Science.gov

Sample records for human cytomegalovirus ie1

  1. Human cytomegalovirus IE1 protein alters the higher-order chromatin structure by targeting the acidic patch of the nucleosome

    PubMed Central

    Fang, Qianglin; Chen, Ping; Wang, Mingzhu; Fang, Junnan; Yang, Na; Li, Guohong; Xu, Rui-Ming

    2016-01-01

    Human cytomegalovirus (hCMV) immediate early 1 (IE1) protein associates with condensed chromatin of the host cell during mitosis. We have determined the structure of the chromatin-tethering domain (CTD) of IE1 bound to the nucleosome core particle, and discovered that the specific interaction between IE1-CTD and the H2A-H2B acidic patch impairs the compaction of higher-order chromatin structure. Our results suggest that IE1 loosens up the folding of host chromatin during hCMV infections. DOI: http://dx.doi.org/10.7554/eLife.11911.001 PMID:26812545

  2. N-terminal determinants of human cytomegalovirus IE1 protein in nuclear targeting and disrupting PML-associated subnuclear structures

    SciTech Connect

    Lee, Hye-Ra; Huh, Yong Ho; Kim, Young-Eui; Lee, Karim; Kim, Sunyoung; Ahn, Jin-Hyun . E-mail: jahn@med.skku.ac.kr

    2007-05-04

    The 72-kDa IE1 protein of human cytomegalovirus disrupts PML-associated subnuclear structures (PODs) by inducing PML desumoylation. This process correlates with the functions of IE1 in transcriptional regulation and efficient viral replication. Here, we defined the N-terminal regions of IE1 required for nuclear targeting and POD-disrupting activity. Although the 24 N-terminal amino acids encoded by exon 2, which were previously shown to be essential for nuclear targeting, did not appear to contain typical basic nuclear localization signals, these residues were able to efficiently convey the GFP protein into the nucleus, suggesting a role in promoting nuclear translocation. In assays using a series of N-terminal truncation IE1 mutants, which were forced to enter the nucleus, exon 2 was completely dispensable for POD disruption. However, the predicted two {alpha}-helix regions in exon 3 were identified as important structural determinants for protein stability and for the correlating activities in POD disruption and PML desumoylation.

  3. Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones specifically activated by IE1 peptides in vitro.

    PubMed Central

    Davignon, J L; Castanié, P; Yorke, J A; Gautier, N; Clément, D; Davrinche, C

    1996-01-01

    The control of latent cytomegalovirus (CMV) infections by the immune system is poorly understood. We have previously shown that CD4+ T cells specific for the human CMV major regulatory protein IE1 are frequent in latently infected healthy blood donors. In order to learn about the possible role of these cells, we have developed IE1-specific CD4+ T-cell clones and, in this study, analyzed their epitope specificity and function in vitro. We measured their cytokine production when stimulated with specific IE1 peptides or whole recombinant IE1 protein. Their cytokine profiles, as deduced from gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), and interleukin-4 (IL-4) and IL-6 production, were of the Th0- and Th1-like phenotypes. Supernatants from IE1-specific clones producing IFN-gamma and TNF-alpha were shown to inhibit CMV replication in U373 MG cells. This effect was due, as found by using cytokine-specific neutralizing antibodies, mostly to IFN-gamma, which was secreted at higher levels than TNF-alpha. To better assess the anti-CMV activity of cytokines, recombinant IFN-gamma and TNF-alpha were used and shown to have a synergistic effect on the inhibition of CMV replication and protein expression. Thus, IE1-specific CD4+ T cells display in vitro anti-CMV activity through cytokine secretion and may play a role in the control of in vivo latent infections. PMID:8642638

  4. Characterization of Recombinant Human Cytomegaloviruses Encoding IE1 Mutants L174P and 1-382 Reveals that Viral Targeting of PML Bodies Perturbs both Intrinsic and Innate Immune Responses

    PubMed Central

    Scherer, Myriam; Otto, Victoria; Stump, Joachim D.; Klingl, Stefan; Müller, Regina; Reuter, Nina; Muller, Yves A.; Sticht, Heinrich

    2015-01-01

    ABSTRACT PML is the organizer of cellular structures termed nuclear domain 10 (ND10) or PML-nuclear bodies (PML-NBs) that act as key mediators of intrinsic immunity against human cytomegalovirus (HCMV) and other viruses. The antiviral function of ND10 is antagonized by viral regulatory proteins such as the immediate early protein IE1 of HCMV. IE1 interacts with PML through its globular core domain (IE1CORE) and induces ND10 disruption in order to initiate lytic HCMV infection. Here, we investigate the consequences of a point mutation (L174P) in IE1CORE, which was shown to abrogate the interaction with PML, for lytic HCMV infection. We found that a recombinant HCMV encoding IE1-L174P displays a severe growth defect similar to that of an IE1 deletion virus. Bioinformatic modeling based on the crystal structure of IE1CORE suggested that insertion of proline into the highly alpha-helical domain severely affects its structural integrity. Consistently, L174P mutation abrogates the functionality of IE1CORE and results in degradation of the IE1 protein during infection. In addition, our data provide evidence that IE1CORE as expressed by a recombinant HCMV encoding IE1 1-382 not only is required to antagonize PML-mediated intrinsic immunity but also affects a recently described function of PML in innate immune signaling. We demonstrate a coregulatory role of PML in type I and type II interferon-induced gene expression and provide evidence that upregulation of interferon-induced genes is inhibited by IE1CORE. In conclusion, our data suggest that targeting PML by viral regulatory proteins represents a strategy to antagonize both intrinsic and innate immune mechanisms. IMPORTANCE PML nuclear bodies (PML-NBs), which represent nuclear multiprotein complexes consisting of PML and additional proteins, represent important cellular structures that mediate intrinsic resistance against many viruses, including human cytomegalovirus (HCMV). During HCMV infection, the major immediate

  5. Transactivation of a human cytomegalovirus early promoter by gene products from the immediate-early gene IE2 and augmentation by IE1: mutational analysis of the viral proteins.

    PubMed Central

    Malone, C L; Vesole, D H; Stinski, M F

    1990-01-01

    Expression from a human cytomegalovirus early promoter (E1.7) has been shown to be activated in trans by the IE2 gene products (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281-290, 1989). Using wild-type and mutant viral proteins, we have defined the protein regions required for transactivation of the E1.7 promoter in IE2 and for augmentation of transactivation in the IE1 protein. Two regions of the IE2 proteins were found to be essential for transactivation. One near the amino terminus is within 52 amino acids encoded by exon 3. The second comprises the carboxyl-terminal 85 amino acids encoded by exon 5. The IE2 protein encoded by an mRNA which lacks the intron within exon 5 and the IE2 protein encoded by exon 5 had no activity for transactivation of the E1.7 promoter. Although the IE1 gene product alone had no effect on this early viral promoter, maximal early promoter activity was detected when both IE1 and IE2 gene products were present. The IE1 protein positively regulated its enhancer-containing promoter-regulatory region. The IE1 protein alone increased the steady-state level of IE2 mRNA; therefore, IE1 and IE2 are synergistic for expression from the E1.7 promoter. Like the IE2 proteins, the IE1 protein requires for activity 52 amino acids encoded by exon 3. IE1 also requires amino acids encoded by exon 4. Since the IE1 and IE2 proteins have 85 amino acids in common at the amino-terminal end encoded by exons 2 and 3, the difference between these specific transactivators resides in their carboxyl-terminal amino acids encoded by exons 4 and 5, respectively. Images PMID:2157038

  6. Crystal Structure of Cytomegalovirus IE1 Protein Reveals Targeting of TRIM Family Member PML via Coiled-Coil Interactions

    PubMed Central

    Sevvana, Madhumati; Otto, Victoria; Schilling, Eva-Maria; Stump, Joachim D.; Müller, Regina; Reuter, Nina; Sticht, Heinrich; Muller, Yves A.; Stamminger, Thomas

    2014-01-01

    PML nuclear bodies (PML-NBs) are enigmatic structures of the cell nucleus that act as key mediators of intrinsic immunity against viral pathogens. PML itself is a member of the E3-ligase TRIM family of proteins that regulates a variety of innate immune signaling pathways. Consequently, viruses have evolved effector proteins to modify PML-NBs; however, little is known concerning structure-function relationships of viral antagonists. The herpesvirus human cytomegalovirus (HCMV) expresses the abundant immediate-early protein IE1 that colocalizes with PML-NBs and induces their dispersal, which correlates with the antagonization of NB-mediated intrinsic immunity. Here, we delineate the molecular basis for this antagonization by presenting the first crystal structure for the evolutionary conserved primate cytomegalovirus IE1 proteins. We show that IE1 consists of a globular core (IE1CORE) flanked by intrinsically disordered regions. The 2.3 Å crystal structure of IE1CORE displays an all α-helical, femur-shaped fold, which lacks overall fold similarity with known protein structures, but shares secondary structure features recently observed in the coiled-coil domain of TRIM proteins. Yeast two-hybrid and coimmunoprecipitation experiments demonstrate that IE1CORE binds efficiently to the TRIM family member PML, and is able to induce PML deSUMOylation. Intriguingly, this results in the release of NB-associated proteins into the nucleoplasm, but not of PML itself. Importantly, we show that PML deSUMOylation by IE1CORE is sufficient to antagonize PML-NB-instituted intrinsic immunity. Moreover, co-immunoprecipitation experiments demonstrate that IE1CORE binds via the coiled-coil domain to PML and also interacts with TRIM5α We propose that IE1CORE sequesters PML and possibly other TRIM family members via structural mimicry using an extended binding surface formed by the coiled-coil region. This mode of interaction might render the antagonizing activity less susceptible to

  7. Immediate-Early (IE) gene regulation of cytomegalovirus: IE1- and pp71-mediated viral strategies against cellular defenses.

    PubMed

    Torres, Lilith; Tang, Qiyi

    2014-12-01

    Three crucial hurdles hinder studies on human cytomegalovirus (HCMV): strict species specificity, differences between in vivo and in vitro infection, and the complexity of gene regulation. Ever since the sequencing of the whole genome was first accomplished, functional studies on individual genes have been the mainstream in the CMV field. Gene regulation has therefore been elucidated in a more detailed fashion. However, viral gene regulation is largely controlled by both cellular and viral components. In other words, viral gene expression is determined by the virus-host interaction. Generally, cells respond to viral infection in a defensive pattern; at the same time, viruses try to counteract the cellular defense or else hide in the host (latency). Viruses evolve effective strategies against cellular defense in order to achieve replicative success. Whether or not they are successful, cellular defenses remain in the whole viral replication cycle: entry, immediate-early (IE) gene expression, early gene expression, DNA replication, late gene expression, and viral egress. Many viral strategies against cellular defense, and which occur in the immediate-early time of viral infection, have been documented. In this review, we will summarize the documented biological functions of IE1 and pp71 proteins, especially with regard to how they counteract cellular intrinsic defenses.

  8. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell.

  9. Thermoinactivation of human cytomegalovirus.

    PubMed

    Vonka, V; Benyeshmelnick, M

    1966-01-01

    Vonka, Vladimir (Baylor University College of Medicine, Houston, Tex.), and Matilda Benyesh-Melnick. Thermoinactivation of human cytomegalovirus. J. Bacteriol. 91:221-226. 1966.-The inactivation at 4 and 37 C of several strains of human cytomegalovirus was studied. The preliminary findings that freshly harvested cytomegalovirus was inactivated more rapidly at 4 C than at higher temperatures was confirmed. Intracellular virus still within infected cells was found to be more stable at 4 C than virus released by sonic treatment just before incubation at 4 C. The composition of the diluent played an important role. In tris(hydroxymethyl)-aminomethane buffer, virus was unstable at both 4 and 37 C, with the rate of inactivation faster at 4 than at 37 C. Similar results were obtained when bicarbonate-phosphate buffer or Eagle's medium when bicarbonate was used as virus diluent. Calf serum stabilized the virus at 37 C, but not at 4 C. The deletion of bicarbonate from Eagle's medium had a stabilizing effect at both temperatures. An even greater stabilizing effect at both 4 and 37 C was obtained when distilled water was used as virus diluent. Inactivation rates varied from one strain to the next at 4 C but not at 37 C. Differences were found also with virus progeny derived from a single strain, but harvested at different stages during virus multiplication. Virus harvested early was more labile at 4 than at 37 C, whereas the late virus was more labile at the higher temperature. Intracellular and extracellular virus preparations were inactivated at the same rates at either 4 or 37 C.

  10. [Infection by human cytomegalovirus].

    PubMed

    Sanbonmatsu Gámez, Sara; Ruiz, Mercedes Pérez; Navarro Marí, José María

    2014-02-01

    Prevalence of human cytomegalovirus infection is very high worldwide. Following primary infection, the virus remains latent, being able to cause recurrences either by reinfection with a new strain or by reactivation of the replication of the latent virus. The most severe disease is seen in congenital infection and in immunosuppressed patients, in whom the virus act as an opportunistic pathogen. Serological techniques are the methods of choice in primary infection and to determine the immune status against CMV in organ donor and receptor. Although well-standardized studies are lacking, the recent commercial availability of methods that measure cellular immune response are promising to predict the risk of CMV disease in immunosuppressed individuals. Molecular assays, that have gradually been substituting viral culture and/or antigen detection, are the most widely used methods for the diagnosis and control of CMV infection.

  11. Human Cytomegalovirus Persistence

    PubMed Central

    Goodrum, Felicia; Caviness, Katie; Zagallo, Patricia

    2012-01-01

    Summary Viral persistence is the rule following infection with all herpesviruses. The β-herpesvirus, human cytomegalovirus (HCMV), persists through chronic and latent states of infection. Both the chronic and latent states of infection contribute to HCMV persistence and to the high HCMV seroprevalence worldwide. The chronic infection is poorly defined molecularly, but clinically manifests as low-level virus shedding over extended periods of time and often in the absence of symptoms. Latency requires long-term maintenance of viral genomes in a reversibly quiescent state in the immunocompetent host. In this review, we focus on recent advances in the biology of HCMV persistence, particularly with respect to the latent mode of persistence. Latently infected individuals harbor HCMV genomes in hematopoietic cells and maintain large subsets of HCMV-specific T-cells. In the last few years, impressive advances have been made in understanding virus-host interactions important to HCMV infection, many of which will profoundly impact latency and persistence. We discuss these advances and their known or potential impact on viral latency. As herpesviruses are met with similar challenges in achieving latency and often employ conserved strategies to persist, we discuss current and future directions of HCMV persistence in the context of the greater body of knowledge regarding α-and γ-herpesviruses persistence. PMID:22329758

  12. Human cytomegalovirus inhibits erythropoietin production.

    PubMed

    Butler, Lynn M; Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia

    2014-08-01

    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients.

  13. The pathogenesis of human cytomegalovirus.

    PubMed

    Griffiths, Paul; Baraniak, Ilona; Reeves, Matt

    2015-01-01

    Human cytomegalovirus (HCMV) is a recognized cause of disease in the fetus, the allograft recipient and AIDS patients. More recently, it has been recognized as a pathogen for those admitted to intensive care units, for the elderly and for the general population. The epidemiology and molecular and cellular pathology of this virus are summarized to provide an overarching model of pathogenesis, able to account for these varying clinical presentations. In brief, HCMV has the potential to spread in the bloodstream to all organs, but only produces overt disease if the viral load increases to high levels. This is normally prevented by a robust immune response, so that the infected individual usually remains asymptomatic. However, this benefit comes at the cost of committing more and more immunological resources to controlling HCMV with time, so that the overall function of the immune system is impaired. Fortunately, recent progress in developing novel antiviral drugs and vaccines suggests the possibility that the diverse effects of HCMV may soon become controllable at the individual and population level, respectively.

  14. Interactions of human cytomegalovirus with human fibroblasts.

    PubMed

    Vonka, V; Benyesh-Melnick, M

    1966-01-01

    Vonka, Vladimir (Baylor University College of Medicine, Houston, Tex.), and Matilda Benyesh-Melnick. Interactions of human cytomegalovirus with human fibroblasts. J. Bacteriol. 91:213-220. 1966.-Virus attachment of human cytomegalovirus to human embryo lung fibroblasts was found to be temperature-independent, from 4 to 37 C. Prolonged incubation at 4 C, however, resulted in inactivation of a high proportion of attached virus. Virus penetration seemed to be temperature-dependent, occurring at 37 C but not at 4 C. Detailed studies of the growth curve of the virus were made. Cell-associated virus preceded the appearance of virus in the fluid phase by 2 to 5 days. Complement-fixing antigen could be detected, but only when the cytopathic effect was advanced, and it was demonstrable only in the cell-associated fraction. Under methyl cellulose, decreasing the bicarbonate concentration in the overlay from 0.225 to 0.15% resulted in marked increase in plating efficiency with all strains tested. However, varying the concentration of bicarbonate from 0.3 to 0.15% in fluid medium did not influence the growth of virus.

  15. Human Cytomegalovirus Induces JC Virus DNA Replication in Human Fibroblasts

    NASA Astrophysics Data System (ADS)

    Heilbronn, Regine; Albrecht, Ingrid; Stephan, Sonja; Burkle, Alexander; Zur Hausen, Harald

    1993-12-01

    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML.

  16. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  17. Animal cytomegaloviruses.

    PubMed Central

    Staczek, J

    1990-01-01

    Cytomegaloviruses are agents that infect a variety of animals. Human cytomegalovirus is associated with infections that may be inapparent or may result in severe body malformation. More recently, human cytomegalovirus infections have been recognized as causing severe complications in immunosuppressed individuals. In other animals, cytomegaloviruses are often associated with infections having relatively mild sequelae. Many of these sequelae parallel symptoms associated with human cytomegalovirus infections. Recent advances in biotechnology have permitted the study of many of the animal cytomegaloviruses in vitro. Consequently, animal cytomegaloviruses can be used as model systems for studying the pathogenesis, immunobiology, and molecular biology of cytomegalovirus-host and cytomegalovirus-cell interactions. PMID:2170830

  18. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  19. Correlation between infectivity and physical virus particles in human cytomegalovirus.

    PubMed

    Benyesh-Melnick, M; Probstmeyer, F; McCombs, R; Brunschwig, J P; Vonka, V

    1966-11-01

    Benyesh-Melnick, Matilda (Baylor University College of Medicine, Houston, Tex.), Fern Probstmeyer, Robert McCombs, Jean P. Brunschwig, and Vladimir Vonka. Correlation between infectivity and physical virus particles in human cyto-megalovirus. J. Bacteriol. 92:1555-1561. 1966.-Infectivity titers [measured as plaque-forming units (PFU)] and particle counts by the sedimentation pseudo-replication technique were determined for crude, unpurified, intracellular preparations of two different strains of human cytomegalovirus. Unlike the high particle-infectivity ratio of 10(6) to 10(8) previously reported for these viruses, the number of total particles per PFU ranged from 160 to 490 with strain AD-169 and from 176 to 1,050 for strain C-87. Interpretation of particle-PFU ratios of intracellular cytomegalovirus in terms of particle morphology is not conclusive at this time. The number of enveloped forms found varied between 0 and 34% of the total particles counted. However, the true proportion is probably greater, because envelopes were found to be destroyed by the enzyme treatment used in preparing the specimens for examination in the electron microscope. The number of full particles found ranged between 4 and 31% of the total particles counted. The particle per PFU ratio of extracellular virus was found to be three- to fivefold lower than that of intracellular virus.

  20. Murine cytomegalovirus resistant to antivirals has genetic correlates with human cytomegalovirus.

    PubMed

    Scott, G M; Ng, H-L; Morton, C J; Parker, M W; Rawlinson, W D

    2005-08-01

    Human cytomegalovirus (HCMV) resistance to antivirals is a significant clinical problem. Murine cytomegalovirus (MCMV) infection of mice is a well-described animal model for in vivo studies of CMV pathogenesis, although the mechanisms of MCMV antiviral susceptibility need elucidation. Mutants resistant to nucleoside analogues aciclovir, adefovir, cidofovir, ganciclovir, penciclovir and valaciclovir, and the pyrophosphate analogue foscarnet were generated by in vitro passage of MCMV (Smith) in increasing concentrations of antiviral. All MCMV antiviral resistant mutants contained DNA polymerase mutations identical or similar to HCMV DNA polymerase mutations known to confer antiviral resistance. Mapping of the mutations onto an MCMV DNA polymerase three-dimensional model generated using the Thermococcus gorgonarius Tgo polymerase crystal structure showed that the DNA polymerase mutations potentially confer resistance through changes in regions surrounding a catalytic aspartate triad. The ganciclovir-, penciclovir- and valaciclovir-resistant isolates also contained mutations within MCMV M97 identical or similar to recognized GCV-resistant mutations of HCMV UL97 protein kinase, and demonstrated cross-resistance to antivirals of the same class. This strongly suggests that MCMV M97 has a similar role to HCMV UL97 in the phosphorylation of nucleoside analogue antivirals. All MCMV mutants demonstrated replication-impaired phenotypes, with the lowest titre and plaque size observed for isolates containing mutations in both DNA polymerase and M97. These findings indicate DNA polymerase and protein kinase regions of potential importance for antiviral susceptibility and replication. The similarities between MCMV and HCMV mutations that arise under antiviral selective pressure increase the utility of MCMV as a model for in vivo studies of CMV antiviral resistance. PMID:16033961

  1. Cell-specific activity of the modulator region in the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Lubon, H.K.; Hennighausen, L. ); Ghazal, P.; Reynolds-Kohler, C.; Lockshin, C.; Nelson, J. )

    1989-03-01

    In this paper the authors demonstrate that modular sequences upstream of the enhancer of the major immediate-early promoter of human cytomegalovirus exert a differential effort on the level of transcription in a variety of cells and that this region has the capacity to interact with specific nuclear protein. Depending on the cell type, these modulator sequences increased or decreased transcriptional activation from the IE1 gene promoter-enhancer. The cell lines identified in this report should be useful to study the molecular mechanism of cell-specific transcriptional repression and activation exerted by the major immediate-early promoter upstream region.

  2. Identification of the major capsid protein gene of human cytomegalovirus.

    PubMed Central

    Chee, M; Rudolph, S A; Plachter, B; Barrell, B; Jahn, G

    1989-01-01

    The coding region for the major capsid protein (MCP) of human cytomegalovirus (HCMV) was identified by comparing the protein sequence with the respective sequences of herpes simplex virus (HSV), Epstein-Barr virus, and varicella-zoster virus. The predicted length of the HCMV MCP was 1,370 amino acids. Comparison of the MCP sequences of the different human herpesviruses showed a homology of 25% to the MCP of HSV type 1, a homology of 29% to the MCP of Epstein-Barr virus, and a homology of 23% to the MCP of varicella-zoster virus. A subfragment of the HSV type 1 KpnI i fragment encoding the MCP VP5 cross-hybridized with the HCMV HindIII U fragment containing part of the MCP gene. Northern (RNA) blot analyses with subclones out of the coding region for the HCMV MCP detected one large transcript of about 8 kilobases. A portion of the open reading frame was expressed in Escherichia coli plasmid pBD2 IC2OH as a beta-galactosidase fusion protein and was used to generate polyclonal antibodies in New Zealand White rabbits. The obtained antisera reacted in Western immunoblots with the MCP of purified HCMV virions. A monoclonal antibody against the human MCP and a monospecific rabbit antiserum against strain Colburn of simian cytomegalovirus detected the fusion protein as well as the MCP of purified virions in immunoblots. Images PMID:2536837

  3. Human antibody technology and the development of antibodies against cytomegalovirus.

    PubMed

    Ohlin, Mats; Söderberg-Nauclér, Cecilia

    2015-10-01

    Cytomegalovirus (CMV) is a virus that causes chronic infections in a large set of the population. It may cause severe disease in immunocompromised individuals, is linked to immunosenescence and implied to play an important role in the pathogenesis of cardiovascular diseases and cancer. Modulation of the immune system's abilities to manage the virus represent a highly viable therapeutic option and passive immunotherapy with polyclonal antibody preparations is already in clinical use. Defined monoclonal antibodies offer many advantages over polyclonal antibodies purified from serum. Human CMV-specific monoclonal antibodies have consequently been thoroughly investigated with respect to their potential in the treatment of diseases caused by CMV. Recent advances in human antibody technology have substantially expanded the breadth of antibodies for such applications. This review summarizes the fundamental basis for treating CMV disease by use of antibodies, the basic technologies to be used to develop such antibodies, and relevant human antibody specificities available to target this virus.

  4. Human cytomegalovirus encoded microRNAs: hitting targets.

    PubMed

    Ng, Kiat Rui; Li, Jordan Y Z; Gleadle, Jonathan M

    2015-01-01

    Human cytomegalovirus (HCMV) infection is of particular concern in immunodeficient individuals notably transplant recipients, leading to increased morbidity and mortality. HCMV is predicted to encode multiple microRNAs (miRNAs) and several have been characterized in vitro. Furthermore, these miRNAs have been shown to target human and viral mRNAs. Pathways involved in human cellular targets have key roles in vesicle trafficking, immune evasion and cell cycle control. This demonstration of viral miRNA targets provides novel insights into viral pathogenesis. This review details the evidence for the existence of HCMV-encoded miRNA and their targets. HCMV miRNA in blood and other tissues is a potential diagnostic tool and blocking the effects of specific HCMV-encoded miRNA with sequence specific antagomirs is a potential new therapy.

  5. Autoimmunity induced by human cytomegalovirus in patients with systemic lupus erythematosus

    PubMed Central

    2012-01-01

    Human cytomegalovirus is a common herpesvirus that is linked to autoimmunity, especially in genetically predisposed persons. The article by Hsieh and colleagues in a previous issue of Arthritis Research & Therapy suggests that a C-terminal peptide of the human cytomegalovirus protein pp65 is highly immunogenic in patients with systemic lupus erythematosus and that antibodies against this peptide cross-react with nuclear proteins and double-stranded DNA, which are highly frequent autoantibodies in systemic lupus erythematosus patients. These observations highlight the fact that immunization with one small cytomegalovirus-specific peptide results in multiple autoreactive antibodies, probably through molecular mimicry and epitope spreading, in genetically predisposed persons. PMID:22277352

  6. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  7. Discovery of Potent, Orally Bioavailable Inhibitors of Human Cytomegalovirus.

    PubMed

    Fader, Lee; Brault, Martine; Desjardins, Jessica; Dansereau, Nathalie; Lamorte, Louie; Tremblay, Sonia; Bilodeau, François; Bordeleau, Josée; Duplessis, Martin; Gorys, Vida; Gillard, James; Gleason, James L; James, Clint; Joly, Marc-André; Kuhn, Cyrille; Llinas-Brunet, Montse; Luo, Laibin; Morency, Louis; Morin, Sébastien; Parisien, Mathieu; Poirier, Maude; Thibeault, Carl; Trinh, Thao; Sturino, Claudio; Srivastava, Sanjay; Yoakim, Christiane; Franti, Michael

    2016-05-12

    A high-throughput screen based on a viral replication assay was used to identify inhibitors of the human cytomegalovirus. Using this approach, hit compound 1 was identified as a 4 μM inhibitor of HCMV that was specific and selective over other herpes viruses. Time of addition studies indicated compound 1 exerted its antiviral effect early in the viral life cycle. Mechanism of action studies also revealed that this series inhibited infection of MRC-5 and ARPE19 cells by free virus and via direct cell-to-cell spread from infected to uninfected cells. Preliminary structure-activity relationships demonstrated that the potency of compound 1 could be improved to a low nanomolar level, but metabolic stability was a key optimization parameter for this series. A strategy focused on minimizing metabolic hydrolysis of the N1-amide led to an alternative scaffold in this series with improved metabolic stability and good pharmacokinetic parameters in rat. PMID:27190604

  8. Human cytomegalovirus: bacterial artificial chromosome (BAC) cloning and genetic manipulation.

    PubMed

    Paredes, Anne M; Yu, Dong

    2012-02-01

    The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  9. The interaction between cytomegalovirus and the human immune system.

    PubMed

    ten Berge, Ineke J M; van Lier, René A W

    2014-12-01

    Studies on antiviral immunity in man are hampered by the impossibility to standardize the infection as is done in experimental animal studies. An exception is the occurrence of cytomegalovirus infection transmitted by a donor organ into a transplant-recipient, where the time-point of infection is exactly known. Moreover, its strong interaction with the human immune system during evolution and the strong immunogenic properties of this persistent virus, as well as the need for intervention e.g. by vaccine development, all make studies towards the immune response against just this virus very attractive and relevant. In this work, we will present an overview of the studies on this topic that were performed in the departments of Experimental and Clinical Immunology in the AMC and Sanquin in Amsterdam.

  10. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  11. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.

    PubMed

    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg

    2016-09-06

    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity.

  12. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.

    PubMed

    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg

    2016-01-01

    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity. PMID:27595792

  13. Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina

    PubMed Central

    Distéfano, Angélica Lidia; Alonso, Alicia; Martin, Fabián; Pardon, Fabián

    2004-01-01

    Background Human cytomegalovirus (CMV) is one of the most commonly found agents of congenital infections. Primary maternal infection is associated with risk of symptomatic congenital diseases, and high morbidity is frequently associated with very low birth weight. Neonates with asymptomatic infection develop various sequelae during infancy. This is the first Argentine study performed in neonates with congenital and postnatal HCMV infection. The purpose of this study was to evaluate the performance of the polymerase chain reaction (PCR) technique with different pairs of primers, to detect cytomegalovirus isolated in tissue cultures and directly in urine and dried blood spot (DBS) specimens. Results were compared with IgM detection. Methods The study was performed between 1999 and 2001 on routine samples in the Laboratory. A total of 61 urine and 56 serum samples were selected from 61 newborns/infants, 33 patients whose samples were analyzed during the first two to three weeks of life were considered congenital infections; the remaining 28 patients whose samples were taken later than the third week were grouped as perinatal infections, although only in 4 the perinatal transmission of infection was determined unequivocally Cytomegalovirus diagnosis was made by isolating the virus from urine samples in human foreskin fibroblast cells. Three different primer pairs directed to IE, LA and gB genes were used for the HCMV PCR assay in viral isolates. Subsequently, PCR and nested PCR (nPCR) assays with gB primers were performed directly in urine and in 11 samples of dried blood spot (DBS) on Guthrie Card, these results were then compared with serology. Results The main clinical manifestations of the 33 patients with congenital infection were purpura, jaundice, hepatomegaly and anaemia. Three patients presented low birth weight as single symptom, 10, intracranial calcifications, and 2, kidney failure. In the 28 patients grouped as with perinatal infection, anaemia

  14. Positive Role of Promyelocytic Leukemia Protein in Type I Interferon Response and Its Regulation by Human Cytomegalovirus

    PubMed Central

    Kim, Young-Eui; Ahn, Jin-Hyun

    2015-01-01

    Promyelocytic leukemia protein (PML), a major component of PML nuclear bodies (also known as nuclear domain 10), is involved in diverse cellular processes such as cell proliferation, apoptosis, gene regulation, and DNA damage response. PML also acts as a restriction factor that suppresses incoming viral genomes, therefore playing an important role in intrinsic defense. Here, we show that PML positively regulates type I interferon response by promoting transcription of interferon-stimulated genes (ISGs) and that this regulation by PML is counteracted by human cytomegalovirus (HCMV) IE1 protein. Small hairpin RNA-mediated PML knockdown in human fibroblasts reduced ISG induction by treatment of interferon-β or infection with UV-inactivated HCMV. PML was required for accumulation of activated STAT1 and STAT2, interacted with them and HDAC1 and HDAC2, and was associated with ISG promoters after HCMV infection. During HCMV infection, viral IE1 protein interacted with PML, STAT1, STAT2, and HDACs. Analysis of IE1 mutant viruses revealed that, in addition to the STAT2-binding domain, the PML-binding domain of IE1 was necessary for suppression of interferon-β-mediated ISG transcription, and that IE1 inhibited ISG transcription by sequestering interferon-stimulated gene factor 3 (ISGF3) in a manner requiring its binding of PML and STAT2, but not of HDACs. In conclusion, our results demonstrate that PML participates in type I interferon-induced ISG expression by regulating ISGF3, and that this regulation by PML is counteracted by HCMV IE1, highlighting a widely shared viral strategy targeting PML to evade intrinsic and innate defense mechanisms. PMID:25812002

  15. Human cytomegalovirus induced pseudotumor of upper gastrointestinal tract mucosa: effects of long-term chronic disease?

    PubMed

    Reggiani Bonetti, Luca; Barresi, Valeria; Bertani, Angela; Maccio, Livia; Palmiere, Cristian

    2015-06-01

    Human cytomegalovirus-induced lesions resembling malignancies have been described in the gastrointestinal tract and include ulcerated or exophytic large masses. The aim of this study was to review the cases registered in the databases of two academic hospitals and formulate a hypothesis concerning the pathogenic mechanisms responsible for cytomegalovirus-induced pseudotumor development. All the diagnoses of human cytomegalovirus infections of the upper gastrointestinal tract recorded from 1991 to 2013 were reviewed. Cases of mucosal alterations misdiagnosed endoscopically as malignancies were selected. Large ulcers occurring in the stomach (three cases) and an irregular exophytic mass at the gastro-jejunal anastomosis were misdiagnosed endoscopically as malignancies (4 cases out of 53). Histologically, all lesions reflected hyperplastic mucosal changes with a prevalence of epithelial and stroma infected cells, without signs of cell atypia. The hypothesis presented is that the development of human cytomegalovirus-induced pseudotumors may be the morphological expression of chronic mucosa damage underlying long-term infection.

  16. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  17. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    SciTech Connect

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, with levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.

  18. Cytomegalovirus Replicates in Differentiated but not in Undifferentiated Human Embryonal Carcinoma Cells

    NASA Astrophysics Data System (ADS)

    Gonczol, Eva; Andrews, Peter W.; Plotkin, Stanley A.

    1984-04-01

    To study the mode of action of human cytomegalovirus, an important teratogenic agent in human populations, the susceptibility of a pluripotent human embryonal carcinoma cell line to the virus was investigated. Viral antigens were not expressed nor was infectious virus produced by human embryonal carcinoma cells after infection, although the virus was able to penetrate these cells. In contrast, retinoic acid-induced differentiated derivatives of embryonal carcinoma cells were permissive for antigen expression and infectious virus production. Replication of human cytomegalovirus in human teratocarcinoma cells may therefore depend on cellular functions associated with differentiation.

  19. Human cytomegalovirus (CMV) in Africa: a neglected but important pathogen.

    PubMed

    Bates, Matthew; Brantsaeter, Arne Broch

    2016-01-01

    In Africa, human cytomegalovirus (CMV) is an important pathogen in a diverse range of patient groups. Congenital CMV infection is common, and most children undergo primary infection during the first year of life. Preliminary studies suggest that these early primary CMV infections could have population-wide effects on growth and development. In most studies of adults, CMV seroprevalence is close to 100%, but some studies have found that significant minorities of adults are seronegative. CMV is a common cause of pneumonia and meningitis in hospitalised immunosuppressed patient groups, and CMV DNAemia may be an important marker of rapid progression and poor outcomes of HIV infection, despite roll-out of antiretroviral therapy (ART). Diagnosis and treatment of CMV-related disease is broadly neglected in Africa, and no randomised clinical trials of anti-CMV drugs have been conducted to date. Autopsy is rarely performed in Africa, but identifies CMV as a frequent pathogen when it is carried out. Here we review the available literature on CMV in Africa, primarily in adult patients, and discuss this in the context of contemporary understanding of CMV as a human pathogen. PMID:27482452

  20. Analysis of human cytomegalovirus using the polymerase chain reaction.

    PubMed

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  1. Human cytomegalovirus replicates in gamma-irradiated fibroblasts

    SciTech Connect

    Shanley, J.D.

    1986-12-01

    Because of the unique interdependence of human cytomegalovirus (HCMV) and the physiological state of the host cell, we evaluated the ability of human foreskin fibroblasts (HFF), exposed to gamma radiation, to support HCMV growth. Irradiation of HFF with 2,500 rADS prevented cellular proliferation and suppressed cellular DNA, but not RNA or protein synthesis. Treatment of HFF cells with 2,500 rADS 6 or 48 hours prior to infection did not alter the time course or virus yield during HCMV replication. Virus plaquing efficiency in irradiated cells was comparable to that of nonirradiated cells. As judged by thymidine incorporation and BUdR inhibition of virus replication, HCMV infection induced both thymidine kinase activity and host cell DNA synthesis in irradiated cells. In addition, virus could be recovered from HFF exposed to radiation 0-2 days after infection with HCMV. These studies indicate that the damage to cells by gamma irradiation does not alter the capacity of host cells to support HCMV replication.

  2. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  3. Differential relocation and stability of PML-body components during productive human cytomegalovirus infection: detailed characterization by live-cell imaging.

    PubMed

    Dimitropoulou, Panagiota; Caswell, Richard; McSharry, Brian P; Greaves, Richard F; Spandidos, Demetrios A; Wilkinson, Gavin W G; Sourvinos, George

    2010-10-01

    In controlling the switch from latency to lytic infection, the immediate early (IE) genes lie at the core of herpesvirus pathogenesis. To image the 72kDa human cytomegalovirus (HCMV) major IE protein (IE1-72K), a recombinant virus encoding IE1 fused with EGFP was constructed. Using this construct, the IE1-EGFP fusion was detected at ND10 (PML-bodies) within 2h post infection (p.i.) and the complete disruption of ND10 imaged through to 6h p.i. HCMV genomes and IE2-86K protein could be detected adjacent to the slowly degrading IE1-72K/ND10 foci. IE1-72K associates with metaphase chromatin, recruiting both PML and STAT2. hDaxx, STAT1 and IE2-86K did not re-locate to metaphase chromatin; the fate of hDaxx is particularly important as this protein contributes to an intrinsic barrier to HCMV infection. While IE1-72K participates in a complex with chromatin, PML, STAT2 and Sp100, IE1-72K releases hDaxx from ND10 yet does not appear to remain associated with it.

  4. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  5. Improved detection of mutated human cytomegalovirus UL97 by pyrosequencing.

    PubMed

    Schindele, Birgit; Apelt, Luise; Hofmann, Jörg; Nitsche, Andreas; Michel, Detlef; Voigt, Sebastian; Mertens, Thomas; Ehlers, Bernhard

    2010-12-01

    Ganciclovir (GCV) resistance frequently occurs upon prolonged treatment of ongoing active human cytomegalovirus (HCMV) infection in individuals with immature or compromised immune functions (e.g., recipients of solid-organ and hematopoietic stem cell transplants). Using pyrosequencing (PSQ), we established fast and sensitive detection of GCV resistance-associated mutations occurring in the HCMV open reading frame UL97. These mutations have been repeatedly associated with clinical treatment failure. We designed four PSQ assays and evaluated them by analyzing mixtures of plasmids or bacterial artificial chromosome-derived viruses containing UL97 wild-type and mutant sequences. A minimum level of 6% mutant sequence variants could be detected in these mixtures. In order to further evaluate the novel PSQ assays, we tested clinical specimens from patients with active HCMV infections. The results were compared with those obtained by conventional dideoxy chain terminator sequencing. As the PSQ method was more sensitive in detecting minor HCMV mutant fractions in a wild-type population, it is suggested that pyrosequencing is a useful tool for the early detection of emerging GCV-resistant HCMV in GCV-treated patients.

  6. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    PubMed

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  7. Perivascular Stromal Cells as a Potential Reservoir of Human Cytomegalovirus

    PubMed Central

    Soland, M. A.; Keyes, L. R.; Bayne, R.; Moon, J.; Porada, C. D.; St. Jeor, S.; Almeida-Porada, G.

    2014-01-01

    Human cytomegalovirus (HCMV) infection is an important cause of morbidity and mortality among both solid organ and hematopoietic stem cell transplant recipients. Identification of cells throughout the body that can potentially serve as a viral reservoir is essential to dissect mechanisms of cell tropism and latency and to develop novel therapies. Here, we tested and compared the permissivity of liver-, brain-, lung (LNG)- and bone marrow (BM)-derived perivascular mesenchymal stromal cells (MSC) to HCMV infection and their ability to propagate and produce infectious virus. Perivascular MSC isolated from the different organs have in common the expression of CD146 and Stro-1. While all these cells were permissive to HCMV infection, the highest rate of HCMV infection was seen with LNG-MSC, as determined by viral copy number and production of viral particles by these cells. In addition, we showed that, although the supernatants from each of the HCMV-infected cultures contained infectious virus, the viral copy number and the quantity and timing of virus production varied among the various organ-specific MSC. Furthermore, using quantitative polymerase chain reaction, we were able to detect HCMV DNA in BM-MSC isolated from 7 out of 19 healthy, HCMV-seropositive adults, suggesting that BM-derived perivascular stromal cells may constitute an unrecognized natural HCMV reservoir. PMID:24592822

  8. Identification and expression of a human cytomegalovirus early glycoprotein.

    PubMed Central

    Chang, C P; Vesole, D H; Nelson, J; Oldstone, M B; Stinski, M F

    1989-01-01

    A human cytomegalovirus early gene which possesses three temporally regulated promoters is located in the large unique component of the viral genome between 0.054 and 0.064 map units (C.-P. Chang, C.L. Malone, and M.F. Stinski, J. Virol. 63:281-290, 1989). This gene contains a major open reading frame (ORF) located 233 bases downstream of the cap site of an early unspliced RNA. The major ORF predicts a polypeptide of 17 kilodaltons (kDa) which contains a glycoproteinlike signal and anchor domains as well as potential N-glycosylation sites. Antisera were prepared against synthetic peptides derived from amino acid sequences within the major ORF. The antisera detected a viral glycoprotein of 48 kDa in infected cells and recognized the in vitro-translated 17-kDa protein early-gene product. The viral glycoprotein, designated gp48, was modified by N-linked glycans and possibly O-linked glycans. The synthesis of gp48 occurred in the absence of viral DNA replication but accumulated to the highest levels at late times after infection. Since gp48 was found in the virion, it is considered an early structural glycoprotein. Images PMID:2545908

  9. Identification of binary interactions between human cytomegalovirus virion proteins.

    PubMed

    Phillips, Stacia L; Bresnahan, Wade A

    2011-01-01

    Human cytomegalovirus (HCMV) virions are composed of a DNA-containing nucleocapsid surrounded by a tegument layer and host-derived lipid envelope studded with virally encoded glycoproteins. These complex virions are estimated to be composed of more than 50 viral proteins. Assembly of HCMV virions is poorly understood, especially with respect to acquisition of the tegument; however, it is thought to involve the stepwise addition of virion components through protein-protein interactions. We sought to identify interactions among HCMV virion proteins using yeast two-hybrid analysis. Using 33 known capsid and tegument proteins, we tested 1,089 pairwise combinations for binary interaction in the two-hybrid assay. We identified 24 interactions among HCMV virion proteins, including 13 novel interactions among tegument proteins and one novel interaction between capsid proteins. Several of these novel interactions were confirmed by coimmunoprecipitation of protein complexes from transfected cells. In addition, we demonstrate three of these interactions in the context of HCMV infection. This study reveals several new protein-protein interactions among HCMV tegument proteins, some of which are likely important for HCMV replication and pathogenesis. PMID:20962080

  10. Viperin Regulates Cellular Lipid Metabolism during Human Cytomegalovirus Infection

    PubMed Central

    Seo, Jun-Young; Cresswell, Peter

    2013-01-01

    Human cytomegalovirus (HCMV) has been shown to induce increased lipogenesis in infected cells, and this is believed to be required for proper virion envelopment. We show here that this increase is a consequence of the virus-induced redistribution of the host protein viperin to mitochondria and its capacity to interact with and block the function of the mitochondrial trifunctional protein (TFP), the enzyme that mediates fatty acid-β-oxidation. The resulting decrease in cellular ATP levels activates the enzyme AMP-activated protein kinase (AMPK), which induces expression of the glucose transporter GLUT4, resulting in increased glucose import and translocation to the nucleus of the glucose-regulated transcription factor ChREBP. This induces increased transcription of genes encoding lipogenic enzymes, increased lipid synthesis and lipid droplet accumulation, and generation of the viral envelope. Viperin-dependent lipogenesis is required for optimal production of infectious virus. We show that all of these metabolic outcomes can be replicated by direct targeting of viperin to mitochondria in the absence of HCMV infection, and that the motif responsible for Fe-S cluster binding by viperin is essential. The data indicate that viperin is the major effector underlying the ability of HCMV to regulate cellular lipid metabolism. PMID:23935494

  11. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.

    2015-01-01

    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  12. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  13. Human fetal inner ear involvement in congenital cytomegalovirus infection

    PubMed Central

    2013-01-01

    Background Congenital cytomegalovirus (CMV) infection is a leading cause of sensorineural hearing loss (SNHL). The mechanisms of pathogenesis of CMV-related SNHL are still unclear. The aim is to study congenital CMV-related damage in the fetal inner ear, in order to better understand the underlying pathophysiology behind CMV-SNHL. Results We studied inner ears and brains of 20 human fetuses, all at 21 week gestational age, with a high viral load in the amniotic fluid, with and without ultrasound (US) brain abnormalities. We evaluated histological brain damage, inner ear infection, local inflammatory response and tissue viral load. Immunohistochemistry revealed that CMV was positive in 14/20 brains (70%) and in the inner ears of 9/20 fetuses (45%). In the cases with inner ear infection, the marginal cell layer of the stria vascularis was always infected, followed by infection in the Reissner’s membrane. The highest tissue viral load was observed in the inner ear with infected Organ of Corti. Vestibular labyrinth showed CMV infection of sensory cells in the utricle and in the crista ampullaris. US cerebral anomalies were detected in 6 cases, and in all those cases, the inner ear was always involved. In the other 14 cases with normal brain scan, histological brain damage was present in 8 fetuses and 3 of them presented inner ear infection. Conclusions CMV-infection of the marginal cell layer of the stria vascularis may alter potassium and ion circulation, dissipating the endocochlear potential with consequent SNHL. Although abnormal cerebral US is highly predictive of brain and inner ear damage, normal US findings cannot exclude them either. PMID:24252374

  14. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  15. A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus.

    PubMed

    Andreoni, M; Faircloth, M; Vugler, L; Britt, W J

    1989-02-01

    We have developed a murine monoclonal antibody reactive with a major immediate early 72,000 dalton protein of human cytomegalovirus and utilized this reagent in a rapid virus titration and microneutralization assay. Because of the early expression of this virus encoded protein, both assays could be accomplished within 16 h following virus inoculation. In addition, both assays resulted in considerable savings of reagents because the assays were carried out in 96-well microtiter plates. These assays should prove useful in the preparation and study of neutralizing antibodies directed against human cytomegalovirus.

  16. Two Novel Human Cytomegalovirus NK Cell Evasion Functions Target MICA for Lysosomal Degradation

    PubMed Central

    Fielding, Ceri A.; Aicheler, Rebecca; Stanton, Richard J.; Wang, Eddie C. Y.; Han, Song; Seirafian, Sepehr; Davies, James; McSharry, Brian P.; Weekes, Michael P.; Antrobus, P. Robin; Prod'homme, Virginie; Blanchet, Fabien P.; Sugrue, Daniel; Cuff, Simone; Roberts, Dawn; Davison, Andrew J.; Lehner, Paul J.; Wilkinson, Gavin W. G.; Tomasec, Peter

    2014-01-01

    NKG2D plays a major role in controlling immune responses through the regulation of natural killer (NK) cells, αβ and γδ T-cell function. This activating receptor recognizes eight distinct ligands (the MHC Class I polypeptide-related sequences (MIC) A andB, and UL16-binding proteins (ULBP)1–6) induced by cellular stress to promote recognition cells perturbed by malignant transformation or microbial infection. Studies into human cytomegalovirus (HCMV) have aided both the identification and characterization of NKG2D ligands (NKG2DLs). HCMV immediate early (IE) gene up regulates NKGDLs, and we now describe the differential activation of ULBP2 and MICA/B by IE1 and IE2 respectively. Despite activation by IE functions, HCMV effectively suppressed cell surface expression of NKGDLs through both the early and late phases of infection. The immune evasion functions UL16, UL142, and microRNA(miR)-UL112 are known to target NKG2DLs. While infection with a UL16 deletion mutant caused the expected increase in MICB and ULBP2 cell surface expression, deletion of UL142 did not have a similar impact on its target, MICA. We therefore performed a systematic screen of the viral genome to search of addition functions that targeted MICA. US18 and US20 were identified as novel NK cell evasion functions capable of acting independently to promote MICA degradation by lysosomal degradation. The most dramatic effect on MICA expression was achieved when US18 and US20 acted in concert. US18 and US20 are the first members of the US12 gene family to have been assigned a function. The US12 family has 10 members encoded sequentially through US12–US21; a genetic arrangement, which is suggestive of an ‘accordion’ expansion of an ancestral gene in response to a selective pressure. This expansion must have be an ancient event as the whole family is conserved across simian cytomegaloviruses from old world monkeys. The evolutionary benefit bestowed by the combinatorial effect of US18 and US20 on

  17. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  18. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  19. Characterization of membrane antigens on human cytomegalovirus-infected fibroblasts recognized by human antibodies

    SciTech Connect

    van der Voort, L.H.M.; de Leij, L.F.M.H.; The T.H.

    1989-03-01

    The antigens on the surface of human cytomegalovirus (HCMV)-infected fibroblasts which are recognized by human HCMV antibody-positive sera were characterized. Three HCMV-induced polypeptides, with apparent molecular masses of 53 to 63, 94, and 94 to 120 kilodaltons, were precipitated from /sup 125/I-surface-labeled cell extracts with different sera obtained from healthy individuals. Renal transplant recipients who were suffering from active HCMV infections recognized the same set of antigens. By the use of monoclonal antibodies, these antigens were identified as polypeptides belonging to the gcI and gcIII families of HCMV glycoproteins.

  20. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape.

    PubMed

    Landolfo, Santo; De Andrea, Marco; Dell'Oste, Valentina; Gugliesi, Francesca

    2016-08-12

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed "restriction factors" (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell's intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  1. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape

    PubMed Central

    Landolfo, Santo; De Andrea, Marco; Dell’Oste, Valentina; Gugliesi, Francesca

    2016-01-01

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed “restriction factors” (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell’s intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  2. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela

    2016-01-01

    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  3. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  4. Human cytomegalovirus and transplantation: drug development and regulatory issues.

    PubMed

    McIntosh, Megan; Hauschild, Benjamin; Miller, Veronica

    2016-01-01

    Cytomegalovirus (CMV) infection is highly prevalent worldwide and can cause serious disease among immunocompromised individuals, including persons with HIV and transplant recipients on immunosuppressive therapies. It can also result in congenital cytomegalovirus when women are infected during pregnancy. Treatment and prevention of CMV in solid organ and haematopoietic stem cell transplant recipients is accomplished in one of three ways: (1) prophylactic therapy to prevent CMV viraemia; (2) pre-emptive therapy for those with low levels of replicating virus; and (3) treatment for established disease. Despite the high prevalence of CMV, there are few available approved drug therapies, and those that are available are hampered by toxicity and less-than-optimal efficacy. New therapies are being developed and tested; however, inconsistency in standardisation of virus levels and questions about potential endpoints in clinical trials present regulatory hurdles that must be addressed. This review covers the current state of CMV therapy, drugs currently under investigation, and clinical trial issues and questions that are in need of resolution. PMID:27482453

  5. RT-qPCR-based microneutralization assay for human cytomegalovirus using fibroblasts and epithelial cells.

    PubMed

    Wang, Xiao; Peden, Keith; Murata, Haruhiko

    2015-12-16

    Human cytomegalovirus (HCMV) is a leading cause of congenital infection that can result in serious disabilities in affected children. To facilitate HCMV vaccine development, a microscale neutralization assay based on reverse transcription quantitative PCR (RT-qPCR) was developed to quantify HCMV-neutralizing antibodies. Our approach relies on the generation of crude lysates from virus-infected cells that are amenable to direct analysis by RT-qPCR, thereby circumventing rate-limiting procedures associated with sample RNA extraction and purification. By serial passaging of the laboratory HCMV strain AD169 in epithelial cells (ARPE-19), a revertant virus with restored epithelial cell tropism, designated AD169(wt131), was obtained. AD169 and AD169(wt131) were evaluated in both epithelial cells (ARPE-19) and fibroblasts (MRC-5) by one-step RT-qPCR targeting the immediate-early gene IE1 transcript of HCMV. Expression kinetics indicated that RT-qPCR assessment could be conducted as early as 6h post-infection. Human serum samples (n=30) from healthy donors were tested for HCMV-specific IgG using a commercially available ELISA and for HCMV-neutralizing activity using our RT-qPCR-based neutralization assay. In agreement with the ELISA results, higher neutralizing activity was observed in the HCMV IgG seropositive group when compared with the HCMV IgG seronegative group. In addition, HCMV IgG seropositive human sera exhibited higher neutralizing titers using epithelial cells compared with using fibroblasts (geometric mean titers of 344 and 8 in ARPE-19 cells and MRC-5 cells, respectively). Our assay was robust to variation in input virus dose. In addition, a simple lysis buffer containing a non-ionic detergent was successfully demonstrated to be a less costly alternative to commercial reagents for cell-lysate preparation. Thus, our rapid HCMV neutralization assay may be a straightforward and flexible high-throughput tool for measuring antibody responses induced by vaccination

  6. The human fibroblast receptor for gp86 of human cytomegalovirus is a phosphorylated glycoprotein.

    PubMed Central

    Keay, S; Baldwin, B

    1992-01-01

    A human embryonic lung (HEL) cell receptor for gp86 of human cytomegalovirus that functions in virus-cell fusion was further characterized. Anti-idiotype antibodies that mimic gp86 were used to immunoprecipitate the 92.5-kDa fibroblast membrane receptor for gp86, which was preincubated with various endoglycosidases. The receptor, which has a pI ranging from 5.3 to 5.6, appears to be a glycoprotein with primarily N-linked sugar residues, some of which have high concentrations of mannose and some of which are complex oligosaccharides. Western blots (immunoblots) of electrophoretically transferred receptor incubated with various biotinylated lectins confirmed the presence of sugar moieties, including N-acetylglucosamine, glucose or mannose, and galactose, but not fucose or N-acetylgalactosamine. This gp86 receptor from uninfected HEL cells also incorporated radiolabeled phosphate from orthophosphoric acid, indicating that it is a constitutively phosphorylated receptor. Images PMID:1321272

  7. Receptor expression and responsiveness of human peripheral blood mononuclear cells to a human cytomegalovirus encoded CC chemokine.

    PubMed

    Zheng, Qi; Xu, Jun; Gao, Huihui; Tao, Ran; Li, Wei; Shang, Shiqiang; Gu, Weizhong

    2015-01-01

    Human cytomegalovirus is a ubiquitous pathogen that infects the majority of the world's population. After long period of time co-evolving with human being, this pathogen has developed several strategies to evade host immune surveillance. One of the major trick is encoding homologous to those of the host organism or stealing host cellular genes that have significant functions in immune system. To date, we have found several viral immune analogous which include G protein coupled receptor, class I major histocompatibility complex and chemokine. Chemokine is a small group of molecules which is defined by the presence of four cysteines in highly conserved region. The four kinds of chemokines (C, CC, CXC, and CX3C) are classified based on the arrangement of 1 or 2 N-terminal cysteine residues. UL128 protein is one of the analogous that encoded by human cytomegalovirus that has similar amino acid sequences to the human CC chemokine. It has been proved to be one of the essential particles that involved in human cytomegalovirus entry into epithelial/endothelial cells as well as macrophages. It is also the target of potent neutralizing antibodies in human cytomegalovirus-seropositive individuals. We had demonstrated the chemotactic trait of UL128 protein in our previous study. Recombinant UL128 in vitro has the ability to attract monocytes to the infection region and enhances peripheral blood mononuclear cell proliferation by activating the MAPK/ERK signaling pathway. However, the way that this viral encoded chemokine interacting with peripheral blood mononuclear cells and the detailed mechanism that involving the virus entry into host cells keeps unknown. Here we performed in vitro investigation into the effects of UL128 protein on peripheral blood mononuclear cell's activation and receptor binding, which may help us further understand the immunomodulatory function of UL128 protein as well as human cytomegalovirus diffusion mechanism.

  8. Detection of human cytomegalovirus and epstein-barr virus in coronary atherosclerotic tissue.

    PubMed

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-07-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

  9. On the association of human beta 2 microglobulin with cell culture-grown human cytomegalovirus (HCMV).

    PubMed

    Yamashita, Y; Shimokata, K; Nishiyama, Y

    1992-09-01

    We studied the production of human beta 2 microglobulin (beta 2m) in mock-infected or human cytomegalovirus (HCMV) infected human embryonic lung fibroblasts (HEL) and the association of human beta 2m with HCMV virions. Titration of beta 2m by two-step sandwich enzyme immunoassay revealed that HEL released considerable amounts of human beta 2m into the culture medium and that the production of beta 2m was significantly enhanced by HCMV infection. The concentration of human beta 2m in the culture medium of HCMV-infected HEL reached 500 to 600 ng/ml, which corresponded to 7- to 12-fold of levels found in healthy adult urine. Immunoprecipitation assays showed that HEL-grown HCMV bound a significant amount of endogenous beta 2m, but the viruses were efficiently neutralized by either human hyperimmune anti-HCMV globulin or anti-HCMV monoclonal antibody even when treated with a large amount of human beta 2m or with dialysed urine. Thus it seems unlikely that the binding of beta 2m by HCMV is involved in masking the viral antigenic site necessary for neutralization.

  10. Expression of the Human Cytomegalovirus UL97 Gene in a Chimeric Guinea Pig Cytomegalovirus (GPCMV) Results in Viable Virus with Increased Susceptibility to Ganciclovir and Maribavir

    PubMed Central

    McGregor, Alistair; Choi, K. Yeon; Cui, Xiaohong; McVoy, Michael A.; Schleiss, Mark R.

    2009-01-01

    In lieu of a licensed vaccine, antivirals are being considered as an intervention to prevent congenital human cytomegalovirus (HCMV) infection. Ideally, antiviral therapies should undergo pre-clinical evaluation in an animal model prior to human use. Guinea pig cytomegalovirus (GPCMV) is the only small animal model for congenital CMV. However, GPCMV is not susceptible to the most commonly used HCMV antiviral, ganciclovir (GCV), rendering in vivo study of this agent problematic in the guinea pig model. Human cytomegalovirus (HCMV) susceptibility to GCV is linked to the UL97 gene. We hypothesized that GPCMV susceptibility to GCV could be improved by inserting the HCMV (Towne) UL97 gene into the GPCMV genome in place of the homolog, GP97. A chimeric GPCMV (GPCMV::UL97) expressed UL97 protein, and replicated efficiently in cell culture, with kinetics similar to wild-type GPCMV. In contrast, deletion of GP97 resulted in a virus (GPCMVdGP97) that grew poorly in culture. GPCMV::UL97 had substantially improved susceptibility to the inhibitory effects of GCV in comparison to wild-type GPCMV. Additionally, GPCMV::UL97 exhibited improved susceptibility to another antiviral undergoing clinical trials, maribavir (MBV; benzimidazole riboside 1263W94), which also acts through UL97. PMID:18325607

  11. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  12. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang

    2016-01-01

    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  13. Quantitative Proteomic Analyses of Human Cytomegalovirus-Induced Restructuring of Endoplasmic Reticulum-Mitochondrial Contacts at Late Times of Infection*

    PubMed Central

    Zhang, Aiping; Williamson, Chad D.; Wong, Daniel S.; Bullough, Matthew D.; Brown, Kristy J.; Hathout, Yetrib; Colberg-Poley, Anamaris M.

    2011-01-01

    Endoplasmic reticulum-mitochondrial contacts, known as mitochondria-associated membranes, regulate important cellular functions including calcium signaling, bioenergetics, and apoptosis. Human cytomegalovirus is a medically important herpesvirus whose growth increases energy demand and depends upon continued cell survival. To gain insight into how human cytomegalovirus infection affects endoplasmic reticulum-mitochondrial contacts, we undertook quantitative proteomics of mitochondria-associated membranes using differential stable isotope labeling by amino acids in cell culture strategy and liquid chromatography-tandem MS analysis. This is the first reported quantitative proteomic analyses of a suborganelle during permissive human cytomegalovirus infection. Human fibroblasts were uninfected or human cytomegalovirus-infected for 72 h. Heavy mitochondria-associated membranes were isolated from paired unlabeled, uninfected cells and stable isotope labeling by amino acids in cell culture-labeled, infected cells and analyzed by liquid chromatography-tandem MS analysis. The results were verified by a reverse labeling experiment. Human cytomegalovirus infection dramatically altered endoplasmic reticulum-mitochondrial contacts by late times. Notable is the increased abundance of several fundamental networks in the mitochondria-associated membrane fraction of human cytomegalovirus-infected fibroblasts. Chaperones, including HSP60 and BiP, which is required for human cytomegalovirus assembly, were prominently increased at endoplasmic reticulum-mitochondrial contacts after infection. Minimal translational and translocation machineries were also associated with endoplasmic reticulum-mitochondrial contacts and increased after human cytomegalovirus infection as were glucose regulated protein 75 and the voltage dependent anion channel, which can form an endoplasmic reticulum-mitochondrial calcium signaling complex. Surprisingly, mitochondrial metabolic enzymes and cytosolic

  14. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  15. Human cytomegalovirus latency-associated protein LUNA is expressed during HCMV infections in vivo.

    PubMed

    Bego, Mariana G; Keyes, Lisa R; Maciejewski, Jarek; St Jeor, Stephen C

    2011-10-01

    Human cytomegalovirus (HCMV) latency is poorly understood. We previously described a novel HCMV latency-associated transcript, UL81-82ast, coding for a protein designated LUNA (latency unique natural antigen). The aim of this study was to confirm the presence of LUNA in HCMV-seropositive donors. Standard co-immunoprecipitation and ELISA assays were used to detect antibodies against the LUNA protein in the sera of HCMV-seropositive donors. Specific antibodies against LUNA were detected in all HCMV-seropositive donors but in none of the seronegative donors. These data confirm that LUNA is expressed during in vivo infections and is capable of eliciting an immune response.

  16. Isolation and partial chemical characterization of a 64,000-dalton glycoprotein of human cytomegalovirus

    SciTech Connect

    Clark, B.R.; Zaia, J.A.; Balce-Directo, L.; Ting, Y.P.

    1984-01-01

    A guanidinium chloride extract of (/sup 3/H)glucosamine- and (/sup 35/S)methionine-labeled virions plus dense bodies of human cytomegalovirus (Towne) was separated by reverse-phase high-pressure liquid chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the eluate revealed the major peak to be a glycoprotein with a relative mass of 64,000. This glycoprotein (HCMVgp64) was characterized by amino acid analysis and a high-pressure liquid chromatographic map of its tryptic peptides.

  17. Detection of Human Cytomegalovirus and Epstein-Barr Virus in Coronary Atherosclerotic Tissue

    PubMed Central

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-01-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples. PMID:24031529

  18. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.

    2016-01-01

    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  19. Role of myeloid human cytomegalovirus infection in children's idiopathic thrombocytopenic purpura.

    PubMed

    Ding, Yan; Zhao, Lei; Mei, Hong; Zhang, Shu-Ling; Huang, Zhi-Hua

    2007-01-01

    This project explores the specificity of myeloid human cytomegalovirus (HCMV) infection in pathogenesis of idiopathic thrombocytopenic purpura (ITP). Eighty-one subjects with ITP were observed. HCMV early antigen and related myeloid cells in bone marrow, and platelet, HCMV IgM, and IgG in blood were tested. The results presented potent evidence that myeloid HCMV infection is a specific factor in children's ITP: patients of ITP with myeloid HCMV infection had a tendency for exacerbation, refractoriness, and chronic advance. However, HCMV did not affect the quantity of megakaryocyte, which showed the complicated relationships between HCMV and ITP.

  20. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  1. Human cytomegalovirus transcriptome activity differs during replication in human fibroblast, epithelial and astrocyte cell lines

    PubMed Central

    Towler, James C.; Ebrahimi, Bahram; Lane, Brian; Davison, Andrew J.

    2012-01-01

    Broad cell tropism contributes to the pathogenesis of human cytomegalovirus (HCMV), but the extent to which cell type influences HCMV gene expression is unclear. A bespoke HCMV DNA microarray was used to monitor the transcriptome activity of the low passage Merlin strain of HCMV at 12, 24, 48 and 72 h post-infection, during a single round of replication in human fetal foreskin fibroblast cells (HFFF-2s), human retinal pigmented epithelial cells (RPE-1s) and human astrocytoma cells (U373MGs). In order to correlate transcriptome activity with concurrent biological responses, viral cytopathic effect, growth kinetics and genomic loads were examined in the three cell types. The temporal expression pattern of viral genes was broadly similar in HFFF-2s and RPE-1s, but dramatically different in U373MGs. Of the 165 known HCMV protein-coding genes, 41 and 48 were differentially regulated in RPE-1s and U373MGs, respectively, compared with HFFF-2s, and 22 of these were differentially regulated in both RPE-1s and U373MGs. In RPE-1s, all differentially regulated genes were downregulated, but, in U373MGs, some were down- and others upregulated. Differentially regulated genes were identified among the immediate-early, early, early late and true-late viral gene classes. Grouping of downregulated genes according to function at landmark stages of the replication cycle led to the identification of potential bottleneck stages (genome replication, virion assembly, and virion maturation and release) that may account for cell type-dependent viral growth kinetics. The possibility that cell type-specific differences in expressed cellular factors are responsible for modulation of viral gene expression is discussed. PMID:22258857

  2. Sequestration of human cytomegalovirus by human renal and mammary epithelial cells

    SciTech Connect

    Twite, Nicolas; Andrei, Graciela; Kummert, Caroline; Donner, Catherine; Perez-Morga, David; De Vos, Rita; Snoeck, Robert; Marchant, Arnaud

    2014-07-15

    Urine and breast milk represent the main routes of human cytomegalovirus (HCMV) transmission but the contribution of renal and mammary epithelial cells to viral excretion remains unclear. We observed that kidney and mammary epithelial cells were permissive to HCMV infection and expressed immediate early, early and late antigens within 72 h of infection. During the first 24 h after infection, high titers of infectious virus were measured associated to the cells and in culture supernatants, independently of de novo synthesis of virus progeny. This phenomenon was not observed in HCMV-infected fibroblasts and suggested the sequestration and the release of HCMV by epithelial cells. This hypothesis was supported by confocal and electron microscopy analyses. The sequestration and progressive release of HCMV by kidney and mammary epithelial cells may play an important role in the excretion of the virus in urine and breast milk and may thereby contribute to HCMV transmission. - Highlights: • Primary renal and mammary epithelial cells are permissive to HCMV infection. • HCMV is sequestered by epithelial cells and this phenomenon does not require viral replication. • HCMV sequestration by epithelial cells is reduced by antibodies and IFN-γ.

  3. Structural analysis of the major immediate early gene of human cytomegalovirus

    SciTech Connect

    Stenberg, R.M.; Thomsen, D.R.; Stinski, M.F.

    1984-01-01

    The most abundant species of human cytomegalovirus (Towne) immediate early polysome-associated RNA originates from a region of ca. 2.8 kilobases within the XbaI-E DNA fragment. These sequences code for a 1.95-kilobase mRNA and are referred to as immediate early coding region one. The authors have utilized the nuclease mapping technique of Berk and Sharp to examine this gene in detail. Cloned fragments of human cytomegalovirus DNA, either labeled with /sup 32/P in vivo or end labeled in vitro at the 5' or 3' termini, were hybridized to immediate early polysome-associated RNA. The hybrids were treated with single-strand-specific nuclease and subjected to electrophoresis in either neutral or denaturing gels. The major transcript was shown to be spliced molecule containing a 3' terminal exon of 1341 nucleotides. The sequence of the exons as well as the locations of the intro-exon splice junctions were determined. The predicted molecular weight of the polypeptide originating from this region was estimated to be 64,000. The properties of the viral gene and its protein product are discussed.

  4. [Indirect ultramicroElisa for the detection of total antibodies against cytomegaloviruses in human blood].

    PubMed

    Laferte, J; Marrero, M; Alvarez, M; Jomarron, L; Garcia, S; Vazquez, S; Morier, L; Ulacia, M; Melchor, A

    1992-01-01

    We have standardized an indirect ultramicro ELISA assay for detecting antibodies to human Cytomegalovirus (CMV) using human serum samples (UMELISA CMV). The optimal concentration of coating antigen (30 ug/ml), serum dilution (1:40) and anti-human conjugate working dilution (1:1500), were determined by a check board titration method. The UMELISA CMV was compared with the latex agglutination test for antibodies to CMV (Dupont de Nemours) and with an indirect immunofluorescent method. The results have showed the high coincidence, sensitivity and especificity of the proposed assay regarding the two methods compared with, and supporting its use either for a blood donors screening or in the serological diagnosis of this infection by paired serum samples.

  5. Monoclonal antibody E-13 (M-810) to human cytomegalovirus recognizes an epitope encoded by exon 2 of the major immediate early gene.

    PubMed

    Mazeron, M C; Jahn, G; Plachter, B

    1992-10-01

    Monoclonal antibody (MAb) E-13 to human cytomegalovirus is used widely for diagnostic and fundamental studies, and has been shown to be directed against an immediate early (IE) protein(s). To determine which viral antigen is detected by MAb E-13, four subfragments from the open reading frame encoded by exons 2, 3 or 4 of IE-1 were cloned in the bacterial expression vector pROS. The resulting fusion proteins contained amino acids 77 to 491 encoded by mainly exon 4, amino acids 25 to 78 encoded by exon 3, amino acids 1 to 85 encoded by exons 2 and 3, and amino acids 1 to 24 encoded by exon 2. The reactivity of MAb E-13 with the fusion proteins was assayed by Western blotting. MAb E-13 was shown to react exclusively with proteins encoded by exon 2 and therefore recognizes IE proteins which contain the N-terminal amino acid sequence encoded by exon 2, namely the major 72K IE protein, the 82K to 86K IE-2 protein and the 52K to 55K IE-2 protein. MAb E-13 can be used to detect both IE-1- and IE-2-encoded proteins, which share the polypeptide encoded by exon 2. PMID:1383398

  6. Immune evasion proteins gpUS2 and gpUS11 of human cytomegalovirus incompletely protect infected cells from CD8 T cell recognition.

    PubMed

    Besold, K; Wills, M; Plachter, B

    2009-08-15

    Human cytomegalovirus (HCMV) encodes four glycoproteins, termed gpUS2, gpUS3, gpUS6 and gpUS11 that interfere with MHC class I biosynthesis and antigen presentation. Despite gpUS2-11 expression, however, HCMV infection is efficiently controlled by cytolytic CD8 T lymphocytes (CTL). To address the role of gpUS2 and gpUS11 in antigen presentation during viral infection, HCMV mutants were generated that expressed either gpUS2 or gpUS11 alone without coexpression of the three other proteins. Fibroblasts infected with these viruses showed reduced HLA-A2 and HLA-B7 surface expression. Surprisingly, however, CTL directed against the tegument protein pp65 and the regulatory IE1 protein still recognized and lysed mutant virus infected fibroblasts. Yet, suppression of IE1 derived peptide presentation by gpUS2 or gpUS11 was far more pronounced. The results show that gpUS2 and gpUS11 alone only incompletely protect HCMV infected fibroblasts from CTL recognition and underline the importance of studying infected cells to elucidate HCMV immune evasion.

  7. Thrombin induces Sp1-mediated antiviral effects in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Prösch, Susanna; Kotchetkov, Ruslan; Cinatl, Jaroslav; Koch, Frank; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-11-01

    Human cytomegalovirus (HCMV) retinitis causing retinal detachment and destruction of the blood-retina barrier is closely related to retinal hemorrhage/coagulation. However, the effects of procoagulants on HCMV (re)activation in retinal cells have not been investigated yet. Therefore, we studied whether thrombin modulates the expression of HCMV immediate early (IE) and late (L) genes in cultured human retinal pigment epithelial cells (RPE). Thrombin specifically stimulated the protease-activated receptor-1 (PAR-1) on RPE and, surprisingly, inhibited basal and 12,0-tetradecanoylphorbol 13-acetate-stimulated HCMV IE gene expression in infected RPE. On the other hand, HCMV strongly induced Sp1 DNA binding activity, which was prevented by thrombin/PAR1-mediated Sp1 hyperphosphorylation. Our data suggest that thrombin/PAR-1 may inhibit Sp1-dependent HCMV replication, which might be an important regulatory mechanism for HCMV persistence and replication in RPE.

  8. Synergistic effects by combination of ganciclovir and tricin on human cytomegalovirus replication in vitro.

    PubMed

    Yamada, Rie; Suda, Hideki; Sadanari, Hidetaka; Matsubara, Keiko; Tuchida, Yuuzo; Murayama, Tsugiya

    2016-01-01

    It has been demonstrated as the first report that combination treatment with ganciclovir (GCV) and tricin (4',5,7-trihydroxy-3',5' -dimethoxyflavone), a derivative of Sasa albo-marginata, after human cytomegalovirus (HCMV) infection has synergistic effects on both infectious virus production and HCMV DNA synthesis in the human embryonic fibroblast cell line MRC-5. In this paper, we examined the anti-HCMV effects of GCV plus various concentrations of tricin, and tricin plus various concentrations of GCV in MRC-5 cells. We found that expression of the HCMV UL54 gene was significantly inhibited by combination of GCV with tricin when compared with GCV mono-treatment. These results suggest that tricin is a novel compound for combination therapy with GCV against HCMV replication. In addition, reduced-dose combination therapy may provide a direction for treatment in patients with HCMV infection while reducing drug toxicity.

  9. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.

    2015-01-01

    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  10. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian

    2014-01-01

    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  11. [HUMAN CYTOMEGALOVIRUS INFECTION AND SPONTANEOUS ABORTION IN PREGNANT WOMEN OF I AND II TRIMESTER].

    PubMed

    Cheshik, S G; Kisteneva, L B

    2016-01-01

    The goal of this work was the evaluation of the frequency of human CMV infection among the women, whose pregnancy ended in miscarriage, detection of active forms of infection and treatment before pregnancy. Virological and sero-immunological techniques were used. A total of 116 women who had miscarriages before the 28 week of pregnancy were submitted to the CMV test. 109 women (94.0%) demonstrated positive results. 49 women (42.2%) had active form of the cytomegalovirus infection. 13 women (26.5%) had the recurrent form and 36 patients (73.5%) had the persistent form of CMV infection (stage of productive replication). All the women with active CMVI were treated before the next pregnancy. Immunomodulatory therapy for the treatment was used. PMID:27451499

  12. Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

    PubMed Central

    Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

    2011-01-01

    Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

  13. The tiers and dimensions of evasion of the type I interferon response by human cytomegalovirus.

    PubMed

    Amsler, Lisi; Verweij, Marieke C; DeFilippis, Victor R

    2013-12-13

    Human cytomegalovirus (HCMV) is a member of the β-herpesvirus family that invariably occupies hosts for life despite a consistent multi-pronged antiviral immune response that targets the infection. This persistence is enabled by the large viral genome that encodes factors conferring a wide assortment of sophisticated, often redundant phenotypes that disable or otherwise manipulate impactful immune effector processes. The type I interferon system represents a first line of host defense against infecting viruses. The physiological reactions induced by secreted interferon act to effectively block replication of a broad spectrum of virus types, including HCMV. As such, the virus must exhibit counteractive mechanisms to these responses that involve their inhibition, tolerance, or re-purposing. The goal of this review is to describe the impact of the type I interferon system on HCMV replication and to showcase the number and diversity of strategies employed by the virus that allow infection of hosts in the presence of interferon-dependent activity.

  14. Binding of transcription factors and creation of a large nucleoprotein complex on the human cytomegalovirus enhancer

    SciTech Connect

    Ghazal, P.; Lubon, H.; Fleckenstein, B.; Hennighausen, L.

    1987-06-01

    The effect of the human cytomegalovirus immediate early region 1 enhancer on transcription was studied in vitro with HeLa cell nuclear extract. Stimulation of in vitro transcription mediated by the enhancer element involves its recognition by specific trans-acting factors present in the nuclear extract. DNase I protection analysis was used to determine at the nucleotide level those enhancer sequences that interact with nuclear factors. At least nine sites of protein-DNA interaction were detected over approx. = 400 base pairs of enhancer sequence. The regions of nuclease protection are associated with 21-, 19-, 18-, and 17-base-pair repeat elements as well as with a unique sequence, creating a large nucleoprotein complex. The relationship between the protein binding and the activity of the immediate early region 1 enhancer is discussed.

  15. [HUMAN CYTOMEGALOVIRUS INFECTION AND SPONTANEOUS ABORTION IN PREGNANT WOMEN OF I AND II TRIMESTER].

    PubMed

    Cheshik, S G; Kisteneva, L B

    2016-01-01

    The goal of this work was the evaluation of the frequency of human CMV infection among the women, whose pregnancy ended in miscarriage, detection of active forms of infection and treatment before pregnancy. Virological and sero-immunological techniques were used. A total of 116 women who had miscarriages before the 28 week of pregnancy were submitted to the CMV test. 109 women (94.0%) demonstrated positive results. 49 women (42.2%) had active form of the cytomegalovirus infection. 13 women (26.5%) had the recurrent form and 36 patients (73.5%) had the persistent form of CMV infection (stage of productive replication). All the women with active CMVI were treated before the next pregnancy. Immunomodulatory therapy for the treatment was used.

  16. Sustained expression of human cytomegalovirus glycoprotein B (UL55) in the seeds of homozygous rice plants.

    PubMed

    Tackaberry, Eilleen S; Prior, Fiona A; Rowlandson, Karen; Tocchi, Monika; Mehic, Jelica; Porter, Suzanne; Walsh, Mike; Schleiss, Mark R; Ganz, Peter R; Sardana, Ravinder K; Altosaar, Illimar; Dudani, Anil K

    2008-09-01

    Production of recombinant subunit vaccines in transgenic plants may be a means of reducing vaccine costs while increasing availability and safety. A plant-derived product found safe and effective for oral administration would provide additional advantages when used as a vaccine. Outstanding issues with the technology include transgene stability through successive generations and consistent bioproduction. We previously reported expression of glycoprotein B (gB) of human cytomegalovirus in seeds of transgenic tobacco. Here the goal was to determine if gB could be similarly expressed in rice, and if so, to examine expression over several plant generations. Results show that immunoreactive gB was successfully expressed in transgenic rice seeds, with sustained expression over three generations. The gB contained several neutralizing epitopes and was stable over 27 months.

  17. Functional and structural characterisation of AgMNPV ie1.

    PubMed

    Bilen, Marcos Fabián; Pilloff, Marcela Gabriela; Belaich, Mariano Nicolás; Da Ros, Vanina Gabriela; Rodrigues, Julio Carlyle; Ribeiro, Bergmann Morais; Romanowski, Víctor; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2007-12-01

    We have located and cloned the Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate 2D (AgMNPV-2D) genomic DNA fragment containing the immediate early 1 ORF and its flanking regions. Computer assisted analysis of the complete ie1 locus nucleotide sequence information was used to locate regulatory signals in the upstream region and conserved nucleotide and amino acid sequences. Comparative studies led to the identification of several characteristic protein motifs and to the conclusion that AgMNPV-2D is more closely related to Choristoneura fumiferana defective NPV than to other Group I nucleopolyhedrovirus. We have also shown that the AgMNPV IE1 protein was able to transactivate an early Autographa californica MNPV promoter and its own promoter in transient expression assays. In order to investigate the biological functionality of the ie1 promoter, the ie1 upstream activating region (UAR) was molecularly dissected and cloned upstream of the E. coli lacZ ORF. The results obtained, after transfection of UFL-AG-286 insect cells, leading us to find that the -492 and -357 versions contains sequence motifs important for the level of the lacZ reporter gene expression. PMID:17682932

  18. Human Cytomegalovirus Up-Regulates Endothelin Receptor Type B: Implication for Vasculopathies?

    PubMed Central

    Yaiw, Koon-Chu; Mohammad, Abdul-Aleem; Costa, Helena; Taher, Chato; Badrnya, Sigrun; Assinger, Alice; Wilhelmi, Vanessa; Ananthaseshan, Sharan; Estekizadeh, Atosa; Davoudi, Belghis; Ovchinnikova, Olga; Shlyakhto, Eugene; Rafnsson, Arnar; Khan, Zahidul; Butler, Lynn; Rahbar, Afsar; Pernow, John; Söderberg-Nauclér, Cecilia

    2015-01-01

    Background. Both endothelin receptor type B ([ETBR], a G protein-coupled receptor that mediates the vascular effects of the potent vasoconstrictor endothelin-1) and human cytomegalovirus ([HCMV], a ubiquitous herpesvirus) have been implicated in the pathogenesis of cardiovascular disease (CVD). The effects of HCMV infection on ETBR expression are unknown. We hypothesized that HCMV may contribute to the pathogenesis of CVD via ETBR modulation. Methods. Human CMV effects on ETBR were studied in vitro in endothelial cells (ECs) and smooth muscle cells (SMCs) and ex vivo in human carotid plaque tissue specimens. Expression of ETBR and viral immediate-early were quantified using quantitative polymerase chain reaction. Functional consequences after ETBR blockade in ECs were examined by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide proliferation, wound healing, tube formation, and flow adhesion assays. Results. Human CMV is capable of upregulating both ETBR mRNA and protein expression in ECs and SMCs. The ETBR was also abundantly expressed in ECs, foam cells, and SMCs, and, more importantly, in HCMV-positive cells in human carotid plaques. Endothelin receptor type B blockade led to decreased proliferation and reduced tumor necrosis factor α-mediated leukocyte recruitment in both uninfected and HCMV-infected ECs. Direct HCMV infection was antimigratory and antiangiogenic in ECs. Conclusions. Human CMV may contribute to CVD via ETBR induction. PMID:26719843

  19. A rapid DNA extraction method from culture and clinical samples. Suitable for the detection of human cytomegalovirus by the polymerase chain reaction.

    PubMed

    Zandotti, C; De Lamballerie, X; Guignole-Vignoli, C; Bollet, C; De Micco, P

    1993-02-01

    We propose an one-step DNA extraction method suitable for the polymerase chain reaction. This procedure utilizes Chelex 100, a chelating in exchange resin. This technique was compared with a traditional technique (proteinase K lysis, phenol-chloroform extraction and ethanol precipitation) for isolation of human cytomegalovirus DNA from clinical samples. The procedure using Chelex 100 appeared to be a simple and fast extraction method for human cytomegalovirus DNA.

  20. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands.

  1. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands. PMID:24185855

  2. Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains.

    PubMed Central

    Cha, T A; Tom, E; Kemble, G W; Duke, G M; Mocarski, E S; Spaete, R R

    1996-01-01

    Nucleotide sequence comparisons were performed on a highly heterogeneous region of three human cytomegalovirus strains, Toledo, Towne, and AD169. The low-passage, virulent Toledo genome contained a DNA segment of approximately 13 kbp that was not found in the Towne genome and a segment of approximately 15 kbp that was not found in the AD169 genome. The Towne strain contained approximately 4.7 kbp of DNA that was absent from the AD169 genome, and only about half of this segment was present, arranged in an inverted orientation, in the Toledo genome. These additional sequences were located at the unique long (UL)/b' (IRL) boundary within the L component of the viral genome. A region representing nucleotides 175082 to 178221 of the AD169 genome was conserved in all three strains; however, substantial reduction in the size of the adjacent b' sequence was found. The additional DNA segment within the Toledo genome contained 19 open reading frames not present in the AD169 genome. The additional DNA segment within the Towne genome contained four new open reading frames, only one of which shared homology with the Toledo genome. This comparison was extended to five additional clinical isolates, and the additional Toledo sequence was conserved in all. These findings reveal a dramatic level of genome sequence complexity that may explain the differences that these strains exhibit in virulence and tissue tropism. Although the additional sequences have not altered the predicted size of the viral genome (230 to 235 kbp), a total of 22 new open reading frames (denoted UL133 to UL154), many of which have sequence characteristics of glycoproteins, are now defined as cytomegalovirus specific. Our work suggests that wild-type virus carries more than 220 genes, some of which are lost by large-scale deletion and rearrangement of the UL/b' region during laboratory passage. PMID:8523595

  3. Identification, analysis, and evolutionary relationships of the putative murine cytomegalovirus homologs of the human cytomegalovirus UL82 (pp71) and UL83 (pp65) matrix phosphoproteins.

    PubMed Central

    Cranmer, L D; Clark, C L; Morello, C S; Farrell, H E; Rawlinson, W D; Spector, D H

    1996-01-01

    We have identified three open reading frames (ORFs) in murine cytomegalovirus (MCMV), designated M82, M83, and M84, which likely encode homologs of the human cytomegalovirus (HCMV) UL82 and UL83 matrix phosphoproteins. These ORFs, in the HindIII C fragment of MCMV, are colinear with the UL82, UL83, and UL84 ORFs of HCMV. M82 encodes a 598-amino-acid (aa) protein with homology to UL82, M83 encodes an 809-aa protein with homology to UL82 and UL83, and M84 encodes a 587-aa protein with homology to UL83 and UL84. Analysis of transcription by Northern (RNA) blotting indicated that the M82 and M83 ORFs are transcribed as 2.2- and 5-kb mRNAs, respectively, at 24 to 48 h postinfection (p.i.), while M84 is transcribed as a 6.9-kb mRNA only at 8 h p.i. All transcripts appear to terminate at the same position 3' of the M82 ORF. Of the products of the three ORFs, only M83 is strongly recognized by hyperimmune mouse serum. The M83 protein is a virion-associated phosphoprotein with an apparent molecular mass of 125 kDa. In MCMV-infected cells, it is detectable by Western blotting (immunoblotting) only at 48 h p.i. in the absence of phosphonoacetic acid, consistent with late gene expression. The M83 ORF is also expressed at high levels in cells infected by a recombinant vaccinia virus and yields a protein which is serologically cross-reactive and comigrates with the authentic MCMV protein in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PMID:8892916

  4. Human cytomegalovirus induces a distinct innate immune response in the maternal-fetal interface.

    PubMed

    Weisblum, Yiska; Panet, Amos; Zakay-Rones, Zichria; Vitenshtein, Alon; Haimov-Kochman, Ronit; Goldman-Wohl, Debra; Oiknine-Djian, Esther; Yamin, Rachel; Meir, Karen; Amsalem, Hagai; Imbar, Tal; Mandelboim, Ofer; Yagel, Simcha; Wolf, Dana G

    2015-11-01

    The initial interplay between human cytomegalovirus (HCMV) and innate tissue response in the human maternal-fetal interface, though crucial for determining the outcome of congenital HCMV infection, has remained unknown. We studied the innate response to HCMV within the milieu of the human decidua, the maternal aspect of the maternal-fetal interface, maintained ex vivo as an integral tissue. HCMV infection triggered a rapid and robust decidual-tissue innate immune response predominated by interferon (IFN)γ and IP-10 induction, dysregulating the decidual cytokine/chemokine environment in a distinctive fashion. The decidual-tissue response was already elicited during viral-tissue contact, and was not affected by neutralizing HCMV antibodies. Of note, IFNγ induction, reflecting immune-cell activation, was distinctive to the maternal decidua, and was not observed in concomitantly-infected placental (fetal) villi. Our studies in a clinically-relevant surrogate human model, provide a novel insight into the first-line decidual tissue response which could affect the outcome of congenital infection.

  5. Use of diploid human fibroblasts as a model system to culture, grow, and study human cytomegalovirus infection.

    PubMed

    Fortunato, Elizabeth A

    2014-01-01

    Primary human diploid fibroblasts are used routinely to study host/pathogen interactions of human cytomegalovirus (HCMV). Fibroblasts' ease of culture and tremendous permissiveness for infection allow the study of all facets of infection, an abbreviated list of which includes ligand/receptor interactions, activation of cell signaling responses, and dysregulation of the cell cycle and DNA repair processes. Another advantage to fibroblasts' permissiveness for HCMV is the capability to grow high titer stocks of virus in them. This chapter will discuss the production of viral stocks of HCMV in primary human fibroblasts, commencing with culturing and infection of cells and continuing through harvest, titration (determining the infectious capacity of a particular virus preparation), and storage of viral stocks for use in downstream experiments.

  6. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.

    PubMed

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  7. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  8. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    PubMed Central

    Krömmelbein, Natascha; Wiebusch, Lüder; Schiedner, Gudrun; Büscher, Nicole; Sauer, Caroline; Florin, Luise; Sehn, Elisabeth; Wolfrum, Uwe; Plachter, Bodo

    2016-01-01

    The human cytomegalovirus (HCMV) replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP) is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production. PMID:26848680

  9. Analytic Vaccinology: Antibody-Driven Design of a Human Cytomegalovirus Subunit Vaccine.

    PubMed

    Kabanova, Anna; Lilleri, Daniele

    2016-01-01

    Identification of the most relevant protective antigens has represented a considerable obstacle for the development of subunit vaccines against viral infections, including human cytomegalovirus (HCMV) infection. This chapter describes the method of analytic vaccinology, centered on the clonal analysis of human B cell response to HCMV, which represents an essential tool for assessing the impact of individual viral antigens in the antiviral antibody response. By providing key information on the immunogenicity and protective properties of the antibodies elicited by viral proteins, the analytic vaccinology method guides the selection of the most appropriate vaccine candidates. Here we discuss methodologies for the generation of human monoclonal antibodies from B cells of immune donors, antibody screening in in vitro assays of antigen binding and virus neutralization, and strategies of animal immunization useful for the preclinical evaluation of selected viral antigens. The approach of analytic vaccinology could be universally applied to the characterization of B-cell immune response against any virus of interest and ultimately used for vaccine development.

  10. Novel real-time monitoring system for human cytomegalovirus-infected cells in vitro that uses a green fluorescent protein-PML-expressing cell line.

    PubMed

    Ueno, T; Eizuru, Y; Katano, H; Kurata, T; Sata, T; Irie, S; Ogawa-Goto, K

    2006-08-01

    Promyelocytic leukemia (PML) bodies are discrete nuclear foci that are intimately associated with many DNA viruses. In human cytomegalovirus (HCMV) infection, the IE1 (for "immediate-early 1") protein has a marked effect on PML bodies via de-SUMOylation of PML protein. Here, we report a novel real-time monitoring system for HCMV-infected cells using a newly established cell line (SE/15) that stably expresses green fluorescent protein (GFP)-PML protein. In SE/15 cells, HCMV infection causes specific and efficient dispersion of GFP-PML bodies in an IE1-dependent manner, allowing the infected cells to be monitored by fluorescence microscopy without immunostaining. Since a specific change in the detergent solubility of GFP-PML occurs upon infection, the infected cells can be quantified by GFP fluorescence measurement after extraction. With this assay, the inhibitory effects of heparin and neutralizing antibodies were determined in small-scale cultures, indicating its usefulness for screening inhibitory reagents for laboratory virus strains. Furthermore, we established a sensitive imaging assay by counting the number of nuclei containing dispersed GFP-PML, which is applicable for titration of slow-growing clinical isolates. In all strains tested, the virus titers estimated by the GFP-PML imaging assay were well correlated with the plaque-forming cell numbers determined in human embryonic lung cells. Coculture of SE/15 cells and HCMV-infected fibroblasts permitted a rapid and reliable method for estimating the 50% inhibitory concentration values of drugs for clinical isolates in susceptibility testing. Taken together, these results demonstrate the development of a rapid, sensitive, quantitative, and specific detection system for HCMV-infected cells involving a simple procedure that can be used for titration of low-titer clinical isolates.

  11. Inactivation of the Human Cytomegalovirus US20 Gene Hampers Productive Viral Replication in Endothelial Cells

    PubMed Central

    Cavaletto, Noemi; Luganini, Anna

    2015-01-01

    ABSTRACT The human cytomegalovirus (HCMV) US12 gene family includes a group of 10 contiguous genes (US12 to US21) encoding predicted seven-transmembrane-domain (7TMD) proteins that are nonessential for replication within cultured fibroblasts. Nevertheless, inactivation of some US12 family members affects virus replication in other cell types; e.g., deletion of US16 or US18 abrogates virus growth in endothelial and epithelial cells or in human gingival tissue, respectively, suggesting a role for some US12 proteins in HCMV cell tropism. Here, we provide evidence that another member, US20, impacts the ability of a clinical strain of HCMV to replicate in endothelial cells. Through the use of recombinant HCMV encoding tagged versions of the US20 protein, we investigated the expression pattern, localization, and topology of the US20-encoded protein (pUS20). We show that pUS20 is expressed as a partially glycosylated 7TMD protein which accumulates late in infection in endoplasmic reticulum-derived peripheral structures localized outside the cytoplasmic virus assembly compartment (cVAC). US20-deficient mutants generated in the TR clinical strain of HCMV exhibited major growth defects in different types of endothelial cells, whereas they replicated normally in fibroblasts and epithelial cells. While the attachment and entry phases in endothelial cells were not significantly affected by the absence of US20 protein, US20-null viruses failed to replicate viral DNA and express representative E and L mRNAs and proteins. Taken together, these results indicate that US20 sustains the HCMV replication cycle at a stage subsequent to entry but prior to E gene expression and viral DNA synthesis in endothelial cells. IMPORTANCE Human cytomegalovirus (HCMV) is a major pathogen in newborns and immunocompromised individuals. A hallmark of HCMV pathogenesis is its ability to productively replicate in an exceptionally broad range of target cells, including endothelial cells, which represent

  12. Human Cytomegalovirus US28 Is Important for Latent Infection of Hematopoietic Progenitor Cells

    PubMed Central

    Humby, Monica S.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) resides latently in hematopoietic progenitor cells (HPCs). During latency, only a subset of HCMV genes is transcribed, including one of the four virus-encoded G protein-coupled receptors (GPCRs), US28. Although US28 is a multifunctional lytic protein, its function during latency has remained undefined. We generated a panel of US28 recombinant viruses in the bacterial artificial chromosome (BAC)-derived clinical HCMV strain TB40/E-mCherry. We deleted the entire US28 open reading frame (ORF), deleted all four of the viral GPCR ORFs, or deleted three of the HCMV GPCRs but not the US28 wild-type protein. Using these recombinant viruses, we assessed the requirement for US28 during latency in the Kasumi-3 in vitro latency model system and in primary ex vivo-cultured CD34+ HPCs. Our data suggest that US28 is required for latency as infection with viruses lacking the US28 ORF alone or in combination with the remaining HCMV-encoded GPCR results in transcription from the major immediate early promoter, the production of extracellular virions, and the production of infectious virus capable of infecting naive fibroblasts. The other HCMV GPCRs are not required for this phenotype as a virus expressing only US28 but not the remaining virus-encoded GPCRs is phenotypically similar to that of wild-type latent infection. Finally, we found that US28 copurifies with mature virions and is expressed in HPCs upon virus entry although its expression at the time of infection does not complement the US28 deletion latency phenotype. This work suggests that US28 protein functions to promote a latent state within hematopoietic progenitor cells. IMPORTANCE Human cytomegalovirus (HCMV) is a widespread pathogen that, once acquired, remains with its host for life. HCMV remains latent, or quiescent, in cells of the hematopoietic compartment and upon immune challenge can reactivate to cause disease. HCMV-encoded US28 is one of several genes expressed during

  13. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease. PMID:27699182

  14. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease.

  15. Human cytomegalovirus and Epstein–Barr virus inhibit oral bacteria-induced macrophage activation and phagocytosis

    PubMed Central

    Lin, Y.-L.; Li, M.

    2016-01-01

    Introduction Periodontal disease is an inflammatory condition caused by periodontal microorganisms. Viruses such as human cytomegalovirus (HCMV) and Epstein–Barr virus (EBV) are associated with certain types of periodontal disease, but their roles in promoting the disease are unclear. Because both viruses infect human macrophages, cells which play key roles in the clearance of pathogenic bacteria, it is likely that the viruses alter the functional capacity of macrophages by inhibiting their defense mechanisms against invading pathogens. Methods Macrophages preinfected with HCMV or EBV were evaluated following stimulation by selected oral bacteria. Bacteria-induced macrophage activation was assayed by measuring the levels of tumor necrosis factor-α (TNF-α) produced in the media, and phagocytic activity was analysed by a phagocytosis assay with fluorescein isothiocyanate-labeled bacteria. The virus-infected macrophages were also subjected to semi-quantitative polymerase chain reaction to measure the expression of toll-like receptor 9, which is involved in the activation of phagocytosis-related pathways. Results Both HCMV and EBV significantly diminished the TNF-α production typically induced by oral bacteria, inhibited the phagocytic activity of macrophages, and downregulated the expression of toll-like receptor 9. Conclusion Infection by HCMV or EBV inhibits the functional ability of macrophages to respond to bacterial challenge, thereby suggesting their pathogenic role in the development of periodontal disease. PMID:19416455

  16. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades

    PubMed Central

    Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; dos Santos, Claudia Januário; Carlan Silva, Maria Cristina

    2016-01-01

    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties. PMID:27458810

  17. Human cytomegalovirus inhibition by cardiac glycosides: evidence for involvement of the HERG gene.

    PubMed

    Kapoor, Arun; Cai, Hongyi; Forman, Michael; He, Ran; Shamay, Meir; Arav-Boger, Ravit

    2012-09-01

    Infection with human cytomegalovirus (HCMV) continues to be a major threat for pregnant women and the immunocompromised population. Although several anti-HCMV therapies are available, the development of new anti-HCMV agents is highly desired. There is growing interest in identifying compounds that might inhibit HCMV by modulating the cellular milieu. Interest in cardiac glycosides (CG), used in patients with congestive heart failure, has increased because of their established anticancer and their suggested antiviral activities. We report that the several CG--digoxin, digitoxin, and ouabain--are potent inhibitors of HCMV at nM concentrations. HCMV inhibition occurred prior to DNA replication, but following binding to its cellular receptors. The levels of immediate early, early, and late viral proteins and cellular NF-κB were significantly reduced in CG-treated cells. The activity of CG in infected cells correlated with the expression of the potassium channel gene, hERG. CMV infection upregulated hERG, whereas CG significantly downregulated its expression. Infection with mouse CMV upregulated mouse ERG (mERG), but treatment with CG did not inhibit virus replication or mERG transcription. These findings suggest that CG may inhibit HCMV by modulating human cellular targets associated with hERG and that these compounds should be studied for their antiviral activities. PMID:22777050

  18. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  19. Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

    NASA Astrophysics Data System (ADS)

    Gaspar, Miguel; Shenk, Thomas

    2006-02-01

    The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway

  20. Germline V-genes sculpt the binding site of a family of antibodies neutralizing human cytomegalovirus

    SciTech Connect

    Thomson, Christy A.; Bryson, Steve; McLean, Gary R.; Creagh, A. Louise; Pai, Emil F.; Schrader, John W.

    2008-10-17

    Immunoglobulin genes are generated somatically through specialized mechanisms resulting in a vast repertoire of antigen-binding sites. Despite the stochastic nature of these processes, the V-genes that encode most of the antigen-combining site are under positive evolutionary selection, raising the possibility that V-genes have been selected to encode key structural features of binding sites of protective antibodies against certain pathogens. Human, neutralizing antibodies to human cytomegalovirus that bind the AD-2S1 epitope on its gB envelope protein repeatedly use a pair of well-conserved, germline V-genes IGHV3-30 and IGKV3-11. Here, we present crystallographic, kinetic and thermodynamic analyses of the binding site of such an antibody and that of its primary immunoglobulin ancestor. These show that these germline V-genes encode key side chain contacts with the viral antigen and thereby dictate key structural features of the hypermutated, high-affinity neutralizing antibody. V-genes may thus encode an innate, protective immunological memory that targets vulnerable, invariant sites on multiple pathogens.

  1. Essential role of protein kinase R antagonism by TRS1 in human cytomegalovirus replication.

    PubMed

    Braggin, Jacquelyn E; Child, Stephanie J; Geballe, Adam P

    2016-02-01

    Human cytomegalovirus (HCMV) lacking TRS1 and IRS1 (HCMV[ΔI/ΔT]) cannot replicate in cell culture. Although both proteins can block the protein kinase R (PKR) pathway, they have multiple other activities and binding partners. It remains unknown which functions are essential for HCMV replication. To investigate this issue, we first identified a TRS1 mutant that is unable to bind to PKR. Like HCMV[ΔI/ΔT], a recombinant HCMV containing this mutant (HCMV[TRS1-Mut 1]) did not replicate in wild-type cells. However, HCMV[ΔI/ΔT] did replicate in cells in which PKR expression was reduced by RNA interference. Moreover, HCMV[ΔI/ΔT] and HCMV[TRS1-Mut 1] replicated to similar levels as virus containing wild-type TRS1 in cell lines in which PKR expression was knocked out by CRISPR/Cas9-mediated genome editing. These results demonstrate that the sole essential function of TRS1 is to antagonize PKR and that its other activities do not substantially enhance HCMV replication, at least in cultured human fibroblasts.

  2. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  3. In vitro selection of novel RNA ligands that bind human cytomegalovirus and block viral infection.

    PubMed Central

    Wang, J; Jiang, H; Liu, F

    2000-01-01

    Ribonuclease-resistant RNA molecules that bind to infectious human cytomegalovirus (HCMV) were isolated in vitro from a pool of randomized sequences after 16 cycles of selection and amplification. The two ligands (L13 and L19) characterized exhibited high HCMV-binding affinity in vitro and effectively inhibited viral infection in tissue culture. Their antiviral activity was also specific as they only reacted with two different strains of HCMV but not with the related herpes simplex virus 1 and human cells. These two ligands appeared to function as antivirals by blocking viral entry. Ultraviolet (UV) crosslinking studies suggested that L13 and L19 bind to HCMV essential glycoproteins B and H, respectively. Thus, RNA ligands that bind to different surface antigens of HCMV can be simultaneously isolated by the selection procedure. Our study demonstrates the feasibility of using these RNA ligands as a research tool to identify viral proteins required for infectivity and as an antiviral agent to block viral infection. PMID:10786848

  4. Virion Glycoprotein-Mediated Immune Evasion by Human Cytomegalovirus: a Sticky Virus Makes a Slick Getaway.

    PubMed

    Gardner, Thomas J; Tortorella, Domenico

    2016-09-01

    The prototypic herpesvirus human cytomegalovirus (CMV) exhibits the extraordinary ability to establish latency and maintain a chronic infection throughout the life of its human host. This is even more remarkable considering the robust adaptive immune response elicited by infection and reactivation from latency. In addition to the ability of CMV to exist in a quiescent latent state, its persistence is enabled by a large repertoire of viral proteins that subvert immune defense mechanisms, such as NK cell activation and major histocompatibility complex antigen presentation, within the cell. However, dissemination outside the cell presents a unique existential challenge to the CMV virion, which is studded with antigenic glycoprotein complexes targeted by a potent neutralizing antibody response. The CMV virion envelope proteins, which are critical mediators of cell attachment and entry, possess various characteristics that can mitigate the humoral immune response and prevent viral clearance. Here we review the CMV glycoprotein complexes crucial for cell attachment and entry and propose inherent properties of these proteins involved in evading the CMV humoral immune response. These include viral glycoprotein polymorphism, epitope competition, Fc receptor-mediated endocytosis, glycan shielding, and cell-to-cell spread. The consequences of CMV virion glycoprotein-mediated immune evasion have a major impact on persistence of the virus in the population, and a comprehensive understanding of these evasion strategies will assist in designing effective CMV biologics and vaccines to limit CMV-associated disease. PMID:27307580

  5. Generation of potent neutralizing human monoclonal antibodies against cytomegalovirus infection from immune B cells

    PubMed Central

    Funaro, Ada; Gribaudo, Giorgio; Luganini, Anna; Ortolan, Erika; Lo Buono, Nicola; Vicenzi, Elisa; Cassetta, Luca; Landolfo, Santo; Buick, Richard; Falciola, Luca; Murphy, Marianne; Garotta, Gianni; Malavasi, Fabio

    2008-01-01

    Background Human monoclonal antibodies (mAbs) generated as a result of the immune response are likely to be the most effective therapeutic antibodies, particularly in the case of infectious diseases against which the immune response is protective. Human cytomegalovirus (HCMV) is an ubiquitous opportunistic virus that is the most serious pathogenic agent in transplant patients. The available therapeutic armamentarium (e.g. HCMV hyperimmune globulins or antivirals) is associated with severe side effects and the emergence of drug-resistant strains; therefore, neutralizing human mAb may be a decisive alternative in the prevention of primary and re-activated HCMV infections in these patients. Results The purpose of this study was to generate neutralizing mAb against HCMV from the immunological repertoire of immune donors. To this aim, we designed an efficient technology relying on two discrete and sequential steps: first, human B-lymphocytes are stimulated with TLR9-agonists and IL-2; second, after both additives are removed, the cells are infected with EBV. Using this strategy we obtained 29 clones secreting IgG neutralizing the HCMV infectivity; four among these were further characterized. All of the mAbs neutralize the infection in different combinations of HCMV strains and target cells, with a potency ~20 fold higher than that of the HCMV hyperimmune globulins, currently used in transplant recipients. Recombinant human monoclonal IgG1 suitable as a prophylactic or therapeutic tool in clinical applications has been generated. Conclusion The technology described has proven to be more reproducible, efficient and rapid than previously reported techniques, and can be adopted at low overall costs by any cell biology laboratory for the development of fully human mAbs for immunotherapeutic uses. PMID:19014469

  6. Polyfunctional T cells accumulate in large human cytomegalovirus-specific T cell responses.

    PubMed

    Lachmann, Raskit; Bajwa, Martha; Vita, Serena; Smith, Helen; Cheek, Elizabeth; Akbar, Arne; Kern, Florian

    2012-01-01

    Large cytomegalovirus (CMV)-specific CD8 T-cell responses are observed in both young and, somewhat more often, old people. Frequent CMV reactivation is thought to exhaust these cells and render them dysfunctional so that larger numbers of them are needed to control CMV. Expansions of CMV-specific CD4 T cells are also seen but are less well studied. In this study, we examined the T-cell response to the dominant CMV pp65 and IE-1 antigens in healthy CMV-infected people across a wide age range (20 to 84 years) by using multicolor flow cytometry. CMV-specific T cells were characterized by the activation markers CD40 ligand (CD40L), interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-α), and gamma interferon (IFN-γ) and the memory markers CD27 and CD45RA. The proportions of effector memory T cells increased in large responses, as did the proportions of polyfunctional CD8 (IFN-γ(+) IL-2(+/-) TNF-α(+)) and CD4 (CD40L(+/-) IFN-γ(+) IL-2(+) TNF-α(+)) T-cell subsets, while the proportion of naïve T cells decreased. The bigger the CD4 or CD8 T-cell response to pp65, the larger was the proportion of T cells with an advanced memory phenotype in the entire (including non-CMV-specific) T-cell compartment. In addition, the number of activation markers per cell correlated with the degree of T-cell receptor downregulation, suggesting increased antigen sensitivity in polyfunctional cells. In summary, our findings show that polyfunctional CMV-specific T cells were not superseded by dysfunctional cells, even in very large responses. At the same time, however, the memory subset composition of the entire T-cell compartment correlated with the size of the T-cell response to CMV pp65, confirming a strong effect of CMV infection on the immune systems of some, but not all, infected people. PMID:22072753

  7. Induction of chromosome aberrations and mitotic arrest by cytomegalovirus in human cells

    SciTech Connect

    AbuBakar, S.; Au, W.W.; Legator, M.S.; Albrecht, T.

    1988-01-01

    Human cytomegalovirus (CMV) is potentially an effective but often overlooked genotoxic agent in humans. We report here evidence that indicates that infection by CMV can induce chromosome alterations and mitotic inhibition. The frequency of chromosome aberrations induced was dependent on the input multiplicity of infection (m.o.i.) for human lung fibroblasts (LU), but not for human peripheral blood lymphocytes (PBLs) when both cell types were infected at the GO phase of the cell cycle. The aberrations induced by CMV were mostly chromatid breaks and chromosome pulverizations that resembled prematurely condensed S-phase chromatin. Pulverized chromosomes were not observed in LU cells infected with virus stocks that had been rendered nonlytic by UV-irradiation at 24,000 ergs/mm2 or from infection of human lymphocytes. In LU cells infected with UV-irradiated CMV, the frequency of aberrations induced was inversely dependent on the extent of the exposure of the CMV stock to the UV-light. In permissive CMV infection of proliferating LU cells at 24 hr after subculture, a high percentage (greater than 40%) of the metaphase cells were arrested at their first metaphase and displayed severely condensed chromosomes when harvested 48 hr later. A significant increase (p less than 0.05) in the chromosome aberration frequency was also observed. Our study shows that CMV infection is genotoxic to host cells. The types and extent of damage are dependent on the viral genome expression and on the cell cycle stage of the cells at the time of infection. The possible mechanisms for induction of chromosome damage by CMV are discussed.

  8. Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35

    SciTech Connect

    Salsman, Jayme; Wang Xueqi; Frappier, Lori

    2011-06-05

    The human cytomegalovirus (HCMV) UL35 gene encodes two proteins, UL35 and UL35a. Expression of UL35 in transfected cells results in the formation of UL35 nuclear bodies that associate with promyelocytic leukemia (PML) protein. PML forms the basis for PML nuclear bodies that are important for suppressing viral lytic gene expression. Given the important relationship between PML and viral infection, we have further investigated the association of UL35 with PML bodies. We demonstrate that UL35 bodies form independently of PML and subsequently recruit PML, Sp100 and Daxx. In contrast, UL35a did not form bodies; however, it could bind UL35 and inhibit the formation of UL35 bodies. The HCMV tegument protein pp71 promoted the formation of UL35 bodies and the cytoplasmic localization of UL35a. Similarly, UL35a shifted pp71 to the cytoplasm. These results indicate that the interplay between UL35, UL35a and pp71 affects their subcellular localization and likely their functions throughout infection.

  9. Sites and roles of phosphorylation of the human cytomegalovirus DNA polymerase subunit UL44

    SciTech Connect

    Silva, Laurie A.; Strang, Blair L.; Lin, Eric W.; Kamil, Jeremy P.; Coen, Donald M.

    2011-09-01

    The human cytomegalovirus DNA polymerase subunit UL44 is a phosphoprotein, but its sites and roles of phosphorylation have not been investigated. We compared sites of phosphorylation of UL44 in vitro by the viral protein kinase UL97 and cyclin-dependent kinase 1 with those in infected cells. Transient treatment of infected cells with a UL97 inhibitor greatly reduced labeling of two minor UL44 phosphopeptides. Viruses containing alanine substitutions of most UL44 residues that are phosphorylated in infected cells exhibited at most modest effects on viral DNA synthesis and yield. However, substitution of highly phosphorylated sites adjacent to the nuclear localization signal abolished viral replication. The results taken together are consistent with UL44 being phosphorylated directly by UL97 during infection, and a crucial role for phosphorylation-mediated nuclear localization of UL44 for viral replication, but lend little support to the widely held hypothesis that UL97-mediated phosphorylation of UL44 is crucial for viral DNA synthesis.

  10. Detection of human cytomegalovirus in different histopathological types of glioma in Iraqi patients.

    PubMed

    Shamran, Haidar A; Kadhim, Haider S; Hussain, Aws R; Kareem, Abdulameer; Taub, Dennis D; Price, Robert L; Nagarkatti, Mitzi; Nagarkatti, Prakash S; Singh, Udai P

    2015-01-01

    Human Cytomegalovirus (HCMV) is an endemic herpes virus that reemerges in cancer patients enhancing oncogenic potential. HCMV infection is associated with certain types of cancer morbidity such as glioblastomas. HCMV, like all other herpes viruses, has the ability to remain latent within the body of the host and can contribute in chronic inflammation. To determine the role of HCMV in glioma pathogenesis, paraffin-embedded blocks from glioma patients (n = 50) and from benign meningioma patients (n = 30) were obtained and evaluated by immunohistochemistry and polymerase chain reaction for the evidence of HCMV antigen expression and the presence of viral DNA. We detected HCMV antigen and DNA for IEI-72, pp65, and late antigen in 33/36, 28/36, and 26/36 in glioblastoma multiforme patients whereas 12/14, 10/14, and 9/14 in anaplastic astrocytoma patients, respectively. Furthermore, 84% of glioma patients were positive for immunoglobulin G (IgG) compared to 72.5% among control samples (P = 0.04). These data indicate the presence of the HCMV virus in a high percentage of glioma samples demonstrating distinct histopathological grades and support previous reports showing the presence of HCMV infection in glioma tissue. These studies demonstrate that detection of low-levels of latent viral infections may play an active role in glioma development and pathogenesis. PMID:25710012

  11. Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate.

    PubMed

    Compton, T; Nowlin, D M; Cooper, N R

    1993-04-01

    In this report, we demonstrate that the initial event in human cytomegalovirus (HCMV) infection is attachment to extracellular heparan sulfate. Further, this interaction is important for initiation of infection in fibroblast cells. Using microbinding assays to specifically monitor virus attachment as well as plaque titration assays to measure infectivity, we found that heparin competition as well as enzymatic digestion of cells with heparinase blocked virus attachment, initiation of immediate-early gene expression and infectivity. Other major glycosaminoglycans were found not to be involved in HCMV attachment and infectivity. In addition, HCMV was unable to attach to mutant derivatives of Chinese hamster ovary cells deficient in synthesis of heparan sulfate proteoglycans. Basic fibroblast growth factor, which requires initial interaction with extracellular heparin prior to binding to its high affinity receptor, also inhibited HCMV attachment to cells. Time-course experiments revealed that the initial HCMV binding was sensitive to heparin competition (10 micrograms/ml) or 0.75 M salt washes. The initial heparin-dissociable binding converted rapidly to high affinity (heparin resistant) HCMV attachment. These data suggest that sequential receptor interactions may mediate HCMV adsorption to cells. Heparin affinity chromatography revealed that multiple HCMV envelope glycoproteins, including gB, are capable of binding to heparin.

  12. Molecular profiling of cytomegalovirus-induced human CD8+ T cell differentiation

    PubMed Central

    Hertoghs, Kirsten M.L.; Moerland, Perry D.; van Stijn, Amber; Remmerswaal, Ester B.M.; Yong, Sila L.; van de Berg, Pablo J.E.J.; van Ham, S. Marieke; Baas, Frank; ten Berge, Ineke J.M.; van Lier, René A.W.

    2010-01-01

    CD8+ T cells play a critical role in the immune response to viral pathogens. Persistent human cytomegalovirus (HCMV) infection results in a strong increase in the number of virus-specific, quiescent effector-type CD8+ T cells with constitutive cytolytic activity, but the molecular pathways involved in the induction and maintenance of these cells are unknown. We show here that HCMV infection induced acute and lasting changes in the transcriptomes of virus-reactive T cells collected from HCMV-seropositive patients at distinct stages of infection. Enhanced cell cycle and metabolic activity was restricted to the acute phase of the response, but at all stages, HCMV-specific CD8+ T cells expressed the Th1-associated transcription factors T-bet (TBX21) and eomesodermin (EOMES), in parallel with continuous expression of IFNG mRNA and IFN-γ–regulated genes. The cytolytic proteins granzyme B and perforin as well as the fractalkine-binding chemokine receptor CX3CR1 were found in virus-reactive cells throughout the response. During HCMV latency, virus-specific CD8+ T cells lacked the typical features of exhausted cells found in other chronic infections. Persistent effector cell traits together with the permanent changes in chemokine receptor usage of virus-specific, nonexhausted, long-lived CD8+ T cells may be crucial to maintain lifelong protection from HCMV reactivation. PMID:20921622

  13. On the relative roles of background selection and genetic hitchhiking in shaping human cytomegalovirus genetic diversity.

    PubMed

    Renzette, Nicholas; Kowalik, Timothy F; Jensen, Jeffrey D

    2016-01-01

    A central focus of population genetics has been examining the contribution of selective and neutral processes in shaping patterns of intraspecies diversity. In terms of selection specifically, surveys of higher organisms have shown considerable variation in the relative contributions of background selection and genetic hitchhiking in shaping the distribution of polymorphisms, although these analyses have rarely been extended to bacteria and viruses. Here, we study the evolution of a ubiquitous, viral pathogen, human cytomegalovirus (HCMV), by analysing the relationship among intraspecies diversity, interspecies divergence and rates of recombination. We show that there is a strong correlation between diversity and divergence, consistent with expectations of neutral evolution. However, after correcting for divergence, there remains a significant correlation between intraspecies diversity and recombination rates, with additional analyses suggesting that this correlation is largely due to the effects of background selection. In addition, a small number of loci, centred on long noncoding RNAs, also show evidence of selective sweeps. These data suggest that HCMV evolution is dominated by neutral mechanisms as well as background selection, expanding our understanding of linked selection to a novel class of organisms. PMID:26211679

  14. Human Cytomegalovirus Antigens in Malignant Gliomas as Targets for Adoptive Cellular Therapy

    PubMed Central

    Landi, Daniel; Hegde, Meenakshi; Ahmed, Nabil

    2014-01-01

    Malignant gliomas are the most common primary brain tumor in adults, with over 12,000 new cases diagnosed in the United States each year. Over the last decade, investigators have reliably identified human cytomegalovirus (HCMV) proteins, nucleic acids, and virions in most high-grade gliomas, including glioblastoma (GBM). This discovery is significant because HCMV gene products can be targeted by immune-based therapies. In this review, we describe the current level of understanding regarding the presence and role in pathogenesis of HCMV in GBM. We describe our success detecting and expanding HCMV-specific cytotoxic T lymphocytes to kill GBM cells and explain how these cells can be used as a platform for enhanced cellular therapies. We discuss alternative approaches that capitalize on HCMV infection to treat patients with HCMV-positive tumors. Adoptive cellular therapy for HCMV-positive GBM has been tried in a small number of patients with some benefit, but we reason why, to date, these approaches generally fail to generate long-term remission or cure. We conjecture how cellular therapy for GBM can be improved and describe the barriers that must be overcome to cure these patients. PMID:25505736

  15. The Microtubule Inhibitor Podofilox Inhibits an Early Entry Step of Human Cytomegalovirus

    PubMed Central

    Cohen, Tobias; Schwarz, Toni M.; Vigant, Frederic; Gardner, Thomas J.; Hernandez, Rosmel E.; Lee, Benhur; Tortorella, Domenico

    2016-01-01

    Human cytomegalovirus is a ubiquitous β-herpesvirus that infects many different cell types through an initial binding to cell surface receptors followed by a fusion event at the cell membrane or endocytic vesicle. A recent high-throughput screen to identify compounds that block a step prior to viral gene expression identified podofilox as a potent and nontoxic inhibitor. Time-of-addition studies in combination with quantitative-PCR analysis demonstrated that podofilox limits an early step of virus entry at the cell surface. Podofilox was also able to drastically reduce infection by herpes simplex 1, an α-herpesvirus with a very similar entry process to CMV. Podofilox caused a reduced maximal plateau inhibition of infection by viruses with single step binding processes prior to fusion-like Newcastle disease virus, Sendai virus, and influenza A virus or viruses that enter via endocytosis like vesicular stomatitis virus and a clinical-like strain of CMV. These results indicate that microtubules appear to be participating in the post-binding step of virus entry including the pre- and post-penetration events. Modulation of the plasma membrane is required to promote virus entry for herpesviruses, and that podofilox, unlike colchicine or nocodazole, is able to preferentially target microtubule networks at the plasma membrane. PMID:27783035

  16. Intracellular expression of engineered RNase P ribozymes effectively blocks gene expression and replication of human cytomegalovirus.

    PubMed

    Kim, Kihoon; Umamoto, Sean; Trang, Phong; Hai, Rong; Liu, Fenyong

    2004-03-01

    A ribozyme (M1GS RNA) constructed from the catalytic RNA subunit of RNase P from Escherichia coli was used to target the overlapping region of two human cytomegalovirus (HCMV) mRNAs, which encode for the viral essential protease (PR) and capsid assembly proteins (AP), respectively. The results show a reduction of >80% in the expression levels of PR and AP and an inhibition of approximately 2000-fold of viral growth in cells that stably expressed the ribozyme. In comparison, <10% reduction in the expression of the targets and viral growth was found in cells that either did not express the ribozyme or produced a "disabled" ribozyme carrying mutations that abolished its catalytic activity. Examination of replication of the virus in the ribozyme-expressing cells indicates that packaging of the viral genomic DNA into capsids is blocked, and suggests that the antiviral effects are because the ribozyme specifically inhibits the AP and PR expression and, consequently, abolishes viral capsid formation and growth. Our results show that RNase P ribozymes are highly effective in blocking HCMV growth by targeting the PR and AP mRNAs and demonstrate the feasibility to use these ribozymes in gene therapy for antiviral applications.

  17. Degradation of host ubiquitin E3 ligase Itch by human cytomegalovirus UL42.

    PubMed

    Koshizuka, Tetsuo; Tanaka, Keiichiro; Suzutani, Tatsuo

    2016-01-01

    Human cytomegalovirus (HCMV) UL42 is classified as a CMV-specific but function-unknown gene. According to its amino acid sequence, UL42 has a C-terminal hydrophobic domain predicted to be a transmembrane domain and two PPxY (PY) motifs in its N terminus, but no N-terminal signal peptide. These features resemble those of herpes simplex virus (HSV) UL56 and varicella-zoster virus ORF0. HCMV UL42 interacts with Itch, a member of the Nedd4 family of ubiquitin E3 ligases, through its PY motifs as observed in HSV UL56. HCMV UL42 was partially colocalized with the trans-Golgi network and cytoplasmic vesicles in transfected fibroblasts. Itch was colocalized with HCMV UL42 and accumulated in a fine-speckled pattern in the cytoplasm. UL42 induced the ubiquitination and degradation of Itch in HCMV-infected fibroblasts, and was partially colocalized with p62, a ubiquitin-binding protein, and CD63, a marker of lysosome and multivesicular bodies. The electrophoretic pattern of Itch was altered by infection with HCMV and the amount of Itch was increased by the deletion of UL42. Our findings suggest that the regulatory function of the Nedd4 E3 ligase family and the structural features of HCMV UL42 are conserved characteristics in herpesviruses. PMID:26555021

  18. Determinant for endoplasmic reticulum retention in the luminal domain of the human cytomegalovirus US3 glycoprotein.

    PubMed

    Lee, Sungwook; Park, Boyoun; Ahn, Kwangseog

    2003-02-01

    US3 of human cytomegalovirus is an endoplasmic reticulum resident transmembrane glycoprotein that binds to major histocompatibility complex class I molecules and prevents their departure. The endoplasmic reticulum retention signal of the US3 protein is contained in the luminal domain of the protein. To define the endoplasmic reticulum retention sequence in more detail, we have generated a series of deletion and point mutants of the US3 protein. By analyzing the rate of intracellular transport and immunolocalization of the mutants, we have identified Ser58, Glu63, and Lys64 as crucial for retention, suggesting that the retention signal of the US3 protein has a complex spatial arrangement and does not comprise a contiguous sequence of amino acids. We also show that a modified US3 protein with a mutation in any of these amino acids maintains its ability to bind class I molecules; however, such mutated proteins are no longer retained in the endoplasmic reticulum and are not able to block the cell surface expression of class I molecules. These findings indicate that the properties that allow the US3 glycoprotein to be localized in the endoplasmic reticulum and bind major histocompatibility complex class I molecules are located in different parts of the molecule and that the ability of US3 to block antigen presentation is due solely to its ability to retain class I molecules in the endoplasmic reticulum. PMID:12525649

  19. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins

    PubMed Central

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-01-01

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%–99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy. PMID:26114473

  20. Nuclear trafficking of the human cytomegalovirus pp71 (ppUL82) tegument protein

    SciTech Connect

    Shen Weiping; Westgard, Elizabeth; Huang Liqun; Ward, Michael D.; Osborn, Jodi L.; Chau, Nha H.; Collins, Lindsay; Marcum, Benjamin; Koach, Margaret A.; Bibbs, Jennifer; Semmes, O. John; Kerry, Julie A.

    2008-06-20

    The human cytomegalovirus tegument protein pp71 localizes to the nucleus immediately upon infection, and functions to initiate viral gene expression. Analysis of a series of random insertion mutations revealed that sequences within the mid region (MR) of pp71 are important for localization to the nucleus. Fusion of MR sequences with eGFP revealed that amino acids 94 to 300 were sufficient to target proteins to the nucleus. Random substitution mutagenesis within this domain resulted in two double substitution mutants, pp71P203T/T223M and pp71T228M/L275Q, with a predominantly cytoplasmic localization. Disruption of nuclear targeting resulted in relocalization of the fusion proteins to a distinct perinuclear region. Using tandem mass spectrometry, we determined that threonine 223 can be phosphorylated. Mutation of this residue to a phosphomimetic amino acid resulted in abrogation of nuclear targeting. These results strongly suggest that the intracellular trafficking of pp71 is regulated by phosphorylation.

  1. Structural changes in human cytomegalovirus cytoplasmic assembly sites in the absence of UL97 kinase activity

    SciTech Connect

    Azzeh, Maysa; Honigman, Alik; Taraboulos, Albert; Rouvinski, Alexander; Wolf, Dana G. . E-mail: wolfd@md.huji.ac.il

    2006-10-10

    Studies of human cytomegalovirus (HCMV) UL97 kinase deletion mutant ({delta}UL97) indicated a multi-step role for this kinase in early and late phases of the viral life cycle, namely, in DNA replication, capsid maturation and nuclear egress. Here, we addressed its possible involvement in cytoplasmic steps of HCMV assembly. Using the {delta}UL97 and the UL97 kinase inhibitor NGIC-I, we demonstrate that the absence of UL97 kinase activity results in a modified subcellular distribution of the viral structural protein assembly sites, from compact structures impacting upon the nucleus to diffuse perinuclear structures punctuated by large vacuoles. Infection by either wild type or {delta}UL97 viruses induced a profound reorganization of wheat germ agglutinin (WGA)-positive Golgi-related structures. Importantly, the viral-induced Golgi remodeling along with the reorganization of the nuclear architecture was substantially altered in the absence of UL97 kinase activity. These findings suggest that UL97 kinase activity might contribute to organization of the viral cytoplasmic assembly sites.

  2. Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169

    SciTech Connect

    Wright, D.A.; Staprans, S.I.; Spector, D.H.

    1988-01-01

    In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the (/sup 35/S)methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region.

  3. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  4. The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication.

    PubMed

    Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J

    2016-02-01

    Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics.

  5. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  6. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins.

    PubMed

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-06-24

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%-99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy.

  7. Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169.

    PubMed Central

    Wright, D A; Staprans, S I; Spector, D H

    1988-01-01

    In this report, we identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the [35S]methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region. Images PMID:2824853

  8. Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci

    SciTech Connect

    Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En

    2009-09-30

    The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.

  9. Superresolution Imaging of Human Cytomegalovirus vMIA Localization in Sub-Mitochondrial Compartments

    PubMed Central

    Bhuvanendran, Shivaprasad; Salka, Kyle; Rainey, Kristin; Sreetama, Sen Chandra; Williams, Elizabeth; Leeker, Margretha; Prasad, Vidhya; Boyd, Jonathan; Patterson, George H.; Jaiswal, Jyoti K.; Colberg-Poley, Anamaris M.

    2014-01-01

    The human cytomegalovirus (HCMV) viral mitochondria-localized inhibitor of apoptosis (vMIA) protein, traffics to mitochondria-associated membranes (MAM), where the endoplasmic reticulum (ER) contacts the outer mitochondrial membrane (OMM). vMIA association with the MAM has not been visualized by imaging. Here, we have visualized this by using a combination of confocal and superresolution imaging. Deconvolution of confocal microscopy images shows vMIA localizes away from mitochondrial matrix at the Mitochondria-ER interface. By gated stimulated emission depletion (GSTED) imaging, we show that along this interface vMIA is distributed in clusters. Through multicolor, multifocal structured illumination microscopy (MSIM), we find vMIA clusters localize away from MitoTracker Red, indicating its OMM localization. GSTED and MSIM imaging show vMIA exists in clusters of ~100–150 nm, which is consistent with the cluster size determined by Photoactivated Localization Microscopy (PALM). With these diverse superresolution approaches, we have imaged the clustered distribution of vMIA at the OMM adjacent to the ER. Our findings directly compare the relative advantages of each of these superresolution imaging modalities for imaging components of the MAM and sub-mitochondrial compartments. These studies establish the ability of superresolution imaging to provide valuable insight into viral protein location, particularly in the sub-mitochondrial compartments, and into their clustered organization. PMID:24721787

  10. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  11. Commutability of the First World Health Organization International Standard for Human Cytomegalovirus

    PubMed Central

    Preiksaitis, J.; Tong, Y.; Pang, X.; Sun, Y.; Tang, L.; Cook, L.; Pounds, S.; Fryer, J.; Caliendo, A. M.

    2015-01-01

    Quantitative detection of cytomegalovirus (CMV) DNA has become a standard part of care for many groups of immunocompromised patients; recent development of the first WHO international standard for human CMV DNA has raised hopes of reducing interlaboratory variability of results. Commutability of reference material has been shown to be necessary if such material is to reduce variability among laboratories. Here we evaluated the commutability of the WHO standard using 10 different real-time quantitative CMV PCR assays run by eight different laboratories. Test panels, including aliquots of 50 patient samples (40 positive samples and 10 negative samples) and lyophilized CMV standard, were run, with each testing center using its own quantitative calibrators, reagents, and nucleic acid extraction methods. Commutability was assessed both on a pairwise basis and over the entire group of assays, using linear regression and correspondence analyses. Commutability of the WHO material differed among the tests that were evaluated, and these differences appeared to vary depending on the method of statistical analysis used and the cohort of assays included in the analysis. Depending on the methodology used, the WHO material showed poor or absent commutability with up to 50% of assays. Determination of commutability may require a multifaceted approach; the lack of commutability seen when using the WHO standard with several of the assays here suggests that further work is needed to bring us toward true consensus. PMID:26269622

  12. Preparation of the Human Cytomegalovirus Nuclear Egress Complex and Associated Proteins.

    PubMed

    Sharma, Mayuri; Kamil, Jeremy P; Coen, Donald M

    2016-01-01

    Herpesviruses, like most DNA viruses, replicate their genomes in the host cell nucleus. Their DNA is then packaged and assembled into viral nucleocapsids, which, in most cases, are too large to pass through the nuclear pore complex. Instead, herpesviruses use a complex multistep pathway, termed nuclear egress, to exit the nucleus. Key players in this process include two conserved viral proteins that form the nuclear egress complex (NEC). In human cytomegalovirus, these NEC proteins are UL50, embedded in the inner nuclear membrane, and its nucleoplasmic partner UL53. Both are essential for viral nuclear egress. However, other viral components as well as host nuclear envelope proteins may also participate in nuclear egress. Identifying these viral and cellular factors may provide important insight into the herpesvirus lifecycle and its relationship to the underlying, yet still-mysterious, host nuclear egress pathway. We developed an immunoprecipitation-based protocol, described herein, to identify protein-protein interactions involving the NEC from the nuclear fraction of infected cells that express an epitope-tagged version of NEC subunit UL53.

  13. Virological and immunological characteristics of human cytomegalovirus infection associated with Alzheimer disease.

    PubMed

    Lurain, Nell S; Hanson, Barbara A; Martinson, Jeffrey; Leurgans, Sue E; Landay, Alan L; Bennett, David A; Schneider, Julie A

    2013-08-15

    Serum, cerebrospinal fluid (CSF), and cryopreserved lymphocytes from subjects in the Rush Alzheimer's Disease Center Religious Orders Study were analyzed for associations between cytomegalovirus (CMV) infection and clinical and pathological markers of Alzheimer disease. CMV antibody levels were associated with neurofibrillary tangles (NFTs). CSF interferon γ was only detected in seropositive subjects and was significantly associated with NFTs. The percentage of senescent T cells (CD4+ or CD8+CD28-CD57+) was significantly higher for CMV-seropositive as compared to CMV-seronegative subjects and was marginally associated with the pathologic diagnosis of Alzheimer disease (CD4+) or amyloid-β (CD8+). Immunocytochemical analysis showed induction of amyloid-β in human foreskin fibroblasts (HFFs) infected with each of 3 clinical CMV strains. In the same subjects, there was no association of herpes simplex virus type 1 (HSV-1) antibody levels with CMV antibody levels or clinical or pathological markers of Alzheimer disease. HSV-1 infection of HFFs did not induce amyloid-β. These data support an association between CMV and the development of Alzheimer disease.

  14. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.

    PubMed

    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E

    1993-07-01

    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  15. High frequency of Human Cytomegalovirus DNA in the Liver of Infants with Extrahepatic Neonatal Cholestasis

    PubMed Central

    De Tommaso, Adriana MA; Andrade, Paula D; Costa, Sandra CB; Escanhoela, Cecília AF; Hessel, Gabriel

    2005-01-01

    Background Biliary atresia (BA) is the most severe hepatic disorder in newborns and its etiopathogenesis remains unknown. Viral involvement has been proposed, including the human cytomegalovirus (HCMV). The aims of the study were to use the polymerase chain reaction (PCR) to screen the liver tissue of infants with extrahepatic cholestasis for HCMV and to correlate the results with serological antibodies against HCMV and histological findings. Methods A retrospective study in a tertiary care setting included 35 patients (31 BA, 1 BA associated with a choledochal cyst, 2 congenital stenosis of the distal common bile duct and 1 hepatic cyst). HCMV serology was determined by ELISA. Liver and porta hepatis were examined histologically. Liver samples from infants and a control group were screened for HCMV DNA. Results Twelve patients had HCMV negative serology, 9 were positive for IgG antibodies and 14 were positive for IgG and IgM. Nine liver and seven porta hepatis samples were positive for HCMV DNA but none of the control group were positive (general frequency of positivity was 34.3% – 12/35). There was no correlation between HCMV positivity by PCR and the histological findings. The accuracy of serology for detecting HCMV antibodies was low. Conclusion These results indicate an elevated frequency of HCMV in pediatric patients with extrahepatic neonatal cholestasis. They also show the low accuracy of serological tests for detecting active HCMV infection and the lack of correlation between HCMV positivity by PCR and the histopathological changes. PMID:16321152

  16. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus.

  17. Human Cytomegalovirus Secretome Contains Factors That Induce Angiogenesis and Wound Healing

    SciTech Connect

    Dumortier, Jerome; Streblow, Daniel N.; Moses, Ashlee V.; Jacobs, Jon M.; Kreklywich, Craig N.; Camp, David G.; Smith, Richard D.; Orloff, Susan L.; Nelson, Jay

    2008-07-01

    Human cytomegalovirus (HCMV) is implicated in the acceleration of a number of vascular diseases including transplant vascular sclerosis (TVS), the lesion associated with chronic rejection (CR) of solid organ transplants. Although the virus persists in the allograft throughout the course of disease, few cells are directly infected by CMV. This observation is in contrast to the global effects that CMV has on the acceleration of TVS/CR, suggesting that CMV infection indirectly promotes the vascular disease process. Recent transcriptome analysis of CMV-infected heart allografts indicates that the virus induces cytokines and growth factors associated with angiogenesis (AG) and wound healing (WH), suggesting that CMV may accelerate TVS/CR through the induction and secretion of AG/WH factors from infected cells. We analyzed virus-free supernatants from HCMV-infected cells (HCMV secretomes) for growth factors, by mass spectrometry and immunoassays, and found that the HCMV secretome contains over 1,000 cellular proteins, many of which are involved in AG/WH. Importantly, functional assays demonstrated that CMV but not herpes simplex virus secretomes not only induce AG/WH but also promote neovessel stabilization and endothelial cell survival for 2 weeks. These findings suggest that CMV acceleration of TVS occurs through virus-induced growth factors and cytokines in the CMV secretome.

  18. Nonnucleoside Pyrrolopyrimidines with a Unique Mechanism of Action against Human Cytomegalovirus

    PubMed Central

    Jacobson, Jennie G.; Renau, Thomas E.; Nassiri, M. Reza; Sweier, Dominica G.; Breitenbach, Julie M.; Townsend, Leroy B.; Drach, John C.

    1999-01-01

    Based upon a prior study which evaluated a series of nonnucleoside pyrrolo[2,3-d]pyrimidines as inhibitors of human cytomegalovirus (HCMV), we have selected three active analogs for detailed study. In an HCMV plaque-reduction assay, compounds 828, 951, and 1028 had 50% inhibitory concentrations (IC50s) of 0.4 to 1.0 μM. Similar results were obtained when 828 and 951 were examined by HCMV enzyme-linked immunosorbent assay (IC50s = 1.9 and 0.4 μM, respectively) and when 828 was tested in a viral DNA-DNA hybridization assay (IC50 = 1.3 μM). In yield-reduction assays with a low multiplicity of infection (MOI), all three compounds caused multiple log10 reductions in virus titer, and the activities of these compounds were comparable to the activity of ganciclovir (GCV; IC90 = 0.2 μM). In contrast to the reduction of viral titers by GCV, the reduction of viral titers by 828, 951, and 1028 decreased with increasing MOI. Cytotoxicity in human foreskin fibroblasts and KB cells ranged from 32 to >100 μM. In addition, 828 (the only compound tested) was less toxic against human bone marrow progenitor cells than GCV. Time-of-addition and time-of-removal studies established that the three pyrrolopyrimidines inhibited HCMV replication before GCV had an effect on viral DNA synthesis but after viral adsorption. Compound 828 was equally effective against GCV-sensitive and GCV-resistant HCMV clinical isolates. Combination studies with 828 and GCV showed that the effects of the two compounds on HCMV were additive but not synergistic. Taken together, the data indicate that these pyrrolopyrimidines target a viral protein that is required in an MOI-dependent manner and that is expressed early in the HCMV replication cycle. PMID:10428908

  19. Significant Association of Multiple Human Cytomegalovirus Genomic Loci with Glioblastoma Multiforme Samples

    PubMed Central

    Ranganathan, Padhma; Clark, Paul A.; Kuo, John S.; Salamat, M. Shahriar

    2012-01-01

    Viruses are appreciated as etiological agents of certain human tumors, but the number of different cancer types induced or exacerbated by viral infections is unknown. Glioblastoma multiforme (GBM)/astrocytoma grade IV is a malignant and lethal brain cancer of unknown origin. Over the past decade, several studies have searched for the presence of a prominent herpesvirus, human cytomegalovirus (HCMV), in GBM samples. While some have detected HCMV DNA, RNA, and proteins in GBM tissues, others have not. Therefore, any purported association of HCMV with GBM remains controversial. In most of the previous studies, only one or a select few viral targets were analyzed. Thus, it remains unclear the extent to which the entire viral genome was present when detected. Here we report the results of a survey of GBM specimens for as many as 20 different regions of the HCMV genome. Our findings indicate that multiple HCMV loci are statistically more likely to be found in GBM samples than in other brain tumors or epileptic brain specimens and that the viral genome was more often detected in frozen samples than in paraffin-embedded archival tissue samples. Finally, our experimental results indicate that cellular genomes substantially outnumber viral genomes in HCMV-positive GBM specimens, likely indicating that only a minority of the cells found in such samples harbor viral DNA. These data argue for the association of HCMV with GBM, defining the virus as oncoaccessory. Furthermore, they imply that, were HCMV to enhance the growth or survival of a tumor (i.e., if it is oncomodulatory), it would likely do so through mechanisms distinct from classic tumor viruses that express transforming viral oncoproteins in the overwhelming majority of tumor cells. PMID:22090104

  20. In vitro inhibition of human cytomegalovirus replication by calcium trinatrium diethylenetriaminepentaacetic acid.

    PubMed

    Cinatl, J; Hoffmann, F; Cinatl, J; Weber, B; Scholz, M; Rabenau, H; Stieneker, F; Kabickova, H; Blasko, M; Doerr, H W

    1996-06-01

    Desferrioxamine (DFO) has been shown to inhibit human cytomegalovirus (CMV) replication in vitro. In the present study, we compared antiviral effects of DFO in human foreskin fibroblast (HFF) cells against several CMV strains with those of other chelators that interact with iron and other ions from different pools. DFO, a hydrophilic chelator, that may chelate both intracellular and extracellular ions inhibited production of CMV late antigen at 50% effective concentrations (EC50S) ranging from 6.2 to 8.9 microM. EC50S for calcium trinatrium diethylenetriaminepentaacetic acid (CaDTPA) ranged from 6.1 to 9.9 microM. EC50S for 2,2'-bipyridine (BPD), a hydrophobic chelator, which diffuses into cell membranes ranged from 65 to 72 microM. Concentrations which inhibited BrdU incorporation into cellular DNA by 50% (IC50S) ranged from 8.2 to 12.0 microM (DFO), from 65 to 89 microM (BPD), and from 139 to 249 microM (CaDTPA). CaDTPA was the only chelator which completely inhibited production of infectious virus in HFF and vascular endothelial cells at concentrations which had no significant effects on cellular DNA synthesis and growth. Addition of stoichiometric amounts of Fe3+ in the culture medium of HFF cells completely eliminated antiviral effects of DFO while antiviral effects of CaDTPA and BPD were only moderately affected. Fe2+ and Cu2+ were stronger inhibitors of CaDTPA than Fe3+; however, Mn2+ and Zn2+ completely suppressed antiviral effects of CaDTPA. The results show that CaDTPA is a novel nontoxic inhibitor of CMV replication. The antiviral activity of CaDTPA is suppressed by metal ions with a decreasing potency order of Mn2+/Zn2+ > Fe2+ > Cu2+ > Fe3+.

  1. Role of human cytomegalovirus in the proliferation and invasion of extravillous cytotrophoblasts isolated from early placentae

    PubMed Central

    Liu, Tao; Zheng, Xiaofei; Li, Qin; Chen, Juanjuan; Yin, Zongzhi; Xiao, Juan; Zhang, Dandan; Li, Wei; Qiao, Yuan; Chen, Suhua

    2015-01-01

    Aim: We investigated the role of human cytomegalovirus (HCMV) and its mechanism in extravillous cytotrophoblast (EVT) proliferation and invasion in vitro. Methods: Differential enzymatic digestion combined with gradient centrifugation, was used to isolate primary EVT from human chorionic villi collected from early placentae of healthy pregnant women. HCMV infection was determined by immunofluorescence staining of HCMVpp65 antigen expression. An MTT assay was used to examine the role of HCMV in the proliferation of EVT. Quantitative real-time polymerase chain reaction (qRT-PCR), immunocytochemical staining and Western blots were carried out in a control group (EVT) and a virus group (EVT+HCMV) to examine the expression of major genes and protein in TGF-β/Smad signaling pathways in EVT 48 h after inoculation with HCMV. An in vitro cell invasion assay was performed to analyze the influence of HCMV on EVT invasion. Results: HCMV significantly inhibited the proliferation of EVT 48 h after viral infection (P < 0.05). The expression of TGF-β1, Smad1, Smad2, Smad3, Smad4, and Smad5 genes was significantly increased (P < 0.05), but that of TGF-β2, TGF-β3, TGFβRI, TGFβRII, Smad7, MMP2, and MMP9 was significantly decreased in the virus group 48 h after HCMV infection (P < 0.05). Smad7, MMP-2 and MMP-9 protein levels were significantly decreased and the TGF-β1 protein level was significantly increased in infected EVT (all P < 0.05). Conclusions: HCMV may act on multiple steps of the TGF-β/Smad signaling pathway to impede EVT proliferation and invasion. PMID:26770317

  2. Functional analysis of human cytomegalovirus UL/b' region using SCID-hu mouse model.

    PubMed

    Dulal, Kalpana; Cheng, Tong; Yang, Lianwei; Wang, Wei; Huang, Ying; Silver, Benjamin; Selariu, Anca; Xie, Cynthia; Wang, Dai; Espeseth, Amy; Lin, Yanzhen; Wen, Lanling; Xia, Ningshao; Fu, Tong-Ming; Zhu, Hua

    2016-08-01

    Human cytomegalovirus (HCMV) attenuated strains, Towne, and AD169, differ from prototypic pathogenic strains, such as Toledo, in that they are missing a ∼15-kb segment in the UL/b' region. In contrast to the attenuated strains, Toledo can replicate in human tissue implants in SCID (SCID-hu) mice. Thus, this model provides a unique in vivo system to study the mechanism of viral pathogenesis. Twenty-two ORFs have been annotated in the UL/b' region, including tissue-tropic genes encoded in a pentameric gH/gl complex. To differentiate the role of the pentameric gH/gl complex versus the functions of other ORFs in the 15-kb region in supporting viral growth in vivo, a series of recombinant viral strains were constructed and their ability to replicate in SCID-hu mice was tested. The mutations in the Towne and AD169 strains were repaired to restore their pentameric gH/gl complex and it was found that these changes did not rescue their inability to replicate in the SCID-hu mice. Subsequently four deletion viruses (D1, D2, D3, and D4) in the 15-kb region from the Toledo strain were created. It was demonstrated that D2 and D3 were able to grow in SCID-hu mice, while D1 and D4 were not viable. Interestingly, co-infection of the implant with the D1 and D4 viruses could compensate their respective growth defect in vivo. The results demonstrated that rescuing viral epithelial tropism is not sufficient to revert the attenuation phenotype of AD169 or Towne, and pathogenic genes are located in the segments missing in D1 and D4 viruses. J. Med. Virol. 88:1417-1426, 2016. © 2016 Wiley Periodicals, Inc.

  3. A Role for Nuclear F-Actin Induction in Human Cytomegalovirus Nuclear Egress

    PubMed Central

    Wilkie, Adrian R.; Lawler, Jessica L.

    2016-01-01

    ABSTRACT Herpesviruses, which include important pathogens, remodel the host cell nucleus to facilitate infection. This remodeling includes the formation of structures called replication compartments (RCs) in which herpesviruses replicate their DNA. During infection with the betaherpesvirus, human cytomegalovirus (HCMV), viral DNA synthesis occurs at the periphery of RCs within the nuclear interior, after which assembled capsids must reach the inner nuclear membrane (INM) for translocation to the cytoplasm (nuclear egress). The processes that facilitate movement of HCMV capsids to the INM during nuclear egress are unknown. Although an actin-based mechanism of alphaherpesvirus capsid trafficking to the INM has been proposed, it is controversial. Here, using a fluorescently-tagged, nucleus-localized actin-binding peptide, we show that HCMV, but not herpes simplex virus 1, strongly induced nuclear actin filaments (F-actin) in human fibroblasts. Based on studies using UV inactivation and inhibitors, this induction depended on viral gene expression. Interestingly, by 24 h postinfection, nuclear F-actin formed thicker structures that appeared by super-resolution microscopy to be bundles of filaments. Later in infection, nuclear F-actin primarily localized along the RC periphery and between the RC periphery and the nuclear rim. Importantly, a drug that depolymerized nuclear F-actin caused defects in production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization near the nuclear rim, without decreasing capsid accumulation in the nucleus. Thus, our results suggest that for at least one herpesvirus, nuclear F-actin promotes capsid movement to the nuclear periphery and nuclear egress. We discuss our results in terms of competing models for these processes. PMID:27555312

  4. Human cytomegalovirus neutralizing antibody-resistant phenotype is associated with reduced expression of glycoprotein H.

    PubMed Central

    Li, L; Coelingh, K L; Britt, W J

    1995-01-01

    We have characterized a neutralizing antibody-resistant mutant human cytomegalovirus (HCMV) obtained from a patient treated with a human monoclonal antiglycoprotein H (gH; unique long region 75) antibody. This virus exhibited resistance to several different neutralizing anti-gH murine monoclonal antibodies (MAbs), as well as to a polyvalent anti-gH serum. The resistant phenotype was unstable and could be maintained only by passage of plaque-purified virus under neutralizing MAb selection. In the absence of a MAb, the resistant phenotype reverted to a neutralizing antibody-sensitive phenotype within one passage. The predicted amino acid sequences of gH from the MAb-resistant and -susceptible parent viruses were identical. Biochemical analysis of the MAb-resistant and -susceptible parent viruses revealed a marked decrease of gH expression in the envelope of the MAb-resistant virus. Furthermore, propagation of the virus in various MAb concentrations resulted in the production of extracellular virions with various levels of resistance to the neutralizing activity of the MAb. These results suggest a mechanism for the generation of neutralizing antibody-resistant viruses which could evade host-derived antiviral antibody responses. In addition, our findings indicate that the stoichiometry of gH in the envelope of infectious HCMV virions is not rigidly fixed and therefore offer a simple explanation for production of phenotypic variants of HCMV through an assembly process in which the content of gH in the envelope of progeny virions varies randomly. PMID:7666509

  5. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane

    2016-01-01

    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  6. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  7. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  8. Indirect fluorescent-antibody test for human cytomegalovirus infection in the absence of interfering immunoglobulin G receptors.

    PubMed Central

    Swack, N S; Michalski, F J; Baumgarten, A; Hsiung, G D

    1977-01-01

    The presence of immunoglobulin G receptors in human fibroblasts infected with human cytomegalovirus (CMV) resulted in a nonspecific cytoplasmic reaction in the indirect fluorescent-antibody test. Both CMV antibody-positive and antibody-negative sera from human or other animal species produced the cytoplasmic reaction. The substitution of a simian CMV strain for the human virus successfully eliminated this cytoplasmic reaction and, thus, allowed for the observation of virus-induced fluorescent intranuclear inclusions. With the latter system, CMV antibody titers in human sera were equivalent to those obtained by using the human virus and, in addition, allowed for the detection of relatively low-titered serum samples in which antibody measurement was difficult when human CMV-infected cells were used in the indirect fluorescent-antibody test. Images PMID:193791

  9. Human Cytomegalovirus Exploits Interferon-Induced Transmembrane Proteins To Facilitate Morphogenesis of the Virion Assembly Compartment

    PubMed Central

    Xie, Maorong; Xuan, Baoqin; Shan, Jiaoyu; Pan, Deng; Sun, Yamei; Shan, Zhao; Zhang, Jinping; Yu, Dong

    2014-01-01

    ABSTRACT Recently, interferon-induced transmembrane proteins (IFITMs) have been identified to be key effector molecules in the host type I interferon defense system. The invasion of host cells by a large range of RNA viruses is inhibited by IFITMs during the entry step. However, the roles of IFITMs in DNA virus infections have not been studied in detail. In this study, we report that human cytomegalovirus (HCMV), a large human DNA virus, exploits IFITMs to facilitate the formation of the virion assembly compartment (vAC) during infection of human fibroblasts. We found that IFITMs were expressed constitutively in human embryonic lung fibroblasts (MRC5 cells). HCMV infection inhibited IFITM protein accumulation in the later stages of infection. Overexpression of an IFITM protein in MRC5 cells slightly enhanced HCMV production and knockdown of IFITMs by RNA interference reduced the virus titer by about 100-fold on day 8 postinfection, according to the findings of a virus yield assay at a low multiplicity of infection. Virus gene expression and DNA synthesis were not affected, but the typical round structure of the vAC was not formed after the suppression of IFITMs, thereby resulting in defective virion assembly and the production of less infectious virion particles. Interestingly, the replication of herpes simplex virus, a human herpesvirus that is closely related to HCMV, was not affected by the suppression of IFITMs in MRC5 cells. These results indicate that IFITMs are involved in a specific pathway required for HCMV replication. IMPORTANCE HCMV is known to repurpose the interferon-stimulated genes (ISGs) viperin and tetherin to facilitate its replication. Our results expand the range of ISGs that can be exploited by HCMV for its replication. This is also the first report of a proviral function of IFITMs in DNA virus replication. In addition, whereas previous studies showed that IFITMs modulate virus entry, which is a very early stage in the virus life cycle, we

  10. Multiple mechanisms are implicated in the regulation of NF-kappa B activity during human cytomegalovirus infection.

    PubMed Central

    Kowalik, T F; Wing, B; Haskill, J S; Azizkhan, J C; Baldwin, A S; Huang, E S

    1993-01-01

    Infection-induced activation of the human cytomegalovirus major immediate early enhancer/promoter has been shown to be regulated primarily by transcription factor NF-kappa B cis elements. However, the mechanism(s) by which human cytomegalovirus induces NF-kappa B activity is unknown. A study was therefore undertaken to determine how this virus would affect normal NF-kappa B regulation. Viral infection of fibroblasts resulted in the specific stimulation of promoters containing major histocompatibility complex NF-kappa B cis elements fused upstream of the chloramphenicol acetyltransferase reporter gene. Electrophoretic mobility shift assays of nuclear extracts derived from mock- and virus-infected cells showed dramatic and sustained increases in DNA-binding proteins specific for these NF-kappa B sequences. Experiments using MAD-3 I kappa B, a specific inhibitor of NF-kappa B, and antibodies directed against rel family members demonstrated that the induced binding activities contained p50 and p65 proteins but not c-rel. Northern analysis indicated maximal levels of p50 mRNA by 4 h postinfection, whereas p65 and MAD-3 I kappa B mRNA accumulation peaked at 48-72 h postinfection, suggesting different regulatory mechanisms for p50 and p65/I kappa B genes. Electrophoretic mobility shift assays with deoxycholate-treated cytoplasmic extracts demonstrated a 3- to 4-fold decrease in the cytosolic stores of NF-kappa B binding activity by 4 h postinfection. Western blots probed with antibodies directed against MAD-3 I kappa B or pp40 (a protein isolated from chicken with sequence and biochemical properties similar to those of MAD-3 I kappa B) indicated that a cross-reactive peptide of 39 kDa was no longer detectable after 24 h postinfection. These results demonstrate that the activation and maintenance of nuclear NF-kappa B DNA binding and enhancer activities upon human cytomegalovirus infection occurs by multiple mechanisms. Images PMID:8381532

  11. Nucleocytoplasmic shuttling and CRM1-dependent MHC class I peptide presentation of human cytomegalovirus pp65.

    PubMed

    Frankenberg, Nadine; Lischka, Peter; Pepperl-Klindworth, Sandra; Stamminger, Thomas; Plachter, Bodo

    2012-11-01

    The phosphoprotein 65 (pp65) of human cytomegalovirus is a prominent target of the antiviral CD8 T lymphocyte response. This study focused on investigating the properties of pp65 that render it a privileged antigen. It was found that pp65 was metabolically stable. The tegument protein was introduced into MHC class I presentation following its delivery via non-replicating dense bodies. No ubiquitination was found on particle-associated pp65. Proof was obtained that pp65 was a nucleocytoplasmic shuttle protein, using heterokaryon analyses. Based on this finding, inhibition experiments showed that presentation of particle-derived pp65 by HLA-A2 was sensitive to the impairment of the CRM1-mediated nuclear export pathway. The data support the idea that particle-derived pp65 can serve as a nuclear reservoir for proteasomal processing and MHC class I presentation, following its CRM1-dependent nuclear export. The presentation of pp65-derived peptides was also impaired by CRM1-inhibition following de novo synthesis of the tegument protein. However, pp65 protein levels were also reduced when blocking CRM1-mediated export after transient expression. This indicated that pp65 expression rather than direct interference with its own nuclear export was responsible for its reduced presentation in this case. The functionality of CRM1-mediated nuclear export is thus important for the presentation of pp65-derived peptides in the context of MHC class I on organ cells, both after exogenous uptake and after de novo synthesis of the tegument protein, but different mechanisms may account for either case.

  12. Interactions between Proteins Encoded within the Human Cytomegalovirus UL133-UL138 Locus

    PubMed Central

    Petrucelli, Alex; Umashankar, Mahadevaiah; Zagallo, Patricia; Rak, Michael

    2012-01-01

    We previously described a novel genetic locus within the ULb′ region of the human cytomegalovirus (HCMV) genome that, while dispensable for replication in fibroblasts, suppresses replication in hematopoietic progenitors and augments replication in endothelial cells. This locus, referred to as the UL133-UL138 locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. In this work, we have mapped the interactions among these proteins. An analysis of all pairwise interactions during transient expression revealed a robust interaction between pUL133 and pUL138. Potential interactions between pUL136 and both pUL133 and pUL138 were also revealed. In addition, each of the UL133-UL138 locus proteins self-associated, suggesting a potential to form higher-order homomeric complexes. As both pUL133 and pUL138 function in promoting viral latency in CD34+ hematopoietic progenitor cells (HPCs) infected in vitro, we further focused on this interaction. pUL133 and pUL138 are the predominant complex detected when all proteins are expressed together and require no other proteins in the locus for their association. During infection, the interaction between pUL133 and pUL138 or pUL136 can be detected. A recombinant virus that fails to express both pUL133 and pUL138 exhibited a latency phenotype similar to that of viruses that fail to express either pUL133 or pUL138, indicating that these proteins function cooperatively in latency and do not have independent functions that additively contribute to HCMV latency. These studies identify protein interactions among proteins encoded by the UL133-UL138 locus and demonstrate an important interaction impacting the outcome of HCMV infection. PMID:22674978

  13. Human cytomegalovirus gene expression in long-term infected glioma stem cells.

    PubMed

    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana

    2014-01-01

    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  14. Biochemical, biophysical, and mutational analyses of subunit interactions of the human cytomegalovirus nuclear egress complex.

    PubMed

    Sam, My D; Evans, Brady T; Coen, Donald M; Hogle, James M

    2009-04-01

    Nuclear egress, the trafficking of herpesvirus nucleocapsids from the nucleus to the cytoplasm, involves two conserved viral proteins that form a complex at the nuclear envelope, referred to as the nuclear egress complex. In human cytomegalovirus, these two proteins are called UL50 and UL53. To study UL50 and UL53 in molecular detail, these proteins were expressed in bacteria and purified. To obtain highly expressed, pure proteins, it was necessary to truncate both constructs based on sequence conservation and predicted secondary structural elements. Size exclusion chromatography and analytical ultracentrifugation studies indicated that the truncated form of UL50 is a monomer in solution, that the truncated form of UL53 is a homodimer, and that, when mixed, the two proteins form a heterodimer. To identify residues of UL53 crucial for homodimerization and for heterodimerization with UL50, we constructed and expressed mutant forms of UL53 containing alanine substitutions in a predicted helix. Isothermal titration calorimetry was used to measure the binding affinities of the UL53 mutants to UL50. UL53 residues, the replacement of which reduced binding to UL50, form a surface on one face of the predicted helix. Moreover, most of the substitutions that reduce UL53-UL50 interactions also reduced homodimerization. Substitutions that reduced the interaction between UL50 and UL53 in vitro also reduced colocalization of full-length UL50 and UL53 at the nuclear rim in transfected cells. These results demonstrate direct protein-protein interactions between these proteins that are likely to be mediated by a helix, and they have implications for understanding nuclear egress and for drug discovery.

  15. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism.

    PubMed

    Li, Gang; Nguyen, Christopher C; Ryckman, Brent J; Britt, William J; Kamil, Jeremy P

    2015-04-01

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes.

  16. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism

    PubMed Central

    Li, Gang; Nguyen, Christopher C.; Ryckman, Brent J.; Britt, William J.; Kamil, Jeremy P.

    2015-01-01

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes. PMID:25831500

  17. Effectiveness of PCR and Immunofluorescence Techniques for Detecting Human Cytomegalovirus in Blood and Bronchoalveolar Lavage Fluid.

    PubMed

    Roży, A; Duk, K; Szumna, B; Skrońska, P; Gawryluk, D; Chorostowska-Wynimko, J

    2016-01-01

    Current diagnostic methods allow a rapid and reliable detection of active human cytomegalovirus (hCMV) infection by identifying the presence of pp65 CMV antigen or CMV DNA in peripheral blood and affected organs. The goal of this study was to evaluate the effectiveness of CMV detection in blood and organ-specific biological material, such as bronchoalveolar lavage fluid (BALF), by comparing two standard diagnostic methods, immunofluorescence (IF) and the real-time polymerase chain reaction (PCR). We evaluated 25 patients with concomitant respiratory disease who were referred to our hospital for diagnosis due to suspected acute CMV infection. The presence of hCMV was concomitantly evaluated by IF and PCR in 16 peripheral blood samples. In two patients, we observed positive results for both IF and PCR, and in two other patients the results were discordant. Of 11 patients, CMV DNA was detected in six BALF samples, and in one blood plasma sample. Real-time PCR detected CMV DNA in 54.6 % of BALF samples and 12.0 % of blood samples, while indirect IF testing confirmed antigenemia in 12.5 % of blood samples. The results from our study suggest that the IF method is as effective as PCR for detecting an ongoing CMV infection in blood samples. However, real-time PCR was much more effective at detecting CMV DNA in BALF compared to blood samples. Our results suggest that the biological material being tested during CMV diagnosis should be derived directly from the virally infected organ(s).

  18. Primary human adult lung epithelial cells in vitro: response to interferon-gamma and cytomegalovirus.

    PubMed Central

    Ibrahim, L; Dominguez, M; Yacoub, M

    1993-01-01

    Primary human adult lung epithelial cells (ALEC) were established in culture using the most distal parts of the lung to avoid the airways. Immunocytochemical peroxidase staining and semiquantitative flow cytometry were used to characterize the cells in conjunction with a panel of monoclonal antibodies (mAb). The cells showed a constitutive expression of major histocompatibility complex (MHC) class I antigens, patchy expression of intercellular adhesion molecule-1 (ICAM-1) and a weak patchy expression of MHC class II antigens (detected using immunocytochemical staining). Incubation of the primary ALEC with interferon-gamma (IFN-gamma) (250 U/ml) stimulated an up-regulation of the expression of these three antigens to varying degrees; expression of MHC class I antigens and ICAM-1 molecules showed an up-regulation at 10 hr after the start of the treatment, reaching a peak at 48 hr, maintaining it for the next 24 hr and then, steadily and progressively, losing it towards the end of the experiment at 96 hr. Expression of HLA-DR showed an up-regulation at 17 hr after the start of the treatment, reaching a peak at 72 hr and maintaining it for the next 24 hr. Cytomegalovirus (CMV) infection of ALEC in culture caused an up-regulation of expression of class I antigens and ICAM-1, but not DR. However, when the infected cells were incubated with IFN-gamma, an up-regulation in the expression of DR took place. Therefore, within the micro-environment of the transplanted lung the presence of cytokines (IFN-gamma) produced by infiltrating activated mononuclear cells, may render the lung epithelial cells capable of acting as antigen-presenting cells, expressing high levels of class I antigens, ICAM-1 and class II antigens, activating CD8 and CD4 cells thus playing a major part in the process of rejection of the lung allograft; themselves becoming a primary target in the process. Images Figure 1 Figure 2 PMID:8099565

  19. Function of human cytomegalovirus UL97 kinase in viral infection and its inhibition by maribavir

    PubMed Central

    Prichard, Mark N.

    2013-01-01

    Summary The serine/threonine kinase expressed by human cytomegalovirus from gene UL97 phosphorylates the antiviral drug ganciclovir, but its biological function is the phosphorylation of its natural viral and cellular protein substrates which affect viral replication at many levels. The UL97 kinase null phenotype is therefore complex, as is the mechanism of action of maribavir, a highly specific inhibitor of its enzymatic activity. Studies that utilise the drug corroborate results from genetic approaches and together have elucidated many functions of the UL97 kinase that are critical for viral replication. The kinase phosphorylates eukaryotic elongation factor 1delta, the carboxyl terminal domain of the large subunit of RNA polymerase II, the retinoblastoma tumour suppressor and lamins A and C. Each of these is also phosphorylated and regulated by cdc2/cyclin-dependent kinase 1, suggesting that the viral kinase may perform a similar function. These and other activities of the UL97 kinase appear to stimulate the cell cycle to support viral DNA synthesis, enhance the expression of viral genes, promote virion morphogenesis and facilitate the egress of mature capsids from the nucleus. In the absence of UL97 kinase activity, viral DNA synthesis is inefficient and structural proteins are sequestered in nuclear aggresomes, reducing the efficiency of virion morphogenesis. Mature capsids that do form fail to egress the nucleus as the nuclear lamina are not dispersed by the kinase. The critical functions performed by the UL97 kinase illustrate its importance in viral replication and confirm that the kinase is a target for the development of antiviral therapies. PMID:19434630

  20. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  1. Fragment of tegument protein pp65 of human cytomegalovirus induces autoantibodies in BALB/c mice

    PubMed Central

    2011-01-01

    Introduction Human cytomegalovirus (HCMV) infection has been implicated in the development of autoimmunity, including systemic lupus erythematosus (SLE). Previously we reported that HCMV phosphoprotein 65 (pp65) could induce early onset of autoantibody and glomerulonephritis on lupus-prone NZB/W mice. This study further examined whether the B cell epitope(s) in pp65 is able to drive the development of autoantibody. Methods Sera from SLE patients or HCMVpp65-immunized mice were analyzed for anti-nuclear antibody by immunoblotting, enzyme-linked immunosorbent assay (ELISA), immunofluorescent stain and Crithidia luciliae stain. The deposition of immunoglobulin to the kidney was also examined by immunofluorescent stain. The interactions between pp65 sub-fragment to cellular proteins were revealed by yeast two-hybrid analyses. Results Our results showed that most SLE patients possessed antibodies to the C-terminal half of the HCMVpp65 antigen. Of these positive sera, 73% were also positive to the pp65336-439 sub-fragment. The immunization of pp65336-439 induced formation of multiple anti-nuclear antibodies, including anti-chromatin, anti-centriole, anti-mitotic spindle type I/II (MSA I/II) and a significant elevation of anti-double-stranded DNA (anti-dsDNA) antibodies on BALB/c mice. Yeast two-hybrid analyses revealed the binding of pp65336-439 sub-fragment to cellular proteins. Immunoglobulin deposition on glomeruli was also detected on pp65336-439-immunized mice. Conclusions Our data suggested that HCMVpp65336-439 sub-fragment may induce cross-reactive antibodies to several nuclear antigens, which could contribute to the development of autoimmunity in genetic-suspected individuals. PMID:21989080

  2. Human cytomegalovirus tegument protein pUL71 is required for efficient virion egress.

    PubMed

    Womack, Andrew; Shenk, Thomas

    2010-01-01

    The human cytomegalovirus virion is composed of a DNA genome packaged in an icosahedral capsid, surrounded by a tegument of protein and RNA, all enclosed within a glycoprotein-studded envelope. Achieving this intricate virion architecture requires a coordinated process of assembly and egress. We show here that pUL71, a component of the virion tegument with a previously uncharacterized function, is required for the virus-induced reorganization of host cell membranes, which is necessary for efficient viral assembly and egress. A mutant that did not express pUL71 was able to efficiently accumulate viral genomes and proteins that were tested but was defective for the production and release of infectious virions. The protein localized to vesicular structures at the periphery of the viral assembly compartment, and during infection with a pUL71-deficient virus, these structures were grossly enlarged and aberrantly contained a cellular marker of late endosomes/lysosomes. Mutant virus preparations exhibited less infectivity per unit genome than wild-type virus preparations, due to aggregation of virus particles and their association with membrane fragments. Finally, mutant virus particles accumulated within the cytoplasm of infected cells and were localized to the periphery of large structures with properties of lysosomes, whose formation was kinetically favored in mutant-virus-infected cells. Together, these observations point to a role for pUL71 in the establishment and/or maintenance of a functional viral assembly compartment that is required for normal virion trafficking and egress from infected cells. PMID:21151777

  3. A Role for 3-O-Sulfated Heparan Sulfate in Promoting Human Cytomegalovirus Infection in Human Iris Cells

    PubMed Central

    Baldwin, John; Maus, Erika; Zanotti, Brian; Volin, Michael V.; Tandon, Ritesh; Shukla, Deepak

    2015-01-01

    Human cytomegalovirus (HCMV) has emerged as a clinically opportunistic pathogen that targets multiple types of ocular cells and tissues, including the iris region of the uveal tract during anterior uveitis. In this report, we used primary cultures of human iris stroma (HIS) cells derived from human eye donors to investigate HCMV entry. The following lines of evidence suggested the role of 3-O-sulfated heparan sulfate (3-OS HS) during HCMV-mediated entry and cell-to-cell fusion in HIS cells. First, 3-O-sulfotransferase-3 (3-OST-3) expression in HIS cells promoted HCMV internalization, while pretreatment of HIS cells with heparinase enzyme or with anti-3-OS HS (G2) peptide significantly reduced the HCMV-mediated formation of plaques/foci. Second, coculture of the HCMV-infected HIS cells with CHO-K1 cells expressing 3-OS HS significantly enhanced cell fusion. Finally, a similar trend of enhanced fusion was observed with cells expressing HCMV glycoproteins (gB, gO, and gH-gL) cocultured with 3-OS HS cells. Taken together, these results highlight the role of 3-OS HS during HCMV plaque formation and cell-to-cell fusion and identify a novel target for future therapeutic interventions. PMID:25717110

  4. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  5. Early detection of cytomegalovirus-specific cytotoxic T lymphocytes against cytomegalovirus antigenemia in human leukocyte antigen haploidentical hematopoietic stem cell transplantation.

    PubMed

    Kato, Ruri; Tamaki, Hiroya; Ikegame, Kazuhiro; Yoshihara, Satoshi; Kaida, Katsuji; Taniguchi, Kyoko; Inoue, Takayuki; Ishii, Shinichi; Nakata, Jun; Fujioka, Tatsuya; Eguchi, Ryoji; Soma, Toshihiro; Okada, Masaya; Ogawa, Hiroyasu

    2015-10-01

    Human leukocyte antigen (HLA)-haploidentical stem cell transplantation (haplo-SCT) is associated with a high incidence of cytomegalovirus (CMV) infection, probably originating from the delayed reconstitution of CMV-specific T cell immunity. There have been few reports on the presence of CMV-specific cytotoxic T lymphocytes (CMV-CTLs) after haplo-SCT. We have studied CMV-specific immune reconstitution by measuring the absolute number of CMV-CTLs using a flow cytometry method with HLA-A2-restricted NLVPMVATV peptide dextramers. We examined the association between reconstitution patterns of CMV-CTLs and the duration of CMV antigenemia in 15 patients who underwent first allogeneic SCT from HLA-haploidentical-related donors with HLA-A2. In seven and eight patients, CMV antigenemia consecutively resolved for more than 4 weeks (the CMV antigenemia 'resolved' group) and intermittently persisted (the CMV antigenemia 'persistent' group) during a 100-day observation period, respectively. The group of the seven patients, in whom levels of CMV antigenemia were reduced to zero, had a significantly lower maximum level of CMV antigenemia than the CMV antigenemia persistent group. In contrast, the CMV antigenemia persistent group had a significantly higher maximum level of CMV-CTLs, but the levels took longer to peak. Despite no difference in general lymphocyte recovery between the two groups, the CMV antigenemia resolved group had significantly higher median CMV-CTL counts than the CMV antigenemia persistent group at 6 weeks after onset of CMV infection. Flow cytometry analysis of CMV-CTLs is a convenient method of monitoring reconstitution of CMV-specific lymphocyte immunity following haplo-SCT.

  6. Detection of human cytomegalovirus DNA in paraffin sections of human brain by polymerase chain reaction and the occurrence of false negative results.

    PubMed Central

    Gass, P; Kiessling, M; Schäfer, P; Mester, C; Schmitt, H P; Kühn, J E

    1993-01-01

    Paraffin-embedded necropsy material from 6 patients with human cytomegalovirus encephalitis (HCMVE) corroborated by immunocytochemistry and 11 control cases were examined for the presence of human cytomegalovirus (HCMV) DNA by a nested polymerase chain reaction (nPCR). A characteristic 183 base pair (bp) fragment of the HCMV genome could readily be amplified in 4 cases of HCMVE. In 2 cases of HCMVE, viral DNA could be demonstrated only sporadically by PCR, due most likely to inefficient DNA extraction or DNA degradation. All control cases remained negative. The nPCR provides a specific method for detecting HCMV DNA in routinely processed biopsy and necropsy material and may be used in archival tissues for the diagnosis of infection. Fixation of samples and DNA extraction are, however, crucial steps and require careful control if PCR is used for detection of HCMV, to avoid false negative results. Images PMID:8382271

  7. Classical and non-classical MHC I molecule manipulation by human cytomegalovirus: so many targets—but how many arrows in the quiver?

    PubMed Central

    Halenius, Anne; Gerke, Carolin; Hengel, Hartmut

    2015-01-01

    Major mechanisms for the recognition of pathogens by immune cells have evolved to employ classical and non-classical major histocompatibility complex class I (MHC I) molecules. Classical MHC I molecules present antigenic peptide ligands on infected cells to CD8+ T cells, whereas a key function for non-classical MHC I molecules is to mediate inhibitory or activating stimuli in natural killer (NK) cells. The structural diversity of MHC I puts immense pressure on persisting viruses, including cytomegaloviruses. The very large coding capacity of the human cytomegalovirus allows it to express a whole arsenal of immunoevasive factors assigned to individual MHC class I targets. This review summarizes achievements from more than two decades of intense research on how human cytomegalovirus manipulates MHC I molecules and escapes elimination by the immune system. PMID:25418469

  8. Identification of a Neutralizing Epitope within Antigenic Domain 5 of Glycoprotein B of Human Cytomegalovirus

    PubMed Central

    Wiegers, Anna-Katharina; Sticht, Heinrich; Winkler, Thomas H.; Britt, William J.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is an important, ubiquitous pathogen that causes severe clinical disease in immunocompromised individuals, such as organ transplant recipients and infants infected in utero. The envelope glycoprotein B (gB) of HCMV is a major antigen for the induction of virus-neutralizing antibodies. We have begun to define target structures within gB that are recognized by virus-neutralizing antibodies. Antigenic domain 5 (AD-5) of gB has been identified as an important target for neutralizing antibodies in studies using human monoclonal antibodies (MAbs). Anti-AD-5 MAbs share a target site on gB, despite originating from different, healthy, HCMV-infected donors. Mutational analysis of AD-5 identified tyrosine 280 in combination with other surface-exposed residues (the YNND epitope) as critical for antibody binding. The YNND epitope is strictly conserved among different HCMV strains. Recombinant viruses carrying YNND mutations in AD-5 were resistant to virus-neutralizing MAbs. Competition enzyme-linked immunosorbent assays (ELISAs) with human HCMV-convalescent-phase sera from unselected donors confirmed the conserved antibody response for the YNND epitope in HCMV-infected individuals and, because a significant fraction of the gB AD-5 response was directed against the YNND epitope, further argued that this epitope is a major target of anti-AD-5 antibody responses. In addition, affinity-purified polyclonal anti-AD-5 antibodies prepared from individual sera showed reactivity to AD-5 and neutralization activity toward gB mutant viruses that were similar to those of AD-5-specific MAbs. Taken together, our data indicate that the YNND epitope represents an important target for anti-gB antibody responses as well as for anti-AD-5 virus-neutralizing antibodies. IMPORTANCE HCMV is a major global health concern, and a vaccine to prevent HCMV disease is a widely recognized medical need. Glycoprotein B of HCMV is an important target for neutralizing

  9. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  10. A permanently growing human endothelial cell line supports productive infection with human cytomegalovirus under conditional cell growth arrest.

    PubMed

    Lieber, Diana; Hochdorfer, Daniel; Stoehr, Dagmar; Schubert, Axel; Lotfi, Ramin; May, Tobias; Wirth, Dagmar; Sinzger, Christian

    2015-09-01

    Infection of vascular endothelial cells (ECs) is assumed to contribute to dissemination of human cytomegalovirus (HCMV). Investigation of virus-host interactions in ECs such as human umbilical vein endothelial cells (HUVECs) is limited due to the low maximal passage numbers of these primary cells. We tested a conditionally immortalized EC line (HEC-LTT) and a permanent cell line (EA.hy926) for their susceptibility to HCMV infection. Both cell lines resembled HUVECs in that they allowed for entry and immediate early protein expression of highly endotheliotropic HCMV strains but not of poorly endotheliotropic strains, rendering them suitable for analysis of the viral entry mechanism in ECs. The late phase of viral replication and release, however, was supported by growth-controlled HEC-LTT cells but not by EA.hy926 cells. HEC-LTT cells support both the early and late phase of viral replication and release infectious progeny virus at titers comparable to primary HUVECs; thus, the HEC-LTT cell line is a cell culture model representing the full viral replicative cycle of HCMV in ECs. The implementation of permanent HEC-LTT and EA.hy926 cell lines in HCMV research will facilitate long-term approaches that are not feasible in primary HUVECs.

  11. Human cytomegalovirus infection leads to elevated levels of transplant arteriosclerosis in a humanized mouse aortic xenograft model.

    PubMed

    Abele-Ohl, S; Leis, M; Wollin, M; Mahmoudian, S; Hoffmann, J; Müller, R; Heim, C; Spriewald, B M; Weyand, M; Stamminger, T; Ensminger, S M

    2012-07-01

    Recent findings emphasized an important role of human cytomegalovirus (HCMV) infection in the development of transplant arteriosclerosis. Therefore, the aim of this study was to develop a human peripheral blood lymphocyte (hu-PBL)/Rag-2(-/-) γc(-/-) mouse-xenograft-model to investigate both immunological as well as viral effector mechanisms in the progression of transplant arteriosclerosis. For this, sidebranches from the internal mammary artery were recovered during coronary artery bypass graft surgery, tissue-typed and infected with HCMV. Then, size-matched sidebranches were implanted into the infrarenal aorta of Rag-2(-/-) γc(-/-) mice. The animals were reconstituted with human peripheral blood mononuclear cells (PBMCs) 7 days after transplantation. HCMV-infection was confirmed by Taqman-PCR and immunofluorescence analyses. Arterial grafts were analyzed by histology on day 40 after transplantation. PBMC-reconstituted Rag-2(-/-) γc(-/-) animals showed splenic chimerism levels ranging from 1-16% human cells. After reconstitution, Rag-2(-/-) γc(-/-) mice developed human leukocyte infiltrates in their grafts and vascular lesions that were significantly elevated after infection. Cellular infiltration revealed significantly increased ICAM-1 and PDGF-R-β expression after HCMV-infection of the graft. Arterial grafts from unreconstituted Rag-2(-/-) γc(-/-) recipients showed no vascular lesions. These data demonstrate a causative relationship between HCMV-infection as an isolated risk factor and the development of transplant-arteriosclerosis in a humanized mouse arterial-transplant-model possibly by elevated ICAM-1 and PDGF-R-β expression.

  12. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus

    PubMed Central

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q.; Xu, Xin; Dulcey, Andrés E.; Marugan, Juan J.; Ferrer, Marc; Arav-Boger, Ravit

    2016-01-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50−40±1.72 nM, CC50−8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected

  13. Human Cytomegalovirus Vaccine Based on the Envelope gH/gL Pentamer Complex

    PubMed Central

    Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A.; Diamond, Don J.

    2014-01-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  14. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.

    PubMed

    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J

    2014-11-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  15. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.

    PubMed

    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J

    2014-11-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  16. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus.

    PubMed

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q; Xu, Xin; Dulcey, Andrés E; Marugan, Juan J; Ferrer, Marc; Arav-Boger, Ravit

    2016-06-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50-40±1.72 nM, CC50-8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected RPS14

  17. Genome structure and virion polypeptides of the primate herpesviruses Herpesvirus aotus types 1 and 3: comparison with human cytomegalovirus.

    PubMed Central

    Ebeling, A; Keil, G; Nowak, B; Fleckenstein, B; Berthelot, N; Sheldrick, P

    1983-01-01

    Two serologically distinguishable primate herpesviruses, Herpesvirus aotus type 1 and type 3, were examined with regard to their genomes and structural polypeptides. The duplex DNA genomes of these two viruses were found to be essentially identical in molecular weight (Mr approximately equal to 145 X 10(6)) and guanine plus cytosine composition (55%). Both contained unique and inverted repeat nucleotide sequences of the same size and arrangement, which, as judged by DNA-DNA hybridization and restriction enzyme analyses, were at least 95% homologous. In addition, no differences were observed in electrophoretic profiles of virion polypeptides. Because of their great similarity with respect to these criteria, the two viruses ought to be considered independent isolates (or strains) of a single virus, which should be designated H. aotus type 1. The elevated molecular weight and presence of two sets of inverted repeat sequences closely resemble the structure of the human cytomegalovirus genome. However, no sequence homology (less than 5%) nor similarity in virion polypeptides was detected between H. aotus type 1 and human cytomegalovirus. Images PMID:6300430

  18. Xenotransplantation and porcine cytomegalovirus.

    PubMed

    Denner, Joachim

    2015-01-01

    Porcine microorganisms may be transmitted to the human recipient when xenotransplantation with pig cells, tissues, and organs will be performed. Most of such microorganisms can be eliminated from the donor pig by specified or designated pathogen-free production of the animals. As human cytomegalovirus causes severe transplant rejection in allotransplantation, considerable concern is warranted on the potential pathogenicity of porcine cytomegalovirus (PCMV) in the setting of xenotransplantation. On the other hand, despite having a similar name, PCMV is different from HCMV. The impact of PCMV infection on pigs is known; however, the influence of PCMV on the human transplant recipient is unclear. However, first transplantations of pig organs infected with PCMV into non-human primates were associated with a significant reduction of the survival time of the transplants. Sensitive detection methods and strategies for elimination of PCMV from donor herds are required.

  19. Modulation of Homology-Directed Repair in T98G Glioblastoma Cells Due to Interactions between Wildtype p53, Rad51 and HCMV IE1-72

    PubMed Central

    Kulkarni, Amit S.; Fortunato, Elizabeth A.

    2014-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous pathogen capable of causing life threatening consequences in neonates and immune-compromised individuals. HCMV inflicts site-specific double strand breaks (DSBs) in the cellular genome. DNA damage infliction raises the corollary question of virus modulation of DNA repair. We recently reported HDR was stimulated in wt human foreskin fibroblasts (HFFs) during fully permissive infection or expression of the HCMV protein IE1-72 (IE72). These studies have been extended into semi-permissive T98G glioblastoma cells. T98Gs encode a mutant p53, which may contribute to their high baseline rate of HDR. We fully expected HCMV infection to increase HDR in T98Gs, similar to its effects in HFFs. Surprisingly in T98Gs HCMV infection, or sole expression of IE72, decreased HDR by two-fold. Transient expression of wt p53 in T98Gs also reduced HDR by two-fold. Dual transient expression of wt p53 and IE72 restored high baseline HDR levels. GST pulldown experiments revealed that both IE72 and wt p53 bound the important HDR protein, Rad51. We conclude that the expression of certain HCMV proteins can modulate HDR in an infected cell, dependent upon p53 status. We propose a model of the protein interactions explaining this behavior. PMID:24576846

  20. Human Cytomegalovirus UL97 Kinase and Nonkinase Functions Mediate Viral Cytoplasmic Secondary Envelopment ▿

    PubMed Central

    Goldberg, Miri D.; Honigman, Alik; Weinstein, Jacob; Chou, Sunwen; Taraboulos, Albert; Rouvinski, Alexander; Shinder, Vera; Wolf, Dana G.

    2011-01-01

    Previous studies have revealed critical roles for the human cytomegalovirus (HCMV) UL97 kinase in viral nuclear maturation events. We have shown recently that UL97 affects the morphology of the viral cytoplasmic assembly compartment (AC) (M. Azzeh, A. Honigman, A. Taraboulos, A. Rouvinski, and D. G. Wolf, Virology 354:69-79, 2006). Here, we employed a comprehensive ultrastructural analysis to dissect the impact of UL97 on cytoplasmic steps of HCMV assembly. Using UL97 deletion (ΔUL97) and kinase-null (K355M) mutants, as well as the UL97 kinase inhibitor NGIC-I, we demonstrated that the loss of UL97 kinase activity resulted in a unique combination of cytoplasmic features: (i) the formation of pp65-rich aberrant cytoplasmic tegument aggregates, (ii) distorted intracytoplasmic membranes, which replaced the normal architecture of the AC, and (iv) a paucity of cytoplasmic tegumented capsids and dense bodies (DBs). We further showed that these abnormal assembly intermediates did not result from impaired nuclear capsid maturation and egress per se by using 2-bromo-5,6-dichloro-1-(β-d-ribofuranosyl) benzimidizole (BDCRB) to induce the artificial inhibition of nuclear maturation and the nucleocytoplasmic translocation of capsids. The specific abrogation of UL97 kinase activity under low-multiplicity-of-infection conditions resulted in the improved release of extracellular virus compared to that of ΔUL97, despite similar rates of viral DNA accumulation and similar effects on nuclear capsid maturation and egress. The only ultrastructural correlate of the growth difference was a higher number of cytoplasmic DBs, tegumented capsids, and clustered viral particles observed upon the specific abrogation of UL97 kinase activity compared to that of ΔUL97. These combined findings reveal a novel role for UL97 in HCMV cytoplasmic secondary envelopment steps, with a further distinction of kinase-mediated function in the formation of the virus-induced AC and a nonkinase function

  1. Human Cytomegalovirus UL97 Kinase Activity Is Required for the Hyperphosphorylation of Retinoblastoma Protein and Inhibits the Formation of Nuclear Aggresomes

    SciTech Connect

    Prichard, Mark N.; Sztul, Elizabeth; Daily, Shannon L.; Perry, Amie L.; Frederick, Samuel L.; Gill, Rachel B.; Hartline, Caroll B.; Streblow, Daniel N.; Varnum, Susan M.; Smith, Richard D.; Kern, Earl R.

    2008-05-01

    Cells infected with human cytomegalovirus in the absence of UL97 kinase activity produce large nuclear aggregates that sequester considerable quantities of viral proteins. A transient expression assay suggested that pp71 and IE1 were also involved in this process, and this suggestion was significant, since both proteins have been reported to interact with components of promyelocytic leukemia (PML) bodies (ND10) and also interact functionally with retinoblastoma pocket proteins (RB). PML bodies have been linked to the formation of nuclear aggresomes, and colocalization studies suggested that viral proteins were recruited to these structures and that UL97 kinase activity inhibited their formation. Proteins associated with PML bodies were examined by Western blot analysis, and pUL97 appeared to specifically affect the phosphorylation of RB in a kinasedependent manner. Three consensus RB binding motifs were identified in the UL97 kinase, and recombinant viruses were constructed in which each was mutated to assess a potential role in the phosphorylation of RB and the inhibition of nuclear aggresome formation. The mutation of either the conserved LxCxE RB binding moti for the lysine required for kinase activity impaired the ability of the virus to stabilize and phosphorylate RB. We concluded from these studies that both UL97 kinase activity and the LxCxE RB binding motif are required for the phosphorylation and stabilization of RB in infected cells and that this effect can be antagonized by the antiviral drug maribavir. These data also suggest a potential link between RB function and the formation of aggresomes.

  2. Human Cytomegalovirus pUL29/28 and pUL38 Repression of p53-Regulated p21CIP1 and Caspase 1 Promoters during Infection

    PubMed Central

    Savaryn, John P.; Reitsma, Justin M.; Bigley, Tarin M.; Halligan, Brian D.; Qian, Zhikang; Yu, Dong

    2013-01-01

    During infection by human cytomegalovirus (HCMV), the tumor suppressor protein p53, which promotes efficient viral gene expression, is stabilized. However, the expression of numerous p53-responsive cellular genes is not upregulated. The molecular mechanism used to manipulate the transcriptional activity of p53 during infection remains unclear. The HCMV proteins IE1, IE2, pUL44, and pUL84 likely contribute to the regulation of p53. In this study, we used a discovery-based approach to identify the protein targets of the HCMV protein pUL29/28 during infection. Previous studies have demonstrated that pUL29/28 regulates viral gene expression by interacting with the chromatin remodeling complex NuRD. Here, we observed that pUL29/28 also associates with p53, an additional deacetylase complex, and several HCMV proteins, including pUL38. We confirmed the interaction between p53 and pUL29/28 in both the presence and absence of infection. HCMV pUL29/28 with pUL38 altered the activity of the 53-regulatable p21CIP1 promoter. During infection, pUL29/28 and pUL38 contributed to the inhibition of p21CIP1 as well as caspase 1 expression. The expression of several other p53-regulating genes was not altered. Infection using a UL29-deficient virus resulted in increased p53 binding and histone H3 acetylation at the responsive promoters. Furthermore, expression of pUL29/28 and its interacting partner pUL38 contributed to an increase in the steady-state protein levels of p53. This study identified two additional HCMV proteins, pUL29/28 and pUL38, which participate in the complex regulation of p53 transcriptional activity during infection. PMID:23236067

  3. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.

    PubMed

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-04-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  4. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

    PubMed Central

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-01-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  5. Acute cytomegalovirus (CMV) infection

    MedlinePlus

    CMV mononucleosis; Cytomegalovirus (CMV) ... Infection with cytomegalovirus (CMV) is very common. The infection is spread by: Blood transfusions Organ transplants Respiratory droplets Saliva Sexual contact ...

  6. Stimulation of the Replication of ICP0-Null Mutant Herpes Simplex Virus 1 and pp71-Deficient Human Cytomegalovirus by Epstein-Barr Virus Tegument Protein BNRF1

    PubMed Central

    Lu, Yongxu; Orr, Anne

    2016-01-01

    ABSTRACT It is now well established that several cellular proteins that are components of promyelocytic leukemia nuclear bodies (PML NBs, also known as ND10) have restrictive effects on herpesvirus infections that are countered by viral proteins that are either present in the virion particle or are expressed during the earliest stages of infection. For example, herpes simplex virus 1 (HSV-1) immediate early (IE) protein ICP0 overcomes the restrictive effects of PML-NB components PML, Sp100, hDaxx, and ATRX while human cytomegalovirus (HCMV) IE protein IE1 targets PML and Sp100, and its tegument protein pp71 targets hDaxx and ATRX. The functions of these viral regulatory proteins are in part interchangeable; thus, both IE1 and pp71 stimulate the replication of ICP0-null mutant HSV-1, while ICP0 increases plaque formation by pp71-deficient HCMV. Here, we extend these studies by examining proteins that are expressed by Epstein-Barr virus (EBV). We report that EBV tegument protein BNRF1, discovered by other investigators to target the hDaxx/ATRX complex, increases the replication of both ICP0-null mutant HSV-1 and pp71-deficient HCMV. In addition, EBV protein EBNA-LP, which targets Sp100, also augments ICP0-null mutant HSV-1 replication. The combination of these two EBV regulatory proteins had a greater effect than each one individually. These findings reinforce the concept that disruption of the functions of PML-NB proteins is important for efficient herpesvirus infections. IMPORTANCE Whether a herpesvirus initiates a lytic infection in a host cell or establishes quiescence or latency is influenced by events that occur soon after the viral genome has entered the host cell nucleus. Certain cellular proteins respond in a restrictive manner to the invading pathogen's DNA, while viral functions are expressed that counteract the cell-mediated repression. One aspect of cellular restriction of herpesvirus infections is mediated by components of nuclear structures known as

  7. Quantitative analysis of human herpesvirus-6 and human cytomegalovirus in blood and saliva from patients with acute leukemia.

    PubMed

    Nefzi, Faten; Ben Salem, Nabil Abid; Khelif, Abderrahim; Feki, Salma; Aouni, Mahjoub; Gautheret-Dejean, Agnès

    2015-03-01

    Human herpesvirus-6 (HHV-6) and human cytomegalovirus (HCMV) DNAs were quantified by real-time PCR assays in blood and saliva obtained from 50 patients with acute leukemia at the time of diagnosis (50 of each matrix), aplasia (65 of each matrix), remission (55 of each matrix), and relapse (20 of each matrix) to evaluate which biological matrix was more suitable to identify a viral reactivation, search for a possible link between HHV-6 and HCMV reactivations, and evaluate the relations between viral loads and count of different leukocyte types in blood. The median HHV-6 loads were 136; 219; 226, and 75 copies/million cells in blood at diagnosis, aplasia, remission and relapse, respectively. The HCMV loads were 193 and 317 copies/million cells in blood at diagnosis and remission. In the saliva samples, the HHV-6 loads were 22,165; 15,238; 30,214, and 17,454 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HCMV loads were 8,991; 1,461; 2,980, and 4,283 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HHV-6 load in the blood was correlated to the counts of polymorphonuclear leukocytes (R(2)  = 0.5; P < 0.0001) and lymphocytes (R(2)  = 0.4; P = 0.001) and was not correlated to the monocyte counts (R(2)  = 0.07; P = 0.7). Saliva appears to be a more sensitive biological matrix than whole blood in the detection of HHV-6 or HCMV reactivations. The HHV-6 and HCMV reactivations were linked only in saliva.

  8. Use of an N-terminal half truncated IE1 as an antagonist of IE1, an essential regulatory protein in baculovirus.

    PubMed

    Yamada, Yoji; Matsuyama, Takahiro; Quan, Guo-Xing; Kanda, Toshio; Tamura, Toshiki; Sahara, Ken; Asano, Shin-ichiro; Bando, Hisanori

    2002-12-01

    An immediate-early gene product of baculovirus, IE1, is essential for viral gene expression and for viral DNA replication. It has been demonstrated for Autographa californica nuclear polyhedrosis virus (AcNPV) that the C-terminal region of IE1 is required for dimerization. And the acidic N-terminal region of IE1 has been identified as the activation domain. We constructed an N-terminal 267 amino acid (a.a.) truncated mutant of Bombyx mori nuclear polyhedrosis virus (BmNPV) IE1, which was defective as a transactivator of a viral early gene (p35) promoter. We then examined possible IE1 antagonistic functions of this defective IE1, IE1TN, in BmNPV-infected cells. A transient expression experiment demonstrated that IE1TN strongly repressed the activation of the hr5-dependent p35 promoter derived from BmNPV infection. In addition, DpnI assay elucidated an inhibitory effect of IE1TN on the hr5-dependent replication of plasmid in BmN cells induced by NPV infection. A marked reduction in the production of virus was observed when the BmN cells were infected with BmNPV after transfection with IE1TN-expression plasmids. These results suggested that IE1TN could act as an IE1 antagonist in silkworm cells infected with BmNPV. We then analyzed the ability of IE1TN to inhibit the multiplication of BmNPV using transgenic silkworms. The BmNPV-resistance of the transgenic silkworms was very weak, suggesting insufficient expression of the transgene product, IE1TN. PMID:12457979

  9. Pathogenesis of experimental rhesus cytomegalovirus infection.

    PubMed

    Lockridge, K M; Sequar, G; Zhou, S S; Yue, Y; Mandell, C P; Barry, P A

    1999-11-01

    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v. ), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  10. Genetic Stability of Bacterial Artificial Chromosome-Derived Human Cytomegalovirus during Culture In Vitro

    PubMed Central

    Murrell, Isa; Wilkie, Gavin S.; Davison, Andrew J.; Statkute, Evelina; Fielding, Ceri A.; Tomasec, Peter; Wilkinson, Gavin W. G.

    2016-01-01

    ABSTRACT Clinical human cytomegalovirus (HCMV) strains invariably mutate when propagated in vitro. Mutations in gene RL13 are selected in all cell types, whereas in fibroblasts mutants in the UL128 locus (UL128L; genes UL128, UL130, and UL131A) are also selected. In addition, sporadic mutations are selected elsewhere in the genome in all cell types. We sought to investigate conditions under which HCMV can be propagated without incurring genetic defects. Bacterial artificial chromosomes (BACs) provide a stable, genetically defined source of viral genome. Viruses were generated from BACs containing the genomes of strains TR, TB40, FIX, and Merlin, as well as from Merlin-BAC recombinants containing variant nucleotides in UL128L from TB40-BAC4 or FIX-BAC. Propagation of viruses derived from TR-BAC, TB40-BAC4, and FIX-BAC in either fibroblast or epithelial cells was associated with the generation of defects around the prokaryotic vector, which is retained in the unique short (US) region of viruses. This was not observed for Merlin-BAC, from which the vector is excised in derived viruses; however, propagation in epithelial cells was consistently associated with mutations in the unique long b′ (UL/b′) region, all impacting on gene UL141. Viruses derived from Merlin-BAC in fibroblasts had mutations in UL128L, but mutations occurred less frequently with recombinants containing UL128L nucleotides from TB40-BAC4 or FIX-BAC. Viruses derived from a Merlin-BAC derivative in which RL13 and UL128L were either mutated or repressed were remarkably stable in fibroblasts. Thus, HCMV containing a wild-type gene complement can be generated in vitro by deriving virus from a self-excising BAC in fibroblasts and repressing RL13 and UL128L. IMPORTANCE Researchers should aim to study viruses that accurately represent the causative agents of disease. This is problematic for HCMV because clinical strains mutate rapidly when propagated in vitro, becoming less cell associated, altered in

  11. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie

    2014-01-01

    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  12. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  13. Thrombin stimulates IL-6 and IL-8 expression in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Kotchetkov, Ruslan; Cinatl, Jaroslav; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-02-01

    Recently, we reported that thrombin specifically stimulates protease-activated receptor-1 (PAR-1) signaling in RPE entailing inhibition of Sp1 dependent HCMV replication. We now studied whether thrombin modulates the expression of the proinflammatory cytokine/chemokines IL-6 and IL-8 in mock- and cytomegalovirus-infected human retinal pigment epithelial cells (RPE). Our data show that thrombin/PAR-1 stimulates IL-6 and IL-8 gene transcription and protein secretion in both mock- and HCMV-infected RPE. Thrombin/PAR-1-mediated signaling stimulated PKC and NF-kappaB-dependent IL-6 and IL-8 gene expression via phosphoinositide 3-kinase and further downstream via p42/44 and p38 MAPKs. Thus, thrombin/PAR-1-mediated IL-6/IL-8 gene expression is uncoupled from Sp1 inhibition and may support proinflammatory pathomechanisms probably involved in hemorrhage/HCMV retinitis progression.

  14. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  15. Rises in antibody to human herpesvirus 6 detected by enzyme immunoassay in transplant recipients with primary cytomegalovirus infection.

    PubMed

    Chou, S W; Scott, K M

    1990-05-01

    Immunoglobulin G to human herpesvirus 6 (HHV-6) and cytomegalovirus (CMV) in sera from solid organ recipients was measured by an enzyme-linked immunoassay (ELISA) before and after transplant. The HHV-6 ELISA was developed from glycine extracts of HHV-6-infected and uninfected HSB-2 cells. At a serum dilution of 1:500, 80 (91%) of 88 recipients were seropositive for HHV-6 before transplant, while only 14 (16%) were seropositive for CMV. Posttransplant HHV-6 serologic rises were observed in 38 (43%) recipients; rises in 25 of these recipients were associated with primary CMV infection. Titration of sera revealed much higher HHV-6 titer rises among those with primary CMV infection than among those with CMV reactivation or with no CMV infection. Elevated HHV-6 antibody titers persisted for up to 2 years after primary CMV infection. No correlation was noted between CMV and HHV-6 antibody titers in individual serum samples.

  16. Detection of human cytomegalovirus by slot-blot hybridization assay employing oligo-primed /sup 32/P-labelled probe

    SciTech Connect

    Agha, S.A.; Coleman, J.C.; Selwyn, S.; Mahmound, L.A.; Abd-Elaal, A.M.; Archard, L.C.

    1988-12-01

    A /sup 32/P-labelled Hind III-0 DNA fragment (nine Kilobases; Kb) from human cytomegalovirus AD-169 (HCMV) was used in slot-blot hybridization assay for the detection of HCMV in clinical samples. The results obtained with DNA hybridization assay (DNA HA) were compared with virus isolation using conventional tube cell culture (CTC) and centrifugation vial culture (CVC), immunofluorescence (IF), and complement fixation test (CFT). Of 15 CTC-positive samples, 13 were positive with DNA HA (sensitivity 86.7%). Also, 14 additional samples were DNA HA-positive but CTC-negative. CVC and/or IF confirmed the diagnosis in nine of 14; the remaining five samples were from three patients who showed fourfold rising antibody titre by CFT. Although DNA HA using /sup 32/P-labelled probes is relatively cumbersome and expensive, it is a valuable test for quantitation of viral shedding in patients with HCMV infections who may benefit from antiviral therapy.

  17. Human cytomegalovirus (CMV) susceptibility to currently approved antiviral drugs does not impact on CMV terminase complex polymorphism.

    PubMed

    Pilorgé, Léa; Burrel, Sonia; Aït-Arkoub, Zaïna; Agut, Henri; Boutolleau, David

    2014-11-01

    Currently approved anti-human cytomegalovirus (CMV) drugs, all targeting the viral DNA polymerase, are associated with significant toxicities and emergence of drug resistance. In this context, CMV terminase complex constitutes a promising target for novel antiviral compounds. In this study, we describe the low natural polymorphism (interstrain identity >97.7% at both nucleotide and amino acid levels) of the terminase subunits pUL56 and pUL89, and the portal protein pUL104, among 63 CMV clinical strains, and we show that the CMV resistance profile to current DNA polymerase inhibitors has no impact on the natural polymorphism of CMV terminase complex. These results support the idea that both CMV clinical strains exhibiting either susceptibility or resistance to current CMV DNA polymerase inhibitors are comparably sensitive to novel inhibitors of CMV terminase complex, such as letermovir.

  18. In vitro antiviral efficacy of the ganciclovir complexed with beta-cyclodextrin on human cytomegalovirus clinical strains.

    PubMed

    Nicolazzi, Céline; Venard, Véronique; Le Faou, Alain; Finance, Chantal

    2002-05-01

    The toxicity of the compounds currently used in the treatment of human cytomegalovirus (HCMV) infections in immunocompromised hosts may force the treatment to be discontinued. The aim of this study was to improve the antiviral activity of ganciclovir (GCV), one the most widely used drug, by complexing it with beta-cyclodextrin. Cyclodextrins (cds) have the property to form inclusion complexes with a great number of molecules and to enhance bioavailability and biological properties of these molecules. In this study, we investigated the in vitro antiviral activity of complexed GCV against several strains of HCMV: AD169, a reference strain, RCL-1, a laboratory mutant resistant to GCV, and four clinical isolates. The complexed GCV was more effective than free GCV against all HCMV strains tested. Cds as carriers for antiviral drugs would represent a useful adjunct to classical treatment procedures. They may make it possible to administer lower doses, thus reducing the toxic side effects of the drugs. PMID:12062397

  19. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens.

  20. Structure of Human Cytomegalovirus UL141 Binding to TRAIL-R2 Reveals Novel, Non-canonical Death Receptor Interactions

    PubMed Central

    Nemčovičová, Ivana; Benedict, Chris A.; Zajonc, Dirk M.

    2013-01-01

    The TRAIL (TNF-related apoptosis inducing ligand) death receptors (DRs) of the tumor necrosis factor receptor superfamily (TNFRSF) can promote apoptosis and regulate antiviral immunity by maintaining immune homeostasis during infection. In turn, human cytomegalovirus (HCMV) expresses immunomodulatory proteins that down-regulate cell surface expression of TNFRSF members as well as poliovirus receptor-related proteins in an effort to inhibit host immune effector pathways that would lead to viral clearance. The UL141 glycoprotein of human cytomegalovirus inhibits host defenses by blocking cell surface expression of TRAIL DRs (by retention in ER) and poliovirus receptor CD155, a nectin-like Ig-fold molecule. Here we show that the immunomodulatory function of HCMV UL141 is associated with its ability to bind diverse proteins, while utilizing at least two distinct binding sites to selectively engage TRAIL DRs or CD155. Binding studies revealed high affinity interaction of UL141 with both TRAIL-R2 and CD155 and low affinity binding to TRAIL-R1. We determined the crystal structure of UL141 bound to TRAIL-R2 at 2.1 Å resolution, which revealed that UL141 forms a homodimer that engages two TRAIL-R2 monomers 90° apart to form a heterotetrameric complex. Our structural and biochemical data reveal that UL141 utilizes its Ig-domain to facilitate non-canonical death receptor interactions while UL141 partially mimics the binding site of TRAIL on TRAIL-R2, which we found to be distinct from that of CD155. Moreover, UL141 also binds to an additional surface patch on TRAIL-R2 that is distinct from the TRAIL binding site. Therefore, the breadth of UL141-mediated effects indicates that HCMV has evolved sophisticated strategies to evade the immune system by modulating multiple effector pathways. PMID:23555243

  1. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  2. Identification and procaryotic expression of the gene coding for the highly immunogenic 28-kilodalton structural phosphoprotein (pp28) of human cytomegalovirus.

    PubMed Central

    Meyer, H; Bankier, A T; Landini, M P; Brown, C M; Barrell, B G; Rüger, B; Mach, M

    1988-01-01

    Human cytomegalovirus contains a structural polypeptide that is 28 kilodaltons in apparent molecular size and is reactive in Western blot (immunoblot) analysis with the majority of human sera. The gene coding for this polypeptide was mapped on the genome of human cytomegalovirus strain AD169. A monoclonal antibody specific for the 28-kilodalton polypeptide was used to screen a cDNA library constructed from poly(A)+ RNA of human cytomegalovirus-infected cells in the procaryotic expression vector lambda gt11. Hybridization of cDNA with cosmid and plasmid clones mapped the gene to the HindIII R fragment. The gene was transcribed into a late 1.3-kilobase RNA. The nucleotide sequence of the coding region was determined. Parts of the 28-kilodalton polypeptide were expressed in Escherichia coli as hybrid proteins fused to beta-galactosidase. In Western blots these proteins were recognized by human sera. Antibodies raised against the hybrid proteins reacted specifically with the viral antigen in immunoprecipitations and Western blots. In vitro phosphorylation of HCMV virions and immunoprecipitation showed that the 28-kilodalton polypeptide was phosphorylated. Images PMID:2836608

  3. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture.

    PubMed

    Gardner, Thomas J; Hernandez, Rosmel E; Noriega, Vanessa M; Tortorella, Domenico

    2016-01-01

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV. PMID:27026399

  4. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture.

    PubMed

    Gardner, Thomas J; Hernandez, Rosmel E; Noriega, Vanessa M; Tortorella, Domenico

    2016-03-30

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV.

  5. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture

    PubMed Central

    Gardner, Thomas J.; Hernandez, Rosmel E.; Noriega, Vanessa M.; Tortorella, Domenico

    2016-01-01

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV. PMID:27026399

  6. Human Cytomegalovirus-Encoded Human Interleukin-10 (IL-10) Homolog Amplifies Its Immunomodulatory Potential by Upregulating Human IL-10 in Monocytes

    PubMed Central

    Avdic, Selmir; McSharry, Brian P.; Steain, Megan; Poole, Emma; Sinclair, John; Abendroth, Allison

    2016-01-01

    ABSTRACT The human cytomegalovirus (HCMV) gene UL111A encodes cytomegalovirus-encoded human interleukin-10 (cmvIL-10), a homolog of the potent immunomodulatory cytokine human interleukin 10 (hIL-10). This viral homolog exhibits a range of immunomodulatory functions, including suppression of proinflammatory cytokine production and dendritic cell (DC) maturation, as well as inhibition of major histocompatibility complex (MHC) class I and class II. Here, we present data showing that cmvIL-10 upregulates hIL-10, and we identify CD14+ monocytes and monocyte-derived macrophages and DCs as major sources of hIL-10 secretion in response to cmvIL-10. Monocyte activation was not a prerequisite for cmvIL-10-mediated upregulation of hIL-10, which was dose dependent and controlled at the transcriptional level. Furthermore, cmvIL-10 upregulated expression of tumor progression locus 2 (TPL2), which is a regulator of the positive hIL-10 feedback loop, whereas expression of a negative regulator of the hIL-10 feedback loop, dual-specificity phosphatase 1 (DUSP1), remained unchanged. Engagement of the hIL-10 receptor (hIL-10R) by cmvIL-10 led to upregulation of heme oxygenase 1 (HO-1), an enzyme linked with suppression of inflammatory responses, and this upregulation was required for cmvIL-10-mediated upregulation of hIL-10. We also demonstrate an important role for both phosphatidylinositol 3-kinase (PI3K) and STAT3 in the upregulation of HO-1 and hIL-10 by cmvIL-10. In addition to upregulating hIL-10, cmvIL-10 could exert a direct immunomodulatory function, as demonstrated by its capacity to upregulate expression of cell surface CD163 when hIL-10 was neutralized. This study identifies a mechanistic basis for cmvIL-10 function, including the capacity of this viral cytokine to potentially amplify its immunosuppressive impact by upregulating hIL-10 expression. IMPORTANCE Human cytomegalovirus (HCMV) is a large, double-stranded DNA virus that causes significant human disease

  7. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  8. The UL97 protein kinase of human cytomegalovirus and homologues in other herpesviruses: impact on virus and host.

    PubMed

    Michel, Detlef; Mertens, Thomas

    2004-03-11

    The human herpesviruses, herpes simplex virus 1 (HSV-1), HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpesvirus 6A (HHV-6A), HHV-6B, HHV-7 and HHV-8, establish persistent infections with possible recurrence during immunosuppression. HCMV replication is inhibited by the nucleoside analogue ganciclovir (GCV), the compound of choice for the treatment of HCMV diseases and preemptive treatment of infections. The viral UL97 protein (pUL97) which shares homologies with protein kinases and bacterial phosphotransferases is able to monophosphorylate GCV. Homologues of pUL97 are found in HSV (UL13), VZV (ORF47), EBV (BGLF4), HHV-6 (U69), HHV-8 (ORF36) as well as in murine CMV (M97) or rat CMV (R97). Several indolocarbazoles have been reported to be specific inhibitors of pUL97. The protein is important for efficient replication of the virus. Autophosphorylation of pUL97 was observed using different experimental systems. Most recently, it has been shown that pUL97 interacts with the DNA polymerase processivity factor pUL44. Indolocarbazole protein kinase inhibitors are promising lead compounds for the development of more specific inhibitors of HCMV. PMID:15023359

  9. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects.

    PubMed

    Sylwester, Andrew W; Mitchell, Bridget L; Edgar, John B; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R; Grabstein, Kenneth H; Hosken, Nancy A; Kern, Florian; Nelson, Jay A; Picker, Louis J

    2005-09-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4(+) and/or CD8(+) T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average approximately 10% of both the CD4(+) and CD8(+) memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8(+) T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  10. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects

    PubMed Central

    Sylwester, Andrew W.; Mitchell, Bridget L.; Edgar, John B.; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R.; Grabstein, Kenneth H.; Hosken, Nancy A.; Kern, Florian; Nelson, Jay A.; Picker, Louis J.

    2005-01-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4+ and/or CD8+ T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average ∼10% of both the CD4+ and CD8+ memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8+ T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  11. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  12. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model

    PubMed Central

    Slavuljica, Irena; Kveštak, Daria; Csaba Huszthy, Peter; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-01-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8+ T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed. PMID:25042632

  13. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model.

    PubMed

    Slavuljica, Irena; Kveštak, Daria; Huszthy, Peter Csaba; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-03-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8(+) T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed.

  14. Cytomegalovirus keratitis after penetrating keratoplasty.

    PubMed

    Wehrly, S R; Manning, F J; Proia, A D; Burchette, J L; Foulks, G N

    1995-11-01

    We report the development of cytomegalovirus (CMV) keratitis in the penetrating keratoplasty of a 59-year-old human immunodeficiency virus-negative woman after uncomplicated corneal transplantation. Immunosuppression with topical cyclosporine A 2% in corn oil and topical prednisolone acetate 1% suspension was used postoperatively. The 15-month postoperative course was complicated by multiple episodes of endothelial rejection, medically controlled elevated intraocular pressure, polymicrobial bacterial (coagulase-negative staphlococcus and alpha-hemolytic streptococcus) keratitis, and endothelial plaque formation with associated hypopyon and epithelial defect. The graft failed and penetrating keratoplasty was repeated. Cytomegalovirus infection of superficial keratocytes in a region of scarring was identified in histological sections stained with hematoxylin and eosin and confirmed using mouse monoclonal anti-cytomegalovirus antibodies. Excision of the diseased corneal button with no additional treatment appears to have been curative. Low-grade keratitis was the only manifestation of the CMV infection, and it has not recurred 6 months postoperatively.

  15. Enzyme linked immunosorbent assay (ELISA) for determination of IgG antibodies to human cytomegalovirus.

    PubMed

    Sarov, I; Andersen, P; Andersen, H K

    1980-02-01

    A solid-phase enzyme linked immunosorbent assay (ELISA) for determination of IgG antibodies to cytomegalovirus (CMV) is described. The assay used purified CMV and extracts of CMV infected cells as antigen. Antigens were desiccated onto the bottom surface of polystyrene microcuvettes. The antibodies bound to the antigens were assayed by anti-IgG-alkaline phosphate conjugate followed by addition of the enzyme substrate. Titration curves have been obtained from the sera of 35 blood donors and of 23 patients. Comparison of results obtained by ELISA with those obtained by complement fixation (CF) shows that there is agreement between the tests. Both purified CMV and extracts of CMV infected cells were found to be suitable antigens. Purified CMV was of value particularly in those sera which show high reactivity against control antigen. The ELISA technique described is approximately 412 to 548 times more sensitive than the CF test when purified CMV or extracts of CMV infected cells, respectively, are used as antigens. No significant heterotypic rise to CMV was observed by ELISA in three sets of sera with seroconversion to herpes simplex virus. The ELISA technique gives objective results, is easily performed, and may be adaptable as a routine test both for serological diagnosis of CMV infection and for screening of the general population.

  16. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  17. Effect of baicalein on the expression of VIP in extravillous cytotrophoblasts infected with human cytomegalovirus in vitro.

    PubMed

    Qiao, Yuan; Fang, Jian-guo; Xiao, Juan; Liu, Tao; Liu, Jing; Zhang, Yan-li; Chen, Su-hua

    2013-06-01

    This paper aimed to study the ability of baicalein to block human cytomegalovirus (HCMV) infection in extravillous cytotrophoblasts (EVT) and its effect on the vasoactive intestinal peptide (VIP) expression in HCMV-infected EVT in vitro. A human trophoblast cell line (HPT-8) was chosen in this study. HCMV with 100 TCID50 was added into culture medium to infect HPT-8 cells, and then HCMV pp65 antigen was assayed by immunofluorescence staining. The infection status was determined by virus titration. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to detect virus DNA load in the infected cells. The expression of VIP mRNA and protein in the infected cells was measured by qRT-PCR, immunocytochemistry and Western blotting. Concentration of VIP secreted in supernatants was determined by ELISA. Red-stained HCMV pp65 antigens were found in infected HPT-8 cells 48 h after infection. HCMV replicated in large quantity in infected HPT-8 cells 4 days after infection, reaching a peak at day 6 post-infection. After treatment with baicalein, virus DNA load in infected HPT-8 cells was decreased (P<0.05), and the levels of VIP mRNA and protein, and the concentration were raised to the normal (P>0.05). Our study suggested that baicalein exerts a positive effect on the VIP expression in HCMV-infected EVT at maternal-fetal interface.

  18. Solid phase ELISA for determination of the virus dose dependent sensitivity of human cytomegalovirus to antiviral drugs in vitro.

    PubMed

    Ståhle, E L; Schloss, L; Sundqvist, V A; Brytting, M; Hökeberg, I; Cox, S; Wahren, B; Linde, A

    1998-12-01

    The main problems in determining the true in vivo susceptibility of human cytomegalovirus (CMV) to antiviral compounds are the influence of the size of the viral inoculum, the variation in the replication capacity of different CMV strains and the subjective evaluation of the inhibition of viral growth in the plaque assay. In this study, a specific assay was developed which reproducibly determines the sensitivity of primary isolates of CMV. The assay includes simultaneous virus titration and determination of the antiviral sensitivity. When individual virus doses were evaluated, the IC50 was generally dependent on the virus dose, except for resistant isolates, where the IC50 did not change irrespective of the dose of virus. The novel method of IC50 calculation takes into account all values derived from the linear part of the inhibition curve. This may better reflect the in vivo conditions, where the antiviral drug encounters different amounts of virus in different organs. Two human fibroblast-derived cell lines showed similar results.

  19. Human cytomegalovirus increases modified low density lipoprotein uptake and scavenger receptor mRNA expression in vascular smooth muscle cells.

    PubMed Central

    Zhou, Y F; Guetta, E; Yu, Z X; Finkel, T; Epstein, S E

    1996-01-01

    Evidence suggests a possible role for human cytomegalovirus (HCMV) in the development of arteriosclerosis. One of the earliest events in plaque formation is the accumulation of lipid-laden foam cells, derived from macrophages and smooth muscle cells (SMCs). The lipid accumulation that occurs depends upon the uptake of oxidized LDL (Ox-LDL), a process in which the scavenger receptor (SR) has been postulated to play an important role. We therefore examined the effects of HCMV on this process. We demonstrate that HCMV infection of human SMCs increases modified LDL uptake and stimulates class A SR gene (SR-A) mRNA expression. In addition, infection of rat SMCs with HCMV, which causes immediate early gene expression (IE72/IE84), but no early or late HCMV gene products and no cytopathic effects, also increases SMC uptake of Ox-LDL and acetylated LDL, with either effect blocked by an excess of either cold Ox-LDL or acetylated-LDL, and by fucoidin, an SR competitor. Cotransfection of an IE72, but not an IE84, expression plasmid and a plasmid containing a Class A SR promoter/reporter gene construct enhances SR promoter activity. Since increased Ox-LDL uptake is believed to play an important role in arteriosclerosis, these results provide a link between HCMV infection and arteriosclerotic plaque formation. PMID:8903333

  20. Molecular Imprint of Exposure to Naturally Occurring Genetic Variants of Human Cytomegalovirus on the T cell Repertoire

    NASA Astrophysics Data System (ADS)

    Smith, Corey; Gras, Stephanie; Brennan, Rebekah M.; Bird, Nicola L.; Valkenburg, Sophie A.; Twist, Kelly-Anne; Burrows, Jacqueline M.; Miles, John J.; Chambers, Daniel; Bell, Scott; Campbell, Scott; Kedzierska, Katherine; Burrows, Scott R.; Rossjohn, Jamie; Khanna, Rajiv

    2014-02-01

    Exposure to naturally occurring variants of herpesviruses in clinical settings can have a dramatic impact on anti-viral immunity. Here we have evaluated the molecular imprint of variant peptide-MHC complexes on the T-cell repertoire during human cytomegalovirus (CMV) infection and demonstrate that primary co-infection with genetic variants of CMV was coincident with development of strain-specific T-cell immunity followed by emergence of cross-reactive virus-specific T-cells. Cross-reactive CMV-specific T cells exhibited a highly conserved public T cell repertoire, while T cells directed towards specific genetic variants displayed oligoclonal repertoires, unique to each individual. T cell recognition foot-print and pMHC-I structural analyses revealed that the cross-reactive T cells accommodate alterations in the pMHC complex with a broader foot-print focussing on the core of the peptide epitope. These findings provide novel molecular insight into how infection with naturally occurring genetic variants of persistent human herpesviruses imprints on the evolution of the anti-viral T-cell repertoire.

  1. IL-6 in human cytomegalovirus secretome promotes angiogenesis and survival of endothelial cells through the stimulation of survivin

    PubMed Central

    Botto, Sara; Streblow, Daniel N.; DeFilippis, Victor; White, Laura; Kreklywich, Craig N.; Smith, Patricia P.

    2011-01-01

    Human cytomegalovirus (HCMV) is linked to the acceleration of vascular diseases such as atherosclerosis and transplant vasculopathy. One of the hallmarks of these diseases is angiogenesis (AG) and neovessel formation. Endothelial cells (ECs) are an integral part of AG and are sites of HCMV persistence. AG requires multiple synchronous processes that include EC proliferation, migration, and vessel stabilization. Virus-free supernatant (secretome) from HCMV-infected ECs induces AG. To identify factor(s) involved in this process, we performed a human cytokine array. Several cytokines were significantly induced in the HCMV secretomes including interleukin-6 (IL-6), granulocyte macrophage colony-stimulating factor, and IL-8/CXCL8. Using in vitro AG assays, neutralization of IL-6 significantly reduced neovessel formation. Addition of the HCMV secretome to preformed vessels extended neovessel survival, but this effect was blocked by neutralization of IL-6. In these cells, IL-6 prevented apoptosis by blocking caspase-3 and -7 activation through the induction of survivin. Neutralization of IL-6 receptor on ECs abolished the ability of HCMV secretome to increase survivin expression and activated effector caspases. Moreover, survivin shRNA expression induced rapid regression of tubule capillary networks in ECs stimulated with HCMV secretome and activated effector caspases. These observations may explain how CMV accelerates vascular disease despite limited infection in tissues. PMID:20930069

  2. Human T-lymphotropic virus tax activates human cytomegalovirus major-immediate early promoter and improves production of recombinant proteins in HEK293 cells.

    PubMed

    Lwa, Teng Rhui; Lee, Jialing; Ng, Chew Har; Lew, Qiao Jing; Hia, Hui Ching; Chao, Sheng-Hao

    2011-01-01

    The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter. PMID:21425252

  3. Human Cytomegalovirus Infection is Associated with Essential Hypertension in Kazakh and Han Chinese Populations

    PubMed Central

    Tang, Na; Li, Jia-wei; Liu, Yong-min; Zhong, Hua; Wang, La-mei; Deng, Feng-mei; Qu, Yuan-yuan; Hui, Jing; Cheng, Jiang; Tang, Bin; Huang, Gang; Guo, Shu-xia; Li, Xin-zhi; Wei, Li-li; He, Fang

    2014-01-01

    Background We aimed to study the association between cytomegalovirus (CMV) infection and hypertension in Kazakh and Han populations from Xinjiang Province, China. Material/Methods We analyzed data on 800 Kazakhs (467 hypertension patients and 333 healthy control participants) and 800 Hans (482 hypertension patients and 318 healthy control participants) aged 18–84 years old. ELISA and real-time quantitative PCR coupled with restriction fragment length polymorphism analysis were applied for determining CMV infection and glycoprotein B (gB) genotypes, respectively. Results Serologic evidence of CMV infection was obtained for 95.4% and 90.1% of the Kazakhs and Hans, respectively. The CMV seroprevalence rates among the Kazakh and Han participants with hypertension were 96.8% and 89.8%, respectively. Multiple logistic regression analyses revealed statistically significant independent associations between CMV seropositivity and hypertension in Kazakh males and between CMV antibody titers and hypertension in Hans; significant relationships also existed between CMV antibody titers and blood pressure in Hans. In Kazakhs, 3 CMV gB genotypes were identified: gB2 and genotype mixtures gB1+gB2 and gB2+gB3. In Hans, 4 CMV gB genotypes were identified: gB1, gB2, gB1+gB2, and gB2+gB3. Of the 4 studied genotypes, gB2+gB3 showed a significant independent association with hypertension in Kazakh females. Conclusions CMV infection is associated with essential hypertension in Kazakh males and Hans in Xinjiang. CMV seropositivity is associated with hypertension in Kazakh males, and CMV antibody titers are associated with blood pressure and hypertension in Han males and females. Moreover, the CMV gB2+gB3 genotype mixture is associated independently with essential hypertension in Kazakh females. PMID:25448630

  4. Detection of cytomegalovirus and human herpesvirus-6 DNA in liver biopsy specimens and their correlation with rejection after liver transplantation.

    PubMed

    Guardia-Silva, A C; Stucchi, R S B; Sampaio, A M; Milan, A; Costa, S C B; Boin, I F S F

    2012-10-01

    Cytomegalovirus (CMV) and human herpesvirus-6 (HHV-6) reactivation after transplantation put patients at an increased risk of graft rejection mainly among those who receive organs that are positive in their donor biopsies. The aim of this study was to investigate the presence of CMV and HHV-6 DNA in liver biopsy specimens from the donors and from their grafts for correlation with rejection after transplantation. We followed 41 liver transplantation patients whose samples were evaluated using nested-polymerase chain reactions (N-PCR). Twenty-one (51%) of the 41 studied patients experienced rejection; 4/21 (19%) were CMV positive in the donor biopsy specimens and remained positive; another 5 subjects became positive. The patients who received organs from donors with biopsies positive for CMV demonstrated a trend to develop graft rejection after transplantation (Fisher's exact test [P = .0591] with significant results on univariate and multivariate analysis [P = .042]). Eight of the 21 who experienced rejection episodes were HHV-6 positive in the donor biopsy but there was no statistical significance CMV DNA diagnosed in liver donor biopsies remained positive posttransplantation in liver biopsy recipients; it was considered a tendency to develop acute cellular rejection after transplantation.

  5. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.

    PubMed

    Lee, Junsub; Kim, Sunyoung

    2016-05-01

    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  6. Activation of Langerhans-Type Dendritic Cells Alters Human Cytomegalovirus Infection and Reactivation in a Stimulus-Dependent Manner

    PubMed Central

    Coronel, Roxanne; Jesus, Desyree M.; Dalle Ore, Lucia; Mymryk, Joe S.; Hertel, Laura

    2016-01-01

    Oral mucosal Langerhans cells (LC) are likely to play important roles in host defense against infection by human cytomegalovirus (CMV). We previously showed that in vitro-differentiated immature LC (iLC) populations contain smaller amounts of infected cells but produce higher yields than mature LC (mLC) cultures, obtained by iLC stimulation with fetal bovine serum (FBS), CD40 ligand (CD40L) and lipopolysaccharide (LPS). Here, we sought to determine if exposure to select stimuli can improve LC permissiveness to infection, if specific components of the mLC cocktail are responsible for lowering viral yields, if this is due to defects in progeny production or release, and if these restrictions are also effective against reactivated virus. None of the stimuli tested extended the proportion of infected cells to 100%, suggesting that the block to infection onset cannot be fully removed. While CD40L and FBS exerted positive effects on viral progeny production per cell, stimulation with LPS alone or in combination with CD40L was detrimental. Reductions in viral titers were not due to defects in progeny release, and the permissive or restrictive intracellular environment established upon exposure to each stimulus appeared to act in a somewhat similar way toward lytic and latent infections. PMID:27683575

  7. The increased sensitivity of human cytomegalovirus (HCMV) PCR quantitation in whole blood affects reproductive rate (Ro) measurement.

    PubMed

    Gurtler, Volker; Mayall, Barrie C; Wang, Jenny; Ghaly-Derias, Shahbano

    2014-02-01

    In order to determine the effect of the increase in sensitivity of HCMV detection in whole blood compared to plasma on reproductive rate (Ro) measurement, an optimized human cytomegalovirus (HCMV) quantitative PCR assay was developed. The results presented in this study are summarized by the following three methodological improvements: (i) at values below the limit of quantitation (LOQ) of 60copies/ml, determination of HCMV load was more sensitive with whole blood than plasma, (ii) for the determination of viral load, whole blood was more sensitive than plasma below 1000copies/ml but little difference was observed above 1000copies/ml and (iii) the measurement of "Reproductive Rate" can be affected by imprecise measurement of HCMV viral load in either plasma or whole blood compartments depending on whether samples were taken from patients on antiviral treatment or from patients where HCMV load was rising. Taken together this study provides methodological improvements suggesting that below HCMV viral load levels of 1000copies/ml (1640IU/ml) both plasma and whole blood should be tested.

  8. Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line.

    PubMed

    Ioudinkova, Elena; Arcangeletti, Maria Cristina; Rynditch, Alla; De Conto, Flora; Motta, Federica; Covan, Silvia; Pinardi, Federica; Razin, Sergey V; Chezzi, Carlo

    2006-12-15

    Non-differentiated THP-1 cells can be infected by human cytomegalovirus (HCMV) Towne strain, which persists in these cells in a non-active (latent) form without undergoing a productive cycle. The same cells become permissive for HCMV lytic infection after induction of cell differentiation by treatment with 12-O-tetradecanoylphorbol-13-acetate. We used this cellular model to study the possible role of histone modifications in the control of HCMV latency. Using chromatin immunoprecipitation with antibodies against histone H3 acetylated or dimethylated in position K9, we demonstrated that in lytically infected cells the HCMV enhancer was associated with heavy acetylated but not dimethylated H3. In the case of latent infection, the HCMV enhancer was associated with neither acetylated nor dimethylated H3. HCMV genes encoding DNA polymerase (early), pp65 (early-late) and pp150 (late) proteins were associated preferentially with acetylated H3 in lytically infected cells and with dimethylated H3 in latently infected cells. These data strongly suggest that K9 methylation of H3 is involved in HCMV gene repression, while association of the above genes with acetylated histones is likely to be necessary for active transcription. It can be postulated that the same histone modifications are used to mark active and repressed genes in both cellular and viral chromatin. PMID:16989963

  9. Activation of Langerhans-Type Dendritic Cells Alters Human Cytomegalovirus Infection and Reactivation in a Stimulus-Dependent Manner.

    PubMed

    Coronel, Roxanne; Jesus, Desyree M; Dalle Ore, Lucia; Mymryk, Joe S; Hertel, Laura

    2016-01-01

    Oral mucosal Langerhans cells (LC) are likely to play important roles in host defense against infection by human cytomegalovirus (CMV). We previously showed that in vitro-differentiated immature LC (iLC) populations contain smaller amounts of infected cells but produce higher yields than mature LC (mLC) cultures, obtained by iLC stimulation with fetal bovine serum (FBS), CD40 ligand (CD40L) and lipopolysaccharide (LPS). Here, we sought to determine if exposure to select stimuli can improve LC permissiveness to infection, if specific components of the mLC cocktail are responsible for lowering viral yields, if this is due to defects in progeny production or release, and if these restrictions are also effective against reactivated virus. None of the stimuli tested extended the proportion of infected cells to 100%, suggesting that the block to infection onset cannot be fully removed. While CD40L and FBS exerted positive effects on viral progeny production per cell, stimulation with LPS alone or in combination with CD40L was detrimental. Reductions in viral titers were not due to defects in progeny release, and the permissive or restrictive intracellular environment established upon exposure to each stimulus appeared to act in a somewhat similar way toward lytic and latent infections. PMID:27683575

  10. Ribonucleotide reductase inhibitors hydroxyurea, didox, and trimidox inhibit human cytomegalovirus replication in vitro and synergize with ganciclovir

    PubMed Central

    Bhave, Sukhada; Elford, Howard; McVoy, Michael A.

    2013-01-01

    Ganciclovir (GCV) is a deoxyguanosine analog that is effective in inhibiting human cytomegalovirus (HCMV) replication. In infected cells GCV is converted to GCV-triphosphate which competes with dGTP for incorporation into the growing DNA strand by the viral DNA polymerase. Incorporated GCV promotes chain termination as it is an inefficient substrate for elongation. Because viral DNA synthesis also relies on cellular ribonucleotide reductase (RR) to synthesize deoxynucleotides, RR inhibitors are predicted to inhibit HCMV replication. Moreover, as dGTP competes with GCV-triphosphate for incorporation, RR inhibitors may also synergize with GCV by reducing intracellular dGTP levels and there by promoting increased GCV-triphosphate utilization by DNA polymerase. To investigate potential of RR inhibitors as anti-HCMV agents both alone and in combination with GCV, HCMV-inhibitory activities of three RR inhibitors, hydroxyurea, didox, and trimidox, were determined. In both spread inhibition and yield reduction assays RR inhibitors had modest anti-HCMV activity with 50% inhibitory concentrations ranging from 36 ± 1.7 to 221 ± 52 µM. However, all three showed significant synergy with GCV at concentrations below their 50% inhibitory and 50% toxic concentrations. These results suggest that combining GCV with relatively low doses of RR inhibitors could significantly potentiate the anti-HCMV activity of GCV in vivo and could improve clinical response to therapy. PMID:23933116

  11. (S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine, a potent and selective inhibitor of human cytomegalovirus replication.

    PubMed Central

    Snoeck, R; Sakuma, T; De Clercq, E; Rosenberg, I; Holy, A

    1988-01-01

    From a series of phosphonylmethoxyalkylpurine and -pyrimidine derivatives, (S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine [(S)-HPMPC] emerged as a particularly potent and selective inhibitor of the replication of human cytomegalovirus (CMV). Its potency against CMV was similar to that of the structurally related adenine derivative (S)-HPMPA but higher than that of the reference compounds phosphonoformate and 9-(1,3-dihydroxy-2-propoxymethyl)guanine (DHPG). The minimum concentrations of phosphonoformate, DHPG, (S)-HPMPA, and (S)-HPMPC required to inhibit CMV plaque formation by 50% were 15, 0.7, 0.1, and 0.07 microgram/ml, respectively. The selectivity indices of phosphonoformate, DHPG, (S)-HPMPA, and (S)-HPMPC, as determined by the ratio of the 50% inhibitory concentration for cell growth to the 50% inhibitory concentration for plaque formation for CMV (AD-169 strain), were 14, 150, 200 and 1,500, respectively. Corresponding values for the CMV Davis strain were 20, 200, 100, and 1,000, respectively. (S)-HPMPC was inhibitory to CMV plaque formation even when added to the cells at 24 or 48 h postinfection. When (S)-HPMPC was added immediately postinfection, a 24- or 48-h incubation time sufficed to obtain a marked inhibitory effect on CMV replication. Such limited incubation time was insufficient for DHPG to achieve any protection against CMV. PMID:2854454

  12. Human cytomegalovirus tegument protein pUL83 inhibits IFI16-mediated DNA sensing for immune evasion.

    PubMed

    Li, Tuo; Chen, Jin; Cristea, Ileana M

    2013-11-13

    Nuclear sensing of viral DNA has emerged as an essential step in innate immune responses against herpesviruses. Here, we provide mechanistic insight into host recognition of human cytomegalovirus (HCMV) and subsequent immune evasion by this prominent DNA virus. We establish that the interferon-inducible protein IFI16 acts as a nuclear DNA sensor following HCMV infection, binding viral DNA and triggering expression of antiviral cytokines via the STING-TBK1-IRF3 signaling pathway. The HCMV tegument protein pUL83 inhibits this response by interacting with the IFI16 pyrin domain, blocking its oligomerization upon DNA sensing and subsequent immune signals. pUL83 disrupts IFI16 by concerted action of its N- and C-terminal domains, in which an evolutionarily conserved N-terminal pyrin association domain (PAD) binds IFI16. Additionally, phosphorylation of the N-terminal domain modulates pUL83-mediated inhibition of pyrin aggregation. Collectively, our data elucidate the interplay between host DNA sensing and HCMV immune evasion, providing targets for restoring antiviral immunity.

  13. Seroprevalence of Hepatitis C, Hepatitis B, Cytomegalovirus, and Human Immunodeficiency Viruses in Multitransfused Thalassemic Children in Upper Egypt

    PubMed Central

    Mahmoud, Ramadan A.; El-Mazary, Abdel-Azeem M.; Khodeary, Ashraf

    2016-01-01

    Background. Frequent blood transfusions in thalassemia major children expose them to the risk of transfusion-transmitted infections (TTIs). The aim of this study was to estimate the prevalence of hepatitis C virus (HCV), hepatitis B virus (HBV), human immunodeficiency virus (HIV), and cytomegalovirus (CMV) in thalassemic children attending the Pediatrics Departments of both Sohag and Minia Universities of Upper Egypt, during the period from May 2014 to May 2015. Methods. Serum samples were screened for hepatitis B surface antigen (HBsAg), anti-HCV, anti-CMV, and anti-HIV type 1 and type 2 using the Vitek Immunodiagnostic Assay System. Results. The frequencies of anti-HCV, HBsAg, anti-CMV, and anti-HIV type 1 and type 2 were found to be 37.11%, 4.12%, 4.12%, 0.00%, and 0.00%, respectively. Seropositivity for anti-HCV, HBsAg, and anti-CMV increased with increasing age of the patients, duration of the disease, serum ferritin level (ng/mL), and liver enzymes (U/L), while it was not significantly associated with gender, frequency of blood transfusion, or the status of splenectomy operation (P > 0.05). Conclusion. The frequency of TTIs, especially HCV, is considerably high among Egyptian children with thalassemia major. It is therefore important to implement measures to improve blood transfusion screening, such as polymerase chain reaction, in order to reduce TTIs from blood donor units. PMID:26989417

  14. Human Cytomegalovirus-Encoded pUL7 Is a Novel CEACAM1-Like Molecule Responsible for Promotion of Angiogenesis

    PubMed Central

    MacManiman, Jason D.; Meuser, Andrew; Botto, Sara; Smith, Patricia P.; Liu, Fenyong; Jarvis, Michael A.; Caposio, Patrizia

    2014-01-01

    ABSTRACT Persistent human cytomegalovirus (HCMV) infection has been linked to several diseases, including atherosclerosis, transplant vascular sclerosis (TVS), restenosis, and glioblastoma. We have previously shown that factors secreted from HCMV-infected cells induce angiogenesis and that this process is due, at least in part, to increased secretion of interleukin-6 (IL-6). In order to identify the HCMV gene(s) responsible for angiogenesis promotion, we constructed a large panel of replication-competent HCMV recombinants. One HCMV recombinant deleted for UL1 to UL10 was unable to induce secretion of factors necessary for angiogenesis. Fine mapping using additional HCMV recombinants identified UL7 as a viral gene required for production of angiogenic factors from HCMV-infected cells. Transient expression of pUL7 induced phosphorylation of STAT3 and ERK1/2 MAP kinases and production of proangiogenic factors, including IL-6. Addition of recombinant pUL7 to cells was sufficient for angiogenesis and was again associated with increased IL-6 expression. Analysis of the UL7 structure revealed a conserved domain similar to the immunoglobulin superfamily domain and related to the N-terminal V-like domain of carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1). Our report therefore identifies UL7 as a novel HCMV-encoded molecule that is both structurally and functionally related to cellular CEACAM1, a proangiogenic factor highly expressed during vasculogenesis. PMID:25352622

  15. A collaborative study to establish the 1st WHO International Standard for human cytomegalovirus for nucleic acid amplification technology.

    PubMed

    Fryer, Jacqueline F; Heath, Alan B; Minor, Philip D

    2016-07-01

    Variability in the performance of nucleic acid amplification technology (NAT)-based assays presents a significant problem in the diagnosis and management of human cytomegalovirus (HCMV) infections. Here we describe a collaborative study to evaluate the suitability of candidate reference materials to harmonize HCMV viral load measurements in a wide range of NAT assays. Candidate materials comprised lyophilized Merlin virus, liquid Merlin virus, liquid AD169 virus, and purified HCMV Merlin DNA cloned into a bacterial artificial chromosome. Variability in the laboratory mean HCMV concentrations determined for virus samples across the different assays was 2 log10. Variability for the purified DNA sample was higher (>3 log10). The agreement between laboratories was markedly improved when the potencies of the liquid virus samples were expressed relative to the lyophilized virus candidate. In contrast, the agreement between laboratories for the purified DNA sample was not improved. Results indicated the suitability of the lyophilized Merlin virus preparation as the 1st WHO International Standard for HCMV for NAT. It was established in October 2010, with an assigned potency of 5 × 10(6) International Units (IU) (NIBSC code 09/162). It is intended to be used to calibrate secondary references, used in HCMV NAT assays, in IU. PMID:27179913

  16. Analysis of the interactions of viral and cellular factors with human cytomegalovirus lytic origin of replication, oriLyt

    PubMed Central

    Kagele, Dominique; Rossetto, Cyprian C.; Elorza, Margret; Pari, Gregory S.

    2011-01-01

    Human cytomegalovirus transient lytic DNA replication relies on the cis-acting element oriLyt, six viral-encoded core proteins, the proposed DNA replication initiator protein UL84, IE2, IRS1 and the gene products from the UL112/113 loci. In an effort to elucidate cellular and viral-encoded factors that may play a role in oriLyt-dependent replication we used DNA-affinity purification and mass spectrometry to isolate and identify several previously unknown cellular and viral factors that interact with HCMV oriLyt DNA. These proteins include the multifunctional hnRNP-K, BUB3, HMGB1, PTB-1, UL83, UL112/113, and IRS1. Chromatin immunoprecipitation (ChIP) assays confirmed an interaction of several of these factors with oriLyt. Co-immunoprecipitation experiments detected an interaction between UL84 and hnRNP-K in infected and transfected cells. Knockdown of hnRNP K expression by siRNA inhibited the amplification of oriLyt in the transient assay. Together, these data suggest a possible regulatory role in DNA replication for several previously unidentified viral and cellular factors. PMID:22236369

  17. UL84-independent replication of human cytomegalovirus strains conferred by a single codon change in UL122.

    PubMed

    Spector, David J

    2015-02-01

    The UL84 gene of human cytomegalovirus (HCMV) is thought to be involved in the initiation of viral DNA replication, and is essential for replication of strains AD169 and Towne. Hence, discovery that strain TB40-BAC4 is viable in the absence of UL84 presented an enigma requiring an explanation. Data reported here show that strain TR also tolerated loss of UL84, whereas strains FIX, Merlin, Ph, and Toledo did not. UL84-independent growth required the viral replication origin. The genetic locus in TB40 that controls UL84 dependence was mapped to codon 388 of the UL122 gene, which encodes the immediate early 2 (IE2) 86kD protein. Introduction of this TB40-BAC4 variant (H388D) into FIX and Toledo clones converted these strains to UL84 independence. These results provide genetic evidence in virus-infected cells that supports the hypothesis that UL122 participates in the initiation of viral DNA replication by a mechanism involving transcription-mediated activation of the origin.

  18. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase--A Potential Strategy for Suppression of the Wnt Pathway.

    PubMed

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit

    2015-12-29

    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS' activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes.

  19. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53.

    PubMed

    Kuan, Man I; O'Dowd, John M; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J; Fortunato, Elizabeth A

    2016-10-01

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm.

  20. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins.

    PubMed

    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R; Brune, Wolfram; Geballe, Adam P; Beau, Isabelle; Esclatine, Audrey

    2016-01-01

    Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus. PMID:26654401

  1. Activation of Langerhans-Type Dendritic Cells Alters Human Cytomegalovirus Infection and Reactivation in a Stimulus-Dependent Manner

    PubMed Central

    Coronel, Roxanne; Jesus, Desyree M.; Dalle Ore, Lucia; Mymryk, Joe S.; Hertel, Laura

    2016-01-01

    Oral mucosal Langerhans cells (LC) are likely to play important roles in host defense against infection by human cytomegalovirus (CMV). We previously showed that in vitro-differentiated immature LC (iLC) populations contain smaller amounts of infected cells but produce higher yields than mature LC (mLC) cultures, obtained by iLC stimulation with fetal bovine serum (FBS), CD40 ligand (CD40L) and lipopolysaccharide (LPS). Here, we sought to determine if exposure to select stimuli can improve LC permissiveness to infection, if specific components of the mLC cocktail are responsible for lowering viral yields, if this is due to defects in progeny production or release, and if these restrictions are also effective against reactivated virus. None of the stimuli tested extended the proportion of infected cells to 100%, suggesting that the block to infection onset cannot be fully removed. While CD40L and FBS exerted positive effects on viral progeny production per cell, stimulation with LPS alone or in combination with CD40L was detrimental. Reductions in viral titers were not due to defects in progeny release, and the permissive or restrictive intracellular environment established upon exposure to each stimulus appeared to act in a somewhat similar way toward lytic and latent infections.

  2. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.

    PubMed

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities.

  3. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins

    PubMed Central

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  4. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.

    PubMed

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  5. Preclinical and Toxicology Studies of 1263W94, a Potent and Selective Inhibitor of Human Cytomegalovirus Replication

    PubMed Central

    Koszalka, George W.; Johnson, Nelson W.; Good, Steven S.; Boyd, Leslie; Chamberlain, Stanley C.; Townsend, Leroy B.; Drach, John C.; Biron, Karen K.

    2002-01-01

    1263W94 is a novel benzimidazole compound being developed for treatment of human cytomegalovirus infection. No adverse pharmacological effects were demonstrated in safety pharmacology studies with 1263W94. The minimal-effect dose in a 1-month rat study was 100 mg/kg/day, and the no-effect dose in a 1-month monkey study was 180 mg/kg/day. Toxic effects were limited to increases in liver weights, neutrophils, and monocytes at higher doses in female rats. 1263W94 was not genotoxic in the Ames or micronucleus assays. In the mouse lymphoma assay, 1263W94 was mutagenic in the absence of the rat liver S-9 metabolic activation system, with equivocal results in the presence of the S-9 mix. Mean oral bioavailability of 1263W94 was >90% in rats and ∼50% in monkeys. Clearance in rats and monkeys was primarily by biliary secretion, with evidence of enterohepatic recirculation. In 1-month studies in rats and monkeys, mean peak concentrations and exposures to 1263W94 increased in near proportion to dose. Metabolism of 1263W94 to its primary metabolite, an N-dealkylated analog, appeared to be mediated via the isozyme CYP3A4 in humans. 1263W94 was primarily distributed in the gastrointestinal tract of rats but did not cross the blood-brain barrier. In monkeys, 1263W94 levels in the brain, cerebrospinal fluid, and vitreous humor ranged from 4 to 20%, 1 to 2%, and <1%, of corresponding concentrations in plasma, respectively. The high level of binding by 1263W94 to human plasma proteins (primarily albumin) was readily reversible, with less protein binding seen in the monkey, rat, and mouse. Results of these studies demonstrate a favorable safety profile for 1263W94. PMID:12121907

  6. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  7. Association of Human Immunoglobulin G1 Heavy Chain Variants With Neutralization Capacity and Antibody-Dependent Cellular Cytotoxicity Against Human Cytomegalovirus.

    PubMed

    Vietzen, Hannes; Görzer, Irene; Puchhammer-Stöckl, Elisabeth

    2016-10-15

    Human cytomegalovirus (HCMV) infection is limited by HCMV-specific antibody functions. Here the association between the genetic marker (GM) 3/17 variants in the immunoglobulin G1 (IgG1) heavy chain constant region, virus neutralization, and natural killer (NK)-cell activation was investigated. In 100 HCMV-seropositive individuals, the GM3/17 polymorphism, serum 50% HCMV antibody neutralization titer (NT50), and in vitro HCMV-specific antibody NK-cell activation were assessed. The HCMV NT50 was higher in heterozygous GM3/17 persons than in GM3/3 persons (P = .0276). Furthermore, individuals expressing GM3/17 exhibited significantly higher NK-cell activation than persons carrying GM3/3 (P < .0001) or GM17/17 (P = .0095). Thus, persons expressing GM3/17 have potentially a selective advantage in HCMV defense.

  8. Is CMV a target in pediatric glioblastoma? Expression of CMV proteins, pp65 and IE1-72 and CMV nucleic acids in a cohort of pediatric glioblastoma patients.

    PubMed

    Wakefield, Amanda; Pignata, Antonella; Ghazi, Alexia; Ashoori, Aidin; Hegde, Meenakshi; Landi, Daniel; Gray, Tara; Scheurer, Michael E; Chintagumpala, Murali; Adesina, Adekunle; Gottschalk, Stephen; Hicks, John; Powell, Suzanne Z; Ahmed, Nabil

    2015-11-01

    While the 5-year overall survival is better in pediatric than in adult patients diagnosed with glioblastoma (GBM), outcomes in children remain very poor. Understanding the mechanisms of tumorigenesis and tumor propagation can identify therapeutic targets to improve these outcomes. Human cytomegalovirus (CMV) proteins and nucleic acids are present in the majority of adult GBM. Indeed, CMV is emerging as a potential glioma-associated target for anti-CMV agents and cellular therapeutics. Furthermore, CMV appears to contribute to GBM's malignant phenotype, although its role in tumorigenesis is less certain. In this cohort of 25 serially diagnosed pediatric GBMs, the largest described cohort to date, we used immunohistochemical staining and in situ hybridization to show the presence of CMV antigens pp65 and IE1-72 as well as CMV nucleic acids, respectively. Our cohort indicated either CMV antigen pp65 or IE1-72 was present in approximately 67 % of pediatric GBM samples. The majority of samples stained positive for either CMV antigen showing a cytoplasmic pattern in 25-50 % of cells within the sample at a moderate intensity, while a few samples showed nuclear staining and higher grade/intensity. Of 16 samples where in situ hybridization was performed, 13 (81 %) showed specific staining using a CMV genome specific probe cocktail. ISH positive samples showed high concordance with being pp65 or IE1-72 positive. These findings, paired with the association of CMV expression with poor prognosis and overall survival, indicate the need to further investigate how these antigens are promoting tumor growth and preventing cell death. Also, the expression of these antigens in a majority of tumor tissues should be considered for immunotherapeutic targets in cases of pediatric GBM. PMID:26341370

  9. Comparison between human cytomegalovirus pUL97 and murine cytomegalovirus (MCMV) pM97 expressed by MCMV and vaccinia virus: pM97 does not confer ganciclovir sensitivity.

    PubMed

    Wagner, M; Michel, D; Schaarschmidt, P; Vaida, B; Jonjic, S; Messerle, M; Mertens, T; Koszinowski, U

    2000-11-01

    The UL97 protein (pUL97) of human cytomegalovirus (HCMV) is a protein kinase that also phosphorylates ganciclovir (GCV), but its biological function is not yet clear. The M97 protein (pM97) of mouse cytomegalovirus (MCMV) is the homolog of pUL97. First, we studied the consequences of genetic replacement of M97 by UL97. Using the infectious bacterial plasmid clone of the full-length MCMV genome (M. Wagner, S. Jonjic, U. H. Koszinowski, and M. Messerle, J. Virol. 73:7056-7060, 1999), we replaced the M97 gene with the UL97 gene and constructed an MCMV M97 deletion mutant and a revertant virus. In addition, pUL97 and pM97 were expressed by recombinant vaccinia virus to compare both for known functions. Remarkably, pM97 proved not to be the reason for the GCV sensitivity of MCMV. When expressed by the recombinant MCMV, however, pUL97 was phosphorylated and endowed MCMV with the capacity to phosphorylate GCV, thereby rendering MCMV more susceptible to GCV. We found that deletion of pM97, although it is not essential for MCMV replication, severely affected virus growth. This growth deficit was only partially amended by pUL97 expression. When expressed by recombinant vaccinia viruses, both proteins were phosphorylated and supported phosphorylation of GCV, but pUL97 was about 10 times more effective than pM97. One hint of the functional differences between the proteins was provided by the finding that pUL97 accumulates in the nucleus, whereas pM97 is predominantly located in the cytoplasm of infected cells. In vivo testing revealed that the UL97-MCMV recombinant should allow evaluation of novel antiviral drugs targeted to the UL97 protein of HCMV in mice. PMID:11044117

  10. Expression of the IE1 transactivator of Autographa californica nuclear polyhedrosis virus during viral infection.

    PubMed

    Choi, J; Guarino, L A

    1995-05-10

    The immediate-early IE1 protein of Autographa californica nuclear polyhedrosis virus (AcMNPV) is an important regulator of viral gene transcription. To provide a tool for further analysis of the expression and function of IE1, a polyclonal antiserum was raised against IE1 expressed in bacteria. Immunoblot analysis of infected cell lysates was used to monitor the accumulation of IE1 throughout the viral life cycle. When extracts were prepared in the presence of phosphatase inhibitors, only one protein band was detected on SDS-polyacrylamide gels. However, in the absence of phosphatase inhibitors, at least four distinct electrophoretic species were detected. Mobility shift assays were conducted using an enhancer DNA probe and whole cell extracts prepared at different times postinfection. Results indicated that the enhancer-binding activity of IE1 increased from 4 to 72 hr postinfection. DNA-protein complexes formed with infected cell extracts migrated more slowly than those formed with transfected cell extracts. This effect was more pronounced with extracts prepared in the presence of phosphatase inhibitors. Supershift experiments with IE1 antiserum confirmed that IE1 was a component of DNA-protein complexes in both transfected and infected cell extracts. A titration experiment was done to determine the minimal amounts of IE1 required for activation of the 39k promoter in the presence and absence of a cis-linked enhancer element. These analyses indicated that the intracellular levels of IE1 are not sufficient for enhancer-independent activation of the 39k promoter during the early phase of viral infection. Quantitative immunoblots revealed that the amount of IE1 in budded virus was less than 0.68 mole per mole of viral DNA, suggesting that IE1 is not a structural protein of AcNPV.

  11. Palmitoylation Strengthens Cholesterol-dependent Multimerization and Fusion Activity of Human Cytomegalovirus Glycoprotein B (gB).

    PubMed

    Patrone, Marco; Coroadinha, Ana Sofia; Teixeira, Ana P; Alves, Paula M

    2016-02-26

    Herpesviruses are a large order of animal enveloped viruses displaying a virion fusion mechanism of unusual complexity. Their multipartite machinery has a conserved core made of the gH/gL ancillary complexes and the homo-trimeric fusion protein glycoprotein B (gB). Despite its essential role in starting the viral infection, gB interaction with membrane lipids is still poorly understood. Here, evidence is provided demonstrating that human cytomegalovirus (HCMV) gB depends on the S-palmitoylation of its endodomain for an efficient interaction with cholesterol-rich membrane patches. We found that, unique among herpesviral gB proteins, the HCMV fusion factor has a Cys residue in the C-terminal region that is palmitoylated and mediates methyl-β-cyclodextrin-sensitive self-association of purified gB. A cholesterol-dependent virus-like particle trap assay, based on co-expression of the HIV Gag protein, confirmed that this post-translational modification is functional in the context of cellular membranes. Mutation of the palmitoylated Cys residue to Ala or inhibition of protein palmitoylation decreased HCMV gB export via Gag particles. Moreover, purified gBC777A showed an increased kinetic sensitivity in a cholesterol depletion test, demonstrating that palmitoyl-gB limits outward cholesterol diffusion. Finally, gB palmitoylation was required for full fusogenic activity in human epithelial cells. Altogether, these results uncover the palmitoylation of HCMV gB and its role in gB multimerization and activity.

  12. Human cytomegalovirus inhibits apoptosis by proteasome-mediated degradation of Bax at endoplasmic reticulum-mitochondrion contacts.

    PubMed

    Zhang, Aiping; Hildreth, Richard L; Colberg-Poley, Anamaris M

    2013-05-01

    Human cytomegalovirus (HCMV) encodes the UL37 exon 1 protein (pUL37x1), which is the potent viral mitochondrion-localized inhibitor of apoptosis (vMIA), to increase survival of infected cells. HCMV vMIA traffics from the endoplasmic reticulum (ER) to ER subdomains, which are physically linked to mitochondria known as mitochondrion-associated membranes (MAM), and to mitochondria. The antiapoptotic function of vMIA is thought to primarily result from its ability to inhibit Bax-mediated permeabilization of the outer mitochondrial membrane (OMM). Here, we establish that vMIA retargets Bax to the MAM as well as to the OMM from immediate early through late times of infection. However, MAM localization of Bax results in its increased ubiquitination and proteasome-mediated degradation. Surprisingly, HCMV infection does not increase OMM-associated degradation (OMMAD) of Bax, even though the ER and mitochondria are physically connected at the MAM. It was recently found that lipid rafts at the plasma membrane can connect extrinsic and intrinsic apoptotic pathways and can serve as sites of apoptosome assembly. In transfected permissive human fibroblasts, vMIA mediates, through its cholesterol affinity, association of Bax and apoptosome components with MAM lipid rafts. While Bax association with MAM lipid rafts was detected in HCMV-infected cells, association of apoptosome components was not. These results establish that Bax recruitment to the MAM and its MAM-associated degradation (MAMAD) are a newly described antiapoptotic mechanism used by HCMV infection to increase cell survival for its growth.

  13. A multigene family encodes the human cytomegalovirus glycoprotein complex gcII (gp47-52 complex)

    SciTech Connect

    Gretch, D.R.; Stinski, M.F. ); Kari, B.; Gehrz, R.C. )

    1988-06-01

    The HXLF (HindIII-X left reading frame) gene family is a group of five genes that share one or two regions of homology and are arranged in tandem within the short unique component of the human cytomegalovirus genome. These genes were cloned into an SP6 expression vector in both the sense and antisense orientations. An abundant 1.62-kilobase (kb) bicistronic mRNA, predicted to originate from HXLF1 and HXLF2, was detected in the cytoplasm of infected human fibroblast cells by Northern (RNA) blot analysis. Less abundant RNAs of 1.0 and 0.8 kb, predicted to originate from the HXLF5 and HXLF2 genes, respectively, were also detected. Monocistronic, bicistronic, and polycistronic RNAs synthesized in vitro by using SP6 polymerase were translated in rabbit reticulocyte lysates with or without canine pancreatic microsomal membranes. The HXLF1 or the HXLF1 and HXLF2 translation products were detected when the above mRNAs were used. The HXLF3, HXLF4, and HXLF5 gene products were not detected by in vitro translation of the SP6-derived polycistronic mRNA. The amino acid composition of gp47-52 purified from virion envelopes has the highest similarity to the predicted amino acid composition of the HXLF1 plus HXLF2 open reading frames, but it is more similar to HXLF2 than to HXLF1. The Northern blot results imply that gp47-52 is synthesized predominantly from the abundant 1.62-kb bicistronic mRNA encoded by the HXLF1 and HXLF2 genes. However, the glycoprotein could also be synthesized by the monocistronic 0.8-kb mRNA encoded by the HXLF2 gene as well as by the mRNAs predicted from the other HXLF genes.

  14. Resistance of human cytomegalovirus to cyclopropavir maps to a base pair deletion in the open reading frame of UL97.

    PubMed

    Gentry, Brian G; Vollmer, Laura E; Hall, Ellie D; Borysko, Katherine Z; Zemlicka, Jiri; Kamil, Jeremy P; Drach, John C

    2013-09-01

    Human cytomegalovirus (HCMV) is a widespread pathogen in the human population, affecting many immunologically immature and immunocompromised patients, and can result in severe complications, such as interstitial pneumonia and mental retardation. Current chemotherapies for the treatment of HCMV infections include ganciclovir (GCV), foscarnet, and cidofovir. However, the high incidences of adverse effects (neutropenia and nephrotoxicity) limit the use of these drugs. Cyclopropavir (CPV), a guanosine nucleoside analog, is 10-fold more active against HCMV than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively). We hypothesize that the mechanism of action of CPV is similar to that of GCV: phosphorylation to a monophosphate by viral pUL97 protein kinase with further phosphorylation to a triphosphate by endogenous kinases, resulting in inhibition of viral DNA synthesis. To test this hypothesis, we isolated a CPV-resistant virus, sequenced its genome, and discovered that bp 498 of UL97 was deleted. This mutation caused a frameshift in UL97 resulting in a truncated protein that lacks a kinase domain. To determine if this base pair deletion was responsible for drug resistance, the mutation was engineered into the wild-type viral genome, which was then exposed to increasing concentrations of CPV. The results demonstrate that the engineered virus was approximately 72-fold more resistant to CPV (EC50 = 25.8 ± 3.1 μM) than the wild-type virus (EC50 = 0.36 ± 0.11 μM). We conclude, therefore, that this mutation is sufficient for drug resistance and that pUL97 is involved in the mechanism of action of CPV.

  15. Baculoviruses deficient in ie1 gene function abrogate viral gene expression in transduced mammalian cells

    SciTech Connect

    Efrose, Rodica; Swevers, Luc; Iatrou, Kostas

    2010-10-25

    One of the newest niches for baculoviruses-based technologies is their use as vectors for mammalian cell transduction and gene therapy applications. However, an outstanding safety issue related to such use is the residual expression of viral genes in infected mammalian cells. Here we show that infectious baculoviruses lacking the major transcriptional regulator, IE1, can be produced in insect host cells stably transformed with IE1 expression constructs lacking targets of homologous recombination that could promote the generation of wt-like revertants. Such ie1-deficient baculoviruses are unable to direct viral gene transcription to any appreciable degree and do not replicate in normal insect host cells. Most importantly, the residual viral gene expression, which occurs in mammalian cells infected with wt baculoviruses is reduced 10 to 100 fold in cells infected with ie1-deficient baculoviruses. Thus, ie1-deficient baculoviruses offer enhanced safety features to baculovirus-based vector systems destined for use in gene therapy applications.

  16. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL.

    PubMed Central

    Wills, M R; Carmichael, A J; Mynard, K; Jin, X; Weekes, M P; Plachter, B; Sissons, J G

    1996-01-01

    Cytotoxic T lymphocytes (CTL) appear to play an important role in the control of human cytomegalovirus (HCMV) in the normal virus carrier: previous studies have identified peripheral blood CD8+ CTL specific for the HCMV major immediate-early gene product (IE1) and more recently, by bulk culture and cloning techniques, have identified CTL specific for a structural gene product, the lower matrix protein pp65. In order to determine the relative contributions of CTL which recognize the HCMV proteins IE1, pp65, and glycoprotein B (gB) to the total HCMV-specific CTL response, we have used a limiting-dilution analysis system to quantify HCMV-specific CTL precursors with different specificities, allowing the antigenic specificity of multiple short-term CTL clones to be assessed, in a group of six healthy seropositive donors. All donors showed high frequencies of HCMV-specific major histocompatibility complex-restricted CTL precursors. There was a very high frequency of CTL specific for pp65 (lower matrix protein); IE1-specific CTL were also detectable at lower frequencies in three of five donors, while CTL directed to gB were undetectable. A pp65 gene deletion mutant of HCMV was then used to estimate the contribution of pp65-specific CTL to the total HCMV-specific CTL response; this showed that between 70 and 90% of all CTL recognizing HCMV-infected cells were pp65 specific. Analysis of the peptide specificity of pp65-specific CTL showed that some donors have a highly focused response recognizing a single peptide; the T-cell receptor Vbeta gene usage in these two donors was shown to be remarkably restricted, with over half of the responding CD8+ T cells utilizing a single Vbeta gene rearrangement. Other subjects recognized multiple pp65 peptides: nine new pp65 CTL peptide epitopes were defined, and for five of these the HLA-presenting allele has been identified. All four of the HLA A2 donors tested in this study recognized the same peptide. This apparent domination of the

  17. Is human cytomegalovirus infection associated with essential hypertension? A meta-analysis of 11,878 participants.

    PubMed

    Wang, Zuoguang; Peng, Xiaoyun; Li, Mei; Jin, Fei; Zhang, Bei; Wang, Hao; Wei, Yongxiang

    2016-05-01

    Human cytomegalovirus (HCMV) has been reported to be highly expressed in essential hypertension (EH), and it has been proposed that HCMV infection may contribute to EH development. However, different studies showed opposite results. The present meta-analysis was performed to investigate the association between HCMV infection and the risk of EH. All relevant literature from 1980 to 2015 was extracted from six electronic databases. Odds ratios (OR) and 95% confidence intervals (CI) were used to assess the strength of the association of HCMV infection and risk of EH. Sensitivity analysis and examination for bias were conducted to evaluate cumulative evidence of the association. The random-effect model using the Mantel-Haenszel method was used to give the individual effect-size estimates. Of the 11,878 participants included in this study, there were 3,864 EH patients and 8,014 control subjects. Meta-analysis of nine studies performed in a random-effect model found that EH patients had a higher risk of HCMV infection than normal control subjects (OR = 1.47, 95%CI: 1.13-1.90, P = 0.004; heterogeneity: I(2)  = 66%, P = 0.002). Sensitivity analysis and bias examination showed the overall quality and consistency of the studies to be acceptable. For subgroup analysis, studies of Chinese populations were selected for further analysis. There was a significant association between HCMV infection and EH among Chinese patients (OR = 2.18, 95%CI:1.43-3.31, P = 0.0003) but not among other ethnic groups (OR = 1.11, 95%CI:0.95-1.31, P = 0.19). These findings provide quantitative support for the association between HCMV infection and high risk of EH in individuals of Chinese ethnicity.

  18. The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

    PubMed

    Winkler, Laura L; Kalejta, Robert F

    2014-10-01

    Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during

  19. The carboxyl terminus of human cytomegalovirus-encoded 7 transmembrane receptor US28 camouflages agonism by mediating constitutive endocytosis.

    PubMed

    Waldhoer, Maria; Casarosa, Paola; Rosenkilde, Mette M; Smit, Martine J; Leurs, Rob; Whistler, Jennifer L; Schwartz, Thue W

    2003-05-23

    US28 is one of four 7 transmembrane (7TM) chemokine receptors encoded by human cytomegalovirus and has been shown to both signal and endocytose in a ligand-independent, constitutively active manner. Here we show that the constitutive activity and constitutive endocytosis properties of US28 are separable entities in this viral chemokine receptor. We generated chimeric and mutant US28 proteins that were altered in either their constitutive endocytic (US28 Delta 300, US28 Delta 317, US28-NK1-ctail, and US28-ORF74-ctail) or signaling properties (US28R129A). By using this series of mutants, we show that the cytoplasmic tail domain of US28 per se regulates receptor endocytosis, independent of the signaling ability of the core domain of US28. The constitutive endocytic property of the US28 c-tail was transposable to other 7TM receptors, the herpes virus 8-encoded ORF74 and the tachykinin NK1 receptor (ORF74-US28-ctail and NK1-US28-ctail). Deletion of the US28 C terminus resulted in reduced constitutive endocytosis and consequently enhanced signaling capacity of all receptors tested as assessed by inositol phosphate turnover, NF-kappa B, and cAMP-responsive element-binding protein transcription assays. We further show that the constitutive endocytic property of US28 affects the action of its chemokine ligand fractalkine/CX3CL1 and show that in the absence of the US28 C terminus, fractalkine/CX3CL1 acts as an agonist on US28. This demonstrates for the first time that the endocytic properties of a 7TM receptor can camouflage the agonist properties of a ligand.

  20. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  1. RhoB is a component of the human cytomegalovirus assembly complex and is required for efficient viral production

    PubMed Central

    Goulidaki, Nektaria; Alarifi, Saud; Alkahtani, Saad H; Al-Qahtani, Ahmed; Spandidos, Demetrios A; Stournaras, Christos; Sourvinos, George

    2015-01-01

    Human Cytomegalovirus (HCMV), an ubiquitous β-herpesvirus, is a significant pathogen that causes medically severe diseases in immunocompromised individuals and in congenitally infected neonates. RhoB belongs to the family of Rho GTPases, which regulates diverse cellular processes. Rho proteins are implicated in the entry and egress from the host cell of mainly α- and γ-herpesviruses, whereas β-herpesviruses are the least studied in this regard. Here, we studied the role of RhoB GTPase during HCMV lytic infection. Microscopy analysis, both in fixed and live infected cells showed that RhoB was translocated to the assembly complex/compartment (AC) of HCMV, a cytoplasmic zone in infected cells where many viral structural proteins are known to accumulate and assembly of new virions takes place. Furthermore, RhoB was localized at the AC even when the expression of the late HCMV AC proteins was inhibited. At the very late stages of infection, cellular projections were formed containing RhoB and HCMV virions, potentially contributing to the successful viral spread. Interestingly, the knockdown of RhoB in HCMV-infected cells resulted in a significant reduction of the virus titer and could also affect the accumulation of AC viral proteins at this subcellular compartment. RhoB knockdown also affected actin fibers' structure. Actin reorganization was observed at late stages of infection originating from the viral AC and surrounding the cellular projections, implying a potential interplay between RhoB and actin during HCMV assembly and egress. In conclusion, our results demonstrate for the first time that RhoB is a constituent of the viral AC and is required for HCMV productive infection. PMID:26114383

  2. Effect of the complexation with cyclodextrins on the in vitro antiviral activity of ganciclovir against human cytomegalovirus.

    PubMed

    Nicolazzi, C; Abdou, S; Collomb, J; Marsura, A; Finance, C

    2001-02-01

    The toxicity of the molecules currently used in the treatment of human cytomegalovirus (HCMV) in immunocompromised hosts often causes interruption of the therapy. Cyclodextrins (Cds), oligosaccharides possessing a hydrophobic cavity, have the property of forming inclusion complexes with a great number of molecules, improving their bioavailability and their biological properties. In this study, we have tested the ability of three native Cds to improve the antiviral effect of ganciclovir (GCV) on two HCMV strains: AD169, a reference susceptible strain, and RC11, a GCV resistant strain. The efficacy of the GCV, expressed in IC50 values, showed no improvement in the presence of alpha-Cd, while the use of beta- and gamma-Cd improved by 6- and 4-fold, respectively, its antiviral activity tested on AD169 strain. The influence of beta- or gamma-Cd on GCV efficiency evaluated on RC11 strain showed a decrease of the IC50. Parallel NMR studies were undertaken in order to characterize formation of [GCV:Cd] complexes. The results showed that complexation between alpha- or gamma-Cd and GCV did not occur. In contrast, spectra proved that beta-Cd formed an inclusion complex with GCV. This complex was characterized in UV-Visible spectrophotometry and the influence of the beta-Cd on the GCV penetration in cells was measured. The use of Cds as carriers of antiviral drugs would be a good alternative to traditional treatment, because it may allow the administration of lower doses and so continuous treatment by reducing the toxic effects of drugs. PMID:11249120

  3. A targeted spatial-temporal proteomics approach implicates multiple cellular trafficking pathways in human cytomegalovirus virion maturation.

    PubMed

    Moorman, Nathaniel J; Sharon-Friling, Ronit; Shenk, Thomas; Cristea, Ileana M

    2010-05-01

    The assembly of infectious virus particles is a complex event. For human cytomegalovirus (HCMV) this process requires the coordinated expression and localization of at least 60 viral proteins that comprise the infectious virion. To gain insight into the mechanisms controlling this process, we identified protein binding partners for two viral proteins, pUL99 (also termed pp28) and pUL32 (pp150), which are essential for HCMV virion assembly. We utilized HCMV strains expressing pUL99 or pUL32 carboxyl-terminal green fluorescent protein fusion proteins from their native location in the HCMV genome. Based on the presence of ubiquitin in the pUL99 immunoisolation, we discovered that this viral protein colocalizes with components of the cellular endosomal sorting complex required for transport (ESCRT) pathway during the initial stages of virion assembly. We identified the nucleocapsid and a large number of tegument proteins as pUL32 binding partners, suggesting that events controlling trafficking of this viral protein in the cytoplasm regulate nucleocapsid/tegument maturation. The finding that pUL32, but not pUL99, associates with clathrin led to the discovery that the two viral proteins traffic via distinct pathways during the early stages of virion assembly. Additional investigation revealed that the majority of the major viral glycoprotein gB initially resides in a third compartment. Analysis of the trafficking of these three viral proteins throughout a time course of virion assembly allowed us to visualize their merger into a single large cytoplasmic structure during the late stages of viral assembly. We propose a model of HCMV virion maturation in which multiple components of the virion traffic independently of one another before merging.

  4. Genetic polymorphisms of the human cytomegalovirus UL144 gene in colorectal cancer and its association with clinical outcome.

    PubMed

    Chen, Hsin-Pai; Jiang, Jeng-Kai; Chan, Chia-Hao; Teo, Wan-Huai; Yang, Chih-Yung; Chen, Yen-Chung; Chou, Teh-Ying; Lin, Chi-Hung; Chan, Yu-Jiun

    2015-12-01

    Human cytomegalovirus (HCMV) has been increasingly detected in colorectal cancer (CRC), and genetic polymorphisms in HCMV affect its pathogenesis. This study aimed to investigate HCMV genetic polymorphisms in CRC and its correlation with the clinical outcomes. We performed PCR and sequencing of a viral immunomodulatory gene, UL144, in clinical isolates and CRC specimens. The nucleotide and amino acid sequences were aligned, and a phylogenetic tree was constructed. The clinical, pathological and survival data were compared among tumours with different UL144 genotypes. HCMV was detected in 49 (47.8 %) of the tumour specimens. Genotype A predominated in 43 samples (22/43; 51.2 %) with successful sequencing, followed by genotype B (13/43; 30.2 %) and genotype C (8/43; 18.6 %). The genotypic distribution was similar to that of the clinical isolates and those reported in other Asian populations. The amino acid sequence of genotype B was the most conserved. For stage II and III CRC patients with HCMV-positive tumours, disease-free survival (DFS) varied among the three major genotypes (P50.0046). The presence of genotype B virus in the tumours was associated with a shorter DFS and independently predicted tumour recurrence in a multivariate Cox proportional hazards model (hazard ratio, 5.79; 95 % confidence interval, 1.30–25.81; P50.021). By reverse transcription PCR, tumour samples with genotype B viruses had the highest rate of UL144 expression. Our results suggest that genetic polymorphisms of HCMV UL144 are associated with clinical outcome in CRC and that HCMV may play an immunomodulatory role in the tumour microenvironment of CRC. PMID:26450180

  5. Latent infection of myeloid progenitors by human cytomegalovirus protects cells from FAS-mediated apoptosis through the cellular IL-10/PEA-15 pathway

    PubMed Central

    Lau, Jonathan C. H.; Sinclair, John

    2015-01-01

    Latent infection of primary CD34+ progenitor cells by human cytomegalovirus (HCMV) results in their increased survival in the face of pro-apoptotic signals. For instance, we have shown previously that primary myeloid cells are refractory to FAS-mediated killing and that cellular IL-10 (cIL-10) is an important survival factor for this effect. However, how cIL-10 mediates this protection is unclear. Here, we have shown that cIL-10 signalling leading to upregulation of the cellular factor PEA-15 mediates latency-associated protection of CD34+ progenitor cells from the extrinsic death pathway. PMID:25957098

  6. A First-in-Human Study To Assess the Safety and Pharmacokinetics of Monoclonal Antibodies against Human Cytomegalovirus in Healthy Volunteers.

    PubMed

    Dole, Kiran; Segal, Florencia Pereyra; Feire, Adam; Magnusson, Baldur; Rondon, Juan C; Vemula, Janardhana; Yu, Jing; Pang, Yinuo; Pertel, Peter

    2016-05-01

    Human cytomegalovirus (HCMV) can cause significant disease in immunocompromised patients and treatment options are limited by toxicities. CSJ148 is a combination of two anti-HCMV human monoclonal antibodies (LJP538 and LJP539) that bind to and inhibit the function of viral HCMV glycoprotein B (gB) and the pentameric complex, consisting of glycoproteins gH, gL, UL128, UL130, and UL131. Here, we evaluated the safety, tolerability, and pharmacokinetics of a single intravenous dose of LJP538 or LJP539 or their combination in healthy volunteers. Adverse events and laboratory abnormalities occurred sporadically with similar incidence between antibody and placebo groups and without any apparent relationship to dose. No subject who received antibody developed a hypersensitivity, infusion-related reaction or anti-drug antibodies. After intravenous administration, both LJP538 and LJP539 demonstrated typical human IgG1 pharmacokinetic properties, with slow clearances, limited volumes of distribution, and long terminal half-lives. The pharmacokinetic parameters were linear and dose proportional for both antibodies across the 50-fold range of doses evaluated in the study. There was no apparent impact on pharmacokinetics when the antibodies were administered alone or in combination. CSJ148 and the individual monoclonal antibodies were safe and well tolerated, with pharmacokinetics as expected for human immunoglobulin.

  7. Transcriptional regulation of the human cytomegalovirus major immediate-early gene is associated with induction of DNase I-hypersensitive sites.

    PubMed Central

    Nelson, J A; Groudine, M

    1986-01-01

    Human teratocarcinoma cells were used to examine structural features associated with expression of the major immediate-early (IE) gene of human cytomegalovirus. By immunofluorescence, comparison of RNA levels, and in vitro transcription of nuclei, we showed that the major IE gene is inactive in undifferentiated but active in differentiated cells. Therefore, the block in human cytomegalovirus replication in teratocarcinoma cells appears to be at the transcriptional level, in one of the initial genes transcribed. In addition, the in vitro transcription experiments demonstrated that in permissive infections the gene was transcriptionally inactive late in infection. A comparison of the structural features of the promoter region with the active and inactive IE genes showed the presence of constitutive and inducible DNase I-hypersensitive sites. The majority of the constitutive sites existed at -175, -275, -375, -425, and -525 relative to the cap site in an area which has been shown to be capable of simian virus 40 enhancer function. In contrast, the inducible DNase I sites were located outside this region at -650, -775, -875, and -975. Images PMID:3023848

  8. Quantitation of human cytomegalovirus DNA in leukocytes by end-point titration and duplex polymerase chain reaction.

    PubMed

    Kulski, J K

    1994-09-01

    The presence of human cytomegalovirus (CMV) DNA and cellular DNA in leukocytes was detected by duplex polymerase chain reaction (PCR) and quantitated by end-point titration. Two different duplex PCR methods were used to co-amplify CMV DNA and a 536 bp fragment of globin DNA. MIE-globin PCR amplified a 435 bp fragment of the major immediate early (MIE) gene of CMV DNA whereas the LA-globin PCR amplified a 200 bp fragment of the late antigen (LA) gene of CMV DNA. PCR products were separated by electrophoresis in 3% agarose gels and detected by ethidium bromide staining. Amplification of globin DNA was included in the PCR as a positive control to monitor the accuracy and reproducibility of the PCR assay and to provide a reference point for CMV DNA levels. End-point titration PCR using known amounts of recombinant CMV DNA and human placental DNA showed that the end-point titres of the amplified CMV DNA correlated directly with the amount of CMV DNA in the sample. The limit of detection of MIE-globin and LA-globin PCR was 1 ng for placental DNA, and 10 fg (1000 copies) for CMV-MIE DNA and 1 fg (100 copies) for CMV-LA DNA, respectively. The amount of CMV DNA was quantitated in leukocytic lysates of 16 immunocompromised patients, who were tested for the presence of CMV in blood by cell culture, and of four normal controls. The blood concentration of CMV DNA, calculated as the number of copies of CMV DNA per microgram of leukocyte DNA, varied between 10(4) and 10(7) in the seven bloods that were CMV-cell-culture-positive, and between 10(2) and 10(4) in the blood of five patients that were CMV-cell-culture-negative. CMV DNA was undetected by PCR in the blood of another eight CMV-negative cases. This study shows that end-point titration and duplex PCR can be used as a simple and rapid method to quantitate CMV DNA in blood of patients that are either CMV-positive or CMV-negative by cell culture. Quantitation of CMV DNA in blood by end-point titration PCR has potential to

  9. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  10. Platelet-derived growth factor-α receptor is the cellular receptor for human cytomegalovirus gHgLgO trimer.

    PubMed

    Kabanova, Anna; Marcandalli, Jessica; Zhou, Tongqing; Bianchi, Siro; Baxa, Ulrich; Tsybovsky, Yaroslav; Lilleri, Daniele; Silacci-Fregni, Chiara; Foglierini, Mathilde; Fernandez-Rodriguez, Blanca Maria; Druz, Aliaksandr; Zhang, Baoshan; Geiger, Roger; Pagani, Massimiliano; Sallusto, Federica; Kwong, Peter D; Corti, Davide; Lanzavecchia, Antonio; Perez, Laurent

    2016-06-06

    Human cytomegalovirus encodes at least 25 membrane glycoproteins that are found in the viral envelope(1). While gB represents the fusion protein, two glycoprotein complexes control the tropism of the virus: the gHgLgO trimer is involved in the infection of fibroblasts, and the gHgLpUL128L pentamer is required for infection of endothelial, epithelial and myeloid cells(2-5). Two reports suggested that gB binds to ErbB1 and PDGFRα (refs 6,7); however, these results do not explain the tropism of the virus and were recently challenged(8,9). Here, we provide a 19 Å reconstruction for the gHgLgO trimer and show that it binds with high affinity through the gO subunit to PDGFRα, which is expressed on fibroblasts but not on epithelial cells. We also provide evidence that the trimer is essential for viral entry in both fibroblasts and epithelial cells. Furthermore, we identify the pentamer, which is essential for infection of epithelial cells, as a trigger for the ErbB pathway. These findings help explain the broad tropism of human cytomegalovirus and indicate that PDGFRα and the viral gO subunit could be targeted by novel anti-viral therapies.

  11. Platelet-derived growth factor-α receptor is the cellular receptor for human cytomegalovirus gHgLgO trimer.

    PubMed

    Kabanova, Anna; Marcandalli, Jessica; Zhou, Tongqing; Bianchi, Siro; Baxa, Ulrich; Tsybovsky, Yaroslav; Lilleri, Daniele; Silacci-Fregni, Chiara; Foglierini, Mathilde; Fernandez-Rodriguez, Blanca Maria; Druz, Aliaksandr; Zhang, Baoshan; Geiger, Roger; Pagani, Massimiliano; Sallusto, Federica; Kwong, Peter D; Corti, Davide; Lanzavecchia, Antonio; Perez, Laurent

    2016-01-01

    Human cytomegalovirus encodes at least 25 membrane glycoproteins that are found in the viral envelope(1). While gB represents the fusion protein, two glycoprotein complexes control the tropism of the virus: the gHgLgO trimer is involved in the infection of fibroblasts, and the gHgLpUL128L pentamer is required for infection of endothelial, epithelial and myeloid cells(2-5). Two reports suggested that gB binds to ErbB1 and PDGFRα (refs 6,7); however, these results do not explain the tropism of the virus and were recently challenged(8,9). Here, we provide a 19 Å reconstruction for the gHgLgO trimer and show that it binds with high affinity through the gO subunit to PDGFRα, which is expressed on fibroblasts but not on epithelial cells. We also provide evidence that the trimer is essential for viral entry in both fibroblasts and epithelial cells. Furthermore, we identify the pentamer, which is essential for infection of epithelial cells, as a trigger for the ErbB pathway. These findings help explain the broad tropism of human cytomegalovirus and indicate that PDGFRα and the viral gO subunit could be targeted by novel anti-viral therapies. PMID:27573107

  12. Primary structure and transcription of the genes coding for the two virion phosphoproteins pp65 and pp71 of human cytomegalovirus.

    PubMed Central

    Rüger, B; Klages, S; Walla, B; Albrecht, J; Fleckenstein, B; Tomlinson, P; Barrell, B

    1987-01-01

    Human cytomegalovirus contains a phosphorylated matrix protein of 65,000 apparent molecular weight (65K phosphoprotein; pp65) and a related phosphoprotein of 71,000 molecular weight (pp71). The 65K phosphoprotein is usually by far the most abundant structural component found in culture-grown purified virus particles. This study describes the precise mapping of the genes for both polypeptides, giving the entire nucleotide sequences and the exact positions of the respective transcripts. The 65K phosphoprotein is coded for by the 5'-terminal part of an abundant 4-kilobase (kb) mRNA. The 71K phosphoprotein corresponds to the single translational reading frame of a rare nonspliced 1.9-kb mRNA that is coterminal with the 4-kb transcript. The promoter for 4-kb mRNA appears to be unusual in structure; it does not contain a characteristic TATA sequence. The expression of antigenic epitopes from pp65 may allow improved serodiagnosis of human cytomegalovirus infections. Images PMID:3027374

  13. Synthesis and antiviral properties of (+/-)-5'-noraristeromycin and related purine carbocyclic nucleosides. A new lead for anti-human cytomegalovirus agent design.

    PubMed

    Patil, S D; Schneller, S W; Hosoya, M; Snoeck, R; Andrei, G; Balzarini, J; De Clercq, E

    1992-09-01

    (+/-)-5'-Noraristeromycin (3) has been prepared in three steps beginning with the 2,3-O-isopropylidene derivative of (+/-)-(1 alpha, 2 beta, 3 beta, 4 alpha)-4-amino-1,2,3-cyclopentanetriol (7). Also prepared from the same starting material were the related hypoxanthine (4), guanine (5), and 2,6-diaminopurine (6) analogues. Compounds 3-6 were evaluated for antiviral activity against a large number of viruses with marked activity being observed for 3 towards vaccinia virus, human cytomegalovirus, vesicular stomatitis virus, parainfluenza (type 3) virus, measles virus, respiratory syncytial virus, reovirus (type 1), and the arenaviruses Junin and Tacaribe. None of the compounds showed cytotoxicity to the host cell monolayers used in the antiviral studies. Both 3 and 6 have been found to be inhibitors of S-adenosyl-L-homocysteine hydrolase (AdoHcy hydrolase), which likely accounts for their antiviral activity. Inhibition of AdoHcy hydrolase represents a new approach to human cytomegalovirus drug design that should be pursued. Also, the activity of 3 should be further scrutinized for the treatment of pox-, rhabdo-, paramyxo-, reo-, and arenavirus infections. PMID:1326633

  14. The human cytomegalovirus UL133-138 gene locus attenuates the lytic viral cycle in fibroblasts.

    PubMed

    Dutta, Nirmal; Lashmit, Philip; Yuan, Jinxiang; Meier, Jeffery; Stinski, Mark F

    2015-01-01

    The genomes of HCMV clinical strains (e.g. FIX, TR, PH, etc) contain a 15 kb region that encodes 20 putative ORFs. The region, termed ULb', is lost after serial passage of virus in human foreskin fibroblast (HFF) cell culture. Compared to clinical strains, laboratory strains replicate faster and to higher titers of infectious virus. We made recombinant viruses with 22, 14, or 7 ORFs deleted from the ULb' region using FIX and TR as model clinical strains. We also introduced a stop codon into single ORFs between UL133 and UL138 to prevent protein expression. All deletions within ULb' and all stop codon mutants within the UL133 to UL138 region increased to varying degrees, viral major immediate early RNA and protein, DNA, and cell-free infectious virus compared to the wild type viruses. The wild type viral proteins slowed down the viral replication process along with cell-free infectious virus release from human fibroblast cells.

  15. Human Cytomegalovirus pTRS1 and pIRS1 Antagonize Protein Kinase R To Facilitate Virus Replication

    PubMed Central

    Ziehr, Benjamin; Vincent, Heather A.

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) counteracts host defenses that otherwise act to limit viral protein synthesis. One such defense is the antiviral kinase protein kinase R (PKR), which inactivates the eukaryotic initiation factor 2 (eIF2) translation initiation factor upon binding to viral double-stranded RNAs. Previously, the viral TRS1 and IRS1 proteins were found to antagonize the antiviral kinase PKR outside the context of HCMV infection, and the expression of either pTRS1 or pIRS1 was shown to be necessary for HCMV replication. In this study, we found that expression of either pTRS1 or pIRS1 is necessary to prevent PKR activation during HCMV infection and that antagonism of PKR is critical for efficient viral replication. Consistent with a previous study, we observed decreased overall levels of protein synthesis, reduced viral protein expression, and diminished virus replication in the absence of both pTRS1 and pIRS1. In addition, both PKR and eIF2α were phosphorylated during infection when pTRS1 and pIRS1 were absent. We also found that expression of pTRS1 was both necessary and sufficient to prevent stress granule formation in response to eIF2α phosphorylation. Depletion of PKR prevented eIF2α phosphorylation, rescued HCMV replication and protein synthesis, and reversed the accumulation of stress granules in infected cells. Infection with an HCMV mutant lacking the pTRS1 PKR binding domain resulted in PKR activation, suggesting that pTRS1 inhibits PKR through a direct interaction. Together our results show that antagonism of PKR by HCMV pTRS1 and pIRS1 is critical for viral protein expression and efficient HCMV replication. IMPORTANCE To successfully replicate, viruses must counteract host defenses that limit viral protein synthesis. We have identified inhibition of the antiviral kinase PKR by the viral proteins TRS1 and IRS1 and shown that this is a critical step in HCMV replication. Our results suggest that inhibiting pTRS1 and pIRS1 function or

  16. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients

  17. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.

    PubMed Central

    Lang, D; Gebert, S; Arlt, H; Stamminger, T

    1995-01-01

    The 86-kDa IE2 protein (IE86) of human cytomegalovirus (HCMV) has been described as a promiscuous transactivator of viral, as well as cellular, gene expression. Investigation of the mechanism used by IE86 to activate gene expression from the early UL112/113 promoter of HCMV revealed the existence of three binding sites for IE86 located between nucleotides -290 and -120 relative to the transcriptional start site (H. Arlt, D. Lang, S. Gebert, and T. Stamminger, J. Virol. 68:4117-4125, 1994). As shown previously, deletion of these target sites resulted in a reduction of IE86-mediated transactivation by approximately 70%. The remaining promoter, however, could still be stimulated about 40-fold, indicating the presence of an additional responsive element within these sequences. Here, we provide evidence that a binding site for the cellular transcription factor CREB can also act as a target for IE86 transactivation. By DNase I protection analysis, a binding sequence for CREB could be detected between nucleotides -78 and -56 within the respective promoter region. After in vitro mutagenesis of this CREB-binding site within the context of the entire UL112/113 promoter, a marked reduction in transactivation levels was evident. Moreover, when individual CREB-binding sites were positioned upstream of a minimal, TATA box-containing UL112/113 promoter, they were able to confer strong IE86 responsiveness, whereas a mutated sequence did not exert any effect. In far Western blot and pull-down experiments, a direct interaction of IE86 with the cellular transcription factor CREB could be observed. The in vivo relevance of this in vitro interaction was confirmed by using various GAL4 fusion proteins in the presence or absence of IE86 which revealed a strong activation only in the presence of both a GAL4-CREB fusion and IE86. This shows that at least one specific member of the ATF/CREB family of transcription factors is involved in mediating transactivation by the HCMV IE86 protein

  18. A “Coiled-Coil” Motif Is Important for Oligomerization and DNA Binding Properties of Human Cytomegalovirus Protein UL77

    PubMed Central

    Dittmer, Alexandra; Lapp, Sara; Bogner, Elke

    2011-01-01

    Human cytomegalovirus (HCMV) UL77 gene encodes the essential protein UL77, its function is characterized in the present study. Immunoprecipitation identified monomeric and oligomeric pUL77 in HCMV infected cells. Immunostaining of purified virions and subviral fractions showed that pUL77 is a structural protein associated with capsids. In silico analysis revealed the presence of a coiled-coil motif (CCM) at the N-terminus of pUL77. Chemical cross-linking of either wild-type pUL77 or CCM deletion mutant (pUL77ΔCCM) implicated that CCM is critical for oligomerization of pUL77. Furthermore, co-immunoprecipitations of infected and transfected cells demonstrated that pUL77 interacts with the capsid-associated DNA packaging motor components, pUL56 and pUL104, as well as the major capsid protein. The ability of pUL77 to bind dsDNA was shown by an in vitro assay. Binding to certain DNA was further confirmed by an assay using biotinylated 36-, 250-, 500-, 1000-meric dsDNA and 966-meric HCMV-specific dsDNA designed for this study. The binding efficiency (BE) was determined by image processing program defining values above 1.0 as positive. While the BE of the pUL56 binding to the 36-mer bio-pac1 containing a packaging signal was 10.0±0.63, the one for pUL77 was only 0.2±0.03. In contrast to this observation the BE of pUL77 binding to bio-500 bp or bio-1000 bp was 2.2±0.41 and 4.9±0.71, respectively. By using pUL77ΔCCM it was demonstrated that this protein could not bind to dsDNA. These data indicated that pUL77 (i) could form homodimers, (ii) CCM of pUL77 is crucial for oligomerization and (iii) could bind to dsDNA in a sequence independent manner. PMID:21998635

  19. Human Cytomegalovirus Resistance to Deoxyribosylindole Nucleosides Maps to a Transversion Mutation in the Terminase Subunit-Encoding Gene UL89

    PubMed Central

    Phan, Quang; Hall, Ellie D.; Breitenbach, Julie M.; Borysko, Katherine Z.; Kamil, Jeremy P.; Townsend, Leroy B.; Drach, John C.

    2014-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  20. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  1. Novel Method Based on Real-Time Cell Analysis for Drug Susceptibility Testing of Herpes Simplex Virus and Human Cytomegalovirus.

    PubMed

    Piret, Jocelyne; Goyette, Nathalie; Boivin, Guy

    2016-08-01

    The plaque reduction assay (PRA) is the gold standard phenotypic method to determine herpes simplex virus (HSV) and human cytomegalovirus (HCMV) susceptibilities to antiviral drugs. However, this assay is subjective and labor intensive. Here, we describe a novel antiviral phenotypic method based on real-time cell analysis (RTCA) that measures electronic impedance over time. The effective drug concentrations that reduced by 50% (EC50s) the cytopathic effects induced by HSV-1 and HCMV were evaluated by both methods. The EC50s of acyclovir and foscarnet against a reference wild-type (WT) HSV-1 strain in Vero cells were, respectively, 0.5 μM and 32.6 μM by PRA and 0.8 μM and 93.6 μM by RTCA. The EC50 ratios for acyclovir against several HSV-1 thymidine kinase (TK) mutants were 101.8×, 73.4×, 28.8×, and 35.4× (PRA) and 18.0×, 52.0×, 5.5×, and 87.8× (RTCA) compared to those for the WT. The EC50 ratios for acyclovir and foscarnet against the HSV-1 TK/DNA polymerase mutant were 182.8× and 9.7× (PRA) and >125.0× and 10.8× (RTCA) compared to the WT. The EC50s of ganciclovir and foscarnet against WT HCMV strain AD169 in fibroblasts were, respectively, 1.6 μM and 27.8 μM by PRA and 5.0 μM and 111.4 μM by RTCA. The EC50 ratios of ganciclovir against the HCMV UL97 mutant were 3.8× (PRA) and 8.2× (RTCA) compared to those for the WT. The EC50 ratios of ganciclovir and foscarnet against the HCMV UL97/DNA polymerase mutant were 17.1× and 12.1× (PRA) and 14.7× and 4.6× (RTCA) compared to those for the WT. RTCA allows objective drug susceptibility testing of HSV and HCMV and could permit high-throughput screening of new antivirals. PMID:27252463

  2. Human cytomegalovirus resistance to deoxyribosylindole nucleosides maps to a transversion mutation in the terminase subunit-encoding gene UL89.

    PubMed

    Gentry, Brian G; Phan, Quang; Hall, Ellie D; Breitenbach, Julie M; Borysko, Katherine Z; Kamil, Jeremy P; Townsend, Leroy B; Drach, John C

    2015-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  3. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions

    PubMed Central

    Vanarsdall, Adam L.; Howard, Paul W.; Wisner, Todd W.; Johnson, David C.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16–50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB. PMID:27082872

  4. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  5. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron

    2016-01-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  6. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.

    PubMed

    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M

    2016-07-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  7. The Human Cytomegalovirus UL133-138 Gene Locus Attenuates the Lytic Viral Cycle in Fibroblasts

    PubMed Central

    Dutta, Nirmal; Lashmit, Philip; Yuan, Jinxiang; Meier, Jeffery; Stinski, Mark F.

    2015-01-01

    The genomes of HCMV clinical strains (e.g. FIX, TR, PH, etc) contain a 15 kb region that encodes 20 putative ORFs. The region, termed ULb’, is lost after serial passage of virus in human foreskin fibroblast (HFF) cell culture. Compared to clinical strains, laboratory strains replicate faster and to higher titers of infectious virus. We made recombinant viruses with 22, 14, or 7 ORFs deleted from the ULb’ region using FIX and TR as model clinical strains. We also introduced a stop codon into single ORFs between UL133 and UL138 to prevent protein expression. All deletions within ULb’ and all stop codon mutants within the UL133 to UL138 region increased to varying degrees, viral major immediate early RNA and protein, DNA, and cell-free infectious virus compared to the wild type viruses. The wild type viral proteins slowed down the viral replication process along with cell-free infectious virus release from human fibroblast cells. PMID:25799165

  8. Aging and cytomegalovirus infection differentially and jointly affect distinct circulating T cell subsets in humans.

    PubMed

    Wertheimer, Anne M; Bennett, Michael S; Park, Byung; Uhrlaub, Jennifer L; Martinez, Carmine; Pulko, Vesna; Currier, Noreen L; Nikolich-Žugich, Dragana; Kaye, Jeffrey; Nikolich-Žugich, Janko

    2014-03-01

    The impact of intrinsic aging upon human peripheral blood T cell subsets remains incompletely quantified and understood. This impact must be distinguished from the influence of latent persistent microorganisms, particularly CMV, which has been associated with age-related changes in the T cell pool. In a cross-sectional cohort of 152 CMV-negative individuals, aged 21-101 y, we found that aging correlated strictly to an absolute loss of naive CD8, but not CD4, T cells but, contrary to many reports, did not lead to an increase in memory T cell numbers. The loss of naive CD8 T cells was not altered by CMV in 239 subjects (range 21-96 y), but the decline in CD4(+) naive cells showed significance in CMV(+) individuals. These individuals also exhibited an absolute increase in the effector/effector memory CD4(+) and CD8(+) cells with age. That increase was seen mainly, if not exclusively, in older subjects with elevated anti-CMV Ab titers, suggesting that efficacy of viral control over time may determine the magnitude of CMV impact upon T cell memory, and perhaps upon immune defense. These findings provide important new insights into the age-related changes in the peripheral blood pool of older adults, demonstrating that aging and CMV exert both distinct and joint influence upon blood T cell homeostasis in humans. PMID:24501199

  9. New efficient artemisinin derived agents against human leukemia cells, human cytomegalovirus and Plasmodium falciparum: 2nd generation 1,2,4-trioxane-ferrocene hybrids.

    PubMed

    Reiter, Christoph; Fröhlich, Tony; Zeino, Maen; Marschall, Manfred; Bahsi, Hanife; Leidenberger, Maria; Friedrich, Oliver; Kappes, Barbara; Hampel, Frank; Efferth, Thomas; Tsogoeva, Svetlana B

    2015-06-01

    In our ongoing search for highly active hybrid molecules exceeding their parent compounds in anticancer, antimalaria as well as antiviral activity and being an alternative to the standard drugs, we present the synthesis and biological investigations of 2nd generation 1,2,4-trioxane-ferrocene hybrids. In vitro tests against the CCRF-CEM leukemia cell line revealed di-1,2,4-trioxane-ferrocene hybrid 7 as the most active compound (IC50 of 0.01 μM). Regarding the activity against the multidrug resistant subline CEM/ADR5000, 1,2,4-trioxane-ferrocene hybrid 5 showed a remarkable activity (IC50 of 0.53 μM). Contrary to the antimalaria activity of hybrids 4-8 against Plasmodium falciparum 3D7 strain with slightly higher IC50 values (between 7.2 and 30.2 nM) than that of their parent compound DHA, hybrids 5-7 possessed very promising activity (IC50 values lower than 0.5 μM) against human cytomegalovirus (HCMV). The application of 1,2,4-trioxane-ferrocene hybrids against HCMV is unprecedented and demonstrated here for the first time.

  10. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2010-01-01 2010-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section 300.60 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT OF...

  11. Accessory human cytomegalovirus glycoprotein US9 in the unique short component of the viral genome promotes cell-to-cell transmission of virus in polarized epithelial cells.

    PubMed Central

    Maidji, E; Tugizov, S; Jones, T; Zheng, Z; Pereira, L

    1996-01-01

    Human cytomegalovirus (CMV) encodes accessory glycoproteins that are dispensable for virus growth in nonpolarized cells in culture. We report that CMV deletion mutants lacking the gene for accessory glycoprotein US9 in the unique short component of the viral genome are impaired in plaque formation in polarized human retinal pigment epithelial (ARPE-19) cells. Comparison of CMV deletion mutants in US9 with herpes simplex virus type 1 deletion mutants lacking glycoproteins gE and gI showed that both of these mutants are impaired in altering junctional complexes and increasing paracellular permeability in polarized ARPE-19 cells cultured on permeable filter supports. Results of functional studies indicate that CMV US9 and homologs of gE have analogous roles in promoting virus spread across lateral membranes of polarized epithelial cells. PMID:8970961

  12. Analysis of memory-like natural killer cells in human cytomegalovirus-infected children undergoing αβ+T and B cell-depleted hematopoietic stem cell transplantation for hematological malignancies.

    PubMed

    Muccio, Letizia; Bertaina, Alice; Falco, Michela; Pende, Daniela; Meazza, Raffaella; Lopez-Botet, Miguel; Moretta, Lorenzo; Locatelli, Franco; Moretta, Alessandro; Della Chiesa, Mariella

    2016-03-01

    We analyzed the impact of human cytomegalovirus infection on the development of natural killer cells in 27 pediatric patients affected by hematological malignancies, who had received a HLA-haploidentical hematopoietic stem cell transplantation, depleted of both α/β+ T cells and B cells. In line with previous studies in adult recipients of umbilical cord blood transplantation, we found that human cytomegalovirus reactivation accelerated the emergence of mature natural killer cells. Thus, most children displayed a progressive expansion of a memory-like natural killer cell subset expressing NKG2C, a putative receptor for human cytomegalovirus, and CD57, a marker of terminal natural killer cell differentiation. NKG2C(+)CD57(+) natural killer cells were detectable by month 3 following hematopoietic stem cell transplantation and expanded until at least month 12. These cells were characterized by high killer Ig-like receptors (KIRs) and leukocyte inhibitory receptor 1 (LIR-1) and low Siglec-7, NKG2A and Interleukin-18Rα expression, killed tumor targets and responded to cells expressing HLA-E (a NKG2C ligand). In addition, they were poor Interferon-γ producers in response to Interleukin-12 and Interleukin-18. The impaired response to these cytokines, together with their highly differentiated profile, may reflect their skewing toward an adaptive condition specialized in controlling human cytomegalovirus. In conclusion, in pediatric patients receiving a type of allograft different from umbilical cord blood transplantation, human cytomegalovirus also induced memory-like natural killer cells, possibly contributing to controlling infections and reinforcing anti-leukemia effects.

  13. Antibody-driven design of a human cytomegalovirus gHgLpUL128L subunit vaccine that selectively elicits potent neutralizing antibodies.

    PubMed

    Kabanova, Anna; Perez, Laurent; Lilleri, Daniele; Marcandalli, Jessica; Agatic, Gloria; Becattini, Simone; Preite, Silvia; Fuschillo, Dario; Percivalle, Elena; Sallusto, Federica; Gerna, Giuseppe; Corti, Davide; Lanzavecchia, Antonio

    2014-12-16

    The use of neutralizing antibodies to identify the most effective antigen has been proposed as a strategy to design vaccines capable of eliciting protective B-cell immunity. In this study, we analyzed the human antibody response to cytomegalovirus (human cytomegalovirus, HCMV) infection and found that antibodies to glycoprotein (g)B, a surface glycoprotein that has been developed as a HCMV vaccine, were primarily nonneutralizing. In contrast, most of the antibodies to the complex formed by gH, gL, protein (p)UL128, pUL130, and pUL131 (the gHgLpUL128L pentamer) neutralized HCMV infection with high potency. Based on this analysis, we developed a single polycistronic vector encoding the five pentamer genes separated by "self-cleaving" 2A peptides to generate a stably transfected CHO cell line constitutively secreting high levels of recombinant pentamer that displayed the functional antigenic sites targeted by human neutralizing antibodies. Immunization of mice with the pentamer formulated with different adjuvants elicited HCMV neutralizing antibody titers that persisted to high levels over time and that were a hundred- to thousand-fold higher than those found in individuals that recovered from primary HCMV infection. Sera from mice immunized with the pentamer vaccine neutralized infection of both epithelial cells and fibroblasts and prevented cell-to-cell spread and viral dissemination from endothelial cells to leukocytes. Neutralizing monoclonal antibodies from immunized mice showed the same potency as human antibodies and targeted the same as well as additional sites on the pentamer. These results illustrate with a relevant example a general and practical approach of analytic vaccinology for the development of subunit vaccines against complex pathogens.

  14. Multiple early transcripts and splicing of the Autographa californica nuclear polyhedrosis virus IE-1 gene.

    PubMed Central

    Chisholm, G E; Henner, D J

    1988-01-01

    The immediate-early IE-1 gene of Autographa californica nuclear polyhedrosis virus was cloned, and its nucleotide sequence was determined. Sequence analysis indicated that this gene would encode a protein of 582 amino acids with a predicted molecular weight of 66,822. Analysis of IE-1 gene expression during baculovirus infection identified two transcripts. One, 1.9 kilobases (kb), was expressed at constant steady-state levels throughout infection, whereas the other, 2.1 kb, was expressed only early in infection. Analysis of IE-1 cDNA clones demonstrated that the 2.1-kb transcript contained the entire 1.9-kb transcript (exon 1) plus an additional 5' end (exon 0). Genomic Southern analysis placed the exon 0 sequences on the EcoRI B fragment, 4 kilobase pairs upstream of exon 1. Sequencing of the upstream region identified an open reading frame whose 5' end was identical to the exon 0 sequences in the cDNAs. Examination of the genomic DNA sequences around the exon-exon junction revealed sequences similar to published consensus splice acceptor and donor sequences. This is the first example of splicing of any viral transcript during baculovirus infection. Images PMID:3043024

  15. Sensitive non-isotopic DNA hybridisation assay or immediate-early antigen detection for rapid identification of human cytomegalovirus in urine.

    PubMed

    Kimpton, C P; Morris, D J; Corbitt, G

    1991-04-01

    A sensitive non-radioactive DNA hybridisation assay employing digoxigenin-labelled probes was compared with immediate-early antigen detection and conventional virus isolation for the identification of human cytomegalovirus (HCMV) in 249 urine samples. Of 44 specimens yielding HCMV by virus isolation, more were positive by DNA hybridisation (32; 73%) than by immediate-early antigen detection (25; 52%) (P = 0.05). The specificity of the hybridisation assay in 45 apparently falsely positive specimens was supported by detection of HCMV DNA in 40 of these specimens using the polymerase chain reaction. Many urine specimens may thus contain large amounts of non-viable virus or free viral DNA. Evaluation of various protocols for the extraction and denaturation of virus DNA prior to hybridisation showed that proteinase K digestion with phenol/chloroform extraction was the most sensitive and reliable procedure. We conclude that the non-radioactive DNA hybridisation assay described is a potentially valuable routine diagnostic test.

  16. IgG subclass antibodies to human cytomegalovirus (CMV) in normal human plasma samples and immune globulins and their neutralizing activities.

    PubMed

    Gupta, C K; Leszczynski, J; Gupta, R K; Siber, G R

    1996-06-01

    An enzyme-linked immunoabsorbent assay (ELISA) was developed for quantitation of IgG subclass antibodies to human cytomegalovirus (CMV) in human serum or plasma samples and in immune globulin (IG) preparations. The assay was based on the parallel titration of known concentrations of purified IgG subclass myeloma proteins and a specific CMV antiserum. The purified IgG subclass myeloma proteins were captured on an ELISA plate pre-coated with anti-human kappa, anti-human lambda or a mixture of anti-human kappa and lambda antibodies and the specific antiserum was titrated against CMV antigen coated on the plate. IgG subclass antibodies, captured or bound to antigen, were quantitated with IGG subclass heavy chain specific monoclonal antibodies. The method was highly reproducible, specific and sensitive. Using this method, 257 human plasma samples and 50 IG preparations were assayed for CMV specific IgG subclass and IgM antibodies. The major IgG subclass antibody to CMV was IgG1 which represented more than 96% of CMV IgG antibodies, followed by IgG3 (mean CMV IgG3 antibody content was 3% of IgG antibodies in IG preparations and 1.8% in plasma samples). A majority of the samples had low levels of IgG2 antibodies and a few samples exhibited low levels of IgG4 antibodies. IG preparations showed very low levels of CMV IgM antibodies whereas plasma samples had 14.2% of CMV antibodies (IgG and IgM) as IgM antibodies. Virus neutralizing (Nt) activity of these samples showed a significant correlation with CMV IgG1 antibodies. Nine samples of plasma and IGs were further evaluated for Nt activity of IgG1 and IgG3 antibodies by separating IgG3 from the rest of the antibodies with protein A agarose. IgG3 antibodies showed much higher Nt activity than IgG1 antibodies suggesting that enrichment of IgG3 antibodies in IG preparations may be useful in preparing CMV specific IG.

  17. Detection of human cytomegalovirus and Epstein-Barr Virus in symptomatic and asymptomatic apical periodontitis lesions by real-time PCR

    PubMed Central

    Ozbek, Selcuk M.; Yavuz, Muhammed S.

    2013-01-01

    Objectives: Recent studies have investigated the occurrence of human cytomegalovirus and Epstein-Barr Virus in samples from apical periodontitis lesions and a role in the pathogenesis of this disease has been suggested. Because genotype distribution and seroprevalence of EBV and HCMV differ among populations, it is important to determine the presence of these viruses in endodontic periapical lesions of different populations. The aims of this study were to determine the presence of HCMV and EBV DNAs in samples from Turkish patients with symptomatic and asymptomatic apical periodontitis lesions using real-time polymerase chain reaction method and to evaluate their presence in both symptomatic and asymptomatic apical periodontitis lesions. Study Design: Periapical samples were collected from 12 asymptomatic and 16 symptomatic periapical lesions in conjunction with apicectomy. HCMV and EBV DNAs were identified in the samples by real-time PCR. The chi-squared test with Yates’s correction or the Fisher’s exact test was used to analyse the significance of differences. Results: HCMV DNA was detected in 10 of the 16 (62.5%) symptomatic and in five of the 12 (41.7 %) asymptomatic periapical study lesions. The EBV DNA was identified in seven of the 16 (43.7 %) symptomatic and three of the 12 (25 %) asymptomatic periapical lesions. The difference in occurrence of HCMV and EBV DNA between symptomatic and asymptomatic periapical lesions was not statistically significant. (All comparisons have p > 0.05). Conclusions: Our findings suggest that HCMV and EBV is a frequent inhabitant of both symptomatic and asymptomatic apical periodontitis lesions of endodontic origin in Turkish population. Key words:Human cytomegalovirus, Epstein-Barr Virus, apical periodontitis, Polymerase chain reaction method. PMID:23722135

  18. Residues of human cytomegalovirus DNA polymerase catalytic subunit UL54 that are necessary and sufficient for interaction with the accessory protein UL44.

    PubMed

    Loregian, Arianna; Appleton, Brent A; Hogle, James M; Coen, Donald M

    2004-01-01

    The human cytomegalovirus DNA polymerase contains a catalytic subunit, UL54, and an accessory protein, UL44. Recent studies suggested that UL54 might interact via its extreme C terminus with UL44 (A. Loregian, R. Rigatti, M. Murphy, E. Schievano, G. Palu', and H. S. Marsden, J. Virol. 77:8336-8344, 2003). To address this hypothesis, we quantitatively measured the binding of peptides corresponding to the extreme C terminus of UL54 to UL44 by using isothermal titration calorimetry. A peptide corresponding to the last 22 residues of UL54 was sufficient to bind specifically to UL44 in a 1:1 complex with a dissociation constant of ca. 0.7 microM. To define individual residues in this segment that are crucial for interacting with UL44, we engineered a series of mutations in the C-terminal region of UL54. The UL54 mutants were tested for their ability to interact with UL44 by glutathione S-transferase pulldown assays, for basal DNA polymerase activity, and for long-chain DNA synthesis in the presence of UL44. We observed that deletion of the C-terminal segment or substitution of alanine for Leu1227 or Phe1231 in UL54 greatly impaired both the UL54-UL44 interaction in pulldown assays and long-chain DNA synthesis without affecting basal polymerase activity, identifying these residues as important for subunit interaction. Thus, like the herpes simplex virus UL30-UL42 interaction, a few specific side chains in the C terminus of UL54 are crucial for UL54-UL44 interaction. However, the UL54 residues important for interaction with UL44 are hydrophobic and not basic. This information might aid in the rational design of new drugs for the treatment of human cytomegalovirus infection.

  19. [Mononucleosis caused by cytomegalovirus].

    PubMed

    Lajo Plaza, A; del Castillo Martín, F; Martínez Zapico, R

    1990-01-01

    Sixteen cases of mononucleosis due to cytomegalovirus, are presented. The selection of patients was based on clinical criteria. Symptoms are compared with another series of patients affected with mononucleosis by Epstein-Barr virus. We have not found differences comparing the fever, cervical adenopathies and faringoamigdalitis. Differences were significant in hepatomegaly. We conclude that the clinical picture of cytomegalovirus mononucleosis is very similar to those of the Epstein-Barr mononucleosis.

  20. Cell-cycle-dependent localization of human cytomegalovirus UL83 phosphoprotein in the nucleolus and modulation of viral gene expression in human embryo fibroblasts in vitro.

    PubMed

    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Covan, Silvia; Germini, Diego; Razin, Sergey; Dettori, Giuseppe; Chezzi, Carlo

    2011-01-01

    The nucleolus is a multifunctional nuclear compartment widely known to be involved in several cellular processes, including mRNA maturation and shuttling to cytoplasmic sites, control of the cell cycle, cell proliferation, and apoptosis; thus, it is logical that many viruses, including herpesvirus, target the nucleolus in order to exploit at least one of the above-mentioned functions. Recent studies from our group demonstrated the early accumulation of the incoming ppUL83 (pp65), the major tegument protein of human cytomegalovirus (HCMV), in the nucleolus. The obtained results also suggested that a functional relationship might exist between the nucleolar localization of pp65, rRNA synthesis, and the development of the lytic program of viral gene expression. Here we present new data which support the hypothesis of a potentially relevant role of HCMV pp65 and its nucleolar localization for the control of the cell cycle by HCMV (arrest of cell proliferation in G1-G1/S), and for the promotion of viral infection. We demonstrated that, although the incoming pp65 amount in the infected cells appears to be constant irrespective of the cell-cycle phase, its nucleolar accumulation is prominent in G1 and G1/S, but very poor in S or G2/M. This correlates with the observation that only cells in G1 and G1/S support an efficient development of the HCMV lytic cycle. We propose that HCMV pp65 might be involved in regulatory/signaling pathways related to nucleolar functions, such as the cell-cycle control. Co-immunoprecipitation experiments have permitted to identify nucleolin as one of the nucleolar partners of pp65. PMID:21053310

  1. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  2. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally.

    PubMed

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota

    2015-10-01

    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth.

  3. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally.

    PubMed

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota

    2015-10-01

    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth. PMID:25926093

  4. Expression of the Human Cytomegalovirus UL11 Glycoprotein in Viral Infection and Evaluation of Its Effect on Virus-Specific CD8 T Cells

    PubMed Central

    Gabaev, Ildar; Elbasani, Endrit; Ameres, Stefanie; Steinbrück, Lars; Stanton, Richard; Döring, Marius; Lenac Rovis, Tihana; Kalinke, Ulrich; Jonjic, Stipan; Moosmann, Andreas

    2014-01-01

    ABSTRACT The human cytomegalovirus (CMV) UL11 open reading frame (ORF) encodes a putative type I transmembrane glycoprotein which displays remarkable amino acid sequence variability among different CMV isolates, suggesting that it represents an important virulence factor. In a previous study, we have shown that UL11 can interact with the cellular receptor tyrosine phosphatase CD45, which has a central role for signal transduction in T cells, and treatment of T cells with large amounts of a soluble UL11 protein inhibited their proliferation. In order to analyze UL11 expression in CMV-infected cells, we constructed CMV recombinants whose genomes either encode tagged UL11 versions or carry a stop mutation in the UL11 ORF. Moreover, we examined whether UL11 affects the function of virus-specific cytotoxic T lymphocytes (CTLs). We found that the UL11 ORF gives rise to several proteins due to both posttranslational modification and alternative translation initiation sites. Biotin labeling of surface proteins on infected cells indicated that only highly glycosylated UL11 forms are present at the plasma membrane, whereas less glycosylated UL11 forms were found in the endoplasmic reticulum. We did not find evidence of UL11 cleavage or secretion of a soluble UL11 version. Cocultivation of CTLs recognizing different CMV epitopes with fibroblasts infected with a UL11 deletion mutant or the parental strain revealed that under the conditions applied UL11 did not influence the activation of CMV-specific CD8 T cells. For further studies, we propose to investigate the interaction of UL11 with CD45 and the functional consequences in other immune cells expressing CD45. IMPORTANCE Human cytomegalovirus (CMV) belongs to those viruses that extensively interfere with the host immune response, yet the precise function of many putative immunomodulatory CMV proteins remains elusive. Previously, we have shown that the CMV UL11 protein interacts with the leukocyte common antigen CD45, a

  5. ChREBP, a glucose-responsive transcriptional factor, enhances glucose metabolism to support biosynthesis in human cytomegalovirus-infected cells.

    PubMed

    Yu, Yongjun; Maguire, Tobi G; Alwine, James C

    2014-02-01

    Carbohydrate-response element binding protein (ChREBP) plays a key role in regulating glucose metabolism and de novo lipogenesis in metabolic tissues and cancer cells. Here we report that ChREBP is also a critical regulator of the metabolic alterations induced during human cytomegalovirus (HCMV) infection. The expression of both ChREBP-α and ChREBP-β is robustly induced in HCMV-infected human fibroblasts; this induction is required for efficient HCMV infection. Depletion of ChREBP in HCMV-infected cells results in reduction of HCMV-induced glucose transporter 4 and glucose transporter 2 expression, leading to inhibition of glucose uptake, lactate production, nucleotide biosynthesis, and NADPH generation. We previously reported that HCMV infection induces lipogenesis through the activation of sterol regulatory element binding protein 1, which is mediated by the induction of PKR-like endoplasmic reticulum kinase. Data from the present study show that HCMV-induced lipogenesis is also controlled by the induction of ChREBP, in a second mechanism involved in the regulation of HCMV-induced de novo lipogenesis. These results suggest that ChREBP plays a key role in reprogramming glucose and lipid metabolism in HCMV infection.

  6. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  7. Binding of cellular repressor protein or the IE2 protein to a cis-acting negative regulatory element upstream of a human cytomegalovirus early promoter.

    PubMed Central

    Huang, L; Stinski, M F

    1995-01-01

    We have previously shown that the human cytomegalovirus early UL4 promoter has upstream negative and positive cis-acting regulatory elements. In the absence of the upstream negative regulatory region, the positive element confers strong transcriptional activity. The positive element contains a CCAAT box dyad symmetry and binds the cellular transcription factor NF-Y. The effect of the negative regulatory element is negated by the viral IE2 protein (L. Huang, C.L. Malone, and M.F. Stinski, J. Virol. 68:2108, 1994). We investigated the binding of cellular or viral IE2 protein to the negative regulatory region. The major cis-acting negative regulatory element was located between -168 and -134 bp relative to the transcription start site. This element could be transferred to a heterologous promoter, and it functioned in either orientation. Mutational analysis demonstrated that a core DNA sequence in the cis-acting negative regulatory element, 5'-GTTTGGAATCGTT-3', was required for the binding of either a cellular repressor protein(s) or the viral IE2 protein. The cellular DNA binding activity was present in both nonpermissive HeLa and permissive human fibroblast cells but more abundant in HeLa cells. Binding of the cellular repressor protein to the upstream cis-acting negative regulatory element correlates with repression of transcription from the early UL4 promoter. Binding of the viral IE2 protein correlates with negation of the repressive effect. PMID:7494269

  8. Hearing Loss and Cytomegalovirus.

    ERIC Educational Resources Information Center

    Strauss, Melvin

    1997-01-01

    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  9. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.

    2016-01-01

    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  10. Human cytomegalovirus-induced NKG2C(hi) CD57(hi) natural killer cells are effectors dependent on humoral antiviral immunity.

    PubMed

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold; Mertens, Thomas

    2013-07-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2C(hi) CD57(hi) NK cells gated on CD3(neg) CD56(dim) cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2C(hi) CD57(hi) NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2C(hi) CD57(hi) NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2C(hi) CD57(hi) NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy.

  11. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  12. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts.

    PubMed

    Williamson, Chad D; Wong, Daniel S; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M

    2015-09-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondrial network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients.

  13. Herpes simplex virus and cytomegalovirus co-infection presenting as exuberant genital ulcer in a woman infected with human immunodeficiency virus.

    PubMed

    Gouveia, A I; Borges-Costa, J; Soares-Almeida, L; Sacramento-Marques, M; Kutzner, H

    2014-12-01

    In patients infected with human immunodeficiency virus (HIV), genital herpes can result in severe and atypical clinical presentations, and can become resistant to aciclovir treatment. Rarely, these manifestations may represent concurrent herpes simplex virus (HSV) with other agents. We report a 41-year-old black woman with HIV who presented with extensive and painful ulceration of the genitalia. Histological examination of a biopsy sample was suggestive of herpetic infection, and intravenous aciclovir was started, but produced only partial improvement. PCR was performed on the biopsy sample, and both HSV and cytomegalovirus (CMV) DNA was detected. Oral valganciclovir was started with therapeutic success. CMV infection is common in patients infected with HIV, but its presence in mucocutaneous lesions is rarely reported. This case exemplifies the difficulties of diagnosis of genital ulcers in patients infected with HIV. The presence of exuberant and persistent HSV genital ulcers in patients with HIV should also raise suspicions of the presence of co-infection with other organisms such as CMV.

  14. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.

    PubMed

    Wu, Shu-En; Miller, William E

    2015-09-01

    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage. PMID:25965798

  15. Titration of human cytomegalovirus (HCMV) DNA in urine by combined use of PCR and microplate hybridization in a renal transplant patient with HCMV pneumonitis.

    PubMed

    Meigata, K; Hondo, R; Fujima, A; Shinkai-Shibata, M; Itoh, S; Kikuchi, K; Ando, Y; Ichikawa, N; Nomura, Y; Watanabe, K; Degawa, H; Beck, Y; Tomikawa, S; Nagao, T; Uchida, H

    1996-06-01

    We titrated human cytomegalovirus (HCMV) DNA in urine specimens obtained from 14 healthy individuals and a renal transplant patient with HCMV pneumonitis by modifying the method for titration of varicella-zoster virus DNA previously described (1,2). Of 14 HCMV seropositive healthy individuals, 13 had HCMV DNA under the detection limit of 10(2.0) copies/ml, whereas one person had 10(2.0) copies/ml. The viral DNA in urine samples was at a low level in healthy individuals with latent infection. In a case with HCMV pneumonitis after renal transplantation, the amount of HCMV DNA in urine gradually increased from the level under 10(2.0) copies/ml and reached a peak of 10(4.7) copies/ml one month prior to the manifestation of pneumonitis. It, thereafter, decreased with the course of clinical remission, and finally settled at under 10(2.0) copies/ml. Serial titrations of HCMV DNA in urine specimens proved to be useful in identifying recipients at risk of developing active HCMV infection after renal transplantation and as a guide for treatment of patients.

  16. Binding parameters and thermodynamics of the interaction of the human cytomegalovirus DNA polymerase accessory protein, UL44, with DNA: implications for the processivity mechanism.

    PubMed

    Loregian, Arianna; Sinigalia, Elisa; Mercorelli, Beatrice; Palù, Giorgio; Coen, Donald M

    2007-01-01

    The mechanisms of processivity factors of herpesvirus DNA polymerases remain poorly understood. The proposed processivity factor for human cytomegalovirus DNA polymerase is a DNA-binding protein, UL44. Previous findings, including the crystal structure of UL44, have led to the hypothesis that UL44 binds DNA as a dimer via lysine residues. To understand how UL44 interacts with DNA, we used filter-binding and electrophoretic mobility shift assays and isothermal titration calorimetry (ITC) analysis of binding to oligonucleotides. UL44 bound directly to double-stranded DNA as short as 12 bp, with apparent dissociation constants in the nanomolar range for DNAs >18 bp, suggesting a minimum DNA length for UL44 interaction. UL44 also bound single-stranded DNA, albeit with lower affinity, and for either single- or double-stranded DNA, there was no apparent sequence specificity. ITC analysis revealed that UL44 binds to duplex DNA as a dimer. Binding was endothermic, indicating an entropically driven process, likely due to release of bound ions. Consistent with this hypothesis, analysis of the relationship between binding and ionic strength indicated that, on average, 4 +/- 1 monovalent ions are released in the interaction of each monomer of UL44 with DNA. The results taken together reveal interesting implications for how UL44 may mediate processivity.

  17. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts

    PubMed Central

    Williamson, Chad D.; Wong, Daniel S.; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M.

    2015-01-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondria network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients. PMID:26331984

  18. Rapid and combined detection of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus using AllGlo quadruplex quantitative PCR.

    PubMed

    Chen, Yi; He, Hui; Pan, Ping; He, Songzhe; Dong, Xueyan; Chen, Yueming; Wang, Shuying; Yu, Daojun

    2016-07-01

    Acute respiratory infections (ARIs) cause substantial morbidity and mortality worldwide. The causes of ARI are dynamic, and co-infections of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus are recently developed causes of ARI. Here, we established a quadruplex quantitative PCR (qPCR) method to rapidly identify and simultaneously detect a single infection or co-infection of these three pathogens and an internal control in a single tube using AllGlo probes. The analysis demonstrated a wide linear range of detection from 101 to 108 copies per test and a low coefficient of variation of less than 5 %. The amplification efficiencies were all close to 1, and the correlation coefficients (r2) were all greater than 0.99. We found no significant difference in a comparative reagent test (P >0.05). Moreover, the results of tests on clinical samples using AllGlo quadruplex qPCR and TaqMan uniplex qPCR were in near-perfect agreement (κ =0.97). Clinically, the availability of this method will enable better differential diagnosis, disease surveillance and controlled outcomes. PMID:27093597

  19. Enhanced Expression of Full-Length Human Cytomegalovirus Fusion Protein in Non-Swelling Baculovirus-Infected Cells with a Minimal Fed-Batch Strategy

    PubMed Central

    Patrone, Marco; Carinhas, Nuno; Sousa, Marcos Q.; Peixoto, Cristina; Ciferri, Claudio; Carfì, Andrea; Alves, Paula M.

    2014-01-01

    Human cytomegalovirus congenital infection represents an unmet medical issue and attempts are ongoing to develop an effective vaccine. The virion fusion players of this enveloped virus are the natural targets to achieve this goal and to develop novel anti-viral therapies. The secreted ectodomain of the viral fusion factor glycoprotein B (gB) has been exploited so far as an alternative to the cumbersome expression of the wild type trans-membrane protein. In the soluble form, gB showed encouraging but limited potential as antigen candidate calling for further efforts. Here, the exhaustive evaluation of the Baculovirus/insect cell expression system has been coupled to an orthogonal screening for expression additives to produce full-length gB. In detail, rapamycin was found to prolong gB intracellular accumulation while inhibiting the infection-induced cell swelling. Not obvious to predict, this inhibition did not affect Baculovirus growth, revealing that the virus-induced cell size increase is a dispensable side phenotype. In parallel, a feeding strategy for the limiting nutrient cysteine has been set up which improved gB stability. This multi-modal scheme allowed the production of full-length, mutation-free gB in the milligram scale. The recombinant full-length gB obtained was embedded into a stable mono-dispersed particle substantially larger than the protein trimer itself, according to the reported association of this protein with detergent-resistant lipid domains. PMID:24595278

  20. Rapid Genetic Engineering of Human Cytomegalovirus by Using a Lambda Phage Linear Recombination System: Demonstration that pp28 (UL99) Is Essential for Production of Infectious Virus

    PubMed Central

    Britt, William J.; Jarvis, Michael; Seo, Jun-Young; Drummond, Derek; Nelson, Jay

    2004-01-01

    A highly efficient lambda phage recombination system previously utilized for studies of bacterial artificial chromosome (BAC)-maintained mouse chromosomal DNA was adapted for the study of the role of human cytomegalovirus (HCMV)-encoded pp28 (UL99) in virus replication. Incorporating a two-step mutagenesis strategy with blue/white selection in Escherichia coli containing a HCMV AD169 BAC, we have shown that we can rapidly introduce point mutations into the HCMV BAC using linear PCR fragments. All manipulations were carried out in bacteria, which greatly accelerated the introduction and analysis of mutations in the viral genome. Our results indicated that HCMV pp28 was essential for the production of infectious virus and that introduction of a single base change that resulted in loss of the myristylation site on pp28 was also associated with the lack of production of infectious virus. Although the block in the viral morphogenesis cannot be determined from these studies, the latter finding suggested that authentic intracellular localization of pp28, not only the expression of the protein, is required for virus assembly. PMID:14671136

  1. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  2. Human cytomegalovirus microRNA miR-US25-1-5p inhibits viral replication by targeting multiple cellular genes during infection.

    PubMed

    Jiang, Shujuan; Qi, Ying; He, Rong; Huang, Yujing; Liu, Zhongyang; Ma, Yanping; Guo, Xin; Shao, Yaozhong; Sun, Zhengrong; Ruan, Qiang

    2015-10-01

    MicroRNAs (miRNAs) play important roles in regulating various cellular processes in plants, animals, and viruses. This mechanism is also utilized by human cytomegalovirus (HCMV) in the process of infection and pathogenesis. The HCMV-encoded miRNA, hcmv-miR-US25-1-5p, was highly expressed during lytic and latent infections, and was found to inhibit viral replication. Identification of functional target genes of this microRNA is important in that it will enable a better understanding of the function of hcmv-miR-US25-1-5p during HCMV infection. In the present study, 35 putative cellular transcript targets of hcmv-miR-US25-1-5p were identified. Down-regulation of the targets YWHAE, UBB, NPM1, and HSP90AA1 by hcmv-miR-US25-1-5p was validated by luciferase reporter assay and Western blot analysis. In addition, we showed that hcmv-miR-US25-1-5p could inhibit viral replication by interacting with these targets, the existence of which may impact virus replication directly or indirectly.

  3. Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with immunity prior to pregnancy.

    PubMed

    Britt, William

    2015-06-01

    Human cytomegalovirus (HCMV) is the most common virus infection in the developing fetus. A fraction of infants infected in utero develop significant life-threatening and organ-threatening disease with over 90% of infected infants exhibiting no clinical evidence of infection in the newborn period. However, about 10% of all infected infants will develop long-term sequelae. Early studies stressed the importance of primary maternal HCMV infection during pregnancy as a critical determinant of intrauterine transmission and outcome. This concept serves as the foundation for the development of prophylactic vaccines and biologics such as HCMV immune globulins. More recently, studies in maternal populations with high HCMV seroprevalence have challenged the concept of protective maternal immunity. Findings from multiple studies suggest that preexisting maternal HCMV immunity provides at best, partial protection from disease in the infected offspring and similarly may have limited impact on intrauterine transmission. This brief review will provide some considerations about the apparent paradox of maternal HCMV immunity and congenital infection.

  4. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.

    1989-03-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  5. Human cytomegalovirus miR-UL36-5p inhibits apoptosis via downregulation of adenine nucleotide translocator 3 in cultured cells.

    PubMed

    Guo, Xin; Huang, Yujing; Qi, Ying; Liu, Zhongyang; Ma, Yanping; Shao, Yaozhong; Jiang, Shujuan; Sun, Zhengrong; Ruan, Qiang

    2015-10-01

    Human cytomegalovirus (HCMV) encodes at least 26 microRNAs (miRNA). These miRNAs are utilized by HCMV to regulate its own genes as well as the genes of the host cell during infection. It has been reported that a cellular gene, solute carrier family 25, member 6 (SLC25A6), which is also designated adenine nucleotide translocator 3 (ANT3), was identified as a candidate target of hcmv-miR-UL36-5p by hybrid PCR. In this study, ANT3 was further demonstrated to be a direct target of hcmv-miR-UL36-5p by luciferase reporter assays. The expression level of ANT3 protein was confirmed, by western blotting, to be directly downregulated by overexpression of hcmv-miR-UL36-5p in HEK293 cells, U373 cells and HELF cells. Moreover, HCMV-infected cells showed a decrease in the ANT3 protein level. Using ANT3-specific small interfering RNA (siRNA) and an inhibitor for hcmv-miR-UL36-5p, it was shown that inhibition of apoptosis by hcmv-miR-UL36-5p in these cells specifically occurred via inhibition of ANT3 expression. These results imply that hcmv-miR-UL36-5 may play the same role during actual HCMV infection in order to establish a balance between the host cell and the virus.

  6. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.

    PubMed

    Wu, Shu-En; Miller, William E

    2015-09-01

    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage.

  7. Identification of two independent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein.

    PubMed

    Slack, J M; Blissard, G W

    1997-12-01

    The Autographa californica multicapsid nuclear polyhedrosis virus immediate-early protein, IE1, is a 582-amino-acid phosphoprotein that regulates the transcription of early viral genes. Deletion of N-terminal regions of IE1 in previous studies (G. R. Kovacs, J. Choi, L. A. Guarino, and M. D. Summers, J. Virol. 66:7429-7437, 1992) resulted in the loss of transcriptional activation, suggesting that this region may contain an acidic activation domain. To identify independently functional transcriptional activation domains, we developed a heterologous system in which potential regulatory domains were fused with a modified Escherichia coli Lac repressor protein that contains a nuclear localization signal (NLacR). Transcriptional activation by the resulting NLacR-IE1 chimeras was measured with a basal baculovirus early promoter containing optimized Lac repressor binding sites (lac operators). Chimeras containing IE1 peptides dramatically activated transcription of the basal promoter only when lac operator sequences were present. In addition, transcriptional activation by NLacR-IE1 chimeras was allosterically regulated by the lactose analog, isopropyl-beta-D-thiogalactopyranoside (IPTG). For a more detailed analysis of IE1 regulatory domains, the M1 to T266 N-terminal portion of IE1 was subdivided (on the basis of average amino acid charge) into five smaller regions which were fused in various combinations to NLacR. Regions M1 to N125 and A168 to G222 were identified as independent transcriptional activation domains. Some NLacR-IE1 chimeras exhibited retarded migration in sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels. As with wild-type IE1, this aberrant gel mobility was associated with phosphorylation. Mapping studies with the NLacR-IE1 chimeras indicate that the M1 to A168 region of IE1 is necessary for this phosphorylation-associated effect.

  8. An enzyme immunoassay based micro-neutralization test for titration of antibodies to human cytomegalovirus (CMV) and its correlation with direct ELISA measuring CMV IgG antibodies.

    PubMed

    Gupta, C K; Leszczynski, J; Gupta, R K; Siber, G R

    1996-03-01

    An ELISA-based micro-neutralization (Nt) test in MRC-5 cells for titration of neutralizing antibodies against human cytomegalovirus (CMV) in human plasma and preparations of immune globulins was developed to eliminate microscopic reading of cytopathic effect (CPE), a process that is subjective and time consuming. Un-neutralized CMV from the Nt reaction and grown in MRC-5 cells as per the standard micro-Nt test was coated in the same plates by various methods and CMV antigen was quantified by polyclonal or monoclonal CMV antibodies. Optimal coating of plates with CMV antigen (100 TCID50 of virus grown on MRC-5 cells for 7 days) was obtained by freezing/thawing of virus infected MRC-5 cells in phosphate buffered saline, ph 7.2. The CMV antigen treated sequentially with CMV monoclonal antibody to late nuclear protein antigen, goat anti-mouse IgG3 alkaline phosphatase conjugate and phosphatase substrate gave an absorbance of 1 at 410 nm wavelength whereas uninfected MRC-5 cells treated under similar conditions did not show any absorbance. The optimal Nt reaction occurred at 37 degrees C for 1-2 h and was unaffected by complement. At 4 degrees C, CMV was inactivated in 1-2 h. The antibody titres were affected by the virus dose used in the Nt test over a range of 20 to 798 TCID50. When the titre was determined against a reference serum, the effect of virus dose on the Nt titre was reduced. Complete neutralization virus read microscopically correlated with ELISA absorbance of < 0.1. CPE produced by approximately 1 TCID50 of CMV showed an absorbance of 0.1 or more. The correlation coefficient (r) between Nt titres and CMV IgG antibodies determined by ELISA was 0.69 (P < 0.001) for 257 human plasma samples and 0.85 (P < 0.001) for 50 immune globulin preparations.

  9. NKp46 and DNAM-1 NK-cell receptors drive the response to human cytomegalovirus-infected myeloid dendritic cells overcoming viral immune evasion strategies.

    PubMed

    Magri, Giuliana; Muntasell, Aura; Romo, Neus; Sáez-Borderías, Andrea; Pende, Daniela; Geraghty, Daniel E; Hengel, Hartmut; Angulo, Ana; Moretta, Alessandro; López-Botet, Miguel

    2011-01-20

    Information on natural killer (NK)-cell receptor-ligand interactions involved in the response to human cytomegalovirus (HCMV) is limited and essentially based on the study of infected fibroblasts. Experimental conditions were set up to characterize the NK response to HCMV-infected myeloid dendritic cells (DCs). Monocyte-derived DCs (moDCs) infected by the TB40/E HCMV strain down-regulated the expression of human leukocyte antigen class I molecules and specifically activated autologous NK-cell populations. NKG2D ligands appeared virtually undetectable in infected moDCs, reflecting the efficiency of immune evasion mechanisms, and explained the lack of antagonistic effects of NKG2D-specific monoclonal antibody. By contrast, DNAM-1 and DNAM-1 ligands (DNAM-1L)-specific monoclonal antibodies inhibited the NK response at 48 hours after infection, although the impact of HCMV-dependent down-regulation of DNAM-1L in infected moDCs was perceived at later stages. moDCs constitutively expressed ligands for NKp46 and NKp30 natural cytotoxicity receptors, which were partially reduced on HCMV infection; yet, only NKp46 appeared involved in the NK response. In contrast to previous reports in fibroblasts, human leukocyte antigen-E expression was not preserved in HCMV-infected moDCs, which triggered CD94/NKG2A(+) NK-cell activation. The results provide an insight on key receptor-ligand interactions involved in the NK-cell response against HCMV-infected moDCs, stressing the importance of the dynamics of viral immune evasion mechanisms.

  10. Deletion of open reading frame UL26 from the human cytomegalovirus genome results in reduced viral growth, which involves impaired stability of viral particles.

    PubMed

    Lorz, Kerstin; Hofmann, Heike; Berndt, Anja; Tavalai, Nina; Mueller, Regina; Schlötzer-Schrehardt, Ursula; Stamminger, Thomas

    2006-06-01

    We previously showed that open reading frame (ORF) UL26 of human cytomegalovirus, a member of the US22 multigene family of betaherpesviruses, encodes a novel tegument protein, which is imported into cells in the course of viral infection. Moreover, we demonstrated that pUL26 contains a strong transcriptional activation domain and is capable of stimulating the major immediate-early (IE) enhancer-promoter. Since this suggested an important function of pUL26 during the initiation of the viral replicative cycle, we sought to ascertain the relevance of pUL26 by construction of a viral deletion mutant lacking the UL26 ORF using the bacterial artificial chromosome mutagenesis procedure. The resulting deletion virus was verified by PCR, enzyme restriction, and Southern blot analyses. After infection of human foreskin fibroblasts, the UL26 deletion mutant showed a small-plaque phenotype and replicated to significantly lower titers than wild-type or revertant virus. In particular, we noticed a striking decrease of infectious titers 7 days postinfection in a multistep growth experiment, whereas the release of viral DNA from infected cells was not impaired. A further investigation of this aspect revealed a significantly diminished stability of viral particles derived from the UL26 deletion mutant. Consistent with this, we observed that the tegument composition of the deletion mutant deviates from that of the wild-type virus. We therefore hypothesize that pUL26 plays a role not only in the onset of IE gene transcription but also in the assembly of the viral tegument layer in a stable and correct manner. PMID:16699023

  11. Roles of phosphatidylinositol 3-kinase and NF-kappaB in human cytomegalovirus-mediated monocyte diapedesis and adhesion: strategy for viral persistence.

    PubMed

    Smith, M Shane; Bivins-Smith, Elizabeth R; Tilley, A Michael; Bentz, Gretchen L; Chan, Gary; Minard, Jessica; Yurochko, Andrew D

    2007-07-01

    Infected peripheral blood monocytes are proposed to play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to tissues, a critical step in the establishment of HCMV persistence and the development of HCMV-associated diseases. We recently provided evidence for a unique strategy involved in viral dissemination: HCMV infection of primary human monocytes promotes their transendothelial migration and differentiation into proinflammatory macrophages permissive for the replication of the original input virus. To decipher the mechanism of hematogenous spread, we focused on the viral dysregulation of early cellular processes involved in transendothelial migration. Here, we present evidence that both phosphatidylinositol 3-kinase [PI(3)K] and NF-kappaB activities were crucial for the HCMV induction of monocyte motility and firm adhesion to endothelial cells. We found that the beta(1) integrins, the beta(2) integrins, intracellular adhesion molecule 1 (ICAM-1), and ICAM-3 were upregulated following HCMV infection and that they played a key role in the firm adhesion of infected monocytes to the endothelium. The viral regulation of adhesion molecule expression is complex, with PI(3)K and NF-kappaB affecting the expression of each adhesion molecule at different stages of the expression cascade. Our data demonstrate key roles for PI(3)K and NF-kappaB signaling in the HCMV-induced cellular changes in monocytes and identify the biological rationale for the activation of these pathways in infected monocytes, which together suggest a mechanism for how HCMV promotes viral spread to and persistence within host organs.

  12. Cytomegalovirus: the stealth virus.

    PubMed

    Robinson, Sharon

    2016-05-01

    Cytomegalovirus (CMV) is an infection, part of the herpes family of viruses which, if contracted during pregnancy, cancause devastating effects on the newborn baby. This article is written by the trustee of a volunteer-based charity, mostly run by mothers of CMV children, who are striving to raise awareness of this infection, which is more common than Down's syndrome, listeria and toxoplasmosis, and is theprimary preventable cause of childhood hearing loss.

  13. Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1.

    PubMed

    Liu, Wang-Jing; Chang, Yun-Shiang; Wang, Hao-Ching; Leu, Jiann-Horng; Kou, Guang-Hsiung; Lo, Chu-Fang

    2008-11-01

    Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with (32)P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers. PMID:18768963

  14. Cytomegalovirus and Langerhans Cell Histiocytosis: Is There a Link?

    PubMed Central

    Khoddami, Maliheh; Nadji, Seyed-Alireza; Dehghanian, Paria; Vahdatinia, Mahsa; Shamshiri, Ahmad-Reza

    2016-01-01

    Background: Langerhans cell histiocytosis is a rare proliferative histiocytic disease of unknown etiology. Histologically, it is characterized by granuloma-like proliferation of Langerhans-type dendritic cells derived from bone marrow. Many investigators have suggested the possible role of viruses such as Epstein-Barr virus, human herpesvirus-6 (HHV-6), herpes simplex virus (HSV) types 1 and 2, and Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. Objectives: In this study, we have investigated the presence of Cytomegalovirus in Langerhans cell histiocytosis in Iranian children. Patients and Methods: In this retrospective study, we have investigated the presence of Cytomegalovirus DNA expression, using paraffin-embedded tissue samples of 30 patients with Langerhans cell histiocytosis and 30 age and site-matched controls by qualitative Polymerase Chain Reaction (PCR) method. Results: No significant difference in prevalence of Cytomegalovirus presence between patients and controls was found. Cytomegalovirus was found by qualitative PCR in only 2 (6.66%) out of 30 patients and in 1 (3.3%) of 30 control samples with a P value of 1 (1.00 > 0.05) using chi-square test with OR: 2.07; 95% CI of OR: 0.18 - 24.15. Conclusions: Our findings do not support the hypothesis of a possible role for Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. PMID:27307972

  15. Cytomegalovirus: pathophysiological mechanisms of the cytomegalovirus-induced cellular responses

    SciTech Connect

    Nokta, M.A.

    1986-01-01

    Cytomegalovirus (CMV) infection of fibroblasts of human origin is associated with a cascade of morphologic cellular responses which in other systems have been associated with regulation of intracellular free (IF) (Ca/sup + +/). In the present study, the relationship of specific ion fluxes (Ca/sup + +/, Na/sup +/) to the development of cytomegalovirus (CMV)-induced morphologic cellular responses was investigated. An influx of Ca/sup + +/ was observed by the first hour after CMV infection (PI), and total calcium sequestered by infected cells was enhanced by 5 hr Pl. A gradual rise in intracellular free (IF) (Ca/sup + +/) was observed that continued through 48 hour postinfection (hr Pl). The IF (Ca/sup + +/) response to CMV infection was shown to be multiplicity dependent, require viable virus, and occur under conditions consistent with the expression of immediate early CMV genes. Development and progression of cytomegaly was found to be independent of CMV DNA synthesis and appeared to be dependent on the IF (Ca/sup + +/) response. Ca/sup + +/ influx blockers (e.g. verapamil) and cyclic nucleotide modulators (e.g. papaverine) inhibited both Ca/sup + +/ responses and cytomegaly. Quabain-sensitive /sup 86/Rb uptake and sequestering of Ca/sup + +/ increased in parallel with development of cytomegaly. There may be a relationship between Ca/sup + +/ influx, IF (Ca/sup + +/), activation of the Na/sup +//H/sup +/ exchanger, induction of Na/sup +/, Cl/sup -/, HCO/sub 3/ cotransport, Na/sup +/ entry, Na/sup +//K/sup +/ ATPase activity and development of CMV-induced morphologic cellular responses including cytomegaly.

  16. 11 CFR 300.62 - Non-Federal elections (2 U.S.C. 441i(e)(1)(B)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... elections (2 U.S.C. 441i(e)(1)(B)). A person described in 11 CFR 300.60 may solicit, receive, direct... 11 Federal Elections 1 2010-01-01 2010-01-01 false Non-Federal elections (2 U.S.C. 441i(e)(1)(B)). 300.62 Section 300.62 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT...

  17. 11 CFR 300.61 - Federal elections (2 U.S.C. 441i(e)(1)(A)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... elections (2 U.S.C. 441i(e)(1)(A)). No person described in 11 CFR 300.60 shall solicit, receive, direct... any Federal election activity as defined in 11 CFR 100.24, unless the amounts consist of Federal funds... 11 Federal Elections 1 2010-01-01 2010-01-01 false Federal elections (2 U.S.C. 441i(e)(1)(A))....

  18. Human cytomegalovirus infection inhibits tumor necrosis factor alpha (TNF-alpha) signaling by targeting the 55-kilodalton TNF-alpha receptor.

    PubMed

    Baillie, J; Sahlender, D A; Sinclair, J H

    2003-06-01

    Infection with human cytomegalovirus (HCMV) results in complex interactions between viral and cellular factors which perturb many cellular functions. HCMV is known to target the cell cycle, cellular transcription, and immunoregulation, and it is believed that this optimizes the cellular environment for viral DNA replication during productive infection or during carriage in the latently infected host. Here, we show that HCMV infection also prevents external signaling to the cell by disrupting the function of TNFRI, the 55-kDa receptor for tumor necrosis factor alpha (TNF-alpha), one of the receptors for a potent cytokine involved in eliciting a wide spectrum of cellular responses, including antiviral responses. HCMV infection of fully permissive differentiated monocytic cell lines and U373 cells resulted in a reduction in cell surface expression of TNFRI. The reduction appeared to be due to relocalization of TNFRI from the cell surface and was reflected in the elimination of TNF-alpha-induced Jun kinase activity. Analysis of specific phases of infection suggested that viral early gene products were responsible for this relocalization. However, a mutant HCMV in which all viral gene products known to be involved in down-regulation of major histocompatibility complex (MHC) class I were deleted still resulted in relocalization of TNFRI. Consequently, TNFRI relocalization by HCMV appears to be mediated by a novel viral early function not involved in down-regulation of cell surface MHC class I expression. We suggest that upon infection, HCMV isolates the cell from host-mediated signals, forcing the cell to respond only to virus-specific signals which optimize the cell for virus production and effect proviral responses from bystander cells.

  19. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  20. Comparison of nested PCR for detection of DNA in plasma with pp65 leukocytic antigenemia procedure for diagnosis of human cytomegalovirus infection.

    PubMed Central

    Freymuth, F; Gennetay, E; Petitjean, J; Eugene, G; Hurault de Ligny, B; Ryckelynck, J P; Legoff, C; Hazera, P; Bazin, C

    1994-01-01

    A nested PCR was used for the detection of human cytomegalovirus (HCMV) DNA in plasma. The presence of HCMV DNA and its correlation to pp65 leukocytic antigenemia were investigated with 299 blood samples from 45 organ transplant recipients and 63 AIDS patients. Of the 53 samples positive by nested PCR, 52 (98%) were also positive for leukocytic antigenemia and 23 had high levels of antigenemia (> 50 positive cells per 2 x 10(5) leukocytes). Of the 246 samples negative in PCR, only 3 (1.2%) had highly positive antigenemia. For 15 patients having a high antigenemia level in the course of their disease, consecutive blood samples were studied and also assessed for viremia in culture. The extent to which HCMV DNA, detected by PCR, was present in plasma correlated with increased levels of HCMV leukocytic antigenemia for six of the eight AIDS patients and for all the organ transplant recipients. Positivity for HCMV DNA in PCR and for viremia in cell culture was usually restricted to the highest antigenemia levels. From a total of 69 blood samples, PCR and culture gave positive results, respectively, for 17 of 32 samples (53%) and 14 of 32 samples (43%) from transplant recipients and for 15 of 37 samples (40%) and 9 of 37 samples (24%) from AIDS patients. Our findings have shown a strong correlation between high levels of leukocytic antigenemia and HCMV DNA in plasma. The detection of HCMV DNA in plasma by this nested PCR can prove HCMV dissemination in blood, but it lacks the rapidity and simplicity of the leukocytic pp65 antigenemia procedure. PMID:8077418

  1. Specific residues in the connector loop of the human cytomegalovirus DNA polymerase accessory protein UL44 are crucial for interaction with the UL54 catalytic subunit.

    PubMed

    Loregian, Arianna; Appleton, Brent A; Hogle, James M; Coen, Donald M

    2004-09-01

    The human cytomegalovirus DNA polymerase includes an accessory protein, UL44, which has been proposed to act as a processivity factor for the catalytic subunit, UL54. How UL44 interacts with UL54 has not yet been elucidated. The crystal structure of UL44 revealed the presence of a connector loop analogous to that of the processivity subunit of herpes simplex virus DNA polymerase, UL42, which is crucial for interaction with its cognate catalytic subunit, UL30. To investigate the role of the UL44 connector loop, we replaced each of its amino acids (amino acids 129 to 140) with alanine. We then tested the effect of each substitution on the UL44-UL54 interaction by glutathione S-transferase pulldown and isothermal titration calorimetry assays, on the stimulation of UL54-mediated long-chain DNA synthesis by UL44, and on the binding of UL44 to DNA-cellulose columns. Substitutions that affected residues 133 to 136 of the connector loop measurably impaired the UL44-UL54 interaction without altering the ability of UL44 to bind DNA. One substitution, I135A, completely disrupted the binding of UL44 to UL54 and inhibited the ability of UL44 to stimulate long-chain DNA synthesis by UL54. Thus, similar to the herpes simplex virus UL30-UL42 interaction, a residue of the connector loop of the accessory subunit is crucial for UL54-UL44 interaction. However, while alteration of a polar residue of the UL42 connector loop only partially reduced binding to UL30, substitution of a hydrophobic residue of UL44 completely disrupted the UL54-UL44 interaction. This information may aid the discovery of small-molecule inhibitors of the UL44-UL54 interaction.

  2. Modulatory effect of rRNA synthesis and ppUL83 nucleolar compartmentalization on human cytomegalovirus gene expression in vitro.

    PubMed

    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; De Conto, Flora; Gatti, Rita; Orlandini, Guido; Ferraglia, Francesca; Motta, Federica; Covan, Silvia; Razin, Sergey V; Dettori, Giuseppe; Chezzi, Carlo

    2009-10-01

    The nucleolus is a nuclear domain involved in the biogenesis of ribosomes, as well as in many other important cellular regulatory activities, such as cell cycle control and mRNA processing. Many viruses, including herpesviruses, are known to exploit the nucleolar compartment during their replication cycle. In a previous study, we demonstrated the preferential targeting and accumulation of the human cytomegalovirus (HCMV) UL83 phosphoprotein (pp65) to the nucleolar compartment and, in particular, to the nucleolar matrix of lytically infected fibroblasts; such targeting was already evident at very early times after infection. Here we have investigated the possible effects of rRNA synthesis inhibition upon the development of HCMV lytic infection, by using either actinomycin D or cisplatin at low concentrations, that are known to selectively inhibit RNA polymerase I activity, whilst leaving RNA polymerase II function unaffected. Following the inhibition of rRNA synthesis by either of the agents used, we observed a significant redistribution of nucleolar proteins within the nucleoplasm and a simultaneous depletion of viral pp65 from the nucleolus; this effect was highly evident in both unextracted cells and in nuclear matrices in situ. Of particular interest, even a brief suppression of rRNA synthesis resulted in a very strong inhibition of the progression of HCMV infection, as was concluded from the absence of accumulation of HCMV major immediate-early proteins within the nucleus of infected cells. These data suggest that a functional relationship might exist between rRNA synthesis, pp65 localization to the nucleolar matrix and the normal development of HCMV lytic infection. PMID:19585527

  3. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  4. Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope

    PubMed Central

    Lamm, Christian E.; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe

    2016-01-01

    In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell’s nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein. PMID:26978388

  5. Phosphorylation of Golgi Peripheral Membrane Protein Grasp65 Is an Integral Step in the Formation of the Human Cytomegalovirus Cytoplasmic Assembly Compartment

    PubMed Central

    Rebmann, G. Michael; Grabski, Robert; Sanchez, Veronica

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the largest member of the Herpesviridae and represents a significant cause of disease. During virus replication, HCMV alters cellular functions to facilitate its replication, including significant reorganization of the secretory and endocytic pathways of the infected cell. A defining morphologic change of the infected cell is the formation of a membranous structure in the cytoplasm that is designated the virion assembly compartment (AC), which consists of virion structural proteins surrounded by cellular membranes. The loss of normal Golgi compartment morphology and its relocalization from a juxtanuclear ribbonlike structure to a series of concentric rings on the periphery of the AC represents a readily recognized reorganization of cellular membranes in the HCMV-infected cell. Although trafficking of viral proteins to this compartment is required for the assembly of infectious virions, the functional significance of the reorganization of intracellular membranes like the Golgi membranes into the AC in the assembly of infectious virus remains understudied. In this study, we determined that Golgi membrane ribbon fragmentation increased during the early cytoplasmic phase of virion assembly and that Golgi membrane fragmentation in infected cells was dependent on the phosphorylation of an integral cis-Golgi protein, Grasp65. Inhibition of Golgi membrane fragmentation and of its reorganization into the AC resulted in decreased production of infectious particles and alteration of the incorporation of an essential protein into the envelope of the mature virion. These results demonstrated the complexity of the virus-host cell interactions required for efficient assembly of this large DNA virus. PMID:27703074

  6. Human cytomegalovirus IE72 protein interacts with the transcriptional repressor hDaxx to regulate LUNA gene expression during lytic infection.

    PubMed

    Reeves, Matthew; Woodhall, David; Compton, Teresa; Sinclair, John

    2010-07-01

    A putative latency-associated transcript (LUNA) complementary to the human cytomegalovirus (HCMV) UL81-82 region previously identified in seropositive donors' monocytes is also expressed during lytic infection. Thus, the LUNA promoter is active during both lytic and latent infection. Consequently, the mechanisms regulating this promoter may provide further insight into factors that determine whether the outcome of HCMV infection is latent or lytic. By transfection, the LUNA promoter exhibited low but reproducible activity. Substantial activation by virus infection suggested that a viral factor was important for LUNA expression during lytic infection. IE72, a known transactivator of viral promoters, activated the LUNA promoter in cotransfection assays. Furthermore, coinfection with wild-type HCMV but not an IE72 deletion virus (CR208) also activated the LUNA promoter. Finally, diminished LUNA gene expression in CR208 virus-infected cells supported a role for IE72 in LUNA gene expression. The initial regulation of herpesvirus immediate-early gene expression is associated with proteins found at cellular nuclear domain 10 (ND10) bodies, such as PML, hDaxx, and ATRX. hDaxx transfection repressed LUNA promoter activity. Furthermore, we observed binding of hDaxx to the LUNA promoter, which was abrogated by IE72 gene expression via direct interaction. Finally, we show that small interfering RNA (siRNA) knockdown of the hDaxx interaction partner ATRX rescued LUNA gene expression in CR208-infected cells. Overall, these data show that hDaxx/ATRX-mediated repression of LUNA during lytic infection absolutely requires IE72 gene expression. It also suggests that the targeting of cellular factors by IE72 is important throughout the different phases of HCMV gene expression during productive infection.

  7. The human cytomegalovirus UL11 protein interacts with the receptor tyrosine phosphatase CD45, resulting in functional paralysis of T cells.

    PubMed

    Gabaev, Ildar; Steinbrück, Lars; Pokoyski, Claudia; Pich, Andreas; Stanton, Richard J; Schwinzer, Reinhard; Schulz, Thomas F; Jacobs, Roland; Messerle, Martin; Kay-Fedorov, Penelope C

    2011-12-01

    Human cytomegalovirus (CMV) exerts diverse and complex effects on the immune system, not all of which have been attributed to viral genes. Acute CMV infection results in transient restrictions in T cell proliferative ability, which can impair the control of the virus and increase the risk of secondary infections in patients with weakened or immature immune systems. In a search for new immunomodulatory proteins, we investigated the UL11 protein, a member of the CMV RL11 family. This protein family is defined by the RL11 domain, which has homology to immunoglobulin domains and adenoviral immunomodulatory proteins. We show that pUL11 is expressed on the cell surface and induces intercellular interactions with leukocytes. This was demonstrated to be due to the interaction of pUL11 with the receptor tyrosine phosphatase CD45, identified by mass spectrometry analysis of pUL11-associated proteins. CD45 expression is sufficient to mediate the interaction with pUL11 and is required for pUL11 binding to T cells, indicating that pUL11 is a specific CD45 ligand. CD45 has a pivotal function regulating T cell signaling thresholds; in its absence, the Src family kinase Lck is inactive and signaling through the T cell receptor (TCR) is therefore shut off. In the presence of pUL11, several CD45-mediated functions were inhibited. The induction of tyrosine phosphorylation of multiple signaling proteins upon TCR stimulation was reduced and T cell proliferation was impaired. We therefore conclude that pUL11 has immunosuppressive properties, and that disruption of T cell function via inhibition of CD45 is a previously unknown immunomodulatory strategy of CMV. PMID:22174689

  8. Detection of cytomegalovirus, human parvovirus B19, and herpes simplex virus-1/2 in women with first-trimester spontaneous abortions.

    PubMed

    Zhou, Ya; Bian, Guohui; Zhou, Qiongxiu; Gao, Zhan; Liao, Pu; Liu, Yu; He, Miao

    2015-10-01

    The relationship between viral infections and first-trimester spontaneous abortions is not well-understood. The study aim was to investigate the prevalence of cytomegalovirus (CMV), human parvovirus B19 (B19V), and herpes simplex virus-1/2 (HSV-1/2) infection by molecular and serological techniques in women experiencing spontaneous miscarriage in the first trimester of pregnancy. Plasma samples were examined for CMV, B19V, and HSV-1/2 DNA using real-time quantitative polymerase chain reaction (Real-time qPCR), and for specific IgG antibodies against B19V, CMV, and HSV-1/2 using serological assays. The abortion group consisted of women (n = 1,716) with a history of two or more first-trimester spontaneous abortions. Women younger than 30 years possess higher portion to experience spontaneous abortion. No specimens were positive for B19V or CMV DNA. Seven out of the 1,716 specimens were positive for HSV-1/2 DNA. By serology, 47.24% of patients were positive for B19V IgG, 39.66% for HSV IgG, 79.31% for CMV IgG, and 9.31% for B19V IgM. The high rate of positivity for CMV IgG suggests that the majority of women with first-trimester spontaneous abortions are not susceptible to primary CMV infection. The lack of virus DNA in the majority of cases indicates that B19V, CMV, and HSV-1/2 infection is not commonly associated with first-trimester spontaneous abortion.

  9. Differential cellular localization of Epstein-Barr virus and human cytomegalovirus in the colonic mucosa of patients with active or quiescent inflammatory bowel disease.

    PubMed

    Ciccocioppo, Rachele; Racca, Francesca; Scudeller, Luigia; Piralla, Antonio; Formagnana, Pietro; Pozzi, Lodovica; Betti, Elena; Vanoli, Alessandro; Riboni, Roberta; Kruzliak, Peter; Baldanti, Fausto; Corazza, Gino Roberto

    2016-02-01

    The role of human cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) in the exacerbation of inflammatory bowel disease (IBD) is still uncertain. We prospectively investigated the presence of EBV and HCMV infection in both epithelial and immune cells of colonic mucosa of IBD patients, both refractory and responders to standard therapies, in comparison with patients suffering from irritable bowel syndrome who were considered as controls, by using quantitative real-time polymerase chain reaction, immunohistochemistry and in situ hybridization, in an attempt to assess viral localization, DNA load, life cycle phase and possible correlation with disease activity indexes. We obtained clear evidence of the presence of high DNA loads of both viruses in either enterocytes or immune cells of refractory IBD patients, whereas we observed low levels in the responder group and an absence of detectable copies in all cell populations of controls. Remarkably, the values of EBV and HCMV DNA in inflamed mucosa were invariably higher than in non-inflamed areas in both IBD groups, and the EBV DNA loads in the cell populations of diseased mucosa of refractory IBD patients positively correlated with the severity of mucosal damage and clinical indexes of activity. Moreover, EBV infection resulted the most prevalent either alone or in combination with HCMV, while immunohistochemistry and in situ hybridization did not allow us to distinguish between the different phases of viral life cycle. Finally, as regards treatment, these novel findings could pave the way for the use of new antiviral molecules in the treatment of this condition. PMID:26659090

  10. Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.

    PubMed

    Meier, Jeffery L; Keller, Michael J; McCoy, James J

    2002-01-01

    We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

  11. Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope.

    PubMed

    Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe

    2016-03-10

    In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.

  12. Congenital cytomegalovirus infection. Is there a breakthrough?

    PubMed Central

    Bar-Oz, B.; Berkovitch, M.; Ford-Jones, L.; Koren, G.

    2001-01-01

    QUESTION: My 26-year-old patient is planning her first pregnancy in the coming month. She works in a day-care centre. Recently, two cases of cytomegalovirus (CMV) infection were diagnosed in her class. What tests should she have before and during the pregnancy, and how should I care for her? ANSWER: Cytomegalovirus infection, the most common congenital viral infection in humans, carries high risk of long-term morbidity and mortality. Seronegative mothers of children in day-care centres are at as high risk of acquiring the infection as day-care workers themselves. The immune status of at-risk patients should be evaluated as pregnancy progresses. Evidence of fetal infection does not necessarily mean fetal disease or damage. With a primary-infected fetus, termination of pregnancy might be discussed with the parents. PMID:11421042

  13. Design and synthesis of pyrrolidine-5,5'-trans-lactams (5-oxo-hexahydropyrrolo[3,2-b]pyrroles) as novel mechanism-based inhibitors of human cytomegalovirus protease. 4. Antiviral activity and plasma stability.

    PubMed

    Borthwick, Alan D; Davies, Dave E; Ertl, Peter F; Exall, Anne M; Haley, Terry M; Hart, Graham J; Jackson, Deborah L; Parry, Nigel R; Patikis, Angela; Trivedi, Naimisha; Weingarten, Gordon G; Woolven, James M

    2003-10-01

    A series of chiral, (S)-proline-alpha-methylpyrrolidine-5,5-trans-lactam serine protease inhibitors has been developed as antivirals of human cytomegalovirus (HCMV). The SAR of the functionality on the proline nitrogen has shown that derivatives of para-substituted phenyl ureas > para-substituted phenyl sulfonamides > para-substituted phenyl carboxamide for activity against HCMV deltaAla protease, producing para-substituted phenyl ureas with single figure nM potency (K(i)) against the viral enzyme. The SAR of the functionality on the lactam nitrogen has defined the steric and electronic requirements for high human plasma stability while retaining good activity against HCMV protease. The combination of high potency against HCMV deltaAla protease and high human plasma stability has produced compounds with significant in vitro antiviral activity against human cytomegalovirus with the 6-hydroxymethyl benzothiazole derivative 72 being equivalent in potency to ganciclovir. The parent benzothiazole 56 had good pharmacokinetics in dogs with 29% bioavailability and good brain and ocular penetration in guinea pigs.

  14. Resistance of transgenic silkworm to BmNPV could be improved by silencing ie-1 and lef-1 genes.

    PubMed

    Zhang, P; Wang, J; Lu, Y; Hu, Y; Xue, R; Cao, G; Gong, C

    2014-01-01

    RNA interference (RNAi)-mediated viral inhibition has been used in several organisms for improving viral resistance. In the present study, we reported the use of transgenic RNAi in preventing Bombyx mori nucleopolyhedrovirus (BmNPV) multiplication in the transgenic silkworm B. mori. We targeted the BmNPV immediate-early-1 (ie-1) and late expression factor-1 (lef-1) genes in the transiently transfected BmN cells, in the stable transformed BmN cell line and in the transgenic silkworms. We generated four piggyBac-based vectors containing short double-stranded ie-1 RNA (sdsie-1), short double-stranded lef-1 RNA (sdslef-1), long double-stranded ie-1 RNA (ldsie-1) and both sdsie-1 and sdslef-1 (sds-ie1-lef1) expression cassettes. Strong viral repression was observed in the transiently transfected cells and in the stable transformed BmN cells transfected with sds-ie-1, sdslef-1, ldsie-1 or sds-ie-lef. The decrease of ie-1 mRNA level in the sds-ie1-lef1 transiently transfected cells was most obvious among the cells transfected with different vectors. The inhibitory effect of viral multiplication was decreased in a viral dose-dependent manner; the infection ratio of transfected cells for sds-ie-1, sdslef-1, ldsie-1 and sds-ie-lef decreased by 18.83%, 13.73%, 6.93% and 30.63%, respectively, compared with control cells 5 days after infection. We generated transgenic silkworms using transgenic vector piggyantiIE-lef1-neo with sds-ie1-lef1 expression cassette; the fourth instar larvae of transgenic silkworms of generation G5 exhibited stronger resistance to BmNPV, the mortalities for the transgenic silkworms and control silkworms were 60% and 100%, respectively, at 11 days after inoculation with BmNPV (10(6) occlusion bodies per ml). These results suggest that double-stranded RNA expression of essential genes of BmNPV is a feasible method for breeding silkworms with a high antiviral capacity. PMID:24173242

  15. Acute appendicitis due to Cytomegalovirus in an apparently immunocompetent patient: a case report

    PubMed Central

    2014-01-01

    Introduction In healthy subjects, Cytomegalovirus infection can be asymptomatic or manifest as mononucleosis syndrome, but organ disease has also been reported. However, in immunocompromised patients this infection can lead to its most significant and severe disease and even mortality. When Cytomegalovirus causes a gastrointestinal tract infection, it more commonly manifests with luminal tract disease and is usually characterized by ulcerative lesions. Appendicitis is a rare manifestation, and has been reported mainly in human immunodeficiency virus-infected patients or patients with other causes of immunocompromise. Case presentation The authors report on a case of acute primary Cytomegalovirus infection complicated with acute appendicitis due to Cytomegalovirus in an apparently immunocompetent 24-year-old Caucasian man also suffering from primary sclerosing cholangitis and ulcerative colitis. Diagnosis was based on clinical manifestations, serology results, as well as microbiological and histological findings. Treatment consisted of surgery and anti-Cytomegalovirus therapy. Conclusions Cytomegalovirus should be included among the etiologic agents of acute appendicitis in patients with primary sclerosing cholangitis and ulcerative colitis. Currently, there are no definitive data regarding the frequency of Cytomegalovirus appendicitis and the role of anti-Cytomegalovirus treatment in human immunodeficiency virus-negative and apparently immunocompetent subjects. PMID:24612821

  16. Infection of a Single Cell Line with Distinct Strains of Human Cytomegalovirus Can Result in Large Variations in Virion Production and Facilitate Efficient Screening of Virus Protein Function

    PubMed Central

    Zavala, Anamaria G.; O'Dowd, John M.

    2015-01-01

    ABSTRACT Previously, we reported that the absence of the ataxia telangiectasia mutated (ATM) kinase, a critical DNA damage response (DDR) signaling component for double-strand breaks, caused no change in HCMV Towne virion production. Later, others reported decreased AD169 viral titers in the absence of ATM. To address this discrepancy, human foreskin fibroblasts (HFF) and three ATM− lines (GM02530, GM05823, and GM03395) were infected with both Towne and AD169. Two additional ATM− lines (GM02052 and GM03487) were infected with Towne. Remarkably, both previous studies' results were confirmed. However, the increased number of cell lines and infections with both lab-adapted strains confirmed that ATM was not necessary to produce wild-type-level titers in fibroblasts. Instead, interactions between individual virus strains and the cellular microenvironment of the individual ATM− line determined efficiency of virion production. Surprisingly, these two commonly used lab-adapted strains produced drastically different titers in one ATM− cell line, GM05823. The differences in titer suggested a rapid method for identifying genes involved in differential virion production. In silico comparison of the Towne and AD169 genomes determined a list of 28 probable candidates responsible for the difference. Using serial iterations of an experiment involving virion entry and input genome nuclear trafficking with a panel of related strains, we reduced this list to four (UL129, UL145, UL147, and UL148). As a proof of principle, reintroduction of UL148 largely rescued genome trafficking. Therefore, use of a battery of related strains offers an efficient method to narrow lists of candidate genes affecting various virus life cycle checkpoints. IMPORTANCE Human cytomegalovirus (HCMV) infection of multiple cell lines lacking ataxia telangiectasia mutated (ATM) protein produced wild-type levels of infectious virus. Interactions between virus strains and the microenvironment of individual

  17. Contribution of the Major ND10 Proteins PML, hDaxx and Sp100 to the Regulation of Human Cytomegalovirus Latency and Lytic Replication in the Monocytic Cell Line THP-1

    PubMed Central

    Wagenknecht, Nadine; Reuter, Nina; Scherer, Myriam; Reichel, Anna; Müller, Regina; Stamminger, Thomas

    2015-01-01

    Promyelocytic leukemia nuclear bodies, also termed nuclear domain 10 (ND10), have emerged as nuclear protein accumulations mediating an intrinsic cellular defense against viral infections via chromatin-based mechanisms, however, their contribution to the control of herpesviral latency is still controversial. In this study, we utilized the monocytic cell line THP-1 as an in vitro latency model for human cytomegalovirus infection (HCMV). Characterization of THP-1 cells by immunofluorescence and Western blot analysis confirmed the expression of all major ND10 components. THP-1 cells with a stable, individual knockdown of PML, hDaxx or Sp100 were generated. Importantly, depletion of the major ND10 proteins did not prevent the terminal cellular differentiation of THP-1 monocytes. After construction of a recombinant, endotheliotropic human cytomegalovirus expressing IE2-EYFP, we investigated whether the depletion of ND10 proteins affects the onset of viral IE gene expression. While after infection of differentiated, THP-1-derived macrophages as well as during differentiation-induced reactivation from latency an increase in the number of IE-expressing cells was readily detectable in the absence of the major ND10 proteins, no effect was observed in non-differentiated monocytes. We conclude that PML, hDaxx and Sp100 primarily act as cellular restriction factors during lytic HCMV replication and during the dynamic process of reactivation but do not serve as key determinants for the establishment of HCMV latency. PMID:26057166

  18. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  19. Comparison of human coagulation factor VIII expression directed by cytomegalovirus and mammary gland-specific promoters in HC11 cells and transgenic mice.

    PubMed

    Wang, Qing; Hao, Siguo; Ma, Liyuan; Zhang, Wenhao; Wan, Jiangbo; Deng, Xiaohui

    2015-10-01

    Hemophilia A is an inherited X-linked recessive bleeding disorder caused by coagulant factor VIII (FVIII) deficiency. The conventional treatment involves the administration of recombinant human FVIII (rhFVIII) preparations. In this study, the mammary gland 'bioreactor' is designed to specifically and efficiently express a foreign protein hFVIII in the mammary glands of transgenic mice. We constructed a P1A3-hFVIIIBD vector directed by the mammary gland-specific P1A3 promoter, and transiently transfected HC11 cells and mouse mammary glands with P1A3-hFVIIIBD or CMV-hFVIIIBD vectors directed by a ubiquitous cytomegalovirus (CMV) promoter, respectively. We also generated P1A3-hFVIIIBD and CMV-hFVIIIBD transgenic mice by microinjection, respectively. Our data indicated that both vectors effectively expressed hFVIIIBD in HC11 cells at the transcription level, and hFVIIIBD protein was efficiently expressed in mouse milk after the injection of the hFVIIIBD vectors into mouse mammary glands during lactation. In both CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice, hFVIIIBD proteins were efficiently expressed in the mammary glands at the mRNA and protein levels. No significant difference was observed in hFVIIIBD levels between the CMV-hFVIIIBD and P1A3-hFVIIIBD transgenic mice (P > 0.05). However, the activity of hFVIII in CMV-directed transgenic mice was slightly higher than that in P1A3-directed transgenic mice (P < 0.05). While hFVIIIBD was present in multiple organs in CMV-hFVIIIBD mice, P1A3-hFVIIIBD mice showed negligible hFVIIIBD expression in organs other than the mammary glands. This study demonstrated that the mammary gland-specific P1A3-hFVIIIBD vector was more suitable for the generation of hFVIIIBD mammary gland bioreactor.

  20. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  1. Human cytomegalovirus maturational proteinase: expression in Escherichia coli, purification, and enzymatic characterization by using peptide substrate mimics of natural cleavage sites.

    PubMed Central

    Burck, P J; Berg, D H; Luk, T P; Sassmannshausen, L M; Wakulchik, M; Smith, D P; Hsiung, H M; Becker, G W; Gibson, W; Villarreal, E C

    1994-01-01

    The proteolytic processing of the human cytomegalovirus (HCMV) assembly protein, resulting in truncation of its C terminus, is an essential step in virion maturation. The proteinase responsible for this cleavage is the amino-terminal half of the protein encoded by the UL80a open reading fame. We have obtained high expression levels of this 256-amino-acid HCMV proteinase, assemblin, in Escherichia coli. In addition to the 28-kDa proteinase, a 15-kDa protein comprising the first 143 amino acids and a 13-kDa protein comprising the last 113 amino acids of the 28-kDa HCMV proteinase were present. Both the 28-kDa proteinase and the 15-kDa protein were purified by a two-step chromatographic procedure utilizing anion exchange in urea and dithiothreitol and size exclusion in NaSCN and dithiothreitol. Activation of the purified 28-kDa proteinase required denaturation in urea as well as complete reduction of all five cysteine residues in the molecule. Removal of the urea by dialysis with retention of the reducing agent yielded an active proteinase. Addition of glycerol to 50% enhanced the activity. The HCMV proteinase cleaved the peptides RGVVNASSRLAK and SYVKASVSPE, which are mimics of the maturational (M)- and release (R)-site sequences, respectively, in the UL80a-encoded protein. The cleavage site in the peptides was at the same Ala-Ser scissile bond as observed in the UL80a protein. The Km value for the cleavage of RGVVNASSRLAK (M-site mimic) by the proteinase was similar to that for SYVKASVSPE (R-site mimic), but the turnover (kcat) of the M-site peptide mimic substrate by the proteinase was six to eight times faster. The peptide homologs of the herpes simplex virus type 1 M- and R-site sequences in the UL26-encoded protein were also cleaved by the HCMV proteinase, although at rates slower than those for the HCMV substrates. The HCMV proteinase was inhibited by Zn2+ and by alkylating agents, but only at very high inhibitor concentrations. The purified 15-kDa protein

  2. Novel Human Cytomegalovirus Viral Chemokines, vCXCL-1s, Display Functional Selectivity for Neutrophil Signaling and Function.

    PubMed

    Heo, Jinho; Dogra, Pranay; Masi, Tom J; Pitt, Elisabeth A; de Kruijf, Petra; Smit, Martine J; Sparer, Tim E

    2015-07-01

    Human CMV (HCMV) uses members of the hematopoietic system including neutrophils for dissemination throughout the body. HCMV encodes a viral chemokine, vCXCL-1, that is postulated to attract neutrophils for dissemination within the host. The gene encoding vCXCL-1, UL146, is one of the most variable genes in the HCMV genome. Why HCMV has evolved this hypervariability and how this affects the virus' dissemination and pathogenesis is unknown. Because the vCXCL-1 hypervariability maps to important binding and activation domains, we hypothesized that vCXCL-1s differentially activate neutrophils, which could contribute to HCMV dissemination, pathogenesis, or both. To test whether these viral chemokines affect neutrophil function, we generated vCXCL-1 proteins from 11 different clades from clinical isolates from infants infected congenitally with HCMV. All vCXCL-1s were able to induce calcium flux at a concentration of 100 nM and integrin expression on human peripheral blood neutrophils, despite differences in affinity for the CXCR1 and CXCR2 receptors. In fact, their affinity for CXCR1 or CXCR2 did not correlate directly with chemotaxis, G protein-dependent and independent (β-arrestin-2) activation, or secondary chemokine (CCL22) expression. Our data suggest that vCXCL-1 polymorphisms affect the binding affinity, receptor usage, and differential peripheral blood neutrophil activation that could contribute to HCMV dissemination and pathogenesis.

  3. Impact of oxidative stress on human cytomegalovirus replication and on cytokine-mediated stimulation of endothelial cells.

    PubMed

    Scholz, M; Cinatl, J; Gross, V; Vogel, J U; Blaheta, R A; Freisleben, H J; Markus, B H; Doerr, H W

    1996-06-27

    Transplantation-related pathogenic factors such as ischemia or allograft-directed inflammation are associated with oxidative changes that might lead to cellular oxidative stress. The aim of this study was to investigate the impact of oxidative stress on: (1) CMV replication in cultured human endothelial cells and (2) the stimulation of endothelial cells by proinfiammatory cytokines. Both pathomechanisms are known to contribute to graft rejection crises in vivo. Oxidative stress was induced in endothelial cell cultures with 10-200 microM buthionine sulfoximine. Western blotting showed a significant increase in the production of CMV-specific immediate early and late proteins in buthionine sulfoximine-treated cultures. Immunocytochemical staining suggested that this effect was caused by increased numbers of CMV antigen expressing cells (66% immediate early; 78%, late). Quantitative polymerase chain reaction for CMV-specific DNA and virus titration revealed that enhanced viral replication levels correlated with increased virion production. As a measure for the endothelial cell activation status, the surface expression of HLA-ABC and HLA-DR and adhesion molecules (ICAM-1, ELAM-1, VCAM-1) was quantified by fluorometric methods. Whereas oxidative stress alone did not modulate any surface molecule expression, the IFN-gamma-mediated expression of HLA-ABC and HLA-DR and the IL-1-mediated expression of ICAM-1, but not of ELAM-1 and VCAM-1 (IL-1 + TNF-alpha), was amplified. Interestingly, the amplification of HLA molecule expression was even higher in CMV-infected endothelial cells. This study provides evidence that oxidative stress contributes to the regulation of CMV replication, virus shedding, and the activation of endothelial cells by proinflammatory cytokines as it is observed in transplant recipients.

  4. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  5. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  6. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  7. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  8. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  9. Cytomegalovirus infection accelerates epigenetic aging.

    PubMed

    Kananen, Laura; Nevalainen, Tapio; Jylhävä, Juulia; Marttila, Saara; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-12-01

    Epigenetic mechanisms such as DNA methylation (DNAm) have a central role in the regulation of gene expression and thereby in cellular differentiation and tissue homeostasis. It has recently been shown that aging is associated with profound changes in DNAm. Several of these methylation changes take place in a clock-like fashion, i.e. correlating with the calendar age of an individual. Thus, the epigenetic clock based on these kind of DNAm changes could provide a new biomarker for human aging process, i.e. being able to separate the calendar and biological age. Information about the correlation of the time indicated by this clock to the various aspects of immunosenescence is still missing. As chronic cytomegalovirus (CMV) infection is probably one of the major driving forces of immunosenescence, we now have analyzed the correlation of CMV seropositivity with the epigenetic age in the Vitality 90+cohort 1920 (122 nonagenarians and 21 young controls, CMV seropositivity rates 95% and 57%, respectively). The data showed that CMV seropositivity was associated with a higher epigenetic age in both of these age groups (median 26.5 vs. 24.0 (p < 0.02,Mann–Whitney U-test) in the young controls and 76.0 vs. 70.0 (p < 0.01) in the nonagenarians). Thus, these data provide a new aspect to the CMV associated pathological processes. PMID:26485162

  10. Alveolar Macrophages Are a Prominent but Nonessential Target for Murine Cytomegalovirus Infecting the Lungs

    PubMed Central

    Farrell, Helen E.; Lawler, Clara; Oliveira, Martha T.; Davis-Poynter, Nick

    2015-01-01

    ABSTRACT Cytomegaloviruses (CMVs) infect the lungs and cause pathological damage there in immunocompromised hosts. How lung infection starts is unknown. Inhaled murine CMV (MCMV) directly infected alveolar macrophages (AMs) and type 2 alveolar epithelial cells (AEC2s) but not type 1 alveolar epithelial cells (AEC1s). In contrast, herpes simplex virus 1 infected AEC1s and murid herpesvirus 4 (MuHV-4) infected AEC1s via AMs. MCMV-infected AMs prominently expressed viral reporter genes from a human CMV IE1 promoter; but most IE1-positive cells were AEC2s, and CD11c-cre mice, which express cre in AMs, switched the fluorochrome expression of <5% of floxed MCMV in the lungs. In contrast, CD11C-cre mice exhibited fluorochrome switching in >90% of floxed MuHV-4 in the lungs and 50% of floxed MCMV in the blood. AM depletion increased MCMV titers in the lung during the acute phase of infection. Thus, the influence of AMs was more restrictive than permissive. Circulating monocytes entered infected lungs in large numbers and became infected, but not directly; infection occurred mainly via AEC2s. Mice infected with an MCMV mutant lacking its m131/m129 chemokine homolog, which promotes macrophage infection, showed levels of lung infection equivalent to those of wild-type MCMV-infected mice. The level of lung infiltration by Gr-1-positive cells infected with the MCMV m131/m129-null mutant was modestly different from that for wild-type MCMV-infected lungs. These results are consistent with myeloid cells mainly disseminating MCMV from the lungs, whereas AEC2s provide local amplification. IMPORTANCE Cytomegaloviruses (CMVs) chronically and systemically infect most mammals. Human CMV infection is usually asymptomatic but causes lung disease in people with poor immune function. As human infection is hard to analyze, studies with related animal viruses provide important insights. We show that murine CMV has two targets in the lungs: macrophages and surfactant-secreting epithelial cells

  11. Phenotypic characterization of two naturally occurring human Cytomegalovirus sequence polymorphisms located in a distinct region of ORF UL56 known to be involved in in vitro resistance to letermovir.

    PubMed

    Goldner, Thomas; Zimmermann, Holger; Lischka, Peter

    2015-04-01

    Letermovir is a new drug in Phase 3 clinical development for the prevention of human Cytomegalovirus (HCMV) infections in hematopoietic-stem-cell transplant recipients (HSCT). In contrast to marketed anti-HCMV drugs which all target the viral DNA polymerase, letermovir's novel mode of action targets the UL56 subunit of the viral terminase complex. Consistently letermovir resistance has mapped in vitro to a distinct region within ORF UL56 (amino acid 230-370). Here we used marker transfer to demonstrate that two naturally occurring UL56 sequence variants within this region, located directly adjacent to sites known to mediate letermovir resistance in vitro (D242G and A327V) represent normal interstrain polymorphisms unrelated to drug-resistance.

  12. Congenital Cytomegalovirus Infection.

    PubMed

    Bale, James F.; Miner, Lonnie; Petheram, Susan J.

    2002-05-01

    Intrauterine infection with cytomegalovirus (CMV), a betaherpesvirus, remains the most frequent congenital virus infection in many regions of the world. Although most CMV-infected newborns lack signs of CMV infection, approximately 10% have signs that can consist of low birth weight, jaundice, hepatosplenomegaly, skin rash, microcephaly, and chorioretinitis. Neonates with signs of CMV infection at birth have high rates of audiologic and neurodevelopmental sequelae. Although postnatal therapy with ganciclovir transiently reduces virus shedding and may lessen the audiologic consequences of CMV in some infected infants, additional strategies are needed to prevent congenital CMV disease and to improve the neurodevelopmental prognosis of infants infected with CMV in utero. Some cases of intrauterine infections can be prevented in susceptible women by avoiding contact with the urine or saliva of young children who may be shedding CMV. Vaccines against CMV remain in the experimental stages of development. Termination of pregnancy can be offered to women whose infants have evidence of intrauterine CMV infection and sonographic signs of central nervous system damage. Infants who survive symptomatic intrauterine infections have high rates of neurodevelopmental sequelae and require comprehensive evaluation and therapy through center and home-based early intervention programs. PMID:11931729

  13. Cytomegalovirus infection in transplant recipients

    PubMed Central

    Azevedo*, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Filho, Helio Hehl Caiaffa; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; dos Santos, Vera Aparecida; da Cruz Gouveia Linardi, Camila; Yasuda, Maria Aparecida Shikanai; de Sousa Marques, Heloisa Helena

    2015-01-01

    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  14. Overview: cytomegalovirus and the herpesviruses in transplantation.

    PubMed

    Fishman, J A

    2013-02-01

    Herpesviruses infect most animal species. Infections due to the eight human herpesviruses (HHV) are exacerbated by immunosuppression in organ transplantation. The special features of the herpesvirus life cycle include the ability to establish latent, nonproductive infection and the life-long capacity for reactivation to productive, lytic infection. Interactions between latent virus and the immune system determine the frequency and severity of symptomatic infections. The immunologic and cellular effects of herpesvirus infections contribute to risk for opportunistic infections and graft rejection. Among the most important advances in transplantation are laboratory assays for the diagnosis and monitoring of herpesvirus infections and antiviral agents with improved efficacy in prophylaxis and therapy. For herpes simplex virus, varicella zoster virus and cytomegalovirus, these advances have significantly reduced the morbidity of infection. The syndromes of EBV-associated posttransplant lymphoproliferative disorders (PTLD) and Kaposi's sarcoma remain important complications of immunosuppression. The epidemiology and essential biology of human herpesvirus is reviewed. PMID:23347210

  15. History of the molecular biology of cytomegaloviruses.

    PubMed

    Stinski, Mark F

    2014-01-01

    The history of the molecular biology of cytomegaloviruses from the purification of the virus and the viral DNA to the cloning and expression of the viral genes is reviewed. A key genetic element of cytomegalovirus (the CMV promoter) contributed to our understanding of eukaryotic cell molecular biology and to the development of lifesaving therapeutic proteins. The study of the molecular biology of cytomegaloviruses also contributed to the development of antivirals to control the viral infection.

  16. A human cytomegalovirus early promoter with upstream negative and positive cis-acting elements: IE2 negates the effect of the negative element, and NF-Y binds to the positive element.

    PubMed Central

    Huang, L; Malone, C L; Stinski, M F

    1994-01-01

    The human cytomegalovirus early promoter for the UL4 gene, which codes for an early viral envelope glycoprotein designated gpUL4, requires immediate-early viral protein two (IE2) synthesis to be activated (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281, 1989). We investigated the cis-acting and trans-acting factors that regulate transcription from this UL4 promoter. In transient transfection assays, the viral IE2 protein negated the effect of an upstream cis-acting negative element and enhanced downstream gene expression. A cis-acting positive element contributed to the activity of the viral promoter when an upstream cis-acting negative element was deleted or when the viral IE2 protein was present. The cellular protein(s) that binds to the cis-acting negative element requires further investigation. The cellular protein that binds to the cis-acting positive element was characterized. Two DNA sequence-specific protein complexes were detected with DNA probes spanning the region containing the cis-acting positive element and human cytomegalovirus-infected human fibroblast cell nuclear extracts. The more slowly migrating complex was labeled complex A, and the faster was labeled complex B. Only complex B was detected with mock-infected cell nuclear extracts. Competition experiments confirmed the specificity of the A and B complexes. The protein bound to the DNA in both the complexes contacts a CCAAT box imperfect dyad symmetry (5'CCAATCACTGG3'). Either CCAAT box within the dyad symmetry could compete for binding the nuclear factor. Mutation of the CCAAT box dyad symmetry resulted in a decrease of the transcriptional activity from the UL4 promoter. A cellular transcription factor, antigenically related to nuclear factor-Y (NF-Y), was found in both complexes A and B. Events associated with viral infection caused phosphorylation of protein complex A. Dephosphorylation of the DNA-binding protein converts complex A to complex B. The effect of phosphorylation

  17. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  18. pUL69 of Human Cytomegalovirus Recruits the Cellular Protein Arginine Methyltransferase 6 via a Domain That Is Crucial for mRNA Export and Efficient Viral Replication

    PubMed Central

    Thomas, Marco; Sonntag, Eric; Müller, Regina; Schmidt, Stefanie; Zielke, Barbara; Fossen, Torgils

    2015-01-01

    ABSTRACT The regulatory protein pUL69 of human cytomegalovirus acts as a viral mRNA export factor, facilitating the cytoplasmic accumulation of unspliced RNA via interaction with the cellular mRNA export factor UAP56. Here we provide evidence for a posttranslational modification of pUL69 via arginine methylation within the functionally important N terminus. First, we demonstrated a specific immunoprecipitation of full-length pUL69 as well as pUL69aa1-146 by a mono/dimethylarginine-specific antibody. Second, we observed a specific electrophoretic mobility shift upon overexpression of the catalytically active protein arginine methyltransferase 6 (PRMT6). Third, a direct interaction of pUL69 and PRMT6 was confirmed by yeast two-hybrid and coimmunoprecipitation analyses. We mapped the PRMT6 interaction motif to the pUL69 N terminus and identified critical amino acids within the arginine-rich R1 box of pUL69 that were crucial for PRMT6 and/or UAP56 recruitment. In order to test the impact of putative methylation substrates on the functions of pUL69, we constructed various pUL69 derivatives harboring arginine-to-alanine substitutions and tested them for RNA export activity. Thus, we were able to discriminate between arginines within the R1 box of pUL69 that were crucial for UAP56/PRMT6-interaction and/or mRNA export activity. Remarkably, nuclear magnetic resonance (NMR) analyses revealed the same α-helical structures for pUL69 sequences encoding either the wild type R1/R2 boxes or a UAP56/PRMT6 binding-deficient derivative, thereby excluding the possibility that R/A amino acid substitutions within R1 affected the secondary structure of pUL69. We therefore conclude that the pUL69 N terminus is methylated by PRMT6 and that this critically affects the functions of pUL69 for efficient mRNA export and replication of human cytomegalovirus. IMPORTANCE The UL69 protein of human cytomegalovirus is a multifunctional regulatory protein that acts as a viral RNA export factor with a

  19. Cytomegalovirus Infection in Ireland

    PubMed Central

    Hassan, Jaythoon; O’Neill, Derek; Honari, Bahman; De Gascun, Cillian; Connell, Jeff; Keogan, Mary; Hickey, David

    2016-01-01

    Abstract Cytomegalovirus (CMV) infections occur worldwide and primary infection usually occurs in early childhood and is often asymptomatic whereas primary infection in adults may result in symptomatic illness. CMV establishes a chronic latent infection with intermittent periods of reactivation. Primary infection or reactivation associate with increased mortality and morbidity in those who are immunocompromised. Transplacental transmission may result in significant birth defects or long-term sensorineural hearing loss. We performed a study to determine the CMV seroprevalence and the association between HLA Class I alleles and frequency of CMV infection in Ireland. The presence of CMV IgG, a marker of previous CMV infection, was determined for a cohort of 1849 HLA typed solid organ transplant donors between 1990 and 2013. The presence of CMV IgG was correlated with HLA type. The CMV seroprevalence in solid organ transplant donors was 33.4% (range 22–48% per annum) over the time period 1990 to 2013. Multivariate logistic regression analysis showed that both age and HLA alleles were associated with CMV seropositivity. A significant and positive relationship between age and CMV seropositivity was observed (OR = 1.013, P < 0.001, CI [1.007, 1.019]). Chi-square analysis revealed that the female gender was independently associated with CMV seropositivity (P < 0.01). Seroprevalence in women of reproductive age (20–39 years) was significantly higher than men of the same age (37% vs 26%, P < 0.01). The frequencies of HLA-A1, HLA-A2, and HLA-A3 in our cohort were 40.8%, 48.8%, and 25.9%, respectively. Logistic regression analysis showed that the presence of HLA-A1 but not HLA-A2 or HLA-A3 was independently associated with CMV seronegativity (P < 0.01). Interestingly, individuals who co-expressed HLA-A2 and HLA-A3 alleles were significantly more likely to be CMV seropositive (P < 0.02). The frequencies of HLA-B5, HLA-B7, and HLA-B8 in our cohort

  20. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-08-05

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection.

  1. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  2. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  3. Design and synthesis of pyrrolidine-5,5-trans-lactams (5-oxohexahydropyrrolo[3,2-b]pyrroles) as novel mechanism-based inhibitors of human cytomegalovirus protease. 2. Potency and chirality.

    PubMed

    Borthwick, Alan D; Crame, Andrew J; Ertl, Peter F; Exall, Anne M; Haley, Terry M; Hart, Graham J; Mason, Andrew M; Pennell, Andrew M K; Singh, Onkar M P; Weingarten, Gordon G; Woolven, James M

    2002-01-01

    The stereospecific synthesis of a series of alpha-methylpyrrolidine-5,5-trans-lactam inhibitors of human cytomegalovirus (HCMV) protease is described. Examination of the SAR in this series has defined the size and chirality of the alpha-substituent, optimized the acyl substituent on the lactam nitrogen, and defined the steric constraint of this functionality. The SAR of the functionality on the pyrrolidine nitrogen of the trans-lactam has been investigated, and this has led to the discovery of potent serine protease inhibitors that are highly selective for the viral enzyme over the mammalian enzymes elastase, thrombin, and acetylcholine esterase. The mechanism of action of our lead compounds has been established by mass spectrometry, and enzymatic degradation of HCMV deltaAla protease acylated with these inhibitors showed that Ser 132 is the active site nucleophile. The crystal structure of HCMV protease was obtained and used to model the conformationally restricted, chiral (S)-proline-alpha-methyl-5,5-trans-lactams into the active site groove of the enzyme, enabling us to direct and rationalize the SAR in this series. The activity against HCMV deltaAla protease is the greatest with inhibitors based on the dansyl-(S)-proline alpha-methyl-5,5-trans-lactam template, which have low nanomolar activity against the viral enzyme.

  4. A fusion protein of HCMV IE1 exon4 and IE2 exon5 stimulates potent cellular immunity in an MVA vaccine vector

    SciTech Connect

    Wang, Z.; Zhou, W.; Srivastava, T.; La Rosa, C.; Mandarino, A.; Forman, S.J.; Zaia, J.A.; Britt, W.J.; Diamond, D.J.

    2008-08-01

    A therapeutic CMV vaccine incorporating an antigenic repertoire capable of eliciting a cellular immune response has yet to be successfully implemented for patients who already have acquired an infection. To address this problem, we have developed a vaccine candidate derived from modified vaccinia Ankara (MVA) that expresses three immunodominant antigens (pp65, IE1, IE2) from CMV. The novelty of this vaccine is the fusion of two adjacent exons from the immediate-early region of CMV, their successful expression in MVA, and robust immunogenicity in both primary and memory response models. Evaluation of the immunogenicity of the viral vaccine in mouse models shows that it can stimulate primary immunity against all three antigens in both the CD4{sup +} and CD8{sup +} T cell subsets. Evaluation of human PBMC from healthy CMV-positive donors or patients within 6 months of receiving hematopoietic cell transplant shows robust stimulation of existing CMV-specific CD4{sup +} and CD8{sup +} T cell subsets.

  5. [Historical outlook on cytomegalovirus research].

    PubMed

    Furukawa, T

    1998-01-01

    In historical point of view, cytomegalovirus (CMV) research could be divided into two phases, before and after discovery of the virus from a baby with severe jaundice. CMV is an ubiquitous virus which makes it difficult to diagnose CMV diseases. Therefore criteria for definite CMV disease has been proposed by the expert committee. Basic research is concentrating on analysis of functional map of the sequences, which helps to develop more genetically engineered vaccine and clarify the mechanism of latency of CMV. I hope increased awareness of CMV disease in organ transplantation advances the development of both chemotherapy and preventive method in near future. PMID:9465657

  6. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  7. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process.

  8. Temporal Profiling of the Coding and Noncoding Murine Cytomegalovirus Transcriptomes▿†

    PubMed Central

    Lacaze, Paul; Forster, Thorsten; Ross, Alan; Kerr, Lorraine E.; Salvo-Chirnside, Eliane; Lisnic, Vanda Juranic; López-Campos, Guillermo H.; García-Ramírez, José J.; Messerle, Martin; Trgovcich, Joanne; Angulo, Ana; Ghazal, Peter

    2011-01-01

    The global transcriptional program of murine cytomegalovirus (MCMV), involving coding, noncoding, and antisense transcription, remains unknown. Here we report an oligonucleotide custom microarray platform capable of measuring both coding and noncoding transcription on a genome-wide scale. By profiling MCMV wild-type and immediate-early mutant strains in fibroblasts, we found rapid activation of the transcriptome by 6.5 h postinfection, with absolute dependency on ie3, but not ie1 or ie2, for genomic programming of viral gene expression. Evidence is also presented to show, for the first time, genome-wide noncoding and bidirectional transcription at late stages of MCMV infection. PMID:21471238

  9. Human cytomegalovirus miR-UL112-1 promotes the down-regulation of viral immediate early-gene expression during latency to prevent T-cell recognition of latently infected cells.

    PubMed

    Lau, Betty; Poole, Emma; Van Damme, Ellen; Bunkens, Lieve; Sowash, Madeleine; King, Harry; Murphy, Eain; Wills, Mark; Van Loock, Marnix; Sinclair, John

    2016-09-01

    Human cytomegalovirus, a member of the herpesvirus family, can cause significant morbidity and mortality in immune compromised patients resulting from either primary lytic infection or reactivation from latency. Latent infection is associated with a restricted viral transcription programme compared to lytic infection which consists of defined protein coding RNAs but also includes a number of virally encoded microRNAs (miRNAs). One of these, miR-UL112-1, is known to target the major lytic IE72 transcript but, to date, a functional role for miR-UL112-1 during latent infection has not been shown. To address this, we have analysed latent infection in myeloid cells using a virus in which the target site for miR-UL112-1 in the 3' UTR of IE72 was removed such that any IE72 RNA present during latent infection would no longer be subject to regulation by miR-UL112-1 through the RNAi pathway. Our data show that removal of the miR-UL112-1 target site in IE72 results in increased levels of IE72 RNA in experimentally latent primary monocytes. Furthermore, this resulted in induction of immediate early (IE) gene expression that is detectable by IE-specific cytotoxic T-cells (CTLs); no such CTL recognition of monocytes latently infected with wild-type virus was observed. We also recapitulated these findings in the more tractable THP-1 cell line model of latency. These observations argue that an important role for miR-UL112-1 during latency is to ensure tight control of lytic viral immediate early (IE) gene expression thereby preventing recognition of latently infected cells by the host's potent pre-existing anti-viral CTL response.

  10. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu

    2014-01-01

    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  11. The Downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 Axis and by Human Cytomegalovirus (HCMV) Associated Factors Allows the Activation of the HCMV Major IE Promoter and the Transition to Productive Infection

    PubMed Central

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A.; Doxaki, Christina; Kampranis, Sotirios C.; Kottakis, Filippos; Tsichlis, Philip N.

    2014-01-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program. PMID:24830456

  12. Induction of an Epithelial Integrin αvβ6 in Human Cytomegalovirus-Infected Endothelial Cells Leads to Activation of Transforming Growth Factor-β1 and Increased Collagen Production

    PubMed Central

    Tabata, Takako; Kawakatsu, Hisaaki; Maidji, Ekaterina; Sakai, Takao; Sakai, Keiko; Fang-Hoover, June; Aiba, Motohiko; Sheppard, Dean; Pereira, Lenore

    2008-01-01

    Human cytomegalovirus (CMV) infection is a major cause of morbidity in immunosuppressed individuals, and congenital CMV infection is a leading cause of birth defects in newborns. Infection with pathogenic viral strains alters cell-cell and cell-matrix interactions, affecting extracellular matrix remodeling and endothelial cell migration. The multifunctional cytokine transforming growth factor (TGF)-β1 regulates cell proliferation, differentiation, and extracellular matrix remodeling. Secreted as a latent protein complex, TGF-β1 requires activation before binding to receptors that phosphorylate intracellular effectors. TGF-β1 is activated by integrin αvβ6, which is strongly induced in the epithelium by injury and inflammation but has not previously been found in endothelial cells. Here, we report that CMV infection induces integrin αvβ6 expression in endothelial cells, leading to activation of TGF-β1, signaling through its receptor ALK5, and phosphorylation of its intracellular effector Smad3. Infection of endothelial cells was also found to stimulate collagen synthesis through a mechanism dependent on both TGF-β1 and integrin αvβ6. Immunohistochemical analysis showed integrin αvβ6 up-regulation in capillaries proximal to foci of CMV infection in lungs, salivary glands, uterine decidua, and injured chorionic villi of the placenta, demonstrating both its induction in endothelium and up-regulation in epithelium in vivo. Our results suggest that activation of TGF-β1 by integrin αvβ6 contributes to pathological changes and may impair endothelial cell functions in tissues that are chronically infected with CMV. PMID:18349127

  13. Inactivation and Disassembly of the Anaphase-Promoting Complex during Human Cytomegalovirus Infection Is Associated with Degradation of the APC5 and APC4 Subunits and Does Not Require UL97-Mediated Phosphorylation of Cdh1 ▿

    PubMed Central

    Tran, Karen; Kamil, Jeremy P.; Coen, Donald M.; Spector, Deborah H.

    2010-01-01

    Infection of quiescent cells by human cytomegalovirus (HCMV) elicits severe cell cycle deregulation, resulting in a G1/S arrest, which can be partly attributed to the inactivation of the anaphase-promoting complex (APC). As we previously reported, the premature phosphorylation of its coactivator Cdh1 and/or the dissociation of the core complex can account for the inactivation. We have expanded on these results and further delineated the key components required for disabling the APC during HCMV infection. The viral protein kinase UL97 was hypothesized to phosphorylate Cdh1, and consistent with this, phosphatase assays utilizing a virus with a UL97 deletion mutation (ΔUL97 virus) indicated that Cdh1 is hypophosphorylated at early times in the infection. Mass spectrometry analysis demonstrated that UL97 can phosphorylate Cdh1 in vitro, and the majority of the sites identified correlated with previously characterized cyclin-dependent kinase (Cdk) consensus sites. Analysis of the APC core complex during ΔUL97 virus infection showed APC dissociation occurring at the same time as during infection with wild-type virus, suggesting that the UL97-mediated phosphorylation of Cdh1 is not required for this to occur. Further investigation of the APC subunits showed a proteasome-dependent loss of the APC5 and APC4 subunits that was temporally associated with the disassembly of the APC. Immediate early viral gene expression was not sufficient for the degradation of APC4 and APC5, indicating that a viral early gene product(s), possibly in association with a de novo-synthesized cellular protein(s), is involved. PMID:20686030

  14. Reconstitution of Human Cytomegalovirus-Specific CD4+ T Cells is Critical for Control of Virus Reactivation in Hematopoietic Stem Cell Transplant Recipients but Does Not Prevent Organ Infection.

    PubMed

    Gabanti, Elisa; Lilleri, Daniele; Ripamonti, Francesco; Bruno, Francesca; Zelini, Paola; Furione, Milena; Colombo, Anna A; Alessandrino, Emilio P; Gerna, Giuseppe

    2015-12-01

    The relative contribution of human cytomegalovirus (HMCV)-specific CD4(+) and CD8(+) T cells to the control of HCMV infection in hematopoietic stem cell transplant (HSCT) recipients is still controversial. HCMV reactivation and HCMV-specific CD4(+) and CD8(+) T cell reconstitution were monitored for 1 year in 63 HCMV-seropositive patients receiving HSCT. HCMV reactivation was detected in all but 2 patients. In 20 of 63 (31.7%) patients (group 1) HCMV infection resolved spontaneously, whereas 32 of 63 (50.8%) patients (group 2) controlled the infection after a single short-course of pre-emptive therapy and the remaining 9 (14.3%) patients (group 3) suffered from relapsing episodes of HCMV infection, requiring multiple courses of antiviral therapy. The kinetics and magnitude of HCMV-specific CD8(+) T cell reconstitution were comparable among the 3 groups, but HCMV-specific CD4(+) T cells were lower in number in patients requiring antiviral treatment. HCMV-seronegative donors, as well as unrelated donors (receiving antithymocyte globulin) and acute graft-versus-host disease (GVHD) were associated with both delayed HCMV-specific CD4(+) T cell reconstitution and severity of infection. Conversely, these risk factors had no impact on HCMV-specific CD8(+) T cells. Eight patients with previous GVHD suffered from HCMV gastrointestinal disease, although in the presence of HCMV-specific CD4(+) and CD8(+) systemic immunity and undetectable HCMV DNA in blood. Reconstitution of systemic HCMV-specific CD4(+) T cell immunity is required for control of HCMV reactivation in adult HSCT recipients, but it may not be sufficient to prevent late-onset organ localization in patients with GVHD. HCMV-specific CD8(+) T cells contribute to control of HCMV infection, but only after HCMV-specific CD4(+) T cell reconstitution.

  15. The downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 axis and by human cytomegalovirus (HCMV) associated factors allows the activation of the HCMV major IE promoter and the transition to productive infection.

    PubMed

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A; Doxaki, Christina; Kampranis, Sotirios C; Kottakis, Filippos; Tsichlis, Philip N

    2014-05-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program.

  16. Cytomegalovirus Primary Envelopment Occurs at Large Infoldings of the Inner Nuclear Membrane▿

    PubMed Central

    Buser, Christopher; Walther, Paul; Mertens, Thomas; Michel, Detlef

    2007-01-01

    We have investigated the morphogenesis of human and murine cytomegalovirus by transmission electron microscopy after high-pressure freezing, freeze substitution, and plastic embedding. We observed large tubular infoldings of the inner nuclear membrane that were free of lamina and active in primary envelopment and subsequent transport of capsids to the nuclear periphery. Semiquantitative determinations of the enlarged inner nuclear membrane area and the location of the primary envelopment of nucleocapsids demonstrated that this structure represents a virus-induced specialized membrane domain at which the particles are preferentially enveloped. This is a previously undescribed structural element relevant in cytomegalovirus morphogenesis. PMID:17192309

  17. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators

    PubMed Central

    Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-01-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  18. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators.

    PubMed

    Kim, Ye Ji; Kim, Eui Tae; Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-08-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  19. Horizontal In Utero Acquisition of Cytomegalovirus Infection in a Twin Pregnancy

    PubMed Central

    Gabrielli, Liliana; Lazzarotto, Tiziana; Foschini, Maria Pia; Lanari, Marcello; Guerra, Brunella; Eusebi, Vincenzo; Landini, Maria Paola

    2003-01-01

    It is generally accepted that viral infections can be transmitted horizontally by direct or indirect contact with virus-excreting persons, and some viral infections can be transmitted vertically, either prenatally or perinatally, from mother to child. This report presents data strongly supporting a prenatal horizontal acquisition of human cytomegalovirus infection in a twin pregnancy. PMID:12624079

  20. Modeling cytomegalovirus infection in mouse tumor models.

    PubMed

    Price, Richard Lee; Chiocca, Ennio Antonio

    2015-01-01

    The hypothesis that cytomegalovirus (CMV) modulates cancer is evolving. Originally discovered in glioblastoma in 2002, the number of cancers, where intratumoral CMV antigen is detected, has increased in recent years suggesting that CMV actively affects the pathobiology of certain tumors. These findings are controversial as several groups have also reported inability to replicate these results. Regardless, several clinical trials for glioblastoma are underway or have been completed that target intratumoral CMV with anti-viral drugs or immunotherapy. Therefore, a better understanding of the possible pathobiology of CMV in cancer needs to be ascertained. We have developed genetic, syngeneic, and orthotopic malignant glioma mouse models to study the role of CMV in cancer development and progression. These models recapitulate for the most part intratumoral CMV expression as seen in human tumors. Additionally, we discovered that CMV infection in Trp53(-/+) mice promotes pleomorphic rhabdomyosarcomas. These mouse models are not only a vehicle for studying pathobiology of the viral-tumor interaction but also a platform for developing and testing cancer therapeutics. PMID:25853089

  1. CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter.

    PubMed Central

    Schwartz, R; Helmich, B; Spector, D H

    1996-01-01

    The human cytomegalovirus (HCMV) immediate-early region 2 86-kDa protein (IE2 86) is the major transactivator of the promoter for the 2.2-kb class of early RNAs (open reading frame UL 112-113). Previously, we reported that a DNA segment on this promoter between nucleotides (nt) -113 and -59 was critical for activation by IE2 86 in vivo and could be bound by IE2 86 in vitro (R. Schwartz, M. H. Sommer, A. Scully, and D. H. Spector, J. Virol. 68:5613-5622, 1994). With a set of site-specific mutations within nt -84 to -61, we have localized the essential cis-acting sequences to nt -72 to -61, which contain an ATF/CREB-binding site. The IE2 86-binding site between nt -113 and -85 is not essential for activation of the promoter by IE2 86 in transient-expression assays, but its presence can enhance the level of activation mediated through the sequences located between nt -84 and -59. Electrophoretic mobility shift assays with a segment containing nt -84 to -59 and nuclear extracts from human cells permissive for the HCMV infection revealed a complex band pattern. However, by supershift analysis with specific antibodies, we were able to identify CREB as the major ATF/CREB family member in the protein-DNA complexes. Further evidence that CREB is a target for IE2 86-mediated induction, is provided by the finding that IE2 86 activates the somatostatin promoter to high levels. Although the binding of IE2 86 to nonphosphorylated full-length CREB or deltaCREB is minimal, IE2 86 does form complexes with p300 and the CREB-binding protein (CBP), which in turn bind to CREB and can serve as adaptor proteins for CREB function. In addition, the in vivo functional relevance of the interaction between IE2 86 and CBP is indicated by the ability of IE2 86 to enhance transcriptional activation mediated by a GAL4-CBP fusion protein brought to a promoter by GAL4-binding sites. PMID:8794339

  2. Pyrrolidine-5,5-trans-lactams as novel mechanism-based inhibitors of human cytomegalovirus protease. Part 3: potency and plasma stability.

    PubMed

    Borthwick, Alan D; Exall, Anne M; Haley, Terry M; Jackson, Deborah L; Mason, Andrew M; Weingarten, Gordon G

    2002-07-01

    Mechanism-based inhibitors of HCMV protease, which are stable to human plasma (> or = 20 h) and have single-figure potency in the microM range against HCMV protease, have been developed based on the dansylproline alpha-methyl pyrrolidine-5,5-trans-lactam nucleus.

  3. Rare presentations of cytomegalovirus infection in renal allograft recipients.

    PubMed

    Ardalan, Mohammadreza

    2012-01-01

    Cytomegalovirus is the most common viral infection after kidney transplantation. Clinical presentations of cytomegalovirus infection range from asymptomatic infection to organ-specific involvement. Most symptomatic infections manifest as fever and cytopenia. The gastrointestinal tract is the most common site of tissue-invasive infection, often presenting as diarrhea or gastrointestinal bleeding. Gastrointestinal obstruction, perforation, thrombosis of large gastrointestinal veins, splenic artery thrombosis, and pancreatitis are rare gastrointestinal presentations of cytomegalovirus infection. Renal-allograft ureteral stricture and skin involvement are other rare presentations of cytomegalovirus infection. hemophagocytic syndrome, thrombotic microangiopathy, adrenal insufficiency, and renal allograft artery stenosis are other rare symptoms of cytomegalovirus infection.

  4. Cytomegalovirus excretion in gnotobiotic pigs.

    PubMed Central

    Edington, N.; Watt, R. G.; Plowright, W.

    1976-01-01

    Germ-free piglets were infected intranasally with porcine cytomegalovirus (PCMV) at 1 day (group A) or 3 weeks of age (group B). Viraemia and virus excretion by the nasal, pharyngeal and conjunctival routes was studied up to the time of death or to 12 weeks. Virus was also sought in tissues at death or at slaughter, as well as in a few urine samples. Viraemia was detected in group A between days 5 and 19 after infection and in group B between days 14 and 16 inclusive. The chief route of virus excretion was the nasal mucosa, followed by the pharynx and conjunctiva; the maximal duration of excretion by these routes was 32, 25 and 14 days for pigs of group A and 9, 7 and 4 days for group B. The quantity of virus was also greater in the former group, of which died of generalized PCMV infection. A viruria was demonstrated in 2 animals. Antibody detectable in indirect immunofluorescence (IIF) tests appeared towards the end of the third week, reaching maximal titres at 5 to 7 weeks after infection. The mean peak titre of antibody in group B was lower than in group A. Corticosteroid treatment at days 56--62 after infection resulted in some recrudescence of virus excretion, accompanied in group B by about a twofold increase in IIF antibody. PCMV was isolated in cultures of lung macrophages from 4 of 7 animals killed at about 12 weeks after inoculation. PMID:185292

  5. Cytomegalovirus Immunoglobulin After Thoracic Transplantation

    PubMed Central

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-01-01

    Abstract Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R−). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  6. Fetal cytomegalovirus infection manifesting as transient pancytopenia.

    PubMed

    Kiyokoba, Ryo; Hidaka, Nobuhiro; Sakata, Yukiyo; Hachisuga, Kazuhisa; Fukushima, Kotaro; Kato, Kiyoko

    2015-08-01

    We encountered a patient with a fetal cytomegalovirus infection manifesting as pancytopenia and thoracic hypoplasia. The fetal anemia was treated by transfusion via the umbilical cord, and did not progress after 22 weeks' gestation. The neutropenia resolved spontaneously, and only thrombocytopenia was persistent at birth. The severe thoracic hypoplasia led to pulmonary hypertension and required intensive postnatal respiratory management. Our experience suggests that pancytopenia is a possible manifestation in fetuses infected with cytomegalovirus. This may be transient, resolving spontaneously during fetal life; however, caution should be taken with blood counts, particularly platelet counts, after delivery. In addition, clinicians should carefully follow the thoracic volume in cytomegalovirus-infected fetuses and consider the possibility of postnatal severe respiratory insufficiency.

  7. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation

    PubMed Central

    Cloarec, Robin; Bauer, Sylvian; Luche, Hervé; Buhler, Emmanuelle; Pallesi-Pocachard, Emilie; Salmi, Manal; Courtens, Sandra; Massacrier, Annick; Grenot, Pierre; Teissier, Natacha; Watrin, Françoise; Schaller, Fabienne; Adle-Biassette, Homa; Gressens, Pierre; Malissen, Marie; Stamminger, Thomas; Streblow, Daniel N.; Bruneau, Nadine; Szepetowski, Pierre

    2016-01-01

    Background Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells. Objectives and Methods In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15) and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments. Results Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b– lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1. Conclusion In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which

  8. Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRI, BglII, and HindIII.

    PubMed Central

    Spector, D H; Hock, L; Tamashiro, J C

    1982-01-01

    We have used cloned EcoRI fragments of the human CMV (HCMV) genome, strain AD169, to prepare restriction endonuclease maps of the DNA. Individual 32P-labeled cloned fragments were hybridized to Southern blots of HCMV DNA cleaved to completion with the restriction endonucleases BglII and HindIII and cleaved partially with EcoRI. By determining which EcoRI fragments hybridized to the same band on a Southern blot, we were able to establish linkage groups. This information coupled with the data derived from digestion of the cloned fragments with the enzymes BglII and HindIII (Tamashiro et al., J. Virol. 42:547-557, 1982) provided the basis for the construction of detailed maps for the enzymes EcoRI, BglII, and HindIII. We also identified the EcoRI fragments derived from the termini of this genome and mapped them with respect to the BglII and HindIII terminal fragments. From our mapping data, we conclude that the genome of HCMV is approximately 240 kilobases in length and is divided into long (198 kilobases) and short (42 kilobases) regions. Both regions consist of a unique sequence bounded by inverted repeats (11 to 12 kilobases for the long region and 2 to 3 kilobases for the short region). Furthermore, the long and short regions can invert relative to each other. Images PMID:6283173

  9. Subclinical Congenital Cytomegalovirus Infection and Hearing Impairment

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1974-01-01

    When the hearing sensitivity of children with subclinical congenital cytomegalovirus infection was evaluated and compared with that of a group of matched control subjects, nine of the 18 infected subjects were found to have some hearing loss, ranging from slight high-frequency impairments to a severe-to-profound unilateral loss. (MYS)

  10. [Hemophagocytic syndrome associated with cytomegalovirus viral infection].

    PubMed

    Núñez Bacarreza, J J; Montiel López, L; Núñez del Prado Alcoreza, J R

    2011-04-01

    The clinical case of a 19-year old woman with the clinical criteria of Cytomegalovirus (CMV) viral associated with Hemophagocytic syndrome (VAHS) is presented. The clinical outcome was poor and rapidly progressive, ending in exitus letalis. The principal concepts and characteristics of the Hemophagocytic syndrome are discussed, stressing the current consensus rules and the variations in management according to international guidelines.

  11. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  12. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-12-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  13. A Proteomics Analysis of Human Cytomegalovirus Particles

    SciTech Connect

    Streblow, Daniel N.; Varnum, Susan M.; Smith, Richard D.; Nelson, Jay

    2006-01-01

    While the sequence of the AD169 HCMV genome has been known for several years, the viral and cellular proteins that compose the infectious HCMV virion and entry-competent, non-replicating viral particles such as Dense Bodies (DBs) and Non-Infectious Enveloped Particles (NIEPs) are unknown. To approach this problem we have utilized a gel-free 2-D capillary liquid chromatography (LC)-MS/MS and Fourier transform ion cyclotron resonance (FTICR) mass spectrometry to identify and determine the relative abundance of viral and cellular proteins in purified HCMV AD169 particles. !is study has identified and quantitated the proteins that compose both HCMV virions and DBs. While a number of previously identified proteins were detected by this method the number of viral proteins that compose the HCMV virion was doubled in this study suggesting that over a third of the viral open reading frames are part of an infectious virion. !is chapter will discuss the implications of our findings in relation to what was previously known about HCMV and MCMV virion composition.

  14. A Human Cytomegalovirus gO-Null Mutant Fails To Incorporate gH/gL into the Virion Envelope and Is Unable To Enter Fibroblasts and Epithelial and Endothelial Cells▿

    PubMed Central

    Wille, Paul T.; Knoche, Amber J.; Nelson, Jay A.; Jarvis, Michael A.; Johnson, David C.

    2010-01-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRΔgO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRΔgO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRΔgO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRΔgO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRΔgO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of gH/gL complexes into the HCMV

  15. A human cytomegalovirus gO-null mutant fails to incorporate gH/gL into the virion envelope and is unable to enter fibroblasts and epithelial and endothelial cells.

    PubMed

    Wille, Paul T; Knoche, Amber J; Nelson, Jay A; Jarvis, Michael A; Johnson, David C

    2010-03-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRDeltagO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRDeltagO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRDeltagO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRDeltagO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRDeltagO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of g

  16. Thrombosis associated with acute cytomegalovirus infection: a narrative review

    PubMed Central

    Sherman, Shany; Eytan, Ori

    2014-01-01

    Thrombosis associated with acute cytomegalovirus infection has been reported many times in the literature since the mid 1980s – mainly in case reports and in small case series, but also in four controlled studies. Still, many physicians are unaware of this association although acute cytomegalovirus infection diagnosis in a thrombosis patient may warrant antiviral therapy and may affect anticoagulation therapy duration. Accordingly, the clinical characteristics of patients with thrombosis and acute cytomegalovirus infection are reviewed, and the current knowledge concerning this unique association is presented herein. We believe it is time to add acute cytomegalovirus infection to the list of thrombosis triggers. PMID:25624857

  17. [Intravitreal ganciclovir in cytomegalovirus retinitis in AIDS].

    PubMed

    Olea, J L; Salvat, M; Mateos, J M; Vila, J; Villalonga, C; Riera, M

    1996-04-01

    A retrospective study was made of 26 patients with AIDS who initially presented with retinitis as the only clinical manifestation of cytomegalovirus infection (39 eyes). Sixty-five induction or re-induction therapeutic courses were administered with intravitreal ganciclovir. The efficiency rate of therapy was 93.8%. Thirty-eight maintenance therapeutic courses (200 micrograms/week) were evaluated. The non-compliance rate was 23%. Bilateral retinitis occurred in 44.4% of cases. The systemic administration of therapy had to be substituted for the intravitreal administration in 32% of patients during the clinical course of their conditions. The mean survival rate was 9.5 months. Both retinal detachment and vitreal hemorrhage occurred in 5% of patients. When retinitis is the first clinical manifestation of cytomegalovirus infection, therapy with intravitreal ganciclovir is efficacious to inactivate lesions. Although bilateral retinitis and extraocular dissemination are common, the mean survival rate is high.

  18. Cytomegalovirus and HIV: A Dangerous Pas de Deux.

    PubMed

    Gianella, Sara; Letendre, Scott

    2016-10-01

    Human immunodeficiency virus (HIV)-infected adults who take stable antiretroviral therapy (ART) are at risk for early onset of age-related diseases. This is likely due to a complex interaction between traditional risk factors, HIV infection itself, and other factors, such as underlying immune dysfunction and persistent inflammation. HIV disrupts the balance between the host and coinfecting microbes, worsening control of these potential pathogens. For example, HIV-infected adults are more likely than the general population to have subclinical bursts of cytomegalovirus (CMV) replication at mucosal sites. Production of antigens can activate the immune system and stimulate HIV replication, and it could contribute to the pathogenesis of adverse outcomes of aging, like cardiovascular disease and neurocognitive impairment. Further investigation of the relationships between CMV, immune dysfunction, and unsuccessful aging during chronic HIV infection is warranted. PMID:27625433

  19. Cytomegalovirus UL103 controls virion and dense body egress.

    PubMed

    Ahlqvist, Jenny; Mocarski, Edward

    2011-05-01

    Human cytomegalovirus UL103 encodes a tegument protein that is conserved across herpesvirus subgroups. Mutant viruses lacking this gene product exhibit dramatically reduced accumulation of cell-free virus progeny and poor cell-to-cell spread. Given that viral proteins and viral DNA accumulate with normal kinetics in cells infected with mutant virus, UL103 appears to function during the late phase of replication, playing a critical role in egress of capsidless dense bodies and virions. Few dense bodies were observed in the extracellular space in mutant virus-infected cells in the presence or absence of the DNA encapsidation inhibitor 2-bromo-5,6-dichloro-1-(β-d-ribofuranosyl)benzimidazole. Upon reversal of encapsidation inhibition, UL103 had a striking impact on accumulation of cell-free virus, but not on accumulation of cell-associated virus. Thus, UL103 plays a novel and important role during maturation, regulating virus particle and dense body egress from infected cells.

  20. Cytomegalovirus Cutaneous Infection in an Immunocompromised Patient

    PubMed Central

    Pedersen, Faye T; Alhassan, Sulaiman; Adjapong, Opoku; Thirumala, Raghukumar

    2016-01-01

    Cytomegalovirus (CMV), a member of the Herpesviridae family, is an opportunistic infection with a typically benign course in the healthy host but has a more ominous course in the immunocompromised population. CMV infection commonly affects the visceral organs, particularly the respiratory and the gastrointestinal tract. CMV cutaneous lesions are rare and can be easily missed. We present a case of a 76-year-old woman presenting with a diffuse non-pruritic macular lesion with scattered vesicles and bullae, which was initially treated as a varicella zoster virus infection and herpes simplex viral infection, but was later found on biopsy to be due to cytomegalovirus. She has a history of Sjögren's syndrome, interstitial lung disease, and being on chronic immunosuppression therapy. This case highlights the importance of considering CMV infection in the differential diagnosis of vesicular skin lesions in immunocompromised patients. Based on a PubMed search for “cutaneous cytomegalovirus”, “cutaneous CMV”, “cytomegalovirus skin”, and “skin CMV” in material published in the last 20 years (from 1996 to 2016) and reviewing any applicable referenced material outside of those dates, cases of cutaneous CMV are not well documented. PMID:27335710

  1. Examining the Species-Specificity of Rhesus Macaque Cytomegalovirus (RhCMV) in Cynomolgus Macaques

    PubMed Central

    Perciani, Catia T.; Russell, Justen N. Hoffman; Chan, Jacqueline K.; Janes, Michelle; Antony, Joseph M.; Pilon, Richard; Sandstrom, Paul; Willer, David O.; MacDonald, Kelly S.

    2015-01-01

    Cytomegalovirus (CMV) is a highly species-specific virus that has co-evolved with its host over millions of years and thus restricting cross-species infection. To examine the extent to which host restriction may prevent cross-species research between closely related non-human primates, we evaluated experimental infection of cynomolgus macaques with a recombinant rhesus macaque-derived CMV (RhCMV-eGFP). Twelve cynomolgus macaques were randomly allocated to three groups: one experimental group (RhCMV-eGFP) and two control groups (UV-inactivated RhCMV-eGFP or media alone). The animals were given two subcutaneous inoculations at week 0 and week 8, and a subset of animals received an intravenous inoculation at week 23. No overt clinical or haematological changes were observed and PBMCs isolated from RhCMV-eGFP inoculated animals had comparable eGFP- and IE-1-specific cellular responses to the control animals. Following inoculation with RhCMV-eGFP, we were unable to detect evidence of infection in any blood or tissue samples up to 4 years post-inoculation, using sensitive viral co-culture, qPCR, and Western blot assays. Co-culture of urine and saliva samples demonstrated the presence of endogenous cynomolgus CMV (CyCMV) cytopathic effect, however no concomitant eGFP expression was observed. The absence of detectable RhCMV-eGFP suggests that the CyCMV-seropositive cynomolgus macaques were not productively infected with RhCMV-eGFP under these inoculation conditions. In a continued effort to develop CMV as a viral vector for an HIV/SIV vaccine, these studies demonstrate that CMV is highly restricted to its host species and can be highly affected by laboratory cell culture. Consideration of the differences between lab-adapted and primary viruses with respect to species range and cell tropism should be a priority in evaluating CMV as vaccine vector for HIV or other pathogens at the preclinical development stage. PMID:25822981

  2. Mouse cytomegalovirus immediate-early protein 1 binds with host cell repressors to relieve suppressive effects on viral transcription and replication during lytic infection.

    PubMed

    Tang, Qiyi; Maul, Gerd G

    2003-01-01

    Herpesviruses start their transcriptional cascade at nuclear domain 10 (ND10). The deposition of virus genomes at these nuclear sites occurs due to the binding of the interferon-inducible repressor protein promyelocytic leukemia protein (PML) and/or Daxx to a viral DNA-protein complex. However, the presence of repressive proteins at the nuclear site of virus transcription has remained unexplained. We investigated the mouse cytomegalovirus (MCMV) immediate-early 1 protein (IE1), which is necessary for productive infection at low multiplicities of infection and therefore likely to be involved in overcoming cellular repression. Temporal analysis of IE1 distribution revealed its initial segregation into ND10 by binding to PML and/or Daxx and IE1-dependent recruitment of the transcriptional repressor histone deacetylase-2 (HDAC-2) to this site. However, these protein aggregates are dissociated in cells producing sufficient IE1 through titration of PML, Daxx, and HDAC-2. Importantly, binding of IE1 to HDAC-2 decreased deacetylation activity. Moreover, inhibition of HDAC by trichostatin-A resulted in an increase in viral protein synthesis, an increase in cells starting the formation of prereplication compartments, and an increase in the total infectious viruses produced. Thus, IE1, like trichostatin-A, reverses the repressive effect of HDAC evident in the presence of acetylated histones in the immediate-early promoter region. Since HDAC also binds to the promoter region of IE1, as determined by the chromatin immunoprecipitation assay, these combined results suggest that IE1 inhibits or reverses HDAC-mediated repression of the infecting viral genomes, possibly by a process akin to activation of heterochromatin. We propose that even permissive cells can repress transcription of infecting viral genomes through repressors, including HDAC, Daxx, and PML, and the segregation of IE1 to ND10 that would inactivate those repressors. The virus can counter this repression by

  3. Complete Genome Sequences of Mandrillus leucophaeus and Papio ursinus Cytomegaloviruses.

    PubMed

    Blewett, Earl Linwood; Sherrod, Carly J; Texier, Jordan R; Conrad, Tom M; Dittmer, Dirk P

    2015-01-01

    The complete genome sequences of Mandrillus leucophaeus and Papio ursinus cytomegaloviruses were determined. An isolate from a drill monkey, OCOM6-2, and an isolate from a chacma baboon, OCOM4-52, were subjected to pyrosequencing and assembled. Comparative alignment of published primate cytomegaloviruses (CMVs) showed variable sequence conservation between species.

  4. Dataset of aqueous humor cytokine profile in HIV patients with Cytomegalovirus (CMV) retinitis.

    PubMed

    Iyer, Jayant Venkatramani; Agrawal, Rupesh; Yeo, Tun Kuan; Gunasekeran, Dinesh V; Balne, Praveen Kumar; Lee, Bernett; Au, Veonice Bijin; Connolly, John; Teoh, Stephen C B

    2016-09-01

    The data shows the aqueous humor cytokine profiling results acquired in a small cohort of 17 HIV patients clinically diagnosed with Cytomegalovirus retinitis using the FlexMAP 3D (Luminex®) platform using the Milliplex Human Cytokine® kit. Aqueous humor samples were collected from these patients at different time points (pre-treatment and at 4-weekly intervals through the 12-week course of intravitreal ganciclovir treatment) and 41 cytokine levels were analyzed at each time point. CMV DNA viral load was assessed in 8 patients at different time points throughout the course of ganciclovir treatment. The data described herein is related to the research article entitled "Aqueous humor immune factors and cytomegalovirus (CMV) levels in CMV retinitis through treatment - The CRIGSS study" (Iyer et al., 2016) [1]. Cytokine levels against the different time points which indicate the response to the given treatment and against the CMV viral load were analyzed. PMID:27547803

  5. The murine cytomegalovirus (MCMV) homolog of the HCMV phosphotransferase (UL97(pk)) gene.

    PubMed

    Rawlinson, W D; Zeng, F; Farrell, H E; Cunningham, A L; Scalzo, A A; Booth, T W; Scott, G M

    1997-07-01

    The murine cytomegalovirus (MCMV) M97 gene is homologous with both eukaryotic protein kinases and the phosphotransferases of herpesviruses. The gene conserves the domain structure of protein kinases and of the human cytomegalovirus UL97 (phosphotransferase) gene. An M97 transcript of 2.5 kb is present predominantly at late times, and much smaller quantities of the transcript are detected at early times postinfection. Comparison of the DNA sequences of the complete M97 genes from 12 ganciclovir-sensitive and aciclovir-sensitive strains of MCMV showed that the sensitive isolates strongly conserve the sequence of the catalytic domains, but have only moderate conservation of the sequence of the amino-terminal (regulatory) region. MCMV provides a useful model for studying the in vivo function of the phosphotransferase genes of the betatherpesviruses and has potential for use in studies of antiviral resistance. PMID:9217058

  6. Massive Alimentary Tract Bleeding due to Cytomegalovirus Infection in an Elderly Patient.

    PubMed

    Koc, Bora; Bircan, Huseyin Yuce; Altaner, Semsi; Cinar, Ozlem; Ozcelik, Umit; Yavuz, Alpaslan; Kemik, Ozgur

    2014-08-13

    In recent years, cytomegalovirus (CMV) has been recognized as an important common pathogen in immunocompromized patients. This is due to the increasing number of immunosuppressive medications, intensive cancer chemotherapy use, recurrent transplantations, progressively aging population, and the higher number of human immunodeficiency virus infections. Cytomegalovirus infection especially interests the gastrointestinal tract, anywhere, from the mouth to the anus. Namely, the most commonly affected area is the colon, followed by duodenum, stomach, esophagus and small intestine. The most frequent manifestations of CMV colitis are: diarrhea, fever, gastrointestinal bleeding and abdominal pain. We report here the case of an 82-year-old woman, who was treated for non-Hodgkin lymphoma; she was admitted to the emergency department for abdominal pain and diffuse arthralgia, following massive upper- and lower- gastrointestinal bleeding, due to duodenal and colonic ulcers related to CMV infection. PMID:25276331

  7. Strongyloides Hyperinfection Syndrome Combined with Cytomegalovirus Infection

    PubMed Central

    Alsaeed, Mohammed; Ballool, Sulafa; Attia, Ashraf

    2016-01-01

    The mortality in Strongyloides hyperinfection syndrome (SHS) is alarmingly high. This is particularly common in bone marrow, renal, and other solid organ transplant (SOT) patients, where figures may reach up to 50–85%. Immunosuppressives, principally corticosteroids, are the primary triggering factor. In general, the clinical features of Strongyloides stercoralis hyperinfection are nonspecific; therefore, a high index of suspicion is required for early diagnosis and starting appropriate therapy. Although recurrent Gram-negative sepsis and meningitis have been previously reported, the combination of both cytomegalovirus (CMV) and strongyloidiasis had rarely been associated. We here describe a patient who survived SHS with recurrent Escherichia coli (E. coli) urosepsis and CMV infection. PMID:27703835

  8. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions.

    PubMed

    Walzer, Sascha A; Egerer-Sieber, Claudia; Sticht, Heinrich; Sevvana, Madhumati; Hohl, Katharina; Milbradt, Jens; Muller, Yves A; Marschall, Manfred

    2015-11-13

    Nuclear replication of cytomegalovirus relies on elaborate mechanisms of nucleocytoplasmic egress of viral particles. Thus, the role of two essential and conserved viral nuclear egress proteins, pUL50 and pUL53, is pivotal. pUL50 and pUL53 heterodimerize and form a core nuclear egress complex (NEC), which is anchored to the inner nuclear membrane and provides a scaffold for the assembly of a multimeric viral-cellular NEC. Here, we report the crystal structure of the pUL50-pUL53 heterodimer (amino acids 1-175 and 50-292, respectively) at 2.44 Å resolution. Both proteins adopt a globular fold with mixed α and β secondary structure elements. pUL53-specific features include a zinc-binding site and a hook-like N-terminal extension, the latter representing a hallmark element of the pUL50-pUL53 interaction. The hook-like extension (amino acids 59-87) embraces pUL50 and contributes 1510 Å(2) to the total interface area (1880 Å(2)). The pUL50 structure overall resembles the recently published NMR structure of the murine cytomegalovirus homolog pM50 but reveals a considerable repositioning of the very C-terminal α-helix of pUL50 upon pUL53 binding. pUL53 shows structural resemblance with the GHKL domain of bacterial sensory histidine kinases. A close examination of the crystal structure indicates partial assembly of pUL50-pUL53 heterodimers to hexameric ring-like structures possibly providing additional scaffolding opportunities for NEC. In combination, the structural information on pUL50-pUL53 considerably improves our understanding of the mechanism of HCMV nuclear egress. It may also accelerate the validation of the NEC as a unique target for developing a novel type of antiviral drug and improved options of broad-spectrum antiherpesviral therapy.

  9. Report from the second cytomegalovirus and immunosenescence workshop

    PubMed Central

    2011-01-01

    The Second International Workshop on CMV & Immunosenescence was held in Cambridge, UK, 2-4th December, 2010. The presentations covered four separate sessions: cytomegalovirus and T cell phenotypes; T cell memory frequency, inflation and immunosenescence; cytomegalovirus in aging, mortality and disease states; and the immunobiology of cytomegalovirus-specific T cells and effects of the virus on vaccination. This commentary summarizes the major findings of these presentations and references subsequently published work from the presenter laboratory where appropriate and draws together major themes that were subsequently discussed along with new areas of interest that were highlighted by this discussion. PMID:22035114

  10. Progressive Hearing Impairment in Children with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1979-01-01

    Audiological assessment of 86 children (mean age 38 months at last evaluation time) with congenital cytomegalovirus infection revealed progressive hearing loss in four of 12 Ss with sensorineural hearing impairments. Case descriptions documented the progression of the hearing loss. (Author)

  11. Late cytomegalovirus infection after hematopoietic stem cell transplantation: case reports

    PubMed Central

    Pinheiro, Sâmara Grapiuna; de Matos, Sócrates Bezerra; Botura, Mônica Borges; Meyer, Roberto; Lima, Fernanda Washington de Mendonça

    2013-01-01

    Cytomegalovirus is related to high rates of morbidity and mortality after hematopoietic stem cell transplantation. This report highlights the importance of adequate monitoring and management of this infection. We report on two cases of patients with late subclinical cytomegalovirus infection. These patients were monitored for antigenemia by indirect immunofluorescence assay. Active cytomegalovirus infection is most common in the first three months after transplantation however the cases reported herein show the importance of monitoring for active infection after Day +100 post-transplantation. Early detection of active infection enables quick preemptive therapy. In conclusion, we emphasize that patients with risk factors for developing severe or late cytomegalovirus disease should be monitored for more than 100 post-transplant days as late active infection is a reality. PMID:24478611

  12. Synthetic DNA approach to cytomegalovirus vaccine/immune therapy.

    PubMed

    Wu, Stephan J; Villarreal, Daniel O; Shedlock, Devon J; Weiner, David B

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60-95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem.

  13. Synthetic DNA Approach to Cytomegalovirus Vaccine/Immune Therapy

    PubMed Central

    Wu, Stephan J.; Villarreal, Daniel O.; Shedlock, Devon J.; Weiner, David B.

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60–95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem. PMID:25757619

  14. Synthetic DNA approach to cytomegalovirus vaccine/immune therapy.

    PubMed

    Wu, Stephan J; Villarreal, Daniel O; Shedlock, Devon J; Weiner, David B

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60-95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem. PMID:25757619

  15. Antiviral Prevention of Sepsis Induced Cytomegalovirus Reactivation in Immunocompetent Mice

    PubMed Central

    Forster, Meghan R.; Trgovcich, Joanne; Zimmerman, Peter; Chang, Alexander; Miller, Cortland; Klenerman, Paul; Cook, Charles H.

    2009-01-01

    Introduction Immunocompetent patients can reactivate latent cytomegalovirus (CMV) during critical illness and reactivation is associated with significantly worse outcomes. Prior to clinical trials in humans to prove causality, we sought to determine an optimal antiviral treatment strategy. Methods Mice latently infected with murine CMV (MCMV) received a septic reactivation trigger and were randomized to receive one of four ganciclovir regimens or saline. Lungs were evaluated for viral transcriptional reactivation and fibrosis after each regimen. Influences of ganciclovir on early sepsis induced pulmonary inflammation and T-cell activation were studied after sepsis induction. Results All ganciclovir regimens reduced measurable MCMV transcriptional reactivation, and 10mg/day for 7 or 21 days was most effective. Lower dose (5mg/kg/day) or delayed therapy were associated with significant breakthrough reactivation. Higher doses of ganciclovir given early were associated with the lowest incidence of pulmonary fibrosis, and delay of therapy for 1 week was associated with significantly worse pulmonary fibrosis. Although bacterial sepsis induced activation of MCMV-specific pulmonary T-cells, this activation was not influenced by ganciclovir. Conclusion These results suggest that antiviral treatment trials in humans should use 10mg/kg/day ganciclovir administered as early as possible in at-risk patients to minimize reactivation events and associated pulmonary injury PMID:20004216

  16. Antineurofilament and antiretinal antibodies in AIDS patients with cytomegalovirus retinitis.

    PubMed Central

    Rosberger, D F; Tshering, S L; Polsky, B; Heinemann, M H; Klein, R F; Cunningham-Rundles, S

    1994-01-01

    Sera obtained from AIDS patients with cytomegalovirus (CMV) retinitis before and after treatment with foscarnet, AIDS patients with human immunodeficiency virus (HIV) retinopathy, AIDS patients without retinal disease, and normal healthy controls with and without positive CMV serologies were assayed for the presence of antibodies against the 200-kDa outer, 160-kDa middle, and 68-kDa core subunits of the neurofilament triplet. Additional studies were performed to determine the presence of antibodies reactive with proteins extracted from crude human retinal antigen preparations. Antibodies against the 200-, 260-, and 68-kDa proteins of the neurofilament triplet were detected in 15 of 15 AIDS patients with CMV retinitis. The expression of these antibodies was unaffected, qualitatively, by successful treatment with foscarnet. In contrast, only 30% of patients with HIV retinopathy unrelated to CMV, fewer than 35% of AIDS patients with positive CMV titers but without evident retinitis, and fewer than 25% of healthy controls with positive or negative CMV titers possessed antibodies against any of the triplet proteins (P < 0.001). Antibodies against several clusters of retinal antigens were also identified in the sera of patients with CMV retinitis. In summary, the data indicate that retinal elements damaged by CMV infection induce an antibody response against the 200-, 160-, and 68kDa components of the neurofilament triplet as well as other, as yet undefined retinal antigens. Images PMID:8556483

  17. Congenital cytomegalovirus infection in San Luis Potosi, Mexico.

    PubMed

    Noyola, Daniel E; Mejía-Elizondo, Ana R; Canseco-Lima, Jesús M; Allende-Carrera, Ricardo; Hernánsez-Salinas, Alba E; Ramírez-Zacarías, José L

    2003-01-01

    The incidence of congenital cytomegalovirus infection in Mexico is unknown. We evaluated the presence of cytomegalovirus infection in 560 newborn infants at a public general hospital. There were five (0.89%) infected newborns. Infants with congenital infection were more likely to be born to primigravid mothers (P = 0.01) and were more often from rural areas (P = 0.058) than were noninfected newborns.

  18. Mutation of glutamine to arginine at position 548 of IE2 86 in human cytomegalovirus leads to decreased expression of IE2 40, IE2 60, UL83, and UL84 and increased transcription of US8-9 and US29-32.

    PubMed

    Burgdorf, Sarah W; Clark, Charles L; Burgdorf, James R; Spector, Deborah H

    2011-11-01

    The IE2 86 protein of human cytomegalovirus (HCMV) is essential for productive infection. The mutation of glutamine to arginine at position 548 of IE2 86 causes the virus to grow both slowly and to very low titers, making it difficult to study this mutant via infection. In this study, Q548R IE2 86 HCMV was produced on the complementing cell line 86F/40HA, which allowed faster and higher-titer production of mutant virus. The main defects observed in this mutant were greatly decreased expression of IE2 40, IE2 60, UL83, and UL84. Genome replication and the induction of cell cycle arrest were found to proceed at or near wild-type levels, and there was no defect in transitioning to early or late protein expression. Q548R IE2 86 was still able to interact with UL84. Furthermore, Q548R IE2 40 maintained the ability to enhance UL84 expression in a cotransfection assay. Microarray analysis of Q548R IE2 HCMV revealed that the US8, US9, and US29-32 transcripts were all significantly upregulated. These results further confirm the importance of IE2 in UL83 and UL84 expression as well as pointing to several previously unknown regions of the HCMV genome that may be regulated by IE2.

  19. Systemic lupus erythematous revealed by cytomegalovirus infection

    PubMed Central

    Amel, Rezgui; Monia, Karmani; Anis, Mzabi; Fatma, Ben Fredj; Chadia, Laouani

    2016-01-01

    Cytomegalovirus (CMV) infection have been described as exacerbing systemic lupus erythematous (SLE). The role of CMV in starting off SLE remains object of debate. We report a severe presentation of SLE revealed by CMV infection with hemophogocytic syndrome. A 22 old women without a history of systemic disease developed a cutaneous eruption with fever and myalgia persistant for 2 weeks. Laboratory studies revealed a CMV serology supporting acute CMV infection, with positive antinuclear antidody, anti ds DNA, elevated liver functions tests, pancytopenia. Further exams revealed an hemophagocytic syndrome and a lupus nephritis. While receiving antiviral and corticosteroid therapy, the patient developed seizures related to a cerebral vasculitis. The outcome was favorable when intravenous immunoglobulins were associated. This observation showed that CMV infection in patients with SLE is often serious and difficult to diagnose and to treat, especially when SLE is not yet recognized. So we suggest all patients with recent SLE have routine testing for CMV immunity. PMID:27800096

  20. Cytomegalovirus myelitis in perinatally acquired HIV.

    PubMed Central

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W

    1993-01-01

    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, neurons, macrophages, ependymal, endothelial, and Schwann cells. Other organs had no signs of CMV infection. Central nervous spinal CMV infection was most probably due to insufficient penetration of the blood-brain barrier by the CMV hyper-immunoglobulin. In suspicious cases early spinal magnetic resonance imaging (1.5 tesla) combined with an examination of urine and cerebrospinal fluid for CMV is recommended. Images Figure 1 Figure 2 Figure 3 PMID:8385439

  1. Screening, prevention, and treatment of congenital cytomegalovirus.

    PubMed

    Johnson, Julie; Anderson, Brenna

    2014-12-01

    Congenital cytomegalovirus (CMV) is a leading cause of permanent disability in children. The main source of maternal infection is from contact with young children. Primary maternal infection is diagnosed with demonstration of seroconversion or a positive CMV IgM in combination with a low-avidity CMV IgG. Fetal infection may be diagnosed with amniotic fluid polymerase chain reaction and culture. CMV-specific hyperimmune globulin has shown promise as a possible means to prevent congenital infection; large randomized trials are ongoing. To date, the only effective means of prevention is through reducing exposure to the virus. Rates of maternal infection may be reduced through education regarding sources of infection and improved hygiene.

  2. The history of vaccination against cytomegalovirus.

    PubMed

    Plotkin, Stanley

    2015-06-01

    Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.

  3. Optimum treatment of congenital cytomegalovirus infection.

    PubMed

    Leruez-Ville, Marianne; Ville, Yves

    2016-01-01

    Congenital cytomegalovirus infection affects 0.7% of live births and is the leading cause of congenital neurological handicaps of infectious origin. However, systematic screening of this infection has not been implemented in pregnancy or at birth in any country. This apparent paradox has been justified by the unavailability of an efficient vaccine and by the scarcity of data available on the treatment of congenital CMV. However, in the last decade interesting new data on the management of this congenital infection has emerged including new results on both neonatal and postnatal treatments. This review provides an update on the potential benefits of antiviral treatment and on passive immunisation both in the neonatal and the antenatal periods. These suggest a benefit to a proactive approach for neonatal and prenatal congenital infections. PMID:27043943

  4. Knockout of the Host Resistance Gene Pkr Fully Restores Replication of Murine Cytomegalovirus m142 and m143 Mutants In Vivo

    PubMed Central

    Ostermann, Eleonore; Warnecke, Gabriele; Waibler, Zoe

    2015-01-01

    Murine cytomegalovirus (MCMV) proteins m142 and m143 are essential for viral replication. They bind double-stranded RNA and prevent protein kinase R-induced protein synthesis shutoff. Whether the two viral proteins have additional functions such as their homologs in human cytomegalovirus do remained unknown. We show that MCMV m142 and m143 knockout mutants attain organ titers equivalent to those attained by wild-type MCMV in Pkr knockout mice, suggesting that these viral proteins do not encode additional PKR-independent functions relevant for pathogenesis in vivo. PMID:26512090

  5. Late-phase expression of a murine cytomegalovirus immediate-early antigen recognized by cytolytic T lymphocytes.

    PubMed Central

    Reddehase, M J; Fibi, M R; Keil, G M; Koszinowski, U H

    1986-01-01

    The cloned murine cytolytic T-lymphocyte line IE1-IL and several sublines detect a murine cytomegalovirus immediate-early (IE) membrane determinant in conjunction with Ld class I major histocompatibility glycoprotein. The lines retained cytolytic activity, strict antigen specificity, and self-restriction even when adapted to long-term, antigen-independent growth in the presence of interleukin-2 only (M. J. Reddehase, H.-J. Bühring, and U. H. Koszinowski, J. Virol. 57:408-412). These attributes allowed us to use IE1-IL as a stable, monospecific probe for tracing the expression of the IE membrane antigen throughout the viral replication cycle. Presentation of the antigen at the cell membrane proved to be most effective when expression of IE genes in infected mouse embryo fibroblasts was selectively enhanced by consecutive cycloheximide-actinomycin D treatment, whereas without enhancement high numbers of IE1-IL cytolytic T lymphocytes were required to demonstrate the antigen in the IE phase. In the early phase of infection when IE genes were no longer transcribed, cytolysis was not observed, although IE proteins were detectable in the nuclei of the infected cells. Without application of inhibitors IE membrane antigen expression was most prominent during the late phase of infection. Reinitiation of transcription from the genomic region encoding the major IE protein (pp89) and de novo synthesis of pp89 correlated with this reexpression of the IE membrane antigen. Images PMID:2431160

  6. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant

    MedlinePlus

    ... Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a ... weakened by medicines that you must take after stem cell transplant and by the transplant itself. Your body ...

  7. Cutaneous cytomegalovirus infection on multi dermatomal herpes zoster scars: an isotopic immune response.

    PubMed

    Katibi, O S; Dlova, N C; Mosam, A

    2015-01-01

    As more patients with human immunodeficiency virus (HIV) are surviving, despite severe immune suppression, clinicians are faced with atypical manifestations of both common and uncommon dermatoses. A 30-year-old black South African woman presented with a 10-month history of multiple chronic ulcers appearing on a multidermatomal herpes zoster (HZ) scar. The woman was infected with HIV, and her CD4 count was 45 cells/μL. Histology and PCR revealed cytomegalovirus (CMV) infection. This case highlights an unusual presentation of cutaneous CMV occurring as an isotopic immune response on a pre-existing multidermatomal HZ scar. PMID:25266481

  8. Lack of XBP-1 Impedes Murine Cytomegalovirus Gene Expression

    PubMed Central

    Drori, Adi; Messerle, Martin; Brune, Wolfram; Tirosh, Boaz

    2014-01-01

    The unfolded protein response (UPR) is an endoplasmic reticulum (ER)-to-nucleus signaling cascade induced in response to ER stress. The UPR aims at restoring homeostasis, but can also induce apoptosis if stress persists. Infection by human and murine cytomegaloviruses (CMVs) provokes ER stress and induces the UPR. However, both CMVs manipulate the UPR to promote its prosurvival activity and delay apoptosis. The underlying mechanisms remain largely unknown. Recently, we demonstrated that MCMV and HCMV encode a late protein to target IRE1 for degradation. However, the importance of its downstream effector, X Box binding protein 1 (XBP-1), has not been directly studied. Here we show that deletion of XBP-1 prior to or early after infection confers a transient delay in viral propagation in fibroblasts that can be overcome by increasing the viral dose. A similar phenotype was demonstrated in peritoneal macrophages. In vivo, acute infection by MCMV is reduced in the absence of XBP-1. Our data indicate that removal of XBP-1 confers a kinetic delay in early stages of MCMV infection and suggest that the late targeting of IRE1 is aimed at inhibiting activities other than the splicing of XBP-1 mRNA. PMID:25333725

  9. Passive Immunization against Congenital Cytomegalovirus Infection: Current State of Knowledge.

    PubMed

    Jückstock, Julia; Rothenburger, Markus; Friese, Klaus; Traunmüller, Friederike

    2015-01-01

    Primary infection with the human cytomegalovirus (CMV) occurs in 1-4% of pregnancies. The rates of maternal-fetal CMV transmissions are around 25, 36, 41, and 66%, for infections occurring in the peri-conceptional weeks, first, second, and third trimester of pregnancy, respectively. On the other hand, the severity of fetal organ damage and dysfunction diminishes with increasing gestational age. Congenitally CMV-infected newborns may have neurosensory impairments like mental retardation, cerebral palsy, epilepsy, progressive hearing loss or visual defects, or even may have a fatal outcome. In in-vitro experiments, CMV specific neutralizing IgG antibodies - which are abundant in CMV specific hyperimmune globulin (HIG) products - inhibited the entry of the virus into target cells and hampered viral cell-to-cell spread. This article provides a brief overview on the epidemiology and diagnostic tools in congenital CMV infection. It also concisely summarizes the currently available study results on the s