthan, Rani


    Cytomegalovirus latency, though ubiquitous in the human population, is known to cause colitis in both immunocompromised and immunocompetent hosts. Furthermore, the clinical, endoscopic, and histologic appearance of cytomegalovirus colitis can mimic that of inflammatory bowel disease, an extremely well-documented disease. In this context, though many reports have looked at inflammatory bowel disease with superimposed cytomegalovirus infection, less attention has been paid to cytomegalovirus as a primary cause of isolated colitis. Owing to the rarity of this phenomenon, it is important to consider this diagnosis and implement proper testing to avoid misdiagnosis and mismanagement. PMID:27472242

  10. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.


    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  11. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2010 CFR


    ...) REGULATIONS NON-FEDERAL FUNDS Federal Candidates and Officeholders § 300.60 Scope (2 U.S.C. 441i(e)(1)). This subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2010-01-01 2010-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section...

  12. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2011 CFR


    ...) REGULATIONS NON-FEDERAL FUNDS Federal Candidates and Officeholders § 300.60 Scope (2 U.S.C. 441i(e)(1)). This subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2011-01-01 2011-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section...

  13. The Baculovirus PE38 Protein Augments Apoptosis Induced by Transactivator IE1

    PubMed Central

    Prikhod’ko, Elena A.; Miller, Lois K.


    While studying apoptosis induced by baculovirus transactivator IE1 in SF-21 cells, we found that the levels of IE1-induced apoptosis were increased approximately twofold upon cotransfection with the baculovirus early pe38 gene. However, no apoptotic activity was observed in cells transfected with pe38 alone, even when placed under the control of a constitutive promoter. Thus, pe38 was able to augment IE1-induced apoptosis but was unable to induce apoptosis when expressed in SF-21 cells alone. PE38, the full-length product of pe38, is a nuclear protein with RING finger and leucine zipper motifs. Deletion of the amino-terminal region, which contains a putative nuclear localization motif, resulted in cytoplasmic localization of the PE38 mutants. These N-terminal deletion mutants were unable to enhance IE1-induced apoptosis. Mutation of a single conserved leucine (L242) of the leucine zipper motif also eliminated the ability of PE38 to augment apoptosis induced by IE1. In contrast, PE38 mutants with alanine substitutions for conserved cysteine residues (C109 or C138) of the RING finger motif were able to increase IE1-induced apoptosis to levels equivalent to those of wild-type PE38. We propose that PE38 is one of at least two viral factors which collectively evoke a cellular apoptotic response during baculovirus infection. PMID:10400766

  14. Repertoire, diversity, and differentiation of specific CD8 T cells are associated with immune protection against human cytomegalovirus disease.


    Sacre, Karim; Carcelain, Guislaine; Cassoux, Nathalie; Fillet, Anne-Marie; Costagliola, Dominique; Vittecoq, Daniel; Salmon, Dominique; Amoura, Zahir; Katlama, Christine; Autran, Brigitte


    To determine the correlates of immune recovery from active human CMV (HCMV) disease, we compared the antigenic repertoire, diversity, magnitude, and differentiation of HCMV-specific CD8+ T cells in HIV-HCMV coinfected subjects with no, cured, or active HCMV disease and in healthy HIV-negative HCMV-positive controls. ELISPOT-IFN-gamma assays using peptide pools spanning the pp65 and immediate early 1 (IE1) HCMV proteins showed that HCMV-specific CD8+ T cells had a significantly broader antigenic repertoire and greater diversity in HIV-positive patients controlling HCMV replication than in those with active HCMV disease, but the magnitude of the CD8 T cell response did not differ between the different groups. HCMV-specific T cells mainly were focused against IE1 during the short-term recovery from retinitis, and switched toward pp65 during long-term recovery. HCMV-specific T cells displaying an "early" (CD8+CD27+CD28+) and "intermediate" (CD8+CD27-CD28+) differentiation phenotype were increased significantly during long-term recovery compared with other HIV-positive patients and were nearly undetectable during active HCMV disease. HCMV-specific T cells with a "late" (CD8+CD27-28-) differentiation phenotype predominated in all cases. Therefore, restoration of immune protection against HCMV after active HCMV disease in immunodeficient individuals is associated with enlarged repertoire and diversity, and with early differentiation of virus-specific CD8+ T cells, thus defining immune correlates of protection against diseases caused by persistent viruses. PMID:15967826

  15. Synthesis and antiviral properties of (+/-)-5'-noraristeromycin and related purine carbocyclic nucleosides. A new lead for anti-human cytomegalovirus agent design.


    Patil, S D; Schneller, S W; Hosoya, M; Snoeck, R; Andrei, G; Balzarini, J; De Clercq, E


    (+/-)-5'-Noraristeromycin (3) has been prepared in three steps beginning with the 2,3-O-isopropylidene derivative of (+/-)-(1 alpha, 2 beta, 3 beta, 4 alpha)-4-amino-1,2,3-cyclopentanetriol (7). Also prepared from the same starting material were the related hypoxanthine (4), guanine (5), and 2,6-diaminopurine (6) analogues. Compounds 3-6 were evaluated for antiviral activity against a large number of viruses with marked activity being observed for 3 towards vaccinia virus, human cytomegalovirus, vesicular stomatitis virus, parainfluenza (type 3) virus, measles virus, respiratory syncytial virus, reovirus (type 1), and the arenaviruses Junin and Tacaribe. None of the compounds showed cytotoxicity to the host cell monolayers used in the antiviral studies. Both 3 and 6 have been found to be inhibitors of S-adenosyl-L-homocysteine hydrolase (AdoHcy hydrolase), which likely accounts for their antiviral activity. Inhibition of AdoHcy hydrolase represents a new approach to human cytomegalovirus drug design that should be pursued. Also, the activity of 3 should be further scrutinized for the treatment of pox-, rhabdo-, paramyxo-, reo-, and arenavirus infections. PMID:1326633

  16. Platelet-derived growth factor-α receptor is the cellular receptor for human cytomegalovirus gHgLgO trimer.


    Kabanova, Anna; Marcandalli, Jessica; Zhou, Tongqing; Bianchi, Siro; Baxa, Ulrich; Tsybovsky, Yaroslav; Lilleri, Daniele; Silacci-Fregni, Chiara; Foglierini, Mathilde; Fernandez-Rodriguez, Blanca Maria; Druz, Aliaksandr; Zhang, Baoshan; Geiger, Roger; Pagani, Massimiliano; Sallusto, Federica; Kwong, Peter D; Corti, Davide; Lanzavecchia, Antonio; Perez, Laurent


    Human cytomegalovirus encodes at least 25 membrane glycoproteins that are found in the viral envelope(1). While gB represents the fusion protein, two glycoprotein complexes control the tropism of the virus: the gHgLgO trimer is involved in the infection of fibroblasts, and the gHgLpUL128L pentamer is required for infection of endothelial, epithelial and myeloid cells(2-5). Two reports suggested that gB binds to ErbB1 and PDGFRα (refs 6,7); however, these results do not explain the tropism of the virus and were recently challenged(8,9). Here, we provide a 19 Å reconstruction for the gHgLgO trimer and show that it binds with high affinity through the gO subunit to PDGFRα, which is expressed on fibroblasts but not on epithelial cells. We also provide evidence that the trimer is essential for viral entry in both fibroblasts and epithelial cells. Furthermore, we identify the pentamer, which is essential for infection of epithelial cells, as a trigger for the ErbB pathway. These findings help explain the broad tropism of human cytomegalovirus and indicate that PDGFRα and the viral gO subunit could be targeted by novel anti-viral therapies. PMID:27573107

  17. Novel Method Based on Real-Time Cell Analysis for Drug Susceptibility Testing of Herpes Simplex Virus and Human Cytomegalovirus.


    Piret, Jocelyne; Goyette, Nathalie; Boivin, Guy


    The plaque reduction assay (PRA) is the gold standard phenotypic method to determine herpes simplex virus (HSV) and human cytomegalovirus (HCMV) susceptibilities to antiviral drugs. However, this assay is subjective and labor intensive. Here, we describe a novel antiviral phenotypic method based on real-time cell analysis (RTCA) that measures electronic impedance over time. The effective drug concentrations that reduced by 50% (EC50s) the cytopathic effects induced by HSV-1 and HCMV were evaluated by both methods. The EC50s of acyclovir and foscarnet against a reference wild-type (WT) HSV-1 strain in Vero cells were, respectively, 0.5 μM and 32.6 μM by PRA and 0.8 μM and 93.6 μM by RTCA. The EC50 ratios for acyclovir against several HSV-1 thymidine kinase (TK) mutants were 101.8×, 73.4×, 28.8×, and 35.4× (PRA) and 18.0×, 52.0×, 5.5×, and 87.8× (RTCA) compared to those for the WT. The EC50 ratios for acyclovir and foscarnet against the HSV-1 TK/DNA polymerase mutant were 182.8× and 9.7× (PRA) and >125.0× and 10.8× (RTCA) compared to the WT. The EC50s of ganciclovir and foscarnet against WT HCMV strain AD169 in fibroblasts were, respectively, 1.6 μM and 27.8 μM by PRA and 5.0 μM and 111.4 μM by RTCA. The EC50 ratios of ganciclovir against the HCMV UL97 mutant were 3.8× (PRA) and 8.2× (RTCA) compared to those for the WT. The EC50 ratios of ganciclovir and foscarnet against the HCMV UL97/DNA polymerase mutant were 17.1× and 12.1× (PRA) and 14.7× and 4.6× (RTCA) compared to those for the WT. RTCA allows objective drug susceptibility testing of HSV and HCMV and could permit high-throughput screening of new antivirals. PMID:27252463

  18. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.

    PubMed Central

    Lang, D; Gebert, S; Arlt, H; Stamminger, T


    The 86-kDa IE2 protein (IE86) of human cytomegalovirus (HCMV) has been described as a promiscuous transactivator of viral, as well as cellular, gene expression. Investigation of the mechanism used by IE86 to activate gene expression from the early UL112/113 promoter of HCMV revealed the existence of three binding sites for IE86 located between nucleotides -290 and -120 relative to the transcriptional start site (H. Arlt, D. Lang, S. Gebert, and T. Stamminger, J. Virol. 68:4117-4125, 1994). As shown previously, deletion of these target sites resulted in a reduction of IE86-mediated transactivation by approximately 70%. The remaining promoter, however, could still be stimulated about 40-fold, indicating the presence of an additional responsive element within these sequences. Here, we provide evidence that a binding site for the cellular transcription factor CREB can also act as a target for IE86 transactivation. By DNase I protection analysis, a binding sequence for CREB could be detected between nucleotides -78 and -56 within the respective promoter region. After in vitro mutagenesis of this CREB-binding site within the context of the entire UL112/113 promoter, a marked reduction in transactivation levels was evident. Moreover, when individual CREB-binding sites were positioned upstream of a minimal, TATA box-containing UL112/113 promoter, they were able to confer strong IE86 responsiveness, whereas a mutated sequence did not exert any effect. In far Western blot and pull-down experiments, a direct interaction of IE86 with the cellular transcription factor CREB could be observed. The in vivo relevance of this in vitro interaction was confirmed by using various GAL4 fusion proteins in the presence or absence of IE86 which revealed a strong activation only in the presence of both a GAL4-CREB fusion and IE86. This shows that at least one specific member of the ATF/CREB family of transcription factors is involved in mediating transactivation by the HCMV IE86 protein

  19. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh


    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients

  20. Evaluation of New Quantitative Assays for Diagnosis and Monitoring of Cytomegalovirus Disease in Human Immunodeficiency Virus-Positive Patients

    PubMed Central

    Pellegrin, Isabelle; Garrigue, Isabelle; Binquet, Christine; Chene, Genevieve; Neau, Didier; Bonot, Pascal; Bonnet, Fabrice; Fleury, Herve; Pellegrin, Jean-Luc


    Cobas Amplicor CMV Monitor (CMM) and Quantiplex CMV bDNA 2.0 (CMV bDNA 2.0), two new standardized and quantitative assays for the detection of cytomegalovirus (CMV) DNA in plasma and peripheral blood leukocytes (PBLs), respectively, were compared to the CMV viremia assay, pp65 antigenemia assay, and the Amplicor CMV test (P-AMP). The CMV loads were measured in 384 samples from 58 human immunodeficiency virus (HIV) type 1-infected, CMV-seropositive subjects, including 13 with symptomatic CMV disease. The assays were highly concordant (agreement, 0.88 to 0.97) except when the CMV load was low. Quantitative results for plasma and PBLs were significantly correlated (Spearman ρ = 0.92). For PBLs, positive results were obtained 125 days before symptomatic CMV disease by CMV bDNA 2.0 and 124 days by pp65 antigenemia assay, whereas they were obtained 46 days before symptomatic CMV disease by CMM and P-AMP. At the time of CMV disease diagnosis, the sensitivity, specificity, and positive and negative predictive values of CMV bDNA 2.0 were 92.3, 97.8, 92.3, and 97.8%, respectively, whereas they were 92.3, 93.3, 80, and 97.8%, respectively, for the pp65 antigenemia assay; 84.6, 100, 100, and 95.7%, respectively, for CMM; and 76.9, 100, 100, and 93.8%, respectively, for P-AMP. Considering the entire follow-up, the sensitivity, specificity, and positive and negative predictive values of CMV bDNA 2.0 were 92.3, 73.3, 52.1, and 97.1%, respectively, whereas they were 100, 55.5, 39.4, and 100%, respectively, for the pp65 antigenemia assay; 92.3, 86.7, 66.7, and 97.5%, respectively, for CMM; and 84.6, 91.1, 73.3, and 95.3%, respectively, for P-AMP. Detection of CMV in plasma is technically easy and, despite its later positivity (i.e., later than in PBLs), can provide enough information sufficiently early so that HIV-infected patients can be effectively treated. In addition, these standardized quantitative assays accurately monitor the efficacy of anti-CMV treatment. PMID:10488165

  1. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection.


    Li, Qingxue; Wilkie, Adrian R; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I


    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  2. Enveloped Virus-Like Particle Expression of Human Cytomegalovirus Glycoprotein B Antigen Induces Antibodies with Potent and Broad Neutralizing Activity

    PubMed Central

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David


    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  3. Enveloped virus-like particle expression of human cytomegalovirus glycoprotein B antigen induces antibodies with potent and broad neutralizing activity.


    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David; Anderson, David E


    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  4. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto


    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  5. Human cytomegalovirus resistance to deoxyribosylindole nucleosides maps to a transversion mutation in the terminase subunit-encoding gene UL89.


    Gentry, Brian G; Phan, Quang; Hall, Ellie D; Breitenbach, Julie M; Borysko, Katherine Z; Kamil, Jeremy P; Townsend, Leroy B; Drach, John C


    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  6. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions

    PubMed Central

    Vanarsdall, Adam L.; Howard, Paul W.; Wisner, Todd W.; Johnson, David C.


    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16–50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB. PMID:27082872

  7. A “Coiled-Coil” Motif Is Important for Oligomerization and DNA Binding Properties of Human Cytomegalovirus Protein UL77

    PubMed Central

    Dittmer, Alexandra; Lapp, Sara; Bogner, Elke


    Human cytomegalovirus (HCMV) UL77 gene encodes the essential protein UL77, its function is characterized in the present study. Immunoprecipitation identified monomeric and oligomeric pUL77 in HCMV infected cells. Immunostaining of purified virions and subviral fractions showed that pUL77 is a structural protein associated with capsids. In silico analysis revealed the presence of a coiled-coil motif (CCM) at the N-terminus of pUL77. Chemical cross-linking of either wild-type pUL77 or CCM deletion mutant (pUL77ΔCCM) implicated that CCM is critical for oligomerization of pUL77. Furthermore, co-immunoprecipitations of infected and transfected cells demonstrated that pUL77 interacts with the capsid-associated DNA packaging motor components, pUL56 and pUL104, as well as the major capsid protein. The ability of pUL77 to bind dsDNA was shown by an in vitro assay. Binding to certain DNA was further confirmed by an assay using biotinylated 36-, 250-, 500-, 1000-meric dsDNA and 966-meric HCMV-specific dsDNA designed for this study. The binding efficiency (BE) was determined by image processing program defining values above 1.0 as positive. While the BE of the pUL56 binding to the 36-mer bio-pac1 containing a packaging signal was 10.0±0.63, the one for pUL77 was only 0.2±0.03. In contrast to this observation the BE of pUL77 binding to bio-500 bp or bio-1000 bp was 2.2±0.41 and 4.9±0.71, respectively. By using pUL77ΔCCM it was demonstrated that this protein could not bind to dsDNA. These data indicated that pUL77 (i) could form homodimers, (ii) CCM of pUL77 is crucial for oligomerization and (iii) could bind to dsDNA in a sequence independent manner. PMID:21998635

  8. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection

    PubMed Central

    Li, Qingxue; Wilkie, Adrian R.; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I.


    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  9. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron


    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  10. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.


    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M


    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  11. Heterogeneity of CD4+ and CD8+ T-cell responses to cytomegalovirus in HIV-infected and HIV-uninfected men who have sex with men.


    Li, Huifen; Margolick, Joseph B; Bream, Jay H; Nilles, Tricia L; Langan, Susan; Bui, Hanhvy T; Sylwester, Andrew W; Picker, Louis J; Leng, Sean X


    Studies of T-cell immunity to human cytomegalovirus (CMV) primarily reflect anti-CMV pp65 or immediate early antigen 1 (IE-1) activity. We assessed responses of T cells from human immunodeficiency virus (HIV)-negative and HIV-infected men to peptide pools spanning 19 CMV open reading frames selected because they previously correlated with total CMV-specific T-cell responses in healthy donors. Cells producing cytokines in response to pp65 or IE-1 together composed <12% and <40% of the total CD4(+) and CD8(+) T-cell responses to CMV, respectively. These proportions were generally similar regardless of HIV serostatus. Thus, analyses of total CMV-specific T-cell responses should extend beyond pp65 and IE-1 regardless of HIV serostatus. PMID:24532602

  12. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S


    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  13. The Human Cytomegalovirus UL133-138 Gene Locus Attenuates the Lytic Viral Cycle in Fibroblasts

    PubMed Central

    Dutta, Nirmal; Lashmit, Philip; Yuan, Jinxiang; Meier, Jeffery; Stinski, Mark F.


    The genomes of HCMV clinical strains (e.g. FIX, TR, PH, etc) contain a 15 kb region that encodes 20 putative ORFs. The region, termed ULb’, is lost after serial passage of virus in human foreskin fibroblast (HFF) cell culture. Compared to clinical strains, laboratory strains replicate faster and to higher titers of infectious virus. We made recombinant viruses with 22, 14, or 7 ORFs deleted from the ULb’ region using FIX and TR as model clinical strains. We also introduced a stop codon into single ORFs between UL133 and UL138 to prevent protein expression. All deletions within ULb’ and all stop codon mutants within the UL133 to UL138 region increased to varying degrees, viral major immediate early RNA and protein, DNA, and cell-free infectious virus compared to the wild type viruses. The wild type viral proteins slowed down the viral replication process along with cell-free infectious virus release from human fibroblast cells. PMID:25799165

  14. Aminobisphosphonates Synergize with Human Cytomegalovirus To Activate the Antiviral Activity of Vγ9Vδ2 Cells.


    Daguzan, Charline; Moulin, Morgane; Kulyk-Barbier, Hanna; Davrinche, Christian; Peyrottes, Suzanne; Champagne, Eric


    Human Vγ9Vδ2 T cells are activated through their TCR by neighboring cells producing phosphoantigens. Zoledronate (ZOL) treatment induces intracellular accumulation of the phosphoantigens isopentenyl pyrophosphate and ApppI. Few attempts have been made to use immunomanipulation of Vγ9Vδ2 lymphocytes in chronic viral infections. Although Vγ9Vδ2 T cells seem to ignore human CMV (HCMV)-infected cells, we examined whether they can sense HCMV when a TCR stimulus is provided with ZOL. Fibroblasts treated with ZOL activate Vγ9Vδ2 T cells to produce IFN-γ but not TNF. Following the same treatment, HCMV-infected fibroblasts stimulate TNF secretion and an increased production of IFN-γ, indicating that Vγ9Vδ2 cells can sense HCMV infection. Increased lymphokine production was observed with most clinical isolates and laboratory HCMV strains, HCMV-permissive astrocytoma, or dendritic cells, as well as "naive" and activated Vγ9Vδ2 cells. Quantification of intracellular isopentenyl pyrophosphate/ApppI following ZOL treatment showed that HCMV infection boosts their accumulation. This was explained by an increased capture of ZOL and by upregulation of HMG-CoA synthase and reductase transcription. Using an experimental setting where infected fibroblasts were cocultured with γδ cells in submicromolar concentrations of ZOL, we show that Vγ9Vδ2 cells suppressed substantially the release of infectious particles while preserving uninfected cells. Vγ9Vδ2 cytotoxicity was decreased by HCMV infection of targets whereas anti-IFN-γ and anti-TNF Abs significantly blocked the antiviral effect. Our experiments indicate that cytokines produced by Vγ9Vδ2 T cells have an antiviral potential in HCMV infection. This should lead to in vivo studies to explore the possible antiviral effect of immunostimulation with ZOL in this context. PMID:26819204

  15. New efficient artemisinin derived agents against human leukemia cells, human cytomegalovirus and Plasmodium falciparum: 2nd generation 1,2,4-trioxane-ferrocene hybrids.


    Reiter, Christoph; Fröhlich, Tony; Zeino, Maen; Marschall, Manfred; Bahsi, Hanife; Leidenberger, Maria; Friedrich, Oliver; Kappes, Barbara; Hampel, Frank; Efferth, Thomas; Tsogoeva, Svetlana B


    In our ongoing search for highly active hybrid molecules exceeding their parent compounds in anticancer, antimalaria as well as antiviral activity and being an alternative to the standard drugs, we present the synthesis and biological investigations of 2nd generation 1,2,4-trioxane-ferrocene hybrids. In vitro tests against the CCRF-CEM leukemia cell line revealed di-1,2,4-trioxane-ferrocene hybrid 7 as the most active compound (IC50 of 0.01 μM). Regarding the activity against the multidrug resistant subline CEM/ADR5000, 1,2,4-trioxane-ferrocene hybrid 5 showed a remarkable activity (IC50 of 0.53 μM). Contrary to the antimalaria activity of hybrids 4-8 against Plasmodium falciparum 3D7 strain with slightly higher IC50 values (between 7.2 and 30.2 nM) than that of their parent compound DHA, hybrids 5-7 possessed very promising activity (IC50 values lower than 0.5 μM) against human cytomegalovirus (HCMV). The application of 1,2,4-trioxane-ferrocene hybrids against HCMV is unprecedented and demonstrated here for the first time. PMID:25965779

  16. Antibody-mediated response of NKG2Cbright NK cells against human cytomegalovirus.


    Costa-Garcia, Marcel; Vera, Andrea; Moraru, Manuela; Vilches, Carlos; López-Botet, Miguel; Muntasell, Aura


    Human CMV (HCMV) infection promotes a variable and persistent expansion of functionally mature NKG2C(bright) NK cells. We analyzed NKG2C(bright) NK cell responses triggered by Abs from HCMV(+) sera against HCMV-infected MRC5 fibroblasts. Specific Abs promoted the degranulation (i.e., CD107a expression) and the production of cytokines (TNF-α and IFN-γ) by a significant fraction of NK cells, exceeding the low natural cytotoxicity against HCMV-infected targets. NK cell-mediated Ab-dependent cell-mediated cytotoxicity was limited by viral Ag availability and HLA class I expression on infected cells early postinfection and increased at late stages, overcoming viral immunoevasion strategies. Moreover, the presence of specific IgG triggered the activation of NK cells against Ab-opsonized cell-free HCMV virions. As compared with NKG2A(+) NK cells, a significant proportion of NKG2C(bright) NK cells was FcεR γ-chain defective and highly responsive to Ab-driven activation, being particularly efficient in the production of antiviral cytokines, mainly TNF-α. Remarkably, the expansion of NKG2C(bright) NK cells in HCMV(+) subjects was related to the overall magnitude of TNF-α and IFN-γ cytokine secretion upon Ab-dependent and -independent activation. We show the power and sensitivity of the anti-HCMV response resulting from the cooperation between specific Abs and the NKG2C(bright) NK-cell subset. Furthermore, we disclose the proinflammatory potential of NKG2C(bright) NK cells, a variable that could influence the individual responses to other pathogens and tumors. PMID:25667418

  17. Accessory human cytomegalovirus glycoprotein US9 in the unique short component of the viral genome promotes cell-to-cell transmission of virus in polarized epithelial cells.

    PubMed Central

    Maidji, E; Tugizov, S; Jones, T; Zheng, Z; Pereira, L


    Human cytomegalovirus (CMV) encodes accessory glycoproteins that are dispensable for virus growth in nonpolarized cells in culture. We report that CMV deletion mutants lacking the gene for accessory glycoprotein US9 in the unique short component of the viral genome are impaired in plaque formation in polarized human retinal pigment epithelial (ARPE-19) cells. Comparison of CMV deletion mutants in US9 with herpes simplex virus type 1 deletion mutants lacking glycoproteins gE and gI showed that both of these mutants are impaired in altering junctional complexes and increasing paracellular permeability in polarized ARPE-19 cells cultured on permeable filter supports. Results of functional studies indicate that CMV US9 and homologs of gE have analogous roles in promoting virus spread across lateral membranes of polarized epithelial cells. PMID:8970961

  18. Analysis of memory-like natural killer cells in human cytomegalovirus-infected children undergoing αβ+T and B cell-depleted hematopoietic stem cell transplantation for hematological malignancies.


    Muccio, Letizia; Bertaina, Alice; Falco, Michela; Pende, Daniela; Meazza, Raffaella; Lopez-Botet, Miguel; Moretta, Lorenzo; Locatelli, Franco; Moretta, Alessandro; Della Chiesa, Mariella


    We analyzed the impact of human cytomegalovirus infection on the development of natural killer cells in 27 pediatric patients affected by hematological malignancies, who had received a HLA-haploidentical hematopoietic stem cell transplantation, depleted of both α/β+ T cells and B cells. In line with previous studies in adult recipients of umbilical cord blood transplantation, we found that human cytomegalovirus reactivation accelerated the emergence of mature natural killer cells. Thus, most children displayed a progressive expansion of a memory-like natural killer cell subset expressing NKG2C, a putative receptor for human cytomegalovirus, and CD57, a marker of terminal natural killer cell differentiation. NKG2C(+)CD57(+) natural killer cells were detectable by month 3 following hematopoietic stem cell transplantation and expanded until at least month 12. These cells were characterized by high killer Ig-like receptors (KIRs) and leukocyte inhibitory receptor 1 (LIR-1) and low Siglec-7, NKG2A and Interleukin-18Rα expression, killed tumor targets and responded to cells expressing HLA-E (a NKG2C ligand). In addition, they were poor Interferon-γ producers in response to Interleukin-12 and Interleukin-18. The impaired response to these cytokines, together with their highly differentiated profile, may reflect their skewing toward an adaptive condition specialized in controlling human cytomegalovirus. In conclusion, in pediatric patients receiving a type of allograft different from umbilical cord blood transplantation, human cytomegalovirus also induced memory-like natural killer cells, possibly contributing to controlling infections and reinforcing anti-leukemia effects. PMID:26659918

  19. Analysis of memory-like natural killer cells in human cytomegalovirus-infected children undergoing αβ+T and B cell-depleted hematopoietic stem cell transplantation for hematological malignancies

    PubMed Central

    Muccio, Letizia; Bertaina, Alice; Falco, Michela; Pende, Daniela; Meazza, Raffaella; Lopez-Botet, Miguel; Moretta, Lorenzo; Locatelli, Franco; Moretta, Alessandro; Chiesa, Mariella Della


    We analyzed the impact of human cytomegalovirus infection on the development of natural killer cells in 27 pediatric patients affected by hematological malignancies, who had received a HLA-haploidentical hematopoietic stem cell transplantation, depleted of both α/β+ T cells and B cells. In line with previous studies in adult recipients of umbilical cord blood transplantation, we found that human cytomegalovirus reactivation accelerated the emergence of mature natural killer cells. Thus, most children displayed a progressive expansion of a memory-like natural killer cell subset expressing NKG2C, a putative receptor for human cytomegalovirus, and CD57, a marker of terminal natural killer cell differentiation. NKG2C+CD57+ natural killer cells were detectable by month 3 following hematopoietic stem cell transplantation and expanded until at least month 12. These cells were characterized by high killer Ig-like receptors (KIRs) and leukocyte inhibitory receptor 1 (LIR-1) and low Siglec-7, NKG2A and Interleukin-18Rα expression, killed tumor targets and responded to cells expressing HLA-E (a NKG2C ligand). In addition, they were poor Interferon-γ producers in response to Interleukin-12 and Interleukin-18. The impaired response to these cytokines, together with their highly differentiated profile, may reflect their skewing toward an adaptive condition specialized in controlling human cytomegalovirus. In conclusion, in pediatric patients receiving a type of allograft different from umbilical cord blood transplantation, human cytomegalovirus also induced memory-like natural killer cells, possibly contributing to controlling infections and reinforcing anti-leukemia effects. PMID:26659918

  20. Human Cytomegalovirus Glycoprotein gO Complexes with gH/gL, Promoting Interference with Viral Entry into Human Fibroblasts but Not Entry into Epithelial Cells▿

    PubMed Central

    Vanarsdall, Adam L.; Chase, Marie C.; Johnson, David C.


    A complex of five human cytomegalovirus virus (HCMV) proteins, gH, gL, UL128, UL130, and UL131 (gH/gL/UL128-131), is essential for virus entry into epithelial cells. We previously showed that gH/gL/UL128-131 expressed in epithelial cells interferes with subsequent HCMV entry into cells. There was no interference with only gH/gL or gB. We concluded that the expression of gH/gL/UL128-131 causes a mislocalization or downregulation of epithelial cell proteins that HCMV requires for entry. In contrast, gH/gL/UL128-131 expression in fibroblasts did not produce interference, suggesting a different mechanism for entry. Here, we show that the coexpression of another HCMV glycoprotein, gO, with gH/gL in human fibroblasts interferes with HCMV entry into fibroblasts but not epithelial cells. However, the coexpression of gO with gH/gL did not increase the cell surface expression level of gH/gL and did not enhance cell-cell fusion, a process that depends upon cell surface gH/gL. Instead, gO promoted the export of gH/gL from the endoplasmic reticulum (ER) and the accumulation of gH/gL in the trans-Golgi network. Thus, interference with gH/gL or gH/gL/gO, i.e., the mislocalization or blocking of entry mediators, occurs in cytoplasmic membranes and not in cell surface membranes of fibroblasts. Together, the results provide additional support for our hypotheses that epithelial cells express putative gH/gL/UL128-1331 receptors important for HCMV entry and that fibroblasts express distinct gH/gL receptors. PMID:21880752

  1. Rhesus and Human Cytomegalovirus Glycoprotein L Are Required for Infection and Cell-to-Cell Spread of Virus but Cannot Complement Each Other▿

    PubMed Central

    Bowman, J. Jason; Lacayo, Juan C.; Burbelo, Peter; Fischer, Elizabeth R.; Cohen, Jeffrey I.


    Rhesus cytomegalovirus (RhCMV), the homolog of human cytomegalovirus (HCMV), serves as a model for understanding the pathogenesis of HCMV and for developing candidate vaccines. In order to develop a replication-defective virus as a vaccine candidate, we constructed RhCMV with glycoprotein L (gL) deleted. RhCMV gL was essential for viral replication, and virus with gL deleted could only replicate in cells expressing RhCMV gL. Noncomplementing cells infected with RhCMV with gL deleted released intact, noninfectious RhCMV particles that were indistinguishable from wild-type RhCMV by electron microscopy and could be rescued by treatment of cells with polyethylene glycol. In addition, noncomplementing cells infected with RhCMV with gL deleted produced levels of gB, the major target of neutralizing antibodies, at levels similar to those observed in cells infected with wild-type RhCMV. Since RhCMV and HCMV gL share 53% amino acid identity, we determined whether the two proteins could complement the heterologous virus. Cells transfected with an HCMV bacterial artificial chromosome with gL deleted yielded virus that could replicate in human cells expressing HCMV gL. This is the second HCMV mutant with an essential glycoprotein deleted that has been complemented in cell culture. Finally, we found that HCMV gL could not complement the replication of RhCMV with gL deleted and that RhCMV gL could not complement the replication of HCMV with gL deleted. These data indicate that RhCMV and HCMV gL are both essential for replication of their corresponding viruses and, although the two gLs are highly homologous, they are unable to complement each another. PMID:21191007

  2. Cell-cycle-dependent localization of human cytomegalovirus UL83 phosphoprotein in the nucleolus and modulation of viral gene expression in human embryo fibroblasts in vitro.


    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Covan, Silvia; Germini, Diego; Razin, Sergey; Dettori, Giuseppe; Chezzi, Carlo


    The nucleolus is a multifunctional nuclear compartment widely known to be involved in several cellular processes, including mRNA maturation and shuttling to cytoplasmic sites, control of the cell cycle, cell proliferation, and apoptosis; thus, it is logical that many viruses, including herpesvirus, target the nucleolus in order to exploit at least one of the above-mentioned functions. Recent studies from our group demonstrated the early accumulation of the incoming ppUL83 (pp65), the major tegument protein of human cytomegalovirus (HCMV), in the nucleolus. The obtained results also suggested that a functional relationship might exist between the nucleolar localization of pp65, rRNA synthesis, and the development of the lytic program of viral gene expression. Here we present new data which support the hypothesis of a potentially relevant role of HCMV pp65 and its nucleolar localization for the control of the cell cycle by HCMV (arrest of cell proliferation in G1-G1/S), and for the promotion of viral infection. We demonstrated that, although the incoming pp65 amount in the infected cells appears to be constant irrespective of the cell-cycle phase, its nucleolar accumulation is prominent in G1 and G1/S, but very poor in S or G2/M. This correlates with the observation that only cells in G1 and G1/S support an efficient development of the HCMV lytic cycle. We propose that HCMV pp65 might be involved in regulatory/signaling pathways related to nucleolar functions, such as the cell-cycle control. Co-immunoprecipitation experiments have permitted to identify nucleolin as one of the nucleolar partners of pp65. PMID:21053310

  3. Humoral immune response against human cytomegalovirus (HCMV)-specific proteins after HCMV infection in lung transplantation as detected with recombinant and naturally occurring proteins.

    PubMed Central

    van Zanten, J; Harmsen, M C; van der Giessen, M; van der Bij, W; Prop, J; de Leij, L; The, T H


    The humoral immune response to four intracellularly located cytomegalovirus (CMV) proteins was studied in 15 lung transplant recipients experiencing active CMV infections. Five patients had primary infections, and 10 had secondary infections. Antibodies of the immunoglobulin M (IgM) and IgG classes were measured in an enzyme-linked immunosorbent assay (ELISA) system in which procaryotically expressed recombinant proteins were used as a substrate and also in a monoclonal antibody-based capture ELISA which uses naturally occurring proteins as a substrate. The proteins investigated were the lower matrix protein pp65 (ppUL83), the major DNA-binding protein p52 (ppUL44), and the two immediate early proteins IE1 and IE2 (different splicing products of UL123). Higher levels of antibodies were found to pp65 and especially to p52 than to the immediate early antigens. Antibody levels detected in the recombinant protein-based ELISAs were generally lower than antibody responses detected with the matching antigen capture ELISA. Moreover, some patients appeared to have antibodies mainly to epitopes present on naturally occurring proteins. The antibody responses detected in both assays were related to the viral load during infection as assessed by the CMV antigenemia test, which is a quantitative marker for CMV load. It was found that although epitopes on naturally occurring proteins induce higher antibody responses and responses in more patients, antibodies directed to epitopes present on the recombinant proteins were inversely related to the viral load during a CMV infection. Therefore, antibodies to epitopes on the recombinant proteins might be more clinically relevant in this group of lung transplant recipients. PMID:7535179


    EPA Science Inventory

    Mouse cytomegalovirus (MCMV) is a well developed and extremely useful and relevant host resistance model for immunotoxicity testing. at cytomegalovirus (RCMV) is currently under development and may have similar applications. ytomegaloviruses are species specific; RCMV is a distin...

  5. Data correlations between gender, cytomegalovirus infection and T cells, NK cells, and soluble immune mediators in elderly humans.


    Al-Attar, Ahmad; Presnell, Steven R; Peterson, Charlotte A; Thomas, D Travis; Lutz, Charles T


    We describe a cohort of 50 elderly subjects, age at least 70 years. We present gender-specific findings in T lymphocyte markers and soluble immune mediators. We show the correlation between cytomegalovirus infection status with CD56(dim) NK cell responses to a variety of stimuli and with CD56(bright)/CD56(dim) NK cell ratio. We also present the correlation of retinol binding protein (RBP)-4 plasma levels with NK cell responses and we explore the relationship between gender and adiponectin, 25(OH)D (vitamin D), and RBP4 in affecting CD56(dim) NK cell responses. These data are discussed in Al-Attar et al. (2016) [1]. PMID:27508213

  6. The IE2 regulatory protein of human cytomegalovirus induces expression of the human transforming growth factor beta1 gene through an Egr-1 binding site.

    PubMed Central

    Yoo, Y D; Chiou, C J; Choi, K S; Yi, Y; Michelson, S; Kim, S; Hayward, G S; Kim, S J


    Increases in transforming growth factor beta1 (TGF-beta1) mRNA and biological activity in the early phase of human cytomegalovirus (CMV) infection in fibroblasts are paralleled by increased TGF-beta1-chloramphenicol acetyltransferase (CAT) reporter gene activity. To determine how CMV infection transactivates the TGF-beta1 promoter, we examined the effects of the cotransfected IE2 regulatory protein of human CMV on 5'-deleted TGF-beta1 promoter-CAT reporter genes in transient DNA transfection assays. Two upstream TGF-beta1 promoter regions each containing an Egr-1 consensus site were shown to be important for IE2-induced transactivation in a cell type that displayed greatly reduced nonspecific activity. Furthermore, transfer of an Egr-l site from between positions -125 and -98, but not point mutant versions of this site, to a heterologous promoter also conveyed IE2 responsiveness. Addition of an IE2 expression vector or use of the U373 A45 astrocytoma cell line expressing IE2 also produced synergistic stimulation of GAL4-Egr-l-mediated activation of a target promoter containing GAL4 binding sites. The 80-kDa IE2 protein present in A45 cells proved to selectively bind to glutathione S-transferase (GST)-Egr-1 beads. The results of in vitro protein binding assays also revealed that an intact in vitro-translated IE2 protein bound directly to the GST-Egr-1 fusion protein through the zinc finger domain of the Egr-1 protein and that this binding activity was abolished by deletion of parts of the zinc finger DNA-binding domain. Similarly, the Egr-1 protein was found to associate preferentially with a small region within the C-terminal half of the IE2 protein adjacent to the DNA-binding and dimerization domains that are important for both transactivation and downregulation. We conclude from these observations that IE2 may regulate transcription of the TGF-beta1 gene as well as other potential cellular targets by virtue of its ability to interact with the Egr-1 DNA

  7. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.


    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  8. Activity of trifluorothymidine against cytomegalovirus.

    PubMed Central

    Wingard, J R; Stuart, R K; Saral, R; Burns, W H


    Trifluorothymidine (TFT) was tested for antiviral activity against mouse cytomegalovirus (MCMV) and human cytomegalovirus (HCMV) in one-step replication assays. The TFT concentration required to reduce virus yield by 50% (ID50) was 0.22 microM for MCMV and 0.012 microM for HCMV. The antiviral activity of TFT against MCMV was reversed by addition of equimolar thymidine, and no antiviral activity was demonstrable in a host cell line lacking thymidine kinase. Thus, TFT's anti-MCMV activity is dependent on a host cell TK since this herpesvirus lacks thymidine kinase. A continuous subcutaneous infusion of TFT achieving a serum concentration of 1 microM failed to protect mice from lethal MCMV infection, perhaps because serum levels of thymidine were comparable to the drug level. Comparison of the ID50 against HCMV and the ID50 against human bone marrow progenitor cells resulted in an in vitro therapeutic ratio of 108, suggesting that TFT might offer some promise as a clinically useful anti-HCMV agent. PMID:6272627

  9. The Association of Human Cytomegalovirus with Biomarkers of Inflammation and Immune Activation in HIV-1-Infected Women.


    Lurain, Nell S; Hanson, Barbara A; Hotton, Anna L; Weber, Kathleen M; Cohen, Mardge H; Landay, Alan L


    Three groups of cytomegalovirus (CMV)-seropositive women (total n = 164) were selected from the Chicago Women's Interagency HIV-1 Study to investigate the association between CMV coinfection and immune activation: (1) HIV-1 viremic, (2) HIV-1 aviremic, and (3) HIV-1 uninfected. Quantitative measures of CMV serum IgG, CMV DNA, and serum biomarkers interleukin (IL)-6, soluble CD163 (sCD163), soluble CD14 (sCD14), and interferon gamma-induced protein (IP10) were obtained. Levels of CMV IgG and the serum biomarkers were significantly higher in the HIV-1 viremic group compared to the aviremic and uninfected groups (p < 0.001). No significant associations with CMV IgG levels were found for HIV-uninfected women. When each of the HIV-infected groups was analyzed, sCD14 levels in the viremic women were significantly associated with CMV IgG levels with p < 0.02 when adjusted for age, CD4 count, and HIV viral load. There was also a modest association (p = 0.036) with IL-6 from plasma and cervical vaginal lavage specimens both unadjusted and adjusted for CD4 count and HIV viral load. The association of CMV IgG level with sCD14 implicates the monocyte as a potential site for interaction of the two viruses, which eventually may lead to non-AIDS-defining pathological conditions. PMID:26422187

  10. SOCS1 and SOCS3 are expressed in mononuclear cells in human cytomegalovirus viremia after allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Shin, Seung-Hwan; Lee, Ji Yoon; Lee, Tae Hyang; Park, So-Hye; Yahng, Seung-Ah; Yoon, Jae-Ho; Lee, Sung-Eun; Cho, Byung-Sik; Lee, Dong-Gun; Kim, Yoo-Jin; Lee, Seok; Min, Chang-Ki; Cho, Seok-Goo; Kim, Dong-Wook; Lee, Jong-Wook; Min, Woo-Sung; Park, Chong-Won


    Background The expression of the SOCS genes in cytomegalovirus (CMV) viremia after hematopoietic stem cell transplantation (HSCT) remains largely unexplored. Methods Using quantitative RT-PCR of mononuclear cells, we conducted pairwise comparison of SOCS1 and SOCS3 expression levels among a healthy donor group (N=55), a pre-HSCT group (N=17), and the recipient subgroup (N=107), which were divided according to the occurrence of CMV viremia and acute graft-versus-host disease (aGVHD). Results Compared to that in the healthy donor group, SOCS1 expression was higher in the CMV+ subgroup, especially in the CMV+GVHD- group, but decreased in the other subgroups. When compared to the expression in the pre-HSCT group, SOCS1 expression was significantly higher in the CMV+ subgroup, especially in the CMV+GVHD+ subgroup. Meanwhile, compared to that in the healthy donor group, SOCS3 expression was significantly lower in all other groups. The CMV-GVHD- subgroup showed significantly lower SOCS3 expression compared to the CMV+ subgroup, the CMV+GVHD+ subgroup, and the CMV+GVHD- subgroup. Conclusion We report differential expression of SOCS genes according to CMV viremia with acute GVHD occurrence after HSCT, suggesting that regulation of SOCS expression is associated with CMV viremia. PMID:25830129

  11. Suppressive effects of sirtinol on human cytomegalovirus (hCMV) infection and hCMV-induced activation of molecular mechanisms of senescence and production of reactive oxygen species.


    Mao, Genxiang; Li, Huifen; Ding, Xiang; Meng, Xin; Wang, Guofu; Leng, Sean X


    Substantial evidence suggests that chronic human cytomegalovirus (hCMV) infection contributes significantly to T-cell immunosenescence and adverse health outcomes in older adults. As such, it is important to search for compounds with anti-hCMV properties. Studies have shown that resveratrol, a sirtuin activator, suppresses hCMV infection. Here we report suppressive effects of sirtinol, a sirtuin antagonist, on hCMV infection and its cellular and molecular consequences. Human diploid fibroblast WI-38 cells were infected by hCMV Towne strain in the absence or presence of sirtinol. hCMV replication was measured using qPCR. Senescent phenotype was determined by senescence-associated β galactosidase (SA-β-Gal) activity. Expression of hCMV immediate early (IE) and early (E) proteins and senescence-associated proteins (pRb and Rb, p16(INK4), and p53) and production of reactive oxygen species (ROS) were assessed using standard laboratory assays. The results demonstrated that sirtinol suppressed hCMV infection as well as hCMV-induced activation of molecular mechanisms of senescence and ROS production. While underlying molecular mechanisms remain to be elucidated, these findings indicate sirtinol as a novel and potent anti-hCMV agent with the potential to be developed as an effective treatment for chronic hCMV infection and its cellular and molecular consequences that are important to ageing and health of older adults. PMID:26763147

  12. Circulating human cytomegalovirus-encoded HCMV-miR-US4-1 as an indicator for predicting the efficacy of IFNα treatment in chronic hepatitis B patients

    PubMed Central

    Pan, Yi; Wang, Nan; Zhou, Zhenxian; Liang, Hongwei; Pan, Chaoyun; Zhu, Dihan; Liu, Fenyong; Zhang, Chen-Yu; Zhang, Yujing; Zen, Ke


    The efficacy of interferon α (IFNα) therapy for chronic hepatitis B (CHB) patients is about 40% and often associates with adverse side-effects, thus identification of an easy accessible biomarker that can predict the outcome of IFNα treatment for individual CHB patients would be greatly helpful. Recent reports by us and others show that microRNAs encoded by human cytomegalovirus (HCMV) were readily detected in human serum and can interfere with lymphocyte responses required by IFNα therapeutic effect. We thus postulate that differential expression profile of serum HCMV miRNAs in CHB patients may serve as indicator to predict the efficacy of IFNα treatment for CHB patients. Blood was drawn from 56 individual CHB patients prior to IFNα treatment. By quantifying 13 HCMV miRNAs in serum samples, we found that the levels of HCMV-miR-US4-1 and HCMV-miR-UL-148D were significantly higher in IFNα-responsive group than in IFNα-non-responsive group. In a prospective study of 96 new CHB patients, serum level of HCMV-miR-US4-1 alone classified those who were and were not responsive to IFN-α treatment with correct rate of 84.00% and 71.74%, respectively. In conclusion, our results demonstrate that serum HCMV-miR-US4-1 can serve as a novel biomarker for predicting the outcome of IFNα treatment in CHB patients. PMID:26961899

  13. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.


    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  14. Hearing Loss and Cytomegalovirus.

    ERIC Educational Resources Information Center

    Strauss, Melvin


    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  15. Human Cytomegalovirus variant peptides adapt by decreasing their total coordination upon binding to a T cell receptor

    PubMed Central

    Antipas, Georgios S.E.; Germenis, Anastasios E.


    The tertiary structure of the native Cytomegalovirus peptide (NLV) presented by HLA-A2 and bound to the RA14 T cell receptor was used as a reference for the calculation of atomic coordination differences of both the NLV as well as of a number of singly substituted NLV variants in the absence of TCR. Among the pMHC complexes, the native peptide was found to exhibit the highest total coordination difference in respect to the reference structure, suggesting that it experienced the widest structural adaptation upon recognition by the TCR. In addition, the peptide on the isolated NLV-MHC complex was over-coordinated as compared to the rest of the variants. Moreover, the trend was found to account for a set of measured dissociation constants and critical concentrations for target-cell lysis for all variants in complexation with RA14: functionally, all variant peptides were established to be either weak agonists or null peptides, while, at the same time, our current study established that they were also under-coordinated in respect to NLV. It could, thus, be argued that the most ‘efficient’ structural adaptation upon pMHC recognition by the TCR requires of the peptide to undergo the widest under-coordination possible. The main structural characteristic which differentiated the NLV in respect to the variants was a the presence of 16 oxygen atoms (waters) in the former׳s second coordination shell which accounted for over-coordination of roughly 100% and 30% in the O–O and C–O partials respectively. In fact, in the absence of second shell oxygens, the NLV peptide was decidedly under-coordinated in respect to all of the variants, as also suggested by the C–C partial. PMID:26958591

  16. Human Cytomegalovirus UL40 Signal Peptide Regulates Cell Surface Expression of the Natural Killer Cell Ligands HLA-E and gpUL18

    PubMed Central

    Prod’homme, Virginie; Tomasec, Peter; Cunningham, Charles; Lemberg, Marius K.; Stanton, Richard J.; McSharry, Brian P.; Wang, Eddie C.Y.; Cuff, Simone; Martoglio, Bruno; Davison, Andrew J.; Braud, Véronique M.; Wilkinson, Gavin W. G.


    Human cytomegalovirus (HCMV)-encoded NK cell evasion functions include an MHC-I homologue (UL18) with high affinity for the leukocyte inhibitory receptor LIR-1 (CD85j, ILT2 or LILRB1) and a signal peptide (SPUL40) that acts by upregulating cell surface expression of HLA-E. Detailed characterization of SPUL40 revealed that the N-terminal 14 amino acid residues bestowed TAP-independent upregulation of HLA-E, while c-region sequences delayed processing of SPUL40 by a signal peptide peptidase-type intramembrane protease. Most significantly, the consensus HLA-E-binding epitope within SPUL40 was shown to promote cell surface expression of both HLA-E and gpUL18. UL40 was found to possess two transcription start sites, with utilization of the downstream site resulting in translational being initiated within the HLA-E-binding epitope (P2). Remarkably, this truncated SPUL40 was functional and retained the capacity to upregulate gpUL18, but not HLA-E. Our findings thus identify an elegant mechanism by which an HCMV signal peptide differentially regulates two distinct NK cell evasion pathways. Moreover, we describe a natural SPUL40 mutant that provides the first example of an HCMV clinical virus with a defect in an NK cell evasion function and exemplifies issues that confront the virus when adapting to immunogenetic diversity in the host. PMID:22345649

  17. Spatial Relationships between Markers for Secretory and Endosomal Machinery in Human Cytomegalovirus-Infected Cells versus Those in Uninfected Cells▿†

    PubMed Central

    Das, Subhendu; Pellett, Philip E.


    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  18. Rapid and combined detection of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus using AllGlo quadruplex quantitative PCR.


    Chen, Yi; He, Hui; Pan, Ping; He, Songzhe; Dong, Xueyan; Chen, Yueming; Wang, Shuying; Yu, Daojun


    Acute respiratory infections (ARIs) cause substantial morbidity and mortality worldwide. The causes of ARI are dynamic, and co-infections of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus are recently developed causes of ARI. Here, we established a quadruplex quantitative PCR (qPCR) method to rapidly identify and simultaneously detect a single infection or co-infection of these three pathogens and an internal control in a single tube using AllGlo probes. The analysis demonstrated a wide linear range of detection from 101 to 108 copies per test and a low coefficient of variation of less than 5 %. The amplification efficiencies were all close to 1, and the correlation coefficients (r2) were all greater than 0.99. We found no significant difference in a comparative reagent test (P >0.05). Moreover, the results of tests on clinical samples using AllGlo quadruplex qPCR and TaqMan uniplex qPCR were in near-perfect agreement (κ =0.97). Clinically, the availability of this method will enable better differential diagnosis, disease surveillance and controlled outcomes. PMID:27093597

  19. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.


    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  20. Results of a Quality Assurance Program for Detection of Cytomegalovirus Infection in the Pediatric Pulmonary and Cardiovascular Complications of Vertically Transmitted Human Immunodeficiency Virus Infection Study

    PubMed Central

    Demmler, Gail J.; Istas, Allison; Easley, Kirk A.; Kovacs, Andrea


    A quality assurance program was established by the Pediatric Pulmonary and Cardiovascular Complications of Vertically Transmitted Human Immunodeficiency Virus Type 1 Infection Study Group for monitoring cytomegalovirus (CMV) antibody and culture results obtained from nine different participating laboratories. Over a 3-year period, every 6 months, each laboratory was sent by the designated reference laboratory six coded samples: three urine samples for CMV detection and three serum samples for CMV immunoglobulin G (IgG) and IgM antibody determination. Overall, the participating laboratories exhibited the following composite performance statistics, relative to the reference laboratory (sensitivity and specificity, respectively): 100 and 97.4% for CMV cultures, 95.5 and 94.4% for CMV IgG antibody assays, and 92.6 and 90.2% for CMV IgM assays. The practice of having individual laboratories use different commercial methods and reagents for CMV detection and antibody determination was successfully monitored and provided useful information on the comparable performance of different assays. PMID:11060049

  1. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki


    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  2. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana


    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  3. Infection of Vascular Endothelial Cells with Human Cytomegalovirus under Fluid Shear Stress Reveals Preferential Entry and Spread of Virus in Flow Conditions Simulating Atheroprone Regions of the Artery

    PubMed Central

    DuRose, Jenny B.; Li, Julie; Chien, Shu


    Atherosclerosis is a major pathogenic factor in cardiovascular diseases, which are the leading cause of mortality in developed countries. While risk factors for atherosclerosis tend to be systemic, the distribution of atherosclerotic plaques within the vasculature is preferentially located at branch points and curves where blood flow is disturbed and shear stress is low. It is now widely accepted that hemodynamic factors can modulate endothelial gene expression and function and influence the pathophysiological changes associated with atherosclerosis. Human cytomegalovirus (HCMV), a ubiquitous pathogen, has long been proposed as a risk factor for atherosclerosis. To date, the role of HCMV in atherogenesis has been explored only in static conditions, and it is not known how HCMV infection is influenced by the physiological context of flow. In this study, we utilized a parallel-plate flow system to simulate the effects of shear stresses in different regions of the vasculature in vitro. We found that endothelial cells cultured under low shear stress, which simulates the flow condition of atheroprone regions in vivo, are more permissive to HCMV infection than cells experiencing high shear stress or static conditions. Cells exposed to low shear stress show increased entry of HCMV compared to cells exposed to high shear stress or static conditions. Viral structural gene expression, viral titers, and viral spread are also enhanced in endothelial cells exposed to low shear stress. These results suggest that hemodynamic factors modulate HCMV infection of endothelial cells, thus providing new insights into the induction/acceleration of atherosclerosis by HCMV. PMID:23055562

  4. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.


    Wu, Shu-En; Miller, William E


    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage. PMID:25965798

  5. Impaired lymphoid chemokine-mediated migration due to a block on the chemokine receptor switch in human cytomegalovirus-infected dendritic cells.


    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A; Tabi, Zsuzsanna


    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-kappaB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8(+) T cells, while CD4(+)-T-cell activation is not impaired. Although CD8(+) T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8(+)-T-cell responses and aiding early viral spread. PMID:14990723

  6. Impaired Lymphoid Chemokine-Mediated Migration due to a Block on the Chemokine Receptor Switch in Human Cytomegalovirus-Infected Dendritic Cells

    PubMed Central

    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A.; Tabi, Zsuzsanna


    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-κB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8+ T cells, while CD4+-T-cell activation is not impaired. Although CD8+ T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8+-T-cell responses and aiding early viral spread. PMID:14990723

  7. Virus-specific interaction between the human cytomegalovirus major capsid protein and the C terminus of the assembly protein precursor.

    PubMed Central

    Beaudet-Miller, M; Zhang, R; Durkin, J; Gibson, W; Kwong, A D; Hong, Z


    We previously identified a minimal 12-amino-acid domain in the C terminus of the herpes simplex virus type 1 (HSV-1) scaffolding protein which is required for interaction with the HSV-1 major capsid protein. An alpha-helical structure which maximizes the hydropathicity of the minimal domain is required for the interaction. To address whether cytomegalovirus (CMV) utilizes the same strategy for capsid assembly, several glutathione S-transferase fusion proteins to the C terminus of the CMV assembly protein precursor were produced and purified from bacterial cells. The study showed that the glutathione S-transferase fusion containing 16 amino acids near the C-terminal end was sufficient to interact with the major capsid protein. Interestingly, no cross-interaction between HSV-1 and CMV could be detected. Mutation analysis revealed that a three-amino-acid region at the N-terminal side of the central Phe residue of the CMV interaction domain played a role in determining the viral specificity of the interaction. When this region was converted so as to correspond to that of HSV-1, the CMV assembly protein domain lost its ability to interact with the CMV major capsid protein but gained full interaction with the HSV-1 major capsid protein. To address whether the minimal interaction domain of the CMV assembly protein forms an alpha-helical structure similar to that in HSV-1, peptide competition experiments were carried out. The results showed that a cyclic peptide derived from the interaction domain with a constrained (alpha-helical structure competed for interaction with the major capsid protein much more efficiently than the unconstrained linear peptide. In contrast, a cyclic peptide containing an Ala substitution for the critical Phe residue did not compete for the interaction at all. The results of this study suggest that (i) CMV may have developed a strategy similar to that of HSV-1 for capsid assembly; (ii) the minimal interaction motif in the CMV assembly protein

  8. Mapping two major resistance genes in an indica cultivar Zhe733 to the race IE-1K of Magnaporthe oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) genes in rice confer resistance to races of Magnaporthe oryzae that contain the corresponding avirulence genes. The race IE-1K of M. oryzae recovered from the southern US overcomes R gene Pi-ta. The objectives of the present study were to identify new resistance sources to IE-1k an...

  9. The effects of age and latent cytomegalovirus infection on the redeployment of CD8+ T cell subsets in response to acute exercise in humans.


    Spielmann, Guillaume; Bollard, Catherine M; Bigley, Austin B; Hanley, Patrick J; Blaney, James W; LaVoy, Emily C P; Pircher, Hanspeter; Simpson, Richard J


    Dynamic exercise evokes a rapid redeployment of cytotoxic T cell subsets with high expression of β2 adrenergic receptors, presumably to enhance immunosurveillance during acute stress. As this response is affected by age and infection history, this study examined latent CMV infection as a potential confounder to age-related differences in blood CD8+ T-cell responses to exercise. Healthy young (n=16) and older (n=16) humans counterbalanced by CMV IgG serostatus (positive or negative) exercised for 30-min at ∼80% peak cycling power. Those with CMV redeployed ∼2-times more CD8+ T-cells and ∼6-times more KLRG1+/CD28- and CD45RA+/CCR7- CD8+ subsets than non-infected exercisers. Seronegative older exercisers had an impaired redeployment of total CD8+ T-cells, CD45RA+/CCR7+ and KLRG1-/CD28+ CD8+ subsets compared to young. Redeployed CD8+ T-cell numbers were similar between infected young and old. CMVpp65 specific CD8+ cells in HLA/A2(∗) subjects increased ∼2.7-fold after exercise, a response that was driven by the KLRG1+/CD28-/CD8+ subset. Stimulating PBMCs before and after exercise with CMVpp65 and CMV IE-1 antigens and overlapping peptide pools revealed a 2.1 and 4.4-fold increases in CMVpp65 and CMV IE-1 IFN-γ secreting cells respectively. The breadth of the T cell response was maintained after exercise with the magnitude of the response being amplified across the entire epitope repertoire. To conclude, latent CMV infection overrides age-related impairments in CD8+ T-cell redeployment with exercise. We also show for the first time that many T-cells redeployed with exercise are specific to CMVpp65 and CMV IE-1 antigens, have broad epitope specificity, and are mostly of a high-differentiated effector memory phenotype. PMID:23684819

  10. Human Cytomegalovirus Entry into Dendritic Cells Occurs via a Macropinocytosis-Like Pathway in a pH-Independent and Cholesterol-Dependent Manner

    PubMed Central

    Haspot, Fabienne; Lavault, Amélie; Sinzger, Christian; Laib Sampaio, Kerstin; Stierhof, York-Dieter; Pilet, Paul; Bressolette-Bodin, Céline; Halary, Franck


    Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that is able to infect fibroblastic, epithelial, endothelial and hematopoietic cells. Over the past ten years, several groups have provided direct evidence that dendritic cells (DCs) fully support the HCMV lytic cycle. We previously demonstrated that the C-type lectin dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) has a prominent role in the docking of HCMV on monocyte-derived DCs (MDDCs). The DC-SIGN/HCMV interaction was demonstrated to be a crucial and early event that substantially enhanced infection in trans, i.e., from one CMV-bearing cell to another non-infected cell (or trans-infection), and rendered susceptible cells fully permissive to HCMV infection. Nevertheless, nothing is yet known about how HCMV enters MDDCs. In this study, we demonstrated that VHL/E HCMV virions (an endothelio/dendrotropic strain) are first internalized into MDDCs by a macropinocytosis-like process in an actin- and cholesterol-dependent, but pH-independent, manner. We observed the accumulation of virions in large uncoated vesicles with endosomal features, and the virions remained as intact particles that retained infectious potential for several hours. This trans-infection property was specific to MDDCs because monocyte-derived macrophages or monocytes from the same donor were unable to allow the accumulation of and the subsequent transmission of the virus. Together, these data allowed us to delineate the early mechanisms of the internalization and entry of an endothelio/dendrotropic HCMV strain into human MDDCs and to propose that DCs can serve as a "Trojan horse" to convey CMV from entry sites to other locations that may favor the occurrence of either latency or acute infection. PMID:22496863

  11. An acidic cluster in the cytosolic domain of human cytomegalovirus glycoprotein B is a signal for endocytosis from the plasma membrane.


    Tugizov, S; Maidji, E; Xiao, J; Pereira, L


    We previously reported that human cytomegalovirus (CMV) glycoprotein B (gB) is transported to apical membranes in CMV-infected polarized retinal pigment epithelial (ARPE-19) cells and in Madin-Darby canine kidney (MDCK) epithelial cells constitutively expressing gB. The cytosolic domain of gB contains a cluster of acidic amino acids, a motif that plays a pivotal role in vectorial trafficking in polarized epithelial cells and may also function as a signal for entry into the endocytic pathway. Here we compared gB internalization and recycling to the plasma membrane in CMV-infected human fibroblasts (HF) and ARPE-19 cells by using antibody-internalization experiments. Immunofluorescence and quantitative assays showed that gB was internalized from the cell surface into clathrin-coated transport vesicles and then recycled to the plasma membrane. gB colocalized with clathrin-coated vesicles containing the transferrin receptor in the early endocytic/recycling pathway, indicating that gB traffics in this pathway. The specific role of the acidic cluster in regulating the sorting of gB-containing vesicles in the early endocytic/recycling pathway was examined in MDCK cells expressing mutated gB derivatives. Immunofluorescence assays showed that derivatives lacking the acidic cluster were impaired in internalization and failed to recycle. These findings, together with our earlier observation that the acidic cluster is a key determinant for targeting gB molecules to apical membranes in epithelial cells, establish that this signal is recognized by cellular proteins that participate in polarized sorting and transport in the early endocytic/recycling pathway. PMID:10482621

  12. An Acidic Cluster in the Cytosolic Domain of Human Cytomegalovirus Glycoprotein B Is a Signal for Endocytosis from the Plasma Membrane

    PubMed Central

    Tugizov, Sharof; Maidji, Ekaterina; Xiao, Jianqiao; Pereira, Lenore


    We previously reported that human cytomegalovirus (CMV) glycoprotein B (gB) is transported to apical membranes in CMV-infected polarized retinal pigment epithelial (ARPE-19) cells and in Madin-Darby canine kidney (MDCK) epithelial cells constitutively expressing gB. The cytosolic domain of gB contains a cluster of acidic amino acids, a motif that plays a pivotal role in vectorial trafficking in polarized epithelial cells and may also function as a signal for entry into the endocytic pathway. Here we compared gB internalization and recycling to the plasma membrane in CMV-infected human fibroblasts (HF) and ARPE-19 cells by using antibody-internalization experiments. Immunofluorescence and quantitative assays showed that gB was internalized from the cell surface into clathrin-coated transport vesicles and then recycled to the plasma membrane. gB colocalized with clathrin-coated vesicles containing the transferrin receptor in the early endocytic/recycling pathway, indicating that gB traffics in this pathway. The specific role of the acidic cluster in regulating the sorting of gB-containing vesicles in the early endocytic/recycling pathway was examined in MDCK cells expressing mutated gB derivatives. Immunofluorescence assays showed that derivatives lacking the acidic cluster were impaired in internalization and failed to recycle. These findings, together with our earlier observation that the acidic cluster is a key determinant for targeting gB molecules to apical membranes in epithelial cells, establish that this signal is recognized by cellular proteins that participate in polarized sorting and transport in the early endocytic/recycling pathway. PMID:10482621

  13. Development and optimization of a sensitive TaqMan® real-time PCR with synthetic homologous extrinsic control for quantitation of Human cytomegalovirus viral load.


    Slavov, Svetoslav Nanev; Otaguiri, Katia Kaori; de Figueiredo, Glauciane Garcia; Yamamoto, Aparecida Yulie; Mussi-Pinhata, Marisa Marcia; Kashima, Simone; Covas, Dimas Tadeu


    Human cytomegalovirus (Human herpesvirus 5, HCMV) causes frequent asymptomatic infections in the general population. However, in immunosuppressed patients or congenitally infected infants, HCMV is related to high morbidity and mortality. In such cases, a rapid viral detection is crucial for monitoring the clinical outcome and the antiviral treatment. In this study, we optimized a sensitive biplex TaqMan® real-time PCR for the simultaneous detection and differentiation of a partial HCMV UL97 sequence and homologous extrinsic control (HEC) in the same tube. HEC was represented by a plasmid containing a modified HCMV sequence retaining the original primer binding sites, while the probe sequence was substituted by a phylogenetically divergent one (chloroplast CF0 subunit plant gene). It was estimated that the optimal HEC concentration, which did not influence the HCMV amplification is 1,000 copies/reaction. The optimized TaqMan® PCR demonstrated high analytical sensitivity (6.97 copies/reaction, CI = 95%) and specificity (100%). Moreover, the reaction showed adequate precision (repeatability, CV = 0.03; reproducibility, CV = 0.0027) and robustness (no carry-over or cross-contamination). The diagnostic sensitivity (100%) and specificity (97.8%) were adequate for the clinical application of the molecular platform. The optimized TaqMan® real-time PCR is suitable for HCMV detection and quantitation in predisposed patients and monitoring of the applied antiviral therapy. J. Med. Virol. 88:1604-1612, 2016. © 2016 Wiley Periodicals, Inc. PMID:26890091

  14. T cell responses to cytomegalovirus.


    Klenerman, Paul; Oxenius, Annette


    Human cytomegalovirus (HCMV) establishes a latent infection that generally remains asymptomatic in immune-competent hosts for decades but can cause serious illness in immune-compromised individuals. The long-term control of CMV requires considerable effort from the host immune system and has a lasting impact on the profile of the immune system. One hallmark of CMV infection is the maintenance of large populations of CMV-specific memory CD8(+) T cells - a phenomenon termed memory inflation - and emerging data suggest that memory inflation is associated with impaired immunity in the elderly. In this Review, we discuss the molecular triggers that promote memory inflation, the idea that memory inflation could be considered a natural pathway of T cell maturation that could be harnessed in vaccination, and the broader implications of CMV infection and the T cell responses it elicits. PMID:27108521

  15. Cytomegalovirus: the stealth virus.


    Robinson, Sharon


    Cytomegalovirus (CMV) is an infection, part of the herpes family of viruses which, if contracted during pregnancy, cancause devastating effects on the newborn baby. This article is written by the trustee of a volunteer-based charity, mostly run by mothers of CMV children, who are striving to raise awareness of this infection, which is more common than Down's syndrome, listeria and toxoplasmosis, and is theprimary preventable cause of childhood hearing loss. PMID:27295757

  16. Cytomegalovirus and Langerhans Cell Histiocytosis: Is There a Link?

    PubMed Central

    Khoddami, Maliheh; Nadji, Seyed-Alireza; Dehghanian, Paria; Vahdatinia, Mahsa; Shamshiri, Ahmad-Reza


    Background: Langerhans cell histiocytosis is a rare proliferative histiocytic disease of unknown etiology. Histologically, it is characterized by granuloma-like proliferation of Langerhans-type dendritic cells derived from bone marrow. Many investigators have suggested the possible role of viruses such as Epstein-Barr virus, human herpesvirus-6 (HHV-6), herpes simplex virus (HSV) types 1 and 2, and Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. Objectives: In this study, we have investigated the presence of Cytomegalovirus in Langerhans cell histiocytosis in Iranian children. Patients and Methods: In this retrospective study, we have investigated the presence of Cytomegalovirus DNA expression, using paraffin-embedded tissue samples of 30 patients with Langerhans cell histiocytosis and 30 age and site-matched controls by qualitative Polymerase Chain Reaction (PCR) method. Results: No significant difference in prevalence of Cytomegalovirus presence between patients and controls was found. Cytomegalovirus was found by qualitative PCR in only 2 (6.66%) out of 30 patients and in 1 (3.3%) of 30 control samples with a P value of 1 (1.00 > 0.05) using chi-square test with OR: 2.07; 95% CI of OR: 0.18 - 24.15. Conclusions: Our findings do not support the hypothesis of a possible role for Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. PMID:27307972

  17. [Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].


    Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li


    To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was

  18. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients

    PubMed Central

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John


    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R− group. PMID:25312585

  19. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio


    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  20. Surveillance of active human cytomegalovirus infection in hematopoietic stem cell transplantation (HLA sibling identical donor): search for optimal cutoff value by real-time PCR

    PubMed Central


    Background Human cytomegalovirus (CMV) infection still causes significant morbidity and mortality after allogeneic hematopoietic stem cell transplantation (HSCT). Therefore, it is extremely important to diagnosis and monitor active CMV infection in HSCT patients, defining the CMV DNA levels of virus replication that warrant intervention with antiviral agents in order to accurately prevent CMV disease and further related complications. Methods During the first 150 days after allogeneic HSTC, thirty patients were monitored weekly for active CMV infection by pp65 antigenemia, nested-PCR and real-time PCR assays. Receiver operating characteristic (ROC) plot analysis was performed to determine a threshold value of the CMV DNA load by real-time PCR. Results Using ROC curves, the optimal cutoff value by real-time PCR was 418.4 copies/104 PBL (sensitivity, 71.4%; specificity, 89.7%). Twenty seven (90%) of the 30 analyzed patients had active CMV infection and two (6.7%) developed CMV disease. Eleven (40.7%) of these 27 patients had acute GVHD, 18 (66.7%) had opportunistic infection, 5 (18.5%) had chronic rejection and 11 (40.7%) died - one died of CMV disease associated with GVHD and bacterial infection. Conclusions The low incidence of CMV disease in HSCT recipients in our study attests to the efficacy of CMV surveillance based on clinical routine assay. The quantification of CMV DNA load using real-time PCR appears to be applicable to the clinical practice and an optimal cutoff value for guiding timely preemptive therapy should be clinically validated in future studies. PMID:20515464

  1. Comparative study of sensitivity, linearity, and resistance to inhibition of digital and nondigital polymerase chain reaction and loop mediated isothermal amplification assays for quantification of human cytomegalovirus.


    Nixon, Gavin; Garson, Jeremy A; Grant, Paul; Nastouli, Eleni; Foy, Carole A; Huggett, Jim F


    Performing nucleic acid amplification techniques (NAATs) in digital format using limiting dilution provides potential advantages that have recently been demonstrated with digital polymerase chain reaction (dPCR). Key benefits that have been claimed are the ability to quantify nucleic acids without the need of an external calibrator and a greater resistance to inhibitors than real-time quantitative PCR (qPCR). In this study, we evaluated the performance of four NAATs, qPCR, dPCR, real-time quantitative loop mediated isothermal amplification (qLAMP), and digital LAMP (dLAMP), for the detection and quantification of human cytomegalovirus (hCMV). We used various DNA templates and inhibitors to compare the performance of these methods using a conventional real-time thermocycler platform (Bio-Rad CFX96) and a chip based digital platform (Fluidigm Biomark 12.765 Digital Array). dPCR performed well and demonstrated greater resistance to inhibitors than the other methods although this resistance did not apply equally to all inhibitors tested. dLAMP was found to be less sensitive than dPCR, but its quantitative performance was better than qLAMP, the latter being unable to quantify below 1000 copies. dLAMP was also more resistant to inhibitors than qLAMP. Unlike qPCR, both digital methods were able to quantify viral genomes without requiring a calibrator; however, neither can currently compete with the large reaction volumes, and thus the greater absolute sensitivity, of qPCR. With the introduction of digital instrumentation that will enable larger reaction volumes, digital amplification methods such as those evaluated in this study could potentially offer a robust alternative to qPCR for nucleic acid quantification. PMID:24684191

  2. The human cytomegalovirus UL11 protein interacts with the receptor tyrosine phosphatase CD45, resulting in functional paralysis of T cells.


    Gabaev, Ildar; Steinbrück, Lars; Pokoyski, Claudia; Pich, Andreas; Stanton, Richard J; Schwinzer, Reinhard; Schulz, Thomas F; Jacobs, Roland; Messerle, Martin; Kay-Fedorov, Penelope C


    Human cytomegalovirus (CMV) exerts diverse and complex effects on the immune system, not all of which have been attributed to viral genes. Acute CMV infection results in transient restrictions in T cell proliferative ability, which can impair the control of the virus and increase the risk of secondary infections in patients with weakened or immature immune systems. In a search for new immunomodulatory proteins, we investigated the UL11 protein, a member of the CMV RL11 family. This protein family is defined by the RL11 domain, which has homology to immunoglobulin domains and adenoviral immunomodulatory proteins. We show that pUL11 is expressed on the cell surface and induces intercellular interactions with leukocytes. This was demonstrated to be due to the interaction of pUL11 with the receptor tyrosine phosphatase CD45, identified by mass spectrometry analysis of pUL11-associated proteins. CD45 expression is sufficient to mediate the interaction with pUL11 and is required for pUL11 binding to T cells, indicating that pUL11 is a specific CD45 ligand. CD45 has a pivotal function regulating T cell signaling thresholds; in its absence, the Src family kinase Lck is inactive and signaling through the T cell receptor (TCR) is therefore shut off. In the presence of pUL11, several CD45-mediated functions were inhibited. The induction of tyrosine phosphorylation of multiple signaling proteins upon TCR stimulation was reduced and T cell proliferation was impaired. We therefore conclude that pUL11 has immunosuppressive properties, and that disruption of T cell function via inhibition of CD45 is a previously unknown immunomodulatory strategy of CMV. PMID:22174689

  3. Analysis and mapping of a family of 3'-coterminal transcripts containing coding sequences for human cytomegalovirus open reading frames UL93 through UL99.

    PubMed Central

    Wing, B A; Huang, E S


    Human cytomegalovirus (HCMV) open reading frames (ORFs) UL93 through UL99 are contained within a region of viral genome that is well conserved in all herpesviruses. Previous reports detailing the expression of ORF UL99 (also referred to as the 28-kDa virion phosphoprotein or pp28) indicated that the pattern of transcription proximal to pp28 is extremely complex and involves a number of large overlapping transcripts, none of which have been characterized. We have used an RNA-mapping approach consisting of Northern (RNA) hybridization, RNase protection, and primer extensions to determine the coding capacity of several large-molecular-weight transcripts which overlap the 1.3- and 1.6-kb UL99-specific transcripts. Our results suggest that six differentially regulated transcripts with sizes of 2.6, 4.7, 5.6, 7.3, 9.1, and 10.5 kb, and derived from the same strand of the viral genome overlap, are 3'-coterminal with the smaller UL99-specific transcripts. On the basis of 5'-end mapping via primer extension and RNase protection, we have determined that the 2.6- to 10.5-kb messages initiate upstream of each of the potential ORFs in this region, UL98, UL97, UL96, UL95, UL94, and UL93. By using cycloheximide and ganciclovir [9-(1,3-dihydroxy-2-propoxymethyl)guanine] to block de novo viral protein synthesis and viral DNA replication, respectively, we have determined that the 2.6-, 4.7-, 5.6-, and 7.3-kb messages have characteristics of early or early-late transcripts, whereas the 9.1- and 10.5-kb messages appear to be true late transcripts. The evolutionary conservation of ORFs UL93 through UL99 and their transcriptional regulation in other herpesviruses are discussed. PMID:7853485

  4. A mutation deleting sequences encoding the amino terminus of human cytomegalovirus UL84 impairs interaction with UL44 and capsid localization.


    Strang, Blair L; Bender, Brian J; Sharma, Mayuri; Pesola, Jean M; Sanders, Rebecca L; Spector, Deborah H; Coen, Donald M


    Protein-protein interactions are required for many biological functions. Previous work has demonstrated an interaction between the human cytomegalovirus DNA polymerase subunit UL44 and the viral replication factor UL84. In this study, glutathione S-transferase pulldown assays indicated that residues 1 to 68 of UL84 are both necessary and sufficient for efficient interaction of UL84 with UL44 in vitro. We created a mutant virus in which sequences encoding these residues were deleted. This mutant displayed decreased virus replication compared to wild-type virus. Immunoprecipitation assays showed that the mutation decreased but did not abrogate association of UL84 with UL44 in infected cell lysate, suggesting that the association in the infected cell can involve other protein-protein interactions. Further immunoprecipitation assays indicated that IRS1, TRS1, and nucleolin are candidates for such interactions in infected cells. Quantitative real-time PCR analysis of viral DNA indicated that the absence of the UL84 amino terminus does not notably affect viral DNA synthesis. Western blotting experiments and pulse labeling of infected cells with [(35)S]methionine demonstrated a rather modest downregulation of levels of multiple proteins and particularly decreased levels of the minor capsid protein UL85. Electron microscopy demonstrated that viral capsids assemble but are mislocalized in nuclei of cells infected with the mutant virus, with fewer cytoplasmic capsids detected. In sum, deletion of the sequences encoding the amino terminus of UL84 affects interaction with UL44 and virus replication unexpectedly, not viral DNA synthesis. Mislocalization of viral capsids in infected cell nuclei likely contributes to the observed decrease in virus replication. PMID:22855486

  5. Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope

    PubMed Central

    Lamm, Christian E.; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe


    In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell’s nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein. PMID:26978388

  6. Human Cytomegalovirus (HCMV)-Specific CD4+ and CD8+ T Cells Are Both Required for Prevention of HCMV Disease in Seropositive Solid-Organ Transplant Recipients

    PubMed Central

    Gabanti, Elisa; Bruno, Francesca; Lilleri, Daniele; Fornara, Chiara; Zelini, Paola; Cane, Ilaria; Migotto, Clara; Sarchi, Eleonora; Furione, Milena; Gerna, Giuseppe


    In solid-organ transplant recipients (SOTR) the protective role of human cytomegalovirus (HCMV)-specific CD4+, CD8+ and γδ T-cells vs. HCMV reactivation requires better definition. The aim of this study was to investigate the relevant role of HCMV-specific CD4+, CD8+ and γδ T-cells in different clinical presentations during the post-transplant period. Thirty-nine SOTR underwent virologic and immunologic follow-up for about 1 year after transplantation. Viral load was determined by real-time PCR, while immunologic monitoring was performed by measuring HCMV-specific CD4+ and CD8+ T cells (following stimulation with autologous HCMV-infected dendritic cells) and γδ T-cells by flow cytometry. Seven patients had no infection and 14 had a controlled infection, while both groups maintained CD4+ T-cell numbers above the established cut-off (0.4 cell/µL blood). Of the remaining patients, 9 controlled the infection temporarily in the presence of HCMV-specific CD8+ only, until CD4+ T-cell appearance; while 9 had to be treated preemptively due to a viral load greater than the established cut-off (3×105 DNA copies/mL blood) in the absence of specific CD4+ T-cells. Polyfunctional CD8+ T-cells as well as Vδ2− γδ T-cells were not associated with control of infection. In conclusion, in the absence of HCMV-specific CD4+ T-cells, no long-term protection is conferred to SOTR by either HCMV-specific CD8+ T-cells alone or Vδ2− γδ T-cell expansion. PMID:25166270

  7. Monitoring of Human Cytomegalovirus and Virus-Specific T-Cell Response in Young Patients Receiving Allogeneic Hematopoietic Stem Cell Transplantation

    PubMed Central

    Lilleri, Daniele; Gerna, Giuseppe; Zelini, Paola; Chiesa, Antonella; Rognoni, Vanina; Mastronuzzi, Angela; Giorgiani, Giovanna; Zecca, Marco; Locatelli, Franco


    In allogeneic hematopoietic stem-cell transplantation (HSCT) recipients, outcome of human cytomegalovirus (HCMV) infection results from balance between viral load/replication and pathogen-specific T-cell response. Using a cut-off of 30,000 HCMV DNA copies/ml blood for pre-emptive therapy and cut-offs of 1 and 3 virus-specific CD4+ and CD8+ T cells/µl blood for T-cell protection, we conducted in 131 young patients a prospective 3-year study aimed at verifying whether achievement of such immunological cut-offs protects from HCMV disease. In the first three months after transplantation, 55/89 (62%) HCMV-seropositive patients had infection and 36/55 (65%) were treated pre-emptively, whereas only 7/42 (17%) HCMV-seronegative patients developed infection and 3/7 (43%) were treated. After 12 months, 76 HCMV-seropositive and 9 HCMV-seronegative patients (cumulative incidence: 90% and 21%, respectively) displayed protective HCMV-specific immunity. Eighty of these 85 (95%) patients showed spontaneous control of HCMV infection without additional treatment. Five patients after reaching protective T-cell levels needed pre-emptive therapy, because they developed graft-versus-host disease (GvHD). HSCT recipients reconstituting protective levels of HCMV-specific T-cells in the absence of GvHD are no longer at risk for HCMV disease, at least within 3 years after transplantation. The decision to treat HCMV infection in young HSCT recipients may be taken by combining virological and immunological findings. PMID:22848556

  8. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing


    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  9. Human cytomegalovirus-specific T-cell immune reconstitution in preemptively treated heart transplant recipients identifies subjects at critical risk for infection.


    Abate, Davide; Fiscon, Marta; Saldan, Alda; Cofano, Simona; Mengoli, Carlo; Sgarabotto, Dino; d'Agostino, Chiara; Barzon, Luisa; Cusinato, Riccardo; Toscano, Giuseppe; Feltrin, Giuseppe; Gambino, Antonio; Gerosa, Gino; Palù, Giorgio


    Human cytomegalovirus (CMV) infection represents a major threat for heart transplant recipients (HTXs). CMV-specific T cells effectively control virus infection, and thus, assessment of antiviral immune recovery may have clinical utility in identifying HTXs at risk of infection. In this study, 10 CMV-seropositive (R(+)) pretransplant patients and 48 preemptively treated R(+) HTXs were examined before and after 100 days posttransplant. Preemptive treatment is supposed to favor the immune recovery. CMV DNAemia and gamma interferon enzyme-linked immunosorbent spot (ELISPOT) assay were employed to assess the viremia and immune reconstitution. HTXs could be categorized into three groups characterized by high (>100), medium (50 to 100), and low (<50) spot levels. Early-identified high responders efficiently controlled the infection and also maintained high immunity levels after 100 days after transplant. No episodes of grade ≥2R rejection occurred in the high responders. Midresponders were identified as a group with heterogeneous trends of immune reconstitution. Low responders were 41% and 21% of HTXs before and after 100 days posttransplant, respectively. Low responders were associated with a higher incidence of infection. The effect of viremia on immune recovery was investigated: a statistically significant inverse correlation between magnitude of viremia and immune recovery emerged; in particular, each 10-fold increase in viremia (>4 log(10) DNAemia/ml) was associated with a 36% decrease of the ELISPOT assay spot levels. All episodes of high viremia (>4 log(10) DNAemia/ml) occurred from 1 to 60 days after transplant. Thus, the concomitant evaluation of viremia and CMV immune reconstitution has clinical utility in identifying HTXs at risk of infection and may represent a helpful guide in making therapeutic choices. PMID:22461674

  10. Effects of human cytomegalovirus major immediate-early proteins in controlling the cell cycle and inhibiting apoptosis: studies with ts13 cells.


    Lukac, D M; Alwine, J C


    The major immediate-early (MIE) gene of human cytomegalovirus (HCMV) encodes several MIE proteins (MIEPs) produced as a result of alternative splicing and polyadenylation of the primary transcript. Previously we demonstrated that the HCMV MIEPs expressed from the entire MIE gene could rescue the temperature-sensitive (ts) transcriptional defect in the ts13 cell line. This defect is caused by a ts mutation in TAFII250, the 250-kDa TATA binding protein-associated factor (TAF). These and other data suggested that the MIEPs perform a TAF-like function in complex with the basal transcription factor TFIID. In addition to the transcriptional defect, the ts mutation in ts13 cells results in a defect in cell cycle progression which ultimately leads to apoptosis. Since all of these defects can be rescued by wild-type TAFII250, we asked whether the MIEPs could rescue the cell cycle defect and/or affect the progression to apoptosis. We have found that the MIEPs, expressed from the entire MIE gene, do not rescue the cell cycle block in ts13 cells grown at the nonpermissive temperature. However, despite the maintenance of the cell cycle block, the ts13 cells which express the MIEPs are resistant to apoptosis. MIEP mutants, which have previously been shown to be defective in rescuing the ts transcriptional defect, maintained the ability to inhibit apoptosis. Hence, the MIEP functions which affect transcription appear to be separable from the functions which inhibit apoptosis. We discuss these data in the light of the HCMV life cycle and the possibility that the MIEPs promote cellular transformation by a "hit-and-run" mechanism. PMID:10074130

  11. Cis and Trans Acting Factors Involved in Human Cytomegalovirus Experimental and Natural Latent Infection of CD14 (+) Monocytes and CD34 (+) Cells

    PubMed Central

    Pari, Gregory S.


    The parameters involved in human cytomegalovirus (HCMV) latent infection in CD14 (+) and CD34 (+) cells remain poorly identified. Using next generation sequencing we deduced the transcriptome of HCMV latently infected CD14 (+) and CD34 (+) cells in experimental as well as natural latency settings. The gene expression profile from natural infection in HCMV seropositive donors closely matched experimental latency models, and included two long non-coding RNAs (lncRNAs), RNA4.9 and RNA2.7 as well as the mRNAs encoding replication factors UL84 and UL44. Chromatin immunoprecipitation assays on experimentally infected CD14 (+) monocytes followed by next generation sequencing (ChIP-Seq) were employed to demonstrate both UL84 and UL44 proteins interacted with the latent viral genome and overlapped at 5 of the 8 loci identified. RNA4.9 interacts with components of the polycomb repression complex (PRC) as well as with the MIE promoter region where the enrichment of the repressive H3K27me3 mark suggests that this lncRNA represses transcription. Formaldehyde Assisted Isolation of Regulatory Elements (FAIRE), which identifies nucleosome-depleted viral DNA, was used to confirm that latent mRNAs were associated with actively transcribed, FAIRE analysis also showed that the terminal repeat (TR) region of the latent viral genome is depleted of nucleosomes suggesting that this region may contain an element mediating viral genome maintenance. ChIP assays show that the viral TR region interacts with factors associated with the pre replication complex and a plasmid subclone containing the HCMV TR element persisted in latently infected CD14 (+) monocytes, strongly suggesting that the TR region mediates viral chromosome maintenance. PMID:23717203

  12. Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope.


    Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe


    In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein. PMID:26978388

  13. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.


    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix


    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  14. Human cytomegalovirus Fcγ binding proteins gp34 and gp68 antagonize Fcγ receptors I, II and III.


    Corrales-Aguilar, Eugenia; Trilling, Mirko; Hunold, Katja; Fiedler, Manuela; Le, Vu Thuy Khanh; Reinhard, Henrike; Ehrhardt, Katrin; Mercé-Maldonado, Eva; Aliyev, Enver; Zimmermann, Albert; Johnson, David C; Hengel, Hartmut


    Human cytomegalovirus (HCMV) establishes lifelong infection with recurrent episodes of virus production and shedding despite the presence of adaptive immunological memory responses including HCMV immune immunoglobulin G (IgG). Very little is known how HCMV evades from humoral and cellular IgG-dependent immune responses, the latter being executed by cells expressing surface receptors for the Fc domain of IgG (FcγRs). Remarkably, HCMV expresses the RL11-encoded gp34 and UL119-118-encoded gp68 type I transmembrane glycoproteins which bind Fcγ with nanomolar affinity. Using a newly developed FcγR activation assay, we tested if the HCMV-encoded Fcγ binding proteins (HCMV FcγRs) interfere with individual host FcγRs. In absence of gp34 or/and gp68, HCMV elicited a much stronger activation of FcγRIIIA/CD16, FcγRIIA/CD32A and FcγRI/CD64 by polyclonal HCMV-immune IgG as compared to wildtype HCMV. gp34 and gp68 co-expression culminates in the late phase of HCMV replication coinciding with the emergence of surface HCMV antigens triggering FcγRIII/CD16 responses by polyclonal HCMV-immune IgG. The gp34- and gp68-dependent inhibition of HCMV immune IgG was fully reproduced when testing the activation of primary human NK cells. Their broad antagonistic function towards FcγRIIIA, FcγRIIA and FcγRI activation was also recapitulated in a gain-of-function approach based on humanized monoclonal antibodies (trastuzumab, rituximab) and isotypes of different IgG subclasses. Surface immune-precipitation showed that both HCMV-encoded Fcγ binding proteins have the capacity to bind trastuzumab antibody-HER2 antigen complexes demonstrating simultaneous linkage of immune IgG with antigen and the HCMV inhibitors on the plasma membrane. Our studies reveal a novel strategy by which viral FcγRs can compete for immune complexes against various Fc receptors on immune cells, dampening their activation and antiviral immunity. PMID:24830376

  15. Guinea pig cytomegalovirus GP84 is a functional homolog of the human cytomegalovirus (HCMV) UL84 gene that can complement for the loss of UL84 in a chimeric HCMV.


    McGregor, A; Choi, K Y; Schleiss, M R


    The guinea pig cytomegalovirus (GPCMV) co-linear gene and potential functional homolog of HCMV UL84 (GP84) was investigated. The GP84 gene had delayed early transcription kinetics and transient expression studies of GP84 protein (pGP84) demonstrated that it targeted the nucleus and co-localized with the viral DNA polymerase accessory protein as described for HCMV pUL84. Additionally, pGP84 exhibited a transdominant inhibitory effect on viral growth as described for HCMV. The inhibitory domain could be localized to a minimal peptide sequence of 99 aa. Knockout of GP84 generated virus with greatly impaired growth kinetics. Lastly, the GP84 ORF was capable of complementing for the loss of the UL84 coding sequence in a chimeric HCMV. Based on this research and previous studies we conclude that GPCMV is similar to HCMV by encoding single copy co-linear functional homologs of HCMV UL82 (pp71), UL83 (pp65) and UL84 genes. PMID:21094510

  16. Two distinct upstream regulatory domains containing multicopy cellular transcription factor binding sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus.


    Chan, Y J; Tseng, W P; Hayward, G S


    The US3 gene of human cytomegalovirus (HCMV) is expressed at immediate-early (IE) times in permissive HF cells, but not in nonpermissive rodent cells, and encodes several proteins that have been reported to have regulatory characteristics, although they are dispensable for growth in cell culture. Both spliced and unspliced forms of US3 IE transcripts are associated with the second of only two known large and complex upstream enhancer domains within the 229-kb HCMV genome, which we refer to as the IES cis-acting control region. Only the 260-bp proximal segment (from -313 to -55) of the 600-bp IES control domain, which contains multicopy NF-kappaB binding sites, proved to be necessary to transfer both high basal expression plus phorbol ester- and okadaic acid-inducible characteristics to heterologous promoters in transient assays in U-937 and K-562 cells. However, the IES control region contains a distinctive 280-bp distal domain, characterized by the presence of seven interspersed repeats of a 10-bp TGTCGCGACA palindromic consensus motif that encompasses a NruI site. This far upstream Nru repeat region (from -596 to -314) imparted up to 20-fold down-regulation effects onto strong basal heterologous promoters as well as onto the IES enhancer plus minimal promoter region in both U-937 and K-562 cells. Functional Nru repressor elements (NREs) could not be generated by multimerizing either the palindromic (P) Nru motifs alone or adjacent degenerate interrupted (I Nru motifs alone. However, multimerized forms of the combined P plus I elements reconstituted the full 20-fold cis-acting down-regulation phenotype of the intact NRE domain. The P and I forms of the Nru elements each bound independently and specifically to related cellular DNA-binding factors to form differently migrating A or B complexes, respectively, whereas the combined P plus I elements bound cooperatively to both the A and B complexes with high affinity. Interestingly, nuclear extracts from U-937, K-562

  17. Infection of a Single Cell Line with Distinct Strains of Human Cytomegalovirus Can Result in Large Variations in Virion Production and Facilitate Efficient Screening of Virus Protein Function

    PubMed Central

    Zavala, Anamaria G.; O'Dowd, John M.


    ABSTRACT Previously, we reported that the absence of the ataxia telangiectasia mutated (ATM) kinase, a critical DNA damage response (DDR) signaling component for double-strand breaks, caused no change in HCMV Towne virion production. Later, others reported decreased AD169 viral titers in the absence of ATM. To address this discrepancy, human foreskin fibroblasts (HFF) and three ATM− lines (GM02530, GM05823, and GM03395) were infected with both Towne and AD169. Two additional ATM− lines (GM02052 and GM03487) were infected with Towne. Remarkably, both previous studies' results were confirmed. However, the increased number of cell lines and infections with both lab-adapted strains confirmed that ATM was not necessary to produce wild-type-level titers in fibroblasts. Instead, interactions between individual virus strains and the cellular microenvironment of the individual ATM− line determined efficiency of virion production. Surprisingly, these two commonly used lab-adapted strains produced drastically different titers in one ATM− cell line, GM05823. The differences in titer suggested a rapid method for identifying genes involved in differential virion production. In silico comparison of the Towne and AD169 genomes determined a list of 28 probable candidates responsible for the difference. Using serial iterations of an experiment involving virion entry and input genome nuclear trafficking with a panel of related strains, we reduced this list to four (UL129, UL145, UL147, and UL148). As a proof of principle, reintroduction of UL148 largely rescued genome trafficking. Therefore, use of a battery of related strains offers an efficient method to narrow lists of candidate genes affecting various virus life cycle checkpoints. IMPORTANCE Human cytomegalovirus (HCMV) infection of multiple cell lines lacking ataxia telangiectasia mutated (ATM) protein produced wild-type levels of infectious virus. Interactions between virus strains and the microenvironment of individual

  18. Acute appendicitis due to Cytomegalovirus in an apparently immunocompetent patient: a case report

    PubMed Central


    Introduction In healthy subjects, Cytomegalovirus infection can be asymptomatic or manifest as mononucleosis syndrome, but organ disease has also been reported. However, in immunocompromised patients this infection can lead to its most significant and severe disease and even mortality. When Cytomegalovirus causes a gastrointestinal tract infection, it more commonly manifests with luminal tract disease and is usually characterized by ulcerative lesions. Appendicitis is a rare manifestation, and has been reported mainly in human immunodeficiency virus-infected patients or patients with other causes of immunocompromise. Case presentation The authors report on a case of acute primary Cytomegalovirus infection complicated with acute appendicitis due to Cytomegalovirus in an apparently immunocompetent 24-year-old Caucasian man also suffering from primary sclerosing cholangitis and ulcerative colitis. Diagnosis was based on clinical manifestations, serology results, as well as microbiological and histological findings. Treatment consisted of surgery and anti-Cytomegalovirus therapy. Conclusions Cytomegalovirus should be included among the etiologic agents of acute appendicitis in patients with primary sclerosing cholangitis and ulcerative colitis. Currently, there are no definitive data regarding the frequency of Cytomegalovirus appendicitis and the role of anti-Cytomegalovirus treatment in human immunodeficiency virus-negative and apparently immunocompetent subjects. PMID:24612821

  19. Contribution of the Major ND10 Proteins PML, hDaxx and Sp100 to the Regulation of Human Cytomegalovirus Latency and Lytic Replication in the Monocytic Cell Line THP-1

    PubMed Central

    Wagenknecht, Nadine; Reuter, Nina; Scherer, Myriam; Reichel, Anna; Müller, Regina; Stamminger, Thomas


    Promyelocytic leukemia nuclear bodies, also termed nuclear domain 10 (ND10), have emerged as nuclear protein accumulations mediating an intrinsic cellular defense against viral infections via chromatin-based mechanisms, however, their contribution to the control of herpesviral latency is still controversial. In this study, we utilized the monocytic cell line THP-1 as an in vitro latency model for human cytomegalovirus infection (HCMV). Characterization of THP-1 cells by immunofluorescence and Western blot analysis confirmed the expression of all major ND10 components. THP-1 cells with a stable, individual knockdown of PML, hDaxx or Sp100 were generated. Importantly, depletion of the major ND10 proteins did not prevent the terminal cellular differentiation of THP-1 monocytes. After construction of a recombinant, endotheliotropic human cytomegalovirus expressing IE2-EYFP, we investigated whether the depletion of ND10 proteins affects the onset of viral IE gene expression. While after infection of differentiated, THP-1-derived macrophages as well as during differentiation-induced reactivation from latency an increase in the number of IE-expressing cells was readily detectable in the absence of the major ND10 proteins, no effect was observed in non-differentiated monocytes. We conclude that PML, hDaxx and Sp100 primarily act as cellular restriction factors during lytic HCMV replication and during the dynamic process of reactivation but do not serve as key determinants for the establishment of HCMV latency. PMID:26057166

  20. Comparison of human coagulation factor VIII expression directed by cytomegalovirus and mammary gland-specific promoters in HC11 cells and transgenic mice

    PubMed Central

    Wang, Qing; Hao, Siguo; Ma, Liyuan; Zhang, Wenhao; Wan, Jiangbo; Deng, Xiaohui


    Hemophilia A is an inherited X-linked recessive bleeding disorder caused by coagulant factor VIII (FVIII) deficiency. The conventional treatment involves the administration of recombinant human FVIII (rhFVIII) preparations. In this study, the mammary gland ‘bioreactor’ is designed to specifically and efficiently express a foreign protein hFVIII in the mammary glands of transgenic mice. We constructed a P1A3-hFVIIIBD vector directed by the mammary gland-specific P1A3 promoter, and transiently transfected HC11 cells and mouse mammary glands with P1A3-hFVIIIBD or CMV-hFVIIIBD vectors directed by a ubiquitous cytomegalovirus (CMV) promoter, respectively. We also generated P1A3-hFVIIIBD and CMV-hFVIIIBD transgenic mice by microinjection, respectively. Our data indicated that both vectors effectively expressed hFVIIIBD in HC11 cells at the transcription level, and hFVIIIBD protein was efficiently expressed in mouse milk after the injection of the hFVIIIBD vectors into mouse mammary glands during lactation. In both CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice, hFVIIIBD proteins were efficiently expressed in the mammary glands at the mRNA and protein levels. No significant difference was observed in hFVIIIBD levels between the CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice (P > 0.05). However, the activity of hFVIII in CMV-directed transgenic mice was slightly higher than that in P1A3-directed transgenic mice (P < 0.05). While hFVIIIBD was present in multiple organs in CMV-hFVIIIBD mice, P1A3-hFVIIIBD mice showed negligible hFVIIIBD expression in organs other than the mammary glands. This study demonstrated that the mammary gland-specific P1A3-hFVIIIBD vector was more suitable for the generation of hFVIIIBD mammary gland bioreactor. PMID:26192111

  1. The Tegument Protein pp65 of Human Cytomegalovirus Acts as an Optional Scaffold Protein That Optimizes Protein Uploading into Viral Particles

    PubMed Central

    Reyda, Sabine; Tenzer, Stefan; Navarro, Pedro; Gebauer, Wolfgang; Saur, Michael; Krauter, Steffi; Büscher, Nicole


    ABSTRACT The mechanisms that lead to the tegumentation of herpesviral particles are only poorly defined. The phosphoprotein 65 (pp65) is the most abundant constituent of the virion tegument of human cytomegalovirus (HCMV). It is, however, nonessential for virion formation. This seeming discrepancy has not met with a satisfactory explanation regarding the role of pp65 in HCMV particle morphogenesis. Here, we addressed the question of how the overall tegument composition of the HCMV virion depended on pp65 and how the lack of pp65 influenced the packaging of particular tegument proteins. To investigate this, we analyzed the proteomes of pp65-positive (pp65pos) and pp65-negative (pp65neg) virions by label-free quantitative mass spectrometry and determined the relative abundances of tegument proteins. Surprisingly, only pUL35 was elevated in pp65neg virions. As the abundance of pUL35 in the HCMV tegument is low, it is unlikely that it replaced pp65 as a structural component in pp65neg virions. A subset of proteins, including the third most abundant tegument protein, pUL25, as well as pUL43, pUL45, and pUL71, were reduced in pp65neg or pp65low virions, indicating that the packaging of these proteins was related to pp65. The levels of tegument components, like pp28 and the capsid-associated tegument proteins pp150, pUL48, and pUL47, were unaffected by the lack of pp65. Our analyses demonstrate that deletion of pp65 is not compensated for by other viral proteins in the process of virion tegumentation. The results are concordant with a model of pp65 serving as an optional scaffold protein that facilitates protein upload into the outer tegument of HCMV particles. IMPORTANCE The assembly of the tegument of herpesviruses is only poorly understood. Particular proteins, like HCMV pp65, are abundant tegument constituents. pp65 is thus considered to play a major role in tegument assembly in the process of virion morphogenesis. We show here that deletion of the pp65 gene leads to

  2. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.


    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  3. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.


    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L


    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  4. Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells.

    PubMed Central

    Chapman, B S; Thayer, R M; Vincent, K A; Haigwood, N L


    A 2.4 kb fragment of hCMV (Towne strain), containing the 5' end of the major immediate-early gene, has been cloned, sequenced, and used to construct a series of mammalian cell expression plasmids. The effects of regulatory regions present on this fragment were assessed using human glycoproteins as reporter molecules. We compared secreted levels of Factor VIII, t-PA, and HIV-1 envelope glycoproteins in cells transfected with plasmids in which intron A of the immediate-early gene was present or absent. Secretion of several glycoproteins was significantly higher when cells were transfected with intron A-containing plasmids. Mutation of three basepairs in the strong nuclear factor 1 (NF1) binding site in intron A led to reduced transient expression levels, but not to the level observed in the absence of intron A. Reduced expression from NF1 mutant plasmids was roughly correlated with reduced binding in vitro of NF1 proteins to a synthetic oligonucleotide containing the mutation. The evidence indicates that sequences in intron A positively regulate expression from the hCMV immediate-early enhancer/promoter in transformed monkey kidney cells. Images PMID:1650459

  5. Cytomegalovirus-infected human endothelial cells can stimulate allogeneic CD4+ memory T cells by releasing antigenic exosomes1

    PubMed Central

    Walker, Jason D.; Maier, Cheryl L.; Pober, Jordan S.


    Human CMV infection is controlled by T cell-mediated immunity and in immunosuppressed transplant patients it is associated with acute allograft rejection as well as chronic allograft vasculopathy. CMV infects endothelial cells (EC) and it is thought that CMV-specific host immune responses to infected allograft EC contribute to rejection. In vitro, CD4+ T cells from CMV-positive donors (but not CMV-negative donors) are readily activated by CMV-infected allogeneic EC, although it is unclear how allogeneic CMV-infected EC activate self-class II MHC-restricted memory CD4+ T cells. In this study we confirm that purified CD4+ T cells from CMV+ donors are activated by allogeneic CMV-infected EC, but find that the response is dependent upon co-purified APC expressing class II MHC that are autologous to the T cells. The transfer of CMV antigens from infected EC to APC can be mediated by EC-derived exosome-like particles. These results provide a mechanism by which CMV can exacerbate allograft rejection, and suggest a novel function of EC-derived exosomes that could contribute in a more general manner to immune surveillance. PMID:19155503

  6. Cytomegalovirus as nosocomial infection.


    Román González, J; Colón, M; Ramírez-Ronda, C H


    Nosocomial infections with cytomegalovirus are an area of great concern and controversy within the medical community. With the advent of organ transplantation there have been an increased number of susceptible individuals. In the past most cases were confined to newborn nurseries and the neonatal intensive care unit. It is of great interest that recent evidence suggests that health care providers are at no greater risk of acquiring CMV infection inside the hospital setting when compared to a representative control group within the same community. This paper will review some of the literature that deals with the nosocomial transmission of CMV. We will try to emphasize transmission, diagnosis, prevention, and treatment of CMV infection. PMID:1667848

  7. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  8. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  9. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  10. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  11. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  12. Involvement of the N-Terminal Deubiquitinating Protease Domain of Human Cytomegalovirus UL48 Tegument Protein in Autoubiquitination, Virion Stability, and Virus Entry

    PubMed Central

    Kim, Young-Eui; Oh, Se Eun; Kwon, Ki Mun; Lee, Chan Hee


    ABSTRACT Human cytomegalovirus (HCMV) protein pUL48 is closely associated with the capsid and has a deubiquitinating protease (DUB) activity in its N-terminal region. Although this DUB activity moderately increases virus replication in cultured fibroblast cells, the requirements of the N-terminal region of pUL48 in the viral replication cycle are not fully understood. In this study, we characterized the recombinant viruses encoding UL48(ΔDUB/NLS), which lacks the DUB domain and the adjacent nuclear localization signal (NLS), UL48(ΔDUB), which lacks only the DUB, and UL48(Δ360–1200), which lacks the internal region (amino acids 360 to 1200) downstream of the DUB/NLS. While ΔDUB/NLS and Δ360–1200 mutant viruses did not grow in fibroblasts, the ΔDUB virus replicated to titers 100-fold lower than those for wild-type virus and showed substantially reduced viral gene expression at low multiplicities of infection. The DUB domain contained ubiquitination sites, and DUB activity reduced its own proteasomal degradation in trans. Deletion of the DUB domain did not affect the nuclear and cytoplasmic localization of pUL48, whereas the internal region (360–1200) was necessary for cytoplasmic distribution. In coimmunoprecipitation assays, pUL48 interacted with three tegument proteins (pUL47, pUL45, and pUL88) and two capsid proteins (pUL77 and pUL85) but the DUB domain contributed to only pUL85 binding. Furthermore, we found that the ΔDUB virus showed reduced virion stability and less efficiently delivered its genome into the cell than the wild-type virus. Collectively, our results demonstrate that the N-terminal DUB domain of pUL48 contributes to efficient viral growth by regulating its own stability and promoting virion stabilization and virus entry. IMPORTANCE HCMV pUL48 and its herpesvirus homologs play key roles in virus entry, regulation of immune signaling pathways, and virion assembly. The N terminus of pUL48 contains the DUB domain, which is well conserved

  13. Immunosuppressive effect of murine cytomegalovirus.

    PubMed Central

    Loh, L; Hudson, J B


    Murine cytomegalovirus suppressed the ability of spleen cells to respond to mitogens in vitro. The degree of suppression was proportional to the multiplicity of infection. This effect could not be explained by cytolysis of lymphocytes, an alteration in the kinetics of the response to mitogen, or a direct competition between virions and mitogen molecules for cell-surface receptors. Nor was it due to simple contact between cell and virus, since ultraviolet-inactivated murine cytomegalovirus failed to suppress the response to mitogens. Reconstitution experiments were performed which involved mixing various combinations of infected and uninfected macrophages and lymphocytes. Under these conditions, it was found that the infected macrophages and lymphocytes. Under these conditions, it was found that the infected macrophages had an impaired capacity to mediate the response ot T lymphocytes to concanavalin A. This suggests that murine cytomegalovirus may cause immunosuppression indirectly by interfering with macrophage function. PMID:6244228

  14. A Novel Human Cytomegalovirus Glycoprotein, gpUS9, Which Promotes Cell-to-Cell Spread in Polarized Epithelial Cells, Colocalizes with the Cytoskeletal Proteins E-Cadherin and F-Actin

    PubMed Central

    Maidji, Ekaterina; Tugizov, Sharof; Abenes, Gerardo; Jones, Thomas; Pereira, Lenore


    Processes by which human herpesviruses penetrate and are released from polarized epithelial cells, which have distinct apical and basolateral membrane domains differing in protein and lipid content, are poorly understood. We recently reported that human cytomegalovirus (CMV) mutants with deletions of the gene US9 formed wild-type plaques in cultures of human fibroblasts but were impaired in the capacity for cell-to-cell spread in polarized human retinal pigment epithelial cells. Unlike the glycoproteins that are required for infection, the protein encoded by CMV US9 plays an accessory role by promoting dissemination of virus across cell-cell junctions of polarized epithelial cells. To identify the product and investigate its specialized functions, we selected Madine-Darby canine kidney II (MDCK) epithelial cells that constitutively express CMV US9 or, as a control, US8. The gene products, designated gpUS9 and gpUS8, were glycosylated proteins of comparable molecular masses but differed considerably in intracellular distribution and solubility. Immunofluorescence laser scanning confocal microscopy indicated that, like gpUS8, gpUS9 was present in the endoplasmic reticulum and Golgi compartments of nonpolarized cells. In polarized epithelial cells, gpUS9 also accumulated along lateral membranes, colocalizing with cadherin and actin, and was insoluble in Triton X-100, a property shared with proteins that associate with the cytoskeleton. We hypothesize that gpUS9 may enhance the dissemination of CMV in infected epithelial tissues by associating with the cytoskeletal matrix. PMID:9621030

  15. Cytomegalovirus infection in transplant recipients.


    Azevedo, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Caiaffa Filho, Helio Hehl; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; Santos, Vera Aparecida dos; Linardi, Camila da Cruz Gouveia; Yasuda, Maria Aparecida Shikanai; Marques, Heloisa Helena de Sousa


    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  16. Cytomegalovirus infection in transplant recipients

    PubMed Central

    Azevedo*, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Filho, Helio Hehl Caiaffa; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; dos Santos, Vera Aparecida; da Cruz Gouveia Linardi, Camila; Yasuda, Maria Aparecida Shikanai; de Sousa Marques, Heloisa Helena


    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  17. Overview: cytomegalovirus and the herpesviruses in transplantation.


    Fishman, J A


    Herpesviruses infect most animal species. Infections due to the eight human herpesviruses (HHV) are exacerbated by immunosuppression in organ transplantation. The special features of the herpesvirus life cycle include the ability to establish latent, nonproductive infection and the life-long capacity for reactivation to productive, lytic infection. Interactions between latent virus and the immune system determine the frequency and severity of symptomatic infections. The immunologic and cellular effects of herpesvirus infections contribute to risk for opportunistic infections and graft rejection. Among the most important advances in transplantation are laboratory assays for the diagnosis and monitoring of herpesvirus infections and antiviral agents with improved efficacy in prophylaxis and therapy. For herpes simplex virus, varicella zoster virus and cytomegalovirus, these advances have significantly reduced the morbidity of infection. The syndromes of EBV-associated posttransplant lymphoproliferative disorders (PTLD) and Kaposi's sarcoma remain important complications of immunosuppression. The epidemiology and essential biology of human herpesvirus is reviewed. PMID:23347210

  18. Evolutive leukoencephalopathy in congenital cytomegalovirus infection.


    Krakar, Goran; Đaković, Ivana; Delin, Sanja; Bošnjak, Vlatka Mejaški


    Congenital cytomegalovirus infection is the most common infectious cause of congenital brain injury. Type and severity of congenital cytomegalovirus infection-related brain abnormalities depend on the developmental stage of the central nervous system at the time of fetal infection. The aim of this study was to follow the course of leukoencephalopathy in a patient with congenital cytomegalovirus infection. We describe brain magnetic resonance imaging (MRI) findings of a boy with symptomatic congenital cytomegalovirus infection performed at the age of 3 weeks, 13 months, and 4 and 7 years. Neonatal brain MRI showed most of characteristic findings in congenital cytomegalovirus infection with most prominent white matter abnormalities and cortical dysplasia. MRI follow-up images showed that cortical dysgenesis remained unchanged and static, whereas white matter abnormalities evolved over the years. We propose that leukoencephalopathy in congenital cytomegalovirus infection is not only nonprogressive or static but even evolutive and suggests both underlying disruption and delay of myelination. PMID:24453153

  19. Bombyx mori nucleopolyhedrovirus orf8 encodes a nucleic acid binding protein that colocalizes with IE1 during infection.


    Imai, N; Kurihara, M; Matsumoto, S; Kang, W-K


    This report describes the characterization of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf8 gene. Immunoblot analyses demonstrated that orf8 was expressed as an early gene. The ORF8 protein accumulated in the nucleus, and was maintained at relatively constant levels from 4 to 24 h postinfection. Immunoblot analysis failed to detect ORF8 protein associated with budded virus and occlusion derived virus. In addition, immunohistochemical analysis by confocal microscopy showed that ORF8 protein colocalized with IE1 to specific nuclear foci throughout infection. To further examine the function of ORF8, a reporter gene was inserted into the orf8 reading frame. One orf8 disruption mutant (BmD8), which expressed the N-terminal half of ORF8, was isolated. However, it was not possible to isolate a null mutant, suggesting that orf8 may have an important role during viral infection. Single-step growth curves showed that BV production was reduced in BmD8 infected cells. Biochemical analyses indicated that ORF8 bound to nucleic acids. Together, these results suggest that BmNPV ORF8 may be involved in viral DNA replication and/or transcription. PMID:15290382

  20. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.


    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  1. pUL69 of Human Cytomegalovirus Recruits the Cellular Protein Arginine Methyltransferase 6 via a Domain That Is Crucial for mRNA Export and Efficient Viral Replication

    PubMed Central

    Thomas, Marco; Sonntag, Eric; Müller, Regina; Schmidt, Stefanie; Zielke, Barbara; Fossen, Torgils


    ABSTRACT The regulatory protein pUL69 of human cytomegalovirus acts as a viral mRNA export factor, facilitating the cytoplasmic accumulation of unspliced RNA via interaction with the cellular mRNA export factor UAP56. Here we provide evidence for a posttranslational modification of pUL69 via arginine methylation within the functionally important N terminus. First, we demonstrated a specific immunoprecipitation of full-length pUL69 as well as pUL69aa1-146 by a mono/dimethylarginine-specific antibody. Second, we observed a specific electrophoretic mobility shift upon overexpression of the catalytically active protein arginine methyltransferase 6 (PRMT6). Third, a direct interaction of pUL69 and PRMT6 was confirmed by yeast two-hybrid and coimmunoprecipitation analyses. We mapped the PRMT6 interaction motif to the pUL69 N terminus and identified critical amino acids within the arginine-rich R1 box of pUL69 that were crucial for PRMT6 and/or UAP56 recruitment. In order to test the impact of putative methylation substrates on the functions of pUL69, we constructed various pUL69 derivatives harboring arginine-to-alanine substitutions and tested them for RNA export activity. Thus, we were able to discriminate between arginines within the R1 box of pUL69 that were crucial for UAP56/PRMT6-interaction and/or mRNA export activity. Remarkably, nuclear magnetic resonance (NMR) analyses revealed the same α-helical structures for pUL69 sequences encoding either the wild type R1/R2 boxes or a UAP56/PRMT6 binding-deficient derivative, thereby excluding the possibility that R/A amino acid substitutions within R1 affected the secondary structure of pUL69. We therefore conclude that the pUL69 N terminus is methylated by PRMT6 and that this critically affects the functions of pUL69 for efficient mRNA export and replication of human cytomegalovirus. IMPORTANCE The UL69 protein of human cytomegalovirus is a multifunctional regulatory protein that acts as a viral RNA export factor with a

  2. Cytomegalovirus Infection in Ireland

    PubMed Central

    Hassan, Jaythoon; O’Neill, Derek; Honari, Bahman; De Gascun, Cillian; Connell, Jeff; Keogan, Mary; Hickey, David


    Abstract Cytomegalovirus (CMV) infections occur worldwide and primary infection usually occurs in early childhood and is often asymptomatic whereas primary infection in adults may result in symptomatic illness. CMV establishes a chronic latent infection with intermittent periods of reactivation. Primary infection or reactivation associate with increased mortality and morbidity in those who are immunocompromised. Transplacental transmission may result in significant birth defects or long-term sensorineural hearing loss. We performed a study to determine the CMV seroprevalence and the association between HLA Class I alleles and frequency of CMV infection in Ireland. The presence of CMV IgG, a marker of previous CMV infection, was determined for a cohort of 1849 HLA typed solid organ transplant donors between 1990 and 2013. The presence of CMV IgG was correlated with HLA type. The CMV seroprevalence in solid organ transplant donors was 33.4% (range 22–48% per annum) over the time period 1990 to 2013. Multivariate logistic regression analysis showed that both age and HLA alleles were associated with CMV seropositivity. A significant and positive relationship between age and CMV seropositivity was observed (OR = 1.013, P < 0.001, CI [1.007, 1.019]). Chi-square analysis revealed that the female gender was independently associated with CMV seropositivity (P < 0.01). Seroprevalence in women of reproductive age (20–39 years) was significantly higher than men of the same age (37% vs 26%, P < 0.01). The frequencies of HLA-A1, HLA-A2, and HLA-A3 in our cohort were 40.8%, 48.8%, and 25.9%, respectively. Logistic regression analysis showed that the presence of HLA-A1 but not HLA-A2 or HLA-A3 was independently associated with CMV seronegativity (P < 0.01). Interestingly, individuals who co-expressed HLA-A2 and HLA-A3 alleles were significantly more likely to be CMV seropositive (P < 0.02). The frequencies of HLA-B5, HLA-B7, and HLA-B8 in our cohort

  3. Effects of interleukin 2 and large envelope glycoprotein (gp 120) of human immunodeficiency virus (HIV) on lymphocyte proliferative responses to cytomegalovirus.

    PubMed Central

    Krowka, J; Stites, D; Mills, J; Hollander, H; McHugh, T; Busch, M; Wilhelm, L; Blackwood, L


    Lymphocytes from many HIV-infected asymptomatic individuals or patients with AIDS-related conditions (ARC) and from all AIDS patients were unable to proliferate in vitro in response to UV-inactivated cytomegalovirus (CMV). The addition of recombinant IL2 (rIL2) restored proliferative responses of lymphocytes from most HIV-infected asymptomatic individuals and ARC patients to levels similar to those of HIV-seronegative (HIV-) CMV-seropositive (CMV+) individuals. In contrast, rIL2 augmented CMV-specific lymphocyte proliferation of only 33% (6/18) of AIDS patients. Proliferative responses to CMV with or without rIL2 did not correlate well with the levels of CD4+ lymphocytes, HIV antigen levels or ratios of CD4+ and CD8+ lymphocytes. Proliferative responses to CMV were inhibited by relatively high concentrations (greater than or equal to 10 micrograms/ml) of recombinant HIV envelope glycoprotein (rgp120) and this immunosuppression was completely overcome by rIL2. These results indicate that defects in antigen-driven lymphocyte responses of HIV-infected individuals are not simply the result of reduced numbers of CD4+ lymphocytes but are influenced by defects in IL2 pathways and by immunosuppressive effects of HIV gp120. PMID:2842093

  4. Viral and host control of cytomegalovirus maturation

    PubMed Central

    Tandon, Ritesh; Mocarski, Edward S.


    Maturation in herpesviruses initiates in the nucleus of the infected cell with encapsidation of viral DNA to form nucleocapsids and concludes with envelopment in the cytoplasm to form infectious virions that egress the cell. The entire process of virus maturation is orchestrated by protein-protein interactions and enzymatic activities of viral and host origin. Viral tegument proteins play important roles in maintaining the structural stability of capsids and directing the acquisition of virus envelope. Envelopment occurs at modified host membranes and exploits host vesicular trafficking. In this review, we summarize the current knowledge and concepts in human cytomegalovirus (HCMV) maturation and their parallels in other herpesviruses with an emphasis on viral and host factors regulating this process. PMID:22633075

  5. Identification of two major resistance genes against race IE-1k of Magnaporthe oryzae in the indica rice cultivar ZHE733

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The race IE-1K of Magnaporthe oryzae overcoming the resistance (R) gene Pi-ta has been recovered from the southern US over a period several years. In the present study, three isolates TM2, S1, and 94071 of the race IE-1K were used to identify R genes from a newly introduced resistant indica cultiva...

  6. High-Molecular-Weight Protein (pUL48) of Human Cytomegalovirus Is a Competent Deubiquitinating Protease: Mutant Viruses Altered in Its Active-Site Cysteine or Histidine Are Viable†

    PubMed Central

    Wang, Jianlei; Loveland, Amy N.; Kattenhorn, Lisa M.; Ploegh, Hidde L.; Gibson, Wade


    We show here that the high-molecular-weight protein (HMWP or pUL48; 253 kDa) of human cytomegalovirus (HCMV) is a functionally competent deubiquitinating protease (DUB). By using a suicide substrate probe specific for ubiquitin-binding cysteine proteases (DUB probe) to screen lysates of HCMV-infected cells, we found just one infected-cell-specific DUB. Characteristics of this protein, including its large size, expression at late times of infection, presence in extracellular virus particles, and reactivity with an antiserum to the HMWP, identified it as the HMWP. This was confirmed by constructing mutant viruses with substitutions in two of the putative active-site residues, Cys24Ile and His162Ala. HMWP with these mutations either failed to bind the DUB probe (C24I) or had significantly reduced reactivity with it (H162A). More compellingly, the deubiquitinating activity detected in wild-type virus particles was completely abolished in both the C24I and H162A mutants, thereby directly linking HMWP with deubiquitinating enzyme activity. Mutations in these active-site residues were not lethal to virus replication but slowed production of infectious virus relative to wild type and mutations of other conserved residues. Initial studies, by electron microscopy, of cells infected with the mutants revealed no obvious differences at late times of replication in the general appearance of the cells or in the distribution, relative numbers, or appearance of virus particles in the cytoplasm or nucleus. PMID:16731939

  7. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John


    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  8. [Historical outlook on cytomegalovirus research].


    Furukawa, T


    In historical point of view, cytomegalovirus (CMV) research could be divided into two phases, before and after discovery of the virus from a baby with severe jaundice. CMV is an ubiquitous virus which makes it difficult to diagnose CMV diseases. Therefore criteria for definite CMV disease has been proposed by the expert committee. Basic research is concentrating on analysis of functional map of the sequences, which helps to develop more genetically engineered vaccine and clarify the mechanism of latency of CMV. I hope increased awareness of CMV disease in organ transplantation advances the development of both chemotherapy and preventive method in near future. PMID:9465657

  9. A fusion protein of HCMV IE1 exon4 and IE2 exon5 stimulates potent cellular immunity in an MVA vaccine vector

    SciTech Connect

    Wang, Z.; Zhou, W.; Srivastava, T.; La Rosa, C.; Mandarino, A.; Forman, S.J.; Zaia, J.A.; Britt, W.J.; Diamond, D.J.


    A therapeutic CMV vaccine incorporating an antigenic repertoire capable of eliciting a cellular immune response has yet to be successfully implemented for patients who already have acquired an infection. To address this problem, we have developed a vaccine candidate derived from modified vaccinia Ankara (MVA) that expresses three immunodominant antigens (pp65, IE1, IE2) from CMV. The novelty of this vaccine is the fusion of two adjacent exons from the immediate-early region of CMV, their successful expression in MVA, and robust immunogenicity in both primary and memory response models. Evaluation of the immunogenicity of the viral vaccine in mouse models shows that it can stimulate primary immunity against all three antigens in both the CD4{sup +} and CD8{sup +} T cell subsets. Evaluation of human PBMC from healthy CMV-positive donors or patients within 6 months of receiving hematopoietic cell transplant shows robust stimulation of existing CMV-specific CD4{sup +} and CD8{sup +} T cell subsets.

  10. Soluble Human Cytomegalovirus gH/gL/pUL128–131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes*

    PubMed Central

    Loughney, John W.; Rustandi, Richard R.; Wang, Dai; Troutman, Matthew C.; Dick, Lawrence W.; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C.; Price, Colleen E.; Hoang, Van M.; Culp, Timothy D.; DePhillips, Pete A.; Fu, Tong-Ming; Ha, Sha


    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128–131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128–131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128–131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0–6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4–8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128–131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. PMID:25947373

  11. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail:


    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  12. Cross-Presentation of Human Cytomegalovirus pp65 (UL83) to CD8+ T Cells Is Regulated by Virus-Induced, Soluble-Mediator-Dependent Maturation of Dendritic Cells

    PubMed Central

    Arrode, Géraldine; Boccaccio, Claire; Abastado, Jean-Pierre; Davrinche, Christian


    Cytotoxic CD8+ T lymphocytes (CTL) directed against the matrix protein pp65 are major effectors in controlling infection against human cytomegalovirus (HCMV), a persistent virus of the Betaherpesvirus family. We previously suggested that cross-presentation of pp65 by nonpermissive dendritic cells (DCs) could overcome viral strategies that interfere with activation of CTL (G. Arrode, C. Boccaccio, J. Lule, S. Allart, N. Moinard, J. Abastado, A. Alam, and C. Davrinche, J. Virol. 74:10018–10024, 2000). It is well established that mature DCs are very potent in initiating T-cell-mediated immunity. Consequently, the DC maturation process is a key step targeted by viruses in order to avoid an immune response. Here, we report that immature DCs maintained in coculture with infected human (MRC5) fibroblasts acquired pp65 from early-infected cells for cross-presentation to specific HLA-A2-restricted CTL. In contrast, coculture of DCs in the presence of late-infected cells decreased their capacity to stimulate CTL. Analyses of DC maturation after either coculture with infected MRC5 cells or incubation with infected-cell-conditioned medium revealed that acquisition of a mature phenotype was a prerequisite for efficient stimulation of CTL and that soluble factors secreted by infected cells were responsible for both up and down regulation of CD83 expression on DCs. We identified transforming growth factor β1 secreted by late HCMV-infected cells as one of these down regulating mediators. These findings suggest that HCMV has devised another means to compromise immune surveillance mechanisms. Together, our data indicate that recognition of HCMV-infected cells by DCs has to occur early after infection to avoid immune evasion and to allow generation of anti-HCMV CTL. PMID:11739680

  13. Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1.


    Rodems, S M; Friesen, P D


    The hr5 enhancer element stimulates early viral transcription and may function as an origin of DNA replication for Autographa californica nuclear polyhedrosis virus (AcMNPV). The smallest functional unit of hr5 is a 28-bp repeat consisting of an imperfect palindrome (28-mer). To identify essential sequences and examine the molecular basis of hr5 activity, the effects of site-directed mutations on transcriptional enhancement by the 28-mer and binding of the AcMNPV transregulator IE1 were investigated. In transfection assays and infections with AcMNPV recombinants, activation of a basal viral promoter required sequences within both halves of the 28-mer. Basal promoter activation also required a critical spacing between these half sites. Mobility shift assays indicated that hr5 probes containing a single 28-mer were bound by in vitro-synthesized IE1. Competition assays using DNA fragments that contained mutated 28-mers demonstrated that both half sites were required for optimal binding of IE1. Similar assays using mutated 28-mer DNAs and nuclear extracts indicated that the relative affinity with which AcMNPV infection-specific proteins bound to the 28-mer was similar to that of in vitro-synthesized IE1. By using a combination of DNA binding and antibody supershift assays, it was demonstrated that IE1 binds to the 28-mer as a dimer. Collectively, these findings support a model in which symmetrical IE1 binding and simultaneous interaction with each half site are required for IE1-mediated transcriptional enhancement by hr5. Thus, sequence-specific binding may be one of the mechanisms by which IE1 directly or indirectly transregulates baculovirus gene expression. PMID:7636981

  14. Human Cytomegalovirus Infection of Langerhans-Type Dendritic Cells Does Not Require the Presence of the gH/gL/UL128-131A Complex and Is Blocked after Nuclear Deposition of Viral Genomes in Immature Cells

    PubMed Central

    Lauron, Elvin J.; Yu, Dong; Fehr, Anthony R.


    Human cytomegalovirus (CMV) enters its host via the oral and genital mucosae. Langerhans-type dendritic cells (LC) are the most abundant innate immune cells at these sites, where they constitute a first line of defense against a variety of pathogens. We previously showed that immature LC (iLC) are remarkably resistant to CMV infection, while mature LC (mLC) are more permissive, particularly when exposed to clinical-strain-like strains of CMV, which display a pentameric complex consisting of the viral glycoproteins gH, gL, UL128, UL130, and UL131A on their envelope. This complex was recently shown to be required for the infection of immature monocyte-derived dendritic cells. We thus sought to establish if the presence of this complex is also necessary for virion penetration of LC and if defects in entry might be the source of iLC resistance to CMV. Here we report that the efficiency of LC infection is reduced, but not completely abolished, in the absence of the pentameric complex. While virion penetration and nuclear deposition of viral genomes are not impaired in iLC, the transcription of the viral immediate early genes UL122 and UL123 and of the delayed early gene UL50 is substantially lower than that in mLC. Together, these data show that the UL128, UL130, and UL131A proteins are dispensable for CMV entry into LC and that progression of the viral cycle in iLC is restricted at the step of viral gene expression. PMID:24155395

  15. The Latency-Associated UL138 Gene Product of Human Cytomegalovirus Sensitizes Cells to Tumor Necrosis Factor Alpha (TNF-α) Signaling by Upregulating TNF-α Receptor 1 Cell Surface Expression ▿

    PubMed Central

    Montag, Christina; Wagner, Jutta Annabella; Gruska, Iris; Vetter, Barbara; Wiebusch, Lüder; Hagemeier, Christian


    Many viruses antagonize tumor necrosis factor alpha (TNF-α) signaling in order to counteract its antiviral properties. One way viruses achieve this goal is to reduce TNF-α receptor 1 (TNFR1) on the surface of infected cells. Such a mechanism is also employed by human cytomegalovirus (HCMV), as recently reported by others and us. On the other hand, TNF-α has also been shown to foster reactivation of HCMV from latency. By characterizing a new variant of HCMV AD169, we show here that TNFR1 downregulation by HCMV only becomes apparent upon infection of cells with HCMV strains lacking the so-called ULb′ region. This region contains genes involved in regulating viral immune escape, cell tropism, or latency and is typically lost from laboratory strains but present in low-passage strains and clinical isolates. We further show that although ULb′-positive viruses also contain the TNFR1-antagonizing function, this activity is masked by a dominant TNFR1 upregulation mediated by the ULb′ gene product UL138. Isolated expression of UL138 in the absence of viral infection upregulates TNFR1 surface expression and can rescue both TNFR1 reexpression and TNF-α responsiveness of cells infected with an HCMV mutant lacking the UL138-containing transcription unit. Given that the UL138 gene product is one of the few genes recognized to be expressed during HCMV latency and the known positive effects of TNF-α on viral reactivation, we suggest that via upregulating TNFR1 surface expression UL138 may sensitize latently infected cells to TNF-α-mediated reactivation of HCMV. PMID:21880774

  16. Major Tegument Protein pp65 of Human Cytomegalovirus Is Required for the Incorporation of pUL69 and pUL97 into the Virus Particle and for Viral Growth in Macrophages▿

    PubMed Central

    Chevillotte, Meike; Landwehr, Sandra; Linta, Leonhard; Frascaroli, Giada; Lüske, Anke; Buser, Christopher; Mertens, Thomas; von Einem, Jens


    The tegument protein pp65 of human cytomegalovirus (HCMV) represents the major component of mature virus particles. Nevertheless, deletion of pp65 has been shown to have no effects on virus replication and morphogenesis in fibroblasts in vitro. We have studied the HCMV virion composition in the absence of pp65 and viral growth of a pp65 stop mutant in different cell types, including monocyte-derived macrophages. Two stop codons at amino acids 11 and 12 of pp65 were introduced by bacterial artificial chromosome mutagenesis into the endotheliotropic strain TB40/E. Clear changes of the tegument composition could be observed in purified mutant virus particles, where the amount of tegument protein pUL25 was drastically reduced. In addition, pUL69 and the virally encoded protein kinase UL97 were undetectable in the pp65 stop mutant. Expression of pUL69 in infected cells was unaltered while pUL25 accumulated in the absence of pp65, thus demonstrating that only incorporation into virus particles is dependent on pp65. Coimmunoprecipitation experiments using lysates of infected cells revealed an interaction between pUL69 and pp65. This interaction was verified in pull-down experiments using transfected cells, which showed that pp65 and pUL69 do not require the presence of other viral proteins for their interaction. We conclude that pp65 is required for the incorporation of other viral proteins into the virus particle and thus is involved in the protein-protein interaction network leading to normal tegument formation. When studying growth kinetics of the pp65 stop mutant in different cell types, we found a severe impairment of viral growth in monocyte-derived macrophages, showing for the first time a strong cell-specific role of pp65 in viral growth. PMID:19116255

  17. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu


    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  18. Intracellular Trafficking of the Human Cytomegalovirus-Encoded 7-trans-Membrane Protein Homologs pUS27 and pUL78 during Viral Infection: A Comparative Analysis

    PubMed Central

    Niemann, Ina; Reichel, Anna; Stamminger, Thomas


    Human cytomegalovirus (HCMV) encodes four G protein-coupled receptor (GPCR) homologs, termed pUS27, pUS28, pUL33, and pUL78. In contrast to the extensively characterized vGPCRs pUS28 and pUL33, knowledge concerning pUS27 and pUL78 is limited. Previous studies already demonstrated constitutive internalization of pUS27 and pUL78, as well as an association with the endosomal machinery, however, these results were mainly obtained using transiently transfected cells. To explore the subcellular localization of both receptors during viral infection, we constructed recombinant HCMVs expressing tagged vGPCRs. Colocalization analyses revealed a predominant association of pUS27 or pUL78 with the trans-Golgi network or the endoplasmic reticulum, respectively. Intriguingly, our data emphasize that protein sorting is highly regulated by viral functions as we detected dramatic changes in the colocalization of pUS27 and pUL78 with endosomal markers during progression of HCMV replication. Furthermore, we observed cell type-dependent differences in trafficking of both vGPCRs between fibroblasts and epithelial cells. Most importantly, infection experiments with a recombinant HCMV carrying tagged versions of pUS27 and pUL78 simultaneously, revealed that these two proteins do not colocalize during viral infection. This contrasts to results of transient expression experiments. In conclusion, our results highlight the importance to investigate vGPCR trafficking in a viral context. PMID:24517969

  19. Immunomodulation by cytomegaloviruses: manipulative strategies beyond evasion.


    Mocarski, Edward S


    Human cytomegalovirus (CMV) remains the major infectious cause of birth defects as well as an important opportunistic pathogen. Individuals infected with CMV mount a strong immune response that suppresses persistent viral replication and maintains life-long latency. Loss of immune control opens the way to virus reactivation and disease. The large number of immunomodulatory functions encoded by CMV increases the efficiency of infection, dissemination, reactivation and persistent infection in hosts with intact immune systems and could contribute to virulence in immunocompromised hosts. These functions modulate both the innate and adaptive arms of the immune response and appear to target cellular rather than humoral responses preferentially. CMV encodes a diverse arsenal of proteins focused on altering and/or mimicking: (1) classical and non-classical major histocompatibility complex (MHC) protein function; (2) leukocyte migration, activation and cytokine responses; and (3) host cell susceptibility to apoptosis. Evidence that the host evolves mechanisms to counteract virus immune modulation is also accumulating. Although immune evasion is certainly one clear goal of the virus, the pro-inflammatory impact of certain viral functions suggests that increased inflammation benefits viral dissemination. The ability of such viral functions to successfully 'face off' against the host immune system ensures the success of this pathogen in the human population and could provide key insights into disease mechanisms. PMID:12110212

  20. Comparative efficacy of handwashing agents against cytomegalovirus.


    Faix, R G


    Conscientious handwashing is often recommended as an important method for limiting transmission of cytomegalovirus (CMV) from infected individuals to health, education, and child care professionals. To assess the efficacy of handwashing, fingertips of radiation-sterilized latex gloves were inoculated with 0.2 mL of ten different CMV strains. Virus in each inoculum was quantitated by plaque assay. After five minutes, viral inocula were allowed to remain (control), or were washed away by dropwise application of 10 mL of distilled water (DI), 5 mL of 0.08% soap followed by 5 mL of DI, 5 mL of 0.01% chlorhexidine gluconate followed by 5 mL of DI, or 5 mL of 0.025% povidone-iodine solution followed by 5 mL of DI. Separate glove fingertips were sampled 5, 15, 30, 60, 120 and 240 minutes after washing and cultured in duplicate for CMV. Similar studies were performed using human cadaver skin. Ordinary soap was as effective at preventing CMV recovery as other more expensive agents. For inocula with less than 5 log10 pfu CMV/mL, washing with water alone was as effective as other agents. This was confirmed in similar studies with human hands using five CMV stains. Handwashing is probably an effective method for removing CMV from contaminated hands. PMID:3034815

  1. Cerebral ultrasound images in prenatal cytomegalovirus infection.


    Tomà, P; Magnano, G M; Mezzano, P; Lazzini, F; Bonacci, W; Serra, G


    A male newborn with prenatal cytomegalovirus infection was referred for cranial ultrasound. The cranial ultrasound demonstrated areas of increased echogenicity in the thalamic and gray nuclei resembling "a branched candlestick". Doppler technique located the "branched candlestick" along the thalamostriate arteries. This image is particularly interesting because to our knowledge it has never before been described in congenital cytomegalovirus infection, but only in congenital rubella. PMID:2550848

  2. Cytomegalovirus Primary Envelopment Occurs at Large Infoldings of the Inner Nuclear Membrane▿

    PubMed Central

    Buser, Christopher; Walther, Paul; Mertens, Thomas; Michel, Detlef


    We have investigated the morphogenesis of human and murine cytomegalovirus by transmission electron microscopy after high-pressure freezing, freeze substitution, and plastic embedding. We observed large tubular infoldings of the inner nuclear membrane that were free of lamina and active in primary envelopment and subsequent transport of capsids to the nuclear periphery. Semiquantitative determinations of the enlarged inner nuclear membrane area and the location of the primary envelopment of nucleocapsids demonstrated that this structure represents a virus-induced specialized membrane domain at which the particles are preferentially enveloped. This is a previously undescribed structural element relevant in cytomegalovirus morphogenesis. PMID:17192309

  3. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention

    PubMed Central

    van Zuylen, Wendy J; Hamilton, Stuart T; Naing, Zin; Hall, Beverly; Shand, Antonia


    Cytomegalovirus is the most common congenital infection causing serious disease in infants. It is the leading infectious cause of sensorineural hearing loss and neurodevelopmental disability in developed countries. Despite the clinical importance of congenital cytomegalovirus, surveys show there is limited awareness and knowledge in the medical and general community about congenital cytomegalovirus infection. This article reviews the clinical features, global epidemiology, transmission and risk factors for cytomegalovirus infections. It also highlights several major advances made in recent years in the diagnosis and prevention of cytomegalovirus infection during pregnancy. Although research is ongoing, no therapy is currently proven to prevent or treat maternal, fetal or neonatal cytomegalovirus infection. Education of women regarding hygiene measures can help prevent cytomegalovirus infection and are currently the best strategy to prevent congenital cytomegalovirus disease.


    EPA Science Inventory

    Increased Susceptibility to Parathion Poisoning Following Murine Cytomegalovirus Infection. Fifty to 100 percent mortality occurred in mice treated with ordinarily sublethal doses of parathion 2 to 5 days post infection with murine cytomegalovirus (MCMV). These mortalities appear...

  5. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators

    PubMed Central

    Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun


    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  6. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators.


    Kim, Ye Ji; Kim, Eui Tae; Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun


    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  7. Horizontal In Utero Acquisition of Cytomegalovirus Infection in a Twin Pregnancy

    PubMed Central

    Gabrielli, Liliana; Lazzarotto, Tiziana; Foschini, Maria Pia; Lanari, Marcello; Guerra, Brunella; Eusebi, Vincenzo; Landini, Maria Paola


    It is generally accepted that viral infections can be transmitted horizontally by direct or indirect contact with virus-excreting persons, and some viral infections can be transmitted vertically, either prenatally or perinatally, from mother to child. This report presents data strongly supporting a prenatal horizontal acquisition of human cytomegalovirus infection in a twin pregnancy. PMID:12624079

  8. Leflunomide for cytomegalovirus: bench to bedside.


    Chacko, B; John, G T


    Cytomegalovirus (CMV) remains a major cause of morbidity and mortality among transplant recipients, frequently engaging the clinician in a struggle to balance graft preservation with control of CMV disease. Leflunomide has been shown to have immunosuppressive activity in experimental allograft models together with antiviral activity inhibiting CMV both in vitro and in vivo. Data are emerging about its potential role in ganciclovir-sensitive and -resistant CMV, primarily by virtue of a unique mechanism inhibiting virion assembly, as opposed to inhibition of viral DNA synthesis by current agents. This review aims to put in perspective, the knowledge acquired in the last decade or so on leflunomide for CMV. Evidence suggests that it might have activity against human CMV with good oral bioavailability and, more importantly in the resource-poor setting, is economical. Although the data presented here are not from randomized trials, several relevant observations have been made that could influence future, more structured assessments of the drug. An immune suppressive compound with antiviral features and experimental activity in chronic rejection is an attractive combination for organ transplantation, and it appears that leflunomide may just fit that niche. PMID:22093814

  9. Cytomegalovirus


    ... be contagious? I have CMV. Should I stop breastfeeding my baby? I work at a daycare center. How long should I stay home? Will my newborn have any problems because I had CMV while I was pregnant? I have HIV. Do I need any special treatments? Should I ...

  10. CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter.

    PubMed Central

    Schwartz, R; Helmich, B; Spector, D H


    The human cytomegalovirus (HCMV) immediate-early region 2 86-kDa protein (IE2 86) is the major transactivator of the promoter for the 2.2-kb class of early RNAs (open reading frame UL 112-113). Previously, we reported that a DNA segment on this promoter between nucleotides (nt) -113 and -59 was critical for activation by IE2 86 in vivo and could be bound by IE2 86 in vitro (R. Schwartz, M. H. Sommer, A. Scully, and D. H. Spector, J. Virol. 68:5613-5622, 1994). With a set of site-specific mutations within nt -84 to -61, we have localized the essential cis-acting sequences to nt -72 to -61, which contain an ATF/CREB-binding site. The IE2 86-binding site between nt -113 and -85 is not essential for activation of the promoter by IE2 86 in transient-expression assays, but its presence can enhance the level of activation mediated through the sequences located between nt -84 and -59. Electrophoretic mobility shift assays with a segment containing nt -84 to -59 and nuclear extracts from human cells permissive for the HCMV infection revealed a complex band pattern. However, by supershift analysis with specific antibodies, we were able to identify CREB as the major ATF/CREB family member in the protein-DNA complexes. Further evidence that CREB is a target for IE2 86-mediated induction, is provided by the finding that IE2 86 activates the somatostatin promoter to high levels. Although the binding of IE2 86 to nonphosphorylated full-length CREB or deltaCREB is minimal, IE2 86 does form complexes with p300 and the CREB-binding protein (CBP), which in turn bind to CREB and can serve as adaptor proteins for CREB function. In addition, the in vivo functional relevance of the interaction between IE2 86 and CBP is indicated by the ability of IE2 86 to enhance transcriptional activation mediated by a GAL4-CBP fusion protein brought to a promoter by GAL4-binding sites. PMID:8794339

  11. Lymph Node Macrophages Restrict Murine Cytomegalovirus Dissemination

    PubMed Central

    Farrell, Helen E.; Davis-Poynter, Nick; Bruce, Kimberley; Lawler, Clara; Dolken, Lars; Mach, Michael


    ABSTRACT Cytomegaloviruses (CMVs) establish chronic infections that spread from a primary entry site to secondary vascular sites, such as the spleen, and then to tertiary shedding sites, such as the salivary glands. Human CMV (HCMV) is difficult to analyze, because its spread precedes clinical presentation. Murine CMV (MCMV) offers a tractable model. It is hypothesized to spread from peripheral sites via vascular endothelial cells and associated monocytes. However, viral luciferase imaging showed footpad-inoculated MCMV first reaching the popliteal lymph nodes (PLN). PLN colonization was rapid and further spread was slow, implying that LN infection can be a significant bottleneck. Most acutely infected PLN cells were CD169+ subcapsular sinus macrophages (SSM). Replication-deficient MCMV also reached them, indicating direct infection. Many SSM expressed viral reporter genes, but few expressed lytic genes. SSM expressed CD11c, and MCMV with a cre-sensitive fluorochrome switch showed switched infected cells in PLN of CD11c-cre mice but yielded little switched virus. SSM depletion with liposomal clodronate or via a CD169-diphtheria toxin receptor transgene shifted infection to ER-TR7+ stromal cells, increased virus production, and accelerated its spread to the spleen. Therefore, MCMV disseminated via LN, and SSM slowed this spread by shielding permissive fibroblasts and poorly supporting viral lytic replication. IMPORTANCE HCMV chronically infects most people, and it can cause congenital disability and harm the immunocompromised. A major goal of vaccination is to prevent systemic infection. How this is established is unclear. Restriction to humans makes HCMV difficult to analyze. We show that peripheral MCMV infection spreads via lymph nodes. Here, MCMV infected filtering macrophages, which supported virus replication poorly. When these macrophages were depleted, MCMV infected susceptible fibroblasts and spread faster. The capacity of filtering macrophages to limit

  12. Cytomegalovirus Immunoglobulin After Thoracic Transplantation

    PubMed Central

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano


    Abstract Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R−). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  13. Congenital Cytomegalovirus Infection: Audiologic Outcome

    PubMed Central

    Fowler, Karen B.


    The association between congenital cytomegalovirus (CMV) infection and sensorineural hearing loss (SNHL) was first described almost 50 years ago. Studies over the intervening decades have further described the relationship between congenital CMV infection and SNHL in children. However, congenital CMV infection remains a leading cause of SNHL in children in the United States and the world today. As more CMV infections are identified, it is important to recognize that infants who are born to seroimmune mothers are not completely protected from SNHL, although their hearing loss is often milder than that seen in CMV-infected infants following primary maternal infections. Late-onset and progressive hearing losses occur following congenital CMV infection, and CMV-infected infants should be evaluated regularly to provide for early detection of hearing loss and appropriate intervention. Fluctuating hearing loss that is not explained by concurrent middle ear infections is another characteristic of CMV-related hearing loss in children. Challenges still remain in predicting which children with congenital CMV infection will develop hearing loss and, among those who do develop loss, whether or not the loss will continue to deteriorate. PMID:24257423

  14. Altered microRNA expression after infection with human cytomegalovirus leads to TIMP3 downregulation and increased shedding of metalloprotease substrates, including MICA.


    Esteso, Gloria; Luzón, Elisa; Sarmiento, Elisabeth; Gómez-Caro, Ruth; Steinle, Alexander; Murphy, Gillian; Carbone, Javier; Valés-Gómez, Mar; Reyburn, Hugh T


    Proteolytic shedding of ligands for the NK group 2D (NKG2D) receptor is a strategy used by tumors to modulate immune recognition by NK cells and cytotoxic T cells. A number of metalloproteases, especially those of the A disintegrin and metalloprotease (ADAM) family, can mediate NKG2D ligand cleavage and this process can be modulated by expression of the thiol isomerase ERp5. In this article, we describe that an increased shedding of the NKG2D ligand MICA is observed postinfection with several strains of human CMV due to an enhanced activity of ADAM17 (TNF-α converting enzyme) and matrix metalloprotease 14 caused by a reduction in the expression of the endogenous inhibitor of metalloproteases tissue inhibitors of metalloproteinase 3 (TIMP3). This decrease in TIMP3 expression correlates with increased expression of a cellular miRNA known to target TIMP3, and we also identify a human CMV-encoded microRNA able to modulate TIMP3 expression. These observations characterize a novel viral strategy to influence the shedding of cell-surface molecules involved in immune response modulation. They also provide an explanation for previous reports of increased levels of various ADAM17 substrates in the serum from patients with CMV disease. Consistent with this hypothesis, we detected soluble MICA in serum of transplant recipients with CMV disease. Finally, these data suggest that it might be worthwhile to prospectively study ADAM17 activity in a larger group of patients to assay whether this might be a useful biomarker to identify patients at risk for development of CMV disease. PMID:24973455

  15. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation

    PubMed Central

    Cloarec, Robin; Bauer, Sylvian; Luche, Hervé; Buhler, Emmanuelle; Pallesi-Pocachard, Emilie; Salmi, Manal; Courtens, Sandra; Massacrier, Annick; Grenot, Pierre; Teissier, Natacha; Watrin, Françoise; Schaller, Fabienne; Adle-Biassette, Homa; Gressens, Pierre; Malissen, Marie; Stamminger, Thomas; Streblow, Daniel N.; Bruneau, Nadine; Szepetowski, Pierre


    Background Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells. Objectives and Methods In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15) and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments. Results Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b– lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1. Conclusion In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which

  16. Expansion of a unique CD57⁺NKG2Chi natural killer cell subset during acute human cytomegalovirus infection.


    Lopez-Vergès, Sandra; Milush, Jeffrey M; Schwartz, Brian S; Pando, Marcelo J; Jarjoura, Jessica; York, Vanessa A; Houchins, Jeffrey P; Miller, Steve; Kang, Sang-Mo; Norris, Phillip J; Nixon, Douglas F; Lanier, Lewis L


    During human CMV infection, there is a preferential expansion of natural killer (NK) cells expressing the activating CD94-NKG2C receptor complex, implicating this receptor in the recognition of CMV-infected cells. We hypothesized that NK cells expanded in response to pathogens will be marked by expression of CD57, a carbohydrate antigen expressed on highly mature cells within the CD56(dim)CD16(+) NK cell compartment. Here we demonstrate the preferential expansion of a unique subset of NK cells coexpressing the activating CD94-NKG2C receptor and CD57 in CMV(+) donors. These CD57(+)NKG2C(hi) NK cells degranulated in response to stimulation through their NKG2C receptor. Furthermore, CD57(+)NKG2C(hi) NK cells preferentially lack expression of the inhibitory NKG2A receptor and the inhibitory KIR3DL1 receptor in individuals expressing its HLA-Bw4 ligand. Moreover, in solid-organ transplant recipients with active CMV infection, the percentage of CD57(+)NKG2C(hi) NK cells in the total NK cell population preferentially increased. During acute CMV infection, the NKG2C(+) NK cells proliferated, became NKG2C(hi), and finally acquired CD57. Thus, we propose that CD57 might provide a marker of "memory" NK cells that have been expanded in response to infection. PMID:21825173

  17. Human cytomegalovirus UL40 signal peptide regulates cell surface expression of the NK cell ligands HLA-E and gpUL18.


    Prod'homme, Virginie; Tomasec, Peter; Cunningham, Charles; Lemberg, Marius K; Stanton, Richard J; McSharry, Brian P; Wang, Eddie C Y; Cuff, Simone; Martoglio, Bruno; Davison, Andrew J; Braud, Véronique M; Wilkinson, Gavin W G


    Human CMV (HCMV)-encoded NK cell-evasion functions include an MHC class I homolog (UL18) with high affinity for the leukocyte inhibitory receptor-1 (CD85j, ILT2, or LILRB1) and a signal peptide (SP(UL40)) that acts by upregulating cell surface expression of HLA-E. Detailed characterization of SP(UL40) revealed that the N-terminal 14 aa residues bestowed TAP-independent upregulation of HLA-E, whereas C region sequences delayed processing of SP(UL40) by a signal peptide peptidase-type intramembrane protease. Most significantly, the consensus HLA-E-binding epitope within SP(UL40) was shown to promote cell surface expression of both HLA-E and gpUL18. UL40 was found to possess two transcription start sites, with utilization of the downstream site resulting in translation being initiated within the HLA-E-binding epitope (P2). Remarkably, this truncated SP(UL40) was functional and retained the capacity to upregulate gpUL18 but not HLA-E. Thus, our findings identify an elegant mechanism by which an HCMV signal peptide differentially regulates two distinct NK cell-evasion pathways. Moreover, we describe a natural SP(UL40) mutant that provides a clear example of an HCMV clinical virus with a defect in an NK cell-evasion function and exemplifies issues that confront the virus when adapting to immunogenetic diversity in the host. PMID:22345649

  18. Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens.


    Tabi, Z; Moutaftsi, M; Borysiewicz, L K


    Dendritic cells (DCs) play a pivotal role in the development of anti-viral CD8(+) CTL responses. This is straightforward if they are directly infected with virus, but is less clear in response to viruses that cannot productively infect DCS: Human CMV (HCMV) shows strain-specific cell tropism: fibroblast (Fb)-adapted laboratory strains (AD169) and recent clinical isolates do not infect DCs, whereas endothelial cell-adapted strains (TB40/E) result in productive lytic DC infection. However, we show here that uninfected DCs induce CD8(+) T cell cytotoxicity and IFN-gamma production against HCMV pp65 and immediate early 1 Ags following in vitro coculture with HCMV-AD169-infected Fbs, regardless of the HLA type of these FBS: CD8(+) T cell stimulation was inhibited by pretreatment of DCs with cytochalasin B or brefeldin A, indicating a phagosome/endosome to cytosol pathway. HCMV-infected Fbs were not apoptotic as measured by annexin V binding, and induction of apoptosis of infected Fbs in vitro did not augment CTL induction by DCs, suggesting a mechanism other than apoptosis in the initiation of cross-presentation. Furthermore, HCMV-infected Fbs provided a maturation signal for immature DCs during coculture, as evidenced by increased CD83 and HLA class II expression. Cross-presentation of HCMV Ags by host DCs enables these professional APCs to bypass some of the evasion mechanisms HCMV has developed to avoid T cell recognition. It may also serve to explain the presence of immediate early 1 Ag-specific CTLs in the face of pp65-induced inhibition of Ag presentation at the level of the infected cell. PMID:11313411

  19. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G


    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  20. Subclinical Congenital Cytomegalovirus Infection and Hearing Impairment

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others


    When the hearing sensitivity of children with subclinical congenital cytomegalovirus infection was evaluated and compared with that of a group of matched control subjects, nine of the 18 infected subjects were found to have some hearing loss, ranging from slight high-frequency impairments to a severe-to-profound unilateral loss. (MYS)

  1. Cytomegalovirus appendicitis in an immunocompetent host.


    Canterino, Joseph E; McCormack, Michael; Gurung, Ananta; Passarelli, James; Landry, Marie L; Golden, Marjorie


    Cytomegalovirus (CMV) is a common viral pathogen. Asymptomatic infection or a mononucleosis syndrome are the most common manifestations in otherwise healthy individuals. End-organ disease is rare in immunocompetent individuals. Here, we describe a case of CMV appendicitis in a patient without an immune-compromising condition. PMID:26942831

  2. Seroprevalence and Seroconversion Rates of Cytomegalovirus pp65 Antigen and Cord Blood Screening of Pregnant Women in Malatya, Turkey

    PubMed Central

    Dogan, Keziban; Kafkasli, Ayse; Kaya, Cihan; Cengiz, Huseyin


    Objective: The rates of seropositivity, seroconversion and fetal infection with human cytomegalovirus were analyzed in pregnant women and newborn cord blood in this study. The relationships between maternal age, parity, cytomegalovirus serology and polymerase chain reaction results were evaluated. Materials and Methods: A total of 217 pregnant women attended our pregnancy clinic between April 2004 and October 2005. During each trimester, 5 cc of maternal blood was obtained and 5 cc of cord blood was collected after birth. An enzyme-linked immunosorbent assay (ELISA) was used to assess these samples for the presence of human cytomegalovirus protein pp65 antigen (in leukocytes) and cytomegalovirus DNA (in plasma). Results: The mean age of the pregnant women in our study was 28.1±5.3 years. No seroconversion was observed. Among the pregnant women, 212 (97.7%) were IgG positive, and 29 (13.4%) were IgM positive. Five of the pregnant women were positive for IgM alone (2.3%), whereas 24 (11.3%) were positive for both IgM and IgG. The 29 IgM-positive patients were reevaluated using the polymerase chain reaction, and no seropositivity was found. None of the cord blood samples were IgM positive, whereas 211 (97.3%) were IgG positive. There was no significant correlation between parity and seropositivity (p=0.487). The relationship between human cytomegalovirus seropositivity and maternal age was evaluated by dividing the pregnant women into two groups, with a cut-off age of 35 years. There was a significant difference in seropositivity between these two groups (p=0.045). Conclusion: Clearly, there is no need to screen pregnant women for Human cytomegalovirus (HCMV) in the Malatya region. Confirming serology results using the polymerase chain reaction and antigenemia testing to detect false positive results offers the advantage of avoiding unnecessary invasive interventions. PMID:25610259

  3. A Proteomics Analysis of Human Cytomegalovirus Particles

    SciTech Connect

    Streblow, Daniel N.; Varnum, Susan M.; Smith, Richard D.; Nelson, Jay


    While the sequence of the AD169 HCMV genome has been known for several years, the viral and cellular proteins that compose the infectious HCMV virion and entry-competent, non-replicating viral particles such as Dense Bodies (DBs) and Non-Infectious Enveloped Particles (NIEPs) are unknown. To approach this problem we have utilized a gel-free 2-D capillary liquid chromatography (LC)-MS/MS and Fourier transform ion cyclotron resonance (FTICR) mass spectrometry to identify and determine the relative abundance of viral and cellular proteins in purified HCMV AD169 particles. !is study has identified and quantitated the proteins that compose both HCMV virions and DBs. While a number of previously identified proteins were detected by this method the number of viral proteins that compose the HCMV virion was doubled in this study suggesting that over a third of the viral open reading frames are part of an infectious virion. !is chapter will discuss the implications of our findings in relation to what was previously known about HCMV and MCMV virion composition.

  4. Binding of the human cytomegalovirus 80-kDa immediate-early protein (IE2) to minor groove A/T-rich sequences bounded by CG dinucleotides is regulated by protein oligomerization and phosphorylation.


    Waheed, I; Chiou, C J; Ahn, J H; Hayward, G S


    The 80-kDa immediate-early regulatory protein IE2 of human cytomegalovirus (HCMV) functions as an essential positive transactivator of downstream viral promoters, but it also specifically down-regulates transcription from the major immediate-early promoter through a 14-bp DNA target motif known as the cis-repression signal (CRS) located at the transcription start site. The IE2 protein purified from bacteria as a fusion product of either staphylococcal Protein A/IE2(290-579) or glutathione-S-transferase (GST)/IE2(346-579) bound specifically to a [32P]-labeled CRS oligonucleotide probe in an in vitro electrophoretic mobility shift assay (EMSA). In contrast, no direct interaction with the CRS probes could be detected with IE2 wild-type protein in extracts from infected or transfected mammalian cells or when synthesized by in vitro translation. However, in vitro phosphorylation of GST/IE2(346-579) by incubation with either the catalytic subunit of protein kinase A (PKA) or a HeLa cell nuclear extract strongly inhibited its DNA-binding activity. This process required ATP hydrolysis and could be reversed by subsequent incubation with bacterial alkaline phosphatase. Importantly, dephosphorylation of the constitutively expressed native IE2 protein present in a nuclear extract from the U373(A45) cell line unmasked a specific CRS DNA-binding activity that could be supershifted with anti-IE2 monoclonal antibody (mAb). A series of high-molecular-weight hetero-oligomeric DNA-bound structures of intermediate mobility were formed in EMSA assays when a mixture of staphylococcal Protein A/IE2 and GST/IE2 was coincubated with the CRS probe. Coincubation with a DNA-binding negative but dimerization-competent GST/IE2 deletion mutant competitively inhibited DNA-binding by staphylococcal Protein A/IE2, whereas coincubation with a GST/IE2 deletion mutant that lacked the ability to both dimerize and bind to DNA failed to influence the mobility of the DNA-bound staphylococcal Protein A/IE2

  5. A Human Cytomegalovirus gO-Null Mutant Fails To Incorporate gH/gL into the Virion Envelope and Is Unable To Enter Fibroblasts and Epithelial and Endothelial Cells▿

    PubMed Central

    Wille, Paul T.; Knoche, Amber J.; Nelson, Jay A.; Jarvis, Michael A.; Johnson, David C.


    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRΔgO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRΔgO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRΔgO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRΔgO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRΔgO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of gH/gL complexes into the HCMV

  6. A human cytomegalovirus gO-null mutant fails to incorporate gH/gL into the virion envelope and is unable to enter fibroblasts and epithelial and endothelial cells.


    Wille, Paul T; Knoche, Amber J; Nelson, Jay A; Jarvis, Michael A; Johnson, David C


    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRDeltagO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRDeltagO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRDeltagO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRDeltagO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRDeltagO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of g

  7. Human Cytomegalovirus gH/gL/gO Promotes the Fusion Step of Entry into All Cell Types, whereas gH/gL/UL128-131 Broadens Virus Tropism through a Distinct Mechanism

    PubMed Central

    Zhou, Momei; Lanchy, Jean-Marc


    ABSTRACT Interaction between gH/gL and the fusion protein gB is likely a conserved feature of the entry mechanism for all herpesviruses. Human cytomegalovirus (HCMV) gH/gL can be bound by gO or by the set of proteins UL128, UL130, and UL131, forming gH/gL/gO and gH/gL/UL128-131. The mechanisms by which these complexes facilitate entry are poorly understood. Mutants lacking UL128-131 replicate well on fibroblasts but fail to enter epithelial/endothelial cells, and this has led to the general assumption that gH/gL/UL128-131 promotes gB-mediated fusion on epithelial/endothelial cells whereas gH/gL/gO provides this function on fibroblasts. This was challenged by observations that gO-null mutants were defective on all of these cell types, suggesting that entry into epithelial/endothelial cells requires both of the gH/gL complexes, but the severe replication defect of the gO mutants precluded detailed analysis. We previously reported that the ratio of gH/gL/gO and gH/gL/UL128-131 in the virion envelope varied dramatically among HCMV strains. Here, we show that strains not only differ in the ratio, but also vary in the total amount of gH/gL in the virion. Cell-type-specific particle-to-PFU ratios of HCMV strains that contained different amounts of gH/gL/gO and gH/gL/UL128-131 were determined. Infection of both fibroblasts and epithelial cells was generally correlated with the abundance of gH/gL/gO, but not with that of gH/gL/UL128-131. The low infectivity of virions rich in gH/gL/UL128-131 but low in gH/gL/gO could be overcome by treatment with the chemical fusogen polyethylene glycol (PEG), strongly arguing that gH/gL/gO provides the conserved herpesvirus gH/gL entry function of promoting gB-mediated fusion for entry into all cell types, whereas gH/gL/UL128-131 acts through a distinct mechanism to allow infection of select cell types. IMPORTANCE The functions of HCMV gH/gL complexes in entry are unclear. Unlike the well-studied Epstein-Barr virus (EBV), where gH/gL and g

  8. Thrombosis associated with acute cytomegalovirus infection: a narrative review

    PubMed Central

    Sherman, Shany; Eytan, Ori


    Thrombosis associated with acute cytomegalovirus infection has been reported many times in the literature since the mid 1980s – mainly in case reports and in small case series, but also in four controlled studies. Still, many physicians are unaware of this association although acute cytomegalovirus infection diagnosis in a thrombosis patient may warrant antiviral therapy and may affect anticoagulation therapy duration. Accordingly, the clinical characteristics of patients with thrombosis and acute cytomegalovirus infection are reviewed, and the current knowledge concerning this unique association is presented herein. We believe it is time to add acute cytomegalovirus infection to the list of thrombosis triggers. PMID:25624857

  9. Acute Cytomegalovirus Infection as a Cause of Venous Thromboembolism

    PubMed Central

    Rinaldi, Francesca; Lissandrin, Raffaella; Mojoli, Francesco; Baldanti, Fausto; Brunetti, Enrico; Pascarella, Michela; Giordani, Maria Teresa


    Acute Human Cytomegalovirus (HCMV) infection is an unusual cause of venous thromboembolism, a potentially life-threatening condition. Thrombus formation can occur at the onset of the disease or later during the recovery and may also occur in the absence of acute HCMV hepatitis. It is likely due to both vascular endothelium damage caused by HCMV and impairment of the clotting balance caused by the virus itself. Here we report on two immunocompetent women with splanchnic thrombosis that occurred during the course of acute HCMV infection. Although the prevalence of venous thrombosis in patients with acute HCMV infection is unknown, physicians should be aware of its occurrence, particularly in immunocompetent patients presenting with fever and unexplained abdominal pain. PMID:24959338

  10. Acute ulcerative proctocolitis associated with primary cytomegalovirus infection.


    Diepersloot, R J; Kroes, A C; Visser, W; Jiwa, N M; Rothbarth, P H


    The case is reported of a 39-year-old pregnant woman who presented with fever, abdominal complaints, and diarrhea. Laboratory investigation revealed mononucleosis in the peripheral blood. All microbiological studies were negative, with the exception of finding cytomegalovirus (CMV). Seroconversion was documented; the virus was cultured from urine and subsequently was demonstrated to be present in the inflamed mucosa of the rectum and distal sigmoid, which was found at sigmoidoscopy. This woman was delivered of a neonate with congenital CMV infection but without apparent malformations. The patient experienced recurrences of the bowel disease, in the first of which CMV could still be cultured from a biopsy specimen. In the follow-up period, an otherwise aspecific chronic inflammatory bowel disease remained present. No immunological abnormalities were found, and antibodies to human immunodeficiency virus were negative. This case demonstrates that inflammatory bowel disease can develop as a result of primary infection with CMV. PMID:2166491

  11. Cytomegalovirus Survival on Common Environmental Surfaces: Opportunities for Viral Transmission

    PubMed Central

    Stowell, Jennifer D.; Forlin-Passoni, Daniela; Din, Erica; Radford, Kay; Brown, Denise; White, Audrey; Bate, Sheri L.; Dollard, Sheila C.; Bialek, Stephanie R.; Cannon, Michael J.


    Congenital cytomegalovirus (CMV) affects ∼1 of 150 births and is a leading cause of hearing loss and intellectual disability. It has been suggested that transmission may occur via contaminated surfaces. CMV AD169 in filtered human saliva, applied to environmental surfaces, was recovered at various time points. Samples were evaluated by culture and real-time polymerase chain reaction. CMV was found viable on metal and wood to 1 hour, glass and plastic to 3 hours, and rubber, cloth, and cracker to 6 hours. CMV was cultured from 83 of 90 wet and 5 of 40 dry surfaces. CMV was more likely to be isolated from wet, highly absorbent surfaces at earlier time points. PMID:22116837

  12. Cytomegalovirus and HIV: A Dangerous Pas de Deux.


    Gianella, Sara; Letendre, Scott


    Human immunodeficiency virus (HIV)-infected adults who take stable antiretroviral therapy (ART) are at risk for early onset of age-related diseases. This is likely due to a complex interaction between traditional risk factors, HIV infection itself, and other factors, such as underlying immune dysfunction and persistent inflammation. HIV disrupts the balance between the host and coinfecting microbes, worsening control of these potential pathogens. For example, HIV-infected adults are more likely than the general population to have subclinical bursts of cytomegalovirus (CMV) replication at mucosal sites. Production of antigens can activate the immune system and stimulate HIV replication, and it could contribute to the pathogenesis of adverse outcomes of aging, like cardiovascular disease and neurocognitive impairment. Further investigation of the relationships between CMV, immune dysfunction, and unsuccessful aging during chronic HIV infection is warranted. PMID:27625433

  13. Cytomegalovirus Retinitis after Intravitreal Bevacizumab Injection in an Immunocompetent Patient

    PubMed Central

    Bae, So Hyun; Kim, Tae Wan; Chung, Hum


    We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection. PMID:23372384

  14. Acquisition of cytomegalovirus infection: an update.

    PubMed Central

    Forbes, B A


    Human cytomegalovirus (CMV) is a ubiquitous deoxyribonucleic acid virus that commonly infects a majority of individuals at some time during their life. Although most of these CMV infections are asymptomatic, certain patient groups are at risk to develop serious illness. Understanding the epidemiology of this virus is a key element in the development of strategies for preventing CMV disease. However, a number of features of this virus complicate such understanding. Following infection, CMV can remain latent, with subsequent reactivation; the factors controlling latency and reactivation and those factors which determine whether a CMV infection will be symptomatic are unknown. CMV disease can be acquired by natural routes, including horizontal and vertical transmission. Due to the ubiquity of CMV, the delineation of CMV transmission by these natural routes is complicated by the myriad of possible sources. Moreover, concerns over the risk of CMV transmission to the seronegative pregnant female have been raised in relation to preventing CMV transmission. By using molecular biologic techniques, much knowledge has been gained regarding the transmission of CMV disease by natural routes; however, a number of questions remain unanswered. The transmission of CMV infection by natural routes is therefore reviewed and the issues are highlighted. Primary infection, reactivation, and reinfection are the types of active CMV infections that can occur in an immunocompromised patient. In addition to natural routes of infection, introduction of presumably latently infected organs and requirements for multiple blood transfusions increase potential exposure to CMV in the immunocompromised patient. Understanding the epidemiology of CMV infections in the immunocompromised patient is difficult and in some instances controversial due to the complexity and interdependency of a number of factors which lead to CMV infection. In an immunocompromised individual, a major risk factor in developing

  15. Toxoplasmosis, Parvovirus, and Cytomegalovirus in Pregnancy.


    Feldman, Deborah M; Keller, Rebecca; Borgida, Adam F


    There are several infections in adults that warrant special consideration in pregnant women given the potential fetal consequences. Among these are toxoplasmosis, parvovirus B19, and cytomegalovirus. These infections have an important impact on the developing fetus, depending on the timing of infection. This article reviews the modes of transmission as well as maternal and neonatal effects of each of these infections. In addition, the article outlines recommended testing, fetal surveillance, and treatment where indicated. PMID:27235921

  16. Cytomegalovirus Cutaneous Infection in an Immunocompromised Patient

    PubMed Central

    Pedersen, Faye T; Alhassan, Sulaiman; Adjapong, Opoku; Thirumala, Raghukumar


    Cytomegalovirus (CMV), a member of the Herpesviridae family, is an opportunistic infection with a typically benign course in the healthy host but has a more ominous course in the immunocompromised population. CMV infection commonly affects the visceral organs, particularly the respiratory and the gastrointestinal tract. CMV cutaneous lesions are rare and can be easily missed. We present a case of a 76-year-old woman presenting with a diffuse non-pruritic macular lesion with scattered vesicles and bullae, which was initially treated as a varicella zoster virus infection and herpes simplex viral infection, but was later found on biopsy to be due to cytomegalovirus. She has a history of Sjögren's syndrome, interstitial lung disease, and being on chronic immunosuppression therapy. This case highlights the importance of considering CMV infection in the differential diagnosis of vesicular skin lesions in immunocompromised patients. Based on a PubMed search for “cutaneous cytomegalovirus”, “cutaneous CMV”, “cytomegalovirus skin”, and “skin CMV” in material published in the last 20 years (from 1996 to 2016) and reviewing any applicable referenced material outside of those dates, cases of cutaneous CMV are not well documented. PMID:27335710

  17. Examining the Species-Specificity of Rhesus Macaque Cytomegalovirus (RhCMV) in Cynomolgus Macaques

    PubMed Central

    Perciani, Catia T.; Russell, Justen N. Hoffman; Chan, Jacqueline K.; Janes, Michelle; Antony, Joseph M.; Pilon, Richard; Sandstrom, Paul; Willer, David O.; MacDonald, Kelly S.


    Cytomegalovirus (CMV) is a highly species-specific virus that has co-evolved with its host over millions of years and thus restricting cross-species infection. To examine the extent to which host restriction may prevent cross-species research between closely related non-human primates, we evaluated experimental infection of cynomolgus macaques with a recombinant rhesus macaque-derived CMV (RhCMV-eGFP). Twelve cynomolgus macaques were randomly allocated to three groups: one experimental group (RhCMV-eGFP) and two control groups (UV-inactivated RhCMV-eGFP or media alone). The animals were given two subcutaneous inoculations at week 0 and week 8, and a subset of animals received an intravenous inoculation at week 23. No overt clinical or haematological changes were observed and PBMCs isolated from RhCMV-eGFP inoculated animals had comparable eGFP- and IE-1-specific cellular responses to the control animals. Following inoculation with RhCMV-eGFP, we were unable to detect evidence of infection in any blood or tissue samples up to 4 years post-inoculation, using sensitive viral co-culture, qPCR, and Western blot assays. Co-culture of urine and saliva samples demonstrated the presence of endogenous cynomolgus CMV (CyCMV) cytopathic effect, however no concomitant eGFP expression was observed. The absence of detectable RhCMV-eGFP suggests that the CyCMV-seropositive cynomolgus macaques were not productively infected with RhCMV-eGFP under these inoculation conditions. In a continued effort to develop CMV as a viral vector for an HIV/SIV vaccine, these studies demonstrate that CMV is highly restricted to its host species and can be highly affected by laboratory cell culture. Consideration of the differences between lab-adapted and primary viruses with respect to species range and cell tropism should be a priority in evaluating CMV as vaccine vector for HIV or other pathogens at the preclinical development stage. PMID:25822981

  18. Dataset of aqueous humor cytokine profile in HIV patients with Cytomegalovirus (CMV) retinitis.


    Iyer, Jayant Venkatramani; Agrawal, Rupesh; Yeo, Tun Kuan; Gunasekeran, Dinesh V; Balne, Praveen Kumar; Lee, Bernett; Au, Veonice Bijin; Connolly, John; Teoh, Stephen C B


    The data shows the aqueous humor cytokine profiling results acquired in a small cohort of 17 HIV patients clinically diagnosed with Cytomegalovirus retinitis using the FlexMAP 3D (Luminex®) platform using the Milliplex Human Cytokine® kit. Aqueous humor samples were collected from these patients at different time points (pre-treatment and at 4-weekly intervals through the 12-week course of intravitreal ganciclovir treatment) and 41 cytokine levels were analyzed at each time point. CMV DNA viral load was assessed in 8 patients at different time points throughout the course of ganciclovir treatment. The data described herein is related to the research article entitled "Aqueous humor immune factors and cytomegalovirus (CMV) levels in CMV retinitis through treatment - The CRIGSS study" (Iyer et al., 2016) [1]. Cytokine levels against the different time points which indicate the response to the given treatment and against the CMV viral load were analyzed. PMID:27547803

  19. Molecular cloning and physical mapping of murine cytomegalovirus DNA.

    PubMed Central

    Ebeling, A; Keil, G M; Knust, E; Koszinowski, U H


    Murine cytomegalovirus (MCMV) Smith strain DNA is cleaved by restriction endonuclease HindIII into 16 fragments, ranging in size from 0.64 to 22.25 megadaltons. Of the 16 HindIII fragments, 15 were cloned in plasmid pACYC177 in Escherichia coli HB101 (recA). The recombinant plasmid clones were characterized by cleavage with the enzymes XbaI and EcoRI. In addition, fragments generated by double digestion of cloned fragments with HindIII and XbaI were inserted into the plasmid vector pACYC184. The results obtained after hybridization of 32P-labeled cloned fragments to Southern blots of MCMV DNA cleaved with HindIII, XbaI, EcoRI, BamHI, ApaI, ClaI, EcoRV, or KpnI allowed us to construct complete physical maps of the viral DNA for the restriction endonucleases HindIII, XbaI, and EcoRI. On the basis of the cloning and mapping experiments, it was calculated that the MCMV genome spans about 235 kilobase pairs, corresponding to a molecular weight of 155,000,000. All fragments were found to be present in equimolar concentrations, and no cross-hybridization between any of the fragments was seen. We conclude that the MCMV DNA molecule consists of a long unique sequence without large terminal or internal repeat regions. Thus, the structural organization of the MCMV genome is fundamentally different from that of the human cytomegalovirus or herpes simplex virus genome. Images PMID:6312075

  20. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions.


    Walzer, Sascha A; Egerer-Sieber, Claudia; Sticht, Heinrich; Sevvana, Madhumati; Hohl, Katharina; Milbradt, Jens; Muller, Yves A; Marschall, Manfred


    Nuclear replication of cytomegalovirus relies on elaborate mechanisms of nucleocytoplasmic egress of viral particles. Thus, the role of two essential and conserved viral nuclear egress proteins, pUL50 and pUL53, is pivotal. pUL50 and pUL53 heterodimerize and form a core nuclear egress complex (NEC), which is anchored to the inner nuclear membrane and provides a scaffold for the assembly of a multimeric viral-cellular NEC. Here, we report the crystal structure of the pUL50-pUL53 heterodimer (amino acids 1-175 and 50-292, respectively) at 2.44 Å resolution. Both proteins adopt a globular fold with mixed α and β secondary structure elements. pUL53-specific features include a zinc-binding site and a hook-like N-terminal extension, the latter representing a hallmark element of the pUL50-pUL53 interaction. The hook-like extension (amino acids 59-87) embraces pUL50 and contributes 1510 Å(2) to the total interface area (1880 Å(2)). The pUL50 structure overall resembles the recently published NMR structure of the murine cytomegalovirus homolog pM50 but reveals a considerable repositioning of the very C-terminal α-helix of pUL50 upon pUL53 binding. pUL53 shows structural resemblance with the GHKL domain of bacterial sensory histidine kinases. A close examination of the crystal structure indicates partial assembly of pUL50-pUL53 heterodimers to hexameric ring-like structures possibly providing additional scaffolding opportunities for NEC. In combination, the structural information on pUL50-pUL53 considerably improves our understanding of the mechanism of HCMV nuclear egress. It may also accelerate the validation of the NEC as a unique target for developing a novel type of antiviral drug and improved options of broad-spectrum antiherpesviral therapy. PMID:26432641

  1. Analysis of the nucleotide sequence of the guinea pig cytomegalovirus (GPCMV) genome

    PubMed Central

    Schleiss, Mark R; McGregor, Alistair; Choi, K Yeon; Date, Shailesh V; Cui, Xiaohong; McVoy, Michael A


    In this report we describe the genomic sequence of guinea pig cytomegalovirus (GPCMV) assembled from a tissue culture-derived bacterial artificial chromosome clone, plasmid clones of viral restriction fragments, and direct PCR sequencing of viral DNA. The GPCMV genome is 232,678 bp, excluding the terminal repeats, and has a GC content of 55%. A total of 105 open reading frames (ORFs) of > 100 amino acids with sequence and/or positional homology to other CMV ORFs were annotated. Positional and sequence homologs of human cytomegalovirus open reading frames UL23 through UL122 were identified. Homology with other cytomegaloviruses was most prominent in the central ~60% of the genome, with divergence of sequence and lack of conserved homologs at the respective genomic termini. Of interest, the GPCMV genome was found in many cases to bear stronger phylogenetic similarity to primate CMVs than to rodent CMVs. The sequence of GPCMV should facilitate vaccine and pathogenesis studies in this model of congenital CMV infection. PMID:19014498

  2. Cytomegalovirus Retinitis and the Acquired Immune Deficiency Syndrome: Bench to Bedside: LXVII Edward Jackson Memorial Lecture

    PubMed Central

    Jabs, Douglas A.


    Purpose To update information on cytomegalovirus (CMV) retinitis in patients with the acquired immune deficiency syndrome (AIDS) and to integrate information on its pathogenesis and clinical outcomes. Design Literature review. Methods Selected articles from the medical literature, particularly large epidemiologic studies, including the Johns Hopkins Cytomegalovirus Retinitis Cohort Study, the Longitudinal Study of the Ocular Complications of AIDS, and the Cytomegalovirus Retinitis and Viral Resistance Study, were reviewed. Clinical information is discussed in light of knowledge on CMV, its pathogenesis, and its interactions with human immunodeficiency virus (HIV). Results Cytomegalovirus uses several mechanisms to evade the immune system and establish latent infection in immunologically normal hosts. With immune deficiency, such as late-stage AIDS, CMV reactivates, is disseminated to the eye, and establishes a productive infection, resulting in retinal necrosis. HIV and CMV potentiate each other: CMV accelerates HIV disease, and CMV retinitis is associated with increased mortality. Randomized clinical trials have demonstrated the efficacy of treatments for CMV retinitis. Systemically-administered treatment for CMV retinitis decreases AIDS mortality. Highly active antiretroviral therapy (HAART), effectively suppresses HIV replication, resulting in immune recovery, which, if sufficient, controls retinitis without anti-CMV therapy. Resistant CMV, detected in the blood, correlates with resistant virus in the eye and is associated with worse clinical outcomes, including mortality. Host factors, including host genetics and access to care, play a role in the development of CMV retinitis. Conclusions Clinical outcomes of CMV retinitis in patients with AIDS are dependent on characteristics of the virus and host and on HIV–CMV interactions. PMID:21168815

  3. Cytomegalovirus and glioma: putting the cart before the horse.


    Dey, Mahua; Ahmed, Atique U; Lesniak, Maciej S


    In 1908, Oluf Bang and Vilhelm Ellerman laid the foundation for theory of oncoviruses by demonstrating that the avian erythroblastosis (a form of chicken leukaemia) could be transmitted by cell-free extracts. Since then, it has been shown very convincingly that viruses can directly cause several human cancers by various mechanisms. Epidemiological data imply that viruses are the second most important risk factor for cancer development in humans, exceeded only by tobacco consumption. Although the ability of certain viruses (hepatitis B and C, human papillomavirus, etc) to cause cancer has been time tested and proven scientifically, there are several other potential viral candidates whose role in oncogenesis is more controversial. One such controversial scenario involves the role of cytomegalovirus (CMV) in malignant gliomas, the most common form of primary brain tumour. CMV first attracted attention about a decade ago when CMV gene products were found in glioma tissue but not in normal brain. Since this initial observation, several different groups have shown an oncomodulatory effect of CMV; however, direct association between CMV infection and incidence of glioma is lacking. In this review, we will evaluate the evidence, both preclinical and clinical, regarding the possible role of CMV in gliomagenesis and maintenance. We will also critically evaluate the rationale for using antiviral drugs in the treatment of patients with glioma. PMID:24906494

  4. Cytomegalovirus Colitis in a Burn Patient.


    Gibbs, Jeff T; Zieger, Madeline; Sood, Rajiv


    The prevalence of cytomegalovirus in the burn population is high. However, its role in the clinical management of burn patients is still being defined. This report documents a 41-year-old man who developed cytomegalovirus (CMV) colitis after being admitted with a 72% burn. Before the administration of ganciclovir, the authors had difficulty controlling his quantitative wound cultures with serial debridements, topical agents, and systemic antibiotics for known pathogens, which led to graft loss. After the ganciclovir was given, his quantitative wound cultures improved without changing the authors' topical agents or systemic antibiotics and had improved graft take. Whether CMV infection alone contributed to an increased morbidity in this patient or the combination of bacteria/fungal infection with CMV led to a synergistic effect is still not clearly understood. CMV may have contributed to a dysfunction in his cell mediated immunity, which, in turn, lowered the bacterial and fungal load necessary to cause graft loss. Patients who continue to do poorly despite adequate treatment for known pathogens may need to be screened for CMV and treated. PMID:26056763

  5. Progressive Hearing Impairment in Children with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others


    Audiological assessment of 86 children (mean age 38 months at last evaluation time) with congenital cytomegalovirus infection revealed progressive hearing loss in four of 12 Ss with sensorineural hearing impairments. Case descriptions documented the progression of the hearing loss. (Author)

  6. Late cytomegalovirus infection after hematopoietic stem cell transplantation: case reports

    PubMed Central

    Pinheiro, Sâmara Grapiuna; de Matos, Sócrates Bezerra; Botura, Mônica Borges; Meyer, Roberto; Lima, Fernanda Washington de Mendonça


    Cytomegalovirus is related to high rates of morbidity and mortality after hematopoietic stem cell transplantation. This report highlights the importance of adequate monitoring and management of this infection. We report on two cases of patients with late subclinical cytomegalovirus infection. These patients were monitored for antigenemia by indirect immunofluorescence assay. Active cytomegalovirus infection is most common in the first three months after transplantation however the cases reported herein show the importance of monitoring for active infection after Day +100 post-transplantation. Early detection of active infection enables quick preemptive therapy. In conclusion, we emphasize that patients with risk factors for developing severe or late cytomegalovirus disease should be monitored for more than 100 post-transplant days as late active infection is a reality. PMID:24478611

  7. Evaluation of a standardised real-time PCR based DNA-detection method (Realstar®) in whole blood for the diagnosis of primary human cytomegalovirus (CMV) infections in immunocompetent patients.


    Berth, M; Benoy, I; Christensen, N


    Cytomegalovirus (CMV) DNA detection in blood could, as a supplementary test to serology, improve the accuracy and speed of diagnosis of an acute CMV infection. In this study we evaluated the performance of a commercially available and standardised CMV PCR assay in whole blood for the diagnosis of a primary infection in immunocompetent adults. Moreover, the kinetics of viral DNA was evaluated in order to provide a time frame in which viral DNA could be detected during an acute primary infection. Whole blood samples were collected from 66 patients with an acute CMV infection, 65 patients with an acute Epstein-Barr virus infection, 27 patients with various other acute infections (parvovirus B19, HIV, Toxoplasma gondii), 20 patients with past CMV infections (>1 year) and 20 apparently healthy persons. For CMV DNA detection and quantification a commercially available real-time PCR was applied (RealStar®, altona Diagnostics). The clinical sensitivity of CMV PCR in whole blood for the diagnosis of a recent primary CMV infection was 93.9 % and the diagnostic specificity 99.2 %. In the majority of the patients CMV DNA was not detectable anymore approximately within 4 weeks after the first blood sample was taken. From these data we concluded that, together with a suggestive serological profile, a positive CMV PCR result in whole blood can be regarded as a diagnostic confirmation of a recent CMV infection on a single blood sample in an immunocompetent patient. However, a negative CMV PCR result does not exclude a recent CMV infection. PMID:26661089

  8. Antineurofilament and antiretinal antibodies in AIDS patients with cytomegalovirus retinitis.

    PubMed Central

    Rosberger, D F; Tshering, S L; Polsky, B; Heinemann, M H; Klein, R F; Cunningham-Rundles, S


    Sera obtained from AIDS patients with cytomegalovirus (CMV) retinitis before and after treatment with foscarnet, AIDS patients with human immunodeficiency virus (HIV) retinopathy, AIDS patients without retinal disease, and normal healthy controls with and without positive CMV serologies were assayed for the presence of antibodies against the 200-kDa outer, 160-kDa middle, and 68-kDa core subunits of the neurofilament triplet. Additional studies were performed to determine the presence of antibodies reactive with proteins extracted from crude human retinal antigen preparations. Antibodies against the 200-, 260-, and 68-kDa proteins of the neurofilament triplet were detected in 15 of 15 AIDS patients with CMV retinitis. The expression of these antibodies was unaffected, qualitatively, by successful treatment with foscarnet. In contrast, only 30% of patients with HIV retinopathy unrelated to CMV, fewer than 35% of AIDS patients with positive CMV titers but without evident retinitis, and fewer than 25% of healthy controls with positive or negative CMV titers possessed antibodies against any of the triplet proteins (P < 0.001). Antibodies against several clusters of retinal antigens were also identified in the sera of patients with CMV retinitis. In summary, the data indicate that retinal elements damaged by CMV infection induce an antibody response against the 200-, 160-, and 68kDa components of the neurofilament triplet as well as other, as yet undefined retinal antigens. Images PMID:8556483

  9. Knockout of the Host Resistance Gene Pkr Fully Restores Replication of Murine Cytomegalovirus m142 and m143 Mutants In Vivo

    PubMed Central

    Ostermann, Eleonore; Warnecke, Gabriele; Waibler, Zoe


    Murine cytomegalovirus (MCMV) proteins m142 and m143 are essential for viral replication. They bind double-stranded RNA and prevent protein kinase R-induced protein synthesis shutoff. Whether the two viral proteins have additional functions such as their homologs in human cytomegalovirus do remained unknown. We show that MCMV m142 and m143 knockout mutants attain organ titers equivalent to those attained by wild-type MCMV in Pkr knockout mice, suggesting that these viral proteins do not encode additional PKR-independent functions relevant for pathogenesis in vivo. PMID:26512090

  10. Cytomegalovirus myelitis in perinatally acquired HIV.

    PubMed Central

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W


    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, neurons, macrophages, ependymal, endothelial, and Schwann cells. Other organs had no signs of CMV infection. Central nervous spinal CMV infection was most probably due to insufficient penetration of the blood-brain barrier by the CMV hyper-immunoglobulin. In suspicious cases early spinal magnetic resonance imaging (1.5 tesla) combined with an examination of urine and cerebrospinal fluid for CMV is recommended. Images Figure 1 Figure 2 Figure 3 PMID:8385439

  11. Cytomegalovirus as an Insidious Pathogen Causing Duodenitis.


    Hagiya, Hideharu; Iwamuro, Masaya; Tanaka, Takehiro; Hanayama, Yoshihisa; Otsuka, Fumio


    A 60-year-old woman with rheumatoid arthritis treated with methotrexate for a decade complained of slight epigastric discomfort. A positive cytomegalovirus (CMV) antigenemia test indicated the probability of CMV-related gastrointestinal infection, for which esophagogastroduodenoscopy was performed. Endoscopic findings showed a non-specific duodenal mucosal lesion;however, pathological investigation revealed evidence of CMV duodenitis. There is scarce information on the clinical and pathological features of CMV-related duodenitis, likely due to its low prevalence. CMV infection in the upper gastrointestinal tract should be considered as a differential diagnosis in high-risk individuals, particularly those with symptoms relating to the digestive system. Biopsy examinations are preferable for the definitive diagnosis of CMV gastrointestinal infection, even without specific endoscopic features. PMID:26490030

  12. [Cytomegalovirus mononucleosis complicated with peripheral facial palsy].


    Hirano, Taichi; Tsuji, Takahiro; Yamasaki, Hiroshi; Tsuda, Hiroyuki


    A 36-year-old woman was admitted to our hospital for further examination of an acute febrile illness with liver dysfunction. A peripheral blood smear displayed atypical lymphocytes. Cytomegalovirus (CMV) mononucleosis was diagnosed based on the detection of CMV-specific IgM and conventional CMV pp65 antigen. The physical examination on admission revealed signs of lower motor neuron right facial palsy. There were no significant cerebrospinal fluid findings, nor were there other neurological abnormalities. After receiving a short-course of oral corticosteroids, the patient gradually recovered from the facial paralysis. A one-month follow-up examination indicated that she had fully recovered neurologically, showing disappearance of CMV-DNA and a significant increase in the anti-CMV IgG titer. To our knowledge, there has been only one previous report describing CMV as the cause of an isolated facial palsy combined with CMV mononucleosis. PMID:24681941

  13. Optimum treatment of congenital cytomegalovirus infection.


    Leruez-Ville, Marianne; Ville, Yves


    Congenital cytomegalovirus infection affects 0.7% of live births and is the leading cause of congenital neurological handicaps of infectious origin. However, systematic screening of this infection has not been implemented in pregnancy or at birth in any country. This apparent paradox has been justified by the unavailability of an efficient vaccine and by the scarcity of data available on the treatment of congenital CMV. However, in the last decade interesting new data on the management of this congenital infection has emerged including new results on both neonatal and postnatal treatments. This review provides an update on the potential benefits of antiviral treatment and on passive immunisation both in the neonatal and the antenatal periods. These suggest a benefit to a proactive approach for neonatal and prenatal congenital infections. PMID:27043943

  14. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant


    ... Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a ... weakened by medicines that you must take after stem cell transplant and by the transplant itself. Your body ...

  15. Preliminary Evaluation of the Safety and Efficacy of Standard Intravenous Immunoglobulins in Pregnant Women with Primary Cytomegalovirus Infection

    PubMed Central

    Polilli, Ennio; D'Arcangelo, Francesca; Tracanna, Elisa; Clerico, Luigi; Savini, Vincenzo; D'Antonio, Francesco; Rosati, Maurizio; Manzoli, Lamberto; D'Antonio, Domenico; Nigro, Giovanni


    Hyperimmune globulins were reported to prevent and treat fetal cytomegalovirus (CMV) infection during pregnancy. Here, we report that infusions of standard human intravenous immunoglobulin significantly increase CMV IgG titers and avidity indexes in pregnant women, paving the way to their use for passive transfer of maternal CMV humoral immunity to fetuses. Preliminary data on perinatal outcomes of the first 67 newborns are encouraging. PMID:23100477

  16. Cutaneous cytomegalovirus infection on multi dermatomal herpes zoster scars: an isotopic immune response.


    Katibi, O S; Dlova, N C; Mosam, A


    As more patients with human immunodeficiency virus (HIV) are surviving, despite severe immune suppression, clinicians are faced with atypical manifestations of both common and uncommon dermatoses. A 30-year-old black South African woman presented with a 10-month history of multiple chronic ulcers appearing on a multidermatomal herpes zoster (HZ) scar. The woman was infected with HIV, and her CD4 count was 45 cells/μL. Histology and PCR revealed cytomegalovirus (CMV) infection. This case highlights an unusual presentation of cutaneous CMV occurring as an isotopic immune response on a pre-existing multidermatomal HZ scar. PMID:25266481

  17. Lack of XBP-1 Impedes Murine Cytomegalovirus Gene Expression

    PubMed Central

    Drori, Adi; Messerle, Martin; Brune, Wolfram; Tirosh, Boaz


    The unfolded protein response (UPR) is an endoplasmic reticulum (ER)-to-nucleus signaling cascade induced in response to ER stress. The UPR aims at restoring homeostasis, but can also induce apoptosis if stress persists. Infection by human and murine cytomegaloviruses (CMVs) provokes ER stress and induces the UPR. However, both CMVs manipulate the UPR to promote its prosurvival activity and delay apoptosis. The underlying mechanisms remain largely unknown. Recently, we demonstrated that MCMV and HCMV encode a late protein to target IRE1 for degradation. However, the importance of its downstream effector, X Box binding protein 1 (XBP-1), has not been directly studied. Here we show that deletion of XBP-1 prior to or early after infection confers a transient delay in viral propagation in fibroblasts that can be overcome by increasing the viral dose. A similar phenotype was demonstrated in peritoneal macrophages. In vivo, acute infection by MCMV is reduced in the absence of XBP-1. Our data indicate that removal of XBP-1 confers a kinetic delay in early stages of MCMV infection and suggest that the late targeting of IRE1 is aimed at inhibiting activities other than the splicing of XBP-1 mRNA. PMID:25333725

  18. Antiviral Drug- and Multidrug Resistance in Cytomegalovirus Infected SCT Patients

    PubMed Central

    Göhring, Katharina; Hamprecht, Klaus; Jahn, Gerhard


    In pediatric and adult patients after stem cell transplantation (SCT) disseminated infections caused by human cytomegalovirus (HCMV) can cause life threatening diseases. For treatment, the three antivirals ganciclovir (GCV), foscarnet (PFA) and cidofovir (CDV) are approved and most frequently used. Resistance to all of these antiviral drugs may induce a severe problem in this patient cohort. Responsible for resistance phenomena are mutations in the HCMV phosphotransferase-gene (UL97) and the polymerase-gene (UL54). Most frequently mutations in the UL97-gene are associated with resistance to GCV. Resistance against all three drugs is associated to mutations in the UL54-gene. Monitoring of drug resistance by genotyping is mostly done by PCR-based Sanger sequencing. For phenotyping with cell culture the isolation of HCMV is a prerequisite. The development of multidrug resistance with mutation in both genes is rare, but it is often associated with a fatal outcome. The manifestation of multidrug resistance is mostly associated with combined UL97/UL54-mutations. Normally, mutations in the UL97 gene occur initially followed by UL54 mutation after therapy switch. The appearance of UL54-mutation alone without any detection of UL97-mutation is rare. Interestingly, in a number of patients the UL97 mutation could be detected in specific compartments exclusively and not in blood. PMID:25750703

  19. Design of cocktail peptide vaccine against Cytomegalovirus infection

    PubMed Central

    Tabaei, Samira; Mashkani, Baratali; Esmaili, Arezoo; Karimi, Reza; Jamehdar, Saeid Amel


    Objective(s): Human Cytomegalovirus (HCMV) remains a major morbidity and mortality cause in immuno suppressed patients. Therefore, significant effort has been made towards the development of a vaccine. In this study, the expression of the pp65 and gB fusion peptides and Fc domain of mouse IgG2a as a novel delivery system for selective uptake of antigens by antigen-presenting cells (APCs) in Pichia pastoris yeast system were studied. Materials and Method: In this study, four immune dominant sequences in pp65 protein and 3 immuno dominant sequences in gB protein were selected according to literature review. Peptide linker -GGGGS- was used for construction of fusion peptide. This fusion peptide was cloned in the pPICZαA expression vector and transfected into P. pastoris host cells. Results: Dot blot and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) techniques showed that a high level of pp65-gB-Fc fusion peptide was expressed. Conclusion: This CMV pp65-gB-Fc fusion peptide could be a promising candidate for the development of a novel peptide vaccine. PMID:27279990

  20. Expression of cytomegalovirus in glioblastoma multiforme: Myth or reality?


    Taha, Mahmoud S; Abdalhamid, Baha A; El-Badawy, Samy A; Sorour, Yasser M; Almsned, Fahad M; Al-Abbadi, Mousa A


    A role for human cytomegalovirus (HCMV) in the pathogenesis of glioblastoma multiforme (GBM) was proposed more than a decade ago and has since generated a considerable debate as a possible therapeutic target. We investigate the presence of HCMV in the specimens of patients with GBM treated in our centre. This is a retrospective cohort study to investigate the presence of HCMV by routine immunohistochemical stains and polymerase chain reaction (PCR)-based molecular analysis on formalin-fixed-paraffin-embedded tissue of all patients with GBM treated in our hospital in 2009-2013 (5 years). The evaluation of positivity by immunohistochemistry (IHC) was semi-quantitative. The molecular analysis was performed by extracting the tumour DNA from representative paraffin-embedded tissue blocks and amplified for detection by a sensitive real time PCR (RT-PCR) CMV assay. During the study period, we treated 45 patients with GBM; however, adequate pathology tissue materials were available only for 32 patients. All the pathology material was reviewed and the diagnosis was confirmed. All the cases were found to be negative for CMV expression by our IHC and RT-PCR CMV assay. Our study has shown no expression of CMV in GBM. Our results were similar to other recent reports that concluded insufficient evidence to recommend routine testing for CMV in GBM or treatment as an add-on therapy. PMID:26742571

  1. A young patient with multisystem complications after cytomegalovirus infection.


    Pulivarthi, Swaroopa; Gurram, Murali Krishna


    We are describing a case of an 18-year-old male patient with cytomegalovirus (CMV) associated guillain-barre syndrome (GBS) who presented with an acute onset of generalized weakness and numbness in the extremities, dysphagia, and facial diplegia, followed by respiratory failure, which led to mechanical ventilation. He had positive immunoglobulin G and immunoglobulin M antibodies against CMV, and CMV polymerase chain reaction was positive with <2000 copies of deoxyribonucleic acid. Human immunodeficiency virus test was negative. He received a course of ganciclovir, intravenous immunoglobulin, and plasmapheresis. After improving from acute episode, patient was transferred to a rehabilitation facility for physical and occupational therapy. At the rehabilitation facility, he exhibited signs of acute abdomen with pain in the left upper quadrant secondary to peritonitis from dislodged gastrostomy tube and underwent exploratory laparotomy. During the hospital course he was found to have splenic infarct and colitis on the computed tomography of abdomen. This case showed an immunocompetent young patient with multisystem complications including guillain-barre syndrome (GBS), splenic infarct, hepatitis, and colitis due to CMV. PMID:24741254

  2. Fulminant Cytomegalovirus Myocarditis in an Immunocompetent Host: Resolution with Oral Valganciclovir

    PubMed Central

    Kumar, Anupam; Padala, Sandeep


    We report a case of fulminant myocarditis after a primary cytomegalovirus infection, in a previously healthy 72-year-old woman. The infection underwent clinical and immunologic resolution consequent to treatment with oral valganciclovir. In an immunocompetent host, the primary cytomegalovirus infection is usually asymptomatic or manifests itself as a heterophile-negative mononucleosis-like syndrome. Cytomegalovirus myocarditis is uncommon in immunocompetent patients. After presenting our case, we review the literature on cytomegalovirus myocarditis in immunocompetent individuals. PMID:25425988

  3. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4(+) and CD8(+) T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.


    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele


    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+) ) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy. J. Med. Virol. 88:1238-1246, 2016. © 2015 Wiley Periodicals, Inc. PMID:26680747

  4. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.


    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano


    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  5. Cytomegalovirus and glioblastoma; controversies and opportunities.


    Lawler, Sean E


    One of the more polarized ongoing debates in the brain tumor field over recent years has centered on the association of cytomegalovirus (CMV) with glioblastoma. Several laboratories have reported the presence of CMV antigens in glioblastoma patient specimens, whereas others have failed to detect them. CMV genomic DNA and mRNAs have been detected by PCR, but not in next-generation sequencing studies. CMV promotes high grade glioma progression in a mouse genetic model, and many CMV proteins promote cancer hallmarks in vitro, but actively replicating virus has not been isolated from tumor samples. A consensus is gradually emerging in which the presence of CMV antigens in glioblastoma is increasingly accepted. However, it remains challenging to understand this mechanistically due to the low levels of CMV nucleic acids and the absence of viral replication observed in tumors thus far. Nonetheless, these observations have inspired the development of novel therapeutic approaches based on anti-viral drugs and immunotherapy. The potential benefit of valganciclovir in glioblastoma has generated great interest, but efficacy remains to be established in a randomized trial. Also, early stage immunotherapy trials targeting CMV have shown promise. In the near future we will know more answers to these questions, and although areas of controversy may remain, and the mechanisms and roles of CMV in tumor growth are yet to be clearly defined, this widespread virus may have created important new therapeutic concepts and opportunities for the treatment of glioblastoma. PMID:25682092

  6. Cytomegalovirus vaccine: phase II clinical trial results.


    Rieder, F; Steininger, C


    Cytomegalovirus (CMV) is one of the most significant viral pathogens during pregnancy and in immunocompromised patients. Antiviral prophylactic strategies are limited by toxicities, drug-drug interactions and development of antiviral resistance. A safe and protective vaccine against CMV is highly desirable in view of the potential positive impact on CMV-associated morbidity and mortality as well as healthcare costs. Unfortunately, this demand could not be met in the past four decades although development of a CMV vaccine has been ranked at the highest priority by the US Institute of Medicine. Multiple different vaccine candidates have been developed and evaluated in phase I clinical trials and few succeeded to phase II trials. Nevertheless, two different vaccines showed recently promising results in trials that studied healthy adults and immunocompromised solid-organ and bone-marrow transplant recipients, respectively. The gB/MF59 vaccine exhibited a vaccine efficacy of 50% in healthy, postpartum females. In transplant patients, gB/MF59 and the DNA vaccine TransVax both limited the periods of viraemia and consequently the need for antiviral treatment. The success of these trials is encouraging and will probably give new impetus to the development of an effective CMV vaccine. Sterilizing immunity may not be attainable in the near future and may not be necessary for a CMV vaccine to have a significant impact on health care as discussed in the present review. PMID:24283990

  7. Cytomegalovirus Infection After Intestinal Transplantation in Children

    PubMed Central

    Bueno, Javier; Green, Michael; Kocoshis, Samuel; Furukawa, Hiroyuki; Ahu-Elmagd, Kareem; Yunis, Eduardo; Irish, William; Todo, Satoru; Reyes, Jorge; Starzl, Thomas E.


    Sixteen episodes of cytomegalovirus (CMV) disease occurred in 10 of 41 children undergoing intestinal transplantation from 1990 to 1995. Stratification of CMV disease by donor (D)/recipient (R) serological status was as follows: 3 of 8, D+/R−; 3 of 9, D+/R+; 4 of 9, D−/R+; and 0 of 15, D−/R−. Treatment resulted in resolution of CMV disease in 93.3% of episodes. No deaths attributable to CMV disease occurred in this series. CMV in D+/R− children resulted in more extensive and persistent disease. However, patient and graft survival rates were similar in the different D/R subgroups and between children with and without CMV disease. Cumulative dose of steroid boluses (relative risk [RR]. 1.59; 95% confidence interval [CI]. 1.14–2.21) and history of steroid recycles (RR, 2.72; 95% CI, 1.21–6.13) were associated with CMV disease. These results suggest that although CMV-associated morbidity in pediatric intestinal transplant recipients was substantial, it was not associated with an increased rate of mortality or graft loss, even among high-risk D+/R− patients. PMID:9402361

  8. Cytomegalovirus pneumonia in transplant patients: CT findings

    SciTech Connect

    Eun-Young Kang; Patz, E.F. Jr.; Mueller, N.L.


    Our goal was to assess the CT findings of cytomegalovirus (CMV) pneumonia in transplant patients. The study included 10 transplant patients who had chest CT scan and pathologically proven isolated pulmonary CMV infection. Five patients had bone marrow transplant and five had solid organ transplant. The CT scans were retrospectively reviewed for pattern and distribution of disease and the CT findings compared with the findings on open lung biopsy (n = 9) and autopsy (n = 1). Nine of 10 patients had parenchymal abnormalities apparent at CT and I had normal CT scans. The findings in the nine patients included small nodules (n = 6), consolidation (n = 4), ground-glass attenuation (n = 4), and irregular lines (n = 1). The nodules had a bilateral and symmetric distribution and involved all lung zones. The consolidation was most marked in the lower lung zones. The CT findings of CMV pneumonia in transplant patients are heterogeneous. The most common patterns include small nodules and areas of consolidation. 13 refs., 4 figs., 1 tab.

  9. Renal deposition of cytomegalovirus antigen in immunoglobulin-A nephropathy.


    Gregory, M C; Hammond, M E; Brewer, E D

    Renal biopsy specimens from patients with various glomerular disorders were examined by indirect immunofluorescence microscopy with three different heterologous antibodies directed against cytomegalovirus and two heterologous antibodies against herpes simplex virus (HSV) type 1. All 31 samples from patients with immunoglobulin-A (IgA) nephropathy, 1 of 12 with systemic lupus erythematosus (SLE), and 1 of 5 with Henoch-Schönlein purpura (HSP) showed mesangial staining with cytomegalovirus antiserum, whereas no sample from 37 patients with other forms of glomerulonephritis was positive. Antigens of herpes simplex virus I were demonstrated in samples from 4 of 31 patients with IgA nephropathy, 1 of 12 patients with SLE, 1 of 5 patients with HSP, and 1 of 37 patients with other glomerular diseases. The consistent finding of glomerular cytomegalovirus antigen in IgA nephropathy suggests but does not prove that the virus has a role in the aetiology of this disorder. PMID:2891887

  10. Role of Murine Cytomegalovirus US22 Gene Family Members in Replication in Macrophages

    PubMed Central

    Ménard, Carine; Wagner, Markus; Ruzsics, Zsolt; Holak, Karina; Brune, Wolfram; Campbell, Ann E.; Koszinowski, Ulrich H.


    The large cytomegalovirus (CMV) US22 gene family, found in all betaherpesviruses, comprises 12 members in both human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV). Conserved sequence motifs suggested a common ancestry and related functions for these gene products. Two members of this family, m140 and m141, were recently shown to affect MCMV replication on macrophages. To test the role of all US22 members in cell tropism, we analyzed the growth properties in different cell types of MCMV mutants carrying transposon insertions in all 12 US22 gene family members. When necessary, additional targeted mutants with gene deletions, ATG deletions, and ectopic gene revertants were constructed. Mutants with disruption of genes M23, M24, m25.1, m25.2, and m128 (ie2) showed no obvious growth phenotype, whereas growth of M43 mutants was reduced in a number of cell lines. Genes m142 and m143 were shown to be essential for virus replication. Growth of mutants with insertions into genes M36, m139, m140, and m141 in macrophages was severely affected. The common phenotype of the m139, m140, and m141 mutants was explained by an interaction at the protein level. The M36-dependent macrophage growth phenotype could be explained by the antiapoptotic function of the gene that was required for growth on macrophages but not for growth on other cell types. Together, the comprehensive set of mutants of the US22 gene family suggests that individual family members have diverged through evolution to serve a variety of functions for the virus. PMID:12719548

  11. Peroxisomes are platforms for cytomegalovirus' evasion from the cellular immune response.


    Magalhães, Ana Cristina; Ferreira, Ana Rita; Gomes, Sílvia; Vieira, Marta; Gouveia, Ana; Valença, Isabel; Islinger, Markus; Nascimento, Rute; Schrader, Michael; Kagan, Jonathan C; Ribeiro, Daniela


    The human cytomegalovirus developed distinct evasion mechanisms from the cellular antiviral response involving vMIA, a virally-encoded protein that is not only able to prevent cellular apoptosis but also to inhibit signalling downstream from mitochondrial MAVS. vMIA has been shown to localize at mitochondria and to trigger their fragmentation, a phenomenon proven to be essential for the signalling inhibition. Here, we demonstrate that vMIA is also localized at peroxisomes, induces their fragmentation and inhibits the peroxisomal-dependent antiviral signalling pathway. Importantly, we demonstrate that peroxisomal fragmentation is not essential for vMIA to specifically inhibit signalling downstream the peroxisomal MAVS. We also show that vMIA interacts with the cytoplasmic chaperone Pex19, suggesting that the virus has developed a strategy to highjack the peroxisomal membrane proteins' transport machinery. Furthermore, we show that vMIA is able to specifically interact with the peroxisomal MAVS. Our results demonstrate that peroxisomes constitute a platform for evasion of the cellular antiviral response and that the human cytomegalovirus has developed a mechanism by which it is able to specifically evade the peroxisomal MAVS-dependent antiviral signalling. PMID:27181750

  12. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.


    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus


    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  13. Cytomegalovirus infection in pregnancy: review of the literature

    PubMed Central

    Bonalumi, Silvia; Trapanese, Angelica; Santamaria, Angelo; D’Emidio, Laura; Mobili, Luisa


    The aim of this review is to summarize the principles of cytomegalovirus (CMV) infection in pregnancy. In particular, the aim of this review is to evaluate: Incidence and mother-to-child transmissionThe value of screening of pregnant womenDiagnosis of CMV maternal infectionDiagnosis of fetal infection (evaluate the value of ultrasound examination and amniocentesis and evaluate whether the amniotic viral load of mothers with primary cytomegalovirus infection correlate with fetal or neonatal outcomes)Diagnosis of infection in newbornsTherapy in pregnancy, postnatal therapy and prevention PMID:22439067

  14. Ileal perforation caused by cytomegalovirus infection in an immunocompetent adult.


    Van Schaeybroeck, S; Hiele, M; Miserez, M; Croes, R


    A 71-year-old woman developed a small bowel perforation due to cytomegalovirus infection. She did not taken any immunosuppressive medication and her cellular immunity was normal. Surgical resection and antiviral therapy with ganciclovir led to complete recovery. As far as we know, this paper reports the first case of small bowel perforation due to cytomegalovirus infection in a non-immunocompromised patient. Nevertheless the patient was known with diabetes mellitus. It should be emphasised that elderly patients have impaired immune defences and may be unsuspected hosts of opportunistic infections. PMID:12212357

  15. Cytomegalovirus reactivation in critically ill immunocompetent hosts: A decade of progress and remaining challenges

    PubMed Central

    Cook, Charles H.; Trgovcich, Joanne


    Human cytomegalovirus (HCMV) is an undisputed pathogen in humans with severe immunocompromise that has historically been thought to carry little consequence in immunecompetent hosts. During the past decade, however, accumulating data suggest that significant numbers of immunocompetent humans reactivate HCMV during critical illness, and that these reactivation episodes are associated with worsened outcomes. Because most people are infected with this ubiquitous virus by adulthood, confirming pathogenicity has now become a clinical priority. In this article, we will review the incidence and implications of reactivation, the relevant immune responses and reactivation triggers relevant to the immunocompetent host. We will summarize the progress made during the past ten years, outline work ongoing in this field, and identify the major gaps remaining in our emerging understanding of this phenomenon. PMID:21439328

  16. Cytomegalovirus Infection Drives Adaptive Epigenetic Diversification of NK Cells with Altered Signaling and Effector Function

    PubMed Central

    Schlums, Heinrich; Cichocki, Frank; Tesi, Bianca; Theorell, Jakob; Beziat, Vivien; Holmes, Tim D.; Han, Hongya; Chiang, Samuel C.C.; Foley, Bree; Mattsson, Kristin; Larsson, Stella; Schaffer, Marie; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Miller, Jeffrey S.; Bryceson, Yenan T.


    SUMMARY The mechanisms underlying human natural killer (NK) cell phenotypic and functional heterogeneity are unknown. Here, we describe the emergence of diverse subsets of human NK cells selectively lacking expression of signaling proteins after human cytomegalovirus (HCMV) infection. The absence of B and myeloid cell-related signaling protein expression in these NK cell subsets correlated with promoter DNA hyperme-thylation. Genome-wide DNA methylation patterns were strikingly similar between HCMV-associated adaptive NK cells and cytotoxic effector T cells but differed from those of canonical NK cells. Functional interrogation demonstrated altered cytokine responsiveness in adaptive NK cells that was linked to reduced expression of the transcription factor PLZF. Furthermore, subsets of adaptive NK cells demonstrated significantly reduced functional responses to activated autologous T cells. The present results uncover a spectrum of epigenetically unique adaptive NK cell subsets that diversify in response to viral infection and have distinct functional capabilities compared to canonical NK cell subsets. PMID:25786176

  17. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    PubMed Central

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus


    The most abundantly produced virion protein in human cytomegalovirus (HCMV) is the immunodominant phosphoprotein 65 (pp65), which is frequently included in CMV vaccines. Although it is nonessential for in vitro CMV growth, pp65 displays immunomodulatory functions that support a potential role in primary and/or persistent infection. To determine the contribution of pp65 to CMV infection and immunity, we generated a rhesus CMV lacking both pp65 orthologs (RhCMVΔpp65ab). While deletion of pp65ab slightly reduced growth in vitro and increased defective particle formation, the protein composition of secreted virions was largely unchanged. Interestingly, pp65 was not required for primary and persistent infection in animals. Immune responses induced by RhCMVΔpp65ab did not prevent reinfection with rhesus CMV; however, reinfection with RhCMVΔUS2-11, which lacks viral-encoded MHC-I antigen presentation inhibitors, was prevented. Unexpectedly, induction of pp65b-specific T cells alone did not protect against RhCMVΔUS2-11 challenge, suggesting that T cells targeting multiple CMV antigens are required for protection. However, pp65-specific immunity was crucial for controlling viral dissemination during primary infection, as indicated by the marked increase of RhCMVΔpp65ab genome copies in CMV-naive, but not CMV-immune, animals. Our data provide rationale for inclusion of pp65 into CMV vaccines but also demonstrate that pp65-induced T cell responses alone do not recapitulate the protective effect of natural infection. PMID:24691437

  18. Anti-Cytomegalovirus Activity of the Anthraquinone Atanyl Blue PRL

    PubMed Central

    Alam, Zohaib; Al-Mahdi, Zainab; Zhu, Yali; McKee, Zachary; Parris, Deborah S.; Parikh, Hardik I.; Kellogg, Glen E.; Kuchta, Alison; McVoy, Michael A.


    Human cytomegalovirus (CMV) causes significant disease in immunocompromised patients and serious birth defects if acquired in utero. Available CMV antivirals target the viral DNA polymerase, have significant toxicities, and suffer from resistance. New drugs targeting different pathways would be beneficial. The anthraquinone emodin is proposed to inhibit herpes simplex virus by blocking the viral nuclease. Emodin and related anthraquinones are also reported to inhibit CMV. In the present study, emodin reduced CMV infectious yield with an EC50 of 4.9 μM but was cytotoxic at concentrations only two-fold higher. Related anthraquinones acid blue 40 and alizarin violet R inhibited CMV at only high concentrations (238–265 μM) that were also cytotoxic. However, atanyl blue PRL inhibited infectious yield of CMV with an EC50 of 6.3 μM, significantly below its 50% cytotoxic concentration of 216 μM. Atanyl blue PRL reduced CMV infectivity and inhibited spread. When added up to one h after infection, it dramatically reduced CMV immediate early protein expression and blocked viral DNA synthesis. However, it had no antiviral activity when added 24 h after infection. Interestingly, atanyl blue PRL inhibited nuclease activities of purified CMV UL98 protein with IC50 of 4.5 and 9.3 μM. These results indicate that atanyl blue PRL targets very early post-entry events in CMV replication and suggest it may act through inhibition of UL98, making it a novel CMV inhibitor. This compound may provide valuable insights into molecular events that occur at the earliest times post-infection and serve as a lead structure for antiviral development. PMID:25499125

  19. Cytomegalovirus seropositivity is associated with herpes zoster.


    Ogunjimi, Benson; Hens, Niel; Pebody, Richard; Jansens, Hilde; Seale, Holly; Quinlivan, Mark; Theeten, Heidi; Goossens, Herman; Breuer, Judy; Beutels, Philippe


    Herpes zoster (HZ) is caused by VZV reactivation that is facilitated by a declined immunity against varicella-zoster virus (VZV), but also occurs in immunocompetent individuals. Cytomegalovirus (CMV) infection is associated with immunosenescence meaning that VZV-specific T-cells could be less responsive. This study aimed to determine whether CMV infection could be a risk factor for the development of HZ. CMV IgG serostatus was determined in stored serum samples from previously prospectively recruited ambulatory adult HZ patients in the UK (N = 223) in order to compare the results with those from UK population samples (N = 1545) by means of a logistic regression (controlling for age and gender). Furthermore, we compared the UK population CMV seroprevalence with those from population samples from other countries (from Belgium (N1 = 1741, N2 = 576), USA (N = 5572) and Australia (N = 2080)). Furthermore, CMV IgG titers could be compared between UK HZ patients and Belgium N2 population samples because the same experimental set-up for analysis was used. We found UK ambulatory HZ patients to have a higher CMV seroprevalence than UK population samples (OR 1.56 [1.11 2.19]). CMV IgG seropositivity was a significant risk factor for HZ in the UK (OR 3.06 [1.32 7.04]. Furthermore, high CMV IgG titers (exceeding the upper threshold) were less abundant in CMV-seropositive Belgian N2 population samples than in CMV-seropositive UK HZ patients (OR 0.51 [0.31 0.82]. We found CMV-seroprevalence to increase faster with age in the UK than in other countries (P < 0.05). We conclude that CMV IgG seropositivity is associated with HZ. This finding could add to the growing list of risk factors for HZ. PMID:25905443

  20. Cytomegalovirus seropositivity is associated with herpes zoster

    PubMed Central

    Ogunjimi, Benson; Hens, Niel; Pebody, Richard; Jansens, Hilde; Seale, Holly; Quinlivan, Mark; Theeten, Heidi; Goossens, Herman; Breuer, Judy; Beutels, Philippe


    Herpes zoster (HZ) is caused by VZV reactivation that is facilitated by a declined immunity against varicella-zoster virus (VZV), but also occurs in immunocompetent individuals. Cytomegalovirus (CMV) infection is associated with immunosenescence meaning that VZV-specific T-cells could be less responsive. This study aimed to determine whether CMV infection could be a risk factor for the development of HZ. CMV IgG serostatus was determined in stored serum samples from previously prospectively recruited ambulatory adult HZ patients in the UK (N = 223) in order to compare the results with those from UK population samples (N = 1545) by means of a logistic regression (controlling for age and gender). Furthermore, we compared the UK population CMV seroprevalence with those from population samples from other countries (from Belgium (N1 = 1741, N2 = 576), USA (N = 5572) and Australia (N = 2080)). Furthermore, CMV IgG titers could be compared between UK HZ patients and Belgium N2 population samples because the same experimental set-up for analysis was used. We found UK ambulatory HZ patients to have a higher CMV seroprevalence than UK population samples (OR 1.56 [1.11 2.19]). CMV IgG seropositivity was a significant risk factor for HZ in the UK (OR 3.06 [1.32 7.04]. Furthermore, high CMV IgG titers (exceeding the upper threshold) were less abundant in CMV-seropositive Belgian N2 population samples than in CMV-seropositive UK HZ patients (OR 0.51 [0.31 0.82]. We found CMV-seroprevalence to increase faster with age in the UK than in other countries (P < 0.05). We conclude that CMV IgG seropositivity is associated with HZ. This finding could add to the growing list of risk factors for HZ. PMID:25905443

  1. A cyclooxygenase-2 homologue encoded by rhesus cytomegalovirus is a determinant for endothelial cell tropism.


    Rue, Cary A; Jarvis, Michael A; Knoche, Amber J; Meyers, Heather L; DeFilippis, Victor R; Hansen, Scott G; Wagner, Markus; Früh, Klaus; Anders, David G; Wong, Scott W; Barry, Peter A; Nelson, Jay A


    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  2. A Cyclooxygenase-2 Homologue Encoded by Rhesus Cytomegalovirus Is a Determinant for Endothelial Cell Tropism

    PubMed Central

    Rue, Cary A.; Jarvis, Michael A.; Knoche, Amber J.; Meyers, Heather L.; DeFilippis, Victor R.; Hansen, Scott G.; Wagner, Markus; Früh, Klaus; Anders, David G.; Wong, Scott W.; Barry, Peter A.; Nelson, Jay A.


    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  3. Autism in a Child with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Markowitz, Phillip I.


    A case study is described in which early infantile autism was diagnosed in a child with congenital cytomegalovirus (CMU) infection. It is suggested that congenital infection should be considered as an etiological agent in autism. The case's synergistic effect of CMU-induced brain damage, deafness, and maternal deprivation in noted. (CL)

  4. Infantile Spasms and Cytomegalovirus Infection: Antiviral and Antiepileptic Treatment

    ERIC Educational Resources Information Center

    Dunin-Wasowicz, Dorota; Kasprzyk-Obara, Jolanta; Jurkiewicz, Elzbieta; Kapusta, Monika; Milewska-Bobula, Bogumila


    From 1 January 1995 to 31 December 2004, 22 patients (13 males, nine females; age range 2-12mo) with infantile spasms and cytomegalovirus (CMV) infection were treated with intravenous ganciclovir (GCV) and antiepileptic drugs. GCV was given for 3 to 12 weeks with a 1-month interval (one, two, or three courses). Epileptic spasms occurred before…

  5. Brief Report: Autistic Disorder in Three Children with Cytomegalovirus Infection

    ERIC Educational Resources Information Center

    Sweeten, Thayne L.; Posey, David J.; McDougle, Christopher J.


    Previous research has identified a relationship between autistic disorder (autism) and specific congenital infections. Three cases of congenital or perinatal cytomegalovirus (CMV) infection occurring in association with autism are described. Hypothetical mechanisms relating congenital infection, such as CMV, to the development of autism are…

  6. Cytomegalovirus Meningitis in an Infant with Severe Combined Immunodeficiency.


    Vicetti Miguel, Claudia P; Mejias, Asuncion; Ramilo, Octavio; Ardura, Monica I; Sánchez, Pablo J


    A 35-day-old female with severe combined immunodeficiency developed cytomegalovirus (CMV) meningitis before undergoing hematopoietic stem cell transplantation. Strategies for timely diagnosis of neonates with congenital or acquired CMV infection and prevention of CMV acquisition in the era of universal newborn severe combined immunodeficiency screening are needed. PMID:26996725

  7. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P


    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  8. Prevention of Primary Cytomegalovirus Infection in Pregnancy☆

    PubMed Central

    Revello, Maria Grazia; Tibaldi, Cecilia; Masuelli, Giulia; Frisina, Valentina; Sacchi, Alessandra; Furione, Milena; Arossa, Alessia; Spinillo, Arsenio; Klersy, Catherine; Ceccarelli, Manuela; Gerna, Giuseppe; Todros, Tullia


    Background Cytomegalovirus (CMV) is the leading infectious agent causing congenital sensorineural hearing loss and psychomotor retardation. CMV vaccine is currently unavailable and treatment options in pregnancy are limited. Susceptible pregnant women caring for children are at high risk for primary infection. CMV educational and hygienic measures have the potential to prevent primary maternal infection. Methods A mixed interventional and observational controlled study was conducted to investigate the effectiveness of hygiene information among pregnant women at risk for primary CMV infection for personal/occupational reasons. In the intervention arm, CMV-seronegative women, identified at the time of maternal serum screening for fetal aneuploidy at 11–12 weeks of gestation, were given hygiene information and prospectively tested for CMV until delivery. The comparison arm consisted of women enrolled at delivery who were neither tested for nor informed about CMV during pregnancy, and who had a serum sample stored at the screening for fetal aneuploidy. By design, groups were homogeneous for age, parity, education, and exposure to at least one risk factor. The primary outcome was CMV seroconversion. Acceptance of hygiene recommendations was a secondary objective and was measured by a self-report. Findings Four out of 331 (1.2%) women seroconverted in the intervention group compared to 24/315 (7.6%) in the comparison group (delta = 6.4%; 95% CI 3.2–9.6; P < 0.001). There were 3 newborns with congenital infection in the intervention group and 8 in the comparison group (1 with cerebral ultrasound abnormalities at birth). Ninety-three percent of women felt hygiene recommendations were worth suggesting to all pregnant women at risk for infection. Interpretation This controlled study provides evidence that an intervention based on the identification and hygiene counseling of CMV-seronegative pregnant women significantly prevents maternal infection. While waiting for

  9. Cutaneous involvement by cytomegalovirus in a renal transplant recipient as an indicator of severe systemic infection*

    PubMed Central

    Neumann, Antonielle Borges Faria; Daxbacher, Egon Luiz Rodrigues; Chiaratti, Francielle Chiavelli; Jeunon, Thiago


    Cytomegalovirus is an opportunistic virus that commonly affects immunosuppressed patients. Cutaneous involvement by this virus is rare and occurs in significantly immunocompromised hosts, with a poor prognosis. Skin ulcers may represent the first sign of systemic infection by cytomegalovirus in these patients. Herein, a case of a systemic infection by Cytomegalovirus presenting as genital and oral ulcers in a kidney-transplant recipient is reported. PMID:26982783


    PubMed Central

    Chiocca, E. Antonio; Price, Richard L.; Hollon, Todd; Alvarez-Breackenridge, Christopher; Fernandez, Soledad; Oglesbee, Mike; Cook, Charles; Lawler, Sean; Kwon, Chang-Hyuk


    BACKGROUND: There have been several reports that have linked human cytomegalovirus (CMV) to gliomas. Although clinical trials of immunotherapy against CMV antigens found in gliomas have commenced in multiple institutions, the data linking these tumors to this virus remains controversial. METHODS: To study the controversial role of cytomegalovirus (CMV) in glioblastoma, we assessed the effects of murine CMV (MCMV) perinatal infection in a GFAP-cre; Nf1loxP/+ ; Trp53-/+ genetic mouse model of glioma (Mut3 mice). RESULTS: Early on after infection, MCMV antigen was predominantly localized in CD45+ lymphocytes in the brain with active viral replication and local areas of inflammation, but by 7 weeks there was a generalized loss of MCMV in brain, confirmed by bioluminescent imaging. MCMV-infected Mut3 mice exhibited a shorter survival time from their gliomas, when compared to control Mut3 mice, perinatally infected with mock or with a different neurotropic virus. Animal survival was also significantly shortened when orthotopic gliomas were implanted in mice perinatally infected with MCMV vs. controls. MCMV infection increased phosphorylated STAT3 (P-STAT3) levels in neural stem cells (NSCs) harvested from Mut3 mice SVZ and in vivo there was increased P-STAT3 in NSCs in MCMV-infected compared to control mice. Of relevance, human CMV (HCMV) also increased P-STAT3 and proliferation of patient-derived glioblastoma neurospheres, while a STAT3 inhibitor reversed this effect in vitro and in vivo. CONCLUSIONS: These findings thus associate CMV infection to a STAT3-dependent modulatory role in glioma formation/progression in the context of tumor suppressor mutations in mice and possibly in humans. SECONDARY CATEGORY: Neuropathology & Tumor Biomarkers.

  11. The efficiency of human cytomegalovirus pp65(495-503) CD8+ T cell epitope generation is determined by the balanced activities of cytosolic and endoplasmic reticulum-resident peptidases.


    Urban, Sabrina; Textoris-Taube, Kathrin; Reimann, Barbara; Janek, Katharina; Dannenberg, Tanja; Ebstein, Frédéric; Seifert, Christin; Zhao, Fang; Kessler, Jan H; Halenius, Anne; Henklein, Petra; Paschke, Julia; Cadel, Sandrine; Bernhard, Helga; Ossendorp, Ferry; Foulon, Thierry; Schadendorf, Dirk; Paschen, Annette; Seifert, Ulrike


    Control of human CMV (HCMV) infection depends on the cytotoxic activity of CD8(+) CTLs. The HCMV phosphoprotein (pp)65 is a major CTL target Ag and pp65(495-503) is an immunodominant CTL epitope in infected HLA-A*0201 individuals. As immunodominance is strongly determined by the surface abundance of the specific epitope, we asked for the components of the cellular Ag processing machinery determining the efficacy of pp65(495-503) generation, in particular, for the proteasome, cytosolic peptidases, and endoplasmic reticulum (ER)-resident peptidases. In vitro Ag processing experiments revealed that standard proteasomes and immunoproteasomes generate the minimal 9-mer peptide epitope as well as N-terminal elongated epitope precursors of different lengths. These peptides are largely degraded by the cytosolic peptidases leucine aminopeptidase and tripeptidyl peptidase II, as evidenced by increased pp65(495-503) epitope presentation after leucine aminopeptidase and tripeptidyl peptidase II knockdown. Additionally, with prolyl oligopeptidase and aminopeptidase B we identified two new Ag processing machinery components, which by destroying the pp65(495-503) epitope limit the availability of the specific peptide pool. In contrast to cytosolic peptidases, silencing of ER aminopeptidases 1 and 2 strongly impaired pp65(495-503)-specific T cell activation, indicating the importance of ER aminopeptidases in pp65(495-503) generation. Thus, cytosolic peptidases primarily interfere with the generation of the pp65(495-503) epitope, whereas ER-resident aminopeptidases enhance such generation. As a consequence, our experiments reveal that the combination of cytosolic and ER-resident peptidase activities strongly shape the pool of specific antigenic peptides and thus modulate MHC class I epitope presentation efficiency. PMID:22706083

  12. Intraperitoneal administration of cytomegalovirus hyperimmunoglobulin to the cytomegalovirus-infected fetus.


    Negishi, H; Yamada, H; Hirayama, E; Okuyama, K; Sagawa, T; Matsumoto, Y; Fujimoto, S


    Twenty-five percent of cytomegalovirus (CMV)-infected fetuses had sequelae and 8% of those in the recurrent-infected group had sequelae. There is no report yet on the fetal therapy for CMV infections. A Japanese pregnant woman with intrauterine fetal CMV infection diagnosed at 26 weeks of pregnancy is presented. CMV culture of amniotic fluid was positive. A CMV DNA assay using the polymerase chain reaction method of the cord blood and the amniotic fluid was positive during the pregnancy; however, testing for fetal serum CMV-specific IgM was negative. The CMV IgG titer of fetal serum at 27 weeks of pregnancy was a third of that of the maternal serum. CMV hyperimmunoglobulin was injected into the fetal abdominal cavity at 28 and 29 weeks of pregnancy. A second administration of CMV hyperimmunoglobulin increased the titer of CMV IgG in the fetal circulation. At birth, the urine culture was positive for CMV. However, CMV DNA of the ascites became negative. A brain CT scan performed 2 weeks after birth revealed some small calcifications beside the right ventricle. CMV hyperimmunoglobulin injection to the fetal abdominal cavity has been shown to increase the IgG in the fetal serum. This is the first report of fetal therapy of congenital CMV infection. PMID:9848763

  13. 2-(2,4-Dioxy-1,2,3,4-Tetrahydropyrimidin-1-yl)-N-(4-Phenoxyphenyl)-Acetamides as a Novel Class of Cytomegalovirus Replication Inhibitors

    PubMed Central

    Babkov, D. A.; Paramonova, M. P.; Ozerov, A. A.; Khandazhinskaya, A. L.; Snoeck, R.; Andrei, G.; Novikov, M. S.


    A series of novel uracil derivatives, bearing N-(4-phenoxyphenyl)acetamide moiety at N3 of a pyrimidine ring, has been synthesized. Their antiviral activity has been evaluated. It has been found that the novel compounds possess high inhibitory activity against replication of human cytomegalovirus (AD-169 and Davis strains) in HEL cell cultures. In addition, some of the derivatives proved to be inhibitory against varicella zoster virus. PMID:26798502

  14. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70

    PubMed Central

    Zhang, Liang; Guo, Gangqiang; Sun, Xiangwei; Chen, Jing; Ye, Lulu; Ye, Sisi; Mao, Chenchen; Xu, Jianfeng; Zhang, Lifang; Jiang, Lubin; Shen, Xian; Xue, Xiangyang


    It has been hypothesized that human cytomegalovirus (HCMV) could act as a tumor promoter and play an “oncomodulatory” role in the neoplastic process of several human malignancies. However, we demonstrate for the first time that UL138, a HCMV latency-associated gene, could act as a tumor inhibitor in gastric cancer (GC). The expression of UL138 is down-regulated in HCMV positive gastric adenocarcinoma tissues, especially in poorly or none differentiated tumors. Overexpression of UL138 in several human GC cell lines inhibits cell viability and induces apoptosis, in association with the reduction of an anti-apoptotic Bcl-2 protein and the induction of cleaved caspase-3 and caspase-9. Moreover, protein array analysis reveals that UL138 interacts with a chaperone protein, heat shock protein 70 (HSP70). This interaction is confirmed by immunoprecipitation and immunostaining in situ in GC cell lines. In addition, this UL138-mediated cancer cell death could efficiently lead to suppression of human tumor growth in a xenograft animal model of GC. In conclusion, these results uncover a previously unknown role of the cytomegalovirus protein UL138 in inducing GC cells apoptosis, which might imply a general mechanism that viral proteins inhibit cancer growth in interactions with both chaperones and apoptosis-related proteins. Our findings might provide a potential target for new therapeutic strategies of GC treatment. PMID:26735338

  15. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70.


    Chen, Wenjing; Lin, Kezhi; Zhang, Liang; Guo, Gangqiang; Sun, Xiangwei; Chen, Jing; Ye, Lulu; Ye, Sisi; Mao, Chenchen; Xu, Jianfeng; Zhang, Lifang; Jiang, Lubin; Shen, Xian; Xue, Xiangyang


    It has been hypothesized that human cytomegalovirus (HCMV) could act as a tumor promoter and play an "oncomodulatory" role in the neoplastic process of several human malignancies. However, we demonstrate for the first time that UL138, a HCMV latency-associated gene, could act as a tumor inhibitor in gastric cancer (GC). The expression of UL138 is down-regulated in HCMV positive gastric adenocarcinoma tissues, especially in poorly or none differentiated tumors. Overexpression of UL138 in several human GC cell lines inhibits cell viability and induces apoptosis, in association with the reduction of an anti-apoptotic Bcl-2 protein and the induction of cleaved caspase-3 and caspase-9. Moreover, protein array analysis reveals that UL138 interacts with a chaperone protein, heat shock protein 70 (HSP70). This interaction is confirmed by immunoprecipitation and immunostaining in situ in GC cell lines. In addition, this UL138-mediated cancer cell death could efficiently lead to suppression of human tumor growth in a xenograft animal model of GC. In conclusion, these results uncover a previously unknown role of the cytomegalovirus protein UL138 in inducing GC cells apoptosis, which might imply a general mechanism that viral proteins inhibit cancer growth in interactions with both chaperones and apoptosis-related proteins. Our findings might provide a potential target for new therapeutic strategies of GC treatment. PMID:26735338

  16. A cytomegalovirus-based vaccine provides long-lasting protection against lethal Ebola virus challenge after a single dose

    PubMed Central

    Tsuda, Yoshimi; Parkins, Christopher J.; Caposio, Patrizia; Feldmann, Friederike; Botto, Sara; Ball, Susan; Messaoudi, Ilhem; Cicin-Sain, Luka; Feldmann, Heinz; Jarvis, Michael A.


    Ebola virus (Zaire ebolavirus; EBOV) is a highly lethal hemorrhagic disease virus that most recently was responsible for two independent 2014 outbreaks in multiple countries in Western Africa, and the Democratic Republic of the Congo, respectively. Herein, we show that a cytomegalovirus (CMV)-based vaccine provides durable protective immunity from Ebola virus following a single vaccine dose. This study has implications for human vaccination against ebolaviruses, as well as for development of a ‘disseminating’ vaccine to target these viruses in wild African great apes. PMID:25820063

  17. A cytomegalovirus-encoded mitochondria-localized inhibitor of apoptosis structurally unrelated to Bcl-2

    PubMed Central

    Goldmacher, Victor S.; Bartle, Laura M.; Skaletskaya, Anna; Dionne, Cheryl A.; Kedersha, Nancy L.; Vater, Carol A.; Han, Jia-wen; Lutz, Robert J.; Watanabe, Shinya; McFarland, Ellen D. Cahir; Kieff, Elliott D.; Mocarski, Edward S.; Chittenden, Thomas


    Human cytomegalovirus (CMV), a herpesvirus that causes congenital disease and opportunistic infections in immunocompromised individuals, encodes functions that facilitate efficient viral propagation by altering host cell behavior. Here we show that CMV blocks apoptosis mediated by death receptors and encodes a mitochondria-localized inhibitor of apoptosis, denoted vMIA, capable of suppressing apoptosis induced by diverse stimuli. vMIA, a product of the viral UL37 gene, inhibits Fas-mediated apoptosis at a point downstream of caspase-8 activation and Bid cleavage but upstream of cytochrome c release, while residing in mitochondria and associating with adenine nucleotide translocator. These functional properties resemble those ascribed to Bcl-2; however, the absence of sequence similarity to Bcl-2 or any other known cell death suppressors suggests that vMIA defines a previously undescribed class of anti-apoptotic proteins. PMID:10535957

  18. Cytomegalovirus-based vaccine expressing Ebola virus glycoprotein protects nonhuman primates from Ebola virus infection

    PubMed Central

    Marzi, Andrea; Murphy, Aisling A.; Feldmann, Friederike; Parkins, Christopher J.; Haddock, Elaine; Hanley, Patrick W.; Emery, Matthew J.; Engelmann, Flora; Messaoudi, Ilhem; Feldmann, Heinz; Jarvis, Michael A.


    Ebolaviruses pose significant public health problems due to their high lethality, unpredictable emergence, and localization to the poorest areas of the world. In addition to implementation of standard public health control procedures, a number of experimental human vaccines are being explored as a further means for outbreak control. Recombinant cytomegalovirus (CMV)-based vectors are a novel vaccine platform that have been shown to induce substantial levels of durable, but primarily T-cell-biased responses against the encoded heterologous target antigen. Herein, we demonstrate the ability of rhesus CMV (RhCMV) expressing Ebola virus (EBOV) glycoprotein (GP) to provide protective immunity to rhesus macaques against lethal EBOV challenge. Surprisingly, vaccination was associated with high levels of GP-specific antibodies, but with no detectable GP-directed cellular immunity. PMID:26876974

  19. Amino Acids of Conserved Kinase Motifs of Cytomegalovirus Protein UL97 Are Essential for Autophosphorylation

    PubMed Central

    Michel, Detlef; Kramer, Silke; Höhn, Simone; Schaarschmidt, Peter; Wunderlich, Kirsten; Mertens, Thomas


    Thirteen point mutations targeting predicted domains conserved in homologous protein kinases were introduced into the UL97 coding region of the human cytomegalovirus. All mutagenized proteins were expressed in cells infected with recombinant vaccinia viruses (rVV). Several mutations drastically reduced ganciclovir (GCV) phosphorylation. Mutations at amino acids G340, A442, L446, and F523 resulted in a complete loss of pUL97 phosphorylation, which was strictly associated with a loss of GCV phosphorylation. Our results confirm that in rVV-infected cells pUL97 phosphorylation is due to autophosphorylation and show that several amino acids conserved within domains of protein kinases are essential for this pUL97 phosphorylation. GCV phosphorylation is dependent on pUL97 phosphorylation. PMID:10482650

  20. Vaginal Cytomegalovirus Shedding Before and After Initiation of Antiretroviral Therapy in Rakai, Uganda.


    Gianella, Sara; Redd, Andrew D; Grabowski, Mary K; Tobian, Aaron A R; Serwadda, David; Newell, Kevin; Patel, Eshan U; Kalibbala, Sarah; Ssebbowa, Paschal; Gray, Ronald H; Quinn, Thomas C; Reynolds, Steven J


    Vaginal shedding of cytomegalovirus (CMV) DNA was determined longitudinally among 96 women coinfected with human immunodeficiency virus (HIV), herpes simplex virus 2, and CMV starting antiretroviral therapy (ART) during a placebo-controlled trial of HSV-2 suppression with acyclovir in Rakai, Uganda. Vaginal CMV was detected in 75 of 96 women (78.0%) and 379 of 1080 individual visits (35.1%). ART status, higher HIV RNA viral load before ART initiation, and younger age were significantly associated with increased frequency of CMV shedding (P < .01). Compared to pre-ART, CMV shedding peaked from month 2 to month 4 after ART initiation, suggesting possible immune reconstitution inflammatory syndrome. Further studies need to determine the clinical significance of asymptomatic CMV shedding. PMID:25743428

  1. Cytomegalovirus DNA in Semen and Blood Is Associated With Higher Levels of Proviral HIV DNA

    PubMed Central

    Gianella, Sara; Anderson, Christy M.; Vargas, Milenka V.; Richman, Douglas D.; Little, Susan J.; Morris, Sheldon R.; Smith, Davey M.