Science.gov

Sample records for human histone modification

  1. Post-Translational Modifications of Histones in Human Sperm.

    PubMed

    Krejčí, Jana; Stixová, Lenka; Pagáčová, Eva; Legartová, Soňa; Kozubek, Stanislav; Lochmanová, Gabriela; Zdráhal, Zbyněk; Sehnalová, Petra; Dabravolski, Siarhei; Hejátko, Jan; Bártová, Eva

    2015-10-01

    We examined the levels and distribution of post-translationally modified histones and protamines in human sperm. Using western blot immunoassay, immunofluorescence, mass spectrometry (MS), and FLIM-FRET approaches, we analyzed the status of histone modifications and the protamine P2. Among individual samples, we observed variability in the levels of H3K9me1, H3K9me2, H3K27me3, H3K36me3, and H3K79me1, but the level of acetylated (ac) histones H4 was relatively stable in the sperm head fractions, as demonstrated by western blot analysis. Sperm heads with lower levels of P2 exhibited lower levels of H3K9ac, H3K9me1, H3K27me3, H3K36me3, and H3K79me1. A very strong correlation was observed between the levels of P2 and H3K9me2. FLIM-FRET analysis additionally revealed that acetylated histones H4 are not only parts of sperm chromatin but also appear in a non-integrated form. Intriguingly, H4ac and H3K27me3 were detected in sperm tail fractions via western blot analysis. An appearance of specific histone H3 and H4 acetylation and H3 methylation in sperm tail fractions was also confirmed by both LC-MS/MS and MALDI-TOF MS analysis. Taken together, these data indicate that particular post-translational modifications of histones are uniquely distributed in human sperm, and this distribution varies among individuals and among the sperm of a single individual.

  2. Exercise-induced histone modifications in human skeletal muscle

    PubMed Central

    McGee, Sean L; Fairlie, Erin; Garnham, Andrew P; Hargreaves, Mark

    2009-01-01

    Skeletal muscle adaptations to exercise confer many of the health benefits of physical activity and occur partly through alterations in skeletal muscle gene expression. The exact mechanisms mediating altered skeletal muscle gene expression in response to exercise are unknown. However, in recent years, chromatin remodelling through epigenetic histone modifications has emerged as a key regulatory mechanism controlling gene expression in general. The purpose of this study was to examine the effect of exercise on global histone modifications that mediate chromatin remodelling and transcriptional activation in human skeletal muscle in response to exercise. In addition, we sought to examine the signalling mechanisms regulating these processes. Following 60 min of cycling, global histone 3 acetylation at lysine 9 and 14, a modification associated with transcriptional initiation, was unchanged from basal levels, but was increased at lysine 36, a site associated with transcriptional elongation. We examined the regulation of the class IIa histone deacetylases (HDACs), which are enzymes that suppress histone acetylation and have been implicated in the adaptations to exercise. While we found no evidence of proteasomal degradation of the class IIa HDACs, we found that HDAC4 and 5 were exported from the nucleus during exercise, thereby removing their transcriptional repressive function. We also observed activation of the AMP-activated protein kinase (AMPK) and the calcium–calmodulin-dependent protein kinase II (CaMKII) in response to exercise, which are two kinases that induce phosphorylation-dependent class IIa HDAC nuclear export. These data delineate a signalling pathway that might mediate skeletal muscle adaptations in response to exercise. PMID:19884317

  3. Nuclear lactate dehydrogenase modulates histone modification in human hepatocytes

    SciTech Connect

    Castonguay, Zachary; Auger, Christopher; Thomas, Sean C.; Chahma, M’hamed; Appanna, Vasu D.

    2014-11-07

    Highlights: • Nuclear LDH is up-regulated under oxidative stress. • SIRT1 is co-immunoprecipitated bound to nuclear LDH. • Nuclear LDH is involved in histone deacetylation and epigenetics. - Abstract: It is becoming increasingly apparent that the nucleus harbors metabolic enzymes that affect genetic transforming events. Here, we describe a nuclear isoform of lactate dehydrogenase (nLDH) and its ability to orchestrate histone deacetylation by controlling the availability of nicotinamide adenine dinucleotide (NAD{sup +}), a key ingredient of the sirtuin-1 (SIRT1) deacetylase system. There was an increase in the expression of nLDH concomitant with the presence of hydrogen peroxide (H{sub 2}O{sub 2}) in the culture medium. Under oxidative stress, the NAD{sup +} generated by nLDH resulted in the enhanced deacetylation of histones compared to the control hepatocytes despite no discernable change in the levels of SIRT1. There appeared to be an intimate association between nLDH and SIRT1 as these two enzymes co-immunoprecipitated. The ability of nLDH to regulate epigenetic modifications by manipulating NAD{sup +} reveals an intricate link between metabolism and the processing of genetic information.

  4. Analysis of histone modifications at human ribosomal DNA in liver cancer cell

    PubMed Central

    Yu, Feng; Shen, Xingyong; Fan, Li; Yu, Zhaocai

    2015-01-01

    Human liver cancer is the cancer commonly seen clinically. The transcription of ribosomal DNA (rDNA) is a critical step for cells, and epigenetic marks such as post-translational histone modifications have been involved in the regulation of rDNA transcription. But less is known about the pathogenesis of the liver cancers concerning the rDNA transcription regulation. Here we aligned the ChIP-seq data of histone modification markers and CTCF to the human genome assembly which contains a single rDNA repeat in human liver cancer cell and validated their distribution with ChIP-QPCR. Human liver cancer cell possesses a higher enrichment of H3K4me1 and H3K27me3 at ~28 kb within the intergenic spacer (IGS) of rDNA and a higher enrichment of H3K4me3 and H3K27ac upstream of TSS. Furtherly, we studied whether UBF could affect histone modification markers and CTCF at rDNA in human liver cancer cell. UBF depletion leads to a decrease of gene activation mark H3K4me3 across the rDNA promoter. And other histone modification marks and CTCF were not altered after UBF depletion. Taken together, our data showed a high resolution map of histone modification marks at rDNA in human liver cancer cell and provide novel evidence to decipher chromatin-mediated regulation of rDNA in liver cancer. PMID:26657029

  5. Chatting histone modifications in mammals

    PubMed Central

    Izzo, Annalisa

    2010-01-01

    Eukaryotic chromatin can be highly dynamic and can continuously exchange between an open transcriptionally active conformation and a compacted silenced one. Post-translational modifications of histones have a pivotal role in regulating chromatin states, thus influencing all chromatin dependent processes. Methylation is currently one of the best characterized histone modification and occurs on arginine and lysine residues. Histone methylation can regulate other modifications (e.g. acetylation, phosphorylation and ubiquitination) in order to define a precise functional chromatin environment. In this review we focus on histone methylation and demethylation, as well as on the enzymes responsible for setting these marks. In particular we are describing novel concepts on the interdependence of histone modifications marks and discussing the molecular mechanisms governing this cross-talks. PMID:21266346

  6. Epigenetic Modifications of Histones in Periodontal Disease.

    PubMed

    Martins, M D; Jiao, Y; Larsson, L; Almeida, L O; Garaicoa-Pazmino, C; Le, J M; Squarize, C H; Inohara, N; Giannobile, W V; Castilho, R M

    2016-02-01

    Periodontitis is a chronic infectious disease driven by dysbiosis, an imbalance between commensal bacteria and the host organism. Periodontitis is a leading cause of tooth loss in adults and occurs in about 50% of the US population. In addition to the clinical challenges associated with treating periodontitis, the progression and chronic nature of this disease seriously affect human health. Emerging evidence suggests that periodontitis is associated with mechanisms beyond bacteria-induced protein and tissue degradation. Here, we hypothesize that bacteria are able to induce epigenetic modifications in oral epithelial cells mediated by histone modifications. In this study, we found that dysbiosis in vivo led to epigenetic modifications, including acetylation of histones and downregulation of DNA methyltransferase 1. In addition, in vitro exposure of oral epithelial cells to lipopolysaccharides resulted in histone modifications, activation of transcriptional coactivators, such as p300/CBP, and accumulation of nuclear factor-κB (NF-κB). Given that oral epithelial cells are the first line of defense for the periodontium against bacteria, we also evaluated whether activation of pathogen recognition receptors induced histone modifications. We found that activation of the Toll-like receptors 1, 2, and 4 and the nucleotide-binding oligomerization domain protein 1 induced histone acetylation in oral epithelial cells. Our findings corroborate the emerging concept that epigenetic modifications play a role in the development of periodontitis. PMID:26496800

  7. Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line.

    PubMed

    Ioudinkova, Elena; Arcangeletti, Maria Cristina; Rynditch, Alla; De Conto, Flora; Motta, Federica; Covan, Silvia; Pinardi, Federica; Razin, Sergey V; Chezzi, Carlo

    2006-12-15

    Non-differentiated THP-1 cells can be infected by human cytomegalovirus (HCMV) Towne strain, which persists in these cells in a non-active (latent) form without undergoing a productive cycle. The same cells become permissive for HCMV lytic infection after induction of cell differentiation by treatment with 12-O-tetradecanoylphorbol-13-acetate. We used this cellular model to study the possible role of histone modifications in the control of HCMV latency. Using chromatin immunoprecipitation with antibodies against histone H3 acetylated or dimethylated in position K9, we demonstrated that in lytically infected cells the HCMV enhancer was associated with heavy acetylated but not dimethylated H3. In the case of latent infection, the HCMV enhancer was associated with neither acetylated nor dimethylated H3. HCMV genes encoding DNA polymerase (early), pp65 (early-late) and pp150 (late) proteins were associated preferentially with acetylated H3 in lytically infected cells and with dimethylated H3 in latently infected cells. These data strongly suggest that K9 methylation of H3 is involved in HCMV gene repression, while association of the above genes with acetylated histones is likely to be necessary for active transcription. It can be postulated that the same histone modifications are used to mark active and repressed genes in both cellular and viral chromatin. PMID:16989963

  8. Histone-modifying enzymes, histone modifications and histone chaperones in nucleosome assembly: Lessons learned from Rtt109 histone acetyltransferases.

    PubMed

    Dahlin, Jayme L; Chen, Xiaoyue; Walters, Michael A; Zhang, Zhiguo

    2015-01-01

    During DNA replication, nucleosomes ahead of replication forks are disassembled to accommodate replication machinery. Following DNA replication, nucleosomes are then reassembled onto replicated DNA using both parental and newly synthesized histones. This process, termed DNA replication-coupled nucleosome assembly (RCNA), is critical for maintaining genome integrity and for the propagation of epigenetic information, dysfunctions of which have been implicated in cancers and aging. In recent years, it has been shown that RCNA is carefully orchestrated by a series of histone modifications, histone chaperones and histone-modifying enzymes. Interestingly, many features of RCNA are also found in processes involving DNA replication-independent nucleosome assembly like histone exchange and gene transcription. In yeast, histone H3 lysine K56 acetylation (H3K56ac) is found in newly synthesized histone H3 and is critical for proper nucleosome assembly and for maintaining genomic stability. The histone acetyltransferase (HAT) regulator of Ty1 transposition 109 (Rtt109) is the sole enzyme responsible for H3K56ac in yeast. Much research has centered on this particular histone modification and histone-modifying enzyme. This Critical Review summarizes much of our current understanding of nucleosome assembly and highlights many important insights learned from studying Rtt109 HATs in fungi. We highlight some seminal features in nucleosome assembly conserved in mammalian systems and describe some of the lingering questions in the field. Further studying fungal and mammalian chromatin assembly may have important public health implications, including deeper understandings of human cancers and aging as well as the pursuit of novel anti-fungal therapies.

  9. Identification and interrogation of combinatorial histone modifications.

    PubMed

    Karch, Kelly R; Denizio, Jamie E; Black, Ben E; Garcia, Benjamin A

    2013-01-01

    Histone proteins are dynamically modified to mediate a variety of cellular processes including gene transcription, DNA damage repair, and apoptosis. Regulation of these processes occurs through the recruitment of non-histone proteins to chromatin by specific combinations of histone post-translational modifications (PTMs). Mass spectrometry has emerged as an essential tool to discover and quantify histone PTMs both within and between samples in an unbiased manner. Developments in mass spectrometry that allow for characterization of large histone peptides or intact protein has made it possible to determine which modifications occur simultaneously on a single histone polypeptide. A variety of techniques from biochemistry, biophysics, and chemical biology have been employed to determine the biological relevance of discovered combinatorial codes. This review first describes advancements in the field of mass spectrometry that have facilitated histone PTM analysis and then covers notable approaches to probe the biological relevance of these modifications in their nucleosomal context.

  10. Top-down and Middle-down Protein Analysis Reveals that Intact and Clipped Human Histones Differ in Post-translational Modification Patterns.

    PubMed

    Tvardovskiy, Andrey; Wrzesinski, Krzysztof; Sidoli, Simone; Fey, Stephen J; Rogowska-Wrzesinska, Adelina; Jensen, Ole N

    2015-12-01

    Post-translational modifications (PTMs) of histone proteins play a fundamental role in regulation of DNA-templated processes. There is also growing evidence that proteolytic cleavage of histone N-terminal tails, known as histone clipping, influences nucleosome dynamics and functional properties. Using top-down and middle-down protein analysis by mass spectrometry, we report histone H2B and H3 N-terminal tail clipping in human hepatocytes and demonstrate a relationship between clipping and co-existing PTMs of histone H3. Histones H2B and H3 undergo proteolytic processing in primary human hepatocytes and the hepatocellular carcinoma cell line HepG2/C3A when grown in spheroid (3D) culture, but not in a flat (2D) culture. Using tandem mass spectrometry we localized four different clipping sites in H3 and one clipping site in H2B. We show that in spheroid culture clipped H3 proteoforms are mainly represented by canonical histone H3, whereas in primary hepatocytes over 90% of clipped H3 correspond to the histone variant H3.3. Comprehensive analysis of histone H3 modifications revealed a series of PTMs, including K14me1, K27me2/K27me3, and K36me1/me2, which are differentially abundant in clipped and intact H3. Analysis of co-existing PTMs revealed negative crosstalk between H3K36 methylation and H3K23 acetylation in clipped H3. Our data provide the first evidence of histone clipping in human hepatocytes and demonstrate that clipped H3 carry distinct co-existing PTMs different from those in intact H3.

  11. "Identification Card": Sites on Histone Modification of Cancer Cell.

    PubMed

    Huang, Chao; Wen, Bin

    2015-12-01

    Formation of malignant tumor originating from normal healthy cell is a multistep process including genetic and epigenetic lesions. Previous studies of cell line model systems displayed that early important epigenetic events happened in stepwise fashion prior to cell immortalization. Once these epigenetic alterations are integrated into chromatin, they will perform vertical propagation through cell subculture. Hence, status of epigenetics is dramatically important in maintaining of cell identity. Histone modification is another factor of epigenetic alterations during human oncogenesis. Histones, one of main components of chromatin, can be modified post-translationally. Histone tail modifications are regulated by corresponding modification enzymes. This review focuses on the description of relationship between the main sites of histone modification and oncogenesis. PMID:26960300

  12. Alterations of histone modifications by cobalt compounds

    PubMed Central

    Li, Qin; Ke, Qingdong; Costa, Max

    2009-01-01

    In the present study, we examined the effects of CoCl2 on multiple histone modifications at the global level. We found that in both human lung carcinoma A549 cells and human bronchial epithelial Beas-2B cells, exposure to CoCl2 (≥200 μM) for 24 h increased H3K4me3, H3K9me2, H3K9me3, H3K27me3, H3K36me3, uH2A and uH2B but decreased acetylation at histone H4 (AcH4). Further investigation demonstrated that in A549 cells, the increase in H3K4me3 and H3K27me3 by cobalt ions exposure was probably through enhancing histone methylation processes, as methionine-deficient medium blocked the induction of H3K4me3 and H3K27me3 by cobalt ions, whereas cobalt ions increased H3K9me3 and H3K36me3 by directly inhibiting JMJD2A demethylase activity in vitro, which was probably due to the competition of cobalt ions with iron for binding to the active site of JMJD2A. Furthermore, in vitro ubiquitination and deubiquitination assays revealed that the cobalt-induced histone H2A and H2B ubiquitination is the result of inhibition of deubiquitinating enzyme activity. Microarray data showed that exposed to 200 μM of CoCl2 for 24 h, A549 cells not only increased but also decreased expression of hundreds of genes involved in different cellular functions, including tumorigenesis. This study is the first to demonstrate that cobalt ions altered epigenetic homeostasis in cells. It also sheds light on the possible mechanisms involved in cobalt-induced alteration of histone modifications, which may lead to altered programs of gene expression and carcinogenesis since cobalt at higher concentrations is a known carcinogen. PMID:19376846

  13. Interpreting thelanguage of histone and DNA modifications

    PubMed Central

    Rothbart, Scott B.; Strahl, Brian D.

    2014-01-01

    A major mechanism regulating the accessibility and function of eukaryotic genomes are the covalent modifications to DNA and histone proteins that dependably package our genetic information inside the nucleus of every cell. Formally postulated over a decade ago, it is becoming increasingly clear that post-translational modifications (PTMs) on histones act singly and in combination to form a language or ‘code’ that is read by specialized proteins to facilitate downstream functions in chromatin. Underappreciated at the time was the level of complexity harbored both within histone PTMs and their combinations, as well as within the proteins that read and interpret the language. In addition to histone PTMs, newly-identified DNA modifications that can recruit specific effector proteins has raised further awareness that histone PTMs operate within a broader language of epigenetic modifications to orchestrate the dynamic functions associated with chromatin. Here, we highlight key recent advances in our understanding of the epigenetic language encompassing histone and DNA modifications and foreshadow challenges that lie ahead as we continue our quest to decipher the fundamental mechanisms of chromatin regulation. PMID:24631868

  14. Regulation of chromatin by histone modifications

    PubMed Central

    Bannister, Andrew J; Kouzarides, Tony

    2011-01-01

    Chromatin is not an inert structure, but rather an instructive DNA scaffold that can respond to external cues to regulate the many uses of DNA. A principle component of chromatin that plays a key role in this regulation is the modification of histones. There is an ever-growing list of these modifications and the complexity of their action is only just beginning to be understood. However, it is clear that histone modifications play fundamental roles in most biological processes that are involved in the manipulation and expression of DNA. Here, we describe the known histone modifications, define where they are found genomically and discuss some of their functional consequences, concentrating mostly on transcription where the majority of characterisation has taken place. PMID:21321607

  15. Comprehensive Catalog of Currently Documented Histone Modifications.

    PubMed

    Zhao, Yingming; Garcia, Benjamin A

    2015-09-01

    Modern techniques in molecular biology, genomics, and mass spectrometry-based proteomics have identified a large number of novel histone posttranslational modifications (PTMs), many of whose functions are still under intense investigation. Here, we catalog histone PTMs under two classes: first, those whose functions have been fairly well studied and, second, those PTMs that have been more recently identified but whose functions remain unclear. We hope that this will be a useful resource for researchers from all biological or technical backgrounds, aiding in their chromatin and epigenetic pursuits.

  16. Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells

    PubMed Central

    Itahana, Yoko; Zhang, Jinqiu; Göke, Jonathan; Vardy, Leah A.; Han, Rachel; Iwamoto, Kozue; Cukuroglu, Engin; Robson, Paul; Pouladi, Mahmoud A.; Colman, Alan; Itahana, Koji

    2016-01-01

    The high proliferation rate of embryonic stem cells (ESCs) is thought to arise partly from very low expression of p21. However, how p21 is suppressed in ESCs has been unclear. We found that p53 binds to the p21 promoter in human ESCs (hESCs) as efficiently as in differentiated human mesenchymal stem cells, however it does not promote p21 transcription in hESCs. We observed an enrichment for both the repressive histone H3K27me3 and activating histone H3K4me3 chromatin marks at the p21 locus in hESCs, suggesting it is a suppressed, bivalent domain which overrides activation by p53. Reducing H3K27me3 methylation in hESCs rescued p21 expression, and ectopic expression of p21 in hESCs triggered their differentiation. Further, we uncovered a subset of bivalent promoters bound by p53 in hESCs that are similarly induced upon differentiation in a p53-dependent manner, whereas p53 promotes the transcription of other target genes which do not show an enrichment of H3K27me3 in ESCs. Our studies reveal a unique epigenetic strategy used by ESCs to poise undesired p53 target genes, thus balancing the maintenance of pluripotency in the undifferentiated state with a robust response to differentiation signals, while utilizing p53 activity to maintain genomic stability and homeostasis in ESCs. PMID:27346849

  17. Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells.

    PubMed

    Itahana, Yoko; Zhang, Jinqiu; Göke, Jonathan; Vardy, Leah A; Han, Rachel; Iwamoto, Kozue; Cukuroglu, Engin; Robson, Paul; Pouladi, Mahmoud A; Colman, Alan; Itahana, Koji

    2016-06-27

    The high proliferation rate of embryonic stem cells (ESCs) is thought to arise partly from very low expression of p21. However, how p21 is suppressed in ESCs has been unclear. We found that p53 binds to the p21 promoter in human ESCs (hESCs) as efficiently as in differentiated human mesenchymal stem cells, however it does not promote p21 transcription in hESCs. We observed an enrichment for both the repressive histone H3K27me3 and activating histone H3K4me3 chromatin marks at the p21 locus in hESCs, suggesting it is a suppressed, bivalent domain which overrides activation by p53. Reducing H3K27me3 methylation in hESCs rescued p21 expression, and ectopic expression of p21 in hESCs triggered their differentiation. Further, we uncovered a subset of bivalent promoters bound by p53 in hESCs that are similarly induced upon differentiation in a p53-dependent manner, whereas p53 promotes the transcription of other target genes which do not show an enrichment of H3K27me3 in ESCs. Our studies reveal a unique epigenetic strategy used by ESCs to poise undesired p53 target genes, thus balancing the maintenance of pluripotency in the undifferentiated state with a robust response to differentiation signals, while utilizing p53 activity to maintain genomic stability and homeostasis in ESCs.

  18. Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells.

    PubMed

    Itahana, Yoko; Zhang, Jinqiu; Göke, Jonathan; Vardy, Leah A; Han, Rachel; Iwamoto, Kozue; Cukuroglu, Engin; Robson, Paul; Pouladi, Mahmoud A; Colman, Alan; Itahana, Koji

    2016-01-01

    The high proliferation rate of embryonic stem cells (ESCs) is thought to arise partly from very low expression of p21. However, how p21 is suppressed in ESCs has been unclear. We found that p53 binds to the p21 promoter in human ESCs (hESCs) as efficiently as in differentiated human mesenchymal stem cells, however it does not promote p21 transcription in hESCs. We observed an enrichment for both the repressive histone H3K27me3 and activating histone H3K4me3 chromatin marks at the p21 locus in hESCs, suggesting it is a suppressed, bivalent domain which overrides activation by p53. Reducing H3K27me3 methylation in hESCs rescued p21 expression, and ectopic expression of p21 in hESCs triggered their differentiation. Further, we uncovered a subset of bivalent promoters bound by p53 in hESCs that are similarly induced upon differentiation in a p53-dependent manner, whereas p53 promotes the transcription of other target genes which do not show an enrichment of H3K27me3 in ESCs. Our studies reveal a unique epigenetic strategy used by ESCs to poise undesired p53 target genes, thus balancing the maintenance of pluripotency in the undifferentiated state with a robust response to differentiation signals, while utilizing p53 activity to maintain genomic stability and homeostasis in ESCs. PMID:27346849

  19. Bivalent histone modifications during tooth development.

    PubMed

    Zheng, Li-Wei; Zhang, Bin-Peng; Xu, Ruo-Shi; Xu, Xin; Ye, Ling; Zhou, Xue-Dong

    2014-12-01

    Histone methylation is one of the most widely studied post-transcriptional modifications. It is thought to be an important epigenetic event that is closely associated with cell fate determination and differentiation. To explore the spatiotemporal expression of histone H3 lysine 4 trimethylation (H3K4me3) and histone H3 lysine 27 trimethylation (H3K27me3) epigenetic marks and methylation or demethylation transferases in tooth organ development, we measured the expression of SET7, EZH2, KDM5B and JMJD3 via immunohistochemistry and quantitative polymerase chain reaction (qPCR) analysis in the first molar of BALB/c mice embryos at E13.5, E15.5, E17.5, P0 and P3, respectively. We also measured the expression of H3K4me3 and H3K27me3 with immunofluorescence staining. During murine tooth germ development, methylation or demethylation transferases were expressed in a spatial-temporal manner. The bivalent modification characterized by H3K4me3 and H3K27me3 can be found during the tooth germ development, as shown by immunofluorescence. The expression of SET7, EZH2 as methylation transferases and KDM5B and JMJD3 as demethylation transferases indicated accordingly with the expression of H3K4me3 and H3K27me3 respectively to some extent. The bivalent histone may play a critical role in tooth organ development via the regulation of cell differentiation.

  20. A novel, enigmatic histone modification: biotinylation of histones by holocarboxylase synthetase.

    PubMed

    Hassan, Yousef I; Zempleni, Janos

    2008-12-01

    Holocarboxylase synthetase catalyzes the covalent binding of biotin to histones in humans and other eukaryotes. Eleven biotinylation sites have been identified in histones H2A, H3, and H4. K12-biotinylated histone H4 is enriched in heterochromatin, repeat regions, and plays a role in gene repression. About 30% of the histone H4 molecules are biotinylated at K12 in histone H4 in human fibroblast telomeres. The abundance of biotinylated histones at distinct genomic loci depends on biotin availability. Decreased histone biotinylation decreases life span and stress resistance in Drosophila. Low enrichment of biotinylated histones at transposable elements impairs repression of these elements.

  1. Uncoupling histone turnover from transcription-associated histone H3 modifications.

    PubMed

    Ferrari, Paolo; Strubin, Michel

    2015-04-30

    Transcription in eukaryotes is associated with two major changes in chromatin organization. Firstly, nucleosomal histones are continuously replaced by new histones, an event that in yeast occurs predominantly at transcriptionally active promoters. Secondly, histones become modified post-translationally at specific lysine residues. Some modifications, including histone H3 trimethylation at lysine 4 (H3K4me3) and acetylation at lysines 9 (H3K9ac) and 14 (H3K14ac), are specifically enriched at active promoters where histones exchange, suggesting a possible causal relationship. Other modifications accumulate within transcribed regions and one of them, H3K36me3, is thought to prevent histone exchange. Here we explored the relationship between these four H3 modifications and histone turnover at a few selected genes. Using lysine-to-arginine mutants and a histone exchange assay, we found that none of these modifications plays a major role in either promoting or preventing histone turnover. Unexpectedly, mutation of H3K56, whose acetylation occurs prior to chromatin incorporation, had an effect only when introduced into the nucleosomal histone. Furthermore, we used various genetic approaches to show that histone turnover can be experimentally altered with no major consequence on the H3 modifications tested. Together, these results suggest that transcription-associated histone turnover and H3 modification are two correlating but largely independent events.

  2. The apolipoprotein CIII enhancer regulates both extensive histone modification and intergenic transcription of human apolipoprotein AI/CIII/AIV genes but not apolipoprotein AV.

    PubMed

    Li, Ya-Jun; Wei, Yu-Sheng; Fu, Xiang-Hui; Hao, De-Long; Xue, Zheng; Gong, Huan; Zhang, Zhu-Qin; Liu, De-Pei; Liang, Chih-Chuan

    2008-10-17

    The apolipoprotein (apo) AI/CIII/AIV/AV cluster genes are expressed at different levels in the liver and intestine. The apoCIII enhancer, a common regulatory element, regulates the tissue-specific expression of apoAI, apoCIII, and apoAIV but not apoAV. To study this regulation at the chromatin level, the histone modifications and intergenic transcription in the human apoAI/CIII/AIV/AV cluster were investigated in HepG2 and Caco-2 cells and in the livers of transgenic mice carrying the human gene cluster constructs with or without the apoCIII enhancer. We found that both the promoters and the intergenic regions of the apoAI/CIII/AIV genes were hyperacetylated and formed an open subdomain that did not include the apoAV gene. Hepatic and intestinal intergenic transcripts were identified to transcribe bidirectionally with strand preferences along the cluster. The deletion of the apoCIII enhancer influenced both histone modification and intergenic transcription in the apoAI/CIII/AIV gene region. These results demonstrate that the apoCIII enhancer contributes to the maintenance of an active chromatin subdomain of the apoAI/CIII/AIV genes, but not apoAV.

  3. Metabolic regulation of histone post-translational modifications

    PubMed Central

    Fan, Jing; Krautkramer, Kimberly A.; Feldman, Jessica L.; Denu, John M.

    2015-01-01

    Histone post-translational modifications regulate transcription and other DNA-templated functions. This process is dynamically regulated by specific modifying enzymes whose activities require metabolites that either serve as co-substrates or act as activators/inhibitors. Therefore, metabolism can influence histone modification by changing local concentrations of key metabolites. Physiologically, the epigenetic response to metabolism is important for nutrient sensing and environment adaption. In pathologic states, the connection between metabolism and histone modification mediates epigenetic abnormality in complex disease. In this review, we summarize recent studies of the molecular mechanisms involved in metabolic regulation of histone modifications and discuss their biological significance. PMID:25562692

  4. Histone modifications predispose genome regions to breakage and translocation

    PubMed Central

    Burman, Bharat; Zhang, Zhuzhu Z.; Pegoraro, Gianluca; Lieb, Jason D.; Misteli, Tom

    2015-01-01

    Chromosome translocations are well-established hallmarks of cancer cells and often occur at nonrandom sites in the genome. The molecular features that define recurrent chromosome breakpoints are largely unknown. Using a combination of bioinformatics, biochemical analysis, and cell-based assays, we identify here specific histone modifications as facilitators of chromosome breakage and translocations. We show enrichment of several histone modifications over clinically relevant translocation-prone genome regions. Experimental modulation of histone marks sensitizes genome regions to breakage by endonuclease challenge or irradiation and promotes formation of chromosome translocations of endogenous gene loci. Our results demonstrate that histone modifications predispose genome regions to chromosome breakage and translocations. PMID:26104467

  5. Quantification of histone modifications by parallel-reaction monitoring: a method validation.

    PubMed

    Sowers, James L; Mirfattah, Barsam; Xu, Pei; Tang, Hui; Park, In Young; Walker, Cheryl; Wu, Ping; Laezza, Fernanda; Sowers, Lawrence C; Zhang, Kangling

    2015-10-01

    Abnormal epigenetic reprogramming is one of the major causes leading to irregular gene expression and regulatory pathway perturbations, in the cells, resulting in unhealthy cell development or diseases. Accurate measurements of these changes of epigenetic modifications, especially the complex histone modifications, are very important, and the methods for these measurements are not trivial. By following our previous introduction of PRM to targeting histone modifications (Tang, H.; Fang, H.; Yin, E.; Brasier, A. R.; Sowers, L. C.; Zhang, K. Multiplexed parallel reaction monitoring targeting histone modifications on the QExactive mass spectrometer. Anal. Chem. 2014, 86 (11), 5526-34), herein we validated this method by varying the protein/trypsin ratios via serial dilutions. Our data demonstrated that PRM with SILAC histones as the internal standards allowed reproducible measurements of histone H3/H4 acetylation and methylation in the samples whose histone contents differ at least one-order of magnitude. The method was further validated by histones isolated from histone H3 K36 trimethyltransferase SETD2 knockout mouse embryonic fibroblasts (MEF) cells. Furthermore, histone acetylation and methylation in human neural stem cells (hNSC) treated with ascorbic acid phosphate (AAP) were measured by this method, revealing that H3 K36 trimethylation was significantly down-regulated by 6 days of treatment with vitamin C.

  6. Cancer Chemoprotection Through Nutrient-mediated Histone Modifications

    PubMed Central

    Gao, Yifeng; Tollefsbol, Trygve O.

    2016-01-01

    Epigenetics, the study of heritable changes in gene expression without modifying the nucleotide sequence, is among the most important topics in medicinal chemistry and cancer chemoprotection. Among those changes, DNA methylation and histone modification have been shown to be associated with various types of cancers in a number of ways, many of which are regulated by dietary components that are mostly found in plants. Although, mechanisms of nutrient components affecting histone acetylation/deacetylation in cancer are widely studied, how those natural compounds affect cancer through other histone modifications, such as methylation, phosphorylation and ubiquitylation, is rarely reviewed. Thus, this review article discusses impacts recently studied on histone acetylation as well as other histone modifications by dietary components, such as genistein, resveratrol, curcumin, epigallocatechin-3-gallate (EGCG), 3,3′-diindolylmethane (DIM), diallyl disulfide, garcinol, procyanidin B3, quercetin, sulforaphane and other isothiocyanates, in various types of cancer. PMID:25891109

  7. Histone tail modifications and noncanonical functions of histones: perspectives in cancer epigenetics.

    PubMed

    Hadnagy, Annamaria; Beaulieu, Raymond; Balicki, Danuta

    2008-04-01

    Over the past few years, the histone deacetylase (HDAC) inhibitors have occupied an important place in the effort to develop novel, but less toxic, anticancer therapy. HDAC inhibitors block HDACs, which are the enzymes responsible for histone deacetylation, and therefore they modulate gene expression. The cellular effects of HDAC inhibitors include growth arrest and the induction of differentiation. Early successes in cancer therapeutics obtained using these drugs alone or in combination with other anticancer drugs emphasize the important place of posttranslational modifications of histones in cancer therapy. Histone tail modifications along with DNA methylation are the most studied epigenetic events related to cancer progression. Moreover, extranuclear functions of histones have also been described. Because HDAC inhibitors block HDACs and thereby increase histone acetylation, we propose a model wherein exogenous acetylated histones or other related acetylated proteins that are introduced into the nucleus become HDAC substrates and thereby compete with endogenous histones for HDACs. This competition may lead to the increased acetylation of the endogenous histones, as in the case of HDAC inhibitor therapy. Moreover, other mechanisms of action, such as binding to chromatin and modulating gene expression, are also possible for exogenously introduced histones.

  8. Single-Nucleosome Mapping of Histone Modifications in S. cerevisiae

    PubMed Central

    2005-01-01

    Covalent modification of histone proteins plays a role in virtually every process on eukaryotic DNA, from transcription to DNA repair. Many different residues can be covalently modified, and it has been suggested that these modifications occur in a great number of independent, meaningful combinations. Published low-resolution microarray studies on the combinatorial complexity of histone modification patterns suffer from confounding effects caused by the averaging of modification levels over multiple nucleosomes. To overcome this problem, we used a high-resolution tiled microarray with single-nucleosome resolution to investigate the occurrence of combinations of 12 histone modifications on thousands of nucleosomes in actively growing S. cerevisiae. We found that histone modifications do not occur independently; there are roughly two groups of co-occurring modifications. One group of lysine acetylations shows a sharply defined domain of two hypo-acetylated nucleosomes, adjacent to the transcriptional start site, whose occurrence does not correlate with transcription levels. The other group consists of modifications occurring in gradients through the coding regions of genes in a pattern associated with transcription. We found no evidence for a deterministic code of many discrete states, but instead we saw blended, continuous patterns that distinguish nucleosomes at one location (e.g., promoter nucleosomes) from those at another location (e.g., over the 3′ ends of coding regions). These results are consistent with the idea of a simple, redundant histone code, in which multiple modifications share the same role. PMID:16122352

  9. Regulation of human papillomavirus type 31 gene expression during the differentiation-dependent life cycle through histone modifications and transcription factor binding.

    PubMed

    Wooldridge, Tonia R; Laimins, Laimonis A

    2008-05-10

    The life cycle of high-risk human papillomaviruses is linked to epithelial differentiation with virion production restricted to highly differentiated suprabasal cells. Two major viral promoters direct high-risk HPV gene expression and their activities are dependent upon differentiation. The early promoter controls initiation of transcripts at sites upstream of the E6 open reading frame and is active in both undifferentiated as well as differentiated cells. The late viral promoter directs transcription from a series of heterogeneous start sites in E7 and is activated upon differentiation. In this study, the state of histones as well as the spectrum of transcription factors bound to the two major HPV 31 viral promoters in undifferentiated and differentiated cells were examined using chromatin immunoprecipitation assays. Our studies indicate that, in undifferentiated cells, the chromatin surrounding both promoter regions is in an open, transcriptionally active state as indicated by the presence of dimethylated forms of histone H3 K4 as well as acetylated H3 and acetylated H4. Upon differentiation, there was an increase of four to six fold in the levels of dimethylated H3K4 and acetylated H3 respectively around both promoter regions as well as an increase of approximately nine fold in acetylated H4 at the early promoter. This suggests that nucleosomes of both promoter regions are further activated through histone modifications during differentiation. Chromatin immunoprecipitation assays were also used to examine the binding of transcription factors to the keratinocyte enhancer (KE)/early promoter region in the upstream regulatory region (URR) and late promoter sequences throughout differentiation. Our results suggest that a dynamic change in transcription factor binding occurs in both regions upon differentiation; most notably a significant increase in C/EBP-beta binding to the KE/early promoter region as well as C/EBP-alpha binding to the late promoter region upon

  10. Physicochemical modifications of histones and their impact on epigenomics.

    PubMed

    Andreoli, Federico; Del Rio, Alberto

    2014-09-01

    The study of histone post-translational modifications (PTMs) has made extraordinary progress over the past few years and many epigenetic modifications have been identified and found to be associated with fundamental biological processes and pathological conditions. Most histone-modifying enzymes produce specific covalent modifications on histone tails that, taken together, elicit complex and concerted processes. An even higher level of complexity is generated by the action of small molecules that are able to modulate pharmacologically epigenetic enzymes and interfere with these biochemical mechanisms. In this article, we provide an overview of histone PTMs by reviewing and discussing them in terms of their physicochemical properties, emphasizing these concepts in view of recent research efforts to elucidate epigenetic mechanisms and devise future epigenetic drugs.

  11. Post-translational Modifications Regulate Class IIa Histone Deacetylase (HDAC) Function in Health and Disease*

    PubMed Central

    Mathias, Rommel A.; Guise, Amanda J.; Cristea, Ileana M.

    2015-01-01

    Class IIa histone deacetylases (HDACs4, -5, -7, and -9) modulate the physiology of the human cardiovascular, musculoskeletal, nervous, and immune systems. The regulatory capacity of this family of enzymes stems from their ability to shuttle between nuclear and cytoplasmic compartments in response to signal-driven post-translational modification. Here, we review the current knowledge of modifications that control spatial and temporal histone deacetylase functions by regulating subcellular localization, transcriptional functions, and cell cycle-dependent activity, ultimately impacting on human disease. We discuss the contribution of these modifications to cardiac and vascular hypertrophy, myoblast differentiation, neuronal cell survival, and neurodegenerative disorders. PMID:25616866

  12. A genetic system to assess in vivo the functions of histones and histone modifications in higher eukaryotes.

    PubMed

    Günesdogan, Ufuk; Jäckle, Herbert; Herzig, Alf

    2010-10-01

    Despite the fundamental role of canonical histones in nucleosome structure, there is no experimental system for higher eukaryotes in which basic questions about histone function can be directly addressed. We developed a new genetic tool for Drosophila melanogaster in which the canonical histone complement can be replaced with multiple copies of experimentally modified histone transgenes. This new histone-replacement system provides a well-defined and direct cellular assay system for histone function with which to critically test models in chromatin biology dealing with chromatin assembly, variant histone functions and the biological significance of distinct histone modifications in a multicellular organism.

  13. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  14. Histones and histone modifications in perinuclear chromatin anchoring: from yeast to man.

    PubMed

    Harr, Jennifer C; Gonzalez-Sandoval, Adriana; Gasser, Susan M

    2016-02-01

    It is striking that within a eukaryotic nucleus, the genome can assume specific spatiotemporal distributions that correlate with the cell's functional states. Cell identity itself is determined by distinct sets of genes that are expressed at a given time. On the level of the individual gene, there is a strong correlation between transcriptional activity and associated histone modifications. Histone modifications act by influencing the recruitment of non-histone proteins and by determining the level of chromatin compaction, transcription factor binding, and transcription elongation. Accumulating evidence also shows that the subnuclear position of a gene or domain correlates with its expression status. Thus, the question arises whether this spatial organization results from or determines a gene's chromatin status. Although the association of a promoter with the inner nuclear membrane (INM) is neither necessary nor sufficient for repression, the perinuclear sequestration of heterochromatin is nonetheless conserved from yeast to man. How does subnuclear localization influence gene expression? Recent work argues that the common denominator between genome organization and gene expression is the modification of histones and in some cases of histone variants. This provides an important link between local chromatin structure and long-range genome organization in interphase cells. In this review, we will evaluate how histones contribute to the latter, and discuss how this might help to regulate genes crucial for cell differentiation. PMID:26792937

  15. Histone modifications and chromatin dynamics: a focus on filamentous fungi

    PubMed Central

    Brosch, Gerald; Loidl, Peter; Graessle, Stefan

    2008-01-01

    The readout of the genetic information of eukaryotic organisms is significantly regulated by modifications of DNA and chromatin proteins. Chromatin alterations induce genome-wide and local changes in gene expression and affect a variety of processes in response to internal and external signals during growth, differentiation, development, in metabolic processes, diseases, and abiotic and biotic stresses. This review aims at summarizing the roles of histone H1 and the acetylation and methylation of histones in filamentous fungi and links this knowledge to the huge body of data from other systems. Filamentous fungi show a wide range of morphologies and have developed a complex network of genes that enables them to use a great variety of substrates. This fact, together with the possibility of simple and quick genetic manipulation, highlights these organisms as model systems for the investigation of gene regulation. However, little is still known about regulation at the chromatin level in filamentous fungi. Understanding the role of chromatin in transcriptional regulation would be of utmost importance with respect to the impact of filamentous fungi in human diseases and agriculture. The synthesis of compounds (antibiotics, immunosuppressants, toxins, and compounds with adverse effects) is also likely to be regulated at the chromatin level. PMID:18221488

  16. Dynamic interplay between histone H3 modifications and protein interpreters: emerging evidence for a "histone language".

    PubMed

    Oliver, Samuel S; Denu, John M

    2011-01-24

    Histone proteins organize DNA into dynamic chromatin structures and regulate processes such as transcription, repair, and replication. Control of chromatin function and structure is mediated in part by reversible post-translational modifications (PTMs) on histones. The most N-terminal region of histone H3 contains a high density of modifiable residues. Here we focus on the dynamic interplay between histone modification states on the H3 N terminus and the binding modules that recognize these states. Specifically, we discuss the effect of auxiliary modifications to H3K4unmod/me3 binding modules (specifically H3R2 methylation, H3T3 phosphorylation, and H3T6 phosphorylation). Emerging evidence suggests that histone PTMs behave less like a strict "code", but more like a "language", which better illustrates the importance of context. Using androgen-receptor-mediated gene activation as an example, we propose a model of how the combinatorial natures of PTMs on the H3 N terminus and the complexes that recognize these epigenetic modifications control gene expression. PMID:21243717

  17. Calcium-mediated histone modifications regulate alternative splicing in cardiomyocytes

    PubMed Central

    Sharma, Alok; Nguyen, Hieu; Geng, Cuiyu; Hinman, Melissa N.; Luo, Guangbin; Lou, Hua

    2014-01-01

    In cardiomyocytes, calcium is known to control gene expression at the level of transcription, whereas its role in regulating alternative splicing has not been explored. Here we report that, in mouse primary or embryonic stem cell-derived cardiomyocytes, increased calcium levels induce robust and reversible skipping of several alternative exons from endogenously expressed genes. Interestingly, we demonstrate a calcium-mediated splicing regulatory mechanism that depends on changes of histone modifications. Specifically, the regulation occurs through changes in calcium-responsive kinase activities that lead to alterations in histone modifications and subsequent changes in the transcriptional elongation rate and exon skipping. We demonstrate that increased intracellular calcium levels lead to histone hyperacetylation along the body of the genes containing calcium-responsive alternative exons by disrupting the histone deacetylase-to-histone acetyltransferase balance in the nucleus. Consequently, the RNA polymerase II elongation rate increases significantly on those genes, resulting in skipping of the alternative exons. These studies reveal a mechanism by which calcium-level changes in cardiomyocytes impact on the output of gene expression through altering alternative pre-mRNA splicing patterns. PMID:25368158

  18. Glutamine methylation in histone H2A is an RNA-polymerase-I-dedicated modification

    NASA Astrophysics Data System (ADS)

    Tessarz, Peter; Santos-Rosa, Helena; Robson, Sam C.; Sylvestersen, Kathrine B.; Nelson, Christopher J.; Nielsen, Michael L.; Kouzarides, Tony

    2014-01-01

    Nucleosomes are decorated with numerous post-translational modifications capable of influencing many DNA processes. Here we describe a new class of histone modification, methylation of glutamine, occurring on yeast histone H2A at position 105 (Q105) and human H2A at Q104. We identify Nop1 as the methyltransferase in yeast and demonstrate that fibrillarin is the orthologue enzyme in human cells. Glutamine methylation of H2A is restricted to the nucleolus. Global analysis in yeast, using an H2AQ105me-specific antibody, shows that this modification is exclusively enriched over the 35S ribosomal DNA transcriptional unit. We show that the Q105 residue is part of the binding site for the histone chaperone FACT (facilitator of chromatin transcription) complex. Methylation of Q105 or its substitution to alanine disrupts binding to FACT in vitro. A yeast strain mutated at Q105 shows reduced histone incorporation and increased transcription at the ribosomal DNA locus. These features are phenocopied by mutations in FACT complex components. Together these data identify glutamine methylation of H2A as the first histone epigenetic mark dedicated to a specific RNA polymerase and define its function as a regulator of FACT interaction with nucleosomes.

  19. The interplay of histone modifications – writers that read

    PubMed Central

    Zhang, Tianyi; Cooper, Sarah; Brockdorff, Neil

    2015-01-01

    Histones are subject to a vast array of posttranslational modifications including acetylation, methylation, phosphorylation, and ubiquitylation. The writers of these modifications play important roles in normal development and their mutation or misregulation is linked with both genetic disorders and various cancers. Readers of these marks contain protein domains that allow their recruitment to chromatin. Interestingly, writers often contain domains which can read chromatin marks, allowing the reinforcement of modifications through a positive feedback loop or inhibition of their activity by other modifications. We discuss how such positive reinforcement can result in chromatin states that are robust and can be epigenetically maintained through cell division. We describe the implications of these regulatory systems in relation to modifications including H3K4me3, H3K79me3, and H3K36me3 that are associated with active genes and H3K27me3 and H3K9me3 that have been linked to transcriptional repression. We also review the crosstalk between active and repressive modifications, illustrated by the interplay between the Polycomb and Trithorax histone-modifying proteins, and discuss how this may be important in defining gene expression states during development. PMID:26474904

  20. Modification of histones by sugar β-N-acetylglucosamine (GlcNAc) occurs on multiple residues, including histone H3 serine 10, and is cell cycle-regulated.

    PubMed

    Zhang, Suisheng; Roche, Kevin; Nasheuer, Heinz-Peter; Lowndes, Noel Francis

    2011-10-28

    The monosaccharide, β-N-acetylglucosamine (GlcNAc), can be added to the hydroxyl group of either serines or threonines to generate an O-linked β-N-acetylglucosamine (O-GlcNAc) residue (Love, D. C., and Hanover, J. A. (2005) Sci. STKE 2005 312, 1-14; Hart, G. W., Housley, M. P., and Slawson, C. (2007) Nature 446, 1017-1022). This post-translational protein modification, termed O-GlcNAcylation, is reversible, analogous to phosphorylation, and has been implicated in many cellular processes. Here, we present evidence that in human cells all four core histones of the nucleosome are substrates for this glycosylation in the relative abundance H3, H4/H2B, and H2A. Increasing the intracellular level of UDP-GlcNAc, the nucleotide sugar donor substrate for O-GlcNAcylation enhanced histone O-GlcNAcylation and partially suppressed phosphorylation of histone H3 at serine 10 (H3S10ph). Expression of recombinant H3.3 harboring an S10A mutation abrogated histone H3 O-GlcNAcylation relative to its wild-type version, consistent with H3S10 being a site of histone O-GlcNAcylation (H3S10glc). Moreover, O-GlcNAcylated histones were lost from H3S10ph immunoprecipitates, whereas immunoprecipitation of either H3K4me3 or H3K9me3 (active or inactive histone marks, respectively) resulted in co-immunoprecipitation of O-GlcNAcylated histones. We also examined histone O-GlcNAcylation during cell cycle progression. Histone O-GlcNAcylation is high in G(1) cells, declines throughout the S phase, increases again during late S/early G(2), and persists through late G(2) and mitosis. Thus, O-GlcNAcylation is a novel histone post-translational modification regulating chromatin conformation during transcription and cell cycle progression.

  1. [Advances of Researches on the Role of Histone Modification in Hematological Neoplasms].

    PubMed

    Sun, Fang; Pan, Yun; Li, Yan

    2015-08-01

    As a crucial part of epigenetic regulation, the histone modification catalyzed by histone modification enzymes can alter the chromatin structure and modulate the gene expression. The role of histone modification in disease pathogenesis, especially in tumorigenesis, has become a research hotspot. The deregulation of histone modification, such as the overexpression and gain-of-function mutations of histone methyltransferase EZH2, the inactive mutations of histone methyltransferase MLL2, histone acetyltransferase CREBBP and EP300 are crucial for the development of hematological neoplasms. Some of Epi-drugs such as HDAC inhibitors, EZH2 inhibitors, are already clinically used, some are still in basic research stage, which are important field of new drug development for hematological neoplasms. In this review, the researches advances of basic medical sciences and clinical applications of aberrant histone modifications in hematological neoplasms are summarized. PMID:26314470

  2. Influence of Combinatorial Histone Modifications on Antibody and Effector Protein Recognition

    PubMed Central

    Fuchs, Stephen M.; Krajewski, Krzysztof; Baker, Richard W.; Miller, Victoria L.; Strahl, Brian D.

    2010-01-01

    Summary We report a general method to examine the recognition of post-translational modifications (PTMs) by antibodies and proteins. We use this method to evaluate the binding of modification-specific antibodies and chromatin-associating factors to an array of high-purified, biotinylated peptides (derived from human histone sequences) harboring multiple PTMs printed onto streptavidin-coated glass slides. We find that modification-specific antibodies are both more promiscuous in their PTM recognition than expected and highly influenced by neighboring PTMs. Binding of chromatin-associating factors is also influenced by combinatorial PTMs, giving further support for the “Histone Code” hypothesis. Thus we report the first thorough characterization of PTM influence on antibody recognition and describe a tool for the rapid and inexpensive assessment of chromatin-associating factor binding specificity. PMID:21167713

  3. The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns

    PubMed Central

    Zee, Barry M.; Dibona, Amy B.; Alekseyenko, Artyom A.; French, Christopher A.; Kuroda, Mitzi I.

    2016-01-01

    Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state. PMID:27698495

  4. DNA methylation and histone modification in onion chromosomes.

    PubMed

    Suzuki, Go; Shiomi, Maho; Morihana, Sayuri; Yamamoto, Maki; Mukai, Yasuhiko

    2010-01-01

    Onion, Allium cepa, is a model plant for experimental observation of somatic cell division, whose mitotic chromosome is extremely large, and contains the characteristic terminal heterochromatin. Epigenetic status of the onion chromosome is a matter of deep interest from a molecular cytogenetic point of view, because epigenetic marks regulate chromatin structure and gene expression. Here we examined chromosomal distribution of DNA methylation and histone modification in A. cepa in order to reveal the chromatin structure in detail. Immunodetection of 5-methylcytosine (5mC) and in situ nick-translation analysis showed that onion genomic DNA was highly methylated, and the methylated CG dinucleotides were distributed in entire chromosomes. In addition, distributions of histone methylation codes, which occur in close association with DNA methylation, were similar to those of other large genome species. From these results, a highly heterochromatic and less euchromatic state of large onion chromosomes were demonstrated at an epigenetic level.

  5. Post-Translational Modifications of Histones in Vertebrate Neurogenesis

    PubMed Central

    Mitrousis, Nikolaos; Tropepe, Vincent; Hermanson, Ola

    2015-01-01

    The process of neurogenesis, through which the entire nervous system of an organism is formed, has attracted immense scientific attention for decades. How can a single neural stem cell give rise to astrocytes, oligodendrocytes, and neurons? Furthermore, how is a neuron led to choose between the hundreds of different neuronal subtypes that the vertebrate CNS contains? Traditionally, niche signals and transcription factors have been on the spotlight. Recent research is increasingly demonstrating that the answer may partially lie in epigenetic regulation of gene expression. In this article, we comprehensively review the role of post-translational histone modifications in neurogenesis in both the embryonic and adult CNS. PMID:26733796

  6. Recognition of a Mononucleosomal Histone Modification Pattern by BPTF via Multivalent Interactions

    SciTech Connect

    Ruthenburg, Alexander J.; Li, Haitao; Milne, Thomas A.; Dewell, Scott; McGinty, Robert K.; Yuen, Melanie; Ueberheide, Beatrix; Dou, Yali; Muir, Tom W.; Patel, Dinshaw J.; Allis, C. David

    2011-09-20

    Little is known about how combinations of histone marks are interpreted at the level of nucleosomes. The second PHD finger of human BPTF is known to specifically recognize histone H3 when methylated on lysine 4 (H3K4me2/3). Here, we examine how additional heterotypic modifications influence BPTF binding. Using peptide surrogates, three acetyllysine ligands are indentified for a PHD-adjacent bromodomain in BPTF via systematic screening and biophysical characterization. Although the bromodomain displays limited discrimination among the three possible acetyllysines at the peptide level, marked selectivity is observed for only one of these sites, H4K16ac, in combination with H3K4me3 at the mononucleosome level. In support, these two histone marks constitute a unique trans-histone modification pattern that unambiguously resides within a single nucleosomal unit in human cells, and this module colocalizes with these marks in the genome. Together, our data call attention to nucleosomal patterning of covalent marks in dictating critical chromatin associations.

  7. Compendium of aberrant DNA methylation and histone modifications in cancer.

    PubMed

    Hattori, Naoko; Ushijima, Toshikazu

    2014-12-01

    Epigenetics now refers to the study or research field related to DNA methylation and histone modifications. Historically, global DNA hypomethylation was first revealed in 1983, and, after a decade, silencing of a tumor suppressor gene by regional DNA hypermethylation was reported. After the proposal of the histone code in the 2000s, alterations of histone methylation were also identified in cancers. Now, it is established that aberrant epigenetic alterations are involved in cancer development and progression, along with mutations and chromosomal losses. Recent cancer genome analyses have revealed a large number of mutations of epigenetic modifiers, supporting their important roles in cancer pathogenesis. Taking advantage of the reversibility of epigenetic alterations, drugs targeting epigenetic regulators and readers have been developed for restoration of normal pattern of the epigenome, and some have already demonstrated clinical benefits. In addition, DNA methylation of specific marker genes can be used as a biomarker for cancer diagnosis, including risk diagnosis, detection of cancers, and pathophysiological diagnosis. In this paper, we will summarize the major concepts of cancer epigenetics, placing emphasis on history.

  8. Global histone post-translational modifications and cancer: Biomarkers for diagnosis, prognosis and treatment?

    PubMed Central

    Khan, Shafqat Ali; Reddy, Divya; Gupta, Sanjay

    2015-01-01

    Global alterations in epigenetic landscape are now recognized as a hallmark of cancer. Epigenetic mechanisms such as DNA methylation, histone modifications, nucleosome positioning and non-coding RNAs are proven to have strong association with cancer. In particular, covalent post-translational modifications of histone proteins are known to play an important role in chromatin remodeling and thereby in regulation of gene expression. Further, histone modifications have also been associated with different aspects of carcinogenesis and have been studied for their role in the better management of cancer patients. In this review, we will explore and discuss how histone modifications are involved in cancer diagnosis, prognosis and treatment. PMID:26629316

  9. Family-wide Characterization of Histone Binding Abilities of Human CW Domain-containing Proteins.

    PubMed

    Liu, Yanli; Tempel, Wolfram; Zhang, Qi; Liang, Xiao; Loppnau, Peter; Qin, Su; Min, Jinrong

    2016-04-22

    Covalent modifications of histone N-terminal tails play a critical role in regulating chromatin structure and controlling gene expression. These modifications are controlled by histone-modifying enzymes and read out by histone-binding proteins. Numerous proteins have been identified as histone modification readers. Here we report the family-wide characterization of histone binding abilities of human CW domain-containing proteins. We demonstrate that the CW domains in ZCWPW2 and MORC3/4 selectively recognize histone H3 trimethylated at Lys-4, similar to ZCWPW1 reported previously, while the MORC1/2 and LSD2 lack histone H3 Lys-4 binding ability. Our crystal structures of the CW domains of ZCWPW2 and MORC3 in complex with the histone H3 trimethylated at Lys-4 peptide reveal the molecular basis of this interaction. In each complex, two tryptophan residues in the CW domain form the "floor" and "right wall," respectively, of the methyllysine recognition cage. Our mutation results based on ZCWPW2 reveal that the right wall tryptophan residue is essential for binding, and the floor tryptophan residue enhances binding affinity. Our structural and mutational analysis highlights the conserved roles of the cage residues of CW domain across the histone methyllysine binders but also suggests why some CW domains lack histone binding ability. PMID:26933034

  10. Structure of the histone chaperone CIA/ASF1-double bromodomain complex linking histone modifications and site-specific histone eviction.

    PubMed

    Akai, Yusuke; Adachi, Naruhiko; Hayashi, Yohei; Eitoku, Masamitsu; Sano, Norihiko; Natsume, Ryo; Kudo, Norio; Tanokura, Masaru; Senda, Toshiya; Horikoshi, Masami

    2010-05-01

    Nucleosomes around the promoter region are disassembled for transcription in response to various signals, such as acetylation and methylation of histones. Although the interactions between histone-acetylation-recognizing bromodomains and factors involved in nucleosome disassembly have been reported, no structural basis connecting histone modifications and nucleosome disassembly has been obtained. Here, we determined at 3.3 A resolution the crystal structure of histone chaperone cell cycle gene 1 (CCG1) interacting factor A/antisilencing function 1 (CIA/ASF1) in complex with the double bromodomain in the CCG1/TAF1/TAF(II)250 subunit of transcription factor IID. Structural, biochemical, and biological studies suggested that interaction between double bromodomain and CIA/ASF1 is required for their colocalization, histone eviction, and pol II entry at active promoter regions. Furthermore, the present crystal structure has characteristics that can connect histone acetylation and CIA/ASF1-mediated histone eviction. These findings suggest that the molecular complex between CIA/ASF1 and the double bromodomain plays a key role in site-specific histone eviction at active promoter regions. The model we propose here is the initial structure-based model of the biological signaling from histone modifications to structural change of the nucleosome (hi-MOST model).

  11. Selective inhibition of prostaglandin E2 receptors EP2 and EP4 modulates DNA methylation and histone modification machinery proteins in human endometriotic cells.

    PubMed

    Arosh, Joe A; Lee, JeHoon; Starzinski-Powitz, Anna; Banu, Sakhila K

    2015-07-01

    Endometriosis is an inflammatory gynecological disease of reproductive-age women. The prevalence of endometriosis is 5-10% in reproductive-age women. Modern medical treatments are directed to inhibit the action of estrogen in endometriotic cells. However, hormonal therapies targeting estrogen can be prescribed only for a short time because of their undesirable side effects. Recent studies from our laboratory, using human endometriotic epithelial cell line 12Z and stromal cell line 22B derived from red lesion, discovered that selective inhibition of prostaglandin E2 (PGE2) receptors EP2 and EP4 inhibits adhesion, invasion, growth, and survival of 12Z and 22B cells by modulating integrins, MMPs and TIMPs, cell cycle, survival, and intrinsic apoptotic pathways, suggesting multiple epigenetic mechanisms. The novel findings of the present study indicate that selective pharmacological inhibition of EP2 and EP4: (i) decreases expression of DNMT3a, DNMT3b, H3K9me3, H3K27me3, SUV39H1, HP1a, H3K27, EZH2, JMJD2a, HDAC1, HDAC3, MeCP2, CoREST and Sin3A; (ii) increases expression of H3K4me3, H3H9ac, H3K27ac; and (iii) does not modulate the expression of DNMT1, hSET1, LSD1, MBD1, p300, HDAC2, and JMJD3 epigenetic machinery proteins in an epithelial and stromal cell specific manner. In this study, we report for the first time that inhibition of PGE2-EP2/EP4 signaling modulates DNA methylation, H3 histone methylation and acetylation, and epigenetic memory machinery proteins in human endometriotic epithelial cells and stromal cells. Thus, targeting EP2 and EP4 receptors may emerge as long-term nonsteroidal therapy for treatment of active endometriotic lesions in women.

  12. Middle-down and Top-down mass spectrometric analysis of co-occurring histone modifications

    PubMed Central

    Molden, Rosalynn C; Garcia, Benjamin A

    2014-01-01

    Histones are chromatin proteins that are highly modified with many different types of post-translational modifications. These modifications act in concert to regulate a number of chromatin-related processes. However, identification and quantification of co-occurring histone post-translational modifications is challenging because there are many potential combinations of modifications and because the commonly used strategy of fragmenting proteins using trypsin or an alternative protease prior to LC-MS/MS analysis results in the loss of connectivity between modifications on different peptides. In this unit mass spectrometric methods to analyze combinatorial histone modifications on histone tails (Middle-down mass spectrometry) and on intact histones (Top-down mass spectrometry) are described. PMID:25081742

  13. Chromatin Proteomics Reveals Variable Histone Modifications during the Life Cycle of Trypanosoma cruzi.

    PubMed

    de Jesus, Teresa Cristina Leandro; Nunes, Vinícius Santana; Lopes, Mariana de Camargo; Martil, Daiana Evelin; Iwai, Leo Kei; Moretti, Nilmar Silvio; Machado, Fabrício Castro; de Lima-Stein, Mariana L; Thiemann, Otavio Henrique; Elias, Maria Carolina; Janzen, Christian; Schenkman, Sergio; da Cunha, Julia Pinheiro Chagas

    2016-06-01

    Histones are well-conserved proteins that form the basic structure of chromatin in eukaryotes and undergo several post-translational modifications, which are important for the control of transcription, replication, DNA damage repair, and chromosome condensation. In early branched organisms, histones are less conserved and appear to contain alternative sites for modifications, which could reveal evolutionary unique functions of histone modifications in gene expression and other chromatin-based processes. Here, by using high-resolution mass spectrometry, we identified and quantified histone post-translational modifications in two life cycle stages of Trypanosoma cruzi, the protozoan parasite that causes Chagas disease. We detected 44 new modifications, namely: 18 acetylations, seven monomethylations, seven dimethylations, seven trimethylations, and four phosphorylations. We found that replicative (epimastigote stage) contains more histone modifications than nonreplicative and infective parasites (trypomastigote stage). Acetylations of lysines at the C-terminus of histone H2A and methylations of lysine 23 of histone H3 were found to be enriched in trypomastigotes. In contrast, phosphorylation in serine 23 of H2B and methylations of lysine 76 of histone H3 predominates in proliferative states. The presence of one or two methylations in the lysine 76 was found in cells undergoing mitosis and cytokinesis, typical of proliferating parasites. Our findings provide new insights into the role of histone modifications related to the control of gene expression and cell-cycle regulation in an early divergent organism.

  14. Chromatin Proteomics Reveals Variable Histone Modifications during the Life Cycle of Trypanosoma cruzi.

    PubMed

    de Jesus, Teresa Cristina Leandro; Nunes, Vinícius Santana; Lopes, Mariana de Camargo; Martil, Daiana Evelin; Iwai, Leo Kei; Moretti, Nilmar Silvio; Machado, Fabrício Castro; de Lima-Stein, Mariana L; Thiemann, Otavio Henrique; Elias, Maria Carolina; Janzen, Christian; Schenkman, Sergio; da Cunha, Julia Pinheiro Chagas

    2016-06-01

    Histones are well-conserved proteins that form the basic structure of chromatin in eukaryotes and undergo several post-translational modifications, which are important for the control of transcription, replication, DNA damage repair, and chromosome condensation. In early branched organisms, histones are less conserved and appear to contain alternative sites for modifications, which could reveal evolutionary unique functions of histone modifications in gene expression and other chromatin-based processes. Here, by using high-resolution mass spectrometry, we identified and quantified histone post-translational modifications in two life cycle stages of Trypanosoma cruzi, the protozoan parasite that causes Chagas disease. We detected 44 new modifications, namely: 18 acetylations, seven monomethylations, seven dimethylations, seven trimethylations, and four phosphorylations. We found that replicative (epimastigote stage) contains more histone modifications than nonreplicative and infective parasites (trypomastigote stage). Acetylations of lysines at the C-terminus of histone H2A and methylations of lysine 23 of histone H3 were found to be enriched in trypomastigotes. In contrast, phosphorylation in serine 23 of H2B and methylations of lysine 76 of histone H3 predominates in proliferative states. The presence of one or two methylations in the lysine 76 was found in cells undergoing mitosis and cytokinesis, typical of proliferating parasites. Our findings provide new insights into the role of histone modifications related to the control of gene expression and cell-cycle regulation in an early divergent organism. PMID:27108550

  15. Tracking epigenetic histone modifications in single cells using Fab-based live endogenous modification labeling

    PubMed Central

    Hayashi-Takanaka, Yoko; Yamagata, Kazuo; Wakayama, Teruhiko; Stasevich, Timothy J.; Kainuma, Takashi; Tsurimoto, Toshiki; Tachibana, Makoto; Shinkai, Yoichi; Kurumizaka, Hitoshi; Nozaki, Naohito; Kimura, Hiroshi

    2011-01-01

    Histone modifications play an important role in epigenetic gene regulation and genome integrity. It remains largely unknown, however, how these modifications dynamically change in individual cells. By using fluorescently labeled specific antigen binding fragments (Fabs), we have developed a general method to monitor the distribution and global level of endogenous histone H3 lysine modifications in living cells without disturbing cell growth and embryo development. Fabs produce distinct nuclear patterns that are characteristic of their target modifications. H3K27 trimethylation-specific Fabs, for example, are concentrated on inactive X chromosomes. As Fabs bind their targets transiently, the ratio of bound and free molecules depends on the target concentration, allowing us to measure changes in global modification levels. High-affinity Fabs are suitable for mouse embryo imaging, so we have used them to monitor H3K9 and H3K27 acetylation levels in mouse preimplantation embryos produced by in vitro fertilization and somatic cell nuclear transfer. The data suggest that a high level of H3K27 acetylation is important for normal embryo development. As Fab-based live endogenous modification labeling (FabLEM) is broadly useful for visualizing any modification, it should be a powerful tool for studying cell signaling and diagnosis in the future. PMID:21576221

  16. Histone Posttranslational Modifications of CD4⁺ T Cell in Autoimmune Diseases.

    PubMed

    Wang, Zijun; Yin, Heng; Lau, Chak Sing; Lu, Qianjin

    2016-01-01

    The complexity of immune system is tempered by precise regulation to maintain stabilization when exposed to various conditions. A subtle change in gene expression may be magnified when drastic changes are brought about in cellular development and function. Posttranslational modifications (PTMs) timely alter the functional activity of immune system, and work proceeded in these years has begun to throw light upon it. Posttranslational modifications of histone tails have been mentioned in a large scale of biological developments and disease progression, thereby making them a central field to investigate. Conventional assessments of these changes are centered on the transcription factors and cytokines in T cells regulated by variable histone codes to achieve chromatin remodeling, as well as involved in many human diseases, especially autoimmune diseases. We here put forward an essential review of core posttranslational modulations that regulate T cell function and differentiation in the immune system, with a special emphasis on histone modifications in different T helper cell subsets as well as in autoimmune diseases. PMID:27669210

  17. Histone Posttranslational Modifications of CD4+ T Cell in Autoimmune Diseases

    PubMed Central

    Wang, Zijun; Yin, Heng; Lau, Chak Sing; Lu, Qianjin

    2016-01-01

    The complexity of immune system is tempered by precise regulation to maintain stabilization when exposed to various conditions. A subtle change in gene expression may be magnified when drastic changes are brought about in cellular development and function. Posttranslational modifications (PTMs) timely alter the functional activity of immune system, and work proceeded in these years has begun to throw light upon it. Posttranslational modifications of histone tails have been mentioned in a large scale of biological developments and disease progression, thereby making them a central field to investigate. Conventional assessments of these changes are centered on the transcription factors and cytokines in T cells regulated by variable histone codes to achieve chromatin remodeling, as well as involved in many human diseases, especially autoimmune diseases. We here put forward an essential review of core posttranslational modulations that regulate T cell function and differentiation in the immune system, with a special emphasis on histone modifications in different T helper cell subsets as well as in autoimmune diseases. PMID:27669210

  18. IDENTIFICATION OF HISTONE H3 LYSINE 36 ACETYLATION AS A HIGHLY CONSERVED HISTONE MODIFICATION*

    PubMed Central

    Morris, Stephanie A.; Rao, Bhargavi; Garcia, Benjamin A.; Hake, Sandra B.; Diaz, Robert L.; Shabanowitz, Jeffrey; Hunt, Donald F.; Allis, C. David; Lieb, Jason D.; Strahl, Brian D.

    2010-01-01

    Histone lysine (K) acetylation is a major mechanism by which cells regulate the structure and function of chromatin, and new sites of acetylation continue to be discovered. Here we identify and characterize histone H3K36 acetylation (H3K36ac). By mass spectrometric analyses of H3 purified from Tetrahymena thermophila and Saccharomyces cerevisiae (yeast), we find that H3K36 can be acetylated or methylated. Using an antibody specific to H3K36ac, we show that this modification is conserved in mammals. In yeast, genome-wide ChIP-chip experiments show that H3K36ac is localized predominantly to the promoters of RNA polymerase II-transcribed genes, a pattern inversely related to that of H3K36 methylation. The pattern of H3K36ac localization is similar to that of other sites of H3 acetylation, including H3K9ac and H3K14ac. Using histone acetyltransferase complexes purified from yeast, we show that the Gcn5-containing SAGA complex that regulates transcription specifically acetylates H3K36 in vitro. Deletion of GCN5 completely abolishes H3K36ac in vivo. These data expand our knowledge of the genomic targets of Gcn5, show H3K36ac is highly conserved, and raise the intriguing possibility that the transition between H3K36ac and H3K36me acts as an “acetyl/methyl switch” governing chromatin function along transcription units. PMID:17189264

  19. Biotinylation of histones in human cells. Effects of cell proliferation.

    PubMed

    Stanley, J S; Griffin, J B; Zempleni, J

    2001-10-01

    An enzymatic mechanism has been proposed by which biotinidase may catalyze biotinylation of histones. Here, human cells were found to covalently bind biotin to histones H1, H2A, H2B, H3, and H4. Cells respond to proliferation with increased biotinylation of histones; biotinylation increases early in the cell cycle and remains increased during the cycle. Notwithstanding the catalytic role of biotinidase in biotinylation of histones, mRNA encoding biotinidase and biotinidase activity did not parallel the increased biotinylation of histones in proliferating cells. Biotinylation of histones might be regulated by enzymes other than biotinidase or by the rate of histone debiotinylation.

  20. Recent advances in maize nuclear proteomic studies reveal histone modifications.

    PubMed

    Casati, Paula

    2012-01-01

    The nucleus of eukaryotic organisms is highly dynamic and complex, containing different types of macromolecules including DNA, RNA, and a wide range of proteins. Novel proteomic applications have led to a better overall determination of nucleus protein content. Although nuclear plant proteomics is only at the initial phase, several studies have been reported and are summarized in this review using different plants species, such as Arabidopsis thaliana, rice, cowpea, onion, garden cress, and barrel clover. These include the description of the total nuclear or phospho-proteome (i.e., Arabidopsis, cowpea, onion), or the analysis of the differential nuclear proteome under different growth environments (i.e., Arabidopsis, rice, cowpea, onion, garden cress, and barrel clover). However, only few reports exist on the analysis of the maize nuclear proteome or its changes under various conditions. This review will present recent data on the study of the nuclear maize proteome, including the analysis of changes in posttranslational modifications in histone proteins. PMID:23248634

  1. Convergent evolution of chromatin modification by structurally distinct enzymes: comparative enzymology of histone H3 Lys²⁷ methylation by human polycomb repressive complex 2 and vSET.

    PubMed

    Swalm, Brooke M; Hallenbeck, Kenneth K; Majer, Christina R; Jin, Lei; Scott, Margaret Porter; Moyer, Mikel P; Copeland, Robert A; Wigle, Tim J

    2013-07-15

    H3K27 (histone H3 Lys27) methylation is an important epigenetic modification that regulates gene transcription. In humans, EZH (enhancer of zeste homologue) 1 and EZH2 are the only enzymes capable of catalysing methylation of H3K27. There is great interest in understanding structure-function relationships for EZH2, as genetic alterations in this enzyme are thought to play a causal role in a number of human cancers. EZH2 is challenging to study because it is only active in the context of the multi-subunit PRC2 (polycomb repressive complex 2). vSET is a viral lysine methyltransferase that represents the smallest protein unit capable of catalysing H3K27 methylation. The crystal structure of this minimal catalytic protein has been solved and researchers have suggested that vSET might prove useful as an EZH2 surrogate for the development of active site-directed inhibitors. To test this proposition, we conducted comparative enzymatic analysis of human EZH2 and vSET and report that, although both enzymes share similar preferences for methylation of H3K27, they diverge in terms of their permissiveness for catalysing methylation of alternative histone lysine sites, their relative preferences for utilization of multimeric macromolecular substrates, their active site primary sequences and, most importantly, their sensitivity to inhibition by drug-like small molecules. The cumulative data led us to suggest that EZH2 and vSET have very distinct active site structures, despite the commonality of the reaction catalysed by the two enzymes. Hence, the EZH2 and vSET pair of enzymes represent an example of convergent evolution in which distinct structural solutions have developed to solve a common catalytic need.

  2. Histone modification pattern evolution after yeast gene duplication

    PubMed Central

    2012-01-01

    Background Gene duplication and subsequent functional divergence especially expression divergence have been widely considered as main sources for evolutionary innovations. Many studies evidenced that genetic regulatory network evolved rapidly shortly after gene duplication, thus leading to accelerated expression divergence and diversification. However, little is known whether epigenetic factors have mediated the evolution of expression regulation since gene duplication. In this study, we conducted detailed analyses on yeast histone modification (HM), the major epigenetics type in this organism, as well as other available functional genomics data to address this issue. Results Duplicate genes, on average, share more common HM-code patterns than random singleton pairs in their promoters and open reading frames (ORF). Though HM-code divergence between duplicates in both promoter and ORF regions increase with their sequence divergence, the HM-code in ORF region evolves slower than that in promoter region, probably owing to the functional constraints imposed on protein sequences. After excluding the confounding effect of sequence divergence (or evolutionary time), we found the evidence supporting the notion that in yeast, the HM-code may co-evolve with cis- and trans-regulatory factors. Moreover, we observed that deletion of some yeast HM-related enzymes increases the expression divergence between duplicate genes, yet the effect is lower than the case of transcription factor (TF) deletion or environmental stresses. Conclusions Our analyses demonstrate that after gene duplication, yeast histone modification profile between duplicates diverged with evolutionary time, similar to genetic regulatory elements. Moreover, we found the evidence of the co-evolution between genetic and epigenetic elements since gene duplication, together contributing to the expression divergence between duplicate genes. PMID:22776110

  3. Dynamic interplay between histone H3 modifications and protein interpreters: emerging evidence for a ‘histone language’

    PubMed Central

    Oliver, Samuel S.; Denu, John M.

    2010-01-01

    Histone proteins organize DNA into dynamic chromatin structures and regulate processes such as transcription, repair and replication. Control of chromatin function and structure is mediated in part by reversible posttranslational modifications (PTMs) on histones. The most N-terminal region of histone H3 contains a high density of modifiable residues. In this review, we focus on the dynamic interplay between histone modification states on the H3 N-terminus and the binding modules that recognize these states. Specifically, we will discuss the effect of auxiliary modifications to H3K4unmod/me3 binding modules (specifically H3R2 methylation, H3T3 phosphorylation and H3T6 phosphorylation). Emerging evidence suggests that histone PTMs behave less like a strict ‘code’, but rather like a ‘language’, which better illustrates the importance of context. Using androgen receptor-mediated gene activation as an example, we propose a model for how the combinatorial nature of PTMs on the H3 N-terminus and the complexes that recognize these epigenetic modifications control gene expression. PMID:21243717

  4. Inhibitors of enzymes catalyzing modifications to histone lysine residues: structure, function and activity.

    PubMed

    Lillico, Ryan; Stesco, Nicholas; Khorshid Amhad, Tina; Cortes, Claudia; Namaka, Mike P; Lakowski, Ted M

    2016-05-01

    Gene expression is partly controlled by epigenetic mechanisms including histone-modifying enzymes. Some diseases are caused by changes in gene expression that can be mitigated by inhibiting histone-modifying enzymes. This review covers the enzyme inhibitors targeting histone lysine modifications. We summarize the enzymatic mechanisms of histone lysine acetylation, deacetylation, methylation and demethylation and discuss the biochemical roles of these modifications in gene expression and in disease. We discuss inhibitors of lysine acetylation, deacetylation, methylation and demethylation defining their structure-activity relationships and their potential mechanisms. We show that there are potentially indiscriminant off-target effects on gene expression even with the use of selective epigenetic enzyme inhibitors.

  5. Evaluation of proteomic search engines for the analysis of histone modifications.

    PubMed

    Yuan, Zuo-Fei; Lin, Shu; Molden, Rosalynn C; Garcia, Benjamin A

    2014-10-01

    Identification of histone post-translational modifications (PTMs) is challenging for proteomics search engines. Including many histone PTMs in one search increases the number of candidate peptides dramatically, leading to low search speed and fewer identified spectra. To evaluate database search engines on identifying histone PTMs, we present a method in which one kind of modification is searched each time, for example, unmodified, individually modified, and multimodified, each search result is filtered with false discovery rate less than 1%, and the identifications of multiple search engines are combined to obtain confident results. We apply this method for eight search engines on histone data sets. We find that two search engines, pFind and Mascot, identify most of the confident results at a reasonable speed, so we recommend using them to identify histone modifications. During the evaluation, we also find some important aspects for the analysis of histone modifications. Our evaluation of different search engines on identifying histone modifications will hopefully help those who are hoping to enter the histone proteomics field. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the data set identifier PXD001118.

  6. Evaluation of Proteomic Search Engines for the Analysis of Histone Modifications

    PubMed Central

    2015-01-01

    Identification of histone post-translational modifications (PTMs) is challenging for proteomics search engines. Including many histone PTMs in one search increases the number of candidate peptides dramatically, leading to low search speed and fewer identified spectra. To evaluate database search engines on identifying histone PTMs, we present a method in which one kind of modification is searched each time, for example, unmodified, individually modified, and multimodified, each search result is filtered with false discovery rate less than 1%, and the identifications of multiple search engines are combined to obtain confident results. We apply this method for eight search engines on histone data sets. We find that two search engines, pFind and Mascot, identify most of the confident results at a reasonable speed, so we recommend using them to identify histone modifications. During the evaluation, we also find some important aspects for the analysis of histone modifications. Our evaluation of different search engines on identifying histone modifications will hopefully help those who are hoping to enter the histone proteomics field. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the data set identifier PXD001118. PMID:25167464

  7. Examining histone posttranslational modification patterns by high-resolution mass spectrometry.

    PubMed

    Lin, Shu; Garcia, Benjamin A

    2012-01-01

    Histone variants and posttranslational modifications (PTMs) are essential for epigenetic regulation of transcriptional expression. Single and/or combinatorial PTMs of histones play important roles in development and disease formation. Mass spectrometry (MS) has been a powerful tool to study histone variants and PTMs, as it not only can identify novel PTMs but also can provide quantitative measurement of a spectrum of histone variants and PTMs in the same sample. In this chapter, we employ a combination of chemical derivation and high-resolution MS to identify and quantify multiple histone variants and PTMs. Histones are acid extracted and modified with propionyl groups and subsequently produces suitable sizes of fragments for MS analysis by trypsin digestion. The newly generated N-termini of histone peptides can be differentially marked by stable isotope labeling in a second reaction of propionylation, which enables direct comparison between two different samples in the following MS analysis. PMID:22910200

  8. Modification of Histones during Spermiogenesis in Trout: A Molecular Mechanism for Altering Histone Binding to DNA

    PubMed Central

    Sung, Michael T.; Dixon, Gordon H.

    1970-01-01

    At a late stage of spermatogenesis in rainbow-trout testis, the entire complement of histones is replaced by newly synthesized protamine and histones are extensively phosphorylated and acetylated. Tryptic digestion of purified histones labeled by incubation of testicular cells with [32P]phosphate shows that phosphorylation occurs at a small number of seryl residues. Histone I (lysine-rich) is phosphorylated in the sequence Lys-Ser(PO4)-Pro-Lys, which is located in the lysine-rich C-terminal region of the molecule. Histones IIb1 (slightly lysine-rich) and IV (glycine, arginine-rich) give rise to the same phosphopeptide, Ac-Ser(PO4)-Gly-Arg, which comprises the amino terminus of each histone. Thermolysin digests of phosphohistones IIb1 and IV also released a phosphopeptide with composition corresponding to the first six residues of histone IV: Ac-Ser(PO4)-Gly-Arg-Gly-Lys-Gly. An α-helical model of the N-terminal region of histone IV shows that this region is a possible DNA-binding site. Phosphorylation at serine 1 together with ε-amino acetylation at lysines 5, 8, 12, and 16 (observed in histone IV from trout testis) could profoundly modify ionic interactions and lead to an „unzipping” of histone IV from DNA Images PMID:5274484

  9. Novel types and sites of histone modifications emerge as players in the transcriptional regulation contest.

    PubMed

    Kebede, Adam F; Schneider, Robert; Daujat, Sylvain

    2015-05-01

    N-terminal tails of histones are easily accessible outside of the nucleosomal core particle and post-translational modifications (PTMs) of these tails have been the focus of attention in the past 15-20 years. By recruiting (or excluding) specific readers, histone modifications can regulate chromatin dynamics and, by extension, DNA-dependent processes. However, until very recently, the direct impact of histone PTMs on nucleosome structure and thus on chromatin function has remained somewhat elusive. Recent findings of novel sites and types of histone PTMs located within the globular domain of histones and, in particular, on the lateral surface of the histone octamer have changed this. As a result of their structurally important location in close proximity to the DNA molecule, this new class of histone PTMs can have a direct impact on chromatin function. Depending on their precise position at the nucleosome lateral surface (e.g. near the DNA entry/exit sites or in the dyad region), histone PTMs can regulate nucleosome structure and/or stability differently. We review recent progress on how histone PTMs can influence DNA unwrapping and/or nucleosome disassembly and shed light on how these types of novel modifications contribute mechanistically to the regulation of transcriptional activity. PMID:25220185

  10. Novel types and sites of histone modifications emerge as players in the transcriptional regulation contest.

    PubMed

    Kebede, Adam F; Schneider, Robert; Daujat, Sylvain

    2015-05-01

    N-terminal tails of histones are easily accessible outside of the nucleosomal core particle and post-translational modifications (PTMs) of these tails have been the focus of attention in the past 15-20 years. By recruiting (or excluding) specific readers, histone modifications can regulate chromatin dynamics and, by extension, DNA-dependent processes. However, until very recently, the direct impact of histone PTMs on nucleosome structure and thus on chromatin function has remained somewhat elusive. Recent findings of novel sites and types of histone PTMs located within the globular domain of histones and, in particular, on the lateral surface of the histone octamer have changed this. As a result of their structurally important location in close proximity to the DNA molecule, this new class of histone PTMs can have a direct impact on chromatin function. Depending on their precise position at the nucleosome lateral surface (e.g. near the DNA entry/exit sites or in the dyad region), histone PTMs can regulate nucleosome structure and/or stability differently. We review recent progress on how histone PTMs can influence DNA unwrapping and/or nucleosome disassembly and shed light on how these types of novel modifications contribute mechanistically to the regulation of transcriptional activity.

  11. Resetting Epigenetic Memory by Reprogramming of Histone Modifications in Mammals.

    PubMed

    Zheng, Hui; Huang, Bo; Zhang, Bingjie; Xiang, Yunlong; Du, Zhenhai; Xu, Qianhua; Li, Yuanyuan; Wang, Qiujun; Ma, Jing; Peng, Xu; Xu, Feng; Xie, Wei

    2016-09-15

    Polycomb group proteins and the related histone modification H3K27me3 can maintain the silencing of key developmental regulators and provide cellular memory. However, how such an epigenetic state is reprogrammed and inherited between generations is poorly understood. Using an ultra-sensitive approach, STAR ChIP-seq, we investigated H3K27me3 across 14 developmental stages along mouse gametogenesis and early development. Interestingly, highly pervasive H3K27me3 is found in regions depleted of transcription and DNA methylation in oocytes. Unexpectedly, we observed extensive loss of promoter H3K27me3 at Hox and other developmental genes upon fertilization. This is accompanied by global erasure of sperm H3K27me3 but inheritance of distal H3K27me3 from oocytes. The resulting allele-specific H3K27me3 patterns persist to blastocysts before being converted to canonical forms in postimplantation embryos, where both H3K4me3/H3K27me3 bivalent promoter marks are restored at developmental genes. Together, these data revealed widespread resetting of epigenetic memory and striking plasticity of epigenome during gametogenesis and early development. PMID:27635762

  12. Resetting Epigenetic Memory by Reprogramming of Histone Modifications in Mammals.

    PubMed

    Zheng, Hui; Huang, Bo; Zhang, Bingjie; Xiang, Yunlong; Du, Zhenhai; Xu, Qianhua; Li, Yuanyuan; Wang, Qiujun; Ma, Jing; Peng, Xu; Xu, Feng; Xie, Wei

    2016-09-15

    Polycomb group proteins and the related histone modification H3K27me3 can maintain the silencing of key developmental regulators and provide cellular memory. However, how such an epigenetic state is reprogrammed and inherited between generations is poorly understood. Using an ultra-sensitive approach, STAR ChIP-seq, we investigated H3K27me3 across 14 developmental stages along mouse gametogenesis and early development. Interestingly, highly pervasive H3K27me3 is found in regions depleted of transcription and DNA methylation in oocytes. Unexpectedly, we observed extensive loss of promoter H3K27me3 at Hox and other developmental genes upon fertilization. This is accompanied by global erasure of sperm H3K27me3 but inheritance of distal H3K27me3 from oocytes. The resulting allele-specific H3K27me3 patterns persist to blastocysts before being converted to canonical forms in postimplantation embryos, where both H3K4me3/H3K27me3 bivalent promoter marks are restored at developmental genes. Together, these data revealed widespread resetting of epigenetic memory and striking plasticity of epigenome during gametogenesis and early development.

  13. Trypanosomatid histones.

    PubMed

    Alsford, Sam; Horn, David

    2004-07-01

    The histones are responsible for packaging and regulating access to eukaryotic genomes. Trypanosomatids are flagellated protists that diverged early from the eukaryotic lineage and include parasites that cause disease in humans and other mammals. Here, we review the properties of histones in parasitic trypanosomatids, from gene organization and sequence to expression, post-translational modification and function within chromatin. Phylogenetic and experimental analysis indicates that certain specifically conserved histone sequence motifs, particularly within the N-terminal 'tail' domains, possibly represent functionally important modification substrates conserved throughout the eukaryotic lineage. For example, histone H3 contains a highly conserved methylation substrate. Trypanosomatids also possess at least three variant histones. Among these is an orthologue of H2A.Z, a histone involved in protecting 'active' chromatin from silencing in yeast. Histones provide docking platforms for a variety of regulatory factors. The presence of histone modification and variant histones in trypanosomatids therefore represents evidence for a network that provides the discrimination required to regulate transcription, recombination, repair and chromosome replication and segregation.

  14. The human histone chaperone sNASP interacts with linker and core histones through distinct mechanisms.

    PubMed

    Wang, Huanyu; Ge, Zhongqi; Walsh, Scott T R; Parthun, Mark R

    2012-01-01

    Somatic nuclear autoantigenic sperm protein (sNASP) is a human homolog of the N1/N2 family of histone chaperones. sNASP contains the domain structure characteristic of this family, which includes a large acidic patch flanked by several tetratricopeptide repeat (TPR) motifs. sNASP possesses a unique binding specificity in that it forms specific complexes with both histone H1 and histones H3/H4. Based on the binding affinities of sNASP variants to histones H1, H3.3, H4 and H3.3/H4 complexes, sNASP uses distinct structural domains to interact with linker and core histones. For example, one of the acidic patches of sNASP was essential for linker histone binding but not for core histone interactions. The fourth TPR of sNASP played a critical role in interactions with histone H3/H4 complexes, but did not influence histone H1 binding. Finally, analysis of cellular proteins demonstrated that sNASP existed in distinct complexes that contained either linker or core histones.

  15. ChIp-seq of bovine cells (MDBK) to study butyrate-induced histone modification with 10 datasets

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next-generation sequencing was combined with chromatin immunoprecipitation (ChIP) technology to analyze histone modification (acetylation) induced by butyrate and to map the epigenomic landscape of normal histone H3, H4 in rumen cells of the cow. Ten variants of histone H3 and H4 modification were m...

  16. A novel subtype classification and risk of breast cancer by histone modification profiling.

    PubMed

    Chen, Xiaohua; Hu, Hanyang; He, Lin; Yu, Xueyuan; Liu, Xiangyu; Zhong, Rong; Shu, Maoguo

    2016-06-01

    Breast cancer has been classified into several intrinsic molecular subtypes on the basis of genetic and epigenetic factors. However, knowledge about histone modifications that contribute to the classification and development of biologically distinct breast cancer subtypes remains limited. Here we compared the genome-wide binding patterns of H3K4me3 and H3K27me3 between human mammary epithelial cells and three breast cancer cell lines representing the luminal, HER2, and basal subtypes. We characterized thousands of unique binding events as well as bivalent chromatin signatures unique to each cancer subtype, which were involved in different epigenetic regulation programs and signaling pathways in breast cancer progression. Genes linked to the unique histone mark features exhibited subtype-specific expression patterns, both in cancer cell lines and primary tumors, some of which were confirmed by qPCR in our primary cancer samples. Finally, histone mark-based gene classifiers were significantly correlated with relapse-free survival outcomes in patients. In summary, we have provided a valuable resource for the identification of novel biomarkers of subtype classification and clinical prognosis evaluation in breast cancers. PMID:27178334

  17. CpG island methylation and histone modifications: biology and clinical significance.

    PubMed

    Esteller, M

    2006-01-01

    The discovery that drastic changes in DNA methylation and histone modifications are common in human tumors has inspired various laboratories and pharmaceutical companies to develop and study epigenetic drugs. One of the most promising groups of agents is the inhibitors of histone deacetylases (HDACs), which have different biochemical and biologic properties but have a single common activity: induction of acetylation in histones, the key proteins in nucleosome and chromatin structure. HDAC inhibitors may act through the transcriptional reactivation of dormant tumor-suppressor genes. However, their pleiotropic nature leaves open the possibility that their well-known differentiation, cell-cycle arrest, and apoptotic properties are also involved in other functions associated with HDAC inhibition. Many phase I clinical trials indicate that HDAC inhibitors appear to be well-tolerated drugs. Thus, the field is ready for rigorous biologic and clinical scrutiny to validate the therapeutic potential of these drugs. HDAC inhibitors, probably in association with classical chemotherapy drugs or in combination with DNA-demethylating agents, could be promising drugs for cancer patients.

  18. Stable-isotope-labeled Histone Peptide Library for Histone Post-translational Modification and Variant Quantification by Mass Spectrometry *

    PubMed Central

    Lin, Shu; Wein, Samuel; Gonzales-Cope, Michelle; Otte, Gabriel L.; Yuan, Zuo-Fei; Afjehi-Sadat, Leila; Maile, Tobias; Berger, Shelley L.; Rush, John; Lill, Jennie R.; Arnott, David; Garcia, Benjamin A.

    2014-01-01

    To facilitate accurate histone variant and post-translational modification (PTM) quantification via mass spectrometry, we present a library of 93 synthetic peptides using Protein-Aqua™ technology. The library contains 55 peptides representing different modified forms from histone H3 peptides, 23 peptides representing H4 peptides, 5 peptides representing canonical H2A peptides, 8 peptides representing H2A.Z peptides, and peptides for both macroH2A and H2A.X. The PTMs on these peptides include lysine mono- (me1), di- (me2), and tri-methylation (me3); lysine acetylation; arginine me1; serine/threonine phosphorylation; and N-terminal acetylation. The library was subjected to chemical derivatization with propionic anhydride, a widely employed protocol for histone peptide quantification. Subsequently, the detection efficiencies were quantified using mass spectrometry extracted ion chromatograms. The library yields a wide spectrum of detection efficiencies, with more than 1700-fold difference between the peptides with the lowest and highest efficiencies. In this paper, we describe the impact of different modifications on peptide detection efficiencies and provide a resource to correct for detection biases among the 93 histone peptides. In brief, there is no correlation between detection efficiency and molecular weight, hydrophobicity, basicity, or modification type. The same types of modifications may have very different effects on detection efficiencies depending on their positions within a peptide. We also observed antagonistic effects between modifications. In a study of mouse trophoblast stem cells, we utilized the detection efficiencies of the peptide library to correct for histone PTM/variant quantification. For most histone peptides examined, the corrected data did not change the biological conclusions but did alter the relative abundance of these peptides. For a low-abundant histone H2A variant, macroH2A, the corrected data led to a different conclusion than the

  19. Classification of Promoters Based on the Combination of Core Promoter Elements Exhibits Different Histone Modification Patterns

    PubMed Central

    Natsume-Kitatani, Yayoi; Mamitsuka, Hiroshi

    2016-01-01

    Four different histones (H2A, H2B, H3, and H4; two subunits each) constitute a histone octamer, around which DNA wraps to form histone-DNA complexes called nucleosomes. Amino acid residues in each histone are occasionally modified, resulting in several biological effects, including differential regulation of transcription. Core promoters that encompass the transcription start site have well-conserved DNA motifs, including the initiator (Inr), TATA box, and DPE, which are collectively called the core promoter elements (CPEs). In this study, we systematically studied the associations between the CPEs and histone modifications by integrating the Drosophila Core Promoter Database and time-series ChIP-seq data for histone modifications (H3K4me3, H3K27ac, and H3K27me3) during development in Drosophila melanogaster via the modENCODE project. We classified 96 core promoters into four groups based on the presence or absence of the TATA box or DPE, calculated the histone modification ratio at the core promoter region, and transcribed region for each core promoter. We found that the histone modifications in TATA-less groups were static during development and that the core promoters could be clearly divided into three types: i) core promoters with continuous active marks (H3K4me3 and H3K27ac), ii) core promoters with a continuous inactive mark (H3K27me3) and occasional active marks, and iii) core promoters with occasional histone modifications. Linear regression analysis and non-linear regression by random forest showed that the TATA-containing groups included core promoters without histone modifications, for which the measured RNA expression values were not predictable accurately from the histone modification status. DPE-containing groups had a higher relative frequency of H3K27me3 in both the core promoter region and transcribed region. In summary, our analysis showed that there was a systematic link between the existence of the CPEs and the dynamics, frequency and influence

  20. Metabolic Diseases Downregulate the Majority of Histone Modification Enzymes, Making a Few Upregulated Enzymes Novel Therapeutic Targets--"Sand Out and Gold Stays".

    PubMed

    Shao, Ying; Chernaya, Valeria; Johnson, Candice; Yang, William Y; Cueto, Ramon; Sha, Xiaojin; Zhang, Yi; Qin, Xuebin; Sun, Jianxin; Choi, Eric T; Wang, Hong; Yang, Xiao-feng

    2016-02-01

    To determine whether the expression of histone modification enzymes is regulated in physiological and pathological conditions, we took an experimental database mining approach pioneered in our labs to determine a panoramic expression profile of 164 enzymes in 19 human and 17 murine tissues. We have made the following significant findings: (1) Histone enzymes are differentially expressed in cardiovascular, immune, and other tissues; (2) our new pyramid model showed that heart and T cells are among a few tissues in which histone acetylation/deacetylation, and histone methylation/demethylation are in the highest varieties; and (3) histone enzymes are more downregulated than upregulated in metabolic diseases and regulatory T cell (Treg) polarization/ differentiation, but not in tumors. These results have demonstrated a new working model of "Sand out and Gold stays," where more downregulation than upregulation of histone enzymes in metabolic diseases makes a few upregulated enzymes the potential novel therapeutic targets in metabolic diseases and Treg activity. PMID:26746407

  1. Mass-spectrometry analysis of histone post-translational modifications in pathology tissue using the PAT-H-MS approach.

    PubMed

    Noberini, Roberta; Pruneri, Giancarlo; Minucci, Saverio; Bonaldi, Tiziana

    2016-06-01

    Aberrant histone post-translational modifications (hPTMs) have been implicated with various pathologies, including cancer, and may represent useful epigenetic biomarkers. The data described here provide a mass spectrometry-based quantitative analysis of hPTMs from formalin-fixed paraffin-embedded (FFPE) tissues, from which histones were extracted through the recently developed PAT-H-MS method. First, we analyzed FFPE samples from mouse spleen and liver or human breast cancer up to six years old, together with their corresponding fresh frozen tissue. We then combined the PAT-H-MS approach with a histone-focused version of the super-SILAC strategy-using a mix of histones from four breast cancer cell lines as a spike-in standard- to accurately quantify hPTMs from breast cancer specimens belonging to different subtypes. The data, which are associated with a recent publication (Pathology tissue-quantitative mass spectrometry analysis to profile histone post-translational modification patterns in patient samples (Noberini, 2015) [1]), are deposited at the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD002669. PMID:27408908

  2. The study of epigenetic mechanisms based on the analysis of histone modification patterns by flow cytometry.

    PubMed

    Watson, Maria; Chow, Sue; Barsyte, Dalia; Arrowsmith, Cheryl; Shankey, T Vincent; Minden, Mark; Hedley, David

    2014-01-01

    Epigenetic regulation of genes involved in cell growth, survival, or differentiation through histone modifications is an important determinant of cancer development and outcome. The basic science of epigenetics uses analytical tools that, although powerful, are not well suited to the analysis of heterogeneous cell populations found in human cancers, or for monitoring the effects of drugs designed to modulate epigenetic mechanisms in patients. To address this, we selected three clinically relevant histone marks (H3K27me3, H3K9ac, and H3K9me2), modulated their expression levels by in vitro treatments to generate high and low expressing control cells, and tested the relative sensitivity of candidate antibodies to detect the differences in expression levels by flow cytoametry using a range of sample preparation techniques. We identified monoclonal antibodies to all three histone marks that were suitable for flow cytoametry. Staining intensities were reduced with increasing formaldehyde concentration, and were not affected by ionic strength or by alcohol treatment. A protocol suitable for clinical samples was then developed, to allow combined labeling of histone marks and surface antigens while preserving light scatter signals. This was applied to normal donor blood, and to samples obtained from 25 patients with leukemia (predominantly acute myeloid leukemia). Significant cellular heterogeneity in H3K9ac and H3K27me3 staining was seen in normal peripheral blood, but the patterns were very similar between individual donors. In contrast, H3K27me3 in particular showed considerable inter-patient heterogeneity in the leukemia cell populations. Although further refinements are likely needed to fully optimize sample staining protocols, "flow epigenetics" appears to be technically feasible, and to have potential both in basic research, and in clinical application. PMID:24038859

  3. Oxidative stress alters global histone modification and DNA methylation.

    PubMed

    Niu, Yingmei; DesMarais, Thomas L; Tong, Zhaohui; Yao, Yixin; Costa, Max

    2015-05-01

    The JmjC domain-containing histone demethylases can remove histone lysine methylation and thereby regulate gene expression. The JmjC domain uses iron Fe(II) and α-ketoglutarate (αKG) as cofactors in an oxidative demethylation reaction via hydroxymethyl lysine. We hypothesize that reactive oxygen species will oxidize Fe(II) to Fe(III), thereby attenuating the activity of JmjC domain-containing histone demethylases. To minimize secondary responses from cells, extremely short periods of oxidative stress (3h) were used to investigate this question. Cells that were exposed to hydrogen peroxide (H2O2) for 3h exhibited increases in several histone methylation marks including H3K4me3 and decreases of histone acetylation marks including H3K9ac and H4K8ac; preincubation with ascorbate attenuated these changes. The oxidative stress level was measured by generation of 2',7'-dichlorofluorescein, GSH/GSSG ratio, and protein carbonyl content. A cell-free system indicated that H2O2 inhibited histone demethylase activity where increased Fe(II) rescued this inhibition. TET protein showed a decreased activity under oxidative stress. Cells exposed to a low-dose and long-term (3 weeks) oxidative stress also showed increased global levels of H3K4me3 and H3K27me3. However, these global methylation changes did not persist after washout. The cells exposed to short-term oxidative stress also appeared to have higher activity of class I/II histone deacetylase (HDAC) but not class III HDAC. In conclusion, we have found that oxidative stress transiently alters the epigenetic program process through modulating the activity of enzymes responsible for demethylation and deacetylation of histones. PMID:25656994

  4. Dynamic Regulation of Histone Modifications in Xenopus Oocytes through Histone Exchange

    PubMed Central

    Stewart, M. David; Sommerville, John; Wong, Jiemin

    2006-01-01

    Histone H3 lysine 9 (H3K9) methylation has broad roles in transcriptional repression, gene silencing, maintenance of heterochromatin, and epigenetic inheritance of heterochromatin. Using Xenopus laevis oocytes, we have previously shown that targeting G9a, an H3K9 histone methyltransferase, to chromatin increases H3K9 methylation and consequently represses transcription. Here we report that treatment with trichostatin A induces histone acetylation and is sufficient to activate transcription repressed by G9a, and this activation is accompanied by a reduction in dimethyl H3K9 (H3K9me2). We tested the possibility that the reduction in H3K9me2 was due to the replacement of methylated H3 with unmethylated H3.3. Surprisingly, we found that both free H3 and H3.3 are continually exchanged with chromatin-associated histones. This dynamic exchange of chromatin-associated H3 with free H3/H3.3 was not affected by alterations in transcriptional activity, elongation, acetylation, H3K9 methylation, or DNA replication. In support of this continual histone exchange model, we show that maintenance of H3K9 methylation at a specific site requires the continual presence of an H3K9 histone methyltransferase. Upon dissociation of the methyltransferase, H3K9 methylation decreases. Taken together, our data suggest that chromatin-associated and non-chromatin-associated histones are continually exchanged in the Xenopus oocyte, creating a highly dynamic chromatin environment. PMID:16943430

  5. Complete Workflow for Analysis of Histone Post-translational Modifications Using Bottom-up Mass Spectrometry: From Histone Extraction to Data Analysis

    PubMed Central

    Sidoli, Simone; Bhanu, Natarajan V.; Karch, Kelly R.; Wang, Xiaoshi; Garcia, Benjamin A.

    2016-01-01

    Nucleosomes are the smallest structural unit of chromatin, composed of 147 base pairs of DNA wrapped around an octamer of histone proteins. Histone function is mediated by extensive post-translational modification by a myriad of nuclear proteins. These modifications are critical for nuclear integrity as they regulate chromatin structure and recruit enzymes involved in gene regulation, DNA repair and chromosome condensation. Even though a large part of the scientific community adopts antibody-based techniques to characterize histone PTM abundance, these approaches are low throughput and biased against hypermodified proteins, as the epitope might be obstructed by nearby modifications. This protocol describes the use of nano liquid chromatography (nLC) and mass spectrometry (MS) for accurate quantification of histone modifications. This method is designed to characterize a large variety of histone PTMs and the relative abundance of several histone variants within single analyses. In this protocol, histones are derivatized with propionic anhydride followed by digestion with trypsin to generate peptides of 5 - 20 aa in length. After digestion, the newly exposed N-termini of the histone peptides are derivatized to improve chromatographic retention during nLC-MS. This method allows for the relative quantification of histone PTMs spanning four orders of magnitude. PMID:27286567

  6. A comparison of control samples for ChIP-seq of histone modifications.

    PubMed

    Flensburg, Christoffer; Kinkel, Sarah A; Keniry, Andrew; Blewitt, Marnie E; Oshlack, Alicia

    2014-01-01

    The advent of high-throughput sequencing has allowed genome wide profiling of histone modifications by Chromatin ImmunoPrecipitation (ChIP) followed by sequencing (ChIP-seq). In this assay the histone mark of interest is enriched through a chromatin pull-down assay using an antibody for the mark. Due to imperfect antibodies and other factors, many of the sequenced fragments do not originate from the histone mark of interest, and are referred to as background reads. Background reads are not uniformly distributed and therefore control samples are usually used to estimate the background distribution at any given genomic position. The Encyclopedia of DNA Elements (ENCODE) Consortium guidelines suggest sequencing a whole cell extract (WCE, or "input") sample, or a mock ChIP reaction such as an IgG control, as a background sample. However, for a histone modification ChIP-seq investigation it is also possible to use a Histone H3 (H3) pull-down to map the underlying distribution of histones. In this paper we generated data from a hematopoietic stem and progenitor cell population isolated from mouse fetal liver to compare WCE and H3 ChIP-seq as control samples. The quality of the control samples is estimated by a comparison to pull-downs of histone modifications and to expression data. We find minor differences between WCE and H3 ChIP-seq, such as coverage in mitochondria and behavior close to transcription start sites. Where the two controls differ, the H3 pull-down is generally more similar to the ChIP-seq of histone modifications. However, the differences between H3 and WCE have a negligible impact on the quality of a standard analysis.

  7. Ordered histone modifications are associated with transcriptional poising and activation of the phaseolin promoter.

    PubMed

    Ng, Danny W-K; Chandrasekharan, Mahesh B; Hall, Timothy C

    2006-01-01

    The phaseolin (phas) promoter drives copious production of transcripts encoding the protein phaseolin during seed embryogenesis but is silent in vegetative tissues, in which a nucleosome is positioned over its three-phased TATA boxes. Transition from the inactive state in transgenic Arabidopsis thaliana leaves was accomplished by ectopic expression of the transcription factor Phaseolus vulgaris ABI3-like factor (ALF) and application of abscisic acid (ABA). Placement of hemagglutinin-tagged ALF expression under the control of an estradiol-inducible promoter permitted chromatin immunoprecipitation analysis of chronological changes in histone modifications, notably increased acetylation of H3-K9 and H4-K12, as phas chromatin was remodeled (potentiated). A different array of changes, including acetylation of H3-K14 and methylation of H3-K4, was found to be associated with ABA-mediated activation. Thus, temporal separation of phas potentiation from activation revealed that histone H3 and H4 Lys residues are not globally hyperacetylated during phas expression. Whereas decreases in histone H3 and H4 levels were detected during ALF-mediated remodeling, slight increases occurred after ABA-mediated activation, suggesting the restoration of histone-phas interactions or the replacement of histones in the phas chromatin. The observed histone modifications provide insight into factors involved in the euchromatinization and activation of a plant gene and expand the evidence for histone code conservation among eukaryotes. PMID:16326929

  8. Enhanced top-down characterization of histone post-translational modifications

    SciTech Connect

    Tian, Zhixin; Tolić, Nikola; Zhao, Rui; Moore, Ronald J.; Hengel, Shawna M.; Robinson, Errol W.; Stenoien, David L.; Wu, Si; Smith, Richard D.; Paša-Tolić, Ljiljana

    2012-01-01

    Background: Multiple post-translational modifications (PTMs) on core histones often work synergistically to fine tune chromatin structure and functions, generating a “histone code” that can be interpreted by a variety of chromatin interacting proteins. Although previous bottom-up and middle-down proteomic approaches have been developed for limited characterization of PTMs on histone N-terminal tails, high-throughput methods for comprehensive identification of PTMs distributed along the entire primary amino acid sequence are yet to be implemented. Results: Here we report a novel online two-dimensional liquid chromatography - tandem mass spectrometry (2D LC–MS/MS) platform for high-throughput and sensitive characterization of histone PTMs at the intact protein level. The metal-free LC system with reverse phase separation followed by weak cation exchange – hydrophilic interaction chromatography (WCX-HILIC) and online Orbitrap Velos tandem mass spectrometry allowed for unambiguous identification of over 700 histone isoforms from a single 2D LC–MS/MS analysis of 7.5 µg of purified core histones. In comparison with previous offline top-down analysis of H4, this online study identified 100 additional isoforms from 100-fold less sample. This platform enabled comprehensive characterization of histone modifications, including those beyond tail regions, with dramatically improved throughput and sensitivity compared to more traditional platforms. Isoforms identified included those with combinatorial PTMs extending well beyond the N-terminal tail regions as well as a large number of phosphorylated isoforms.

  9. Histone H3 phosphorylation – A versatile chromatin modification for different occasions

    PubMed Central

    Sawicka, Anna; Seiser, Christian

    2012-01-01

    Post-translation modifications of histones modulate the accessibility and transcriptional competence of specific chromatin regions within the eukaryotic genome. Phosphorylation of histone H3 is unique in the sense that it associates on one hand with open chromatin during gene activation and marks on the other hand highly condensed chromatin during mitosis. Phosphorylation of serine residues at histone H3 is a highly dynamic process that creates together with acetylation and methylation marks at neighboring lysine residues specific combinatorial patterns that are read by specific detector proteins. In this review we describe the importance of different histone H3 phosphorylation marks for chromatin condensation during mitosis. In addition, we review the signals that trigger histone H3 phosphorylation and the factors that control this reversible modification during interphase and mediate the biological readout of the signal. Finally, we discuss different models describing the role of histone H3 phosphorylation in the activation of transcription of poised genes or by transient derepression of epigenetically silenced genes. We propose that histone H3 phosphorylation in the context with lysine methylation might temporarily relieve the silencing of specific genes without affecting the epigenetic memory. PMID:22564826

  10. Multiplexed parallel reaction monitoring targeting histone modifications on the QExactive mass spectrometer.

    PubMed

    Tang, Hui; Fang, Huasheng; Yin, Eric; Brasier, Allan R; Sowers, Lawrence C; Zhang, Kangling

    2014-06-01

    Histone acetylation and methylation play an important role in the regulation of gene expression. Irregular patterns of histone global acetylation and methylation have frequently been seen in various diseases. Quantitative analysis of these patterns is of high value for the evaluation of disease development and of outcomes from therapeutic treatment. Targeting histone acetylation and methylation by selected reaction monitoring (SRM) is one of the current quantitative methods. Here, we reported the use of the multiplexed parallel reaction monitoring (PRM) method on the QExactive mass spectrometer to target previously known lysine acetylation and methylation sites of histone H3 and H4 for the purpose of establishing precursor-product pairs for SRM. 55 modified peptides among which 29 were H3 K27/K36 modified peptides were detected from 24 targeted precursor ions included in the inclusion list. The identification was carried out directly from the trypsin digests of core histones that were separated without derivatization on a homemade capillary column packed with Waters YMC ODS-AQ reversed phase materials. Besides documenting the higher-energy c-trap dissociation (HCD) MS(2) spectra of previously known histone H3/H4 acetylated and methylated tryptic peptides, we identified novel H3 K18 methylation, H3 K27 monomethyl/acetyl duel modifications, H2B K23 acetylation, and H4 K20 acetylation in mammalian histones. The information gained from these experiments sets the foundation for quantification of histone modifications by targeted mass spectrometry methods directly from core histone samples. PMID:24823915

  11. Preferential Phosphorylation on Old Histones during Early Mitosis in Human Cells.

    PubMed

    Lin, Shu; Yuan, Zuo-Fei; Han, Yumiao; Marchione, Dylan M; Garcia, Benjamin A

    2016-07-15

    How histone post-translational modifications (PTMs) are inherited through the cell cycle remains poorly understood. Canonical histones are made in the S phase of the cell cycle. Combining mass spectrometry-based technologies and stable isotope labeling by amino acids in cell culture, we question the distribution of multiple histone PTMs on old versus new histones in synchronized human cells. We show that histone PTMs can be grouped into three categories according to their distributions. Most lysine mono-methylation and acetylation PTMs are either symmetrically distributed on old and new histones or are enriched on new histones. In contrast, most di- and tri-methylation PTMs are enriched on old histones, suggesting that the inheritance of different PTMs is regulated distinctly. Intriguingly, old and new histones are distinct in their phosphorylation status during early mitosis in the following three human cell types: HeLa, 293T, and human foreskin fibroblast cells. The mitotic hallmark H3S10ph is predominantly associated with old H3 at early mitosis and becomes symmetric with the progression of mitosis. This same distribution was observed with other mitotic phosphorylation marks, including H3T3/T6ph, H3.1/2S28ph, and H1.4S26ph but not S28/S31ph on the H3 variant H3.3. Although H3S10ph often associates with the neighboring Lys-9 di- or tri-methylations, they are not required for the asymmetric distribution of Ser-10 phosphorylation on the same H3 tail. Inhibition of the kinase Aurora B does not change the distribution despite significant reduction of H3S10ph levels. However, K9me2 abundance on the new H3 is significantly reduced after Aurora B inhibition, suggesting a cross-talk between H3S10ph and H3K9me2. PMID:27226594

  12. Histone chaperones link histone nuclear import and chromatin assembly.

    PubMed

    Keck, Kristin M; Pemberton, Lucy F

    2013-01-01

    Histone chaperones are proteins that shield histones from nonspecific interactions until they are assembled into chromatin. After their synthesis in the cytoplasm, histones are bound by different histone chaperones, subjected to a series of posttranslational modifications and imported into the nucleus. These evolutionarily conserved modifications, including acetylation and methylation, can occur in the cytoplasm, but their role in regulating import is not well understood. As part of histone import complexes, histone chaperones may serve to protect the histones during transport, or they may be using histones to promote their own nuclear localization. In addition, there is evidence that histone chaperones can play an active role in the import of histones. Histone chaperones have also been shown to regulate the localization of important chromatin modifying enzymes. This review is focused on the role histone chaperones play in the early biogenesis of histones, the distinct cytoplasmic subcomplexes in which histone chaperones have been found in both yeast and mammalian cells and the importins/karyopherins and nuclear localization signals that mediate the nuclear import of histones. We also address the role that histone chaperone localization plays in human disease. This article is part of a Special Issue entitled: Histone chaperones and chromatin assembly.

  13. Mass Spectrometric Quantification of Histone Post-translational Modifications by a Hybrid Chemical Labeling Method

    PubMed Central

    Maile, Tobias M.; Izrael-Tomasevic, Anita; Cheung, Tommy; Guler, Gulfem D.; Tindell, Charles; Masselot, Alexandre; Liang, Jun; Zhao, Feng; Trojer, Patrick; Classon, Marie; Arnott, David

    2015-01-01

    Mass spectrometry is a powerful alternative to antibody-based methods for the analysis of histone post-translational modifications (marks). A key development in this approach was the deliberate propionylation of histones to improve sequence coverage across the lysine-rich and hydrophilic tails that bear most modifications. Several marks continue to be problematic however, particularly di- and tri-methylated lysine 4 of histone H3 which we found to be subject to substantial and selective losses during sample preparation and liquid chromatography-mass spectrometry. We developed a new method employing a “one-pot” hybrid chemical derivatization of histones, whereby an initial conversion of free lysines to their propionylated forms under mild aqueous conditions is followed by trypsin digestion and labeling of new peptide N termini with phenyl isocyanate. High resolution mass spectrometry was used to collect qualitative and quantitative data, and a novel web-based software application (Fishtones) was developed for viewing and quantifying histone marks in the resulting data sets. Recoveries of 53 methyl, acetyl, and phosphoryl marks on histone H3.1 were improved by an average of threefold overall, and over 50-fold for H3K4 di- and tri-methyl marks. The power of this workflow for epigenetic research and drug discovery was demonstrated by measuring quantitative changes in H3K4 trimethylation induced by small molecule inhibitors of lysine demethylases and siRNA knockdown of epigenetic modifiers ASH2L and WDR5. PMID:25680960

  14. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    PubMed

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation. PMID:26918332

  15. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes

    PubMed Central

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S.; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation. PMID:26918332

  16. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    PubMed

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  17. Histone modifications and DNA double-strand break repair after exposure to ionizing radiations.

    PubMed

    Hunt, Clayton R; Ramnarain, Deepti; Horikoshi, Nobuo; Iyengar, Puneeth; Pandita, Raj K; Shay, Jerry W; Pandita, Tej K

    2013-04-01

    Ionizing radiation exposure induces highly lethal DNA double-strand breaks (DSBs) in all phases of the cell cycle. After DSBs are detected by the cellular machinery, these breaks are repaired by either of two mechanisms: (1) nonhomologous end joining (NHEJ), which re-ligates the broken ends of the DNA and (2) homologous recombination (HR), that makes use of an undamaged identical DNA sequence as a template to maintain the fidelity of DNA repair. DNA DSB repair must occur within the context of the natural cellular DNA structure. Among the major factors influencing DNA organization are specific histone and nonhistone proteins that form chromatin. The overall chromatin structure regulates DNA damage responses since chromatin status can impede DNA damage site access by repair proteins. During the process of DNA DSB repair, several chromatin alterations are required to sense damage and facilitate accessibility of the repair machinery. The DNA DSB response is also facilitated by hierarchical signaling networks that orchestrate chromatin structural changes that may coordinate cell-cycle checkpoints involving multiple enzymatic activities to repair broken DNA ends. During DNA damage sensing and repair, histones undergo posttranslational modifications (PTMs) including phosphorylation, acetylation, methylation and ubiquitylation. Such histone modifications represent a histone code that directs the recruitment of proteins involved in DNA damage sensing and repair processes. In this review, we summarize histone modifications that occur during DNA DSB repair processes.

  18. Progress in epigenetic histone modification analysis by mass spectrometry for clinical investigations

    PubMed Central

    Önder, Özlem; Sidoli, Simone; Carroll, Martin; Garcia, Benjamin A.

    2016-01-01

    Chromatin biology and epigenetics are scientific fields in rapid expansion due to their fundamental role in understanding cell development, heritable characters and progression of diseases. Histone post-translational modifications (PTMs) are major regulators of the epigenetic machinery, due to their ability to modulate gene expression, DNA repair and chromosome condensation. Large- scale strategies based on mass spectrometry have been impressively improved in the last decade, so that global changes of histone PTM abundances are quantifiable with nearly routine proteomics analyses and it is now possible to determine combinatorial patterns of modifications. Presented here is an overview of the most utilized and newly developed proteomics strategies for histone PTM characterization and a number of case studies where epigenetic mechanisms have been comprehensively characterized. Moreover, a number of current epigenetics therapies are illustrated, with an emphasis on cancer PMID:26400466

  19. In-gel NHS-propionate derivatization for histone post-translational modifications analysis in Arabidopsis thaliana.

    PubMed

    Chen, Jiajia; Gao, Jun; Peng, Maolin; Wang, Yi; Yu, Yanyan; Yang, Pengyuan; Jin, Hong

    2015-07-30

    Post-translational modifications (PTMs) on histone are highly correlated with genetic and epigenetic regulation of gene expression from chromatin. Mass spectrometry (MS) has developed to be an optimal tool for the identification and quantification of histone PTMs. Derivatization of histones with chemicals such as propionic anhydride, N-hydroxysuccinimide ester (NHS-propionate) has been widely used in histone PTMs analysis in bottom-up MS strategy, which requires high purity for histone samples. However, biological samples are not always prepared with high purity, containing detergents or other interferences in most cases. As an alternative approach, an adaptation of in gel derivatization method, termed In-gel NHS, is utilized for a broader application in histone PTMs analysis and it is shown to be a more time-saving preparation method. The proposed method was optimized for a better derivatization efficiency and displayed high reproducibility, indicating quantification of histone PTMs based on In-gel NHS was achievable. Without any traditional fussy histone purification procedures, we succeeded to quantitatively profile the histone PTMs from Arabidopsis with selective knock down of CLF (clf-29) and the original parental (col) with In-gel NHS method in a rapid way, which indicated the high specificity of CLF on H3K27me3 in Arabidopsis. In-gel NHS quantification results also suggest distinctive histone modification patterns in plants, which is invaluable foundation for future studies on histone modifications in plants.

  20. Butyrate induced IGF2 activation correlated with distinct chromatin landscapes due to histone modification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Histone modification has emerged as a very important mechanism regulating the transcriptional status of the genome. Insulin-like growth factor 2 (IGF2) is a peptide hormone controlling various cellular processes such as proliferation and apoptosis. IGF2 and H19 are reciprocally regulated imprinted ...

  1. Epigenomic landscape modified by histone modification correlated with activation of IGF2 gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The links of histone post-translational modifications and chromatin structure to cell cycle progression, DNA replication, and overall chromosome functions are very clear. The modulation of genome expression as a consequence of chromatin structural changes is most likely a basic mechanism. The epige...

  2. Nitric Oxide Regulates Gene Expression in Cancers by Controlling Histone Posttranslational Modifications.

    PubMed

    Vasudevan, Divya; Hickok, Jason R; Bovee, Rhea C; Pham, Vy; Mantell, Lin L; Bahroos, Neil; Kanabar, Pinal; Cao, Xing-Jun; Maienschein-Cline, Mark; Garcia, Benjamin A; Thomas, Douglas D

    2015-12-15

    Altered nitric oxide (•NO) metabolism underlies cancer pathology, but mechanisms explaining many •NO-associated phenotypes remain unclear. We have found that cellular exposure to •NO changes histone posttranslational modifications (PTM) by directly inhibiting the catalytic activity of JmjC-domain containing histone demethylases. Herein, we describe how •NO exposure links modulation of histone PTMs to gene expression changes that promote oncogenesis. Through high-resolution mass spectrometry, we generated an extensive map of •NO-mediated histone PTM changes at 15 critical lysine residues on the core histones H3 and H4. Concomitant microarray analysis demonstrated that exposure to physiologic •NO resulted in the differential expression of over 6,500 genes in breast cancer cells. Measurements of the association of H3K9me2 and H3K9ac across genomic loci revealed that differential distribution of these particular PTMs correlated with changes in the level of expression of numerous oncogenes, consistent with epigenetic code. Our results establish that •NO functions as an epigenetic regulator of gene expression mediated by changes in histone PTMs. PMID:26542213

  3. Engineering chromatin states: chemical and synthetic biology approaches to investigate histone modification function.

    PubMed

    Pick, Horst; Kilic, Sinan; Fierz, Beat

    2014-08-01

    Patterns of histone post-translational modifications (PTMs) and DNA modifications establish a landscape of chromatin states with regulatory impact on gene expression, cell differentiation and development. These diverse modifications are read out by effector protein complexes, which ultimately determine their functional outcome by modulating the activity state of underlying genes. From genome-wide studies employing high-throughput ChIP-Seq methods as well as proteomic mass spectrometry studies, a large number of PTMs are known and their coexistence patterns and associations with genomic regions have been mapped in a large number of different cell types. Conversely, the molecular interplay between chromatin effector proteins and modified chromatin regions as well as their resulting biological output is less well understood on a molecular level. Within the last decade a host of chemical approaches has been developed with the goal to produce synthetic chromatin with a defined arrangement of PTMs. These methods now permit systematic functional studies of individual histone and DNA modifications, and additionally provide a discovery platform to identify further interacting nuclear proteins. Complementary chemical- and synthetic-biology methods have emerged to directly observe and modulate the modification landscape in living cells and to readily probe the effect of altered PTM patterns on biological processes. Herein, we review current methodologies allowing chemical and synthetic biological engineering of distinct chromatin states in vitro and in vivo with the aim of obtaining a molecular understanding of histone and DNA modification function. This article is part of a Special Issue entitled: Molecular mechanisms of histone modification function.

  4. Posttranslational Modifications of the Histone 3 Tail and Their Impact on the Activity of Histone Lysine Demethylases In Vitro

    PubMed Central

    Lohse, Brian; Leurs, Ulrike; Cloos, Paul A. C.; Kristensen, Jesper L.; Clausen, Rasmus P.

    2013-01-01

    Posttranslational modifications (PTMs) of the histone H3 tail such as methylation, acetylation and phosphorylation play important roles in epigenetic signaling. Here we study the effect of some of these PTMs on the demethylation rates of methylated lysine 9 in vitro using peptide substrates mimicking histone H3. Various combinations with other PTMs were employed to study possible cross-talk effects by comparing enzyme kinetic characteristics. We compared the kinetics of histone tail substrates for truncated histone lysine demethylases KDM4A and KDM4C containing only the catalytic core (cc) and some combinations were characterized on full length (FL) KDM4A and KDM4C. We found that the substrates combining trimethylated K4 and K9 resulted in a significant increase in the catalytic activity for FL-KDM4A. For the truncated versions of KDM4A and KDM4C a two-fold increase in the catalytic activity toward bis-trimethylated substrates could be observed. Furthermore, a significant difference in the catalytic activity between dimethylated and trimethylated substrates was found for full length demethylases in line with what has been reported previously for truncated demethylases. Histone peptide substrates phosphorylated at T11 could not be demethylated by neither truncated nor full length KDM4A and KDM4C, suggesting that phosphorylation of threonine 11 prevents demethylation of the H3K9me3 mark on the same peptide. Acetylation of K14 was also found to influence demethylation rates significantly. Thus, for truncated KDM4A, acetylation on K14 of the substrate leads to an increase in enzymatic catalytic efficiency (kcat/Km), while for truncated KDM4C it induces a decrease, primarily caused by changes in Km. This study demonstrates that demethylation activities towards trimethylated H3K9 are significantly influenced by other PTMs on the same peptide, and emphasizes the importance of studying these interactions at the peptide level to get a more detailed understanding of the

  5. Histone and DNA Modifications as Regulators of Neuronal Development and Function.

    PubMed

    Lomvardas, Stavros; Maniatis, Tom

    2016-01-01

    SUMMARYDNA and histone modifications, together with constraints imposed by nuclear architecture, contribute to the transcriptional regulatory landscape of the nervous system. Here, we provide select examples showing how these regulatory layers, often referred to as epigenetic, contribute to neuronal differentiation and function. We describe the interplay between DNA methylation and Polycomb-mediated repression during neuronal differentiation, the role of DNA methylation and long-range enhancer-promoter interactions in Protocadherin promoter choice, and the contribution of heterochromatic silencing and nuclear organization in singular olfactory receptor expression. Finally, we explain how the activity-dependent expression of a histone variant determines the longevity of olfactory sensory neurons. PMID:27371659

  6. Analysis of histone posttranslational modifications from nucleolus-associated chromatin by mass spectrometry.

    PubMed

    Dillinger, Stefan; Garea, Ana Villar; Deutzmann, Rainer; Németh, Attila

    2014-01-01

    Chromatin is unevenly distributed within the eukaryote nucleus and it contributes to the formation of morphologically and functionally distinct substructures, called chromatin domains and nuclear bodies. Here we describe an approach to assess specific chromatin features, the histone posttranslational modifications (PTMs), of the largest nuclear sub-compartment, the nucleolus. In this chapter, methods for the isolation of nucleolus-associated chromatin from native or formaldehyde-fixed cells and the effect of experimental procedures on the outcome of mass spectrometry analysis of histone PTMs are compared.

  7. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality.

    PubMed

    Pundhir, Sachin; Bagger, Frederik O; Lauridsen, Felicia B; Rapin, Nicolas; Porse, Bo T

    2016-05-19

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show that NFRs predicted by H3K4me1 and me3 patterns are associated with active enhancers and promoters, respectively. Furthermore, asymmetry in the height of peaks flanking the central valley can predict the directionality of stable transcription at promoters. Using PARE on ChIP-seq histone modifications from four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate both the histone modification landscape and the transcriptional activities governed by active enhancers and promoters, and therefore can be used for their prediction. PARE is freely available at http://servers.binf.ku.dk/pare. PMID:27095194

  8. Mass spectrometry identifies and quantifies 74 unique histone H4 isoforms in differentiating human embryonic stem cells.

    PubMed

    Phanstiel, Doug; Brumbaugh, Justin; Berggren, W Travis; Conard, Kevin; Feng, Xuezhu; Levenstein, Mark E; McAlister, Graeme C; Thomson, James A; Coon, Joshua J

    2008-03-18

    Epigenetic regulation through chromatin is thought to play a critical role in the establishment and maintenance of pluripotency. Traditionally, antibody-based technologies were used to probe for specific posttranslational modifications (PTMs) present on histone tails, but these methods do not generally reveal the presence of multiple modifications on a single-histone tail (combinatorial codes). Here, we describe technology for the discovery and quantification of histone combinatorial codes that is based on chromatography and mass spectrometry. We applied this methodology to decipher 74 discrete combinatorial codes on the tail of histone H4 from human embryonic stem (ES) cells. Finally, we quantified the abundances of these codes as human ES cells undergo differentiation to reveal striking changes in methylation and acetylation patterns. For example, H4R3 methylation was observed only in the presence of H4K20 dimethylation; such context-specific patterning exemplifies the power of this technique.

  9. Profiling Analysis of Histone Modifications and Gene Expression in Lewis Lung Carcinoma Murine Cells Resistant to Anti-VEGF Treatment

    PubMed Central

    Du, Yanhua; Chen, Kaiming; Liu, Zhenping; Li, Bing; Li, Jie; Tao, Fei; Gu, Hua; Jiang, Cizhong; Fang, Jianmin

    2016-01-01

    Tumor cells become resistant after long-term use of anti-VEGF (vascular endothelial growth factor) agents. Our previous study shows that treatment with a VEGF inhibitor (VEGF-Trap) facilitates to develop tumor resistance through regulating angiogenesis-related genes. However, the underlying molecular mechanisms remain elusive. Histone modifications as a key epigenetic factor play a critical role in regulation of gene expression. Here, we explore the potential epigenetic gene regulatory functions of key histone modifications during tumor resistance in a mouse Lewis lung carcinoma (LLC) cell line. We generated high resolution genome-wide maps of key histone modifications in sensitive tumor sample (LLC-NR) and resistant tumor sample (LLC-R) after VEGF-Trap treatment. Profiling analysis of histone modifications shows that histone modification levels are effectively predictive for gene expression. Composition of promoters classified by histone modification state is different between LLC-NR and LLC-R cell lines regardless of CpG content. Histone modification state change between LLC-NR and LLC-R cell lines shows different patterns in CpG-rich and CpG-poor promoters. As a consequence, genes with different level of CpG content whose gene expression level are altered are enriched in distinct functions. Notably, histone modification state change in promoters of angiogenesis-related genes consists with their expression alteration. Taken together, our findings suggest that treatment with anti-VEGF therapy results in extensive histone modification state change in promoters with multiple functions, particularly, biological processes related to angiogenesis, likely contributing to tumor resistance development. PMID:27362259

  10. Recognition of modification status on a histone H3 tail by linked histone reader modules of the epigenetic regulator UHRF1

    PubMed Central

    Arita, Kyohei; Isogai, Shin; Oda, Takashi; Unoki, Motoko; Sugita, Kazuya; Sekiyama, Naotaka; Kuwata, Keiko; Hamamoto, Ryuji; Tochio, Hidehito; Sato, Mamoru; Ariyoshi, Mariko; Shirakawa, Masahiro

    2012-01-01

    Multiple covalent modifications on a histone tail are often recognized by linked histone reader modules. UHRF1 [ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1], an essential factor for maintenance of DNA methylation, contains linked two-histone reader modules, a tandem Tudor domain and a PHD finger, tethered by a 17-aa linker, and has been implicated to link histone modifications and DNA methylation. Here, we present the crystal structure of the linked histone reader modules of UHRF1 in complex with the amino-terminal tail of histone H3. Our structural and biochemical data provide the basis for combinatorial readout of unmodified Arg-2 (H3-R2) and methylated Lys-9 (H3-K9) by the tandem tudor domain and the PHD finger. The structure reveals that the intermodule linker plays an essential role in the formation of a histone H3–binding hole between the reader modules by making extended contacts with the tandem tudor domain. The histone H3 tail fits into the hole by adopting a compact fold harboring a central helix, which allows both of the reader modules to simultaneously recognize the modification states at H3-R2 and H3-K9. Our data also suggest that phosphorylation of a linker residue can modulate the relative position of the reader modules, thereby altering the histone H3–binding mode. This finding implies that the linker region plays a role as a functional switch of UHRF1 involved in multiple regulatory pathways such as maintenance of DNA methylation and transcriptional repression. PMID:22837395

  11. The multi-domain protein Np95 connects DNA methylation and histone modification.

    PubMed

    Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich

    2010-04-01

    DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ss. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways. PMID:20026581

  12. A balance between activating and repressive histone modifications regulates cystic fibrosis transmembrane conductance regulator (CFTR) expression in vivo

    PubMed Central

    Bergougnoux, Anne; Rivals, Isabelle; Liquori, Alessandro; Raynal, Caroline; Varilh, Jessica; Magalhães, Milena; Perez, Marie-José; Bigi, Nicole; Des Georges, Marie; Chiron, Raphaël; Squalli-Houssaini, Ahmed Saad; Claustres, Mireille; De Sario, Albertina

    2014-01-01

    The genetic mechanisms that regulate CFTR, the gene responsible for cystic fibrosis, have been widely investigated in cultured cells. However, mechanisms responsible for tissue-specific and time-specific expression are not completely elucidated in vivo. Through the survey of public databases, we found that the promoter of CFTR was associated with bivalent chromatin in human embryonic stem (ES) cells. In this work, we analyzed fetal (at different stages of pregnancy) and adult tissues and showed that, in digestive and lung tissues, which expressed CFTR, H3K4me3 was maintained in the promoter. Histone acetylation was high in the promoter and in two intronic enhancers, especially in fetal tissues. In contrast, in blood cells, which did not express CFTR, the bivalent chromatin was resolved (the promoter was labeled by the silencing mark H3K27me3). Cis-regulatory sequences were associated with lowly acetylated histones. We also provide evidence that the tissue-specific expression of CFTR is not regulated by dynamic changes of DNA methylation in the promoter. Overall, this work shows that a balance between activating and repressive histone modifications in the promoter and intronic enhancers results in the fine regulation of CFTR expression during development, thereby ensuring tissue specificity. PMID:24782114

  13. Molecular insights into the recognition of N-terminal histone modifications by the BRPF1 bromodomain

    PubMed Central

    Poplawski, Amanda; Hu, Kaifeng; Lee, Woonghee; Natesan, Senthil; Peng, Danni; Carlson, Samuel; Shi, Xiaobing; Balaz, Stefan; Markley, John L.; Glass, Karen C.

    2014-01-01

    The monocytic leukemic zinc-finger (MOZ) histone acetyltransferase (HAT) acetylates free histones H3, H4, H2A, and H2B in vitro and is associated with up-regulation of gene transcription. The MOZ HAT functions as a quaternary complex with the bromodomain-PHD finger protein 1 (BRPF1), inhibitor of growth 5 (ING5), and hEaf6 subunits. BRPF1 links the MOZ catalytic subunit to the ING5 and hEaf6 subunits, thereby promoting MOZ HAT activity. Human BRPF1 contains multiple effector domains with known roles in gene transcription, and chromatin binding and remodeling. However, the biological function of the BRPF1 bromodomain remains unknown. Our findings reveal novel interactions of the BRPF1 bromodomain with multiple acetyllysine residues on the N-terminus of histones, and show it preferentially selects for H2AK5ac, H4K12ac and H3K14ac. We used chemical shift perturbation data from NMR titration experiments to map the BRPF1 bromodomain ligand binding pocket and identified key residues responsible for coordination of the post-translationally modified histones. Extensive molecular dynamics simulations were used to generate structural models of bromodomain-histone ligand complexes, to analyze H-bonding and other interactions, and to calculate the binding free energies. Our results outline the molecular mechanism driving binding specificity of the BRPF1 bromodomain for discrete acetyllysine residues on the N-terminal histone tails. Together these data provide insights on how histone recognition by the bromodomain directs the biological function of BRPF1, ultimately targeting the MOZ HAT complex to chromatin substrates. PMID:24333487

  14. Evolution of histone H3: emergence of variants and conservation of post-translational modification sites.

    PubMed

    Waterborg, Jakob H

    2012-02-01

    Histone H3 proteins are highly conserved across all eukaryotes and are dynamically modified by many post-translational modifications (PTMs). Here we describe a method that defines the evolution of the family of histone H3 proteins, including the emergence of functionally distinct variants. It combines information from histone H3 protein sequences in eukaryotic species with the evolution of these species as described by the tree of life (TOL) project. This so-called TOL analysis identified the time when the few observed protein sequence changes occurred and when distinct, co-existing H3 protein variants arose. Four distinct ancient duplication events were identified where replication-coupled (RC) H3 variants diverged from replication-independent (RI) forms, like histone H3.3 in animals. These independent events occurred in ancestral lineages leading to the clades of metazoa, viridiplantae, basidiomycota, and alveolata. The proto-H3 sequence in the last eukaryotic common ancestor (LECA) was expanded to at least 133 of its 135 residues. Extreme conservation of known acetylation and methylation sites of lysines and arginines predicts that these PTMs will exist across the eukaryotic crown phyla and in protists with canonical chromatin structures. Less complete conservation was found for most serine and threonine phosphorylation sites. This study demonstrates that TOL analysis can determine the evolution of slowly evolving proteins in sequence-saturated datasets.

  15. Chromatin modifiers and histone modifications in bone formation, regeneration, and therapeutic intervention for bone-related disease.

    PubMed

    Gordon, Jonathan A R; Stein, Janet L; Westendorf, Jennifer J; van Wijnen, Andre J

    2015-12-01

    Post-translational modifications of chromatin such as DNA methylation and different types of histone acetylation, methylation and phosphorylation are well-appreciated epigenetic mechanisms that confer information to progeny cells during lineage commitment. These distinct epigenetic modifications have defined roles in bone, development, tissue regeneration, cell commitment and differentiation, as well as disease etiologies. In this review, we discuss the role of these chromatin modifications and the enzymes regulating these marks (methyltransferases, demethylases, acetyltransferases, and deacetylases) in progenitor cells, osteoblasts and bone-related cells. In addition, the clinical relevance of deregulated histone modifications and enzymes as well as current and potential therapeutic interventions targeting chromatin modifiers are addressed.

  16. AIRE activated tissue specific genes have histone modifications associated with inactive chromatin.

    PubMed

    Org, Tõnis; Rebane, Ana; Kisand, Kai; Laan, Martti; Haljasorg, Uku; Andreson, Reidar; Peterson, Pärt

    2009-12-15

    The Autoimmune Regulator (AIRE) protein is expressed in thymic medullary epithelial cells, where it promotes the ectopic expression of tissue-restricted antigens needed for efficient negative selection of developing thymocytes. Mutations in AIRE cause APECED syndrome, which is characterized by a breakdown of self-tolerance. The molecular mechanism by which AIRE increases the expression of a variety of different genes remains unknown. Here, we studied AIRE-regulated genes using whole genome expression analysis and chromatin immunoprecipitation. We show that AIRE preferentially activates genes that are tissue-specific and characterized by low levels of initial expression in stably transfected HEK293 cell model and mouse thymic medullary epithelial cells. In addition, the AIRE-regulated genes lack active chromatin marks, such as histone H3 trimethylation (H3K4me3) and acetylation (AcH3), on their promoters. We also show that during activation by AIRE, the target genes acquire histone H3 modifications associated with transcription and RNA polymerase II. In conclusion, our data show that AIRE is able to promote ectopic gene expression from chromatin associated with histone modifications characteristic to inactive genes.

  17. Structural and Histone Binding Ability Characterizations of Human PWWP Domains

    SciTech Connect

    Wu, Hong; Zeng, Hong; Lam, Robert; Tempel, Wolfram; Amaya, Maria F.; Xu, Chao; Dombrovski, Ludmila; Qiu, Wei; Wang, Yanming; Min, Jinrong

    2013-09-25

    The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members, implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.

  18. The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote

    PubMed Central

    Schübeler, Dirk; MacAlpine, David M.; Scalzo, David; Wirbelauer, Christiane; Kooperberg, Charles; van Leeuwen, Fred; Gottschling, Daniel E.; O'Neill, Laura P.; Turner, Bryan M.; Delrow, Jeffrey; Bell, Stephen P.; Groudine, Mark

    2004-01-01

    The covalent modification of nucleosomal histones has emerged as a major determinant of chromatin structure and gene activity. To understand the interplay between various histone modifications, including acetylation and methylation, we performed a genome-wide chromatin structure analysis in a higher eukaryote. We found a binary pattern of histone modifications among euchromatic genes, with active genes being hyperacetylated for H3 and H4 and hypermethylated at Lys 4 and Lys 79 of H3, and inactive genes being hypomethylated and deacetylated at the same residues. Furthermore, the degree of modification correlates with the level of transcription, and modifications are largely restricted to transcribed regions, suggesting that their regulation is tightly linked to polymerase activity. PMID:15175259

  19. DNA methylation and histone modification patterns during the late embryonic and early postnatal development of chickens.

    PubMed

    Li, Changwu; Guo, Shuangshuang; Zhang, Ming; Gao, Jing; Guo, Yuming

    2015-04-01

    Early mammalian embryonic cells have been proven to be essential for embryonic development and the health of neonates. A series of epigenetic reprogramming events, including DNA methylation and histone modifications, occur during early embryonic development. However, epigenetic marks in late embryos and neonates are not well understood, especially in avian species. To investigate the epigenetic patterns of developing embryos and posthatched chicks, embryos at embryonic day 5 (E5), E8, E11, E14, E17, and E20 and newly hatched chicks on day of life 1 (D1), D7, D14, D21 were collected. The levels of global DNA methylation and histone H3 at lysine 9 residue (H3K9) modifications were measured in samples of liver, jejunum, and breast skeletal muscles by Western blotting and immunofluorescence staining. According to our data, decreased levels of proliferating cell nuclear antigen expression were found in the liver and a V-shaped pattern of proliferating cell nuclear antigen expression was found in the jejunum. The level of proliferating cell nuclear antigen in muscle was relatively stable. Caspase 3 expression gradually decreased over time in liver, was stable in the jejunum, and increased in muscle. Levels of DNA methylation and H3K9 acetylation decreased in liver over time, while the pattern was N-shaped in jejunal tissue and W-shaped in pectoral muscles, and these changes were accompanied by dynamic changes of DNA methyltransferases, histone acetyltransferases 1, and histone deacetylase 2. Moreover, dimethylation, trimethylation, and acetylation of H3K9 were expressed in a time- and tissue-dependent manner. After birth, epigenetic marks were relatively stable and found at lower levels. These results indicate that spatiotemporal specific epigenetic alterations could be critical for the late development of chick embryos and neonates.

  20. In Vivo Study of the Nucleosome Assembly Functions of ASF1 Histone Chaperones in Human Cells▿ †

    PubMed Central

    Galvani, Angélique; Courbeyrette, Régis; Agez, Morgane; Ochsenbein, Françoise; Mann, Carl; Thuret, Jean-Yves

    2008-01-01

    Histone chaperones have been implicated in nucleosome assembly and disassembly as well as histone modification. ASF1 is a highly conserved histone H3/H4 chaperone that synergizes in vitro with two other histone chaperones, chromatin assembly factor 1 (CAF-1) and histone repression A factor (HIRA), in DNA synthesis-coupled and DNA synthesis-independent nucleosome assembly. Here, we identify mutants of histones H3.1 and H3.3 that are unable to interact with human ASF1A and ASF1B isoforms but that are still competent to bind CAF-1 and HIRA, respectively. We show that these mutant histones are inefficiently deposited into chromatin in vivo. Furthermore, we found that both ASF1A and ASF1B participate in the DNA synthesis-independent deposition of H3.3 in HeLa cells, thus highlighting an unexpected role for ASF1B in this pathway. This pathway does not require interaction of ASF1 with HIRA. We provide the first direct determination that ASF1A and ASF1B play a role in the efficiency of nucleosome assembly in vivo in human cells. PMID:18378699

  1. Histone Modifications Are Associated with Δ9-Tetrahydrocannabinol-mediated Alterations in Antigen-specific T Cell Responses*

    PubMed Central

    Yang, Xiaoming; Hegde, Venkatesh L.; Rao, Roshni; Zhang, Jiajia; Nagarkatti, Prakash S.; Nagarkatti, Mitzi

    2014-01-01

    Marijuana is one of the most abused drugs due to its psychotropic effects. Interestingly, it is also used for medicinal purposes. The main psychotropic component in marijuana, Δ9-tetrahydrocannabinol (THC), has also been shown to mediate potent anti-inflammatory properties. Whether the immunomodulatory activity of THC is mediated by epigenetic regulation has not been investigated previously. In this study, we employed ChIP-Seq technology to examine the in vivo effect of THC on global histone methylation in lymph node cells of mice immunized with a superantigen, staphylococcal enterotoxin B. We compared genome-wide histone H3 Lys-4, Lys-27, Lys-9, and Lys-36 trimethylation and histone H3 Lys-9 acetylation patterns in such cells exposed to THC or vehicle. Our results showed that THC treatment leads to the association of active histone modification signals to Th2 cytokine genes and suppressive modification signals to Th1 cytokine genes, indicating that such a mechanism may play a critical role in the THC-mediated switch from Th1 to Th2. At the global level, a significant portion of histone methylation and acetylation regions were altered by THC. However, the overall distribution of these histone methylation signals among the genomic features was not altered significantly by THC, suggesting that THC activates the expression of a subset of genes while suppressing the expression of another subset of genes through histone modification. Functional classification of these histone marker-associated genes showed that these differentially associated genes were involved in various cellular functions, from cell cycle regulation to metabolism, suggesting that THC had a pleiotropic effect on gene expression in immune cells. Altogether, the current study demonstrates for the first time that THC may modulate immune response through epigenetic regulation involving histone modifications. PMID:24841204

  2. Histone modifications and mRNA expression in the inner cell mass and trophectoderm of bovine blastocysts.

    PubMed

    Herrmann, Doris; Dahl, John Arne; Lucas-Hahn, Andrea; Collas, Philippe; Niemann, Heiner

    2013-03-01

    Normal development depends on the precise sequence of changes in the configuration of chromatin; these are primarily related to specific biochemical modifications such as acetylation or methylation of histones and DNA methylation. While the role of DNA methylation during preimplantation development has been studied extensively, little is known about histone modifications related to early embryonic development. Here, we investigated gene-specific histone modifications in in vitro produced bovine blastocysts. Selected genes thought to be critical for bovine preimplantation development were examined and included POU5F1 (OCT4), NANOG, INFT, GAPDH, SLC2A3 and IGF1. We used chromatin immunoprecipitation from pools of bovine blastocysts to unravel several modifications of histone H3 in relation to mRNA expression profiles. We focused on the two cell compartments of the blastocyst, the inner cell mass (ICM) and the trophectoderm (TE). We show that gene expression patterns in the ICM and TE of the bovine blastocyst are consistent with histone modification patterns on the promoter of the corresponding genes. The data show a complex epigenetic pattern of promoter occupancy by transcriptionally permissive and repressive H3 modifications. These results pave the way to in-depth epigenetic studies of preimplantation embryos that are crucial to gain a better understanding of the epigenetic changes frequently observed after use of assisted reproductive technologies. PMID:23406883

  3. ChIPnorm: A Statistical Method for Normalizing and Identifying Differential Regions in Histone Modification ChIP-seq Libraries

    PubMed Central

    Bucher, Philipp; Moret, Bernard M. E.

    2012-01-01

    The advent of high-throughput technologies such as ChIP-seq has made possible the study of histone modifications. A problem of particular interest is the identification of regions of the genome where different cell types from the same organism exhibit different patterns of histone enrichment. This problem turns out to be surprisingly difficult, even in simple pairwise comparisons, because of the significant level of noise in ChIP-seq data. In this paper we propose a two-stage statistical method, called ChIPnorm, to normalize ChIP-seq data, and to find differential regions in the genome, given two libraries of histone modifications of different cell types. We show that the ChIPnorm method removes most of the noise and bias in the data and outperforms other normalization methods. We correlate the histone marks with gene expression data and confirm that histone modifications H3K27me3 and H3K4me3 act as respectively a repressor and an activator of genes. Compared to what was previously reported in the literature, we find that a substantially higher fraction of bivalent marks in ES cells for H3K27me3 and H3K4me3 move into a K27-only state. We find that most of the promoter regions in protein-coding genes have differential histone-modification sites. The software for this work can be downloaded from http://lcbb.epfl.ch/software.html. PMID:22870189

  4. Cyclical DNA Methylation and Histone Changes Are Induced by LPS to Activate COX-2 in Human Intestinal Epithelial Cells

    PubMed Central

    Brancaccio, Mariarita; Coretti, Lorena; Florio, Ermanno; Pezone, Antonio; Calabrò, Viola; Falco, Geppino; Keller, Simona; Lembo, Francesca; Avvedimento, Vittorio Enrico; Chiariotti, Lorenzo

    2016-01-01

    Bacterial lipopolysaccharide (LPS) induces release of inflammatory mediators both in immune and epithelial cells. We investigated whether changes of epigenetic marks, including selected histone modification and DNA methylation, may drive or accompany the activation of COX-2 gene in HT-29 human intestinal epithelial cells upon exposure to LPS. Here we describe cyclical histone acetylation (H3), methylation (H3K4, H3K9, H3K27) and DNA methylation changes occurring at COX-2 gene promoter overtime after LPS stimulation. Histone K27 methylation changes are carried out by the H3 demethylase JMJD3 and are essential for COX-2 induction by LPS. The changes of the histone code are associated with cyclical methylation signatures at the promoter and gene body of COX-2 gene. PMID:27253528

  5. Arsenic Trioxide Reduces Global Histone H4 Acetylation at Lysine 16 through Direct Binding to Histone Acetyltransferase hMOF in Human Cells

    PubMed Central

    Liu, Da; Wu, Donglu; Zhao, Linhong; Yang, Yang; Ding, Jian; Dong, Liguo; Hu, Lianghai; Wang, Fei; Zhao, Xiaoming; Cai, Yong; Jin, Jingji

    2015-01-01

    Histone post-translational modification heritably regulates gene expression involved in most cellular biological processes. Experimental studies suggest that alteration of histone modifications affects gene expression by changing chromatin structure, causing various cellular responses to environmental influences. Arsenic (As), a naturally occurring element and environmental pollutant, is an established human carcinogen. Recently, increasing evidence suggests that As-mediated epigenetic mechanisms may be involved in its toxicity and carcinogenicity, but how this occurs is still unclear. Here we present evidence that suggests As-induced global histone H4K16 acetylation (H4K16ac) partly due to the direct physical interaction between As and histone acetyltransferase (HAT) hMOF (human male absent on first) protein, leading to the loss of hMOF HAT activity. Our data show that decreased global H4K16ac and increased deacetyltransferase HDAC4 expression occurred in arsenic trioxide (As2O3)-exposed HeLa or HEK293T cells. However, depletion of HDAC4 did not affect global H4K16ac, and it could not raise H4K16ac in cells exposed to As2O3, suggesting that HDAC4 might not directly be involved in histone H4K16 de-acetylation. Using As-immobilized agarose, we confirmed that As binds directly to hMOF, and that this interaction was competitively inhibited by free As2O3. Also, the direct interaction of As and C2CH zinc finger peptide was verified by MAIDI-TOF mass and UV absorption. In an in vitro HAT assay, As2O3 directly inhibited hMOF activity. hMOF over-expression not only increased resistance to As and caused less toxicity, but also effectively reversed reduced H4K16ac caused by As exposure. These data suggest a theoretical basis for elucidating the mechanism of As toxicity. PMID:26473953

  6. Streamlined discovery of cross-linked chromatin complexes and associated histone modifications by mass spectrometry

    PubMed Central

    Zee, Barry M.; Alekseyenko, Artyom A.; McElroy, Kyle A.; Kuroda, Mitzi I.

    2016-01-01

    Posttranslational modifications (PTMs) are key contributors to chromatin function. The ability to comprehensively link specific histone PTMs with specific chromatin factors would be an important advance in understanding the functions and genomic targeting mechanisms of those factors. We recently introduced a cross-linked affinity technique, BioTAP-XL, to identify chromatin-bound protein interactions that can be difficult to capture with native affinity techniques. However, BioTAP-XL was not strictly compatible with similarly comprehensive analyses of associated histone PTMs. Here we advance BioTAP-XL by demonstrating the ability to quantify histone PTMs linked to specific chromatin factors in parallel with the ability to identify nonhistone binding partners. Furthermore we demonstrate that the initially published quantity of starting material can be scaled down orders of magnitude without loss in proteomic sensitivity. We also integrate hydrophilic interaction chromatography to mitigate detergent carryover and improve liquid chromatography-mass spectrometric performance. In summary, we greatly extend the practicality of BioTAP-XL to enable comprehensive identification of protein complexes and their local chromatin environment. PMID:26831069

  7. Analysis of Histones H3 and H4 Reveals Novel and Conserved Post-Translational Modifications in Sugarcane

    PubMed Central

    Liu, Shichong; Souza, Glaucia Mendes; Garcia, Benjamin A.; Casas-Mollano, J. Armando

    2015-01-01

    Histones are the main structural components of the nucleosome, hence targets of many regulatory proteins that mediate processes involving changes in chromatin. The functional outcome of many pathways is “written” in the histones in the form of post-translational modifications that determine the final gene expression readout. As a result, modifications, alone or in combination, are important determinants of chromatin states. Histone modifications are accomplished by the addition of different chemical groups such as methyl, acetyl and phosphate. Thus, identifying and characterizing these modifications and the proteins related to them is the initial step to understanding the mechanisms of gene regulation and in the future may even provide tools for breeding programs. Several studies over the past years have contributed to increase our knowledge of epigenetic gene regulation in model organisms like Arabidopsis, yet this field remains relatively unexplored in crops. In this study we identified and initially characterized histones H3 and H4 in the monocot crop sugarcane. We discovered a number of histone genes by searching the sugarcane ESTs database. The proteins encoded correspond to canonical histones, and their variants. We also purified bulk histones and used them to map post-translational modifications in the histones H3 and H4 using mass spectrometry. Several modifications conserved in other plants, and also novel modified residues, were identified. In particular, we report O-acetylation of serine, threonine and tyrosine, a recently identified modification conserved in several eukaryotes. Additionally, the sub-nuclear localization of some well-studied modifications (i.e., H3K4me3, H3K9me2, H3K27me3, H3K9ac, H3T3ph) is described and compared to other plant species. To our knowledge, this is the first report of histones H3 and H4 as well as their post-translational modifications in sugarcane, and will provide a starting point for the study of chromatin

  8. Pathology Tissue-quantitative Mass Spectrometry Analysis to Profile Histone Post-translational Modification Patterns in Patient Samples*

    PubMed Central

    Noberini, Roberta; Uggetti, Andrea; Pruneri, Giancarlo; Minucci, Saverio

    2016-01-01

    Histone post-translational modifications (hPTMs) generate a complex combinatorial code that has been implicated with various pathologies, including cancer. Dissecting such a code in physiological and diseased states may be exploited for epigenetic biomarker discovery, but hPTM analysis in clinical samples has been hindered by technical limitations. Here, we developed a method (PAThology tissue analysis of Histones by Mass Spectrometry - PAT-H-MS) that allows to perform a comprehensive, unbiased and quantitative MS-analysis of hPTM patterns on formalin-fixed paraffin-embedded (FFPE) samples. In pairwise comparisons, histone extracted from formalin-fixed paraffin-embedded tissues showed patterns similar to fresh frozen samples for 24 differentially modified peptides from histone H3. In addition, when coupled with a histone-focused version of the super-SILAC approach, this method allows the accurate quantification of modification changes among breast cancer patient samples. As an initial application of the PAThology tissue analysis of Histones by Mass Spectrometry method, we analyzed breast cancer samples, revealing significant changes in histone H3 methylation patterns among Luminal A-like and Triple Negative disease subtypes. These results pave the way for retrospective epigenetic studies that combine the power of MS-based hPTM analysis with the extensive clinical information associated with formalin-fixed paraffin-embedded archives. PMID:26463340

  9. Role for histone deacetylase 1 in human tumor cell proliferation.

    PubMed

    Senese, Silvia; Zaragoza, Katrin; Minardi, Simone; Muradore, Ivan; Ronzoni, Simona; Passafaro, Alfonso; Bernard, Loris; Draetta, Giulio F; Alcalay, Myriam; Seiser, Christian; Chiocca, Susanna

    2007-07-01

    Posttranslational modifications of core histones are central to the regulation of gene expression. Histone deacetylases (HDACs) repress transcription by deacetylating histones, and class I HDACs have a crucial role in mouse, Xenopus laevis, zebra fish, and Caenorhabditis elegans development. The role of individual class I HDACs in tumor cell proliferation was investigated using RNA interference-mediated protein knockdown. We show here that in the absence of HDAC1 cells can arrest either at the G(1) phase of the cell cycle or at the G(2)/M transition, resulting in the loss of mitotic cells, cell growth inhibition, and an increase in the percentage of apoptotic cells. On the contrary, HDAC2 knockdown showed no effect on cell proliferation unless we concurrently knocked down HDAC1. Using gene expression profiling analysis, we found that inactivation of HDAC1 affected the transcription of specific target genes involved in proliferation and apoptosis. Furthermore, HDAC2 downregulation did not cause significant changes compared to control cells, while inactivation of HDAC1, HDAC1 plus HDAC2, or HDAC3 resulted in more distinct clusters. Loss of these HDACs might impair cell cycle progression by affecting not only the transcription of specific target genes but also other biological processes. Our data support the idea that a drug targeting specific HDACs could be highly beneficial in the treatment of cancer.

  10. Insights into neuroepigenetics through human histone deacetylase PET imaging.

    PubMed

    Wey, Hsiao-Ying; Gilbert, Tonya M; Zürcher, Nicole R; She, Angela; Bhanot, Anisha; Taillon, Brendan D; Schroeder, Fredrick A; Wang, Changing; Haggarty, Stephen J; Hooker, Jacob M

    2016-08-10

    Epigenetic dysfunction is implicated in many neurological and psychiatric diseases, including Alzheimer's disease and schizophrenia. Consequently, histone deacetylases (HDACs) are being aggressively pursued as therapeutic targets. However, a fundamental knowledge gap exists regarding the expression and distribution of HDACs in healthy individuals for comparison to disease states. Here, we report the first-in-human evaluation of neuroepigenetic regulation in vivo. Using positron emission tomography with [(11)C]Martinostat, an imaging probe selective for class I HDACs (isoforms 1, 2, and 3), we found that HDAC expression is higher in cortical gray matter than in white matter, with conserved regional distribution patterns within and between healthy individuals. Among gray matter regions, HDAC expression was lowest in the hippocampus and amygdala. Through biochemical profiling of postmortem human brain tissue, we confirmed that [(11)C]Martinostat selectively binds HDAC isoforms 1, 2, and 3, the HDAC subtypes most implicated in regulating neuroplasticity and cognitive function. In human stem cell-derived neural progenitor cells, pharmacologic-level doses of Martinostat induced changes in genes closely associated with synaptic plasticity, including BDNF (brain-derived neurotrophic factor) and SYP (synaptophysin), as well as genes implicated in neurodegeneration, including GRN (progranulin), at the transcript level, in concert with increased acetylation at both histone H3 lysine 9 and histone H4 lysine 12. This study quantifies HDAC expression in the living human brain and provides the foundation for gaining unprecedented in vivo epigenetic information in health and disease. PMID:27510902

  11. Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification.

    PubMed

    Lippman, Zachary; May, Bruce; Yordan, Cristy; Singer, Tatjana; Martienssen, Rob

    2003-12-01

    Heritable, but reversible, changes in transposable element activity were first observed in maize by Barbara McClintock in the 1950s. More recently, transposon silencing has been associated with DNA methylation, histone H3 lysine-9 methylation (H3mK9), and RNA interference (RNAi). Using a genetic approach, we have investigated the role of these modifications in the epigenetic regulation and inheritance of six Arabidopsis transposons. Silencing of most of the transposons is relieved in DNA methyltransferase (met1), chromatin remodeling ATPase (ddm1), and histone modification (sil1) mutants. In contrast, only a small subset of the transposons require the H3mK9 methyltransferase KRYPTONITE, the RNAi gene ARGONAUTE1, and the CXG methyltransferase CHROMOMETHYLASE3. In crosses to wild-type plants, epigenetic inheritance of active transposons varied from mutant to mutant, indicating these genes differ in their ability to silence transposons. According to their pattern of transposon regulation, the mutants can be divided into two groups, which suggests that there are distinct, but interacting, complexes or pathways involved in transposon silencing. Furthermore, different transposons tend to be susceptible to different forms of epigenetic regulation. PMID:14691539

  12. Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification.

    PubMed

    Lippman, Zachary; May, Bruce; Yordan, Cristy; Singer, Tatjana; Martienssen, Rob

    2003-12-01

    Heritable, but reversible, changes in transposable element activity were first observed in maize by Barbara McClintock in the 1950s. More recently, transposon silencing has been associated with DNA methylation, histone H3 lysine-9 methylation (H3mK9), and RNA interference (RNAi). Using a genetic approach, we have investigated the role of these modifications in the epigenetic regulation and inheritance of six Arabidopsis transposons. Silencing of most of the transposons is relieved in DNA methyltransferase (met1), chromatin remodeling ATPase (ddm1), and histone modification (sil1) mutants. In contrast, only a small subset of the transposons require the H3mK9 methyltransferase KRYPTONITE, the RNAi gene ARGONAUTE1, and the CXG methyltransferase CHROMOMETHYLASE3. In crosses to wild-type plants, epigenetic inheritance of active transposons varied from mutant to mutant, indicating these genes differ in their ability to silence transposons. According to their pattern of transposon regulation, the mutants can be divided into two groups, which suggests that there are distinct, but interacting, complexes or pathways involved in transposon silencing. Furthermore, different transposons tend to be susceptible to different forms of epigenetic regulation.

  13. Sumoylated Human Histone H4 Prevents Chromatin Compaction by Inhibiting Long-range Internucleosomal Interactions*

    PubMed Central

    Dhall, Abhinav; Wei, Sijie; Fierz, Beat; Woodcock, Christopher L.; Lee, Tae-Hee; Chatterjee, Champak

    2014-01-01

    The structure of eukaryotic chromatin directly influences gene function, and is regulated by chemical modifications of the core histone proteins. Modification of the human histone H4 N-terminal tail region by the small ubiquitin-like modifier protein, SUMO-3, is associated with transcription repression. However, the direct effect of sumoylation on chromatin structure and function remains unknown. Therefore, we employed a disulfide-directed strategy to generate H4 homogenously and site-specifically sumoylated at Lys-12 (suH4ss). Chromatin compaction and oligomerization assays with nucleosomal arrays containing suH4ss established that SUMO-3 inhibits array folding and higher order oligomerization, which underlie chromatin fiber formation. Moreover, the effect of sumoylation differed from that of acetylation, and could be recapitulated with the structurally similar protein ubiquitin. Mechanistic studies at the level of single nucleosomes revealed that, unlike acetylation, the effect of SUMO-3 arises from the attenuation of long-range internucleosomal interactions more than from the destabilization of a compacted dinucleosome state. Altogether, our results present the first insight on the direct structural effects of histone H4 sumoylation and reveal a novel mechanism by which SUMO-3 inhibits chromatin compaction. PMID:25294883

  14. Structure and Site-Specific Recognition of Histone H3 by the PHD Finger of Human Autoimmune Regulator

    PubMed Central

    Chakravarty, Suvobrata; Zeng, Lei; Zhou, Ming-Ming

    2010-01-01

    SUMMARY Human autoimmune regulator (AIRE) functions to control thymic expression of tissue-specific antigens via sequence-specific histone H3 recognition by its plant homeodomain (PHD) finger. Mutations in the AIRE PHD finger have been linked to autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). Here we report the three-dimensional solution structure of the first PHD finger of human AIRE bound to a histone H3 peptide. The structure reveals a detailed network of interactions between the protein and the amino-terminal residues of histone H3, and particularly key electrostatic interactions of a conserved aspartic acid 297 in AIRE with the unmodified lysine 4 of histone H3 (H3K4). NMR binding study with H3 peptides carrying known post-translational modifications flanking H3K4 confirms that transcriptional regulation by AIRE through its interactions with histone H3 is confined to the first N-terminal eight residues in H3. Our study offers a molecular explanation for the APECED mutations and helps define a subclass of the PHD finger family proteins that recognize histone H3 in a sequence-specific manner. PMID:19446523

  15. Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation.

    PubMed

    Tropberger, Philipp; Mercier, Alexandre; Robinson, Margaret; Zhong, Weidong; Ganem, Don E; Holdorf, Meghan

    2015-10-20

    Chronic hepatitis B virus (HBV) infection affects 240 million people worldwide and is a major risk factor for liver failure and hepatocellular carcinoma. Current antiviral therapy inhibits cytoplasmic HBV genomic replication, but is not curative because it does not directly affect nuclear HBV closed circular DNA (cccDNA), the genomic form that templates viral transcription and sustains viral persistence. Novel approaches that directly target cccDNA regulation would therefore be highly desirable. cccDNA is assembled with cellular histone proteins into chromatin, but little is known about the regulation of HBV chromatin by histone posttranslational modifications (PTMs). Here, using a new cccDNA ChIP-Seq approach, we report, to our knowledge, the first genome-wide maps of PTMs in cccDNA-containing chromatin from de novo infected HepG2 cells, primary human hepatocytes, and from HBV-infected liver tissue. We find high levels of PTMs associated with active transcription enriched at specific sites within the HBV genome and, surprisingly, very low levels of PTMs linked to transcriptional repression even at silent HBV promoters. We show that transcription and active PTMs in HBV chromatin are reduced by the activation of an innate immunity pathway, and that this effect can be recapitulated with a small molecule epigenetic modifying agent, opening the possibility that chromatin-based regulation of cccDNA transcription could be a new therapeutic approach to chronic HBV infection.

  16. Histone Modifications in a Mouse Model of Early Adversities and Panic Disorder: Role for Asic1 and Neurodevelopmental Genes.

    PubMed

    Cittaro, Davide; Lampis, Valentina; Luchetti, Alessandra; Coccurello, Roberto; Guffanti, Alessandro; Felsani, Armando; Moles, Anna; Stupka, Elia; D' Amato, Francesca R; Battaglia, Marco

    2016-01-01

    Hyperventilation following transient, CO2-induced acidosis is ubiquitous in mammals and heritable. In humans, respiratory and emotional hypersensitivity to CO2 marks separation anxiety and panic disorders, and is enhanced by early-life adversities. Mice exposed to the repeated cross-fostering paradigm (RCF) of interference with maternal environment show heightened separation anxiety and hyperventilation to 6% CO2-enriched air. Gene-environment interactions affect CO2 hypersensitivity in both humans and mice. We therefore hypothesised that epigenetic modifications and increased expression of genes involved in pH-detection could explain these relationships. Medullae oblongata of RCF- and normally-reared female outbred mice were assessed by ChIP-seq for H3Ac, H3K4me3, H3K27me3 histone modifications, and by SAGE for differential gene expression. Integration of multiple experiments by network analysis revealed an active component of 148 genes pointing to the mTOR signalling pathway and nociception. Among these genes, Asic1 showed heightened mRNA expression, coherent with RCF-mice's respiratory hypersensitivity to CO2 and altered nociception. Functional enrichment and mRNA transcript analyses yielded a consistent picture of enhancement for several genes affecting chemoception, neurodevelopment, and emotionality. Particularly, results with Asic1 support recent human findings with panic and CO2 responses, and provide new perspectives on how early adversities and genes interplay to affect key components of panic and related disorders. PMID:27121911

  17. Histone Modifications in a Mouse Model of Early Adversities and Panic Disorder: Role for Asic1 and Neurodevelopmental Genes

    PubMed Central

    Cittaro, Davide; Lampis, Valentina; Luchetti, Alessandra; Coccurello, Roberto; Guffanti, Alessandro; Felsani, Armando; Moles, Anna; Stupka, Elia; D’ Amato, Francesca R.; Battaglia, Marco

    2016-01-01

    Hyperventilation following transient, CO2-induced acidosis is ubiquitous in mammals and heritable. In humans, respiratory and emotional hypersensitivity to CO2 marks separation anxiety and panic disorders, and is enhanced by early-life adversities. Mice exposed to the repeated cross-fostering paradigm (RCF) of interference with maternal environment show heightened separation anxiety and hyperventilation to 6% CO2-enriched air. Gene-environment interactions affect CO2 hypersensitivity in both humans and mice. We therefore hypothesised that epigenetic modifications and increased expression of genes involved in pH-detection could explain these relationships. Medullae oblongata of RCF- and normally-reared female outbred mice were assessed by ChIP-seq for H3Ac, H3K4me3, H3K27me3 histone modifications, and by SAGE for differential gene expression. Integration of multiple experiments by network analysis revealed an active component of 148 genes pointing to the mTOR signalling pathway and nociception. Among these genes, Asic1 showed heightened mRNA expression, coherent with RCF-mice’s respiratory hypersensitivity to CO2 and altered nociception. Functional enrichment and mRNA transcript analyses yielded a consistent picture of enhancement for several genes affecting chemoception, neurodevelopment, and emotionality. Particularly, results with Asic1 support recent human findings with panic and CO2 responses, and provide new perspectives on how early adversities and genes interplay to affect key components of panic and related disorders. PMID:27121911

  18. Acetylated histone H4 is reduced in human gastric adenomas and carcinomas.

    PubMed

    Ono, S; Oue, N; Kuniyasu, H; Suzuki, T; Ito, R; Matsusaki, K; Ishikawa, T; Tahara, E; Yasui, W

    2002-09-01

    Acetylation of core histones is closely linked to transcriptional activation of various genes. The acetylation levels of nucleosomal histones can be modified through a balance of histone acetyltransferases and deacetylases. To elucidate the role of histone acetylation in human gastric carcinogenesis, we studied the status of histone H4 acetylation in gastric carcinoma tissues and corresponding non-neoplastic mucosa. The status of histone acetylation was assessed by examining the expression of acetylated histone H4 through Western blotting and immunohistochemistry using an anti-acetylated histone H4 antibody. The levels of acetylated histone H4 expression were obviously reduced in 72% (13/18) of gastric carcinomas in comparison with non-neoplastic mucosa by Western blotting. In immunohistochemistry, acetylated histone H4 was clearly detected in the nuclei of both non-neoplastic epithelial and stromal cells, whereas the levels of acetylated histone H4 were heterogeneous or reduced in 66% (38/57) of gastric carcinomas and 46% (6/13) of gastric adenomas. Reduced expression of acetylated histone H4 was also observed in some areas of intestinal metaplasia adjacent to carcinomas. Reduction in the expression of acetylated histone H4 was significantly correlated with advanced stage, depth of tumor invasion and lymph node metastasis. These results suggest that low levels of histone acetylation may be closely associated with the development and progression of gastric carcinomas, possibly through alteration of gene expression.

  19. Histone Modification via Rapid Cleavage of C4′-Oxidized Abasic Sites in Nucleosome Core Particles

    PubMed Central

    Zhou, Chuanzheng; Sczepanski, Jonathan T.; Greenberg, Marc M.

    2013-01-01

    The C4′-oxidized abasic site is produced in DNA by a variety of oxidizing agents, including potent cytotoxic antitumor agents. Independent generation of this alkali-labile lesion at defined positions within nucleosome core particles reveals that the histone proteins increase strand scission between 130 and 550-fold. Strand scission proceeds via a Schiff base intermediate but the DNA protein cross-links are unstable. The oxidized abasic site is removed in its entirety from the DNA and transferred to the lysine rich tail region of the proximal histone protein in the form of a lactam. The modification is distributed over several residues within the amino terminal tail of the proximal histone. Transfer of DNA damage to histones could affect gene regulation. PMID:23531104

  20. Integrated Epigenome Profiling of Repressive Histone Modifications, DNA Methylation and Gene Expression in Normal and Malignant Urothelial Cells

    PubMed Central

    Cookson, Victoria; Chen, Wei; Catto, James

    2012-01-01

    Epigenetic regulation of gene expression is commonly altered in human cancer. We have observed alterations of DNA methylation and microRNA expression that reflect the biology of bladder cancer. This common disease arises by distinct pathways with low and high-grade differentiation. We hypothesized that epigenetic gene regulation reflects an interaction between histone and DNA modifications, and differences between normal and malignant urothelial cells represent carcinogenic events within bladder cancer. To test this we profiled two repressive histone modifications (H3K9m3 and H3K27m3) using ChIP-Seq, cytosine methylation using MeDIP and mRNA expression in normal and malignant urothelial cell lines. In genes with low expression we identified H3K27m3 and DNA methylation each in 20–30% of genes and both marks in 5% of genes. H3K9m3 was detected in 5–10% of genes but was not associated with overall expression. DNA methylation was more closely related to gene expression in malignant than normal cells. H3K27m3 was the epigenetic mark most specifically correlated to gene silencing. Our data suggest that urothelial carcinogenesis is accompanied by a loss of control of both DNA methylation and H3k27 methylation. From our observations we identified a panel of genes with cancer specific-epigenetic mediated aberrant expression including those with reported carcinogenic functions and members potentially mediating a positive epigenetic feedback loop. Pathway enrichment analysis revealed genes marked by H3K9m3 were involved with cell homeostasis, those marked by H3K27m3 mediated pro-carcinogenic processes and those marked with cytosine methylation were mixed in function. In 150 normal and malignant urothelial samples, our gene panel correctly estimated expression in 65% of its members. Hierarchical clustering revealed that this gene panel stratified samples according to the presence and phenotype of bladder cancer. PMID:22412920

  1. Transcriptional regulation of cell cycle genes in response to abiotic stresses correlates with dynamic changes in histone modifications in maize.

    PubMed

    Zhao, Lin; Wang, Pu; Hou, Haoli; Zhang, Hao; Wang, Yapei; Yan, Shihan; Huang, Yan; Li, Hui; Tan, Junjun; Hu, Ao; Gao, Fei; Zhang, Qi; Li, Yingnan; Zhou, Hong; Zhang, Wei; Li, Lijia

    2014-01-01

    The histone modification level has been shown to be related with gene activation and repression in stress-responsive process, but there is little information on the relationship between histone modification and cell cycle gene expression responsive to environmental cues. In this study, the function of histone modifications in mediating the transcriptional regulation of cell cycle genes under various types of stress was investigated in maize (Zea mays L.). Abiotic stresses all inhibit the growth of maize seedlings, and induce total acetylation level increase compared with the control group in maize roots. The positive and negative regulation of the expression of some cell cycle genes leads to perturbation of cell cycle progression in response to abiotic stresses. Chromatin immunoprecipitation analysis reveals that dynamic histone acetylation change in the promoter region of cell cycle genes is involved in the control of gene expression in response to external stress and different cell cycle genes have their own characteristic patterns for histone acetylation. The data also showed that the combinations of hyperacetylation and hypoacetylation states of specific lysine sites on the H3 and H4 tails on the promoter regions of cell cycle genes regulate specific cell cycle gene expression under abiotic stress conditions, thus resulting in prolonged cell cycle duration and an inhibitory effect on growth and development in maize seedlings. PMID:25171199

  2. Fetal human keratinocytes produce large amounts of antimicrobial peptides: involvement of histone-methylation processes.

    PubMed

    Gschwandtner, Maria; Zhong, Shaomin; Tschachler, Antonia; Mlitz, Veronika; Karner, Susanne; Elbe-Bürger, Adelheid; Mildner, Michael

    2014-08-01

    Antimicrobial peptides (AMPs), an important part of the innate immune system, are crucial for defense against invading microorganisms. Whereas AMPs have been extensively studied in adult skin, little is known about the impact of AMPs in the developing human skin. We therefore compared the expression and regulation of AMPs in fetal, neonatal, and adult keratinocytes (KCs) in vitro. The constitutive expression of human β-defensin-2 (HBD-2), HBD-3, S100 protein family members, and cathelicidin was significantly higher in KCs from fetal skin than in KCs from postnatal skin. The capacity to further increase AMP production was comparable between prenatal and postnatal KCs. Analysis of skin equivalents (SEs) revealed a strong constitutive expression of S100 proteins in fetal but not in neonatal and adult SEs. The elevated AMP levels correlated with reduced H3K27me3 (tri-methyl-lysine 27 on histone H3) levels and increased expression of the histone demethylase JMJD3. Knockdown of JMJD3 in fetal KCs elevated H3K27me3 levels and significantly downregulated the expression of HBD-3, S100A7, S100A8, S100A9, and cathelicidin. Our data indicate a crucial contribution of histone modifications in the regulation of AMP expression in the skin during ontogeny. The elevated AMP expression in prenatal skin might represent an essential defense strategy of the unborn.

  3. Cadmium affects mitotically inherited histone modification pathways in mouse embryonic stem cells.

    PubMed

    Gadhia, S R; O'Brien, D; Barile, F A

    2015-12-25

    The fetal basis of adult disease (FeBAD) theorizes that embryonic challenges initiate pathologies in adult life through epigenetic modification of gene expression. In addition, inheritance of H3K27 methylation marks, especially in vitro, is still controversial. Metals, such as Cd, are known to affect differentiation, DNA repair and epigenetic status in mES cells. We tested the premise that Cd exerts differential toxicity in mouse embryonic stem (mES) cells by targeting total histone protein (THP) production early in stem cell development, while affecting H3K27-mono-methylation (H3K27me(1)) in latter stages of differentiation. The inability of mES cells to recover from Cd insult at concentrations greater than IC50 indicates that maximum cytotoxicity occurs during initial hours of exposure. Moreover, as a measure of chromatin stability, low dose acute Cd exposure lowers THP production. The heritable effects of Cd exposure on cell proliferation, chromatin stability and transcription observed through several cell population doublings were detected only during alternate passages on days 3, 7, and 11, presumably due to slower maturation of histone methylation marks. These findings demonstrate a selective disruption of chromatin structure following acute Cd exposure, an effect not seen in developmentally mature cells. Hence, we present that acute Cd toxicity is cumulative and disrupts DNA repair, while concurrently affecting cell cycle progression, chromatin stability and transcriptional state in mES cells.

  4. Chromatin Modulation of Herpesvirus Lytic Gene Expression: Managing Nucleosome Density and Heterochromatic Histone Modifications.

    PubMed

    Kristie, Thomas M

    2016-01-01

    Like their cellular hosts, herpesviruses are subject to the regulatory impacts of chromatin assembled on their genomes. Upon infection, these viruses are assembled into domains of chromatin with heterochromatic signatures that suppress viral gene expression or euchromatic characteristics that promote gene expression. The organization and modulation of these chromatin domains appear to be intimately linked to the coordinated expression of the different classes of viral genes and thus ultimately play an important role in the progression of productive infection or the establishment and maintenance of viral latency. A recent report from the Knipe laboratory (J. S. Lee, P. Raja, and D. M. Knipe, mBio 7:e02007-15, 2016) contributes to the understanding of the dynamic modulation of chromatin assembled on the herpes simplex virus genome by monitoring the levels of characteristic heterochromatic histone modifications (histone H3 lysine 9 and 27 methylation) associated with a model viral early gene during the progression of lytic infection. Additionally, this study builds upon previous observations that the viral immediate-early protein ICP0 plays a role in reducing the levels of heterochromatin associated with the early genes. PMID:26884430

  5. The Role of Sulforaphane in Epigenetic Mechanisms, Including Interdependence between Histone Modification and DNA Methylation

    PubMed Central

    Kaufman-Szymczyk, Agnieszka; Majewski, Grzegorz; Lubecka-Pietruszewska, Katarzyna; Fabianowska-Majewska, Krystyna

    2015-01-01

    Carcinogenesis as well as cancer progression result from genetic and epigenetic changes of the genome that leads to dysregulation of transcriptional activity of genes. Epigenetic mechanisms in cancer cells comprise (i) post-translation histone modification (i.e., deacetylation and methylation); (ii) DNA global hypomethylation; (iii) promoter hypermethylation of tumour suppressor genes and genes important for cell cycle regulation, cell differentiation and apoptosis; and (iv) posttranscriptional regulation of gene expression by noncoding microRNA. These epigenetic aberrations can be readily reversible and responsive to both synthetic agents and natural components of diet. A source of one of such diet components are cruciferous vegetables, which contain high levels of a number of glucosinolates and deliver, after enzymatic hydrolysis, sulforaphane and other bioactive isothiocyanates, that are involved in effective up-regulation of transcriptional activity of certain genes and also in restoration of active chromatin structure. Thus a consumption of cruciferous vegetables, treated as a source of isothiocyanates, seems to be potentially useful as an effective cancer preventive factor or as a source of nutrients improving efficacy of standard chemotherapies. In this review an attempt is made to elucidate the role of sulforaphane in regulation of gene promoter activity through a direct down-regulation of histone deacetylase activity and alteration of gene promoter methylation in indirect ways, but the sulforaphane influence on non-coding micro-RNA will not be a subject of this review. PMID:26703571

  6. Multiple dimensions of epigenetic gene regulation in the malaria parasite Plasmodium falciparum: gene regulation via histone modifications, nucleosome positioning and nuclear architecture in P. falciparum.

    PubMed

    Ay, Ferhat; Bunnik, Evelien M; Varoquaux, Nelle; Vert, Jean-Philippe; Noble, William Stafford; Le Roch, Karine G

    2015-02-01

    Plasmodium falciparum is the most deadly human malarial parasite, responsible for an estimated 207 million cases of disease and 627,000 deaths in 2012. Recent studies reveal that the parasite actively regulates a large fraction of its genes throughout its replicative cycle inside human red blood cells and that epigenetics plays an important role in this precise gene regulation. Here, we discuss recent advances in our understanding of three aspects of epigenetic regulation in P. falciparum: changes in histone modifications, nucleosome occupancy and the three-dimensional genome structure. We compare these three aspects of the P. falciparum epigenome to those of other eukaryotes, and show that large-scale compartmentalization is particularly important in determining histone decomposition and gene regulation in P. falciparum. We conclude by presenting a gene regulation model for P. falciparum that combines the described epigenetic factors, and by discussing the implications of this model for the future of malaria research.

  7. Hippocampal Focal Knockout of CBP Affects Specific Histone Modifications, Long-Term Potentiation, and Long-Term Memory

    PubMed Central

    Barrett, Ruth M; Malvaez, Melissa; Kramar, Eniko; Matheos, Dina P; Arrizon, Abraham; Cabrera, Sara M; Lynch, Gary; Greene, Robert W; Wood, Marcelo A

    2011-01-01

    To identify the role of the histone acetyltransferase (HAT) CREB-binding protein (CBP) in neurons of the CA1 region of the hippocampus during memory formation, we examine the effects of a focal homozygous knockout of CBP on histone modifications, gene expression, synaptic plasticity, and long-term memory. We show that CBP is critical for the in vivo acetylation of lysines on histones H2B, H3, and H4. CBP's homolog p300 was unable to compensate for the loss of CBP. Neurons lacking CBP maintained phosphorylation of the transcription factor CREB, yet failed to activate CREB:CBP-mediated gene expression. Loss of CBP in dorsal CA1 of the hippocampus resulted in selective impairments to long-term potentiation and long-term memory for contextual fear and object recognition. Together, these results suggest a necessary role for specific chromatin modifications, selectively mediated by CBP in the consolidation of memories. PMID:21508930

  8. Histone modifications associated with drought tolerance in the desert plant Zygophyllum dumosum Boiss.

    PubMed

    Granot, Gila; Sikron-Persi, Noga; Gaspan, Ofer; Florentin, Assa; Talwara, Susheela; Paul, Laju K; Morgenstern, Yaakov; Granot, Yigal; Grafi, Gideon

    2009-12-01

    Zygophyllum dumosum Boiss. is a perennial Saharo-Arabian phytogeographical element and a dominant shrub on the rocky limestone southeast-facing slopes of the Negev desert. The plant is highly active during the winter, and semideciduous during the dry summer, i.e., it sheds its leaflets, while leaving the thick, fleshy petiole green and rather active during the dry season. Being resistant to extreme perennial drought, Z. dumosum appears to provide an intriguing model plant for studying epigenetic mechanisms associated with drought tolerance in natural habitats. The transition from the wet to the dry season was accompanied by a significant decrease in nuclear size and with posttranslational modifications of histone H3 N-terminal tail. Dimethylation of H3 at lysine 4 (H3K4)--a modification associated with active gene expression--was found to be high during the wet season but gradually diminished on progression to the dry season. Unexpectedly, H3K9 di- and trimethylation as well as H3K27 di- and trimethylation could not be detected in Z. dumosum; H3K9 monomethylation appears to be prominent in Z. dumosum during the wet but not during the dry season. Contrary to Z. dumosum, H3K9 dimethylation was detected in other desert plants, including Artemisia sieberi, Anabasis articulata and Haloxylon scoparium. Taken together, our results demonstrate dynamic genome organization and unique pattern of histone H3 methylation displayed by Z. dumosum, which could have an adaptive value in variable environments of the Negev desert.

  9. Histone modifications associated with drought tolerance in the desert plant Zygophyllum dumosum Boiss.

    PubMed

    Granot, Gila; Sikron-Persi, Noga; Gaspan, Ofer; Florentin, Assa; Talwara, Susheela; Paul, Laju K; Morgenstern, Yaakov; Granot, Yigal; Grafi, Gideon

    2009-12-01

    Zygophyllum dumosum Boiss. is a perennial Saharo-Arabian phytogeographical element and a dominant shrub on the rocky limestone southeast-facing slopes of the Negev desert. The plant is highly active during the winter, and semideciduous during the dry summer, i.e., it sheds its leaflets, while leaving the thick, fleshy petiole green and rather active during the dry season. Being resistant to extreme perennial drought, Z. dumosum appears to provide an intriguing model plant for studying epigenetic mechanisms associated with drought tolerance in natural habitats. The transition from the wet to the dry season was accompanied by a significant decrease in nuclear size and with posttranslational modifications of histone H3 N-terminal tail. Dimethylation of H3 at lysine 4 (H3K4)--a modification associated with active gene expression--was found to be high during the wet season but gradually diminished on progression to the dry season. Unexpectedly, H3K9 di- and trimethylation as well as H3K27 di- and trimethylation could not be detected in Z. dumosum; H3K9 monomethylation appears to be prominent in Z. dumosum during the wet but not during the dry season. Contrary to Z. dumosum, H3K9 dimethylation was detected in other desert plants, including Artemisia sieberi, Anabasis articulata and Haloxylon scoparium. Taken together, our results demonstrate dynamic genome organization and unique pattern of histone H3 methylation displayed by Z. dumosum, which could have an adaptive value in variable environments of the Negev desert. PMID:19809832

  10. N-formylation of lysine in histone proteins as a secondary modification arising from oxidative DNA damage

    PubMed Central

    Jiang, Tao; Zhou, Xinfeng; Taghizadeh, Koli; Dong, Min; Dedon, Peter C.

    2007-01-01

    The posttranslational modification of histone and other chromatin proteins has a well recognized but poorly defined role in the physiology of gene expression. With implications for interfering with these epigenetic mechanisms, we now report the existence of a relatively abundant secondary modification of chromatin proteins, the N6-formylation of lysine that appears to be uniquely associated with histone and other nuclear proteins. Using both radiolabeling and sensitive bioanalytical methods, we demonstrate that the formyl moiety of 3′-formylphosphate residues arising from 5′-oxidation of deoxyribose in DNA, caused by the enediyne neocarzinostatin, for example, acylate the N6-amino groups of lysine side chains. A liquid chromatography (LC)–tandem mass spectrometry (MS) method was developed to quantify the resulting N6-formyl-lysine residues, which were observed to be present in unperturbed cells and all sources of histone proteins to the extent of 0.04–0.1% of all lysines in acid-soluble chromatin proteins including histones. Cells treated with neocarzinostatin showed a clear dose–response relationship for the formation of N6-formyl-lysine, with this nucleosome linker-selective DNA-cleaving agent causing selective N6-formylation of the linker histone H1. The N6-formyl-lysine residue appears to represent an endogenous histone secondary modification, one that bears chemical similarity to lysine N6-acetylation recognized as an important determinant of gene expression in mammalian cells. The N6-formyl modification of lysine may interfere with the signaling functions of lysine acetylation and methylation and thus contribute to the pathophysiology of oxidative and nitrosative stress. PMID:17190813

  11. The top-down, middle-down, and bottom-up mass spectrometry approaches for characterization of histone variants and their post-translational modifications.

    PubMed

    Moradian, Annie; Kalli, Anastasia; Sweredoski, Michael J; Hess, Sonja

    2014-03-01

    Epigenetic regulation of gene expression is, at least in part, mediated by histone modifications. PTMs of histones change chromatin structure and regulate gene transcription, DNA damage repair, and DNA replication. Thus, studying histone variants and their modifications not only elucidates their functional mechanisms in chromatin regulation, but also provides insights into phenotypes and diseases. A challenge in this field is to determine the best approach(es) to identify histone variants and their PTMs using a robust high-throughput analysis. The large number of histone variants and the enormous diversity that can be generated through combinatorial modifications, also known as histone code, makes identification of histone PTMs a laborious task. MS has been proven to be a powerful tool in this regard. Here, we focus on bottom-up, middle-down, and top-down MS approaches, including CID and electron-capture dissociation/electron-transfer dissociation based techniques for characterization of histones and their PTMs. In addition, we discuss advances in chromatographic separation that take advantage of the chemical properties of the specific histone modifications. This review is also unique in its discussion of current bioinformatic strategies for comprehensive histone code analysis.

  12. Histone phosphorylation

    PubMed Central

    Rossetto, Dorine; Avvakumov, Nikita; Côté, Jacques

    2012-01-01

    Histone posttranslational modifications are key components of diverse processes that modulate chromatin structure. These marks function as signals during various chromatin-based events, and act as platforms for recruitment, assembly or retention of chromatin-associated factors. The best-known function of histone phosphorylation takes place during cellular response to DNA damage, when phosphorylated histone H2A(X) demarcates large chromatin domains around the site of DNA breakage. However, multiple studies have also shown that histone phosphorylation plays crucial roles in chromatin remodeling linked to other nuclear processes. In this review, we summarize the current knowledge of histone phosphorylation and describe the many kinases and phosphatases that regulate it. We discuss the key roles played by this histone mark in DNA repair, transcription and chromatin compaction during cell division and apoptosis. Additionally, we describe the intricate crosstalk that occurs between phosphorylation and other histone modifications and allows for sophisticated control over the chromatin remodeling processes. PMID:22948226

  13. Human borna disease virus infection impacts host proteome and histone lysine acetylation in human oligodendroglia cells

    SciTech Connect

    Liu, Xia; Zhao, Libo; Yang, Yongtao; Bode, Liv; Huang, Hua; Liu, Chengyu; Huang, Rongzhong; Zhang, Liang; and others

    2014-09-15

    Background: Borna disease virus (BDV) replicates in the nucleus and establishes persistent infections in mammalian hosts. A human BDV strain was used to address the first time, how BDV infection impacts the proteome and histone lysine acetylation (Kac) of human oligodendroglial (OL) cells, thus allowing a better understanding of infection-driven pathophysiology in vitro. Methods: Proteome and histone lysine acetylation were profiled through stable isotope labeling for cell culture (SILAC)-based quantitative proteomics. The quantifiable proteome was annotated using bioinformatics. Histone acetylation changes were validated by biochemistry assays. Results: Post BDV infection, 4383 quantifiable differential proteins were identified and functionally annotated to metabolism pathways, immune response, DNA replication, DNA repair, and transcriptional regulation. Sixteen of the thirty identified Kac sites in core histones presented altered acetylation levels post infection. Conclusions: BDV infection using a human strain impacted the whole proteome and histone lysine acetylation in OL cells. - Highlights: • A human strain of BDV (BDV Hu-H1) was used to infect human oligodendroglial cells (OL cells). • This study is the first to reveal the host proteomic and histone Kac profiles in BDV-infected OL cells. • BDV infection affected the expression of many transcription factors and several HATs and HDACs.

  14. Structural and biochemical analyses of monoubiquitinated human histones H2B and H4

    PubMed Central

    Machida, Shinichi; Sekine, Satoshi; Nishiyama, Yuuki; Horikoshi, Naoki; Kurumizaka, Hitoshi

    2016-01-01

    Monoubiquitination is a major histone post-translational modification. In humans, the histone H2B K120 and histone H4 K31 residues are monoubiquitinated and may form transcriptionally active chromatin. In this study, we reconstituted nucleosomes containing H2B monoubiquitinated at position 120 (H2Bub120) and/or H4 monoubiquitinated at position 31 (H4ub31). We found that the H2Bub120 and H4ub31 monoubiquitinations differently affect nucleosome stability: the H2Bub120 monoubiquitination enhances the H2A–H2B association with the nucleosome, while the H4ub31 monoubiquitination decreases the H3–H4 stability in the nucleosome, when compared with the unmodified nucleosome. The H2Bub120 and H4ub31 monoubiquitinations both antagonize the Mg2+-dependent compaction of a poly-nucleosome, suggesting that these monoubiquitinations maintain more relaxed conformations of chromatin. In the crystal structure, the H2Bub120 and H4ub31 monoubiquitinations do not change the structure of the nucleosome core particle and the ubiquitin molecules were flexibly disordered in the H2Bub120/H4ub31 nucleosome structure. These results revealed the differences and similarities of the H2Bub120 and H4ub31 monoubiquitinations at the mono- and poly-nucleosome levels and provide novel information to clarify the roles of monoubiquitination in chromatin. PMID:27335322

  15. Histone Modification of Nedd4 Ubiquitin Ligase Controls the Loss of AMPA Receptors and Cognitive Impairment Induced by Repeated Stress

    PubMed Central

    Wei, Jing; Xiong, Zhe; Lee, Janine B.; Cheng, Jia; Duffney, Lara J.; Matas, Emmanuel

    2016-01-01

    Stress and the major stress hormone corticosterone induce profound influences in the brain. Altered histone modification and transcriptional dysfunction have been implicated in stress-related mental disorders. We previously found that repeated stress caused an impairment of prefrontal cortex (PFC)-mediated cognitive functions by increasing the ubiquitination and degradation of AMPA-type glutamate receptors via a mechanism depending on the E3 ubiquitin ligase Nedd4. Here, we demonstrated that in PFC of repeatedly stressed rats, active glucocorticoid receptor had the increased binding to the glucocorticoid response element of histone deacetylase 2 (HDAC2) promoter, resulting in the upregulation of HDAC2. Inhibition or knock-down of HDAC2 blocked the stress-induced impairment of synaptic transmission, AMPAR expression, and recognition memory. Furthermore, we found that, in stressed animals, the HDAC2-dependent downregulation of histone methyltransferase Ehmt2 (G9a) led to the loss of repressive histone methylation at the Nedd4-1 promoter and the transcriptional activation of Nedd4. These results have provided an epigenetic mechanism and a potential treatment strategy for the detrimental effects of chronic stress. SIGNIFICANCE STATEMENT Prolonged stress exposure can induce altered histone modification and transcriptional dysfunction, which may underlie the profound influence of stress in regulating brain functions. We report an important finding about the epigenetic mechanism controlling the detrimental effects of repeated stress on synaptic transmission and cognitive function. First, it has revealed the stress-induced alteration of key epigenetic regulators HDAC2 and Ehmt2, which determines the synaptic and behavioral effects of repeated stress. Second, it has uncovered the stress-induced histone modification of the target gene Nedd4, an E3 ligase that is critically involved in the ubiquitination and degradation of AMPA receptors and cognition. Third, it has provided

  16. Profiling post-translational modifications of histones in neural differentiation of embryonic stem cells using liquid chromatography-mass spectrometry.

    PubMed

    Zheng, Shuzhen; Sun, Ming; Zhang, Kai; Gu, Junjie; Guo, Zhenchang; Tian, Shanshan; Zhai, Guijin; He, Xiwen; Jin, Ying; Zhang, Yukui

    2016-04-01

    The neural differentiation of embryonic stem cells (ESCs) is of great significance for understanding of the mechanism of diseases. Histone post-translational modifications (HPTMs) play a key role in the regulation of ESCs differentiation. Here, we combined the stable isotope chemical derivatization with nano-HPLC-mass spectrometry (MS) for comprehensive analysis and quantification of histone post-translational modifications (HPTMs) in mouse embryonic stem cells (mESCs) and neural progenitor cells (mNPCs) that was derived from ESCs. We identified 85 core HPTM sites in ESCs and 78HPTM sites in NPCs including some novel lysine modifications. Our quantitative analysis results further revealed the changes of HPTMs from ESCs to NPCs and suggested effect of combinational HPTMs in the differentiation. This study demonstrates that HPLC-MS-based quantitative proteomics has a considerable advantage on quantification of combinational PTMs and expands our understanding of HPTMs in the differentiation.

  17. Structure and function of human histone H3.Y nucleosome.

    PubMed

    Kujirai, Tomoya; Horikoshi, Naoki; Sato, Koichi; Maehara, Kazumitsu; Machida, Shinichi; Osakabe, Akihisa; Kimura, Hiroshi; Ohkawa, Yasuyuki; Kurumizaka, Hitoshi

    2016-07-27

    Histone H3.Y is a primate-specific, distant H3 variant. It is evolutionarily derived from H3.3, and may function in transcription regulation. However, the mechanism by which H3.Y regulates transcription has not been elucidated. In the present study, we determined the crystal structure of the H3.Y nucleosome, and found that many H3.Y-specific residues are located on the entry/exit sites of the nucleosome. Biochemical analyses revealed that the DNA ends of the H3.Y nucleosome were more flexible than those of the H3.3 nucleosome, although the H3.Y nucleosome was stable in vitro and in vivo Interestingly, the linker histone H1, which compacts nucleosomal DNA, appears to bind to the H3.Y nucleosome less efficiently, as compared to the H3.3 nucleosome. These characteristics of the H3.Y nucleosome are also conserved in the H3.Y/H3.3 heterotypic nucleosome, which may be the predominant form in cells. In human cells, H3.Y preferentially accumulated around transcription start sites (TSSs). Taken together, H3.Y-containing nucleosomes around transcription start sites may form relaxed chromatin that allows transcription factor access, to regulate the transcription status of specific genes.

  18. Coordinated changes of histone modifications and HDAC mobilization regulate the induction of MHC class II genes by Trichostatin A

    PubMed Central

    2006-01-01

    The deacetylase inhibitor Trichostatin A (TSA) induces the transcription of the Major Histocompatibility Class II (MHC II) DRA gene in a way independent of the master coactivator CIITA. To analyze the molecular mechanisms by which this epigenetic regulator stimulates MHC II expression, we used chromatin immunoprecipitation (ChIP) assays to monitor the alterations in histone modifications that correlate with DRA transcription after TSA treatment. We found that a dramatic increase in promoter linked histone acetylation is followed by an increase in Histone H3 lysine 4 methylation and a decrease of lysine 9 methylation. Fluorescence recovery after photobleaching (FRAP) experiments showed that TSA increases the mobility of HDAC while decreasing the mobility of the class II enhanceosome factor RFX5. These data, in combination with ChIP experiments, indicate that the TSA-mediated induction of DRA transcription involves HDAC relocation and enhanceosome stabilization. In order to gain a genome-wide view of the genes responding to inhibition of deacetylases, we compared the transcriptome of B cells before and after TSA treatment using Affymetrix microarrays. This analysis showed that in addition to the DRA gene, the entire MHC II family and the adjacent histone cluster that are located in chromosome 6p21-22 locus are strongly induced by TSA. A complex pattern of gene reprogramming by TSA involves immune recognition, antiviral, apoptotic and inflammatory pathways and extends the rationale for using Histone Deacetylase Inhibitors (HDACi) to modulate the immune response. PMID:16452299

  19. Human Rights and Behavior Modification

    ERIC Educational Resources Information Center

    Roos, Philip

    1974-01-01

    Criticisms of behavior modification, which charge that it violates ethical and legal principles, are discussed and reasons are presented to explain behavior modification's susceptibility to attack. (GW)

  20. Functional interaction of Rpb1 and Spt5 C-terminal domains in co-transcriptional histone modification

    PubMed Central

    Mbogning, Jean; Pagé, Viviane; Burston, Jillian; Schwenger, Emily; Fisher, Robert P.; Schwer, Beate; Shuman, Stewart; Tanny, Jason C.

    2015-01-01

    Transcription by RNA polymerase II (RNAPII) is accompanied by a conserved pattern of histone modifications that plays important roles in regulating gene expression. The establishment of this pattern requires phosphorylation of both Rpb1 (the largest RNAPII subunit) and the elongation factor Spt5 on their respective C-terminal domains (CTDs). Here we interrogated the roles of individual Rpb1 and Spt5 CTD phospho-sites in directing co-transcriptional histone modifications in the fission yeast Schizosaccharomyces pombe. Steady-state levels of methylation at histone H3 lysines 4 (H3K4me) and 36 (H3K36me) were sensitive to multiple mutations of the Rpb1 CTD repeat motif (Y1S2P3T4S5P6S7). Ablation of the Spt5 CTD phospho-site Thr1 reduced H3K4me levels but had minimal effects on H3K36me. Nonetheless, Spt5 CTD mutations potentiated the effects of Rpb1 CTD mutations on H3K36me, suggesting overlapping functions. Phosphorylation of Rpb1 Ser2 by the Cdk12 orthologue Lsk1 positively regulated H3K36me but negatively regulated H3K4me. H3K36me and histone H2B monoubiquitylation required Rpb1 Ser5 but were maintained upon inactivation of Mcs6/Cdk7, the major kinase for Rpb1 Ser5 in vivo, implicating another Ser5 kinase in these regulatory pathways. Our results elaborate the CTD ‘code’ for co-transcriptional histone modifications. PMID:26275777

  1. The relationship between apoptosis, chromatin configuration, histone modification and competence of oocytes: A study using the mouse ovary-holding stress model

    PubMed Central

    Lin, Juan; Chen, Fei; Sun, Ming-Ju; Zhu, Jiang; Li, You-Wei; Pan, Liu-Zhu; Zhang, Jie; Tan, Jing-He

    2016-01-01

    The epigenetic factors causing competence differences between SN (surrounded nucleolus) and NSN (non-surrounded nucleolus) oocytes, the significance for the increased histone acetylation and methylation in SN oocytes, and whether chromatin configuration or histone modification determines oocyte competence, are unclear. This study has addressed these issues by using the ovary-holding (OH) stress models where oocyte SN configuration was uncoupled from histone modifications and developmental potential. Prepubertal mouse ovaries containing high percentages of NSN oocytes were preserved at 37 or 39 °C for 1 or 2 h before examination for oocyte chromatin configuration, developmental competence, histone modification and apoptosis. Whereas 1-h OH at 37 °C caused a moderate apoptosis with increased oocyte competence, improved histone modification and a normal NSN-to-SN transition, harsher OH conditions induced a severe apoptosis with decreased oocyte competence, impaired histone modification and a pseudo (premature) NSN-to-SN transition. Observations on Fas/FasL expression and using the gld (generalized lymphoproliferative disorder) mice harboring FasL mutations indicated that OH triggered oocyte apoptosis with activation of the Fas signaling. It was concluded that OH stress caused oocyte apoptosis with activation of the Fas/FasL system and that oocyte competence was more closely correlated with histone modification than with chromatin configuration. PMID:27321442

  2. Histone Modification Is Involved in Okadaic Acid (OA) Induced DNA Damage Response and G2-M Transition Arrest in Maize

    PubMed Central

    Zhang, Hao; Wang, Pu; Hou, Haoli; Wen, Huan; Zhou, Hong; Gao, Fei; Wu, Jinping; Qiu, Zhengming; Li, Lijia

    2016-01-01

    Histone modifications are involved in regulation of chromatin structure. To investigate the relationship between chromatin modification and cell cycle regulation during plant cell proliferation, Okadaic acid (OA), a specific inhibitor of serine/threonine protein phosphatase, was applied in this study. The results showed that OA caused the cell cycle arrest at preprophase, leading to seedling growth inhibition. Western blotting assay revealed that the spatial distribution of phosphorylation of Ser10 histone H3 tails (H3S10ph) signals was altered under OA treatment. Reactive oxygen species (ROS) was found to be at higher levels and TdT-mediated dUTP nick end labeling (TUNEL) assay displayed DNA breaks happened at the chromatin after treatment with OA, companied with an increase in the acetylation of histone H4 at lysine 5 (H4K5ac) level. From these observations, we speculated that the alteration of the spatial distribution of H3S10ph and the level of H4K5ac was involved in the procedure that OA induced DNA breaks and G2-M arrested by the accumulation of ROS, and that the histone H3S10ph and H4K5ac might facilitate DNA repair by their association with the chromatin decondensation. PMID:27196101

  3. Effects of Wutou Decoction on DNA Methylation and Histone Modifications in Rats with Collagen-Induced Arthritis.

    PubMed

    Liu, Ya-Fei; Wen, Cai-Yu-Zhu; Chen, Zhe; Wang, Yu; Huang, Ying; Hu, Yong-Hong; Tu, Sheng-Hao

    2016-01-01

    Background. Wutou decoction (WTD) has been wildly applied in the treatment of rheumatoid arthritis and experimental arthritis in rats for many years. Epigenetic deregulation is associated with the aetiology of rheumatoid arthritis; however, the effects of WTD on epigenetic changes are unclear. This study is set to explore the effects of WTD on DNA methylation and histone modifications in rats with collagen-induced arthritis (CIA). Methods. The CIA model was established by the stimulation of collagen and adjuvant. The knee synovium was stained with hematoxylin and eosin. The DNA methyltransferase 1 (DNMT1) and methylated CpG binding domain 2 (MBD2) expression of peripheral blood mononuclear cells (PBMCs) were determined by Real-Time PCR. The global DNA histone H3-K4/H3-K27 methylation and total histones H3 and H4 acetylation of PBMCs were detected. Results. Our data demonstrated that the DNMT1 mRNA expression was significantly lowered in group WTD compared to that in group CIA (P < 0.05). The DNA methylation level was significantly reduced in group WTD compared to that in group CIA (P < 0.05). Moreover, H3 acetylation of PBMCs was overexpressed in WTD compared with CIA (P < 0.05). Conclusions. WTD may modulate DNA methylation and histone modifications, functioning as anti-inflammatory potential. PMID:27042192

  4. SET1 and p300 act synergistically, through coupled histone modifications, in transcriptional activation by p53.

    PubMed

    Tang, Zhanyun; Chen, Wei-Yi; Shimada, Miho; Nguyen, Uyen T T; Kim, Jaehoon; Sun, Xiao-Jian; Sengoku, Toru; McGinty, Robert K; Fernandez, Joseph P; Muir, Tom W; Roeder, Robert G

    2013-07-18

    The H3K4me3 mark in chromatin is closely correlated with actively transcribed genes, although the mechanisms involved in its generation and function are not fully understood. In vitro studies with recombinant chromatin and purified human factors demonstrate a robust SET1 complex (SET1C)-mediated H3K4 trimethylation that is dependent upon p53- and p300-mediated H3 acetylation, a corresponding SET1C-mediated enhancement of p53- and p300-dependent transcription that reflects a primary effect of SET1C through H3K4 trimethylation, and direct SET1C-p53 and SET1C-p300 interactions indicative of a targeted recruitment mechanism. Complementary cell-based assays demonstrate a DNA-damage-induced p53-SET1C interaction, a corresponding enrichment of SET1C and H3K4me3 on a p53 target gene (p21/WAF1), and a corresponding codependency of H3K4 trimethylation and transcription upon p300 and SET1C. These results establish a mechanism in which SET1C and p300 act cooperatively, through direct interactions and coupled histone modifications, to facilitate the function of p53. PMID:23870121

  5. In silico modification of suberoylanilide hydroxamic acid (SAHA) as potential inhibitor for class II histone deacetylase (HDAC)

    PubMed Central

    2011-01-01

    Background The cervical cancer is the second most prevalent cancer for the woman in the world. It is caused by the oncogenic human papilloma virus (HPV). The inhibition activity of histone deacetylase (HDAC) is a potential strategy for cancer therapy. Suberoylanilide hydroxamic acid (SAHA) is widely known as a low toxicity HDAC inhibitor. This research presents in silico SAHA modification by utilizing triazole, in order to obtain a better inhibitor. We conducted docking of the SAHA inhibitor and 12 modified versions to six class II HDAC enzymes, and then proceeded with drug scanning of each one of them. Results The docking results show that the 12 modified inhibitors have much better binding affinity and inhibition potential than SAHA. Based on drug scan analysis, six of the modified inhibitors have robust pharmacological attributes, as revealed by drug likeness, drug score, oral bioavailability, and toxicity levels. Conclusions The binding affinity, free energy and drug scan screening of the best inhibitors have shown that 1c and 2c modified inhibitors are the best ones to inhibit class II HDAC. PMID:22373132

  6. Genome-wide identification of sweet orange (Citrus sinensis) histone modification gene families and their expression analysis during the fruit development and fruit-blue mold infection process.

    PubMed

    Xu, Jidi; Xu, Haidan; Liu, Yuanlong; Wang, Xia; Xu, Qiang; Deng, Xiuxin

    2015-01-01

    In eukaryotes, histone acetylation and methylation have been known to be involved in regulating diverse developmental processes and plant defense. These histone modification events are controlled by a series of histone modification gene families. To date, there is no study regarding genome-wide characterization of histone modification related genes in citrus species. Based on the two recent sequenced sweet orange genome databases, a total of 136 CsHMs (Citrus sinensis histone modification genes), including 47 CsHMTs (histone methyltransferase genes), 23 CsHDMs (histone demethylase genes), 50 CsHATs (histone acetyltransferase genes), and 16 CsHDACs (histone deacetylase genes) were identified. These genes were categorized to 11 gene families. A comprehensive analysis of these 11 gene families was performed with chromosome locations, phylogenetic comparison, gene structures, and conserved domain compositions of proteins. In order to gain an insight into the potential roles of these genes in citrus fruit development, 42 CsHMs with high mRNA abundance in fruit tissues were selected to further analyze their expression profiles at six stages of fruit development. Interestingly, a numbers of genes were expressed highly in flesh of ripening fruit and some of them showed the increasing expression levels along with the fruit development. Furthermore, we analyzed the expression patterns of all 136 CsHMs response to the infection of blue mold (Penicillium digitatum), which is the most devastating pathogen in citrus post-harvest process. The results indicated that 20 of them showed the strong alterations of their expression levels during the fruit-pathogen infection. In conclusion, this study presents a comprehensive analysis of the histone modification gene families in sweet orange and further elucidates their behaviors during the fruit development and the blue mold infection responses.

  7. Genome-wide identification of sweet orange (Citrus sinensis) histone modification gene families and their expression analysis during the fruit development and fruit-blue mold infection process.

    PubMed

    Xu, Jidi; Xu, Haidan; Liu, Yuanlong; Wang, Xia; Xu, Qiang; Deng, Xiuxin

    2015-01-01

    In eukaryotes, histone acetylation and methylation have been known to be involved in regulating diverse developmental processes and plant defense. These histone modification events are controlled by a series of histone modification gene families. To date, there is no study regarding genome-wide characterization of histone modification related genes in citrus species. Based on the two recent sequenced sweet orange genome databases, a total of 136 CsHMs (Citrus sinensis histone modification genes), including 47 CsHMTs (histone methyltransferase genes), 23 CsHDMs (histone demethylase genes), 50 CsHATs (histone acetyltransferase genes), and 16 CsHDACs (histone deacetylase genes) were identified. These genes were categorized to 11 gene families. A comprehensive analysis of these 11 gene families was performed with chromosome locations, phylogenetic comparison, gene structures, and conserved domain compositions of proteins. In order to gain an insight into the potential roles of these genes in citrus fruit development, 42 CsHMs with high mRNA abundance in fruit tissues were selected to further analyze their expression profiles at six stages of fruit development. Interestingly, a numbers of genes were expressed highly in flesh of ripening fruit and some of them showed the increasing expression levels along with the fruit development. Furthermore, we analyzed the expression patterns of all 136 CsHMs response to the infection of blue mold (Penicillium digitatum), which is the most devastating pathogen in citrus post-harvest process. The results indicated that 20 of them showed the strong alterations of their expression levels during the fruit-pathogen infection. In conclusion, this study presents a comprehensive analysis of the histone modification gene families in sweet orange and further elucidates their behaviors during the fruit development and the blue mold infection responses. PMID:26300904

  8. Role of several histone lysine methyltransferases in tumor development

    PubMed Central

    LI, JIFU; ZHU, SHUNQIN; KE, XIAO-XUE; CUI, HONGJUAN

    2016-01-01

    The field of cancer epigenetics has been evolving rapidly in recent decades. Epigenetic mechanisms include DNA methylation, histone modifications and microRNAs. Histone modifications are important markers of function and chromatin state. Aberrant histone methylation frequently occurs in tumor development and progression. Multiple studies have identified that histone lysine methyltransferases regulate gene transcription through the methylation of histone, which affects cell proliferation and differentiation, cell migration and invasion, and other biological characteristics. Histones have variant lysine sites for different levels of methylation, catalyzed by different lysine methyltransferases, which have numerous effects on human cancers. The present review focused on the most recent advances, described the key function sites of histone lysine methyltransferases, integrated significant quantities of data to introduce several compelling histone lysine methyltransferases in various types of human cancers, summarized their role in tumor development and discussed their potential mechanisms of action. PMID:26998265

  9. Pathway analysis of whole exome sequence data provides further support for the involvement of histone modification in the aetiology of schizophrenia.

    PubMed

    Curtis, David

    2016-10-01

    Weighted burden pathway analysis was applied to whole exome sequence data for 2045 schizophrenic patients and 2045 controls. Overall, there was a statistically significant excess of pathways with more rare, functional variants in cases than in controls. Among the highest ranked were pathways relating to histone modification, as well as neuron differentiation and membrane and vesicle function. This bolsters the evidence from previous studies that histone modification pathways may be important in the aetiology of schizophrenia.

  10. Pathway analysis of whole exome sequence data provides further support for the involvement of histone modification in the aetiology of schizophrenia.

    PubMed

    Curtis, David

    2016-10-01

    Weighted burden pathway analysis was applied to whole exome sequence data for 2045 schizophrenic patients and 2045 controls. Overall, there was a statistically significant excess of pathways with more rare, functional variants in cases than in controls. Among the highest ranked were pathways relating to histone modification, as well as neuron differentiation and membrane and vesicle function. This bolsters the evidence from previous studies that histone modification pathways may be important in the aetiology of schizophrenia. PMID:26981879

  11. Use of human embryonic stem cells to model pediatric gliomas with H3.3K27M histone mutation.

    PubMed

    Funato, Kosuke; Major, Tamara; Lewis, Peter W; Allis, C David; Tabar, Viviane

    2014-12-19

    Over 70% of diffuse intrinsic pediatric gliomas, an aggressive brainstem tumor, harbor heterozygous mutations that create a K27M amino acid substitution (methionine replaces lysine 27) in the tail of histone H3.3. The role of the H3.3K27M mutation in tumorigenesis is not fully understood. Here, we use a human embryonic stem cell system to model this tumor. We show that H3.3K27M expression synergizes with p53 loss and PDGFRA activation in neural progenitor cells derived from human embryonic stem cells, resulting in neoplastic transformation. Genome-wide analyses indicate a resetting of the transformed precursors to a developmentally more primitive stem cell state, with evidence of major modifications of histone marks at several master regulator genes. Drug screening assays identified a compound targeting the protein menin as an inhibitor of tumor cell growth in vitro and in mice. PMID:25525250

  12. Use of human embryonic stem cells to model pediatric gliomas with H3.3K27M histone mutation

    PubMed Central

    Funato, Kosuke; Major, Tamara; Lewis, Peter W.; Allis, C. David; Tabar, Viviane

    2016-01-01

    Over 70% of diffuse intrinsic pediatric gliomas, an aggressive brainstem tumor, harbor heterozygous mutations that create a K27M amino acid substitution (methionine replaces lysine 27) in the tail of histone H3.3. The role of the H3.3K27M mutation in tumorigenesis not fully understood. Here, we use a human embryonic stem cell system to model this tumor. We show that H3.3K27M expression synergizes with p53 loss and PDGFRA activation in neural progenitor cells derived from human embryonic stem cells, resulting in neoplastic transformation. Genome-wide analyses indicate a resetting of the transformed precursors to a developmentally more primitive stem cell state, with evidence of major modifications of histone marks at several master regulator genes. Drug screening assays identified a compound targeting the protein menin as an inhibitor of tumor cell growth in vitro and in mice. PMID:25525250

  13. BAF250a Protein Regulates Nucleosome Occupancy and Histone Modifications in Priming Embryonic Stem Cell Differentiation.

    PubMed

    Lei, Ienglam; West, Jason; Yan, Zhijiang; Gao, Xiaolin; Fang, Peng; Dennis, Jonathan H; Gnatovskiy, Leonid; Wang, Weidong; Kingston, Robert E; Wang, Zhong

    2015-07-31

    The unique chromatin signature of ES cells is fundamental to the pluripotency and differentiation of ES cells. One key feature is the poised chromatin state of master developmental genes that are transcriptionally repressed in ES cells but ready to be activated in response to differentiation signals. Poised chromatin in ES cells contains both H3 Lys-4 trimethylation (H3K4me3) and H3 Lys-27 trimethylation (H3K27me3) methylation, indicating activating and repressing potential. However, the contribution of non-covalent chromatin structure to the poised state is not well understood. To address whether remodeling of nucleosomes is important to the poised state, we characterized the function of BAF250a, a key regulatory subunit of the ES cell ATP-dependent Brahma-associated factor (BAF) chromatin remodeling complex (esBAF). Acute deletion of BAF250a disrupted the differentiation potential of ES cells by altering the expression timing of key developmental genes and pluripotent genes. Our genome-wide nucleosome and histone modification analyses indicated that the disruption of gene expression timing was largely due to changes of chromatin structures at poised genes, particularly those key developmental genes mediated by BAF250a. Specifically, BAF250a deletion caused a nucleosome occupancy increase at H3K4me3- and/or H3K27me3-associated promoters. Moreover, H3K27me3 levels and the number of bivalent promoter genes were reduced in BAF250a KO ES cells. We revealed that BAF250a ablation led to elevated Brg1 but reduced Suz12 recruitment at nucleosome occupancy-increased regions, indicating an unexpected and complicated role of BAF250a in regulating esBAF and Polycomb repressive complex (PRC) activities. Together, our studies identified that BAF250a mediates esBAF and PRC functions to establish the poised chromatin configuration in ES cells, which is essential for the proper differentiation of ES cells.

  14. Developmentally arrested Austrofundulus limnaeus embryos have changes in post-translational modifications of histone H3.

    PubMed

    Toni, Lee S; Padilla, Pamela A

    2016-02-01

    Although vertebrate embryogenesis is typically a continuous and dynamic process, some embryos have evolved mechanisms to developmentally arrest. The embryos of Austrofundulus limnaeus, a killifish that resides in ephemeral ponds, routinely enter diapause II (DII), a reversible developmental arrest promoted by endogenous cues rather than environmental stress. DII, which starts at 24-26 days post-fertilization and can persist for months, is characterized by a significant decline in heart rate and an arrest of development and differentiation. Thus, A. limnaeus is a unique model to study epigenetic features associated with embryonic arrest. To investigate chromosome structures associated with mitosis or gene expression, we examined the post-translational modifications of histone H3 (phosphorylation of serine 10, mono-, di- and tri-methylation of lysine 4 or 27) in preDII, DII and postDII embryos. As seen by microscopy analysis, DII embryos have a significant decrease in the H3S10P marker for mitotic nuclei and an inner nuclear membrane localization of the H3K27me2 marker associated with silencing of gene expression. ELISA experiments reveal that the levels of methylation at H3K4 and H3K27 are significantly different between preDII, DII and postDII embryos, indicating that there are molecular differences between embryos of different chronological age and stage of development. Furthermore, in DII embryos relative to preDII embryos, there are differences in the level of H3K27me3 and H3K4me3, which may reflect critical chromatin remodeling that occurs prior to arrest of embryogenesis. This work helps lay a foundation for chromatin analysis of vertebrate embryo diapause, an intriguing yet greatly understudied phenomenon. PMID:26685169

  15. A lesson learned from the H3.3K27M mutation found in pediatric glioma: a new approach to the study of the function of histone modifications in vivo?

    PubMed

    Chan, Kui Ming; Han, Jing; Fang, Dong; Gan, Haiyun; Zhang, Zhiguo

    2013-08-15

    Glioblastoma (GBM) is the most aggressive primary brain tumor in human. Recent studies on high-grade pediatric GBM have identified two recurrent mutations (K27M and G34R/V) in genes encoding histone H3 (H3F3A for H3.3 and HIST1H3B for H3.1). The two histone H3 mutations are mutually exclusive and give rise to tumors in different brain compartments. Recently, we and others have shown that the histone H3 K27M mutation specifically altered the di- and tri-methylation of endogenous histone H3 at Lys27. Genome-wide studies using ChIP-seq on H3.3K27M patient samples indicate a global reduction of H3K27me3 on chromatin. Remarkably, we also found a dramatic enrichment of H3K27me3 and EZH2 (the catalytic subunit H3K27 methyltransferase) at hundreds of gene loci in H3.3K27M patient cells. Here, we discuss potential mechanisms whereby H3K27me3 is enriched at chromatin loci in cells expressing the H3.3K27M mutation and report effects of Lys-to-Met mutations of other well-studied lysine residues of histone H3.1/H3.3 and H4 on the corresponding endogenous lysine methylation. We suggest that mutation(s) on histones may be found in a variety of human diseases, and the expression of mutant histones may help to address the function of histone lysine methylation and possibly other modifications in mammalian cells. PMID:23907119

  16. POTAMOS mass spectrometry calculator: computer aided mass spectrometry to the post-translational modifications of proteins. A focus on histones.

    PubMed

    Vlachopanos, A; Soupsana, E; Politou, A S; Papamokos, G V

    2014-12-01

    Mass spectrometry is a widely used technique for protein identification and it has also become the method of choice in order to detect and characterize the post-translational modifications (PTMs) of proteins. Many software tools have been developed to deal with this complication. In this paper we introduce a new, free and user friendly online software tool, named POTAMOS Mass Spectrometry Calculator, which was developed in the open source application framework Ruby on Rails. It can provide calculated mass spectrometry data in a time saving manner, independently of instrumentation. In this web application we have focused on a well known protein family of histones whose PTMs are believed to play a crucial role in gene regulation, as suggested by the so called "histone code" hypothesis. The PTMs implemented in this software are: methylations of arginines and lysines, acetylations of lysines and phosphorylations of serines and threonines. The application is able to calculate the kind, the number and the combinations of the possible PTMs corresponding to a given peptide sequence and a given mass along with the full set of the unique primary structures produced by the possible distributions along the amino acid sequence. It can also calculate the masses and charges of a fragmented histone variant, which carries predefined modifications already implemented. Additional functionality is provided by the calculation of the masses of fragments produced upon protein cleavage by the proteolytic enzymes that are most widely used in proteomics studies. PMID:25450216

  17. POTAMOS mass spectrometry calculator: computer aided mass spectrometry to the post-translational modifications of proteins. A focus on histones.

    PubMed

    Vlachopanos, A; Soupsana, E; Politou, A S; Papamokos, G V

    2014-12-01

    Mass spectrometry is a widely used technique for protein identification and it has also become the method of choice in order to detect and characterize the post-translational modifications (PTMs) of proteins. Many software tools have been developed to deal with this complication. In this paper we introduce a new, free and user friendly online software tool, named POTAMOS Mass Spectrometry Calculator, which was developed in the open source application framework Ruby on Rails. It can provide calculated mass spectrometry data in a time saving manner, independently of instrumentation. In this web application we have focused on a well known protein family of histones whose PTMs are believed to play a crucial role in gene regulation, as suggested by the so called "histone code" hypothesis. The PTMs implemented in this software are: methylations of arginines and lysines, acetylations of lysines and phosphorylations of serines and threonines. The application is able to calculate the kind, the number and the combinations of the possible PTMs corresponding to a given peptide sequence and a given mass along with the full set of the unique primary structures produced by the possible distributions along the amino acid sequence. It can also calculate the masses and charges of a fragmented histone variant, which carries predefined modifications already implemented. Additional functionality is provided by the calculation of the masses of fragments produced upon protein cleavage by the proteolytic enzymes that are most widely used in proteomics studies.

  18. Social Exclusion Changes Histone Modifications H3K4me3 and H3K27ac in Liver Tissue of Wild House Mice

    PubMed Central

    Krause, Linda; Haubold, Bernhard; Börsch-Haubold, Angelika G.

    2015-01-01

    Wild house mice form social hierarchies with aggressive males defending territories, in which females, young mice and submissive adult males share nests. In contrast, socially excluded males are barred from breeding groups, have numerous bite wounds and patches of thinning fur. Since their feeding times are often disrupted, we investigated whether social exclusion leads to changes in epigenetic marks of metabolic genes in liver tissue. We used chromatin immunoprecipitation and quantitative PCR to measure enrichment of two activating histone marks at 15 candidate loci. The epigenetic profiles of healthy males sampled from nest boxes differed significantly from the profiles of ostracized males caught outside of nests and showing bite wounds indicative of social exclusion. Enrichment of histone-3 lysine-4 trimethylation (H3K4me3) changed significantly at genes Cyp4a14, Gapdh, Nr3c1, Pck1, Ppara, and Sqle. Changes at histone-3 lysine-27 acetylation (H3K27ac) marks were detected at genes Fasn, Nr3c1, and Plin5. A principal components analysis separated the socialized from the ostracized mice. This was independent of body weight for the H3K4me3 mark, and partially dependent for H3K27ac. There was no separation, however, between healthy males that had been sampled from two different nests. A hierarchical cluster analysis also separated the two phenotypes, which was independent of body weight for both markers. Our study shows that a period of social exclusion during adult life leads to quantitative changes in histone modification patterns in mouse liver tissue. Similar epigenetic changes might occur during the development of stress-induced metabolic disorders in humans. PMID:26267652

  19. Nicotine Suppressed Fetal Adrenal StAR Expression via YY1 Mediated-Histone Deacetylation Modification Mechanism.

    PubMed

    Liu, Lian; Wang, Jian-Fei; Fan, Jie; Rao, Yi-Song; Liu, Fang; Yan, You-E; Wang, Hui

    2016-01-01

    Steroidogenic acute regulatory (StAR) protein plays a pivotal role in steroidogenesis. Previously, we have demonstrated that prenatal nicotine exposure suppressed fetal adrenal steroidogenesis via steroidogenic factor 1 deacetylation. This study further explored the potential role of the transcriptional repressor Yin Yang 1 (YY1) in nicotine-mediated StAR inhibition. Nicotine was subcutaneously administered (1.0 mg/kg) to pregnant rats twice per day and NCI-H295A cells were treated with nicotine. StAR and YY1 expression were analyzed by real-time PCR, immunohistochemistry, and Western blotting. Histone modifications and the interactions between the YY1 and StAR promoter were assessed using chromatin immunoprecipitation (ChIP). Prenatal nicotine exposure increased YY1 expression and suppressed StAR expression. ChIP assay showed that there was a decreasing trend for histone acetylation at the StAR promoter in fetal adrenal glands, whereas H3 acetyl-K14 at the YY1 promoter presented an increasing trend following nicotine exposure. Furthermore, in nicotine-treated NCI-H295A cells, nicotine enhanced YY1 expression and inhibited StAR expression. ChIP assay showed that histone acetylation decreased at the StAR promoter in NCI-H295A cells and that the interaction between the YY1 and StAR promoter increased. These data indicated that YY1-medicated histone deacetylation modification in StAR promoters might play an important role in the inhibitory effect of nicotine on StAR expression. PMID:27598153

  20. Nicotine Suppressed Fetal Adrenal StAR Expression via YY1 Mediated-Histone Deacetylation Modification Mechanism.

    PubMed

    Liu, Lian; Wang, Jian-Fei; Fan, Jie; Rao, Yi-Song; Liu, Fang; Yan, You-E; Wang, Hui

    2016-09-03

    Steroidogenic acute regulatory (StAR) protein plays a pivotal role in steroidogenesis. Previously, we have demonstrated that prenatal nicotine exposure suppressed fetal adrenal steroidogenesis via steroidogenic factor 1 deacetylation. This study further explored the potential role of the transcriptional repressor Yin Yang 1 (YY1) in nicotine-mediated StAR inhibition. Nicotine was subcutaneously administered (1.0 mg/kg) to pregnant rats twice per day and NCI-H295A cells were treated with nicotine. StAR and YY1 expression were analyzed by real-time PCR, immunohistochemistry, and Western blotting. Histone modifications and the interactions between the YY1 and StAR promoter were assessed using chromatin immunoprecipitation (ChIP). Prenatal nicotine exposure increased YY1 expression and suppressed StAR expression. ChIP assay showed that there was a decreasing trend for histone acetylation at the StAR promoter in fetal adrenal glands, whereas H3 acetyl-K14 at the YY1 promoter presented an increasing trend following nicotine exposure. Furthermore, in nicotine-treated NCI-H295A cells, nicotine enhanced YY1 expression and inhibited StAR expression. ChIP assay showed that histone acetylation decreased at the StAR promoter in NCI-H295A cells and that the interaction between the YY1 and StAR promoter increased. These data indicated that YY1-medicated histone deacetylation modification in StAR promoters might play an important role in the inhibitory effect of nicotine on StAR expression.

  1. Nicotine Suppressed Fetal Adrenal StAR Expression via YY1 Mediated-Histone Deacetylation Modification Mechanism

    PubMed Central

    Liu, Lian; Wang, Jian-Fei; Fan, Jie; Rao, Yi-Song; Liu, Fang; Yan, You-E; Wang, Hui

    2016-01-01

    Steroidogenic acute regulatory (StAR) protein plays a pivotal role in steroidogenesis. Previously, we have demonstrated that prenatal nicotine exposure suppressed fetal adrenal steroidogenesis via steroidogenic factor 1 deacetylation. This study further explored the potential role of the transcriptional repressor Yin Yang 1 (YY1) in nicotine-mediated StAR inhibition. Nicotine was subcutaneously administered (1.0 mg/kg) to pregnant rats twice per day and NCI-H295A cells were treated with nicotine. StAR and YY1 expression were analyzed by real-time PCR, immunohistochemistry, and Western blotting. Histone modifications and the interactions between the YY1 and StAR promoter were assessed using chromatin immunoprecipitation (ChIP). Prenatal nicotine exposure increased YY1 expression and suppressed StAR expression. ChIP assay showed that there was a decreasing trend for histone acetylation at the StAR promoter in fetal adrenal glands, whereas H3 acetyl-K14 at the YY1 promoter presented an increasing trend following nicotine exposure. Furthermore, in nicotine-treated NCI-H295A cells, nicotine enhanced YY1 expression and inhibited StAR expression. ChIP assay showed that histone acetylation decreased at the StAR promoter in NCI-H295A cells and that the interaction between the YY1 and StAR promoter increased. These data indicated that YY1-medicated histone deacetylation modification in StAR promoters might play an important role in the inhibitory effect of nicotine on StAR expression. PMID:27598153

  2. Computer modeling reveals that modifications of the histone tail charges define salt-dependent interaction of the nucleosome core particles.

    PubMed

    Yang, Ye; Lyubartsev, Alexander P; Korolev, Nikolay; Nordenskiöld, Lars

    2009-03-18

    Coarse-grained Langevin molecular dynamics computer simulations were conducted for systems that mimic solutions of nucleosome core particles (NCPs). The NCP was modeled as a negatively charged spherical particle representing the complex of DNA and the globular part of the histones combined with attached strings of connected charged beads modeling the histone tails. The size, charge, and distribution of the tails relative to the core were built to match real NCPs. Three models of NCPs were constructed to represent different extents of covalent modification on the histone tails: (nonmodified) recombinant (rNCP), acetylated (aNCP), and acetylated and phosphorylated (paNCP). The simulation cell contained 10 NCPs in a dielectric continuum with explicit mobile counterions and added salt. The NCP-NCP interaction is decisively dependent on the modification state of the histone tails and on salt conditions. Increasing the monovalent salt concentration (KCl) from salt-free to physiological concentration leads to NCP aggregation in solution for rNCP, whereas NCP associates are observed only occasionally in the system of aNCPs. In the presence of divalent salt (Mg(2+)), rNCPs form dense stable aggregates, whereas aNCPs form aggregates less frequently. Aggregates are formed via histone-tail bridging and accumulation of counterions in the regions of NCP-NCP contacts. The paNCPs do not show NCP-NCP interaction upon addition of KCl or in the presence of Mg(2+). Simulations for systems with a gradual substitution of K(+) for Mg(2+), to mimic the Mg(2+) titration of an NCP solution, were performed. The rNCP system showed stronger aggregation that occurred at lower concentrations of added Mg(2+), compared to the aNCP system. Additional molecular dynamics simulations performed with a single NCP in the simulation cell showed that detachment of the tails from the NCP core was modest under a wide range of salt concentrations. This implies that salt-induced tail dissociation of the

  3. BAF250a Protein Regulates Nucleosome Occupancy and Histone Modifications in Priming Embryonic Stem Cell Differentiation*

    PubMed Central

    Lei, Ienglam; West, Jason; Yan, Zhijiang; Gao, Xiaolin; Fang, Peng; Dennis, Jonathan H.; Gnatovskiy, Leonid; Wang, Weidong; Kingston, Robert E.; Wang, Zhong

    2015-01-01

    The unique chromatin signature of ES cells is fundamental to the pluripotency and differentiation of ES cells. One key feature is the poised chromatin state of master developmental genes that are transcriptionally repressed in ES cells but ready to be activated in response to differentiation signals. Poised chromatin in ES cells contains both H3 Lys-4 trimethylation (H3K4me3) and H3 Lys-27 trimethylation (H3K27me3) methylation, indicating activating and repressing potential. However, the contribution of non-covalent chromatin structure to the poised state is not well understood. To address whether remodeling of nucleosomes is important to the poised state, we characterized the function of BAF250a, a key regulatory subunit of the ES cell ATP-dependent Brahma-associated factor (BAF) chromatin remodeling complex (esBAF). Acute deletion of BAF250a disrupted the differentiation potential of ES cells by altering the expression timing of key developmental genes and pluripotent genes. Our genome-wide nucleosome and histone modification analyses indicated that the disruption of gene expression timing was largely due to changes of chromatin structures at poised genes, particularly those key developmental genes mediated by BAF250a. Specifically, BAF250a deletion caused a nucleosome occupancy increase at H3K4me3- and/or H3K27me3-associated promoters. Moreover, H3K27me3 levels and the number of bivalent promoter genes were reduced in BAF250a KO ES cells. We revealed that BAF250a ablation led to elevated Brg1 but reduced Suz12 recruitment at nucleosome occupancy-increased regions, indicating an unexpected and complicated role of BAF250a in regulating esBAF and Polycomb repressive complex (PRC) activities. Together, our studies identified that BAF250a mediates esBAF and PRC functions to establish the poised chromatin configuration in ES cells, which is essential for the proper differentiation of ES cells. PMID:26070559

  4. Gallic Acid Decreases Inflammatory Cytokine Secretion Through Histone Acetyltransferase/Histone Deacetylase Regulation in High Glucose-Induced Human Monocytes.

    PubMed

    Lee, Wooje; Lee, Sang Yeol; Son, Young-Jin; Yun, Jung-Mi

    2015-07-01

    Hyperglycemia contributes to diabetes and several diabetes-related complications. Gallic acid is a polyhydroxy phenolic compound found in various natural products. In this study, we investigated the effects and mechanism of gallic acid on proinflammatory cytokine secretion in high glucose-induced human monocytes (THP-1 cells). THP-1 cells were cultured under normoglycemic or hyperglycemic conditions, in the absence or presence of gallic acid. Hyperglycemic conditions significantly induced histone acetylation, nuclear factor-κB (NF-κB) activation, and proinflammatory cytokine release from THP-1 cells, whereas gallic acid suppressed NF-κB activity and cytokine release. It also significantly reduced CREB-binding protein/p300 (CBP/p300, a NF-κB coactivator) gene expression, acetylation levels, and CBP/p300 histone acetyltransferase (HAT) activity. In addition, histone deacetylase 2 (HDAC2) expression was significantly induced. These results suggest that gallic acid inhibits hyperglycemic-induced cytokine production in monocytes through epigenetic changes involving NF-κB. Therefore, gallic acid may have potential for the treatment and prevention of diabetes and its complications.

  5. Genome-wide analysis of histone modifications by ChIP-chip to identify silenced genes in gastric cancer.

    PubMed

    Zhu, Xinjiang; Liu, Jian; Xu, Xiaoyang; Zhang, Chundong; Dai, Dongqiu

    2015-05-01

    The present study aimed to identify novel histone modification markers in gastric cancer (GC) by chromatin immunoprecipitation microarray (ChIP-chip) analysis and to determine whether these markers were able to discriminate between normal and GC cells. We also tested for correlations with DNA methylation. We probed a human CpG island microarray with DNA from a GC cell line (MKN45) by chromatin immunoprecipitation (ChIP). ChIP-reverse-transcriptase quantitative polymerase chain reaction PCR (RT-qPCR) was used to validate the microarray results. Additionally, mRNA expression levels and the DNA methylation of potential target genes were evaluated by RT-qPCR and methylation-specific PCR (MSP). The moults showed that 134 genes exhibited the highest signal-to-noise ratio of H3-K9 trimethylation over acetylation and 46 genes exhibited the highest signal-to-noise ratio of H3-K9 trimethylation over H3-K4 trimethylation in MKN45 cells. The ChIP-qPCR results agreed with those obtained from the ChIP-chip analysis. Aberrant DNA methylation status and mRNA expression levels were also identified for selected genes (PSD, SMARCC1 and Vps37A) in the GC cell lines. The results suggest that CpG island microarray coupled with ChIP (ChIP-chip) can identify novel targets of gene silencing in GC. Additionally, ChIP-chip is the best approach for assessing the genome-wide status of epigenetic regulation, which may allow for a broader genomic understanding compared to the knowledge that has been accumulated from single-gene studies. PMID:25738530

  6. Genome-wide analysis of histone modifications by ChIP-chip to identify silenced genes in gastric cancer.

    PubMed

    Zhu, Xinjiang; Liu, Jian; Xu, Xiaoyang; Zhang, Chundong; Dai, Dongqiu

    2015-05-01

    The present study aimed to identify novel histone modification markers in gastric cancer (GC) by chromatin immunoprecipitation microarray (ChIP-chip) analysis and to determine whether these markers were able to discriminate between normal and GC cells. We also tested for correlations with DNA methylation. We probed a human CpG island microarray with DNA from a GC cell line (MKN45) by chromatin immunoprecipitation (ChIP). ChIP-reverse-transcriptase quantitative polymerase chain reaction PCR (RT-qPCR) was used to validate the microarray results. Additionally, mRNA expression levels and the DNA methylation of potential target genes were evaluated by RT-qPCR and methylation-specific PCR (MSP). The moults showed that 134 genes exhibited the highest signal-to-noise ratio of H3-K9 trimethylation over acetylation and 46 genes exhibited the highest signal-to-noise ratio of H3-K9 trimethylation over H3-K4 trimethylation in MKN45 cells. The ChIP-qPCR results agreed with those obtained from the ChIP-chip analysis. Aberrant DNA methylation status and mRNA expression levels were also identified for selected genes (PSD, SMARCC1 and Vps37A) in the GC cell lines. The results suggest that CpG island microarray coupled with ChIP (ChIP-chip) can identify novel targets of gene silencing in GC. Additionally, ChIP-chip is the best approach for assessing the genome-wide status of epigenetic regulation, which may allow for a broader genomic understanding compared to the knowledge that has been accumulated from single-gene studies.

  7. Epigenetic modification of histone 3 at lysine 9 in sheep zygotes and its relationship with DNA methylation

    PubMed Central

    Hou, Jian; Liu, Lei; Zhang, Jing; Cui, Xiu-Hong; Yan, Feng-Xiang; Guan, Hong; Chen, Yong-Fu; An, Xiao-Rong

    2008-01-01

    Background Previous studies indicated that, unlike mouse zygotes, sheep zygotes lacked the paternal DNA demethylation event. Another epigenetic mark, histone modification, especially at lysine 9 of histone 3 (H3K9), has been suggested to be mechanically linked to DNA methylation. In mouse zygotes, the absence of methylated H3K9 from the paternal pronucleus has been thought to attribute to the paternal DNA demethylation. Results By using the immunofluorescence staining approach, we show that, despite the difference in DNA methylation, modification of H3K9 is similar between the sheep and mouse zygotes. In both species, H3K9 is hyperacetylated or hypomethylated in paternal pronucleus relative to maternal pronucleus. In fact, sheep zygotes can also undergo paternal DNA demethylation, although to a less extent than the mouse. Further examinations of individual zygotes by double immunostaining revealed that, the paternal levels of DNA methylation were not closely associated with that of H3K9 acetylation or tri-methylation. Treatment of either 5-azacytidine or Trichostatin A did not induce a significant decrease of paternal DNA methylation levels. Conclusion Our results suggest that in sheep lower DNA demethylation of paternal genomes is not due to the H3K9 modification and the methylated DNA sustaining in paternal pronucleus does not come from DNA de novo methylation. PMID:18507869

  8. Liganded thyroid hormone receptor induces nucleosome removal and histone modifications to activate transcription during larval intestinal cell death and adult stem cell development.

    PubMed

    Matsuura, Kazuo; Fujimoto, Kenta; Fu, Liezhen; Shi, Yun-Bo

    2012-02-01

    Thyroid hormone (T(3)) plays an important role in regulating multiple cellular and metabolic processes, including cell proliferation, cell death, and energy metabolism, in vertebrates. Dysregulation of T(3) signaling results in developmental abnormalities, metabolic defects, and even cancer. We used T(3)-dependent Xenopus metamorphosis as a model to study how T(3) regulates transcription during vertebrate development. T(3) exerts its metamorphic effects through T(3) receptors (TR). TR recruits, in a T(3)-dependent manner, cofactor complexes that can carry out chromatin remodeling/histone modifications. Whether and how histone modifications change upon gene regulation by TR during vertebrate development is largely unknown. Here we analyzed histone modifications at T(3) target genes during intestinal metamorphosis, a process that involves essentially total apoptotic degeneration of the simple larval epithelium and de novo development of the adult epithelial stem cells, followed by their proliferation and differentiation into the complex adult epithelium. We demonstrated for the first time in vivo during vertebrate development that TR induces the removal of core histones at the promoter region and the recruitment of RNA polymerase. Furthermore, a number of histone activation and repression marks have been defined based on correlations with mRNA levels in cell cultures. Most but not all correlate with gene expression induced by liganded TR during development, suggesting that tissue and developmental context influences the roles of histone modifications in gene regulation. Our findings provide important mechanistic insights on how chromatin remodeling affects developmental gene regulation in vivo.

  9. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    SciTech Connect

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; Pennacchio, Len A.; Weiss, Mitchell J.; Blobel, Gerd A.; Hardison, Ross C.

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the results of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.

  10. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    DOE PAGESBeta

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; et al

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the resultsmore » of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.« less

  11. Rapid Histone-Catalyzed DNA Lesion Excision and Accompanying Protein Modification in Nucleosomes and Nucleosome Core Particles.

    PubMed

    Weng, Liwei; Greenberg, Marc M

    2015-09-01

    C5'-Hydrogen atoms are frequently abstracted during DNA oxidation. The oxidized abasic lesion 5'-(2-phosphoryl-1,4-dioxobutane) (DOB) is an electrophilic product of the C5'-radical. DOB is a potent irreversible inhibitor of DNA polymerase β, and forms interstrand cross-links in free DNA. We examined the reactivity of DOB within nucleosomes and nucleosome core particles (NCPs), the monomeric component of chromatin. Depending upon the position at which DOB is generated within a NCP, it is excised from nucleosomal DNA at a rate 275-1500-fold faster than that in free DNA. The half-life of DOB (7.0-16.8 min) in NCPs is shorter than any other abasic lesion. DOB's lifetime in NCPs is also significantly shorter than the estimated lifetime of an abasic site within a cell, suggesting that the observed chemistry would occur intracellularly. Histones also catalyze DOB excision when the lesion is present in the DNA linker region of a nucleosome. Schiff-base formation between DOB and histone proteins is detected in nucleosomes and NCPs, resulting in pyrrolone formation at the lysine residues. The lysines modified by DOB are often post-translationally modified. Consequently, the histone modifications described herein could affect the regulation of gene expression and may provide a chemical basis for the cytotoxicity of the DNA damaging agents that produce this lesion.

  12. The quinoline compound, S4 effectively antagonizes alcohol intake in mice: Possible association with the histone H3 modifications.

    PubMed

    Banerjee, Tuhin Suvro; Hazra, Abhijit; Mondal, Nirup Bikash; Das, Sumantra

    2015-08-01

    Opioidergic system plays an important role in controlling alcohol seeking behavior. We have previously shown that a quinoline compound, S4 (2-(2-methylquinolin-4-ylamino)-N-phenyl acetamide), having dual affinity for µ- and κ-opioid receptors, could successfully inhibit withdrawal symptoms in mice rendered dependent on morphine. Accordingly, in the present study, we sought to determine the potential of S4 in attenuating voluntary alcohol intake in alcohol-preferring (AP) mice and the mechanism thereof. The study was conducted in different mice strains initially screened for AP and alcohol-avoiding (AA) behavior. S4 was injected subcutaneously (20 mg/kg) to evaluate its efficacy in reducing voluntary alcohol consumption along with prevention of body weight loss during withdrawal from alcohol after discontinuation of the drug. The results showed that S4 significantly reduced the alcohol intake in AP mice and also in a dose dependent manner. Mechanistic studies on the post translational histone H3 modifications in brain of AP mice compared to the AA mice were determined. Compared to AA mice, histone H3 trimethylation at lys9 and its regulators, jumonji domain containing 2A and phosphorylated histones H3 at thr11 as well as the expression of 14-3-3 protein and phosphorylated histones H3 at ser28, were altered in the AP animals, most of which were restored post S4 treatment in the AP mice. Together, the present results suggest that S4 effectively blocked alcohol drinking behavior by restoring the altered epigenetic signature in the AP mice. The study provides a novel compound which could lead to developing effective drugs against alcoholism/alcohol abuse.

  13. Macro histone variants are critical for the differentiation of human pluripotent cells.

    PubMed

    Barrero, María J; Sese, Borja; Martí, Mercè; Izpisua Belmonte, Juan Carlos

    2013-05-31

    We have previously shown that macro histone variants (macroH2A) are expressed at low levels in stem cells and are up-regulated during differentiation. Here we show that the knockdown of macro histone variants impaired the in vitro and in vivo differentiation of human pluripotent cells, likely through defects in the silencing of pluripotency-related genes. ChIP experiments showed that during differentiation macro histone variants are recruited to the regulatory regions of pluripotency and developmental genes marked with H3K27me3 contributing to the silencing of these genes.

  14. Arabidopsis MRG domain proteins bridge two histone modifications to elevate expression of flowering genes.

    PubMed

    Xu, Yifeng; Gan, Eng-Seng; Zhou, Jie; Wee, Wan-Yi; Zhang, Xiaoyu; Ito, Toshiro

    2014-01-01

    Trimethylation of lysine 36 of histone H3 (H3K36me3) is found to be associated with various transcription events. In Arabidopsis, the H3K36me3 level peaks in the first half of coding regions, which is in contrast to the 3'-end enrichment in animals. The MRG15 family proteins function as 'reader' proteins by binding to H3K36me3 to control alternative splicing or prevent spurious intragenic transcription in animals. Here, we demonstrate that two closely related Arabidopsis homologues (MRG1 and MRG2) are localised to the euchromatin and redundantly ensure the increased transcriptional levels of two flowering time genes with opposing functions, FLOWERING LOCUS C and FLOWERING LOCUS T (FT). MRG2 directly binds to the FT locus and elevates the expression in an H3K36me3-dependent manner. MRG1/2 binds to H3K36me3 with their chromodomain and interact with the histone H4-specific acetyltransferases (HAM1 and HAM2) to achieve a high expression level through active histone acetylation at the promoter and 5' regions of target loci. Together, this study presents a mechanistic link between H3K36me3 and histone H4 acetylation. Our data also indicate that the biological functions of MRG1/2 have diversified from their animal homologues during evolution, yet they still maintain their conserved H3K36me3-binding molecular function.

  15. Transcriptomic sequencing reveals a set of unique genes activated by butyrate-induced histone modification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Butyrate is a nutritional element with strong epigenetic regulatory activity as an inhibitor of histone deacetylases (HDACs). Based on the analysis of differentially expressed genes induced by butyrate in the bovine epithelial cell using deep RNA-sequencing technology (RNA-seq), a set of unique gen...

  16. Bioinformatic dissecting of TP53 regulation pathway underlying butyrate-induced histone modification in epigenetic regulation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Butyrate affects cell proliferation, differentiation and motility. Butyrate inhibits histone deacetylase (HDAC) activities and induces cell cycle arrest and apoptosis. TP53 is one of the most active upstream regulators discovered by IPA in our RNA sequencing data set. The TP53 signaling pathway pl...

  17. Jun Dimerization Protein 2 Controls Senescence and Differentiation via Regulating Histone Modification

    PubMed Central

    Huang, Yu-Chang; Hasegawa, Hitomi; Wang, Shin-Wei; Ku, Chia-Chen; Lin, Ying-Chu; Chiou, Shyh-Shin; Hou, Ming-Feng; Wu, Deng-Chyang; Tsai, Eing-Mei; Saito, Shigeo; Yamaguchi, Naoto; Yokoyama, Kazunari K.

    2011-01-01

    Transcription factor, Jun dimerization protein 2 (JDP2), binds directly to histones and DNAs and then inhibits the p300-mediated acetylation both of core histones and of reconstituted nucleosomes that contain JDP2 recognition DNA sequences. JDP2 plays a key role as a repressor of adipocyte differentiation by regulation of the expression of the gene C/EBPδ via inhibition of histone acetylation. Moreover, JDP2-deficient mouse embryonic fibroblasts (JDP2−/− MEFs) are resistant to replicative senescence. JDP2 inhibits the recruitment of polycomb repressive complexes (PRC1 and PRC2) to the promoter of the gene encoding p16Ink4a, resulting from the inhibition of methylation of lysine 27 of histone H3 (H3K27). Therefore, it seems that chromatin-remodeling factors, including the PRC complex controlled by JDP2, may be important players in the senescence program. The novel mechanisms that underline the action of JDP2 in inducing cellular senescence and suppressing adipocyte differentiation are reviewed. PMID:21197464

  18. Behavior Modification: The Human Effort.

    ERIC Educational Resources Information Center

    Bradfield, Robert H., Ed.

    To present the ideas and research of outstanding behaviorists which is directly related to the education of children, the authors tried to include a diverse group of educational situations. Two articles give an overview of behavior modification, while five educational applications are discussed. They concern learning problems, language…

  19. DNA Methylation and Histone Modifications Are Associated with Repression of the Inhibin α Promoter in the Rat Corpus Luteum

    PubMed Central

    Meldi, Kristen M.; Gaconnet, Georgia A.

    2012-01-01

    The transition from follicle to corpus luteum after ovulation is associated with profound morphological and functional changes and is accompanied by corresponding changes in gene expression. The gene encoding the α subunit of the dimeric reproductive hormone inhibin is maximally expressed in the granulosa cells of the preovulatory follicle, is rapidly repressed by the ovulatory LH surge, and is expressed at only very low levels in the corpus luteum. Although previous studies have identified transient repressors of inhibin α gene transcription, little is known about how this repression is maintained in the corpus luteum. This study examines the role of epigenetic changes, including DNA methylation and histone modification, in silencing of inhibin α gene expression. Bisulfite sequencing reveals that methylation of the inhibin α proximal promoter is low in preovulatory and ovulatory follicles but is elevated in the corpus luteum. Increased methylation during luteinization is observed within the cAMP response element in the promoter, and EMSA demonstrate that methylation of this site inhibits cAMP response element binding protein binding in vitro. Chromatin immunoprecipitation reveals that repressive histone marks H3K9 and H3K27 trimethylation are increased on the inhibin α promoter in primary luteal cells, whereas the activation mark H3K4 trimethylation is decreased. The changes in histone modification precede the alterations in DNA methylation, suggesting that they facilitate the recruitment of DNA methyltransferases. We show that the DNA methyltransferase DNMT3a is present in the ovary and in luteal cells when the inhibin α promoter becomes methylated and observe recruitment of DNMT3a to the inhibin promoter during luteinization. PMID:22865368

  20. Cell shape regulates global histone acetylation in human mammaryepithelial cells

    SciTech Connect

    Le Beyec, Johanne; Xu, Ren; Lee, Sun-Young; Nelson, Celeste M.; Rizki, Aylin; Alcaraz, Jordi; Bissell, Mina J.

    2007-02-28

    Extracellular matrix (ECM) regulates cell morphology and gene expression in vivo; these relationships are maintained in three-dimensional (3D) cultures of mammary epithelial cells. In the presence of laminin-rich ECM (lrECM), mammary epithelial cells round up and undergo global histone deacetylation, a process critical for their functional differentiation. However, it remains unclear whether lrECM-dependent cell rounding and global histone deacetylation are indeed part of a common physical-biochemical pathway. Using 3D cultures as well as nonadhesive and micropatterned substrata, here we showed that the cell 'rounding' caused by lrECM was sufficient to induce deacetylation of histones H3 and H4 in the absence of biochemical cues. Microarray and confocal analysis demonstrated that this deacetylation in 3D culture is associated with a global increase in chromatin condensation and a reduction in gene expression. Whereas cells cultured on plastic substrata formed prominent stress fibers, cells grown in 3D lrECM or on micropatterns lacked these structures. Disruption of the actin cytoskeleton with cytochalasin D phenocopied the lrECM-induced cell rounding and histone deacetylation. These results reveal a novel link between ECM-controlled cell shape and chromatin structure, and suggest that this link is mediated by changes in the actin cytoskeleton.

  1. Histone deacetylase inhibitor-induced cell death in bladder cancer is associated with chromatin modification and modifying protein expression: A proteomic approach

    PubMed Central

    LI, QINGDI QUENTIN; HAO, JIAN-JIANG; ZHANG, ZHENG; HSU, IAWEN; LIU, YI; TAO, ZHEN; LEWI, KEIDREN; METWALLI, ADAM R.; AGARWAL, PIYUSH K.

    2016-01-01

    The Cancer Genome Atlas (TCGA) project recently identified the importance of mutations in chromatin remodeling genes in human carcinomas. These findings imply that epigenetic modulators might have a therapeutic role in urothelial cancers. To exploit histone deacetylases (HDACs) as targets for cancer therapy, we investigated the HDAC inhibitors (HDACIs) romidepsin, trichostatin A, and vorinostat as potential chemotherapeutic agents for bladder cancer. We demonstrate that the three HDACIs suppressed cell growth and induced cell death in the bladder cancer cell line 5637. To identify potential mechanisms associated with the anti-proliferative and cytotoxic effects of the HDACIs, we used quantitative proteomics to determine the proteins potentially involved in these processes. Our proteome studies identified a total of 6003 unique proteins. Of these, 2472 proteins were upregulated and 2049 proteins were downregulated in response to HDACI exposure compared to the untreated controls (P<0.05). Bioinformatic analysis further revealed that those differentially expressed proteins were involved in multiple biological functions and enzyme-regulated pathways, including cell cycle progression, apoptosis, autophagy, free radical generation and DNA damage repair. HDACIs also altered the acetylation status of histones and non-histone proteins, as well as the levels of chromatin modification proteins, suggesting that HDACIs exert multiple cytotoxic actions in bladder cancer cells by inhibiting HDAC activity or altering the structure of chromatin. We conclude that HDACIs are effective in the inhibition of cell proliferation and the induction of apoptosis in the 5637 bladder cancer cells through multiple cell death-associated pathways. These observations support the notion that HDACIs provide new therapeutic options for bladder cancer treatment and thus warrant further preclinical exploration. PMID:27082124

  2. Maternal Betaine Supplementation throughout Gestation and Lactation Modifies Hepatic Cholesterol Metabolic Genes in Weaning Piglets via AMPK/LXR-Mediated Pathway and Histone Modification

    PubMed Central

    Cai, Demin; Yuan, Mengjie; Liu, Haoyu; Pan, Shifeng; Ma, Wenqiang; Hong, Jian; Zhao, Ruqian

    2016-01-01

    Betaine serves as an animal and human nutrient which has been heavily investigated in glucose and lipid metabolic regulation, yet the underlying mechanisms are still elusive. In this study, feeding sows with betaine-supplemented diets during pregnancy and lactation increased cholesterol content and low-density lipoprotein receptor (LDLR) and scavenger receptor class B type I (SR-BI) gene expression, but decreasing bile acids content and cholesterol-7a-hydroxylase (CYP7a1) expression in the liver of weaning piglets. This was associated with the significantly elevated serum betaine and methionine levels and hepatic S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) content. Concurrently, the hepatic nuclear transcription factor liver X receptor LXR was downregulated along with activated signal protein AMP-activated protein kinase (AMPK). Moreover, a chromatin immunoprecipitation assay showed lower LXR binding on CYP7a1 gene promoter and more enriched activation histone marker H3K4me3 on LDLR and SR-BI promoters. These results suggest that gestational and lactational betaine supplementation modulates hepatic gene expression involved in cholesterol metabolism via an AMPK/LXR pathway and histone modification in the weaning offspring. PMID:27763549

  3. Immunodetection of histone epitopes correlates with early stages of apoptosis in activated human peripheral T lymphocytes.

    PubMed Central

    Zunino, S. J.; Singh, M. K.; Bass, J.; Picker, L. J.

    1996-01-01

    By coupling intracellular staining with terminal deoxynucleotidyl transferase (TdT)-mediated labeling of internucleosomal DNA strand breaks in a flow cytometric assay, we observed a strong correlation between apoptosis-associated DNA strand breaks and immunoreactivity with the monoclonal antibody (MAb) B-F6 in activated human peripheral blood T lymphocytes (PBTs). Although MAb B-F6 has been reported to be specific for the cytokine interleukin-6, Western blot analysis of activated PBT lysates revealed that the predominant protein band detected by this MAb was 17 kd (p17), distinct from the 23-kd core protein and 26- to 30-kd mature glycosylated forms of interleukin-6. Immunoaffinity isolation and amino-terminal amino acid sequence analysis of p17 revealed identity with the histone H2B, a finding confirmed by Western blot analysis of purified histones and by similar staining of activated PBTs with an unrelated anti-histone MAb. Neither histone staining nor DNA strand breakage was observed in freshly isolated PBTs; however, after T cell activation, histone immunoreactivity appeared to precede the appearance of DNA strand breaks, with both increasing to a maximal level by day 3 after activation. Two-parameter confocal immunofluorescence microscopy of histone and DNA staining confirmed a lack of histone immunoreactivity in viable cells and demonstrated co-localization of histone epitopes with abnormally clumped chromatin in apoptotic cells. These data indicate that alteration of histone epitope accessibility is a marker of early apoptosis and suggest that multiparameter flow cytometric analysis of intracellular epitopes may be a powerful tool in the elucidation of intracellular mechanisms of apoptosis. Images Figure 4 Figure 5 Figure 6 Figure 8 PMID:8702003

  4. Hydroxyphenylation of Histone Lysines: Post-translational Modification by Quinone Imines.

    PubMed

    Ravindra, Kodihalli C; Trudel, Laura J; Wishnok, John S; Wogan, Gerald N; Tannenbaum, Steven R; Skipper, Paul L

    2016-05-20

    Monocyclic aromatic amines are widespread environmental contaminants with multiple sources such as combustion products, pharmaceuticals, and pesticides. Their phenolic metabolites are converted intracellularly to electrophilic quinone imines upon autoxidation and can embed in the cellular matrix through a transimination reaction that leaves a redox-active residue as a substituent of lysine side-chain amino groups. To demonstrate the occurrence of this process within the cellular nucleus, Chinese hamster ovary AA8 cells were treated with the para-phenol of 3,5-dimethylamine, after which the histone proteins were isolated, derivatized, and subjected to tryptic digestion. The resulting peptides were analyzed by tandem mass spectrometry to determine which lysines were modified. Nine residues in histones H2A, H2B, and H4 were identified; these were located in histone tails, close to where DNA makes contact with the nuclear core particle, elsewhere on the protein surface, and deep within the core. Kinetics of disappearance of the modified lysines in cultured cells was determined using isotope-dilution mass spectrometry. AA8 cells were also transfected with the genetically encoded hydrogen peroxide biosensor HyPer in constructs that lead to expression of HyPer in different cellular compartments. Challenging the resulting cells with the dimethylaminophenol resulted in sustained fluorescence emission in each of the compartments, demonstrating ongoing production of H2O2. The kinetics of modified lysine loss determined by mass spectrometry was consistent with persistence of HyPer fluorescence emission. We conclude that the para-phenol of 3,5-dimethylamine can become stably integrated into the histone proteins, which are minimally repaired, if at all, and function as a persistent source of intracellular H2O2. PMID:26866676

  5. Hydroxyphenylation of Histone Lysines: Post-translational Modification by Quinone Imines.

    PubMed

    Ravindra, Kodihalli C; Trudel, Laura J; Wishnok, John S; Wogan, Gerald N; Tannenbaum, Steven R; Skipper, Paul L

    2016-05-20

    Monocyclic aromatic amines are widespread environmental contaminants with multiple sources such as combustion products, pharmaceuticals, and pesticides. Their phenolic metabolites are converted intracellularly to electrophilic quinone imines upon autoxidation and can embed in the cellular matrix through a transimination reaction that leaves a redox-active residue as a substituent of lysine side-chain amino groups. To demonstrate the occurrence of this process within the cellular nucleus, Chinese hamster ovary AA8 cells were treated with the para-phenol of 3,5-dimethylamine, after which the histone proteins were isolated, derivatized, and subjected to tryptic digestion. The resulting peptides were analyzed by tandem mass spectrometry to determine which lysines were modified. Nine residues in histones H2A, H2B, and H4 were identified; these were located in histone tails, close to where DNA makes contact with the nuclear core particle, elsewhere on the protein surface, and deep within the core. Kinetics of disappearance of the modified lysines in cultured cells was determined using isotope-dilution mass spectrometry. AA8 cells were also transfected with the genetically encoded hydrogen peroxide biosensor HyPer in constructs that lead to expression of HyPer in different cellular compartments. Challenging the resulting cells with the dimethylaminophenol resulted in sustained fluorescence emission in each of the compartments, demonstrating ongoing production of H2O2. The kinetics of modified lysine loss determined by mass spectrometry was consistent with persistence of HyPer fluorescence emission. We conclude that the para-phenol of 3,5-dimethylamine can become stably integrated into the histone proteins, which are minimally repaired, if at all, and function as a persistent source of intracellular H2O2.

  6. Structural basis of oncogenic histone H3K27M inhibition of human polycomb repressive complex 2

    PubMed Central

    Justin, Neil; Zhang, Ying; Tarricone, Cataldo; Martin, Stephen R.; Chen, Shuyang; Underwood, Elizabeth; De Marco, Valeria; Haire, Lesley F.; Walker, Philip A.; Reinberg, Danny; Wilson, Jon R.; Gamblin, Steven J.

    2016-01-01

    Polycomb repressive complex 2 (PRC2) silences gene expression through trimethylation of K27 of histone H3 (H3K27me3) via its catalytic SET domain. A missense mutation in the substrate of PRC2, histone H3K27M, is associated with certain pediatric brain cancers and is linked to a global decrease of H3K27me3 in the affected cells thought to be mediated by inhibition of PRC2 activity. We present here the crystal structure of human PRC2 in complex with the inhibitory H3K27M peptide bound to the active site of the SET domain, with the methionine residue located in the pocket that normally accommodates the target lysine residue. The structure and binding studies suggest a mechanism for the oncogenic inhibition of H3K27M. The structure also reveals how binding of repressive marks, like H3K27me3, to the EED subunit of the complex leads to enhancement of the catalytic efficiency of the SET domain and thus the propagation of this repressive histone modification. PMID:27121947

  7. Change in gene expression profiles of secreted frizzled-related proteins (SFRPs) by sodium butyrate in gastric cancers: induction of promoter demethylation and histone modification causing inhibition of Wnt signaling.

    PubMed

    Shin, Hyunsoo; Kim, Jie-Hyun; Lee, Yeo Song; Lee, Yong Chan

    2012-05-01

    Activation of Wnt signaling without mutation of β-catenin or APC occurs frequently in human gastric cancers. Secreted frizzled-related protein (SFRP), a negative modulator of the Wnt signaling pathway, are frequently inactivated in human gastric cancers. Inhibition of SFRP gene expression may account for the Wnt/β-catenin activation in human gastric cancer. However, the molecular mechanisms of silencing of SFRP genes are not fully understood. Sodium butyrate, a histone deacetylase (HDAC) inhibitor, is known to exhibit anti-cancer effects partly through the differentiation of various cancer cells. In the present study, we investigated: i) the relationship between the silencing of SFRP genes and Wnt signaling; ii) the mechanism of sodium butyrate mediated epigenetic regulation of SFRPs expression in human gastric cancer. We observed that nuclear β-catenin was significantly increased in gastric cancer tissues as compared to adjacent non-cancerous tissues. Nuclear β-catenin accumulation and SFRP promoter methylation in human gastric cancer cells were noted. Treatment with the DNA methyltransferase inhibitor, 5'-Aza-2-deoxycytidine (5'-Aza-dC) rapidly restored SFRPs expression. Sodium butyrate (NaB) induced demethylation and histone modification at the promoter region of SFRP1/2 restoring the SFRP expression in human gastric cancer cells. Analysis of general expression revealed that overexpression of SFRPs repressed Wnt target gene expression and induced changes in the proliferation and apoptosis related genes in human gastric cancer cells. These data suggest that aberrant epigenetic modification of SFRP genes is one of the major mechanisms by which Wnt signaling is activated in human gastric cancer cells and sodium butyrate may modulate the SFRP1/2 expression through histone modification and promoter demethylation causing anti-tumor effects.

  8. Release and activity of histone in diseases.

    PubMed

    Chen, R; Kang, R; Fan, X-G; Tang, D

    2014-01-01

    Histones and their post-translational modifications have key roles in chromatin remodeling and gene transcription. Besides intranuclear functions, histones act as damage-associated molecular pattern molecules when they are released into the extracellular space. Administration of exogenous histones to animals leads to systemic inflammatory and toxic responses through activating Toll-like receptors and inflammasome pathways. Anti-histone treatment (e.g., neutralizing antibodies, activated protein C, recombinant thrombomodulin, and heparin) protect mice against lethal endotoxemia, sepsis, ischemia/reperfusion injury, trauma, pancreatitis, peritonitis, stroke, coagulation, and thrombosis. In addition, elevated serum histone and nucleosome levels have been implicated in multiple pathophysiological processes and progression of diseases including autoimmune diseases, inflammatory diseases, and cancer. Therefore, extracellular histones could serve as biomarkers and novel therapeutic targets in human diseases. PMID:25118930

  9. Histone H4 lysine 20 acetylation is associated with gene repression in human cells

    PubMed Central

    Kaimori, Jun-Ya; Maehara, Kazumitsu; Hayashi-Takanaka, Yoko; Harada, Akihito; Fukuda, Masafumi; Yamamoto, Satoko; Ichimaru, Naotsugu; Umehara, Takashi; Yokoyama, Shigeyuki; Matsuda, Ryo; Ikura, Tsuyoshi; Nagao, Koji; Obuse, Chikashi; Nozaki, Naohito; Takahara, Shiro; Takao, Toshifumi; Ohkawa, Yasuyuki; Kimura, Hiroshi; Isaka, Yoshitaka

    2016-01-01

    Histone acetylation is generally associated with gene activation and chromatin decondensation. Recent mass spectrometry analysis has revealed that histone H4 lysine 20, a major methylation site, can also be acetylated. To understand the function of H4 lysine 20 acetylation (H4K20ac), we have developed a specific monoclonal antibody and performed ChIP-seq analysis using HeLa-S3 cells. H4K20ac was enriched around the transcription start sites (TSSs) of minimally expressed genes and in the gene body of expressed genes, in contrast to most histone acetylation being enriched around the TSSs of expressed genes. The distribution of H4K20ac showed little correlation with known histone modifications, including histone H3 methylations. A motif search in H4K20ac-enriched sequences, together with transcription factor binding profiles based on ENCODE ChIP-seq data, revealed that most transcription activators are excluded from H4K20ac-enriched genes and a transcription repressor NRSF/REST co-localized with H4K20ac. These results suggest that H4K20ac is a unique acetylation mark associated with gene repression. PMID:27064113

  10. Histone H4 lysine 20 acetylation is associated with gene repression in human cells.

    PubMed

    Kaimori, Jun-Ya; Maehara, Kazumitsu; Hayashi-Takanaka, Yoko; Harada, Akihito; Fukuda, Masafumi; Yamamoto, Satoko; Ichimaru, Naotsugu; Umehara, Takashi; Yokoyama, Shigeyuki; Matsuda, Ryo; Ikura, Tsuyoshi; Nagao, Koji; Obuse, Chikashi; Nozaki, Naohito; Takahara, Shiro; Takao, Toshifumi; Ohkawa, Yasuyuki; Kimura, Hiroshi; Isaka, Yoshitaka

    2016-01-01

    Histone acetylation is generally associated with gene activation and chromatin decondensation. Recent mass spectrometry analysis has revealed that histone H4 lysine 20, a major methylation site, can also be acetylated. To understand the function of H4 lysine 20 acetylation (H4K20ac), we have developed a specific monoclonal antibody and performed ChIP-seq analysis using HeLa-S3 cells. H4K20ac was enriched around the transcription start sites (TSSs) of minimally expressed genes and in the gene body of expressed genes, in contrast to most histone acetylation being enriched around the TSSs of expressed genes. The distribution of H4K20ac showed little correlation with known histone modifications, including histone H3 methylations. A motif search in H4K20ac-enriched sequences, together with transcription factor binding profiles based on ENCODE ChIP-seq data, revealed that most transcription activators are excluded from H4K20ac-enriched genes and a transcription repressor NRSF/REST co-localized with H4K20ac. These results suggest that H4K20ac is a unique acetylation mark associated with gene repression. PMID:27064113

  11. Altered Histone Mark Deposition and DNA Methylation at Homeobox Genes in Human Oral Squamous Cell Carcinoma Cells

    PubMed Central

    Marcinkiewicz, Katarzyna M.; Gudas, Lorraine J.

    2014-01-01

    We recently reported a role of Polycomb repressive complex 2 (PRC2) and PRC2 trimethylation of histone 3 lysine 27 (H3K27me3) in the regulation of homeobox (HOX) (Marcinkiewicz and Gudas, 2013) gene transcript levels in human oral keratinocytes (OKF6-TERT1R) and tongue squamous cell carcinoma (SCC) cells. Here, we assessed both the levels of various histone modifications at a subset of homeobox genes and genome wide DNA methylation patterns in OKF6-TERT1R and SCC-9 cells by using ERRBS (enhanced reduced representation bisulfite sequencing). We detected the H3K9me3 mark at HOXB7, HOXC10, HOXC13 and HOXD8 at levels higher in OKF6-TERT1R than in SCC-9 cells; at IRX1 and SIX2 the H3K9me3 levels were conversely higher in SCC-9 than in OKF6-TERT1R. The H3K79me3 mark was detectable only at IRX1 in OKF6-TERT1R and at IRX4 in SCC-9 cells. The levels of H3K4me3 and H3K36me3 marks correlate with the transcript levels of the assessed homeobox genes in both OKF6-TERT1R and SCC-9. We detected generally lower CpG methylation levels on DNA in SCC-9 cells at annotated genomic regions which were differentially methylated between OKF6-TERT1R and SCC-9 cells; however, some genomic regions, including the HOX gene clusters, showed DNA methylation at higher levels in SCC-9 than OKF6-TERT1R. Thus, both altered histone modification patterns and changes in DNA methylation are associated with dysregulation of homeobox gene expression in human oral cavity SCC cells, and this dysregulation potentially plays a role in the neoplastic phenotype of oral keratinocytes. PMID:24519855

  12. Jarid2 (Jumonji, AT rich interactive domain 2) regulates NOTCH1 expression via histone modification in the developing heart.

    PubMed

    Mysliwiec, Matthew R; Carlson, Clayton D; Tietjen, Josh; Hung, Holly; Ansari, Aseem Z; Lee, Youngsook

    2012-01-01

    Jarid2/Jumonji, the founding member of the Jmj factor family, critically regulates various developmental processes, including cardiovascular development. The Jmj family was identified as histone demethylases, indicating epigenetic regulation by Jmj proteins. Deletion of Jarid2 in mice resulted in cardiac malformation and increased endocardial Notch1 expression during development. Although Jarid2 has been shown to occupy the Notch1 locus in the developing heart, the precise molecular role of Jarid2 remains unknown. Here we show that deletion of Jarid2 results in reduced methylation of lysine 9 on histone H3 (H3K9) at the Notch1 genomic locus in embryonic hearts. Interestingly, SETDB1, a histone H3K9 methyltransferase, was identified as a putative cofactor of Jarid2 by yeast two-hybrid screening, and the physical interaction between Jarid2 and SETDB1 was confirmed by coimmunoprecipitation experiments. Concurrently, accumulation of SETDB1 at the site of Jarid2 occupancy was significantly reduced in Jarid2 knock out (KO) hearts. Employing genome-wide approaches, putative Jarid2 target genes regulated by SETDB1 via H3K9 methylation were identified in the developing heart by ChIP-chip. These targets are involved in biological processes that, when dysregulated, could manifest in the phenotypic defects observed in Jarid2 KO mice. Our data demonstrate that Jarid2 functions as a transcriptional repressor of target genes, including Notch1, through a novel process involving the modification of H3K9 methylation via specific interaction with SETDB1 during heart development. Therefore, our study provides new mechanistic insights into epigenetic regulation by Jarid2, which will enhance our understanding of the molecular basis of other organ development and biological processes.

  13. Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histone modification in nucleolar dominance.

    PubMed

    Chen, Z J; Pikaard, C S

    1997-08-15

    Nucleolar dominance is an epigenetic phenomenon that describes nucleolus formation around rRNA genes inherited from only one progenitor of an interspecific hybrid or allopolyploid. The phenomenon is widespread, occurring in plants, insects, amphibians, and mammals, yet its molecular basis remains unclear. We have demonstrated nucleolar dominance in three allotetraploids of the plant genus Brassica. In Brassica napus, accurately initiated pre-rRNA transcripts from one progenitor, Brassica rapa are detected readily, whereas transcripts from the approximately 3000 rRNA genes inherited from the other progenitor, Brassica oleracea, are undetectable. Nuclear run-on confirmed that dominance is controlled at the level of transcription. Growth of B. napus seedlings on 5-aza-2'-deoxycytidine to inhibit cytosine methylation caused the normally silent, under-dominant B. oleracea rRNA genes to become expressed to high levels. The histone deacetylase inhibitors sodium butyrate and trichostatin A also derepressed silent rRNA genes. These results reveal an enforcement mechanism for nucleolar dominance in which DNA methylation and histone modifications combine to regulate rRNA gene loci spanning tens of megabase pairs of DNA.

  14. Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histone modification in nucleolar dominance

    PubMed Central

    Chen, Z. Jeffrey; Pikaard, Craig S.

    1997-01-01

    Nucleolar dominance is an epigenetic phenomenon that describes nucleolus formation around rRNA genes inherited from only one progenitor of an interspecific hybrid or allopolyploid. The phenomenon is widespread, occurring in plants, insects, amphibians, and mammals, yet its molecular basis remains unclear. We have demonstrated nucleolar dominance in three allotetraploids of the plant genus Brassica. In Brassica napus, accurately initiated pre-rRNA transcripts from one progenitor, Brassica rapa are detected readily, whereas transcripts from the ∼3000 rRNA genes inherited from the other progenitor, Brassica oleracea, are undetectable. Nuclear run-on confirmed that dominance is controlled at the level of transcription. Growth of B. napus seedlings on 5-aza-2′-deoxycytidine to inhibit cytosine methylation caused the normally silent, under-dominant B. oleracea rRNA genes to become expressed to high levels. The histone deacetylase inhibitors sodium butyrate and trichostatin A also de-epressed silent rRNA genes. These results reveal an enforcement mechanism for nucleolar dominance in which DNA methylation and histone modifications combine to regulate rRNA gene loci spanning tens of megabase pairs of DNA. PMID:9284051

  15. Transcriptomic Sequencing Reveals a Set of Unique Genes Activated by Butyrate-Induced Histone Modification.

    PubMed

    Li, Cong-Jun; Li, Robert W; Baldwin, Ransom L; Blomberg, Le Ann; Wu, Sitao; Li, Weizhong

    2016-01-01

    Butyrate is a nutritional element with strong epigenetic regulatory activity as a histone deacetylase inhibitor. Based on the analysis of differentially expressed genes in the bovine epithelial cells using RNA sequencing technology, a set of unique genes that are activated only after butyrate treatment were revealed. A complementary bioinformatics analysis of the functional category, pathway, and integrated network, using Ingenuity Pathways Analysis, indicated that these genes activated by butyrate treatment are related to major cellular functions, including cell morphological changes, cell cycle arrest, and apoptosis. Our results offered insight into the butyrate-induced transcriptomic changes and will accelerate our discerning of the molecular fundamentals of epigenomic regulation. PMID:26819550

  16. Transcriptomic Sequencing Reveals a Set of Unique Genes Activated by Butyrate-Induced Histone Modification

    PubMed Central

    Li, Cong-Jun; Li, Robert W.; Baldwin, Ransom L.; Blomberg, Le Ann; Wu, Sitao; Li, Weizhong

    2016-01-01

    Butyrate is a nutritional element with strong epigenetic regulatory activity as a histone deacetylase inhibitor. Based on the analysis of differentially expressed genes in the bovine epithelial cells using RNA sequencing technology, a set of unique genes that are activated only after butyrate treatment were revealed. A complementary bioinformatics analysis of the functional category, pathway, and integrated network, using Ingenuity Pathways Analysis, indicated that these genes activated by butyrate treatment are related to major cellular functions, including cell morphological changes, cell cycle arrest, and apoptosis. Our results offered insight into the butyrate-induced transcriptomic changes and will accelerate our discerning of the molecular fundamentals of epigenomic regulation. PMID:26819550

  17. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data

    PubMed Central

    Hu, Yang; Wu, Xiaoliang; Ma, Rui

    2016-01-01

    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  18. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data.

    PubMed

    Zhang, Tianjiao; Hu, Yang; Wu, Xiaoliang; Ma, Rui; Jiang, Qinghua; Wang, Yadong

    2016-01-01

    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  19. Histone Recognition and Large-Scale Structural Analysis of the Human Bromodomain Family

    PubMed Central

    Filippakopoulos, Panagis; Picaud, Sarah; Mangos, Maria; Keates, Tracy; Lambert, Jean-Philippe; Barsyte-Lovejoy, Dalia; Felletar, Ildiko; Volkmer, Rudolf; Müller, Susanne; Pawson, Tony; Gingras, Anne-Claude; Arrowsmith, Cheryl H.; Knapp, Stefan

    2012-01-01

    Summary Bromodomains (BRDs) are protein interaction modules that specifically recognize ε-N-lysine acetylation motifs, a key event in the reading process of epigenetic marks. The 61 BRDs in the human genome cluster into eight families based on structure/sequence similarity. Here, we present 29 high-resolution crystal structures, covering all BRD families. Comprehensive crossfamily structural analysis identifies conserved and family-specific structural features that are necessary for specific acetylation-dependent substrate recognition. Screening of more than 30 representative BRDs against systematic histone-peptide arrays identifies new BRD substrates and reveals a strong influence of flanking posttranslational modifications, such as acetylation and phosphorylation, suggesting that BRDs recognize combinations of marks rather than singly acetylated sequences. We further uncovered a structural mechanism for the simultaneous binding and recognition of diverse diacetyl-containing peptides by BRD4. These data provide a foundation for structure-based drug design of specific inhibitors for this emerging target family. PMID:22464331

  20. Molecular Basis of Histone Tail Recognition by Human TIP5 PHD Finger and Bromodomain of the Chromatin Remodeling Complex NoRC

    PubMed Central

    Tallant, Cynthia; Valentini, Erica; Fedorov, Oleg; Overvoorde, Lois; Ferguson, Fleur M.; Filippakopoulos, Panagis; Svergun, Dmitri I.; Knapp, Stefan; Ciulli, Alessio

    2015-01-01

    Summary Binding of the chromatin remodeling complex NoRC to RNA complementary to the rDNA promoter mediates transcriptional repression. TIP5, the largest subunit of NoRC, is involved in recruitment to rDNA by interactions with promoter-bound TTF-I, pRNA, and acetylation of H4K16. TIP5 domains that recognize posttranslational modifications on histones are essential for recruitment of NoRC to chromatin, but how these reader modules recognize site-specific histone tails has remained elusive. Here, we report crystal structures of PHD zinc finger and bromodomains from human TIP5 and BAZ2B in free form and bound to H3 and/or H4 histones. PHD finger functions as an independent structural module in recognizing unmodified H3 histone tails, and the bromodomain prefers H3 and H4 acetylation marks followed by a key basic residue, KacXXR. Further low-resolution analyses of PHD-bromodomain modules provide molecular insights into their trans histone tail recognition, required for nucleosome recruitment and transcriptional repression of the NoRC complex. PMID:25533489

  1. Discovering Cooperative Relationships of Chromatin Modifications in Human T Cells Based on a Proposed Closeness Measure

    PubMed Central

    Liu, Hongbo; Wu, Xueting; Zhu, Jiang; Su, Jianzhong; Wang, Fang; Cui, Ying; Zhang, Yan

    2010-01-01

    Background Eukaryotic transcription is accompanied by combinatorial chromatin modifications that serve as functional epigenetic markers. Composition of chromatin modifications specifies histone codes that regulate the associated gene. Discovering novel chromatin regulatory relationships are of general interest. Methodology/Principal Findings Based on the premise that the interaction of chromatin modifications is hypothesized to influence CpG methylation, we present a closeness measure to characterize the regulatory interactions of epigenomic features. The closeness measure is applied to genome-wide CpG methylation and histone modification datasets in human CD4+T cells to select a subset of potential features. To uncover epigenomic and genomic patterns, CpG loci are clustered into nine modules associated with distinct chromatin and genomic signatures based on terms of biological function. We then performed Bayesian network inference to uncover inherent regulatory relationships from the feature selected closeness measure profile and all nine module-specific profiles respectively. The global and module-specific network exhibits topological proximity and modularity. We found that the regulatory patterns of chromatin modifications differ significantly across modules and that distinct patterns are related to specific transcriptional levels and biological function. DNA methylation and genomic features are found to have little regulatory function. The regulatory relationships were partly validated by literature reviews. We also used partial correlation analysis in other cells to verify novel regulatory relationships. Conclusions/Significance The interactions among chromatin modifications and genomic elements characterized by a closeness measure help elucidate cooperative patterns of chromatin modification in transcriptional regulation and help decipher complex histone codes. PMID:21151929

  2. Histone lysine methyltransferases as anti-cancer targets for drug discovery

    PubMed Central

    Liu, Qing; Wang, Ming-wei

    2016-01-01

    Post-translational epigenetic modification of histones is controlled by a number of histone-modifying enzymes. Such modification regulates the accessibility of DNA and the subsequent expression or silencing of a gene. Human histone methyltransferases (HMTs)constitute a large family that includes histone lysine methyltransferases (HKMTs) and histone/protein arginine methyltransferases (PRMTs). There is increasing evidence showing a correlation between HKMTs and cancer pathogenesis. Here, we present an overview of representative HKMTs, including their biological and biochemical properties as well as the profiles of small molecule inhibitors for a comprehensive understanding of HKMTs in drug discovery. PMID:27397541

  3. GATA2 regulates GATA1 expression through LSD1-mediated histone modification

    PubMed Central

    Guo, Yidi; Fu, Xueqi; Huo, Bo; Wang, Yongsen; Sun, Jing; Meng, Lingyuan; Hao, Tian; Zhao, Zhizhuang Joe; Hu, Xin

    2016-01-01

    The dynamic and reversed expression of GATA1 and GATA2 are essential for proper erythroid differentiation. Our previous work demonstrates that LSD1, a histone H3K4 demethylase, represses GATA2 expression at late stage of erythroid differentiation. K562 and MEL cells were used and cultured in Roswell Park Memorial Institute-1640 medium (RPMI) and Dulbecco’s modified Eagle’s medium (DMEM), respectively. Western blot assay was used to examine the GATA1, GATA2, TAL1, HDAC1, HDAC2, CoREST and β-actin protein. The immunoprecipitation assay and GST pull-down assay were employed to detect the precipitated protein complexes and investigate the interaction between the proteins. The small interfering RNA (siRNA) and nonspecific control siRNA were synthesized to silence the target genes. Double fluorescence immunostaining was used to observe the association of LSD1 with GATA2 in K562 cells. The results indicated that knockdown of LSD1 in K562 cell causes increased H3K4 di-methylation at GATA1 locus and activates GATA1 expression, demonstrating that LSD1 represses GATA1 expression through LSD1-mediated histone demethylation. Upon induced erythroid differentiation of K562 cells, the interaction between GATA2 and LSD1 is decreased, consistent with a de-repression of GATA1 expression. Meanwhile, the interaction between TAL1 and LSD1 is increased, which forms a complex that efficiently suppresses GATA2 expression. In conclusion, these observations reveal an elegant mechanism to modulate GATA1 and GATA2 expression during erythroid differentiation. While LSD1 mainly forms complex with GATA2 to repress GATA1 expression in hematopoietic progenitor cells, it mostly forms complex with TAL1 to repress GATA2 expression in differentiated cells. PMID:27347333

  4. Poly(ADP-ribosylation) regulates chromatin organization through histone H3 modification and DNA methylation of the first cell cycle of mouse embryos

    SciTech Connect

    Osada, Tomoharu; Rydén, Anna-Margareta; Masutani, Mitsuko

    2013-04-26

    Highlights: •Histone modification of the mouse pronuclei is regulated by poly(ADP-ribosylation). •Hypermethylation of the mouse female pronuclei is maintained by poly(ADP-ribosylation). •Parp1 is physically interacted with Suz12, which may function in the pronuclei. •Poly(ADP-ribosylation) affects ultrastructure of chromatin of the mouse pronucleus. -- Abstract: We examined the roles of poly(ADP-ribosylation) in chromatin remodeling during the first cell cycle of mouse embryos. Drug-based inhibition of poly(ADP-ribosylation) by a PARP inhibitor, PJ-34, revealed up-regulation of dimethylation of histone H3 at lysine 4 in male pronuclei and down-regulation of dimethylation of histone H3 at lysine 9 (H3K9) and lysine 27 (H3K27). Association of poly(ADP-ribosylation) with histone modification was suggested to be supported by the interaction of Suz12, a histone methyltransferase in the polycomb complex, with Parp1. PARP activity was suggested to be required for a proper localization and maintenance of Suz12 on chromosomes. Notably, DNA methylation level of female pronuclei in one-cell embryos was robustly decreased by PJ-34. Electron microscopic analysis showed a frequent appearance of unusual electron-dense areas within the female pronuclei, implying the disorganized and hypercondensed chromatin ultrastructure. These results show that poly(ADP-ribosylation) is important for the integrity of non-equivalent epigenetic dynamics of pronuclei during the first cell cycle of mouse embryos.

  5. Nuclear c-Abl-mediated tyrosine phosphorylation induces chromatin structural changes through histone modifications that include H4K16 hypoacetylation

    SciTech Connect

    Aoyama, Kazumasa; Fukumoto, Yasunori; Ishibashi, Kenichi; Kubota, Sho; Morinaga, Takao; Horiike, Yasuyoshi; Yuki, Ryuzaburo; Takahashi, Akinori; Nakayama, Yuji; Yamaguchi, Naoto

    2011-12-10

    c-Abl tyrosine kinase, which is ubiquitously expressed, has three nuclear localization signals and one nuclear export signal and can shuttle between the nucleus and the cytoplasm. c-Abl plays important roles in cell proliferation, adhesion, migration, and apoptosis. Recently, we developed a pixel imaging method for quantitating the level of chromatin structural changes and showed that nuclear Src-family tyrosine kinases are involved in chromatin structural changes upon growth factor stimulation. Using this method, we show here that nuclear c-Abl induces chromatin structural changes in a manner dependent on the tyrosine kinase activity. Expression of nuclear-targeted c-Abl drastically increases the levels of chromatin structural changes, compared with that of c-Abl. Intriguingly, nuclear-targeted c-Abl induces heterochromatic profiles of histone methylation and acetylation, including hypoacetylation of histone H4 acetylated on lysine 16 (H4K16Ac). The level of heterochromatic histone modifications correlates with that of chromatin structural changes. Adriamycin-induced DNA damage stimulates translocation of c-Abl into the nucleus and induces chromatin structural changes together with H4K16 hypoacetylation. Treatment with trichostatin A, a histone deacetylase inhibitor, blocks chromatin structural changes but not nuclear tyrosine phosphorylation by c-Abl. These results suggest that nuclear c-Abl plays an important role in chromatin dynamics through nuclear tyrosine phosphorylation-induced heterochromatic histone modifications.

  6. Histone deacetylation modification participates in the repression of peanut (Arachis hypogaea L.) seed storage protein gene Ara h 2.02 during germination.

    PubMed

    Yang, P; Zhang, F; Luo, X; Zhou, Y; Xie, J

    2015-03-01

    Genes encoding seed storage proteins (SSPs) are specifically and highly expressed during seed maturation. In Arabidopsis, chromatin-based mechanisms involved in the repression of SSPs during germination have been proposed. However, epigenetic regulation involved in repressing SSPs in vegetative tissues of peanut is not well understood. Histone deacetylase (HDAC) is a chromatin-remodelling factor that contributes to transcriptional repression in eukaryotes. To address whether histone deacetylation modification is involved in the repression of SSP genes during germination in peanut, we generated an Ara h 2.02pro : β-glucuronidase (GUS) construct by fusing the 1972 bp Ara h 2.02 promoter of peanut (from -1972 to -1) to the GUS reporter gene and transformed it into wild-type Arabidopsis plants and HDAC mutants. GUS staining revealed that the mutation in HISTONE DEACETYLASE19 (HDA19) resulted in the ectopic expression of peanut SSP gene Ara h 2.02 in seedlings. In addition, Chromatin immunoprecipitation (ChIP) assays showed that the ectopic expression of Ara h 2.02 was accompanied by histone hyperacetylation during germination. These results suggest that histone deacetylation modification may play a vital role in repressing embryonic properties during the peanut vegetative growth.

  7. Development of primer sets that can verify the enrichment of histone modifications, and their application to examining vernalization-mediated chromatin changes in Brassica rapa L.

    PubMed

    Kawanabe, Takahiro; Osabe, Kenji; Itabashi, Etsuko; Okazaki, Keiichi; Dennis, Elizabeth S; Fujimoto, Ryo

    2016-07-20

    Epigenetic regulation is crucial for the development of plants and for adaptation to a changing environment. Recently, genome-wide profiles of histone modifications have been determined by a combination of chromatin immunoprecipitation (ChIP) and genomic tiling arrays (ChIP on chip) or ChIP and high-throughput sequencing (ChIP-seq) in species including Arabidopsis thaliana, rice and maize. Validation of ChIP analysis by PCR or qPCR using positive and negative regions of histone modification is necessary. In contrast, information about histone modifications is limited in Chinese cabbage, Brassica rapa. The aim of this study was to develop positive and negative control primer sets for H3K4me3 (trimethylation of the 4(th) lysine of H3), H3K9me2, H3K27me3 and H3K36me3 in B. rapa. The expression and histone modification of four FLC paralogs in B. rapa, before and after vernalization, were examined using the method developed here. After vernalization, expression of all four BrFLC genes was reduced, and accumulation of H3K27me3 was observed in three of them. As with A. thaliana, the vernalization response and stability of FLC repression correlated with the accumulation of H3K27me3. These results suggest that the epigenetic state during vernalization is important for high bolting resistance in B. rapa. The positive and negative control primer sets developed here revealed positive and negative histone modifications in B. rapa that can be used as a control for future studies. PMID:27074983

  8. Development of primer sets that can verify the enrichment of histone modifications, and their application to examining vernalization-mediated chromatin changes in Brassica rapa L.

    PubMed

    Kawanabe, Takahiro; Osabe, Kenji; Itabashi, Etsuko; Okazaki, Keiichi; Dennis, Elizabeth S; Fujimoto, Ryo

    2016-07-20

    Epigenetic regulation is crucial for the development of plants and for adaptation to a changing environment. Recently, genome-wide profiles of histone modifications have been determined by a combination of chromatin immunoprecipitation (ChIP) and genomic tiling arrays (ChIP on chip) or ChIP and high-throughput sequencing (ChIP-seq) in species including Arabidopsis thaliana, rice and maize. Validation of ChIP analysis by PCR or qPCR using positive and negative regions of histone modification is necessary. In contrast, information about histone modifications is limited in Chinese cabbage, Brassica rapa. The aim of this study was to develop positive and negative control primer sets for H3K4me3 (trimethylation of the 4(th) lysine of H3), H3K9me2, H3K27me3 and H3K36me3 in B. rapa. The expression and histone modification of four FLC paralogs in B. rapa, before and after vernalization, were examined using the method developed here. After vernalization, expression of all four BrFLC genes was reduced, and accumulation of H3K27me3 was observed in three of them. As with A. thaliana, the vernalization response and stability of FLC repression correlated with the accumulation of H3K27me3. These results suggest that the epigenetic state during vernalization is important for high bolting resistance in B. rapa. The positive and negative control primer sets developed here revealed positive and negative histone modifications in B. rapa that can be used as a control for future studies.

  9. Tissue specific up regulation of ACE2 in rabbit model of atherosclerosis by atorvastatin: role of epigenetic histone modifications.

    PubMed

    Tikoo, Kulbhushan; Patel, Gaurang; Kumar, Sandeep; Karpe, Pinakin Arun; Sanghavi, Maitri; Malek, Vajir; Srinivasan, K

    2015-02-01

    Growing body of evidence points out the crucial role of ACE2 in preventing atherosclerosis. However, data on how atherosclerosis affects ACE2 expression in heart and kidney remains unknown. Atherosclerosis was induced by feeding New Zealand White rabbits with high cholesterol diet (HCD - 2%) for 12 weeks and atorvastatin was administered (5mg/kg/day p.o) in last 3 weeks. ACE2 mRNA and protein expression was assessed by Western blotting and real time PCR. HCD fed rabbits developed atherosclerosis as confirmed by increase in plasma total cholesterol, LDL and triglycerides as well as formation atherosclerotic plaques in arch of aorta. The ACE2 protein but not mRNA expression was reduced in heart and kidney of HCD rabbits. Interestingly, atorvastatin increased the ACE2 protein expression in heart and kidney of HCD rabbits. However, atorvastatin increased ACE2 mRNA in heart but not in kidney of HCD rabbits. Atorvastatin increased the occupancy of histone H3 acetylation (H3-Ac) mark on ACE2 promoter region in heart of HCD rabbits indicating direct or indirect epigenetic up-regulation of ACE2 by atorvastatin. Further, atorvastatin suppressed Ang II-induced contractile responses and enhanced AT2 receptor mediated relaxant responses in atherosclerotic aorta. We propose that atherosclerosis is associated with reduced ACE2 expression in heart and kidney. We also show an unexplored potential of atorvastatin to up-regulate ACE2 via epigenetic histone modifications. Our data suggest a novel way of replenishing ACE2 expression for preventing not only atherosclerosis but also other cardiovascular disorders. PMID:25482567

  10. Pask integrates hormonal signaling with histone modification via Wdr5 phosphorylation to drive myogenesis

    PubMed Central

    Kikani, Chintan K; Wu, Xiaoying; Paul, Litty; Sabic, Hana; Shen, Zuolian; Shakya, Arvind; Keefe, Alexandra; Villanueva, Claudio; Kardon, Gabrielle; Graves, Barbara; Tantin, Dean; Rutter, Jared

    2016-01-01

    PAS domain containing protein kinase (Pask) is an evolutionarily conserved protein kinase implicated in energy homeostasis and metabolic regulation across eukaryotic species. We now describe an unexpected role of Pask in promoting the differentiation of myogenic progenitor cells, embryonic stem cells and adipogenic progenitor cells. This function of Pask is dependent upon its ability to phosphorylate Wdr5, a member of several protein complexes including those that catalyze histone H3 Lysine 4 trimethylation (H3K4me3) during transcriptional activation. Our findings suggest that, during myoblast differentiation, Pask stimulates the conversion of repressive H3K4me1 to activating H3K4me3 marks on the promoter of the differentiation gene myogenin (Myog) via Wdr5 phosphorylation. This enhances accessibility of the MyoD transcription factor and enables transcriptional activation of the Myog promoter to initiate muscle differentiation. Thus, as an upstream kinase of Wdr5, Pask integrates signaling cues with the transcriptional network to regulate the differentiation of progenitor cells. DOI: http://dx.doi.org/10.7554/eLife.17985.001 PMID:27661449

  11. Regulation of mismatch repair by histone code and posttranslational modifications in eukaryotic cells.

    PubMed

    Li, Feng; Ortega, Janice; Gu, Liya; Li, Guo-Min

    2016-02-01

    DNA mismatch repair (MMR) protects genome integrity by correcting DNA replication-associated mispairs, modulating DNA damage-induced cell cycle checkpoints and regulating homeologous recombination. Loss of MMR function leads to cancer development. This review describes progress in understanding how MMR is carried out in the context of chromatin and how chromatin organization/compaction, epigenetic mechanisms and posttranslational modifications of MMR proteins influence and regulate MMR in eukaryotic cells.

  12. Human tNASP promotes in vitro nucleosome assembly with histone H3.3.

    PubMed

    Kato, Daiki; Osakabe, Akihisa; Tachiwana, Hiroaki; Tanaka, Hiroki; Kurumizaka, Hitoshi

    2015-02-10

    Nuclear autoantigenic sperm proteins (NASPs) are members of the acidic histone chaperones, which promote nucleosome assembly. In humans, two splicing variants proposed for the somatic and testicular isoforms, sNASP and tNASP, respectively, have been found, and the shorter form, sNASP, reportedly promotes nucleosome assembly with the histone H3 isoforms, H3.1, H3.2, and H3.3. However, the biochemical properties of the longer form, tNASP, have not been reported. tNASP is considered to exist specifically in the testis. Our present results revealed that the tNASP protein is ubiquitously produced in various human tissues, in addition to testis. Unexpectedly, we found that the nucleosome assembly activity of purified tNASP was extremely low with the canonical histone H3.1 or H3.2, but was substantially detected with the replacement histone H3.3 variant. A mutational analysis revealed that the H3.3 Ile89 residue, corresponding to the H3.1 Val89 residue, is responsible for the tNASP-mediated nucleosome assembly with H3.3. A histone deposition assay showed that the H3.3-H4 complex is more efficiently deposited onto DNA by tNASP than the H3.1-H4 complex. These results provide evidence that tNASP is ubiquitously produced in various types of human tissues and promotes in vitro nucleosome assembly with H3 variant specificity.

  13. Platelet-Activating Factor Induces Epigenetic Modifications in Human Mast Cells

    PubMed Central

    Gorbea, Enrique; Ullrich, Stephen E.

    2015-01-01

    Ultraviolet (UV) radiation-induced systemic immune suppression is a major risk factor for skin cancer induction. The migration of dermal mast cells from the skin to the draining lymph nodes plays a prominent role in activating systemic immune suppression. UV-induced keratinocyte-derived platelet-activating factor (PAF) activates mast cell migration, in part by up regulating the expression of CXCR4 on the surface of mast cells. Others have indicated that epigenetic mechanisms regulate CXCR4 expression, so we asked whether PAF activates epigenetic mechanisms in mast cells. Human mast cells were treated with PAF and the effect on DNA methylation and/or acetylation was measured. PAF suppressed the expression of DNA methyltransferase (DNMT) 1 and 3b. On the other hand, PAF increased p300 histone acetyltransferase expression, and the acetylation of histone H3, which coincided with a decreased expression of the histone deacetylase HDAC2. Chromatin immunoprecipitation assays indicated that PAF-treatment activated the acetylation of the CXCR4 promoter. Finally, inhibiting histone acetylation blocked p300 up-regulation and suppressed PAF-induced surface expression of CXCR4. Our findings suggest a novel molecular mechanism for PAF, activation of epigenetic modifications. We suggest that PAF may serve as an endogenous molecular mediator that links the environment (UV radiation) with the epigenome. PMID:26316070

  14. Histone H1 Variants in Arabidopsis Are Subject to Numerous Post-Translational Modifications, Both Conserved and Previously Unknown in Histones, Suggesting Complex Functions of H1 in Plants.

    PubMed

    Kotliński, Maciej; Rutowicz, Kinga; Kniżewski, Łukasz; Palusiński, Antoni; Olędzki, Jacek; Fogtman, Anna; Rubel, Tymon; Koblowska, Marta; Dadlez, Michał; Ginalski, Krzysztof; Jerzmanowski, Andrzej

    2016-01-01

    Linker histones (H1s) are conserved and ubiquitous structural components of eukaryotic chromatin. Multiple non-allelic variants of H1, which differ in their DNA/nucleosome binding properties, co-exist in animal and plant cells and have been implicated in the control of genetic programs during development and differentiation. Studies in mammals and Drosophila have revealed diverse post-translational modifications of H1s, most of which are of unknown function. So far, it is not known how this pattern compares with that of H1s from other major lineages of multicellular Eukaryotes. Here, we show that the two main H1variants of a model flowering plant Arabidopsis thaliana are subject to a rich and diverse array of post-translational modifications. The distribution of these modifications in the H1 molecule, especially in its globular domain (GH1), resembles that occurring in mammalian H1s, suggesting that their functional significance is likely to be conserved. While the majority of modifications detected in Arabidopsis H1s, including phosphorylation, acetylation, mono- and dimethylation, formylation, crotonylation and propionylation, have also been reported in H1s of other species, some others have not been previously identified in histones.

  15. Genetic alterations of JAK/STAT cascade and histone modification in extranodal NK/T-cell lymphoma nasal type.

    PubMed

    Lee, Seungbok; Park, Ha Young; Kang, So Young; Kim, Seok Jin; Hwang, Jinha; Lee, Seungho; Kwak, Soo Heon; Park, Kyong Soo; Yoo, Hae Yong; Kim, Won Seog; Kim, Jong-Il; Ko, Young Hyeh

    2015-07-10

    Extranodal NK/T-cell lymphoma nasal type (ENKL) is a rare type of non-Hodgkin lymphoma that more frequently occurs in East Asia and Latin America. Even though its molecular background has been discussed in the last few years, the current knowledge does not explain the disease pathogenesis in most cases of ENKL. Here, we performed multiple types of next-generation sequencing on 34 ENKL samples, including whole-exome sequencing (9 cancer tissues and 4 cancer cell lines), targeted sequencing (21 cancer tissues), and RNA sequencing (3 cancer tissues and 4 cancer cell lines). Mutations were found most frequently in 3 genes, STAT3, BCOR, and MLL2 (which were present in 9, 7, and 6 cancer samples, respectively), whereas there were only 2 cases of JAK3 mutation. In total, JAK/STAT pathway- and histone modification-related genes accounted for 55.9% and 38.2% of cancer samples, respectively, and their involvement in ENKL pathogenesis was also supported by gene expression analysis. In addition, we provided 177 genes upregulated only in cancer tissues, which appear to be linked with angiocentric and angiodestructive growth of ENKL. In this study, we propose several novel driver genes of ENKL, and show that these genes and their functional groups may be future therapeutic targets of this disease.

  16. Genetic alterations of JAK/STAT cascade and histone modification in extranodal NK/T-cell lymphoma nasal type

    PubMed Central

    Kang, So Young; Kim, Seok Jin; Hwang, Jinha; Lee, Seungho; Kwak, Soo Heon; Park, Kyong Soo; Yoo, Hae Yong

    2015-01-01

    Extranodal NK/T-cell lymphoma nasal type (ENKL) is a rare type of non-Hodgkin lymphoma that more frequently occurs in East Asia and Latin America. Even though its molecular background has been discussed in the last few years, the current knowledge does not explain the disease pathogenesis in most cases of ENKL. Here, we performed multiple types of next-generation sequencing on 34 ENKL samples, including whole-exome sequencing (9 cancer tissues and 4 cancer cell lines), targeted sequencing (21 cancer tissues), and RNA sequencing (3 cancer tissues and 4 cancer cell lines). Mutations were found most frequently in 3 genes, STAT3, BCOR, and MLL2 (which were present in 9, 7, and 6 cancer samples, respectively), whereas there were only 2 cases of JAK3 mutation. In total, JAK/STAT pathway- and histone modification-related genes accounted for 55.9% and 38.2% of cancer samples, respectively, and their involvement in ENKL pathogenesis was also supported by gene expression analysis. In addition, we provided 177 genes upregulated only in cancer tissues, which appear to be linked with angiocentric and angiodestructive growth of ENKL. In this study, we propose several novel driver genes of ENKL, and show that these genes and their functional groups may be future therapeutic targets of this disease. PMID:25980440

  17. Genetic alterations of JAK/STAT cascade and histone modification in extranodal NK/T-cell lymphoma nasal type.

    PubMed

    Lee, Seungbok; Park, Ha Young; Kang, So Young; Kim, Seok Jin; Hwang, Jinha; Lee, Seungho; Kwak, Soo Heon; Park, Kyong Soo; Yoo, Hae Yong; Kim, Won Seog; Kim, Jong-Il; Ko, Young Hyeh

    2015-07-10

    Extranodal NK/T-cell lymphoma nasal type (ENKL) is a rare type of non-Hodgkin lymphoma that more frequently occurs in East Asia and Latin America. Even though its molecular background has been discussed in the last few years, the current knowledge does not explain the disease pathogenesis in most cases of ENKL. Here, we performed multiple types of next-generation sequencing on 34 ENKL samples, including whole-exome sequencing (9 cancer tissues and 4 cancer cell lines), targeted sequencing (21 cancer tissues), and RNA sequencing (3 cancer tissues and 4 cancer cell lines). Mutations were found most frequently in 3 genes, STAT3, BCOR, and MLL2 (which were present in 9, 7, and 6 cancer samples, respectively), whereas there were only 2 cases of JAK3 mutation. In total, JAK/STAT pathway- and histone modification-related genes accounted for 55.9% and 38.2% of cancer samples, respectively, and their involvement in ENKL pathogenesis was also supported by gene expression analysis. In addition, we provided 177 genes upregulated only in cancer tissues, which appear to be linked with angiocentric and angiodestructive growth of ENKL. In this study, we propose several novel driver genes of ENKL, and show that these genes and their functional groups may be future therapeutic targets of this disease. PMID:25980440

  18. Locus-specific editing of histone modifications at endogenous enhancers using programmable TALE-LSD1 fusions

    PubMed Central

    Mendenhall, Eric M.; Williamson, Kaylyn E.; Reyon, Deepak; Zou, James Y.; Ram, Oren; Joung, J. Keith; Bernstein, Bradley E.

    2013-01-01

    Mammalian gene regulation is dependent on tissue-specific enhancers that can act across large distances to influence transcriptional activity1-3. Mapping experiments have identified hundreds of thousands of putative enhancers whose functionality is supported by cell type–specific chromatin signatures and striking enrichments for disease-associated sequence variants4-11. However, these studies did not address the in vivo functions of the putative elements or their chromatin states and could not determine which genes, if any, a given enhancer regulates. Here we present a strategy to investigate endogenous regulatory elements by selectively altering their chromatin state using programmable reagents. Transcription activator–like (TAL) effector repeat domains fused to the LSD1 histone demethylase efficiently remove enhancer-associated chromatin modifications from target loci, without affecting control regions. We find that inactivation of enhancer chromatin by these fusion proteins frequently causes down-regulation of proximal genes, revealing enhancer target genes. Our study demonstrates the potential of ‘epigenome editing’ tools to characterize an important class of functional genomic elements. PMID:24013198

  19. Epigenetic modification of OXT and human sociability.

    PubMed

    Haas, Brian W; Filkowski, Megan M; Cochran, R Nick; Denison, Lydia; Ishak, Alexandra; Nishitani, Shota; Smith, Alicia K

    2016-07-01

    Across many mammalian species there exist genetic and biological systems that facilitate the tendency to be social. Oxytocin is a neuropeptide involved in social-approach behaviors in humans and others mammals. Although there exists a large, mounting body of evidence showing that oxytocin signaling genes are associated with human sociability, very little is currently known regarding the way the structural gene for oxytocin (OXT) confers individual differences in human sociability. In this study, we undertook a comprehensive approach to investigate the association between epigenetic modification of OXT via DNA methylation, and overt measures of social processing, including self-report, behavior, and brain function and structure. Genetic data were collected via saliva samples and analyzed to target and quantify DNA methylation across the promoter region of OXT We observed a consistent pattern of results across sociability measures. People that exhibit lower OXT DNA methylation (presumably linked to higher OXT expression) display more secure attachment styles, improved ability to recognize emotional facial expressions, greater superior temporal sulcus activity during two social-cognitive functional MRI tasks, and larger fusiform gyrus gray matter volume than people that exhibit higher OXT DNA methylation. These findings provide empirical evidence that epigenetic modification of OXT is linked to several overt measures of sociability in humans and serve to advance progress in translational social neuroscience research toward a better understanding of the evolutionary and genetic basis of normal and abnormal human sociability. PMID:27325757

  20. Epigenetic modification of OXT and human sociability.

    PubMed

    Haas, Brian W; Filkowski, Megan M; Cochran, R Nick; Denison, Lydia; Ishak, Alexandra; Nishitani, Shota; Smith, Alicia K

    2016-07-01

    Across many mammalian species there exist genetic and biological systems that facilitate the tendency to be social. Oxytocin is a neuropeptide involved in social-approach behaviors in humans and others mammals. Although there exists a large, mounting body of evidence showing that oxytocin signaling genes are associated with human sociability, very little is currently known regarding the way the structural gene for oxytocin (OXT) confers individual differences in human sociability. In this study, we undertook a comprehensive approach to investigate the association between epigenetic modification of OXT via DNA methylation, and overt measures of social processing, including self-report, behavior, and brain function and structure. Genetic data were collected via saliva samples and analyzed to target and quantify DNA methylation across the promoter region of OXT We observed a consistent pattern of results across sociability measures. People that exhibit lower OXT DNA methylation (presumably linked to higher OXT expression) display more secure attachment styles, improved ability to recognize emotional facial expressions, greater superior temporal sulcus activity during two social-cognitive functional MRI tasks, and larger fusiform gyrus gray matter volume than people that exhibit higher OXT DNA methylation. These findings provide empirical evidence that epigenetic modification of OXT is linked to several overt measures of sociability in humans and serve to advance progress in translational social neuroscience research toward a better understanding of the evolutionary and genetic basis of normal and abnormal human sociability.

  1. Associations between Blood and Urine Arsenic Concentrations and Global Levels of Post-Translational Histone Modifications in Bangladeshi Men and Women

    PubMed Central

    Howe, Caitlin G.; Liu, Xinhua; Hall, Megan N.; Slavkovich, Vesna; Ilievski, Vesna; Parvez, Faruque; Siddique, Abu B.; Shahriar, Hasan; Uddin, Mohammad N.; Islam, Tariqul; Graziano, Joseph H.; Costa, Max; Gamble, Mary V.

    2016-01-01

    Background: Exposure to inorganic arsenic is associated with numerous adverse health outcomes, with susceptibility differing by sex. Although evidence from in vitro studies suggests that arsenic alters post-translational histone modifications (PTHMs), evidence in humans is limited. Objectives: The objectives were to determine: a) if arsenic exposure is associated with global (percent) levels of PTHMs H3K36me2, H3K36me3, and H3K79me2 in a sex-dependent manner, and b) if %PTHMs are stable when arsenic exposure is reduced. Methods: We examined associations between arsenic, measured in blood and urine, and %PTHMs in peripheral blood mononuclear cells from 317 participants enrolled in the Bangladesh Folic Acid and Creatine Trial (FACT). We also examined the stability of %PTHMs after the use of arsenic-removal water filters (n = 60). Results: Associations between natural log–transformed (ln) urinary arsenic, adjusted for creatinine (uAsCr), and %H3K36me2 differed significantly between men and women (p = 0.01). ln(uAsCr) was positively associated with %H3K36me2 in men [β = 0.12; 95% confidence interval (CI): 0.01, 0.23, p = 0.03] but was negatively associated with %H3K36me2 in women (β = –0.05; 95% CI: –0.12, 0.02, p = 0.19). The patterns of associations with blood arsenic were similar. On average, water filter use was also associated with reductions in %H3K36me2 (p < 0.01), but this did not differ significantly by sex. Arsenic was not significantly associated with %H3K36me3 or %H3K79me2 in men or women. Conclusions: Arsenic exposure was associated with %H3K36me2 in a sex-specific manner but was not associated with %H3K36me3 or %H3K79me2. Additional studies are needed to assess changes in %H3K36me2 after arsenic removal. Citation: Howe CG, Liu X, Hall MN, Slavkovich V, Ilievski V, Parvez F, Siddique AB, Shahriar H, Uddin MN, Islam T, Graziano JH, Costa M, Gamble MV. 2016. Associations between blood and urine arsenic concentrations and global levels of post

  2. Intra- and inter-nucleosomal interactions of the histone H4 tail revealed with a human nucleosome core particle with genetically-incorporated H4 tetra-acetylation.

    PubMed

    Wakamori, Masatoshi; Fujii, Yoshifumi; Suka, Noriyuki; Shirouzu, Mikako; Sakamoto, Kensaku; Umehara, Takashi; Yokoyama, Shigeyuki

    2015-11-26

    Post-translational modifications (PTMs) of histones, such as lysine acetylation of the N-terminal tails, play crucial roles in controlling gene expression. Due to the difficulty in reconstituting site-specifically acetylated nucleosomes with crystallization quality, structural analyses of histone acetylation are currently performed using synthesized tail peptides. Through engineering of the genetic code, translation termination, and cell-free protein synthesis, we reconstituted human H4-mono- to tetra-acetylated nucleosome core particles (NCPs), and solved the crystal structures of the H4-K5/K8/K12/K16-tetra-acetylated NCP and unmodified NCP at 2.4 Å and 2.2 Å resolutions, respectively. The structure of the H4-tetra-acetylated NCP resembled that of the unmodified NCP, and the DNA wrapped the histone octamer as precisely as in the unmodified NCP. However, the B-factors were significantly increased for the peripheral DNAs near the N-terminal tail of the intra- or inter-nucleosomal H4. In contrast, the B-factors were negligibly affected by the H4 tetra-acetylation in histone core residues, including those composing the acidic patch, and at H4-R23, which interacts with the acidic patch of the neighboring NCP. The present study revealed that the H4 tetra-acetylation impairs NCP self-association by changing the interactions of the H4 tail with DNA, and is the first demonstration of crystallization quality NCPs reconstituted with genuine PTMs.

  3. Middle-down hybrid chromatography/tandem mass spectrometry workflow for characterization of combinatorial post-translational modifications in histones.

    PubMed

    Sidoli, Simone; Schwämmle, Veit; Ruminowicz, Chrystian; Hansen, Thomas A; Wu, Xudong; Helin, Kristian; Jensen, Ole N

    2014-10-01

    We present an integrated middle-down proteomics platform for sensitive mapping and quantification of coexisting PTMs in large polypeptides (5-7 kDa). We combined an RP trap column with subsequent weak cation exchange-hydrophilic interaction LC interfaced directly to high mass accuracy ESI MS/MS using electron transfer dissociation. This enabled automated and efficient separation and sequencing of hypermodified histone N-terminal tails for unambiguous localization of combinatorial PTMs. We present Histone Coder and IsoScale software to extract, filter, and analyze MS/MS data, including quantification of cofragmenting isobaric polypeptide species. We characterized histone tails derived from murine embryonic stem cells knockout in suppressor of zeste12 (Suz12(-/-) ) and quantified 256 combinatorial histone marks in histones H3, H4, and H2A. Furthermore, a total of 713 different combinatorial histone marks were identified in purified histone H3. We measured a seven-fold reduction of H3K27me2/me3 (where me2 and me3 are dimethylation and trimethylation, respectively) in Suz12(-) (/) (-) cells and detected significant changes of the relative abundance of 16 other single PTMs of histone H3 and other combinatorial marks. We conclude that the inactivation of Suz12 is associated with changes in the abundance of not only H3K27 methylation but also multiple other PTMs in histone H3 tails.

  4. Distinct chromatin signature of histone H3 variant H3.3 in human cells

    PubMed Central

    Snyers, Luc; Zupkovitz, Gordin; Almeder, Marlene; Fliesser, Marianne; Stoisser, Anja; Weipoltshammer, Klara; Schöfer, Christian

    2014-01-01

    Actively transcribed regions of the genome have been found enriched for the histone H3 variant H3.3. This variant is incorporated into nucleosomes throughout the cell cycle whereas the canonical isoforms are predominately deposited in association with replication. In order to obtain a global picture of the deposition pattern at the single cell level we expressed H3.3 in both normal and malignant human cells and analyzed nuclei using conventional and structured illumination imaging (SIM). We found that the distribution pattern of H3.3 in interphase differs from that of the canonical histone H3 variants and this difference is conveyed to mitotic chromosomes which display a distinct H3.3 banding pattern. Histone H3.3 localization positively correlated with markers for transcriptionally active chromatin and, notably, H3.3 was almost completely absent from the inactive X chromosome. Collectively, our data show that histone variant H3.3 occupies distinct intranuclear chromatin domains and that these genomic loci are associated with gene expression. PMID:25482197

  5. Distinct localization of histone H3 acetylation and H3-K4 methylation to the transcription start sites in the human genome

    PubMed Central

    Liang, Gangning; Lin, Joy C. Y.; Wei, Vivian; Yoo, Christine; Cheng, Jonathan C.; Nguyen, Carvell T.; Weisenberger, Daniel J.; Egger, Gerda; Takai, Daiya; Gonzales, Felicidad A.; Jones, Peter A.

    2004-01-01

    Almost 1-2% of the human genome is located within 500 bp of either side of a transcription initiation site, whereas a far larger proportion (≈25%) is potentially transcribable by elongating RNA polymerases. This observation raises the question of how the genome is packaged into chromatin to allow start sites to be recognized by the regulatory machinery at the same time as transcription initiation, but not elongation, is blocked in the 25% of intragenic DNA. We developed a chromatin scanning technique called ChAP, coupling the chromatin immunoprecipitation assay with arbitrarily primed PCR, which allows for the rapid and unbiased comparison of histone modification patterns within the eukaryotic nucleus. Methylated lysine 4 (K4) and acetylated K9/14 of histone H3 were both highly localized to the 5′ regions of transcriptionally active human genes but were greatly decreased downstream of the start sites. Our results suggest that the large transcribed regions of human genes are maintained in a deacetylated conformation in regions read by elongating polymerase. Common models depicting widespread histone acetylation and K4 methylation throughout the transcribed unit do not therefore apply to the majority of human genes. PMID:15123803

  6. Structural and Functional Profiling of the Human Histone Methyltransferase SMYD3

    SciTech Connect

    Foreman, Kenneth W.; Brown, Mark; Park, Frances; Emtage, Spencer; Harriss, June; Das, Chhaya; Zhu, Li; Crew, Andy; Arnold, Lee; Shaaban, Salam; Tucker, Philip

    2012-10-23

    The SET and MYND Domain (SMYD) proteins comprise a unique family of multi-domain SET histone methyltransferases that are implicated in human cancer progression. Here we report an analysis of the crystal structure of the full length human SMYD3 in a complex with an analog of the S-adenosyl methionine (SAM) methyl donor cofactor. The structure revealed an overall compact architecture in which the 'split-SET' domain adopts a canonical SET domain fold and closely assembles with a Zn-binding MYND domain and a C-terminal superhelical 9 ?-helical bundle similar to that observed for the mouse SMYD1 structure. Together, these structurally interlocked domains impose a highly confined binding pocket for histone substrates, suggesting a regulated mechanism for its enzymatic activity. Our mutational and biochemical analyses confirm regulatory roles of the unique structural elements both inside and outside the core SET domain and establish a previously undetected preference for trimethylation of H4K20.

  7. In vivo targeting of de novo DNA methylation by histone modifications in yeast and mouse.

    PubMed

    Morselli, Marco; Pastor, William A; Montanini, Barbara; Nee, Kevin; Ferrari, Roberto; Fu, Kai; Bonora, Giancarlo; Rubbi, Liudmilla; Clark, Amander T; Ottonello, Simone; Jacobsen, Steven E; Pellegrini, Matteo

    2015-01-01

    Methylation of cytosines (5(me)C) is a widespread heritable DNA modification. During mammalian development, two global demethylation events are followed by waves of de novo DNA methylation. In vivo mechanisms of DNA methylation establishment are largely uncharacterized. Here, we use Saccharomyces cerevisiae as a system lacking DNA methylation to define the chromatin features influencing the activity of the murine DNMT3B. Our data demonstrate that DNMT3B and H3K4 methylation are mutually exclusive and that DNMT3B is co-localized with H3K36 methylated regions. In support of this observation, DNA methylation analysis in yeast strains without Set1 and Set2 shows an increase of relative 5(me)C levels at the transcription start site and a decrease in the gene-body, respectively. We extend our observation to the murine male germline, where H3K4me3 is strongly anti-correlated while H3K36me3 correlates with accelerated DNA methylation. These results show the importance of H3K36 methylation for gene-body DNA methylation in vivo. PMID:25848745

  8. A Peek into the Complex Realm of Histone Phosphorylation▿

    PubMed Central

    Banerjee, Taraswi; Chakravarti, Debabrata

    2011-01-01

    Although discovered long ago, posttranslational phosphorylation of histones has been in the spotlight only recently. Information is accumulating almost daily on phosphorylation of histones and their roles in cellular physiology and human diseases. An extensive cross talk exists between phosphorylation and other posttranslational modifications, which together regulate various biological processes, including gene transcription, DNA repair, and cell cycle progression. Recent research on histone phosphorylation has demonstrated that nearly all histone types are phosphorylated at specific residues and that these modifications act as a critical intermediate step in chromosome condensation during cell division, transcriptional regulation, and DNA damage repair. As with all young fields, apparently conflicting and sometimes controversial observations about histone phosphorylations and their true functions in different species are found in the literature. Accumulating evidence suggests that instead of functioning strictly as part of a general code, histone phosphorylation probably functions by establishing cross talk with other histone modifications and serving as a platform for recruitment or release of effector proteins, leading to a downstream cascade of events. Here we extensively review published information on the complexities of histone phosphorylation, the roles of proteins recognizing these modifications and the resuting physiological outcome, and, importantly, future challenges and opportunities in this fast-moving field. PMID:22006017

  9. Histone modification and signalling cascade of the dormancy-associated MADS-box gene, PpMADS13-1, in Japanese pear (Pyrus pyrifolia) during endodormancy.

    PubMed

    Saito, Takanori; Bai, Songling; Imai, Tsuyoshi; Ito, Akiko; Nakajima, Ikuko; Moriguchi, Takaya

    2015-06-01

    Dormancy-associated MADS-box (DAM) genes play an important role in endodormancy phase transition. We investigated histone modification in the DAM homolog (PpMADS13-1) from Japanese pear, via chromatin immunoprecipitation-quantitative PCR, to understand the mechanism behind the reduced expression of the PpMADS13-1 gene towards endodormancy release. Our results indicated that the reduction in the active histone mark by trimethylation of the histone H3 tail at lysine 4 contributed to the reduction of PpMADS13-1 expression towards endodormancy release. In contrast, the inactive histone mark by trimethylation of the histone H3 tail at lysine 27 in PpMADS13-1 locus was quite low, and these levels were more similar to a negative control [normal mouse immunoglobulin G (IgG)] than to a positive control (AGAMOUS) in endodormancy phase transition. The loss of histone variant H2A.Z also coincided with the down-regulation of PpMADS13-1. Subsequently, we investigated the PpMADS13-1 signalling cascade and found that PpCBF2, a pear C-repeated binding factor, regulated PpMADS13-1 expression via interaction of PpCBF2 with the 5'-upstream region of PpMADS13-1 by transient reporter assay. Furthermore, transient reporter assay confirmed no interaction between the PpMADS13-1 protein and the pear FLOWERING LOCUS T genes. Taken together, our results enhance understanding of the molecular mechanisms underlying endodormancy phase transition in Japanese pear.

  10. The Histone Database: an integrated resource for histones and histone fold-containing proteins.

    PubMed

    Mariño-Ramírez, Leonardo; Levine, Kevin M; Morales, Mario; Zhang, Suiyuan; Moreland, R Travis; Baxevanis, Andreas D; Landsman, David

    2011-01-01

    Eukaryotic chromatin is composed of DNA and protein components-core histones-that act to compactly pack the DNA into nucleosomes, the fundamental building blocks of chromatin. These nucleosomes are connected to adjacent nucleosomes by linker histones. Nucleosomes are highly dynamic and, through various core histone post-translational modifications and incorporation of diverse histone variants, can serve as epigenetic marks to control processes such as gene expression and recombination. The Histone Sequence Database is a curated collection of sequences and structures of histones and non-histone proteins containing histone folds, assembled from major public databases. Here, we report a substantial increase in the number of sequences and taxonomic coverage for histone and histone fold-containing proteins available in the database. Additionally, the database now contains an expanded dataset that includes archaeal histone sequences. The database also provides comprehensive multiple sequence alignments for each of the four core histones (H2A, H2B, H3 and H4), the linker histones (H1/H5) and the archaeal histones. The database also includes current information on solved histone fold-containing structures. The Histone Sequence Database is an inclusive resource for the analysis of chromatin structure and function focused on histones and histone fold-containing proteins.

  11. Evaluation of histone deacetylase inhibitors (HDACi) as therapeutic leads for human African trypanosomiasis (HAT).

    PubMed

    Carrillo, Angela K; Guiguemde, W Armand; Guy, R Kiplin

    2015-08-15

    Two of the histone deacetylases, TbDAC1 and TbDAC3, have been reported to be essential genes in trypanosomes. Therefore, we tested the activity of a panel of human histone deacetylase inhibitors (HDACi) for their ability to block proliferation of Trypanosoma brucei brucei. Among the HDACi's, the hydroxamic acid derivatives panobinostat and belinostat exhibited potency that appeared to make them viable candidates for development due to their reported pharmacokinetic characteristics. However, cellular pharmacodynamic analysis demonstrated that these drugs were unable to kill cultured parasites at exposures seen in patients at their tolerated doses and additionally failed to show any synergistic effects in combination with pentamidine, suramin, melarsoprol, or nifurtimox. Analysis of the potency of the entire HDACi panel revealed no correlations between potency against any human HDAC isoform and inhibition of T. brucei proliferation, suggesting that the trypanosome histone deacetylases possess a unique specificity. These studies confirmed that HDAC inhibitors have potential as leads against human African trypanosomiasis but that none of the current clinical candidates can be directly repurposed. Therefore, development of HDACi's with appropriate specificity and potency may be a viable route to a new class of anti-trypanosomal drugs.

  12. IFI16 Restricts HSV-1 Replication by Accumulating on the HSV-1 Genome, Repressing HSV-1 Gene Expression, and Directly or Indirectly Modulating Histone Modifications

    PubMed Central

    Johnson, Karen E.; Bottero, Virginie; Flaherty, Stephanie; Dutta, Sujoy; Singh, Vivek Vikram; Chandran, Bala

    2014-01-01

    Interferon-γ inducible factor 16 (IFI16) is a multifunctional nuclear protein involved in transcriptional regulation, induction of interferon-β (IFN-β), and activation of the inflammasome response. It interacts with the sugar-phosphate backbone of dsDNA and modulates viral and cellular transcription through largely undetermined mechanisms. IFI16 is a restriction factor for human cytomegalovirus (HCMV) and herpes simplex virus (HSV-1), though the mechanisms of HSV-1 restriction are not yet understood. Here, we show that IFI16 has a profound effect on HSV-1 replication in human foreskin fibroblasts, osteosarcoma cells, and breast epithelial cancer cells. IFI16 knockdown increased HSV-1 yield 6-fold and IFI16 overexpression reduced viral yield by over 5-fold. Importantly, HSV-1 gene expression, including the immediate early proteins, ICP0 and ICP4, the early proteins, ICP8 and TK, and the late proteins gB and Us11, was reduced in the presence of IFI16. Depletion of the inflammasome adaptor protein, ASC, or the IFN-inducing transcription factor, IRF-3, did not affect viral yield. ChIP studies demonstrated the presence of IFI16 bound to HSV-1 promoters in osteosarcoma (U2OS) cells and fibroblasts. Using CRISPR gene editing technology, we generated U2OS cells with permanent deletion of IFI16 protein expression. ChIP analysis of these cells and wild-type (wt) U2OS demonstrated increased association of RNA polymerase II, TATA binding protein (TBP) and Oct1 transcription factors with viral promoters in the absence of IFI16 at different times post infection. Although IFI16 did not alter the total histone occupancy at viral or cellular promoters, its absence promoted markers of active chromatin and decreased those of repressive chromatin with viral and cellular gene promoters. Collectively, these studies for the first time demonstrate that IFI16 prevents association of important transcriptional activators with wt HSV-1 promoters and suggest potential mechanisms of IFI16

  13. Replication stress interferes with histone recycling and predeposition marking of new histones.

    PubMed

    Jasencakova, Zuzana; Scharf, Annette N D; Ask, Katrine; Corpet, Armelle; Imhof, Axel; Almouzni, Geneviève; Groth, Anja

    2010-03-12

    To restore chromatin on new DNA during replication, recycling of histones evicted ahead of the fork is combined with new histone deposition. The Asf1 histone chaperone, which buffers excess histones under stress, is a key player in this process. Yet how histones handled by human Asf1 are modified remains unclear. Here we identify marks on histones H3-H4 bound to Asf1 and changes induced upon replication stress. In S phase, distinct cytosolic and nuclear Asf1b complexes show ubiquitous H4K5K12diAc and heterogeneous H3 marks, including K9me1, K14ac, K18ac, and K56ac. Upon acute replication arrest, the predeposition mark H3K9me1 and modifications typical of chromatin accumulate in Asf1 complexes. In parallel, ssDNA is generated at replication sites, consistent with evicted histones being trapped with Asf1. During recovery, histones stored with Asf1 are rapidly used as replication resumes. This shows that replication stress interferes with predeposition marking and histone recycling with potential impact on epigenetic stability.

  14. Mapping post-translational modifications of mammalian testicular specific histone variant TH2B in tetraploid and haploid germ cells and their implications on the dynamics of nucleosome structure.

    PubMed

    Pentakota, Satya Krishna; Sandhya, Sankaran; P Sikarwar, Arun; Chandra, Nagasuma; Satyanarayana Rao, Manchanahalli R

    2014-12-01

    Histones regulate a variety of chromatin templated events by their post-translational modifications (PTMs). Although there are extensive reports on the PTMs of canonical histones, the information on the histone variants remains very scanty. Here, we report the identification of different PTMs, such as acetylation, methylation, and phosphorylation of a major mammalian histone variant TH2B. Our mass spectrometric analysis has led to the identification of both conserved and unique modifications across tetraploid spermatocytes and haploid spermatids. We have also computationally derived the 3-dimensional model of a TH2B containing nucleosome in order to study the spatial orientation of the PTMs identified and their effect on nucleosome stability and DNA binding potential. From our nucleosome model, it is evident that substitution of specific amino acid residues in TH2B results in both differential histone-DNA and histone-histone contacts. Furthermore, we have also observed that acetylation on the N-terminal tail of TH2B weakens the interactions with the DNA. These results provide direct evidence that, similar to somatic H2B, the testis specific histone TH2B also undergoes multiple PTMs, suggesting the possibility of chromatin regulation by such covalent modifications in mammalian male germ cells.

  15. A novel histone deacetylase inhibitor Chidamide induces apoptosis of human colon cancer cells

    SciTech Connect

    Liu, Lin; Chen, Baoan; Qin, Shukui; Li, Suyi; He, Xiangming; Qiu, Shaomin; Zhao, Wei; Zhao, Hong

    2010-02-05

    Many studies have demonstrated that histone deacetylase (HDAC) inhibitors induce various tumor cells to undergo apoptosis, and such inhibitors have been used in different clinical trials against different human cancers. In this study, we designed and synthesized a novel HDAC inhibitor, Chidamide. We showed that Chidamide was able to increase the acetylation levels of histone H3 and to inhibit the PI3K/Akt and MAPK/Ras signaling pathways, which resulted in arresting colon cancer cells at the G1 phase of the cell cycle and promoting apoptosis. As a result, the proliferation of colon cancer cells was suppressed in vitro. Our data support the potential application of Chidamide as an anticancer agent in treating colon cancer. Future studies are needed to demonstrate its in vivo efficacy.

  16. Recruitment and biological consequences of histone modification of H3K27me3 and H3K9me3.

    PubMed

    Kim, Joomyeong; Kim, Hana

    2012-01-01

    Two histone marks, H3K27me3 and H3K9me3, are well known for their repressive roles in the genic and nongenic regions of metazoan genomes. Several protein complexes are known to be responsible for generating these marks, including polycomb repression complex 2 and several H3K9 methylases. Recent studies have shown that the targeting of these histone-modifying complexes within mammalian genomes may be mediated through several DNA-binding proteins, including AEBP2, JARID2, and YY1. In this review, we discuss the potential targeting mechanisms in light of the recent results that have been derived from genome-wide chromatin immunoprecipitation sequencing data and the in vivo functions of these two histone marks in light of the results derived from mouse and human genetic studies.

  17. Proportions of H1 histone subspecies in human fibroblasts shift during density-dependent growth arrest independent of replicative senescence.

    PubMed

    Houde, M; Shmookler Reis, R J; Goldstein, S

    1989-09-01

    H1 histone subspecies have been reported to vary during tissue differentiation, during aging of mammalian tissues, and as a function of DNA replicative activity. Since cultured human fibroblasts have a limited replicative life span which features arrest in the G1 phase of the cell cycle, we sought to distinguish whether any changes in the proportions of the principal H1 histone subspecies (H1A, H1B, and H1o) in late-passage fibroblasts were specific for senescent loss of replicative potential, or rather ensued as a result of prolonged inhibition of cell division. We observed an identical shift in the proportions of H1 histone subspecies during prolonged density-dependent inhibition of growth in both early-passage and late-passage cells. Since under these conditions there were no passage-specific changes, replicative senescence of human fibroblasts does not appear to involve a defect in the control of H1 histone proportions.

  18. Trimethylation of Histone H3 Lysine 36 by Human Methyltransferase PRDM9 Protein*

    PubMed Central

    Eram, Mohammad S.; Bustos, Susan P.; Lima-Fernandes, Evelyne; Siarheyeva, Alena; Senisterra, Guillermo; Hajian, Taraneh; Chau, Irene; Duan, Shili; Wu, Hong; Dombrovski, Ludmila; Schapira, Matthieu; Arrowsmith, Cheryl H.; Vedadi, Masoud

    2014-01-01

    PRDM9 (PR domain-containing protein 9) is a meiosis-specific protein that trimethylates H3K4 and controls the activation of recombination hot spots. It is an essential enzyme in the progression of early meiotic prophase. Disruption of the PRDM9 gene results in sterility in mice. In human, several PRDM9 SNPs have been implicated in sterility as well. Here we report on kinetic studies of H3K4 methylation by PRDM9 in vitro indicating that PRDM9 is a highly active histone methyltransferase catalyzing mono-, di-, and trimethylation of the H3K4 mark. Screening for other potential histone marks, we identified H3K36 as a second histone residue that could also be mono-, di-, and trimethylated by PRDM9 as efficiently as H3K4. Overexpression of PRDM9 in HEK293 cells also resulted in a significant increase in trimethylated H3K36 and H3K4 further confirming our in vitro observations. Our findings indicate that PRDM9 may play critical roles through H3K36 trimethylation in cells. PMID:24634223

  19. Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men

    PubMed Central

    Hammoud, Saher Sue; Nix, David A.; Hammoud, Ahmad O.; Gibson, Mark; Cairns, Bradley R.; Carrell, Douglas T.

    2011-01-01

    BACKGROUND The sperm chromatin of fertile men retains a small number of nucleosomes that are enriched at developmental gene promoters and imprinted gene loci. This unique chromatin packaging at certain gene promoters provides these genomic loci the ability to convey instructive epigenetic information to the zygote, potentially expanding the role and significance of the sperm epigenome in embryogenesis. We hypothesize that changes in chromatin packaging may be associated with poor reproductive outcome. METHODS Seven patients with reproductive dysfunction were recruited: three had unexplained poor embryogenesis during IVF and four were diagnosed with male infertility and previously shown to have altered protamination. Genome-wide analysis of the location of histones and histone modifications was analyzed by isolation and purification of DNA bound to histones and protamines. The histone-bound fraction of DNA was analyzed using high-throughput sequencing, both initially and following chromatin immunoprecipitation. The protamine-bound fraction was hybridized to agilent arrays. DNA methylation was examined using bisulfite sequencing. RESULTS Unlike fertile men, five of seven infertile men had non-programmatic (randomly distributed) histone retention genome-wide. Interestingly, in contrast to the total histone pool, the localization of H3 Lysine 4 methylation (H3K4me) or H3 Lysine 27 methylation (H3K27me) was highly similar in the gametes of infertile men compared with fertile men. However, there was a reduction in the amount of H3K4me or H3K27me retained at developmental transcription factors and certain imprinted genes. Finally, the methylation status of candidate developmental promoters and imprinted loci were altered in a subset of the infertile men. CONCLUSIONS This initial genome-wide analysis of epigenetic markings in the sperm of infertile men demonstrates differences in composition and epigenetic markings compared with fertile men, especially at certain imprinted

  20. Alternation of histone and DNA methylation in human atherosclerotic carotid plaques.

    PubMed

    Greißel, A; Culmes, M; Napieralski, R; Wagner, E; Gebhard, H; Schmitt, M; Zimmermann, A; Eckstein, H-H; Zernecke, A; Pelisek, J

    2015-08-01

    Little is known about epigenetics and its possible role in atherosclerosis. We here analysed histone and DNA methylation and the expression of corresponding methyltransferases in early and advanced human atherosclerotic carotid lesions in comparison to healthy carotid arteries. Western Blotting was performed on carotid plaques from our biobank with early (n=60) or advanced (n=60) stages of atherosclerosis and healthy carotid arteries (n=12) to analyse di-methylation patterns of histone H3 at positions K4, K9 and K27. In atherosclerotic lesions, di-methylation of H3K4 was unaltered and that of H3K9 and H3K27 significantly decreased compared to control arteries. Immunohistochemistry revealed an increased appearance of di-methylated H3K4 in smooth muscle cells (SMCs), a decreased expression of di-methylated H3K9 in SMCs and inflammatory cells, and reduced di-methylated H3K27 in inflammatory cells in advanced versus early atherosclerosis. Expression of corresponding histone methyltransferases MLL2 and G9a was increased in advanced versus early atherosclerosis. Genomic DNA hypomethylation, as determined by PCR for methylated LINE1 and SAT-alpha, was observed in early and advanced plaques compared to control arteries and in cell-free serum of patients with high-grade carotid stenosis compared to healthy volunteers. In contrast, no differences in DNA methylation were observed in blood cells. Expression of DNA-methyltransferase DNMT1 was reduced in atherosclerotic plaques versus controls, DNMT3A was undetectable, and DNMT3B not altered. DNA-demethylase TET1 was increased in atherosclerosisc plaques. The extent of histone and DNA methylation and expression of some corresponding methyltransferases are significantly altered in atherosclerosis, suggesting a possible contribution of epigenetics in disease development. PMID:25993995

  1. H3K79me3T80ph is a Novel Histone Dual Modification and a Mitotic Indicator in Melanoma

    PubMed Central

    Martinez, Danielle R.; Richards, Hunter W.; Lin, Qiushi; Torres-Cabala, Carlos A.; Prieto, Victor G.; Curry, Jonathan L.; Medrano, Estela E.

    2012-01-01

    The current study characterizes the mitosis-associated histone dual modification on the core of histone H3: trimethylation of histone H3 lysine 79 and simultaneous phosphorylation of H3 threonine 80 (H3K79me3T80ph). Through the use of protein and microscopy-based techniques, we find that H3K79me3T80ph shares a similar spatial and temporal regulation as H3S10ph but additionally requires methyltransferase activity. In addition, we find that Aurora kinase activity is necessary for the catalysis of H3K79me3T80ph in vivo. Finally, our analysis of H3K79me3T80ph using a tissue microarray indicates that H3K79me3T80ph marks a subset of primary cutaneous melanomas with metastatic potential indicating that H3K79me3T80ph may identify a subset of invasive melanomas with a more aggressive clinical behaviour. PMID:23227340

  2. Structure of human nucleosome containing the testis-specific histone variant TSH2B

    SciTech Connect

    Urahama, Takashi; Horikoshi, Naoki; Osakabe, Akihisa; Tachiwana, Hiroaki; Kurumizaka, Hitoshi

    2014-03-25

    The crystal structure of human nucleosome containing the testis-specific TSH2B variant has been determined. The TSH2B Ser85 residue does not interact with H4 in the nucleosome, and induces a local structural difference between TSH2B and H2B in nucleosomes. The human histone H2B variant TSH2B is highly expressed in testis and may function in the chromatin transition during spermatogenesis. In the present study, the crystal structure of the human testis-specific nucleosome containing TSH2B was determined at 2.8 Å resolution. A local structural difference between TSH2B and canonical H2B in nucleosomes was detected around the TSH2B-specific amino-acid residue Ser85. The TSH2B Ser85 residue does not interact with H4 in the nucleosome, but in the canonical nucleosome the H2B Asn84 residue (corresponding to the TSH2B Ser85 residue) forms water-mediated hydrogen bonds with the H4 Arg78 residue. In contrast, the other TSH2B-specific amino-acid residues did not induce any significant local structural changes in the TSH2B nucleosome. These findings may provide important information for understanding how testis-specific histone variants form nucleosomes during spermatogenesis.

  3. Analysis of gene expression and histone modification between C4 and non-C4 homologous genes of PPDK and PCK in maize.

    PubMed

    Dong, Xiu-Mei; Li, Yuan; Chao, Qing; Shen, Jie; Gong, Xiu-Jie; Zhao, Biligen-Gaowa; Wang, Bai-Chen

    2016-07-01

    More efficient photosynthesis has allowed C4 plants to adapt to more diverse ecosystems (such as hot and arid conditions) than C3 plants. To better understand C4 photosynthesis, we investigated the expression patterns of C4 genes (C4PPDK and PCK1) and their non-C4 homologous genes (CyPPDK1, CyPPDK2, and PCK2) in the different organs of maize (Zea mays). Both C4 genes and non-C4 genes showed organ-dependent expression patterns. The mRNA levels of C4 genes were more abundant in leaf organ than in seeds at 25 days after pollination (DAP), while non-C4 genes were mainly expressed in developing seeds. Further, acetylation of histone H3 lysine 9 (H3K9ac) positively correlates with mRNA levels of C4 genes (C4PPDK and PCK1) in roots, stems, leaves, and seeds at 25 DAP, acetylation of histone H4 lysine 5 (H4K5ac) in the promoter regions of both C4 (C4PPDK and PCK1) and non-C4 genes (CyPPDK1, CyPPDK2, and PCK2) correlated well with their transcripts abundance in stems. In photosynthetic organs (stems and leaves), dimethylation of histone H3 lysine 9 (H3K9me2) negatively correlated with mRNA levels of both C4 and non-C4 genes. Taken together, our data suggest that histone modification was involved in the transcription regulation of both C4 genes and non-C4 genes, which might provide a clue of the functional evolution of C4 genes. PMID:27161567

  4. Extent of histone modifications and H1/sup 0/ content during cell cycle progression in the presence of butyrate

    SciTech Connect

    D'Anna, J.A.; Gurley, L.R.; Tobey, R.A.

    1983-01-01

    The effects of butyrate upon the extents of phosphorylation of histones H1 and H1/sup 0/ during cell-cycle progression have been investigated. Chinese hamster (line CHO) cells were synchronized in early S phase and released into medium containing 0 or 15 mM butyrate to resume cell-cycle traverse into G1 of the next cell cycle. Cells were also mechanically selected from monolayer cultures grown in the presence of colcemid and 0 or 15 mM butyrate to obtain >98% pure populations of metaphase cells. Although cell cycle progression is altered by butyrate, electrophoretic patterns of histones H1, H1/sup 0/, H3, and H4 indicate that butyrate has little, if any, effect on the extents of H1 and H1/sup 0/ phosphorylation during the cell cycle or the mitotic-specific phosphorylation of histone H3. Butyrate does, however, inhibit removal of extraordinary levels of histone H4 acetylation (hyperacetylation) during metaphase, and it appears to cause an increase in the content of H1/sup 0/ in chromatin during the S or G2 phases of the cell cycle. 38 references, 4 figures, 1 table.

  5. Resveratrol induces human keratinocyte damage via the activation of class III histone deacetylase, Sirt1.

    PubMed

    Lee, Ju-Hee; Kim, Jin-Shang; Park, Sang-Youel; Lee, You-Jin

    2016-01-01

    Human skin diseases are various and induce chronic inflammatory disorders, including psoriasis, atopic dermatitis and certain forms of ichthyosis. Psoriasis is a chronic inflammatory skin disease characterized by circumscribed, red, thickened plaques. Regulation of the balance between growth, differentiation and death is critical to keratinocytes; when altered, epidermal keratinocytes undergo hyperproliferation, abnormal differentiation and inflammatory infiltration. In the present study, we focused on the effects of resveratrol, found in red wine and peanuts, on the cell death of keratinocytes. We additionally studied the mechanism of resveratrol on Sirt1, a class III histone deacetylase, and Akt phosphorylation. Resveratrol caused apoptosis and increased Sirt1 expression in human HaCaT keratinocytes, following a decrease in the p62 protein level. Inhibition of Sirt1 by Sirt1 inhibitor restored cell viability and protein levels. Furthermore, we showed that resveratrol-induced Sirt1 blocked Akt phosphorylation. The present results indicated that resveratrol inhibited the Akt pathways by inducing Sirt1, thus leading to cell death. These data suggest that resveratrol-mediated activation of Sirt1 histone deacetylase may be a potential therapeutic target for skin diseases including psoriasis.

  6. Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats.

    PubMed

    Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

    2016-01-01

    Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14-21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

  7. Mice lacking Sμ tandem repeats maintain RNA polymerase patterns but exhibit histone modification pattern shifts linked to class switch site locations.

    PubMed

    Balter, Barbara B; Ciccone, David N; Oettinger, Marjorie A; Selsing, Erik

    2012-08-01

    Antibody switching involves class switch recombination (CSR) events between switch (S) regions located upstream of heavy chain constant (C) genes. Mechanisms targeting CSR to S-regions are not clear. Deletion of Sμ tandem repeat (SμTR) sequences causes CSR to shift into downstream regions that do not undergo CSR in WT B-cells, including the Cμ-region. We now find that, in SμTR(-/-) B cells, Sμ chromatin histone modification patterns also shift downstream relative to WT and coincide with SμTR(-/-) CSR locations. Our results suggest that histone H3 acetylation and methylation are involved in accessibility of switch regions and that these modifications are not dependent on the underlying sequence, but may be controlled by the location of upstream promoter or regulatory elements. Our studies also show RNA polymerase II (RNAPII) loading increases in the Eμ/Iμ region in stimulated B cells; these increases are independent of SμTR sequences. Longer Sμ deletions have been reported to eliminate increases in RNAPII density, therefore we suggest that sequences between Iμ and Sμ (possibly the Iμ splicing region as well as G-tracts that are involved in stable RNA:DNA complex formation during transcription) might control the RNAPII density increases.

  8. Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

    PubMed Central

    Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

    2016-01-01

    Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

  9. Potential Role of Epithelial Cell-Derived Histone H1 Proteins in Innate Antimicrobial Defense in the Human Gastrointestinal Tract

    PubMed Central

    Rose, F. R. A. J.; Bailey, K.; Keyte, J. W.; Chan, W. C.; Greenwood, D.; Mahida, Y. R.

    1998-01-01

    In the human gastrointestinal tract, microorganisms are present in large numbers in the colon but are sparse in the proximal small intestine. In this study, we have shown that acid extracts of fresh human terminal ileal mucosal samples mediate antimicrobial activity. Following cation-exchange chromatography, one of the eluted fractions demonstrated antibacterial activity against bacteria normally resident in the human colonic lumen. This activity was further fractionated by reverse-phase high-performance liquid chromatography and identified as histone H1 and its fragments. We have also shown that in tissue sections, immunoreactive histone H1 is present in the cytoplasm of villus epithelial cells. In vitro culturing of detached (from the basement membrane) villus epithelial cells led to the release of antimicrobial histone H1 proteins, while the cells demonstrated ultrastructural features of programmed cell death. Our studies suggest that cytoplasmic histone H1 may provide protection against penetration by microorganisms into villus epithelial cells. Moreover, intestinal epithelial cells released into the lumen may mediate antimicrobial activity by releasing histone H1 proteins and their fragments. PMID:9632593

  10. MRG15 activates the cdc2 promoter via histone acetylation in human cells

    SciTech Connect

    Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.

    2011-07-01

    Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

  11. Histone lysine crotonylation during acute kidney injury in mice

    PubMed Central

    Ruiz-Andres, Olga; Sanchez-Niño, Maria Dolores; Cannata-Ortiz, Pablo; Ruiz-Ortega, Marta; Egido, Jesus; Ortiz, Alberto; Sanz, Ana Belen

    2016-01-01

    ABSTRACT Acute kidney injury (AKI) is a potentially lethal condition for which no therapy is available beyond replacement of renal function. Post-translational histone modifications modulate gene expression and kidney injury. Histone crotonylation is a recently described post-translational modification. We hypothesized that histone crotonylation might modulate kidney injury. Histone crotonylation was studied in cultured murine proximal tubular cells and in kidneys from mice with AKI induced by folic acid or cisplatin. Histone lysine crotonylation was observed in tubular cells from healthy murine and human kidney tissue. Kidney tissue histone crotonylation increased during AKI. This was reproduced by exposure to the protein TWEAK in cultured tubular cells. Specifically, ChIP-seq revealed enrichment of histone crotonylation at the genes encoding the mitochondrial biogenesis regulator PGC-1α and the sirtuin-3 decrotonylase in both TWEAK-stimulated tubular cells and in AKI kidney tissue. To assess the role of crotonylation in kidney injury, crotonate was used to increase histone crotonylation in cultured tubular cells or in the kidneys in vivo. Crotonate increased the expression of PGC-1α and sirtuin-3, and decreased CCL2 expression in cultured tubular cells and healthy kidneys. Systemic crotonate administration protected from experimental AKI, preventing the decrease in renal function and in kidney PGC-1α and sirtuin-3 levels as well as the increase in CCL2 expression. For the first time, we have identified factors such as cell stress and crotonate availability that increase histone crotonylation in vivo. Overall, increasing histone crotonylation might have a beneficial effect on AKI. This is the first observation of the in vivo potential of the therapeutic manipulation of histone crotonylation in a disease state. PMID:27125278

  12. ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome

    SciTech Connect

    Iwase, Shigeki; Xiang, Bin; Ghosh, Sharmistha; Ren, Ting; Lewis, Peter W.; Cochrane, Jesse C.; Allis, C. David; Picketts, David J.; Patel, Dinshaw J.; Li, Haitao; Shi, Yang

    2011-07-19

    ATR-X (alpha-thalassemia/mental retardation, X-linked) syndrome is a human congenital disorder that causes severe intellectual disabilities. Mutations in the ATRX gene, which encodes an ATP-dependent chromatin-remodeler, are responsible for the syndrome. Approximately 50% of the missense mutations in affected persons are clustered in a cysteine-rich domain termed ADD (ATRX-DNMT3-DNMT3L, ADD{sub ATRX}), whose function has remained elusive. Here we identify ADD{sub ATRX} as a previously unknown histone H3-binding module, whose binding is promoted by lysine 9 trimethylation (H3K9me3) but inhibited by lysine 4 trimethylation (H3K4me3). The cocrystal structure of ADD{sub ATRX} bound to H3{sub 1-15}K9me3 peptide reveals an atypical composite H3K9me3-binding pocket, which is distinct from the conventional trimethyllysine-binding aromatic cage. Notably, H3K9me3-pocket mutants and ATR-X syndrome mutants are defective in both H3K9me3 binding and localization at pericentromeric heterochromatin; thus, we have discovered a unique histone-recognition mechanism underlying the ATR-X etiology.

  13. ATRX ADD Domain Links an Atypical Histone Methylation Recognition Mechanism to Human Mental-Retardation Syndrome

    SciTech Connect

    S Iwase; B Xiang; S Ghosh; T Ren; P Lewis; J Cochrane; C Allis; D Picketts; D Patel; et al.

    2011-12-31

    ATR-X (alpha-thalassemia/mental retardation, X-linked) syndrome is a human congenital disorder that causes severe intellectual disabilities. Mutations in the ATRX gene, which encodes an ATP-dependent chromatin-remodeler, are responsible for the syndrome. Approximately 50% of the missense mutations in affected persons are clustered in a cysteine-rich domain termed ADD (ATRX-DNMT3-DNMT3L, ADD{sub ATRX}), whose function has remained elusive. Here we identify ADD{sub ATRX} as a previously unknown histone H3-binding module, whose binding is promoted by lysine 9 trimethylation (H3K9me3) but inhibited by lysine 4 trimethylation (H3K4me3). The cocrystal structure of ADD{sub ATRX} bound to H3{sub 1-15}K9me3 peptide reveals an atypical composite H3K9me3-binding pocket, which is distinct from the conventional trimethyllysine-binding aromatic cage. Notably, H3K9me3-pocket mutants and ATR-X syndrome mutants are defective in both H3K9me3 binding and localization at pericentromeric heterochromatin; thus, we have discovered a unique histone-recognition mechanism underlying the ATR-X etiology.

  14. Mass Spectrometric Analysis of Histone Proteoforms

    NASA Astrophysics Data System (ADS)

    Yuan, Zuo-Fei; Arnaudo, Anna M.; Garcia, Benjamin A.

    2014-06-01

    Histones play important roles in chromatin, in the forms of various posttranslational modifications (PTMs) and sequence variants, which are called histone proteoforms. Investigating modifications and variants is an ongoing challenge. Previous methods are based on antibodies, and because they usually detect only one modification at a time, they are not suitable for studying the various combinations of modifications on histones. Fortunately, mass spectrometry (MS) has emerged as a high-throughput technology for histone analysis and does not require prior knowledge about any modifications. From the data generated by mass spectrometers, both identification and quantification of modifications, as well as variants, can be obtained easily. On the basis of this information, the functions of histones in various cellular contexts can be revealed. Therefore, MS continues to play an important role in the study of histone proteoforms. In this review, we discuss the analysis strategies of MS, their applications on histones, and some key remaining challenges.

  15. Mass Spectrometric Analysis of Histone Proteoforms

    PubMed Central

    Yuan, Zuo-Fei; Arnaudo, Anna M.; Garcia, Benjamin A.

    2014-01-01

    Histones play important roles in chromatin, due to various post-translational modifications and sequence variants, which are called histone proteoforms. Investigating modifications and variants is an on-going challenge. Previous methods are based on antibodies and because they usually detect only one modification at a time, they are not suitable to study the various combinations of modifications on histones. Fortunately, mass spectrometry has emerged as a high-throughput technology for histone analysis and does not require prior knowledge about any modifications. From the data generated by mass spectrometers, both identification and quantification of modifications and variants can be easily obtained. Based on this information, the functions of histones in various cellular contexts can be revealed. Therefore, mass spectrometry continues to play an important role in the study of histone proteoforms. In this review, we will discuss the analysis strategies of mass spectrometry, their applications on histones, and some key remaining challenges. PMID:24896311

  16. Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

    PubMed

    Legartová, Soňa; Kozubek, Stanislav; Franek, Michal; Zdráhal, Zbyněk; Lochmanová, Gabriela; Martinet, Nadine; Bártová, Eva

    2014-04-01

    Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

  17. Nucleosome-specific, time-dependent changes in histone modifications during activation of the early growth response 1 (Egr1) gene.

    PubMed

    Riffo-Campos, Ángela L; Castillo, Josefa; Tur, Gema; González-Figueroa, Paula; Georgieva, Elena I; Rodríguez, José L; López-Rodas, Gerardo; Rodrigo, M Isabel; Franco, Luis

    2015-01-01

    Histone post-translational modifications and nucleosome remodeling are coordinate events involved in eukaryotic transcriptional regulation. There are relatively few data on the time course with which these events occur in individual nucleosomes. As a contribution to fill this gap, we first describe the nature and time course of structural changes in the nucleosomes -2, -1, and +1 of the murine Egr1 gene upon induction. To initiate the transient activation of the gene, we used the stimulation of MLP29 cells with phorbol esters and the in vivo activation after partial hepatectomy. In both models, nucleosomes -1 and +1 are partially evicted, whereas nucleosomes +1 and -2 slide downstream during transcription. The sliding of the latter nucleosome allows the EGR1 protein to bind its site, resulting in the repression of the gene. To decide whether EGR1 is involved in the sliding of nucleosome -2, Egr1 was knocked down. In the absence of detectable EGR1, the nucleosome still slides and remains downstream longer than in control cells, suggesting that the product of the gene may be rather involved in the returning of the nucleosome to the basal position. Moreover, the presence of eight epigenetic histone marks has been determined at a mononucleosomal level in that chromatin region. H3S10phK14ac, H3K4me3, H3K9me3, and H3K27me3 are characteristic of nucleosome +1, and H3K9ac and H4K16ac are mainly found in nucleosome -1, and H3K27ac predominates in nucleosomes -2 and -1. The temporal changes in these marks suggest distinct functions for some of them, although changes in H3K4me3 may result from histone turnover.

  18. Human fibroblast commitment to a senescence-like state in response to histone deacetylase inhibitors is cell cycle dependent.

    PubMed Central

    Ogryzko, V V; Hirai, T H; Russanova, V R; Barbie, D A; Howard, B H

    1996-01-01

    Human diploid fibroblasts (HDF) complete a limited number of cell divisions before entering a growth arrest state that is termed replicative senescence. Two histone deacetylase inhibitors, sodium butyrate and trichostatin A, dramatically reduce the HDF proliferative life span in a manner that is dependent on one or more cell doublings in the presence of these agents. Cells arrested and subsequently released from histone deacetylase inhibitors display markers of senescence and exhibit a persistent G1 block but remain competent to initiate a round of DNA synthesis in response to simian virus 40 T antigen. Average telomere length in prematurely arrested cells is greater than in senescent cells, reflecting a lower number of population doublings completed by the former. Taken together, these results support the view that one component of HDF senescence mimics a cell cycle-dependent drift in differentiation state and that propagation of HDF in histone deacetylase inhibitors accentuates this component. PMID:8756678

  19. Genetic Modification of Preimplantation Embryos: Toward Adequate Human Research Policies

    PubMed Central

    Dresser, Rebecca

    2004-01-01

    Citing advances in transgenic animal research and setbacks in human trials of somatic cell genetic interventions, some scientists and others want to begin planning for research involving the genetic modification of human embryos. Because this form of genetic modification could affect later-born children and their offspring, the protection of human subjects should be a priority in decisions about whether to proceed with such research. Yet because of gaps in existing federal policies, embryo modification proposals might not receive adequate scientific and ethical scrutiny. This article describes current policy shortcomings and recommends policy actions designed to ensure that the investigational genetic modification of embryos meets accepted standards for research on human subjects. PMID:15016248

  20. Differential mRNA Expression Levels of Human Histone-Modifying Enzymes in Normal Karyotype B Cell Pediatric Acute Lymphoblastic Leukemia

    PubMed Central

    Tao, Yan-Fang; Pang, Li; Du, Xiao-Juan; Sun, Li-Chao; Hu, Shao-Yan; Lu, Jun; Cao, Lan; Zhao, Wen-Li; Feng, Xing; Wang, Jian; Wu, Dong; Wang, Na; Ni, Jian; Pan, Jian

    2013-01-01

    Histone modification enzymes regulate gene expression by altering the accessibility of promoters to transcription factors. We sought to determine whether the genes encoding histone modification enzymes are dysregulated in pediatric acute lymphoblastic leukemia (ALL). A real-time PCR array was designed, tested and used to profile the expression of 85 genes encoding histone modification enzymes in bone marrow mononuclear cells from 30 pediatric ALL patients and 20 normal controls. The expression profile of histone-modifying genes was significantly different between normal karyotype B cell pediatric ALL and normal controls. Eleven genes were upregulated in pediatric ALL, including the histone deacetylases HDAC2 and PAK1, and seven genes were downregulated, including PRMT2 and the putative tumor suppressor EP300. Future studies will seek to determine whether these genes serve as biomarkers of pediatric ALL. Ingenuity Pathway Analysis revealed that Gene Expression and Organ Morphology was the highest rated network, with 13 focus molecules (significance score = 35). Ingenuity Pathway Analysis also indicated that curcumin and miR-34 are upstream regulators of histone-modifying enzymes; future studies will seek to validate these results and examine the role of curcumin and miR-34 in leukemia. This study provides new clues into the molecular mechanisms of pediatric ALL. PMID:23389039

  1. Multifaceted Histone H3 Methylation and Phosphorylation Readout by the Plant Homeodomain Finger of Human Nuclear Antigen Sp100C.

    PubMed

    Zhang, Xiaojie; Zhao, Dan; Xiong, Xiaozhe; He, Zhimin; Li, Haitao

    2016-06-10

    The decoding of histone post-translational modifications by chromatin-binding modules ("readers") constitutes one major mechanism of epigenetic regulation. Nuclear antigen Sp100 (SPECKLED, 100 kDa), a constitutive component of the promyelocytic leukemia nuclear bodies, plays key roles in intrinsic immunity and transcriptional repression. Sp100C, a splicing isoform specifically up-regulated upon interferon stimulation, harbors a unique tandem plant homeodomain (PHD) finger and bromodomain at its C terminus. Combining structural, quantitative binding, and cellular co-localization studies, we characterized Sp100C PHD finger as an unmethylated histone H3 Lys(4) (H3K4me0) reader that tolerates histone H3 Thr(3) phosphorylation (H3T3ph), histone H3 Lys(9) trimethylation (H3K9me3), and histone H3 Ser(10) phosphorylation (H3S10ph), hallmarks associated with the mitotic chromosome. In contrast, whereas H3K4me0 reader activity is conserved in Sp140, an Sp100C paralog, the multivalent tolerance of H3T3ph, H3K9me3, and H3S10ph was lost for Sp140. The complex structure determined at 2.1 Å revealed a highly coordinated lysine ϵ-amine recognition sphere formed by an extended N-terminal motif for H3K4me0 readout. Interestingly, reader pocket rigidification by disulfide bond formation enhanced H3K4me0 binding by Sp100C. An additional complex structure solved at 2.7 Å revealed that H3T3ph is recognized by the arginine residue, Arg(713), that is unique to the PHD finger of Sp100C. Consistent with a restrictive cellular role of Sp100C, these results establish a direct chromatin targeting function of Sp100C that may regulate transcriptional gene silencing and promyelocytic leukemia nuclear body-mediated intrinsic immunity in response to interferon stimulation. PMID:27129259

  2. Genome-wide analysis of the rat colon reveals proximal-distal differences in histone modifications and proto-oncogene expression.

    PubMed

    Triff, Karen; Konganti, Kranti; Gaddis, Sally; Zhou, Beiyan; Ivanov, Ivan; Chapkin, Robert S

    2013-12-15

    Since disease susceptibility of the intestine exhibits an anatomical bias, we propose that the chromatin landscape, especially the site-specific epigenetic differences in histone modification patterns throughout the colonic longitudinal axis, contributes to the differential incidence of site-specific pathology. To test this hypothesis, we assessed the chromatin structure associated with gene expression profiles in the rat proximal and distal colon by globally correlating chromatin immunoprecipitation next-generation sequencing analysis (ChIP-Seq) with mRNA transcription (RNA-Seq) data. Crypts were isolated from the proximal and distal colonic regions from rats maintained on a semipurified diet, and mRNA gene expression profiles were generated by RNA-Seq. The remaining isolated crypts were formaldehyde-cross-linked and chromatin immunoprecipitated with antibodies against H3K4me3, H3K9me3, and RNA polymerase II. Globally, RNA-Seq results indicate that 9,866 genes were actively expressed, of which 540 genes were differentially expressed between the proximal and distal colon. Gene ontology analysis indicates that crypt location significantly affected both chromatin and transcriptional regulation of genes involved in enterocyte movement, lipid metabolism, lymphatic development, and immune cell trafficking. Gene function analysis indicates that the PI3-kinase signaling pathway was regulated in a site-specific manner, e.g., proto-oncogenes, JUN, FOS, and ATF, were upregulated in the distal colon. Middle and long noncoding RNAs (lncRNAs) were also detected in the colon, including select lncRNAs formerly only detected in the rat nervous system. In summary, distinct combinatorial patterns of histone modifications exist in the proximal versus distal colon. These site-specific differences may explain the differential effects of chemoprotective agents on cell transformation in the ascending (proximal) and descending (distal) colon.

  3. Genome-wide analysis of the rat colon reveals proximal-distal differences in histone modifications and proto-oncogene expression

    PubMed Central

    Triff, Karen; Konganti, Kranti; Gaddis, Sally; Zhou, Beiyan; Ivanov, Ivan

    2013-01-01

    Since disease susceptibility of the intestine exhibits an anatomical bias, we propose that the chromatin landscape, especially the site-specific epigenetic differences in histone modification patterns throughout the colonic longitudinal axis, contributes to the differential incidence of site-specific pathology. To test this hypothesis, we assessed the chromatin structure associated with gene expression profiles in the rat proximal and distal colon by globally correlating chromatin immunoprecipitation next-generation sequencing analysis (ChIP-Seq) with mRNA transcription (RNA-Seq) data. Crypts were isolated from the proximal and distal colonic regions from rats maintained on a semipurified diet, and mRNA gene expression profiles were generated by RNA-Seq. The remaining isolated crypts were formaldehyde-cross-linked and chromatin immunoprecipitated with antibodies against H3K4me3, H3K9me3, and RNA polymerase II. Globally, RNA-Seq results indicate that 9,866 genes were actively expressed, of which 540 genes were differentially expressed between the proximal and distal colon. Gene ontology analysis indicates that crypt location significantly affected both chromatin and transcriptional regulation of genes involved in enterocyte movement, lipid metabolism, lymphatic development, and immune cell trafficking. Gene function analysis indicates that the PI3-kinase signaling pathway was regulated in a site-specific manner, e.g., proto-oncogenes, JUN, FOS, and ATF, were upregulated in the distal colon. Middle and long noncoding RNAs (lncRNAs) were also detected in the colon, including select lncRNAs formerly only detected in the rat nervous system. In summary, distinct combinatorial patterns of histone modifications exist in the proximal versus distal colon. These site-specific differences may explain the differential effects of chemoprotective agents on cell transformation in the ascending (proximal) and descending (distal) colon. PMID:24151245

  4. Histone acetylation may suppress human glioma cell proliferation when p21 WAF/Cip1 and gelsolin are induced.

    PubMed Central

    Kamitani, Hideki; Taniura, Seijiro; Watanabe, Kenji; Sakamoto, Makoto; Watanabe, Takashi; Eling, Thomas

    2002-01-01

    Histone deacetylase inhibitors that increase histone acetylation on transformed cells are being investigated as unique anticancer drugs. The aim of this investigation was to evaluate an antiproliferative activity of the histone deacetylase inhibitors sodium butyrate (NaBT) and trichostatin A on 5 glioma cell lines, T98G, A172, U-87 MG, U-118 MG, and U-373 MG, with the examination of the altered expressions in p21 and gelsolin genes. Treatment with 5-mM NaBT and 40 ng/ml trichostatin A for 48 h caused more than a 50% growth inhibition in 5 cell lines as measured by cell proliferation assays. An increase in histone acetylation was confirmed in each cell line. After treatment with 5 mM NaBT, T98G, A172, and U118 cells undergo apoptosis as indicated by DNA ladder formation. Treatment with NaBT and trichostatin A also decreased DNA synthesis as examined by the fluorescence-activated cell sorting analysis in T98G and U87 cells. In addition to the suppression of cell growth, the up regulation of p21 and gelsolin expression was observed after treatment with NaBT, especially in T98G cells. Maximum expression of p21 and gelsolin was observed within 24 h after treatment. Results from our in vitro studies indicate that the treatment of human glioma cells with one of the histone deacetylase inhibitors suppresses cell growth with decreasing DNA synthesis and stimulates apoptosis, and that associated molecular mechanisms responsible for these effects include increased histone acetylation as well as enhanced expression of p21 and gelsolin. PMID:11916500

  5. Tetraspanin CD9 modulates human lymphoma cellular proliferation via histone deacetylase activity

    SciTech Connect

    Herr, Michael J.; Longhurst, Celia M.; Baker, Benjamin; Homayouni, Ramin; Speich, Henry E.; Kotha, Jayaprakash; Jennings, Lisa K.

    2014-05-16

    Highlights: • CD9 is differentially expressed in human Burkitt’s lymphoma cells. • We found that CD9 expression promotes these cells proliferation. • CD9 expression also increases HDAC activity. • HDAC inhibition decreased both cell proliferation and importantly CD9 expression. • CD9 may dictate HDAC efficacy and play a role in HDAC regulation. - Abstract: Non-Hodgkin Lymphoma (NHL) is a type of hematological malignancy that affects two percent of the overall population in the United States. Tetraspanin CD9 is a cell surface protein that has been thoroughly demonstrated to be a molecular facilitator of cellular phenotype. CD9 expression varies in two human lymphoma cell lines, Raji and BJAB. In this report, we investigated the functional relationship between CD9 and cell proliferation regulated by histone deacetylase (HDAC) activity in these two cell lines. Introduction of CD9 expression in Raji cells resulted in significantly increased cell proliferation and HDAC activity compared to Mock transfected Raji cells. The increase in CD9–Raji cell proliferation was significantly inhibited by HDAC inhibitor (HDACi) treatment. Pretreatment of BJAB cells with HDAC inhibitors resulted in a significant decrease in endogenous CD9 mRNA and cell surface expression. BJAB cells also displayed decreased cell proliferation after HDACi treatment. These results suggest a significant relationship between CD9 expression and cell proliferation in human lymphoma cells that may be modulated by HDAC activity.

  6. Quantitative dissection and stoichiometry determination of the human SET1/MLL histone methyltransferase complexes.

    PubMed

    van Nuland, Rick; Smits, Arne H; Pallaki, Paschalina; Jansen, Pascal W T C; Vermeulen, Michiel; Timmers, H T Marc

    2013-05-01

    Methylation of lysine 4 on histone H3 (H3K4) at promoters is tightly linked to transcriptional regulation in human cells. At least six different COMPASS-like multisubunit (SET1/MLL) complexes that contain methyltransferase activity for H3K4 have been described, but a comprehensive and quantitative analysis of these SET1/MLL complexes is lacking. We applied label-free quantitative mass spectrometry to determine the subunit composition and stoichiometry of the human SET1/MLL complexes. We identified both known and novel, unique and shared interactors and determined their distribution and stoichiometry over the different SET1/MLL complexes. In addition to being a core COMPASS subunit, the Dpy30 protein is a genuine subunit of the NURF chromatin remodeling complex. Furthermore, we identified the Bod1 protein as a discriminator between the SET1B and SET1A complexes, and we show that the H3K36me-interactor Psip1 preferentially binds to the MLL2 complex. Finally, absolute protein quantification in crude lysates mirrors many of the observed SET1/MLL complex stoichiometries. Our findings provide a molecular framework for understanding the diversity and abundance of the different SET1/MLL complexes, which together establish the H3K4 methylation landscape in human cells. PMID:23508102

  7. All-Trans Retinoic Acid and Sodium Butyrate Enhance Natriuretic Peptide Receptor A Gene Transcription: Role of Histone Modification

    PubMed Central

    Kumar, Prerna; Periyasamy, Ramu; Das, Subhankar; Neerukonda, Smitha; Mani, Indra

    2014-01-01

    The objective of the present study was to delineate the mechanisms of GC-A/natriuretic peptide receptor-A (GC-A/NPRA) gene (Npr1) expression in vivo. We used all-trans retinoic acid (ATRA) and histone deacetylase (HDAC) inhibitor, sodium butyrate (NaBu) to examine the expression and function of Npr1 using gene-disrupted heterozygous (1-copy; +/−), wild-type (2-copy; +/+), and gene-duplicated heterozygous (3-copy; ++/+) mice. Npr1+/− mice exhibited increased renal HDAC and reduced histone acetyltransferase (HAT) activity; on the contrary, Npr1++/+ mice showed decreased HDAC and enhanced HAT activity compared with Npr1+/+ mice. ATRA and NaBu promoted global acetylation of histones H3-K9/14 and H4-K12, reduced methylation of H3-K9 and H3-K27, and enriched accumulation of active chromatin marks at the Npr1 promoter. A combination of ATRA-NaBu promoted recruitment of activator-complex containing E26 transformation–specific 1, retinoic acid receptor α, and HATs (p300 and p300/cAMP response element–binding protein-binding protein–associated factor) at the Npr1 promoter, and significantly increased renal NPRA expression, GC activity, and cGMP levels. Untreated 1-copy mice showed significantly increased systolic blood pressure and renal expression of α-smooth muscle actin (α-SMA) and proliferating cell nuclear antigen (PCNA) compared with 2- and 3-copy mice. Treatment with ATRA and NaBu synergistically attenuated the expression of α-SMA and PCNA and reduced systolic blood pressure in Npr1+/− mice. Our findings demonstrate that epigenetic upregulation of Npr1 gene transcription by ATRA and NaBu leads to attenuation of renal fibrotic markers and systolic blood pressure in mice with reduced Npr1 gene copy number, which will have important implications in prevention and treatment of hypertension-related renal pathophysiological conditions. PMID:24714214

  8. Histone H3 Phosphorylation in Human Skin Histoculture as a Tool to Evaluate Patient’s Response to Antiproliferative Drugs

    PubMed Central

    Ugarte, Fernando; Porth, Katherine; Sadekova, Svetlana

    2015-01-01

    Evaluation of patient’s response to chemotherapeutic drugs is often difficult and time consuming. Skin punch biopsies are easily accessible material that can be used for the evaluation of surrogate biomarkers of a patient’s response to a drug. In this study, we hypothesized that assessment of phosphorylated histone H3 in human skin punch biopsies could be used as a pharmacodynamics biomarker of patient’s response to the kinesin spindle protein inhibitor SCH2047069. To test this hypothesis, we used a human skin histoculture technique that allows culturing intact human skin in the presence of the drug. Human melanoma and skin histocultures were treated with SCH2047069, and the effect of the drug was assessed by increasing histone H3 phosphorylation using immunohistochemistry. Our results demonstrate that SCH2047069 has a significant effect on cell proliferation in human melanoma and skin histoculture and justify using human skin punch biopsies for evaluation of the pharmacodynamic changes induced by SCH2047069. ACRONYMS Histone subunit H3 (H3), Kinesin spindle protein (KSP), 5-ethynyl-2′-deoxyuridine (EDU), Dimethyl sulfoxide (DMSO), Formalin-fixed paraffin embedded (FFPE). PMID:26917945

  9. In silico analysis of histone H3 gene expression during human brain development.

    PubMed

    Ren, Megan; van Nocker, Steve

    2016-01-01

    Precise regulation of chromatin structure is essential for proper development of higher eukaryotes, and methylation of histone H3 at lysine-27 (H3K27) by the Polycomb Repressive Complex 2 (PRC2) component EZH2 has emerged as an important and conserved mechanism to ensure silencing of developmentally regulated genes. Recurrent mutations within the histone H3 genes H3F3A and HIST1H3B that convert K27 to methionine (H3K27M) and disrupt the global H3K27 methylation landscape and PRC2-dependent silencing, have recently been identified in pediatric high-grade gliomas including Diffuse Intrinsic Pontine Glioma (DIPG) and Glioblastoma multiforme (GBM; Type IV glioma). These findings have generated renewed interest in the dynamics of histone genes and their expression, which have been difficult to study due to redundancy and high sequence homology within the H3 gene family. In this in silico study, we re-evaluated genomic organization of the human H3 gene family and expression of these genes in the human brain, utilizing public RNA-based sequence datasets for the human genome and brain development. We identified transcriptional activity from at least 17 protein-encoding H3 genes in the developing brain, comprising at least 14 canonical (H3.1)-like and 3 'replication-independent' (H3.3)-like forms, and encoding six distinct H3 isoforms. Transcripts for H3.3 genes including H3F3A show gradual decrease in abundance associated with developmental progression, whereas H3.1 transcripts including HIST1H3B tend to be strongly downregulated at an early prenatal stage and remain essentially silent thereafter. Twelve genes, including members of both H3.1 and H3.3 classes, contain a K27-AAG codon that is mutable to that for M (ATG), whereas the remaining contain the alternative, AAA codon for K at this position. H3F3A is the only H3.3-like gene containing the K27-AAG codon, whereas HIST1H3B is among ten H3.1-like genes containing this codon. This data indicates that, in the early

  10. Tubastatin A suppresses renal fibrosis via regulation of epigenetic histone modification and Smad3-dependent fibrotic genes.

    PubMed

    Choi, Sin Young; Ryu, Yuhee; Kee, Hae Jin; Cho, Soo-Na; Kim, Gwi Ran; Cho, Jae Yeong; Kim, Hyung-Seok; Kim, In-Kyeom; Jeong, Myung Ho

    2015-09-01

    Inflammation and fibrosis are implicated in the pathogenesis of hypertensive kidney damage. We previously demonstrated that a nonspecific histone deacetylase (HDAC) inhibitor attenuates cardiac fibrosis in deoxycorticosterone acetate-salt hypertensive rats, which induces HDAC6 protein and enzymatic activity. However, the HDAC inhibitor's effect and mechanism have not yet been demonstrated. We sought to determine whether an HDAC6-selective inhibitor could treat hypertension and kidney damage in angiotensin II-infused mice. Hypertension was induced by infusion of ANG in mice. Tubastatin A, an HDAC6 selective inhibitor, did not regulate blood pressure. Hypertensive stimuli enhanced the expression of HDAC6 in vivo and in vitro. We showed that the inhibition of HDAC6 prevents fibrosis and inflammation as determined by quantitative real-time PCR, western blot, and immunohistochemistry. Small interfering RNA (siRNA) against HDAC6 or Smad3 attenuated hypertensive stimuli-induced fibrosis and inflammation, whereas Smad2 siRNA failed to inhibit fibrosis. Interestingly, the combination of the HDAC6 inhibitor and Smad3 knockdown synergistically blocked transforming growth factor β (TGF-β) or ANG-induced fibrosis. We also demonstrated for the first time, to our knowledge, that acetylation of collagen type I can be regulated by HDAC6/p300 acetyltransferase. The chromatin immunoprecipitation assay revealed that the HDAC6 inhibitor suppressed TGF-β-induced acetylated histone H4 or phospho-Smad2/3 to Smad3 binding elements in the fibrosis-associated gene promoters including collagen type I. These results suggest that HDAC6 may be a valuable therapeutic target for the treatment of hypertension-induced kidney fibrosis and inflammation.

  11. The Histone Database: a comprehensive resource for histones and histone fold-containing proteins.

    PubMed

    Mariño-Ramírez, Leonardo; Hsu, Benjamin; Baxevanis, Andreas D; Landsman, David

    2006-03-01

    The Histone Database is a curated and searchable collection of full-length sequences and structures of histones and nonhistone proteins containing histone-like folds, compiled from major public databases. Several new histone fold-containing proteins have been identified, including the huntingtin-interacting protein HYPM. Additionally, based on the recent crystal structure of the Son of Sevenless protein, an interpretation of the sequence analysis of the histone fold domain is presented. The database contains an updated collection of multiple sequence alignments for the four core histones (H2A, H2B, H3, and H4) and the linker histones (H1/H5) from a total of 975 organisms. The database also contains information on the human histone gene complement and provides links to three-dimensional structures of histone and histone fold-containing proteins. The Histone Database is a comprehensive bioinformatics resource for the study of structure and function of histones and histone fold-containing proteins. The database is available at http://research.nhgri.nih.gov/histones/.

  12. Histone Deacetylase Inhibitor Valproic Acid Promotes the Differentiation of Human Induced Pluripotent Stem Cells into Hepatocyte-Like Cells

    PubMed Central

    Kondo, Yuki; Iwao, Takahiro; Yoshihashi, Sachimi; Mimori, Kayo; Ogihara, Ruri; Nagata, Kiyoshi; Kurose, Kouichi; Saito, Masayoshi; Niwa, Takuro; Suzuki, Takayoshi; Miyata, Naoki; Ohmori, Shigeru; Nakamura, Katsunori; Matsunaga, Tamihide

    2014-01-01

    In this study, we aimed to elucidate the effects and mechanism of action of valproic acid on hepatic differentiation from human induced pluripotent stem cell-derived hepatic progenitor cells. Human induced pluripotent stem cells were differentiated into endodermal cells in the presence of activin A and then into hepatic progenitor cells using dimethyl sulfoxide. Hepatic progenitor cells were matured in the presence of hepatocyte growth factor, oncostatin M, and dexamethasone with valproic acid that was added during the maturation process. After 25 days of differentiation, cells expressed hepatic marker genes and drug-metabolizing enzymes and exhibited drug-metabolizing enzyme activities. These expression levels and activities were increased by treatment with valproic acid, the timing and duration of which were important parameters to promote differentiation from human induced pluripotent stem cell-derived hepatic progenitor cells into hepatocytes. Valproic acid inhibited histone deacetylase activity during differentiation of human induced pluripotent stem cells, and other histone deacetylase inhibitors also enhanced differentiation into hepatocytes. In conclusion, histone deacetylase inhibitors such as valproic acid can be used to promote hepatic differentiation from human induced pluripotent stem cell-derived hepatic progenitor cells. PMID:25084468

  13. Irradiation with heavy-ion particles changes the cellular distribution of human histone acetyltranferase HAT1

    SciTech Connect

    Lebel, E.A.; Tafrov, S.; Boukamp, P.

    2010-06-01

    Hat1 was the first histone acetyltransferase identified, however its biological function is still unclear. In this report, we show that the human Hat1 has two isoforms. Isoform a has 418 amino acids (aa) and is localized exclusively in the nuclear matrix of normal human keratinocytes (NHKs). Isoform b has 334 aa and is located in thecytoplasm, the nucleoplasm, attached to the chromatin and to the nuclear matrix. Immunohistochemical analyses revealed that the bulk of Hat1 is confined to the nucleus, with much lesser amounts in the cytoplasm. Cells undergoing mitotic division have an elevated amount of Hat1 compared to non-mitotic ones. NHKs exposed to hydrogen peroxide (H2O2) or to a beam of high mass and energy (HZE) ion particles expressed bright nuclear staining for Hat1, a phenotype that was not observed in NHKs exposed to &947;-rays. We established that the enhanced nuclear staining for Hat1 in response to these treatments is regulated by the PI3K and the MAPK signaling pathways. Our observations clearly implicate Hat1 in the cellular response assuring the survival of the treated cells.

  14. Beyond Histone and Deacetylase: An Overview of Cytoplasmic Histone Deacetylases and Their Nonhistone Substrates

    PubMed Central

    Yao, Ya-Li; Yang, Wen-Ming

    2011-01-01

    Acetylation of lysines is a prominent form of modification in mammalian proteins. Deacetylation of proteins is catalyzed by histone deacetylases, traditionally named after their role in histone deacetylation, transcriptional modulation, and epigenetic regulation. Despite the link between histone deacetylases and chromatin structure, some of the histone deacetylases reside in various compartments in the cytoplasm. Here, we review how these cytoplasmic histone deacetylases are regulated, the identification of nonhistone substrates, and the functional implications of their nondeacetylase enzymatic activities. PMID:21234400

  15. A quantitative multiplexed mass spectrometry assay for studying the kinetic of residue-specific histone acetylation.

    PubMed

    Kuo, Yin-Ming; Henry, Ryan A; Andrews, Andrew J

    2014-12-01

    Histone acetylation is involved in gene regulation and, most importantly, aberrant regulation of histone acetylation is correlated with major human diseases. Although many lysine acetyltransferases (KATs) have been characterized as being capable of acetylating multiple lysine residues on histones, how different factors such as enzyme complexes or external stimuli (e.g. KAT activators or inhibitors) alter KAT specificity remains elusive. In order to comprehensively understand how the homeostasis of histone acetylation is maintained, a method that can quantitate acetylation levels of individual lysines on histones is needed. Here we demonstrate that our mass spectrometry (MS)-based method accomplishes this goal. In addition, the high throughput, high sensitivity, and high dynamic range of this method allows for effectively and accurately studying steady-state kinetics. Based on the kinetic parameters from in vitro enzymatic assays, we can determine the specificity and selectivity of a KAT and use this information to understand what factors influence histone acetylation. These approaches can be used to study the enzymatic mechanisms of histone acetylation as well as be adapted to other histone modifications. Understanding the post-translational modification of individual residues within the histones will provide a better picture of chromatin regulation in the cell.

  16. Germ line-limited and somatic chromosomes of Acricotopus lucidus differ in distribution and timing of alterations of histone modifications in male gonial mitosis and meiosis.

    PubMed

    Staiber, Wolfgang

    2012-08-01

    Special chromosomes limited to the germ line (=Ks) and exceptional genetic events such as elimination mitoses and a monopolar migration of the Ks in the last gonial mitosis are specific features of the complex chromosome cycle occurring in the chironomid Acricotopus lucidus. In the male, this unequal differential gonial mitosis results in a regular spermatocyte possessing all the Ks in addition to the somatic chromosomes (=Ss) and an aberrant spermatocyte containing only Ss. During evolution, the Ks have developed from the Ss and are composed of euchromatic S-homologous sections and heterochromatic segments. Less is known about the function and the transcriptional activity of the Ks. Specific post-translational histone modifications are known to be associated with transcriptionally active and inactive states of the chromatin. In an immunofluorescence study, the distribution of the following acetylated (ac), methylated (me) and phosphorylated (ph) amino acids in the histones H3 and H4 was analysed in Ks and Ss in male gonial mitoses and meiosis of A. lucidus, namely H3K18ac and H4K8ac, H3K4me3 and H3K9me3, H3S10ph, H3S28ph and H3T3ph. Ks and Ss clearly differ in the distribution of H3S28ph in gonial and meiotic metaphases. The H3S28ph mark covered the entire Ss, while the Ks showed this label only on their pericentromeric heterochromatin bands containing germ line-specific repetitive DNA sequences. A differential timing in the dephosphorylation of H3S10ph, H3S28ph and H3T3ph between Ks and Ss within the same cell was detected in the last gonial mitosis. The dephosphorylation occurred earlier in the Ks migrating first to the pole, than in the later equally segregating Ss. A programmed rapid histone deacetylation and dephosphorylation happened in the unseparated Ss of the aberrant spermatocyte at metaphase I in the connected primary spermatocyte, which correlated with the beginning of a permanent inactivation of these Ss in a metaphase-like condensed state. In meiosis

  17. Gene co-expression networks in human brain identify epigenetic modifications in alcohol dependence

    PubMed Central

    Ponomarev, Igor; Wang, Shi; Zhang, Lingling; Harris, R Adron; Mayfield, R Dayne

    2012-01-01

    Alcohol abuse causes widespread changes in gene expression in human brain, some of which contribute to alcohol dependence. Previous microarray studies identified individual genes as candidates for alcohol phenotypes, but efforts to generate an integrated view of molecular and cellular changes underlying alcohol addiction are lacking. Here, we applied a novel systems approach to transcriptome profiling in postmortem human brains and generated a systemic view of brain alterations associated with alcohol abuse. We identified critical cellular components and previously unrecognized epigenetic determinants of gene co-expression relationships and discovered novel markers of chromatin modifications in alcoholic brain. Higher expression levels of endogenous retroviruses and genes with high GC content in alcoholics were associated with DNA hypomethylation and increased histone H3K4 tri-methylation, suggesting a critical role of epigenetic mechanisms in alcohol addiction. Analysis of cell type – specific transcriptomes revealed remarkable consistency between molecular profiles and cellular abnormalities in alcoholic brain. Based on evidence from this study and others, we generated a systems hypothesis for the central role of chromatin modifications in alcohol dependence that integrates epigenetic regulation of gene expression with pathophysiological and neuroadaptive changes in alcoholic brain. Our results offer implications for epigenetic therapeutics in alcohol and drug addiction. PMID:22302827

  18. An adhesin-like protein, Lam29, from Lactobacillus mucosae ME-340 binds to histone H3 and blood group antigens in human colonic mucus.

    PubMed

    Watanabe, Masamichi; Kinoshita, Hideki; Huang, I-Nung; Eguchi, Kei; Tsurumi, Takuya; Kawai, Yasushi; Kitazawa, Haruki; Kimura, Katsunori; Taketomo, Naoki; Kikuchi, Daisuke; Sase, Tomohiko; Miura, Koh; Ogawa, Hitoshi; Shibata, Chikashi; Horii, Akira; Saito, Tadao

    2012-01-01

    A cell-surface 29-kDa protein (Lam29, cysteine-binding protein of the ABC transporter) from Lactobacillus mucosae ME-340 showed an adhesin-like property for human ABO blood group antigens expressed on the gastrointestinal mucosa. In addition, here we report that Lam29 also bound to an 18-kDa protein on human colonic mucus. By ligand blot assay and N-terminal amino acid sequence of the protein, it was identified as human histone H3. By ligand blot and microplate binding assays with recombinant histone H3, binding between Lam29 and histone H3 was confirmed. The adhesion of ME-340 cells to histone H3 was significantly inhibited by 26% after the addition of 2.5 mg/mL Lam29 as compared to the absence of Lam29 (p<0.01). By GHCl extraction and transcription attenuation of ME-340 cells, binding reduction of ME340 cells against histone H3 was detected at 12% and 13% respectively, as compared to control cells by the BIACORE assay (p<0.01). These data indicate that Lam29 shows multiple binding activities to blood group antigens and histone H3 in human colonic mucus. This is the first report to indicate that lactobacilli expressing Lam29 adhere to histone H3 on gastrointestinal mucosa.

  19. Induction of histone deacetylases (HDACs) in human abdominal aortic aneurysm: therapeutic potential of HDAC inhibitors.

    PubMed

    Galán, María; Varona, Saray; Orriols, Mar; Rodríguez, José Antonio; Aguiló, Silvia; Dilmé, Jaume; Camacho, Mercedes; Martínez-González, José; Rodriguez, Cristina

    2016-05-01

    Clinical management of abdominal aortic aneurysm (AAA) is currently limited to elective surgical repair because an effective pharmacotherapy is still awaited. Inhibition of histone deacetylase (HDAC) activity could be a promising therapeutic option in cardiovascular diseases. We aimed to characterise HDAC expression in human AAA and to evaluate the therapeutic potential of class I and IIa HDAC inhibitors in the AAA model of angiotensin II (Ang II)-infused apolipoprotein-E-deficient (ApoE(-/-)) mice. Real-time PCR, western blot and immunohistochemistry evidenced an increased expression of HDACs 1, 2 (both class I), 4 and 7 (both class IIa) in abdominal aorta samples from patients undergoing AAA open repair (n=22) compared with those from donors (n=14). Aortic aneurysms from Ang-II-infused ApoE(-/-) mice exhibited a similar HDAC expression profile. In these animals, treatment with a class I HDAC inhibitor (MS-275) or a class IIa inhibitor (MC-1568) improved survival, reduced the incidence and severity of AAA and limited aneurysmal expansion evaluated by Doppler ultrasonography. These beneficial effects were more potent in MC-1568-treated mice. The disorganisation of elastin and collagen fibres and lymphocyte and macrophage infiltration were effectively reduced by both inhibitors. Additionally, HDAC inhibition attenuated the exacerbated expression of pro-inflammatory markers and the increase in metalloproteinase-2 and -9 activity induced by Ang II in this model. Therefore, our data evidence that HDAC expression is deregulated in human AAA and that class-selective HDAC inhibitors limit aneurysm expansion in an AAA mouse model. New-generation HDAC inhibitors represent a promising therapeutic approach to overcome human aneurysm progression.

  20. Induction of histone deacetylases (HDACs) in human abdominal aortic aneurysm: therapeutic potential of HDAC inhibitors

    PubMed Central

    Galán, María; Varona, Saray; Orriols, Mar; Rodríguez, José Antonio; Aguiló, Silvia; Dilmé, Jaume; Camacho, Mercedes; Martínez-González, José; Rodriguez, Cristina

    2016-01-01

    ABSTRACT Clinical management of abdominal aortic aneurysm (AAA) is currently limited to elective surgical repair because an effective pharmacotherapy is still awaited. Inhibition of histone deacetylase (HDAC) activity could be a promising therapeutic option in cardiovascular diseases. We aimed to characterise HDAC expression in human AAA and to evaluate the therapeutic potential of class I and IIa HDAC inhibitors in the AAA model of angiotensin II (Ang II)-infused apolipoprotein-E-deficient (ApoE−/−) mice. Real-time PCR, western blot and immunohistochemistry evidenced an increased expression of HDACs 1, 2 (both class I), 4 and 7 (both class IIa) in abdominal aorta samples from patients undergoing AAA open repair (n=22) compared with those from donors (n=14). Aortic aneurysms from Ang-II-infused ApoE−/− mice exhibited a similar HDAC expression profile. In these animals, treatment with a class I HDAC inhibitor (MS-275) or a class IIa inhibitor (MC-1568) improved survival, reduced the incidence and severity of AAA and limited aneurysmal expansion evaluated by Doppler ultrasonography. These beneficial effects were more potent in MC-1568-treated mice. The disorganisation of elastin and collagen fibres and lymphocyte and macrophage infiltration were effectively reduced by both inhibitors. Additionally, HDAC inhibition attenuated the exacerbated expression of pro-inflammatory markers and the increase in metalloproteinase-2 and -9 activity induced by Ang II in this model. Therefore, our data evidence that HDAC expression is deregulated in human AAA and that class-selective HDAC inhibitors limit aneurysm expansion in an AAA mouse model. New-generation HDAC inhibitors represent a promising therapeutic approach to overcome human aneurysm progression. PMID:26989193

  1. Changed histone acetylation patterns in normal appearing white matter and early MS lesions

    PubMed Central

    Pedre, X; Mastronardi, F.; Bruck, W.; López-Rodas, G; Kuhlmann, T; Casaccia, P

    2011-01-01

    The epigenetic identity of oligodendrocytes is modulated by post-translational modifications of histones. Acetylation of histone H3 results from the balance between the activity of histone-acetyltransferases (HATs) and histone deacetylases (HDACs) and modulates transcriptional activation. We have previously shown that in rodents histone deacetylation favors oligodendrocyte differentiation, while acetylation is associated with increased levels of transcriptional inhibitors of oligodendrocyte differentiation. Here we report in humans brains, a shift towards histone acetylation in the white matter of the frontal lobes of aged subjects and in patients with chronic multiple sclerosis (MS). Increased immunoreactivity for acetylated histone H3 was observed in the nuclei of NogoA+ oligodendrocytes in a subset of MS samples. These changes were associated with high levels of transcriptional inhibitors of oligodendrocyte differentiation (i.e. TCF7L2, ID2 and SOX2) and higher HAT transcript levels (i.e. CBP, P300) in female MS patients compared to non-neurological controls and correlated with disease duration. Chromatin immunoprecipitation from samples of MS patients revealed enrichment of acetyl-histone H3 at the promoter of the increased target genes (i.e. TCF7L2). The data in chronic lesions contrasted with findings in early MS lesions, where a marked oligodendroglial histone deacetylation was observed. Together these data suggest that histone deacetylation is a process that occurs at the early stages of the disease and whose efficiency decreases with disease duration. PMID:21368055

  2. Histone H3 modifications and Cdx-2 binding to the sucrase-isomaltase (SI) gene is involved in induction of the gene in the transition from the crypt to villus in the small intestine of rats.

    PubMed

    Suzuki, Takuji; Mochizuki, Kazuki; Goda, Toshinao

    2008-05-01

    Expression of the sucrase-isomaltase (SI) gene is induced in cells transitioning from the crypt to the villus of rat jejunum. In the present study, we revealed by ChIP assay using a cryostat sectioning technique that binding of the di-acetylated histone H3 at lysine 9/14 and the transcriptional factor Cdx-2 to the promoter region on the SI gene, as well as mRNA, increased in the transient process. Additionally, di-/tri-methylation of histone H3 at lysine 9/14 on the promoter region of the SI gene rapidly decreased with increasing mRNA. These results suggest that induction of the SI gene during the transition from the crypt to the villi is associated with changes in histone H3 modifications from methylation at lysine 9 to di-acetylation at lysine 9/14, as well as increased binding of Cdx-2 to the SI promoter region.

  3. Biochemical reconstitution and phylogenetic comparison of human SET1 family core complexes involved in histone methylation.

    PubMed

    Shinsky, Stephen A; Monteith, Kelsey E; Viggiano, Susan; Cosgrove, Michael S

    2015-03-01

    Mixed lineage leukemia protein-1 (MLL1) is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases that are required for metazoan development. MLL1 is the best characterized human SET1 family member, which includes MLL1-4 and SETd1A/B. MLL1 assembles with WDR5, RBBP5, ASH2L, DPY-30 (WRAD) to form the MLL1 core complex, which is required for H3K4 dimethylation and transcriptional activation. Because all SET1 family proteins interact with WRAD in vivo, it is hypothesized they are regulated by similar mechanisms. However, recent evidence suggests differences among family members that may reflect unique regulatory inputs in the cell. Missing is an understanding of the intrinsic enzymatic activities of different SET1 family complexes under standard conditions. In this investigation, we reconstituted each human SET1 family core complex and compared subunit assembly and enzymatic activities. We found that in the absence of WRAD, all but one SET domain catalyzes at least weak H3K4 monomethylation. In the presence of WRAD, all SET1 family members showed stimulated monomethyltransferase activity but differed in their di- and trimethylation activities. We found that these differences are correlated with evolutionary lineage, suggesting these enzyme complexes have evolved to accomplish unique tasks within metazoan genomes. To understand the structural basis for these differences, we employed a "phylogenetic scanning mutagenesis" assay and identified a cluster of amino acid substitutions that confer a WRAD-dependent gain-of-function dimethylation activity on complexes assembled with the MLL3 or Drosophila trithorax proteins. These results form the basis for understanding how WRAD differentially regulates SET1 family complexes in vivo.

  4. Biochemical Reconstitution and Phylogenetic Comparison of Human SET1 Family Core Complexes Involved in Histone Methylation*

    PubMed Central

    Shinsky, Stephen A.; Monteith, Kelsey E.; Viggiano, Susan; Cosgrove, Michael S.

    2015-01-01

    Mixed lineage leukemia protein-1 (MLL1) is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases that are required for metazoan development. MLL1 is the best characterized human SET1 family member, which includes MLL1–4 and SETd1A/B. MLL1 assembles with WDR5, RBBP5, ASH2L, DPY-30 (WRAD) to form the MLL1 core complex, which is required for H3K4 dimethylation and transcriptional activation. Because all SET1 family proteins interact with WRAD in vivo, it is hypothesized they are regulated by similar mechanisms. However, recent evidence suggests differences among family members that may reflect unique regulatory inputs in the cell. Missing is an understanding of the intrinsic enzymatic activities of different SET1 family complexes under standard conditions. In this investigation, we reconstituted each human SET1 family core complex and compared subunit assembly and enzymatic activities. We found that in the absence of WRAD, all but one SET domain catalyzes at least weak H3K4 monomethylation. In the presence of WRAD, all SET1 family members showed stimulated monomethyltransferase activity but differed in their di- and trimethylation activities. We found that these differences are correlated with evolutionary lineage, suggesting these enzyme complexes have evolved to accomplish unique tasks within metazoan genomes. To understand the structural basis for these differences, we employed a “phylogenetic scanning mutagenesis” assay and identified a cluster of amino acid substitutions that confer a WRAD-dependent gain-of-function dimethylation activity on complexes assembled with the MLL3 or Drosophila trithorax proteins. These results form the basis for understanding how WRAD differentially regulates SET1 family complexes in vivo. PMID:25561738

  5. Biochemical reconstitution and phylogenetic comparison of human SET1 family core complexes involved in histone methylation.

    PubMed

    Shinsky, Stephen A; Monteith, Kelsey E; Viggiano, Susan; Cosgrove, Michael S

    2015-03-01

    Mixed lineage leukemia protein-1 (MLL1) is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases that are required for metazoan development. MLL1 is the best characterized human SET1 family member, which includes MLL1-4 and SETd1A/B. MLL1 assembles with WDR5, RBBP5, ASH2L, DPY-30 (WRAD) to form the MLL1 core complex, which is required for H3K4 dimethylation and transcriptional activation. Because all SET1 family proteins interact with WRAD in vivo, it is hypothesized they are regulated by similar mechanisms. However, recent evidence suggests differences among family members that may reflect unique regulatory inputs in the cell. Missing is an understanding of the intrinsic enzymatic activities of different SET1 family complexes under standard conditions. In this investigation, we reconstituted each human SET1 family core complex and compared subunit assembly and enzymatic activities. We found that in the absence of WRAD, all but one SET domain catalyzes at least weak H3K4 monomethylation. In the presence of WRAD, all SET1 family members showed stimulated monomethyltransferase activity but differed in their di- and trimethylation activities. We found that these differences are correlated with evolutionary lineage, suggesting these enzyme complexes have evolved to accomplish unique tasks within metazoan genomes. To understand the structural basis for these differences, we employed a "phylogenetic scanning mutagenesis" assay and identified a cluster of amino acid substitutions that confer a WRAD-dependent gain-of-function dimethylation activity on complexes assembled with the MLL3 or Drosophila trithorax proteins. These results form the basis for understanding how WRAD differentially regulates SET1 family complexes in vivo. PMID:25561738

  6. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  7. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  8. Histone acetylation: truth of consequences?

    PubMed

    Choi, Jennifer K; Howe, Leann J

    2009-02-01

    Eukaryotic DNA is packaged into a nucleoprotein structure known as chromatin, which is comprised of DNA, histones, and nonhistone proteins. Chromatin structure is highly dynamic, and can shift from a transcriptionally inactive state to an active form in response to intra- and extracellular signals. A major factor in chromatin architecture is the covalent modification of histones through the addition of chemical moieties, such as acetyl, methyl, ubiquitin, and phosphate groups. The acetylation of the amino-terminal tails of histones is a process that is highly conserved in eukaryotes, and was one of the earliest histone modifications characterized. Since its identification in 1964, a large body of evidence has accumulated demonstrating that histone acetylation plays an important role in transcription. Despite our ever-growing understanding of the nuclear processes involved in nucleosome acetylation, however, the exact biochemical mechanisms underlying the downstream effects of histone acetylation have yet to be fully elucidated. To date, histone acetylation has been proposed to function in 2 nonmutually exclusive manners: by directly altering chromatin structure, and by acting as a molecular tag for the recruitment of chromatin-modifying complexes. Here, we discuss recent research focusing on these 2 potential roles of histone acetylation and clarify what we actually know about the function of this modification.

  9. Increased acetyl and total histone levels in post-mortem Alzheimer's disease brain.

    PubMed

    Narayan, Pritika J; Lill, Claire; Faull, Richard; Curtis, Maurice A; Dragunow, Mike

    2015-02-01

    Histone acetylation is an epigenetic modification that plays a critical role in chromatin remodelling and transcriptional regulation. There is increasing evidence that epigenetic modifications may become compromised in aging and increase susceptibility to the development of neurodegenerative disorders such as Alzheimer's disease. Immunohistochemical labelling of free-floating sections from the inferior temporal gyrus (Alzheimer's disease, n=14; control, n=17) and paraffin-embedded tissue microarrays containing tissue from the middle temporal gyrus (Alzheimer's disease, n=29; control, n=28) demonstrated that acetyl histone H3 and acetyl histone H4 levels, as well as total histone H3 and total histone H4 protein levels, were significantly increased in post-mortem Alzheimer's disease brain tissue compared to age- and sex-matched neurologically normal control brain tissue. Changes in acetyl histone levels were proportional to changes in total histone levels. The increase in acetyl histone H3 and H4 was observed in Neuronal N immunopositive pyramidal neurons in Alzheimer's disease brain. Using immunolabelling, histone markers correlated significantly with the level of glial fibrillary acidic protein and HLA-DP, -DQ and -DR immunopositive cells and with the pathological hallmarks of Alzheimer's disease (hyperphosphorylated tau load and β-amyloid plaques). Given that histone acetylation changes were correlated with changes in total histone protein, it was important to evaluate if protein degradation pathways may be compromised in Alzheimer's disease. Consequently, significant positive correlations were also found between ubiquitin load and histone modifications. The relationship between histone acetylation and ubiquitin levels was further investigated in an in vitro model of SK-N-SH cells treated with the proteasome inhibitor Mg132 and the histone deacetylase inhibitor valproic acid. In this model, compromised protein degradation caused by Mg132 lead to elevated histone

  10. Human THAP7 is a chromatin-associated, histone tail-binding protein that represses transcription via recruitment of HDAC3 and nuclear hormone receptor corepressor.

    PubMed

    Macfarlan, Todd; Kutney, Sara; Altman, Brian; Montross, Rebecca; Yu, Jiujiu; Chakravarti, Debabrata

    2005-02-25

    The identities of signal transducer proteins that integrate histone hypoacetylation and transcriptional repression are largely unknown. Here we demonstrate that THAP7, an uncharacterized member of the recently identified THAP (Thanatos-associated protein) family of proteins, is ubiquitously expressed, associates with chromatin, and represses transcription. THAP7 binds preferentially to hypoacetylated (un-, mono-, and diacetylated) histone H4 tails in vitro via its C-terminal 77 amino acids. Deletion of this domain, or treatment of cells with the histone deacetylase inhibitor TSA, which leads to histone hyperacetylation, partially disrupts THAP7/chromatin association in living cells. THAP7 coimmunoprecipitates with histone deacetylase 3 (HDAC3) and the nuclear hormone receptor corepressor (NCoR) and represses transcription as a Gal4 fusion protein. Chromatin immunoprecipitation assays demonstrate that these corepressors are recruited to promoters in a THAP7 dependent manner and promote histone H3 hypoacetylation. The conserved THAP domain is a key determinant for full HDAC3 association in vitro, and both the THAP domain and the histone interaction domain are important for the repressive properties of THAP7. Full repression mediated by THAP7 is also dependent on NCoR expression. We hypothesize that THAP7 is a dual function repressor protein that actively targets deacetylation of histone H3 necessary to establish transcriptional repression and functions as a signal transducer of the repressive mark of hypoacetylated histone H4. This is the first demonstration of the transcriptional regulatory properties of a human THAP domain protein, and a critical identification of a potential transducer of the repressive signal of hypoacetylated histone H4 in higher eukaryotes. PMID:15561719

  11. Increased expression of TLR2 in CD4(+) T cells from SLE patients enhances immune reactivity and promotes IL-17 expression through histone modifications.

    PubMed

    Liu, Yu; Liao, Jieyue; Zhao, Ming; Wu, Haijing; Yung, Susan; Chan, Tak Mao; Yoshimura, Akihiko; Lu, Qianjin

    2015-09-01

    The innate immune system has been shown to play an important pathologic role in systemic lupus erythematosus (SLE). TLR2, a PRR, recognizes exogenous PAMPs, and endogenous damage-associated molecular patterns and has been implicated in the initiation and maintenance of the perpetuated inflammatory reactions in autoimmune diseases. Here, we report increased expression of TLR2 in CD4(+) and CD8(+) T cells, CD19(+) B cells, and CD14(+) monocytes from SLE patients. Conventional treatment, such as hydroxychloroquine and corticosteroids, showed no effect on TLR2 expression in CD4(+) T cells from SLE patients. In vitro stimulation of TLR2 in CD4(+) T cells from SLE patients increased CD40L and CD70 expression, as well as secretion of IL-6, IL-17A, IL-17F, and TNF-α, while Foxp3 transcription decreased. This effect was reversed by TLR2 siRNA. Moreover, TLR2 activation upregulated H3K4 tri-methylation and H4 acetylation levels while downregulated H3K9 tri-methylation level in the IL-17A promoter region. In addition, it also increased H4 acetylation levels and decreased H3K9 tri-methylation levels in the IL-17F promoter region. In summary, our findings demonstrate that increased expression of TLR2 contributes to immune reactivity and promotes IL-17A and IL-17F expression through histone modifications in SLE.

  12. The histone deacetylase inhibitor SAHA induces HSP60 nitration and its extracellular release by exosomal vesicles in human lung-derived carcinoma cells

    PubMed Central

    Bavisotto, Celeste Caruso; Barone, Rosario; Emanuele, Sonia; Lo Cascio, Filippa; Mocciaro, Emanuele; Fais, Stefano; De Macario, Everly Conway; Macario, Alberto J.L.; Cappello, Francesco; Lauricella, Marianna

    2016-01-01

    HSP60 undergoes changes in quantity and distribution in some types of tumors suggesting a participation of the chaperonin in the mechanism of transformation and cancer progression. Suberoylanilide hydroxamic acid (SAHA), a member of a family of histone deacetylase inhibitors (HDACi), has anti-cancer potential but its interaction, if any, with HSP60 has not been elucidated. We investigated the effects of SAHA in a human lung-derived carcinoma cell line (H292). We analysed cell viability and cycle; oxidative stress markers; mitochondrial integrity; HSP60 protein and mRNA levels; and HSP60 post-translational modifications, and its secretion. We found that SAHA is cytotoxic for H292 cells, interrupting the cycle at the G2/M phase, which is followed by death; cytotoxicity is associated with oxidative stress, mitochondrial damage, and diminution of intracellular levels of HSP60; HSP60 undergoes a post-translational modification and becomes nitrated; and nitrated HSP60 is exported via exosomes. We propose that SAHA causes ROS overproduction and mitochondrial dysfunction, which leads to HSP60 nitration and release into the intercellular space and circulation to interact with the immune system. These successive steps might constitute the mechanism of the anti-tumor action of SAHA and provide a basis to design supplementary therapeutic strategies targeting HSP60, which would be more efficacious than the compound alone. PMID:26700624

  13. Altered Human Memory Modification in the Presence of Normal Consolidation.

    PubMed

    Censor, Nitzan; Buch, Ethan R; Nader, Karim; Cohen, Leonardo G

    2016-09-01

    Following initial learning, the memory is stabilized by consolidation mechanisms, and subsequent modification of memory strength occurs via reconsolidation. Yet, it is not clear whether consolidation and memory modification are the same or different systems-level processes. Here, we report disrupted memory modification in the presence of normal consolidation of human motor memories, which relate to differences in lesioned brain structure after stroke. Furthermore, this behavioral dissociation was associated with macrostructural network architecture revealed by a graph-theoretical approach, and with white-matter microstructural integrity measured by diffusion-weighted MRI. Altered macrostructural network architecture and microstructural integrity of white-matter underlying critical nodes of the related network predicted disrupted memory modification. To the best of our knowledge, this provides the first evidence of mechanistic differences between consolidation, and subsequent memory modification through reconsolidation, in human procedural learning. These findings enable better understanding of these memory processes, which may guide interventional strategies to enhance brain function and resulting behavior. PMID:26271110

  14. Structural Basis for WDR5 Interaction (Win) Motif Recognition in Human SET1 Family Histone Methyltransferases*

    PubMed Central

    Dharmarajan, Venkatasubramanian; Lee, Jeong-Heon; Patel, Anamika; Skalnik, David G.; Cosgrove, Michael S.

    2012-01-01

    Translocations and amplifications of the mixed lineage leukemia-1 (MLL1) gene are associated with aggressive myeloid and lymphocytic leukemias in humans. MLL1 is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases, which are required for transcription of genes involved in hematopoiesis and development. MLL1 associates with a subcomplex containing WDR5, RbBP5, Ash2L, and DPY-30 (WRAD), which together form the MLL1 core complex that is required for sequential mono- and dimethylation of H3K4. We previously demonstrated that WDR5 binds the conserved WDR5 interaction (Win) motif of MLL1 in vitro, an interaction that is required for the H3K4 dimethylation activity of the MLL1 core complex. In this investigation, we demonstrate that arginine 3765 of the MLL1 Win motif is required to co-immunoprecipitate WRAD from mammalian cells, suggesting that the WDR5-Win motif interaction is important for the assembly of the MLL1 core complex in vivo. We also demonstrate that peptides that mimic SET1 family Win motif sequences inhibit H3K4 dimethylation by the MLL1 core complex with varying degrees of efficiency. To understand the structural basis for these differences, we determined structures of WDR5 bound to six different naturally occurring Win motif sequences at resolutions ranging from 1.9 to 1.2 Å. Our results reveal that binding energy differences result from interactions between non-conserved residues C-terminal to the Win motif and to a lesser extent from subtle variation of residues within the Win motif. These results highlight a new class of methylation inhibitors that may be useful for the treatment of MLL1-related malignancies. PMID:22665483

  15. Structural basis for WDR5 interaction (Win) motif recognition in human SET1 family histone methyltransferases.

    PubMed

    Dharmarajan, Venkatasubramanian; Lee, Jeong-Heon; Patel, Anamika; Skalnik, David G; Cosgrove, Michael S

    2012-08-10

    Translocations and amplifications of the mixed lineage leukemia-1 (MLL1) gene are associated with aggressive myeloid and lymphocytic leukemias in humans. MLL1 is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases, which are required for transcription of genes involved in hematopoiesis and development. MLL1 associates with a subcomplex containing WDR5, RbBP5, Ash2L, and DPY-30 (WRAD), which together form the MLL1 core complex that is required for sequential mono- and dimethylation of H3K4. We previously demonstrated that WDR5 binds the conserved WDR5 interaction (Win) motif of MLL1 in vitro, an interaction that is required for the H3K4 dimethylation activity of the MLL1 core complex. In this investigation, we demonstrate that arginine 3765 of the MLL1 Win motif is required to co-immunoprecipitate WRAD from mammalian cells, suggesting that the WDR5-Win motif interaction is important for the assembly of the MLL1 core complex in vivo. We also demonstrate that peptides that mimic SET1 family Win motif sequences inhibit H3K4 dimethylation by the MLL1 core complex with varying degrees of efficiency. To understand the structural basis for these differences, we determined structures of WDR5 bound to six different naturally occurring Win motif sequences at resolutions ranging from 1.9 to 1.2 Å. Our results reveal that binding energy differences result from interactions between non-conserved residues C-terminal to the Win motif and to a lesser extent from subtle variation of residues within the Win motif. These results highlight a new class of methylation inhibitors that may be useful for the treatment of MLL1-related malignancies. PMID:22665483

  16. Trichostatin A, a histone deacetylase inhibitor, suppresses JAK2/STAT3 signaling via inducing the promoter-associated histone acetylation of SOCS1 and SOCS3 in human colorectal cancer cells.

    PubMed

    Xiong, Hua; Du, Wan; Zhang, Yan-Jie; Hong, Jie; Su, Wen-Yu; Tang, Jie-Ting; Wang, Ying-Chao; Lu, Rong; Fang, Jing-Yuan

    2012-02-01

    Aberrant janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling is involved in the oncogenesis of several cancers. Suppressors of cytokine signaling (SOCS) genes and SH2-containing protein tyrosine phosphatase 1 (SHP1) proteins, which are negative regulators of JAK/STAT signaling, have been reported to have tumor suppressor functions. However, in colorectal cancer (CRC) cells, the mechanisms that regulate SOCS and SHP1 genes, and the cause of abnormalities in the JAK/STAT signaling pathway, remain largely unknown. The present study shows that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, leads to the hyperacetylation of histones associated with the SOCS1 and SOCS3 promoters, but not the SHP1 promoter in CRC cells. This indicates that histone modifications are involved in the regulation of SOCS1 and SOCS3. Moreover, upregulation of SOCS1 and SOCS3 expression was achieved using TSA, which also significantly downregulated JAK2/STAT3 signaling in CRC cells. We also demonstrate that TSA suppresses the growth of CRC cells, and induces G1 cell cycle arrest and apoptosis through the regulation of downstream targets of JAK2/STAT3 signaling, including Bcl-2, survivin and p16(ink4a) . Therefore, our data demonstrate that TSA may induce SOCS1 and SOCS3 expression by inducing histone modifications and consequently inhibits JAK2/STAT3 signaling in CRC cells. These results also establish a mechanistic link between the inhibition of JAK2/STAT3 signaling and the anticancer action of TSA in CRC cells.

  17. The double PHD finger domain of MOZ/MYST3 induces α-helical structure of the histone H3 tail to facilitate acetylation and methylation sampling and modification.

    PubMed

    Dreveny, Ingrid; Deeves, Sian E; Fulton, Joel; Yue, Baigong; Messmer, Marie; Bhattacharya, Amit; Collins, Hilary M; Heery, David M

    2014-01-01

    Histone tail modifications control many nuclear processes by dictating the dynamic exchange of regulatory proteins on chromatin. Here we report novel insights into histone H3 tail structure in complex with the double PHD finger (DPF) of the lysine acetyltransferase MOZ/MYST3/KAT6A. In addition to sampling H3 and H4 modification status, we show that the DPF cooperates with the MYST domain to promote H3K9 and H3K14 acetylation, although not if H3K4 is trimethylated. Four crystal structures of an extended DPF alone and in complex with unmodified or acetylated forms of the H3 tail reveal the molecular basis of crosstalk between H3K4me3 and H3K14ac. We show for the first time that MOZ DPF induces α-helical conformation of H3K4-T11, revealing a unique mode of H3 recognition. The helical structure facilitates sampling of H3K4 methylation status, and proffers H3K9 and other residues for modification. Additionally, we show that a conserved double glycine hinge flanking the H3 tail helix is required for a conformational change enabling docking of H3K14ac with the DPF. In summary, our data provide the first observations of extensive helical structure in a histone tail, revealing the inherent ability of the H3 tail to adopt alternate conformations in complex with chromatin regulators.

  18. The double PHD finger domain of MOZ/MYST3 induces α-helical structure of the histone H3 tail to facilitate acetylation and methylation sampling and modification

    PubMed Central

    Dreveny, Ingrid; Deeves, Sian E.; Fulton, Joel; Yue, Baigong; Messmer, Marie; Bhattacharya, Amit; Collins, Hilary M.; Heery, David M.

    2014-01-01

    Histone tail modifications control many nuclear processes by dictating the dynamic exchange of regulatory proteins on chromatin. Here we report novel insights into histone H3 tail structure in complex with the double PHD finger (DPF) of the lysine acetyltransferase MOZ/MYST3/KAT6A. In addition to sampling H3 and H4 modification status, we show that the DPF cooperates with the MYST domain to promote H3K9 and H3K14 acetylation, although not if H3K4 is trimethylated. Four crystal structures of an extended DPF alone and in complex with unmodified or acetylated forms of the H3 tail reveal the molecular basis of crosstalk between H3K4me3 and H3K14ac. We show for the first time that MOZ DPF induces α-helical conformation of H3K4-T11, revealing a unique mode of H3 recognition. The helical structure facilitates sampling of H3K4 methylation status, and proffers H3K9 and other residues for modification. Additionally, we show that a conserved double glycine hinge flanking the H3 tail helix is required for a conformational change enabling docking of H3K14ac with the DPF. In summary, our data provide the first observations of extensive helical structure in a histone tail, revealing the inherent ability of the H3 tail to adopt alternate conformations in complex with chromatin regulators. PMID:24150941

  19. Cadmium induces histone H3 lysine methylation by inhibiting histone demethylase activity.

    PubMed

    Xiao, Chunlian; Liu, Yin; Xie, Chengfeng; Tu, Wei; Xia, Yujie; Costa, Max; Zhou, Xue

    2015-05-01

    Cadmium is an established human lung carcinogen with weak mutagenicity. However, the mechanisms underlying cadmium-induced carcinogenesis remain obscure. It has been suggested that epigenetic mechanisms may play a role in cadmium-induced carcinogenesis. In this study, we investigated the effects of cadmium on histone methylation and histone demethylases, and the role of histone methylation in transformation of immortalized normal human bronchial epithelial (BEAS-2B) cells. Exposure to 0.625, 1.25, 2.5, and 5.0 μM of cadmium for 6, 24, and 48 h increased global trimethylated histone H3 on lysine 4 (H3K4me3) and dimethylated histone H3 on lysine 9 (H3K9me2) in BEAS-2B cells compared with untreated cells, and most of these changes remained after the removal of cadmium (P < .05 or P < .01 for most modifications). Meanwhile, cadmium inhibited the activities of histone H3 on lysine 4 (H3K4) and histone H3 on lysine 9 (H3K9) demethylases which were detected by histone demethylation assay. However, there was no significant change in the protein levels of the H3K4 demethylase lysine-specific demethylase 5A (KDM5A) and the H3K9 demethylase lysine-specific demethylase 3A (KDM3A). Interestingly, during transformation of BEAS-2B cells by 20 weeks of exposure to 2.0 μM cadmium as assessed by anchorage-independent growth in soft agar, global H3K4me3, and H3K9me2 were significantly increased at 4 weeks (P < .05 or P < .01), whereas no significant change was observed at 8, 12, 16, and 20 weeks compared with control. Our study suggests that cadmium increases global H3K4me3 and H3K9me2 by inhibiting the activities of histone demethylases, and aberrant histone methylation that occurs early (48 h) and at 4 weeks is associated with cadmium-induced transformation of BEAS-2B cells at the early stage. PMID:25673502

  20. Histone Modifications around Individual BDNF Gene Promoters in Prefrontal Cortex Are Associated with Extinction of Conditioned Fear

    ERIC Educational Resources Information Center

    Bredy, Timothy W.; Wu, Hao; Crego, Cortney; Zellhoefer, Jessica; Sun, Yi E.; Barad, Mark

    2007-01-01

    Extinction of conditioned fear is an important model both of inhibitory learning and of behavior therapy for human anxiety disorders. Like other forms of learning, extinction learning is long-lasting and depends on regulated gene expression. Epigenetic mechanisms make an important contribution to persistent changes in gene expression; therefore,…

  1. Structural and Functional Conservation of the NuA4 Histone Acetyltransferase Complex from Yeast to Humans

    PubMed Central

    Doyon, Yannick; Selleck, William; Lane, William S.; Tan, Song; Côté, Jacques

    2004-01-01

    The NuA4 histone acetyltransferase (HAT) multisubunit complex is responsible for acetylation of histone H4 and H2A N-terminal tails in yeast. Its catalytic component, Esa1, is essential for cell cycle progression, gene-specific regulation and has been implicated in DNA repair. Almost all NuA4 subunits have clear homologues in higher eukaryotes, suggesting that the complex is conserved throughout evolution to metazoans. We demonstrate here that NuA4 complexes are indeed present in human cells. Tip60 and its splice variant Tip60b/PLIP were purified as stable HAT complexes associated with identical polypeptides, with 11 of the 12 proteins being homologs of yeast NuA4 subunits. This indicates a highly conserved subunit composition and the identified human proteins underline the role of NuA4 in the control of mammalian cell proliferation. ING3, a member of the ING family of growth regulators, links NuA4 to p53 function which we confirmed in vivo. Proteins specific to the human NuA4 complexes include ruvB-like helicases and a bromodomain-containing subunit linked to ligand-dependent transcription activation by the thyroid hormone receptor. We also demonstrate that subunits MRG15 and DMAP1 are present in distinct protein complexes harboring histone deacetylase and SWI2-related ATPase activities, respectively. Finally, analogous to yeast, a recombinant trimeric complex formed by Tip60, EPC1, and ING3 is sufficient to reconstitute robust nucleosomal HAT activity in vitro. In conclusion, the NuA4 HAT complex is highly conserved in eukaryotes, in which it plays primary roles in transcription, cellular response to DNA damage, and cell cycle control. PMID:14966270

  2. Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.).

    PubMed

    Ayyappan, Vasudevan; Kalavacharla, Venu; Thimmapuram, Jyothi; Bhide, Ketaki P; Sripathi, Venkateswara R; Smolinski, Tomasz G; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

    2015-01-01

    Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress.

  3. Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.)

    PubMed Central

    Thimmapuram, Jyothi; Bhide, Ketaki P.; Sripathi, Venkateswara R.; Smolinski, Tomasz G.; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

    2015-01-01

    Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress. PMID:26167691

  4. Diverse Activities of Histone Acylations Connect Metabolism to Chromatin Function.

    PubMed

    Dutta, Arnob; Abmayr, Susan M; Workman, Jerry L

    2016-08-18

    Modifications of histones play important roles in balancing transcriptional output. The discovery of acyl marks, besides histone acetylation, has added to the functional diversity of histone modifications. Since all modifications use metabolic intermediates as substrates for chromatin-modifying enzymes, the prevalent landscape of histone modifications in any cell type is a snapshot of its metabolic status. Here, we review some of the current findings of how differential use of histone acylations regulates gene expression as response to metabolic changes and differentiation programs. PMID:27540855

  5. Sensing core histone phosphorylation — A matter of perfect timing☆

    PubMed Central

    Sawicka, Anna; Seiser, Christian

    2014-01-01

    Systematic analysis of histone modifications has revealed a plethora of posttranslational modifications that mediate changes in chromatin structure and gene expression. Histone phosphorylation is a transient histone modification that becomes induced by extracellular signals, DNA damage or entry into mitosis. Importantly, phosphorylation of histone proteins does lead not only to the binding of specific reader proteins but also to changes in the affinity for readers or writers of other histone modifications. This induces a cross-talk between different chromatin modifications that allows the spatio-temporal control of chromatin-associated events. In this review we will summarize the progress in our current knowledge of factors sensing reversible histone phosphorylation in different biological scenarios. This article is part of a Special Issue entitled: Molecular mechanisms of histone modification function. PMID:24747175

  6. Chromatin modifications associated with diabetes.

    PubMed

    Keating, Samuel T; El-Osta, Assam

    2012-08-01

    Accelerated rates of vascular complications are associated with diabetes mellitus. Environmental factors including hyperglycaemia contribute to the progression of diabetic complications. Epidemiological and experimental animal studies identified poor glycaemic control as a major contributor to the development of complications. These studies suggest that early exposure to hyperglycaemia can instigate the development of complications that present later in the progression of the disease, despite improved glycaemic control. Recent experiments reveal a striking commonality associated with gene-activating hyperglycaemic events and chromatin modification. The best characterised to date are associated with the chemical changes of amino-terminal tails of histone H3. Enzymes that write specified histone tail modifications are not well understood in models of hyperglycaemia and metabolic memory as well as human diabetes. The best-characterised enzyme is the lysine specific Set7 methyltransferase. The contribution of Set7 to the aetiology of diabetic complications may extend to other transcriptional events through methylation of non-histone substrates. PMID:22639343

  7. Knockdown of WHIRLY1 Affects Drought Stress-Induced Leaf Senescence and Histone Modifications of the Senescence-Associated Gene HvS40.

    PubMed

    Janack, Bianka; Sosoi, Paula; Krupinska, Karin; Humbeck, Klaus

    2016-01-01

    The plastid-nucleus located protein WHIRLY1 has been described as an upstream regulator of leaf senescence, binding to the promoter of senescence-associated genes like HvS40. To investigate the impact of WHIRLY1 on drought stress-induced, premature senescence, transgenic barley plants with an RNAi-mediated knockdown of the HvWHIRLY1 gene were grown under normal and drought stress conditions. The course of leaf senescence in these lines was monitored by physiological parameters and studies on the expression of senescence- and drought stress-related genes. Drought treatment accelerated leaf senescence in WT plants, whereas WHIRLY 1 knockdown lines (RNAi-W1) showed a stay-green phenotype. Expression of both senescence-associated and drought stress-responsive genes, was delayed in the transgenic plants. Notably, expression of transcription factors of the WRKY and NAC families, which are known to function in senescence- and stress-related signaling pathways, was affected in plants with impaired accumulation of WHIRLY1, indicating that WHIRLY1 acts as an upstream regulator of drought stress-induced senescence. To reveal the epigenetic indexing of HvS40 at the onset of drought-induced senescence in WT and RNAi-W1 lines, stress-responsive loading with histone modifications of promoter and coding sequences of HvS40 was analyzed by chromatin immunoprecipitation and quantified by qRT-PCR. In the wildtype, the euchromatic mark H3K9ac of the HvS40 gene was low under control conditions and was established in response to drought treatment, indicating the action of epigenetic mechanisms in response to drought stress. However, drought stress caused no significant increase in H3K9ac in plants impaired in accumulation of WHIRLY1. The results show that WHIRLY1 knockdown sets in motion a delay in senescence that involves all aspects of gene expression, including changes in chromatin structure. PMID:27608048

  8. Knockdown of WHIRLY1 Affects Drought Stress-Induced Leaf Senescence and Histone Modifications of the Senescence-Associated Gene HvS40

    PubMed Central

    Janack, Bianka; Sosoi, Paula; Krupinska, Karin; Humbeck, Klaus

    2016-01-01

    The plastid-nucleus located protein WHIRLY1 has been described as an upstream regulator of leaf senescence, binding to the promoter of senescence-associated genes like HvS40. To investigate the impact of WHIRLY1 on drought stress-induced, premature senescence, transgenic barley plants with an RNAi-mediated knockdown of the HvWHIRLY1 gene were grown under normal and drought stress conditions. The course of leaf senescence in these lines was monitored by physiological parameters and studies on the expression of senescence- and drought stress-related genes. Drought treatment accelerated leaf senescence in WT plants, whereas WHIRLY 1 knockdown lines (RNAi-W1) showed a stay-green phenotype. Expression of both senescence-associated and drought stress-responsive genes, was delayed in the transgenic plants. Notably, expression of transcription factors of the WRKY and NAC families, which are known to function in senescence- and stress-related signaling pathways, was affected in plants with impaired accumulation of WHIRLY1, indicating that WHIRLY1 acts as an upstream regulator of drought stress-induced senescence. To reveal the epigenetic indexing of HvS40 at the onset of drought-induced senescence in WT and RNAi-W1 lines, stress-responsive loading with histone modifications of promoter and coding sequences of HvS40 was analyzed by chromatin immunoprecipitation and quantified by qRT-PCR. In the wildtype, the euchromatic mark H3K9ac of the HvS40 gene was low under control conditions and was established in response to drought treatment, indicating the action of epigenetic mechanisms in response to drought stress. However, drought stress caused no significant increase in H3K9ac in plants impaired in accumulation of WHIRLY1. The results show that WHIRLY1 knockdown sets in motion a delay in senescence that involves all aspects of gene expression, including changes in chromatin structure. PMID:27608048

  9. Histone H3K9 acetylation level modulates gene expression and may affect parasite growth in human malaria parasite Plasmodium falciparum.

    PubMed

    Srivastava, Sandeep; Bhowmick, Krishanu; Chatterjee, Snehajyoti; Basha, Jeelan; Kundu, Tapas K; Dhar, Suman K

    2014-12-01

    Three-dimensional positioning of the nuclear genome plays an important role in the epigenetic regulation of genes. Although nucleographic domain compartmentalization in the regulation of epigenetic state and gene expression is well established in higher organisms, it remains poorly understood in the pathogenic parasite Plasmodium falciparum. In the present study, we report that two histone tail modifications, H3K9Ac and H3K14Ac, are differentially distributed in the parasite nucleus. We find colocalization of active gene promoters such as Tu1 (tubulin-1 expressed in the asexual stages) with H3K9Ac marks at the nuclear periphery. By contrast, asexual stage inactive gene promoters such as Pfg27 (gametocyte marker) and Pfs28 (ookinete marker) occupy H3K9Ac devoid zones at the nuclear periphery. The histone H3K9 is predominantly acetylated by the PCAF/GCN5 class of lysine acetyltransferases, which is well characterized in the parasite. Interestingly, embelin, a specific inhibitor of PCAF/GCN5 family histone acetyltransferase, selectively decreases total H3K9Ac acetylation levels (but not H3K14Ac levels) around the var gene promoters, leading to the downregulation of var gene expression, suggesting interplay among histone acetylation status, as well as subnuclear compartmentalization of different genes and their activation in the parasites. Finally, we found that embelin inhibited parasitic growth at the low micromolar range, raising the possibility of using histone acetyltransferases as a target for antimalarial therapy.

  10. Epigenetic change in kidney tumor: downregulation of histone acetyltransferase MYST1 in human renal cell carcinoma

    PubMed Central

    2013-01-01

    Background MYST1 (also known as hMOF), a member of the MYST family of histone acetyltransferases (HATs) as an epigenetic mark of active genes, is mainly responsible for histone H4K16 acetylation in the cells. Recent studies have shown that the abnormal gene expression of hMOF is involved in certain primary cancers. Here we examined the involvement of hMOF expression and histone H4K16 acetylation in primary renal cell carcinoma (RCC). Simultaneously, we investigated the correlation between the expression of hMOF and clear cell RCC (ccRCC) biomarker carbohydrase IX (CA9) in RCC. Materials and methods The frozen RCC tissues and RCC cell lines as materials, the reverse transcription polymerase chain reaction (RT-PCR), western blotting and immunohistochemical staining approaches were used. Results RT-PCR results indicate that hMOF gene expression levels frequently downregulated in 90.5% of patients (19/21) with RCC. The reduction of hMOF protein in both RCC tissues and RCC cell lines is tightly correlated with acetylation of histone H4K16. In addition, overexpression of CA9 was detected in 100% of ccRCC patients (21/21). However, transient transfection of hMOF in ccRCC 786–0 cells did not affect both the gene and protein expression of CA9. Conclusion hMOF as an acetyltransferase of H4K16 might be involved in the pathogenesis of kidney cancer, and this epigenetic changes might be a new CA9-independent RCC diagnostic maker. PMID:23394073

  11. Molecular sequelae of histone deacetylase inhibition in human malignant B cells.

    PubMed

    Mitsiades, Nicholas; Mitsiades, Constantine S; Richardson, Paul G; McMullan, Ciaran; Poulaki, Vassiliki; Fanourakis, Galinos; Schlossman, Robert; Chauhan, Dharminder; Munshi, Nikhil C; Hideshima, Teru; Richon, Victoria M; Marks, Paul A; Anderson, Kenneth C

    2003-05-15

    Histone acetylation modulates gene expression, cellular differentiation, and survival and is regulated by the opposing activities of histone acetyltransferases (HATs) and histone deacetylases (HDACs). HDAC inhibition results in accumulation of acetylated nucleosomal histones and induces differentiation and/or apoptosis in transformed cells. In this study, we characterized the effect of suberoylanilide hydroxamic acid (SAHA), the prototype of a series of hydroxamic acid-based HDAC inhibitors, in cell lines and patient cells from B-cell malignancies, including multiple myeloma (MM) and related disorders. SAHA induced apoptosis in all tumor cells tested, with increased p21 and p53 protein levels and dephosphorylation of Rb. We also detected cleavage of Bid, suggesting a role for Bcl-2 family members in regulation of SAHA-induced cell death. Transfection of Bcl-2 cDNA into MM.1S cells completely abrogated SAHA-induced apoptosis, confirming its protective role. SAHA did not induce cleavage of caspase-8, -9, or -3 in MM.1S cells during the early phase of apoptosis, and the pan-caspase inhibitor ZVAD-FMK did not protect against SAHA. Conversely, poly(ADP)ribose polymerase (PARP) was cleaved in a pattern indicative of calpain activation, and the calpain inhibitor calpeptin abrogated SAHA-induced cell death. Importantly, SAHA sensitized MM.1S cells to death receptor-mediated apoptosis and inhibited the secretion of interleukin 6 (IL-6) induced in bone marrow stromal cells (BMSCs) by binding of MM cells, suggesting that it can overcome cell adhesion-mediated drug resistance. Our studies delineate the mechanisms whereby HDAC inhibitors mediate anti-MM activity and overcome drug resistance in the BM milieu and provide the framework for clinical evaluation of SAHA, which is bioavailable, well tolerated, and bioactive after oral administration, to improve patient outcome.

  12. The histone demethylase PHF8 is an oncogenic protein in human non-small cell lung cancer

    SciTech Connect

    Shen, Yuzhou; Pan, Xufeng; Zhao, Heng

    2014-08-15

    Highlights: • PHF8 overexpresses in human NSCLC and predicts poor survival. • PHF8 regulates lung cancer cell growth and transformation. • PHF8 regulates apoptosis in human lung cancer cells. • PHF8 promotes miR-21 expression in human lung cancer. • MiR-21 is critically essential for PHF8 function in human lung cancer cells. - Abstract: PHF8 is a JmjC domain-containing protein and erases repressive histone marks including H4K20me1 and H3K9me1/2. It binds to H3K4me3, an active histone mark usually located at transcription start sites (TSSs), through its plant homeo-domain, and is thus recruited and enriched in gene promoters. PHF8 is involved in the development of several types of cancer, including leukemia, prostate cancer, and esophageal squamous cell carcinoma. Herein we report that PHF8 is an oncogenic protein in human non-small cell lung cancer (NSCLC). PHF8 is up-regulated in human NSCLC tissues, and high PHF8 expression predicts poor survival. Our in vitro and in vivo evidence demonstrate that PHF8 regulates lung cancer cell proliferation and cellular transformation. We found that PHF8 knockdown induces DNA damage and apoptosis in lung cancer cells. PHF8 promotes miR-21 expression in human lung cancer, and miR-21 knockdown blocks the effects of PHF8 on proliferation and apoptosis of lung cancer cells. In summary, PHF8 promotes lung cancer cell growth and survival by regulating miR-21.

  13. Histone variants: key players of chromatin.

    PubMed

    Biterge, Burcu; Schneider, Robert

    2014-06-01

    Histones are fundamental structural components of chromatin. Eukaryotic DNA is wound around an octamer of the core histones H2A, H2B, H3, and H4. Binding of linker histone H1 promotes higher order chromatin organization. In addition to their structural role, histones impact chromatin function and dynamics by, e.g., post-translational histone modifications or the presence of specific histone variants. Histone variants exhibit differential expression timings (DNA replication-independent) and mRNA characteristics compared to canonical histones. Replacement of canonical histones with histone variants can affect nucleosome stability and help to create functionally distinct chromatin domains. In line with this, several histone variants have been implicated in the regulation of cellular processes such as DNA repair and transcriptional activity. In this review, we focus on recent progress in the study of core histone variants H2A.X, H2A.Z, macroH2A, H3.3, and CENP-A, as well as linker histone H1 variants, their functions and their links to development and disease.

  14. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.

    PubMed

    Vaidya, Himani; Rumph, Candie; Katula, Karen S

    2016-01-01

    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  15. Addressing the human factors issues associated with control room modifications

    SciTech Connect

    O`Hara, J.; Stubler, W.; Kramer, J.

    1998-03-01

    Advanced human-system interface (HSI) technology is being integrated into existing nuclear plants as part of plant modifications and upgrades. The result of this trend is that hybrid HSIs are created, i.e., HSIs containing a mixture of conventional (analog) and advanced (digital) technology. The purpose of the present research is to define the potential effects of hybrid HSIs on personnel performance and plant safety and to develop human factors guidance for safety reviews of them where necessary. In support of this objective, human factors issues associated with hybrid HSIs were identified. The issues were evaluated for their potential significance to plant safety, i.e., their human performance concerns have the potential to compromise plant safety. The issues were then prioritized and a subset was selected for design review guidance development.

  16. Structural Basis for Specific Binding of Human MPP8 Chromodomain to Histone H3 Methylated at Lysine 9

    SciTech Connect

    Li, Jing; Li, Zhihong; Ruan, Jianbin; Xu, Chao; Tong, Yufeng; Pan, Patricia W.; Tempel, Wolfram; Crombet, Lissete; Min, Jinrong; Zang, Jianye

    2012-02-27

    M-phase phosphoprotein 8 (MPP8) was initially identified to be a component of the RanBPM-containing large protein complex, and has recently been shown to bind to methylated H3K9 both in vivo and in vitro. MPP8 binding to methylated H3K9 is suggested to recruit the H3K9 methyltransferases GLP and ESET, and DNA methyltransferase 3A to the promoter of the E-cadherin gene, mediating the E-cadherin gene silencing and promote tumor cell motility and invasion. MPP8 contains a chromodomain in its N-terminus, which is used to bind the methylated H3K9. Here, we reported the crystal structures of human MPP8 chromodomain alone and in complex with the trimethylated histone H3K9 peptide (residue 1-15). The complex structure unveils that the human MPP8 chromodomain binds methylated H3K9 through a conserved recognition mechanism, which was also observed in Drosophila HP1, a chromodomain containing protein that binds to methylated H3K9 as well. The structure also reveals that the human MPP8 chromodomain forms homodimer, which is mediated via an unexpected domain swapping interaction through two {beta} strands from the two protomer subunits. Our findings reveal the molecular mechanism of selective binding of human MPP8 chromodomain to methylated histone H3K9. The observation of human MPP8 chromodomain in both solution and crystal lattice may provide clues to study MPP8-mediated gene regulation furthermore.

  17. Histone Deacetylases

    PubMed Central

    Parbin, Sabnam; Kar, Swayamsiddha; Shilpi, Arunima; Sengupta, Dipta; Deb, Moonmoon; Rath, Sandip Kumar

    2014-01-01

    In the current era of genomic medicine, diseases are identified as manifestations of anomalous patterns of gene expression. Cancer is the principal example among such maladies. Although remarkable progress has been achieved in the understanding of the molecular mechanisms involved in the genesis and progression of cancer, its epigenetic regulation, particularly histone deacetylation, demands further studies. Histone deacetylases (HDACs) are one of the key players in the gene expression regulation network in cancer because of their repressive role on tumor suppressor genes. Higher expression and function of deacetylases disrupt the finely tuned acetylation homeostasis in both histone and non-histone target proteins. This brings about alterations in the genes implicated in the regulation of cell proliferation, differentiation, apoptosis and other cellular processes. Moreover, the reversible nature of epigenetic modulation by HDACs makes them attractive targets for cancer remedy. This review summarizes the current knowledge of HDACs in tumorigenesis and tumor progression as well as their contribution to the hallmarks of cancer. The present report also describes briefly various assays to detect histone deacetylase activity and discusses the potential role of histone deacetylase inhibitors as emerging epigenetic drugs to cure cancer. PMID:24051359

  18. Valproate Treatment of Human Cord Blood CD4-positive Effector T Cells Confers on Them the Molecular Profile (MicroRNA Signature and FOXP3 Expression) of Natural Regulatory CD4-positive Cells through Inhibition of Histone Deacetylase*

    PubMed Central

    Fayyad-Kazan, Hussein; Rouas, Redouane; Merimi, Makram; El Zein, Nabil; Lewalle, Philippe; Jebbawi, Fadi; Mourtada, Mohamad; Badran, Hussein; Ezzeddine, Mohamad; Salaun, Bruno; Romero, Pedro; Burny, Arsène; Martiat, Philippe; Badran, Bassam

    2010-01-01

    Regulatory T cells (Tregs) play a key role in immune system homeostasis and tolerance to antigens, thereby preventing autoimmunity, and may be partly responsible for the lack of an appropriate immune response against tumor cells. Although not sufficient, a high expression of forkhead box P3 (FOXP3) is necessary for their suppressive function. Recent reports have shown that histones deacetylase inhibitors increased FOXP3 expression in T cells. We therefore decided to investigate in non-Tregs CD4-positive cells, the mechanisms by which an aspecific opening of the chromatin could lead to an increased FOXP3 expression. We focused on binding of potentially activating transcription factors to the promoter region of FOXP3 and on modifications in the five miRs constituting the Tregs signature. Valproate treatment induced binding of Ets-1 and Ets-2 to the FOXP3 promoter and acted positively on its expression, by increasing the acetylation of histone H4 lysines. Valproate treatment also induced the acquisition of the miRs Tregs signature. To elucidate whether the changes in the miRs expression could be due to the increased FOXP3 expression, we transduced these non-Tregs with a FOXP3 lentiviral expression vector, and found no changes in miRs expression. Therefore, the modification in their miRs expression profile is not due to an increased expression of FOXP3 but directly results from histones deacetylase inhibition. Rather, the increased FOXP3 expression results from the additive effects of Ets factors binding and the change in expression level of miR-21 and miR-31. We conclude that valproate treatment of human non-Tregs confers on them a molecular profile similar to that of their regulatory counterpart. PMID:20427269

  19. Differential patterns of histone methylase EHMT2 and its catalyzed histone modifications H3K9me1 and H3K9me2 during maturation of central auditory system.

    PubMed

    Ebbers, Lena; Runge, Karen; Nothwang, Hans Gerd

    2016-08-01

    Histone methylation is an important epigenetic mark leading to changes in DNA accessibility and transcription. Here, we investigate immunoreactivity against the euchromatic histone-lysine N-methyltransferase EHMT2 and its catalyzed mono- and dimethylation marks at histone 3 lysine 9 (H3K9me1 and H3K9me2) during postnatal differentiation of the mouse central auditory system. In the brainstem, expression of EHMT2 was high in the first postnatal week and down-regulated thereafter. In contrast, immunoreactivity in the auditory cortex (AC) remained high during the first year of life. This difference might be related to distinct demands for adult plasticity. Analyses of two deaf mouse models, namely Cldn14 (-/-) and Cacna1d (-/-), demonstrated that sound-driven or spontaneous activity had no influence on EHMT2 immunoreactivity. The methylation marks H3K9me1 and H3K9me2 were high throughout the auditory system up to 1 year. Young auditory neurons showed immunoreactivity against both methylations at similar intensities, whereas many mature neurons showed stronger labeling for either H3K9me1 or H3K9me2. These differences were only poorly correlated with cell types. To identify methyltransferases contributing to the persistent H3K9me1 and H3K9me2 marks in the adult brainstem, EHMT1 and the retinoblastoma-interacting zinc-finger protein RIZ1 were analyzed. Both were down-regulated during brainstem development, similar to EHMT2. Contrary to EHMT2, EHMT1 was also down-regulated in adult cortical areas. Together, our data reveal a marked difference in EHMT2 levels between mature brainstem and cortical areas and a decoupling between EHMT2 abundance and histone 3 lysine 9 methylations during brainstem differentiation. Furthermore, EHMT1 and EHMT2 are differentially expressed in cortical areas. PMID:27083448

  20. Identification of 13 novel human modification guide RNAs

    PubMed Central

    Vitali, Patrice; Royo, Hélène; Seitz, Hervé; Bachellerie, Jean-Pierre; Hüttenhofer, Alexander; Cavaillé, Jérôme

    2003-01-01

    Members of the two expanding RNA subclasses termed C/D and H/ACA RNAs guide the 2′-O-methylations and pseudouridylations, respectively, of rRNA and spliceosomal RNAs (snRNAs). Here, we report on the identification of 13 novel human intron-encoded small RNAs (U94–U106) belonging to the two subclasses of modification guides. Seven of them are predicted to direct 2′-O-methylations in rRNA or snRNAs, while the remainder represent novel orphan RNA modification guides. From these, U100, which is exclusively detected in Cajal bodies (CBs), is predicted to direct modification of a U6 snRNA uridine, U9, which to date has not been found to be pseudouridylated. Hence, within CBs, U100 might function in the folding pathway or other aspects of U6 snRNA metabolism rather than acting as a pseudouridylation guide. U106 C/D snoRNA might also possess an RNA chaperone activity only since its two conserved antisense elements match two rRNA sequences devoid of methylated nucleotides and located remarkably close to each other within the 18S rRNA secondary structure. Finally, we have identified a retrogene for U99 snoRNA located within an intron of the Siat5 gene, supporting the notion that retro-transposition events might have played a substantial role in the mobility and diversification of snoRNA genes during evolution. PMID:14602913

  1. Identification of 13 novel human modification guide RNAs.

    PubMed

    Vitali, Patrice; Royo, Hélène; Seitz, Hervé; Bachellerie, Jean-Pierre; Hüttenhofer, Alexander; Cavaillé, Jérôme

    2003-11-15

    Members of the two expanding RNA subclasses termed C/D and H/ACA RNAs guide the 2'-O-methylations and pseudouridylations, respectively, of rRNA and spliceosomal RNAs (snRNAs). Here, we report on the identification of 13 novel human intron-encoded small RNAs (U94-U106) belonging to the two subclasses of modification guides. Seven of them are predicted to direct 2'-O-methylations in rRNA or snRNAs, while the remainder represent novel orphan RNA modification guides. From these, U100, which is exclusively detected in Cajal bodies (CBs), is predicted to direct modification of a U6 snRNA uridine, U(9), which to date has not been found to be pseudouridylated. Hence, within CBs, U100 might function in the folding pathway or other aspects of U6 snRNA metabolism rather than acting as a pseudouridylation guide. U106 C/D snoRNA might also possess an RNA chaperone activity only since its two conserved antisense elements match two rRNA sequences devoid of methylated nucleotides and located remarkably close to each other within the 18S rRNA secondary structure. Finally, we have identified a retrogene for U99 snoRNA located within an intron of the Siat5 gene, supporting the notion that retro-transposition events might have played a substantial role in the mobility and diversification of snoRNA genes during evolution.

  2. Histone variant H2A.Bbd is associated with active transcription and mRNA processing in human cells

    PubMed Central

    Tolstorukov, Michael Y.; Goldman, Joseph A.; Gilbert, Cristele; Ogryzko, Vasily; Kingston, Robert E.; Park, Peter J.

    2013-01-01

    Summary Variation in chromatin composition and organization often reflects differences in genome function. Histone variants, for example, replace canonical histones to contribute to regulation of numerous nuclear processes including transcription, DNA repair and chromosome segregation. Here we focus on H2A.Bbd, a rapidly evolving variant found in mammals but not in invertebrates. We report that in human cells, nucleosomes bearing H2A.Bbd form unconventional chromatin structures enriched within actively transcribed genes and characterized by shorter DNA protection and nucleosome spacing. Analysis of transcriptional profiles from cells depleted for H2A.Bbd demonstrated widespread changes in gene expression with a net down-regulation of transcription and disruption of normal mRNA splicing patterns. In particular, we observed changes in exon inclusion rates and increased presence of intronic sequences in mRNA products upon H2A.Bbd depletion. Taken together, our results indicate that H2A.Bbd is involved in formation of a specific chromatin structure that facilitates both transcription and initial mRNA processing. PMID:22795134

  3. Diversity and Divergence of Dinoflagellate Histone Proteins

    PubMed Central

    Marinov, Georgi K.; Lynch, Michael

    2015-01-01

    Histone proteins and the nucleosomal organization of chromatin are near-universal eukaroytic features, with the exception of dinoflagellates. Previous studies have suggested that histones do not play a major role in the packaging of dinoflagellate genomes, although several genomic and transcriptomic surveys have detected a full set of core histone genes. Here, transcriptomic and genomic sequence data from multiple dinoflagellate lineages are analyzed, and the diversity of histone proteins and their variants characterized, with particular focus on their potential post-translational modifications and the conservation of the histone code. In addition, the set of putative epigenetic mark readers and writers, chromatin remodelers and histone chaperones are examined. Dinoflagellates clearly express the most derived set of histones among all autonomous eukaryote nuclei, consistent with a combination of relaxation of sequence constraints imposed by the histone code and the presence of numerous specialized histone variants. The histone code itself appears to have diverged significantly in some of its components, yet others are conserved, implying conservation of the associated biochemical processes. Specifically, and with major implications for the function of histones in dinoflagellates, the results presented here strongly suggest that transcription through nucleosomal arrays happens in dinoflagellates. Finally, the plausible roles of histones in dinoflagellate nuclei are discussed. PMID:26646152

  4. Diversity and Divergence of Dinoflagellate Histone Proteins.

    PubMed

    Marinov, Georgi K; Lynch, Michael

    2015-12-08

    Histone proteins and the nucleosomal organization of chromatin are near-universal eukaroytic features, with the exception of dinoflagellates. Previous studies have suggested that histones do not play a major role in the packaging of dinoflagellate genomes, although several genomic and transcriptomic surveys have detected a full set of core histone genes. Here, transcriptomic and genomic sequence data from multiple dinoflagellate lineages are analyzed, and the diversity of histone proteins and their variants characterized, with particular focus on their potential post-translational modifications and the conservation of the histone code. In addition, the set of putative epigenetic mark readers and writers, chromatin remodelers and histone chaperones are examined. Dinoflagellates clearly express the most derived set of histones among all autonomous eukaryote nuclei, consistent with a combination of relaxation of sequence constraints imposed by the histone code and the presence of numerous specialized histone variants. The histone code itself appears to have diverged significantly in some of its components, yet others are conserved, implying conservation of the associated biochemical processes. Specifically, and with major implications for the function of histones in dinoflagellates, the results presented here strongly suggest that transcription through nucleosomal arrays happens in dinoflagellates. Finally, the plausible roles of histones in dinoflagellate nuclei are discussed.

  5. Low Proteolytic Clipping of Histone H3 in Cervical Cancer

    PubMed Central

    Sandoval-Basilio, Jorge; Serafín-Higuera, Nicolás; Reyes-Hernandez, Octavio D.; Serafín-Higuera, Idanya; Leija-Montoya, Gabriela; Blanco-Morales, Magali; Sierra-Martínez, Monica; Ramos-Mondragon, Roberto; García, Silvia; López-Hernández, Luz Berenice; Yocupicio-Monroy, Martha; Alcaraz-Estrada, Sofia L.

    2016-01-01

    Chromatin in cervical cancer (CC) undergoes chemical and structural changes that alter the expression pattern of genes. Recently, a potential mechanism, which regulates gene expression at transcriptional levels is the proteolytic clipping of histone H3. However, until now this process in CC has not been reported. Using HeLa cells as a model of CC and human samples from patients with CC, we identify that the H3 cleavage was lower in CC compared with control tissue. Additionally, the histone H3 clipping was performed by serine and aspartyl proteases in HeLa cells. These results suggest that histone H3 clipping operates as part of post-translational modification system in CC. PMID:27698925

  6. Low Proteolytic Clipping of Histone H3 in Cervical Cancer

    PubMed Central

    Sandoval-Basilio, Jorge; Serafín-Higuera, Nicolás; Reyes-Hernandez, Octavio D.; Serafín-Higuera, Idanya; Leija-Montoya, Gabriela; Blanco-Morales, Magali; Sierra-Martínez, Monica; Ramos-Mondragon, Roberto; García, Silvia; López-Hernández, Luz Berenice; Yocupicio-Monroy, Martha; Alcaraz-Estrada, Sofia L.

    2016-01-01

    Chromatin in cervical cancer (CC) undergoes chemical and structural changes that alter the expression pattern of genes. Recently, a potential mechanism, which regulates gene expression at transcriptional levels is the proteolytic clipping of histone H3. However, until now this process in CC has not been reported. Using HeLa cells as a model of CC and human samples from patients with CC, we identify that the H3 cleavage was lower in CC compared with control tissue. Additionally, the histone H3 clipping was performed by serine and aspartyl proteases in HeLa cells. These results suggest that histone H3 clipping operates as part of post-translational modification system in CC.

  7. Chromatin architecture near a potential 3' end of the igh locus involves modular regulation of histone modifications during B-Cell development and in vivo occupancy at CTCF sites.

    PubMed

    Garrett, Francine E; Emelyanov, Alexander V; Sepulveda, Manuel A; Flanagan, Patrick; Volpi, Sabrina; Li, Fubin; Loukinov, Dmitry; Eckhardt, Laurel A; Lobanenkov, Victor V; Birshtein, Barbara K

    2005-02-01

    The murine Igh locus has a 3' regulatory region (3' RR) containing four enhancers (hs3A, hs1,2, hs3B, and hs4) at DNase I-hypersensitive sites. The 3' RR exerts long-range effects on class switch recombination (CSR) to several isotypes through its control of germ line transcription. By measuring levels of acetylated histones H3 and H4 and of dimethylated H3 (K4) with chromatin immunoprecipitation assays, we found that early in B-cell development, chromatin encompassing the enhancers of the 3' RR began to attain stepwise modifications typical of an open conformation. The hs4 enhancer was associated with active chromatin initially in pro- and pre-B cells and then together with hs3A, hs1,2, and hs3B in B and plasma cells. Histone modifications were similar in resting splenic B cells and in splenic B cells induced by lipopolysaccharide to undergo CSR. From the pro-B-cell stage onward, the approximately 11-kb region immediately downstream of hs4 displayed H3 and H4 modifications indicative of open chromatin. This region contained newly identified DNase I-hypersensitive sites and several CTCF target sites, some of which were occupied in vivo in a developmentally regulated manner. The open chromatin environment of the extended 3' RR in mature B cells was flanked by regions associated with dimethylated K9 of histone H3. Together, these data suggest that 3' RR elements are located within a specific chromatin subdomain that contains CTCF binding sites and developmentally regulated modules.

  8. Comparative modeling and benchmarking data sets for human histone deacetylases and sirtuin families.

    PubMed

    Xia, Jie; Tilahun, Ermias Lemma; Kebede, Eyob Hailu; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-02-23

    Histone deacetylases (HDACs) are an important class of drug targets for the treatment of cancers, neurodegenerative diseases, and other types of diseases. Virtual screening (VS) has become fairly effective approaches for drug discovery of novel and highly selective histone deacetylase inhibitors (HDACIs). To facilitate the process, we constructed maximal unbiased benchmarking data sets for HDACs (MUBD-HDACs) using our recently published methods that were originally developed for building unbiased benchmarking sets for ligand-based virtual screening (LBVS). The MUBD-HDACs cover all four classes including Class III (Sirtuins family) and 14 HDAC isoforms, composed of 631 inhibitors and 24609 unbiased decoys. Its ligand sets have been validated extensively as chemically diverse, while the decoy sets were shown to be property-matching with ligands and maximal unbiased in terms of "artificial enrichment" and "analogue bias". We also conducted comparative studies with DUD-E and DEKOIS 2.0 sets against HDAC2 and HDAC8 targets and demonstrate that our MUBD-HDACs are unique in that they can be applied unbiasedly to both LBVS and SBVS approaches. In addition, we defined a novel metric, i.e. NLBScore, to detect the "2D bias" and "LBVS favorable" effect within the benchmarking sets. In summary, MUBD-HDACs are the only comprehensive and maximal-unbiased benchmark data sets for HDACs (including Sirtuins) that are available so far. MUBD-HDACs are freely available at http://www.xswlab.org/ . PMID:25633490

  9. Comparative Modeling and Benchmarking Data Sets for Human Histone Deacetylases and Sirtuin Families

    PubMed Central

    Xia, Jie; Tilahun, Ermias Lemma; Kebede, Eyob Hailu; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Histone Deacetylases (HDACs) are an important class of drug targets for the treatment of cancers, neurodegenerative diseases and other types of diseases. Virtual screening (VS) has become fairly effective approaches for drug discovery of novel and highly selective Histone Deacetylases Inhibitors (HDACIs). To facilitate the process, we constructed the Maximal Unbiased Benchmarking Data Sets for HDACs (MUBD-HDACs) using our recently published methods that were originally developed for building unbiased benchmarking sets for ligand-based virtual screening (LBVS). The MUBD-HDACs covers all 4 Classes including Class III (Sirtuins family) and 14 HDACs isoforms, composed of 631 inhibitors and 24,609 unbiased decoys. Its ligand sets have been validated extensively as chemically diverse, while the decoy sets were shown to be property-matching with ligands and maximal unbiased in terms of “artificial enrichment” and “analogue bias”. We also conducted comparative studies with DUD-E and DEKOIS 2.0 sets against HDAC2 and HDAC8 targets, and demonstrate that our MUBD-HDACs is unique in that it can be applied unbiasedly to both LBVS and SBVS approaches. In addition, we defined a novel metric, i.e. NLBScore, to detect the “2D bias” and “LBVS favorable” effect within the benchmarking sets. In summary, MUBD-HDACs is the only comprehensive and maximal-unbiased benchmark data sets for HDACs (including Sirtuins) that is available so far. MUBD-HDACs is freely available at http://www.xswlab.org/. PMID:25633490

  10. Comparative modeling and benchmarking data sets for human histone deacetylases and sirtuin families.

    PubMed

    Xia, Jie; Tilahun, Ermias Lemma; Kebede, Eyob Hailu; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-02-23

    Histone deacetylases (HDACs) are an important class of drug targets for the treatment of cancers, neurodegenerative diseases, and other types of diseases. Virtual screening (VS) has become fairly effective approaches for drug discovery of novel and highly selective histone deacetylase inhibitors (HDACIs). To facilitate the process, we constructed maximal unbiased benchmarking data sets for HDACs (MUBD-HDACs) using our recently published methods that were originally developed for building unbiased benchmarking sets for ligand-based virtual screening (LBVS). The MUBD-HDACs cover all four classes including Class III (Sirtuins family) and 14 HDAC isoforms, composed of 631 inhibitors and 24609 unbiased decoys. Its ligand sets have been validated extensively as chemically diverse, while the decoy sets were shown to be property-matching with ligands and maximal unbiased in terms of "artificial enrichment" and "analogue bias". We also conducted comparative studies with DUD-E and DEKOIS 2.0 sets against HDAC2 and HDAC8 targets and demonstrate that our MUBD-HDACs are unique in that they can be applied unbiasedly to both LBVS and SBVS approaches. In addition, we defined a novel metric, i.e. NLBScore, to detect the "2D bias" and "LBVS favorable" effect within the benchmarking sets. In summary, MUBD-HDACs are the only comprehensive and maximal-unbiased benchmark data sets for HDACs (including Sirtuins) that are available so far. MUBD-HDACs are freely available at http://www.xswlab.org/ .

  11. The Functional Analysis of Histone Acetyltransferase MOF in Tumorigenesis

    PubMed Central

    Su, Jiaming; Wang, Fei; Cai, Yong; Jin, Jingji

    2016-01-01

    Changes in chromatin structure and heritably regulating the gene expression by epigenetic mechanisms, such as histone post-translational modification, are involved in most cellular biological processes. Thus, abnormal regulation of epigenetics is implicated in the occurrence of various diseases, including cancer. Human MOF (males absent on the first) is a member of the MYST (Moz-Ybf2/Sas3-Sas2-Tip60) family of histone acetyltransferases (HATs). As a catalytic subunit, MOF can form at least two distinct multiprotein complexes (MSL and NSL) in human cells. Both complexes can acetylate histone H4 at lysine 16 (H4K16); however, the NSL complex possesses broader substrate specificity and can also acetylate histone H4 at lysines 5 and 8 (H4K5 and H4K8), suggesting the complexity of the intracellular functions of MOF. Silencing of MOF in cells leads to genomic instability, inactivation of gene transcription, defective DNA damage repair and early embryonic lethality. Unbalanced MOF expression and its corresponding acetylation of H4K16 have been found in certain primary cancer tissues, including breast cancer, medulloblastoma, ovarian cancer, renal cell carcinoma, colorectal carcinoma, gastric cancer, as well as non-small cell lung cancer. In this review, we provide a brief overview of MOF and its corresponding histone acetylation, introduce recent research findings that link MOF functions to tumorigenesis and speculate on the potential role that may be relevant to tumorigenic pathways. PMID:26784169

  12. TNF-α inhibits aquaporin 5 expression in human salivary gland acinar cells via suppression of histone H4 acetylation.

    PubMed

    Yamamura, Yoshiko; Motegi, Katsumi; Kani, Kouichi; Takano, Hideyuki; Momota, Yukihiro; Aota, Keiko; Yamanoi, Tomoko; Azuma, Masayuki

    2012-08-01

    Sjögren's syndrome is a systemic autoimmune disease characterized by reductions in salivary and lacrimal secretions. The mechanisms underlying these reductions remain unclear. We have previously shown that TNF-α plays an important role in the destruction of acinar structures. Here we examined TNF-α's function in the expression of aquaporin (AQP) 5 in human salivary gland acinar cells. Immortalized human salivary gland acinar (NS-SV-AC) cells were treated with TNF-α, and then the expression levels of AQP5 mRNA and protein were analysed. In addition, the mechanisms underlying the reduction of AQP5 expression by TNF-α treatment were investigated. TNF-α-treatment of NS-SV-AC cells significantly suppressed the expression levels of AQP5 mRNA and protein, and reduced the net fluid secretion rate. We examined the expression and activation levels of DNA methyltransferases (Dnmts) in NS-SV-AC cells treated with TNF-α. However, no significant changes were observed in the expression or activation levels of Dnmt1, Dnmt3a or Dnmt3b. Although we also investigated the role of NF-κB activity in the TNF-α-induced suppression of AQP5 expression in NS-SV-AC cells, we detected similar TNF-α suppression of AQP5 expression in non-transfected cells and in a super-repressor form of IκBα cDNA-transfected cell clones. However, interestingly, chromatin immunoprecipitation analysis demonstrated a remarkable decrease in levels of acetylated histone H4 associated with the AQP5 gene promoter after treatment with TNF-α in NS-SV-AC cells. Therefore, our results may indicate that TNF-α inhibition of AQP5 expression in human salivary gland acinar cells is due to the epigenetic mechanism by suppression of acetylation of histone H4.

  13. "Mitochondrial Replacement" Technologies and Human Germline Nuclear Modification.

    PubMed

    Lane, Alyssa; Nisker, Jeff

    2016-08-01

    In 2015 the United Kingdom became the first jurisdiction to approve "mitochondrial replacement techniques" (MRT), thereby dropping prohibitions against creating human embryos with a permanently altered genetic make-up for purposes of reproduction. MRT is a misnomer because in fact it is the nucleus of the oocyte of the woman who wants a genetically related child that is transferred to the enucleated oocyte of a woman paid to undergo IVF to provide the oocyte. MRT thus constitutes nuclear transfer, which is prohibited by criminal sanctions under sections of laws on reproductive cloning in Canada, the United States, Australia, and European countries that regulate assisted reproduction. By adopting policies permitting the use of MRT, the United Kingdom has become the first jurisdiction to counteract an international consensus prohibiting germline modification. Analyses of the legal, ethical, and societal implications of MRT in assisted human reproduction are essential. PMID:27638985

  14. Mitotic Accumulation of Dimethylated Lysine 79 of Histone H3 Is Important for Maintaining Genome Integrity During Mitosis in Human Cells

    PubMed Central

    Guppy, Brent J.; McManus, Kirk J.

    2015-01-01

    The loss of genome stability is an early event that drives the development and progression of virtually all tumor types. Recent studies have revealed that certain histone post-translational modifications exhibit dynamic and global increases in abundance that coincide with mitosis and exhibit essential roles in maintaining genomic stability. Histone H2B ubiquitination at lysine 120 (H2Bub1) is regulated by RNF20, an E3 ubiquitin ligase that is altered in many tumor types. Through an evolutionarily conserved trans-histone pathway, H2Bub1 is an essential prerequisite for subsequent downstream dimethylation events at lysines 4 (H3K4me2) and 79 (H3K79me2) of histone H3. Although the role that RNF20 plays in tumorigenesis has garnered much attention, the downstream components of the trans-histone pathway, H3K4me2 and H3K79me2, and their potential contributions to genome stability remain largely overlooked. In this study, we employ single-cell imaging and biochemical approaches to investigate the spatial and temporal patterning of RNF20, H2Bub1, H3K4me2, and H3K79me2 throughout the cell cycle, with a particular focus on mitosis. We show that H2Bub1, H3K4me2, and H3K79me2 exhibit distinct temporal progression patterns throughout the cell cycle. Most notably, we demonstrate that H3K79me2 is a highly dynamic histone post-translational modification that reaches maximal abundance during mitosis in an H2Bub1-independent manner. Using RNAi and chemical genetic approaches, we identify DOT1L as a histone methyltransferase required for the mitotic-associated increases in H3K79me2. We also demonstrate that the loss of mitotic H3K79me2 levels correlates with increases in chromosome numbers and increases in mitotic defects. Collectively, these data suggest that H3K79me2 dynamics during mitosis are normally required to maintain genome stability and further implicate the loss of H3K79me2 during mitosis as a pathogenic event that contributes to the development and progression of tumors

  15. Mitotic accumulation of dimethylated lysine 79 of histone H3 is important for maintaining genome integrity during mitosis in human cells.

    PubMed

    Guppy, Brent J; McManus, Kirk J

    2015-02-01

    The loss of genome stability is an early event that drives the development and progression of virtually all tumor types. Recent studies have revealed that certain histone post-translational modifications exhibit dynamic and global increases in abundance that coincide with mitosis and exhibit essential roles in maintaining genomic stability. Histone H2B ubiquitination at lysine 120 (H2Bub1) is regulated by RNF20, an E3 ubiquitin ligase that is altered in many tumor types. Through an evolutionarily conserved trans-histone pathway, H2Bub1 is an essential prerequisite for subsequent downstream dimethylation events at lysines 4 (H3K4me2) and 79 (H3K79me2) of histone H3. Although the role that RNF20 plays in tumorigenesis has garnered much attention, the downstream components of the trans-histone pathway, H3K4me2 and H3K79me2, and their potential contributions to genome stability remain largely overlooked. In this study, we employ single-cell imaging and biochemical approaches to investigate the spatial and temporal patterning of RNF20, H2Bub1, H3K4me2, and H3K79me2 throughout the cell cycle, with a particular focus on mitosis. We show that H2Bub1, H3K4me2, and H3K79me2 exhibit distinct temporal progression patterns throughout the cell cycle. Most notably, we demonstrate that H3K79me2 is a highly dynamic histone post-translational modification that reaches maximal abundance during mitosis in an H2Bub1-independent manner. Using RNAi and chemical genetic approaches, we identify DOT1L as a histone methyltransferase required for the mitotic-associated increases in H3K79me2. We also demonstrate that the loss of mitotic H3K79me2 levels correlates with increases in chromosome numbers and increases in mitotic defects. Collectively, these data suggest that H3K79me2 dynamics during mitosis are normally required to maintain genome stability and further implicate the loss of H3K79me2 during mitosis as a pathogenic event that contributes to the development and progression of tumors.

  16. Histone-lysine methyltransferase EHMT2 is involved in proliferation, apoptosis, cell invasion, and DNA methylation of human neuroblastoma cells.

    PubMed

    Lu, Ziyan; Tian, Yufeng; Salwen, Helen R; Chlenski, Alexandre; Godley, Lucy A; Raj, J Usha; Yang, Qiwei

    2013-06-01

    Neuroblastoma (NB), a childhood neoplasm arising from neural crest cells, is characterized by a diversity of clinical behaviors ranging from spontaneous remission to rapid tumor progression and death. In addition to genetic abnormalities, recent studies have indicated that epigenetic aberrations also contribute toward NB pathogenesis. However, the epigenetic mechanisms underlying the pathogenesis of NB are largely unknown. Inhibition of euchromatic histone-lysine N-methyltransferase 2 (EHMT2) was evaluated through the measurement of H3K9Me2 levels. Cell proliferation was examined by cell counting in human NB cell lines (LA1-55n, IMR-5, and NMB). The RNA expression of EHMT2, MYCN, and p21 was measured by real-time PCR. The expression of PCNA, MYCN, p53, cyclinD1, H3, H3K27M2, and H3K9Me2 was examined by western blot analysis. In-vitro invasion and the effects of the EHMT2 inhibitor (BIX-01294) were assessed in the Transwell chamber assay. Caspase 3 and 8 activities were measured using a Caspase-Glo assay kit. The level of overall DNA methylation was measured by liquid chromatography-mass spectroscopy. BIX-01294, a specific inhibitor of EHMT2 (a key enzyme for histone H3 dimethylation at lysine-9), specifically decreases the overall H3K9Me2 level but not H3K27Me2. The inhibition of EHMT2 decreased the proliferation of NB cells and induced apoptosis by increasing caspase 8/caspase 3 activity. BIX-01294 inhibited NB cell mobility and invasion. This was accompanied by a decreased expression of the MYCN oncogene. Inhibition of EHMT2 enhanced a doxorubicin-induced inhibitory effect on cell proliferation. Finally, EHMT2 inhibition modulated overall DNA methylation levels in NB cells. Our results show that histone-lysine methylation is involved in cell proliferation, apoptosis, cell invasion, and overall DNA methylation in human NB cells. Further understanding of this mechanism may provide an insight into the pathogenesis of NB progression and lead to novel treatment

  17. Histone Demethylase Expression Enhances Human Somatic Cell Nuclear Transfer Efficiency and Promotes Derivation of Pluripotent Stem Cells.

    PubMed

    Chung, Young Gie; Matoba, Shogo; Liu, Yuting; Eum, Jin Hee; Lu, Falong; Jiang, Wei; Lee, Jeoung Eun; Sepilian, Vicken; Cha, Kwang Yul; Lee, Dong Ryul; Zhang, Yi

    2015-12-01

    The extremely low efficiency of human embryonic stem cell (hESC) derivation using somatic cell nuclear transfer (SCNT) limits its potential application. Blastocyst formation from human SCNT embryos occurs at a low rate and with only some oocyte donors. We previously showed in mice that reduction of histone H3 lysine 9 trimethylation (H3K9me3) through ectopic expression of the H3K9me3 demethylase Kdm4d greatly improves SCNT embryo development. Here we show that overexpression of a related H3K9me3 demethylase KDM4A improves human SCNT, and that, as in mice, H3K9me3 in the human somatic cell genome is an SCNT reprogramming barrier. Overexpression of KDM4A significantly improves the blastocyst formation rate in human SCNT embryos by facilitating transcriptional reprogramming, allowing efficient derivation of SCNT-derived ESCs using adult Age-related Macular Degeneration (AMD) patient somatic nuclei donors. This conserved mechanistic insight has potential applications for improving SCNT in a variety of contexts, including regenerative medicine. PMID:26526725

  18. ADP-ribosylation of histones by ARTD1: an additional module of the histone code?

    PubMed

    Hottiger, Michael O

    2011-06-01

    ADP-ribosylation is a covalent post-translational protein modification catalyzed by ADP-ribosyltransferases and is involved in important processes such as cell cycle regulation, DNA damage response, replication or transcription. Histones are ADP-ribosylated by ADP-ribosyltransferase diphtheria toxin-like 1 at specific amino acid residues, in particular lysines, of the histones tails. Specific ADP-ribosyl hydrolases and poly-ADP-ribose glucohydrolases degrade the ADP-ribose polymers. The ADP-ribose modification is read by zinc finger motifs or macrodomains, which then regulate chromatin structure and transcription. Thus, histone ADP-ribosylation may be considered an additional component of the histone code.

  19. Transcript Isoform Variation Associated with Cytosine Modification in Human Lymphoblastoid Cell Lines.

    PubMed

    Zhang, Xu; Zhang, Wei

    2016-06-01

    Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. PMID:27029734

  20. Transcript Isoform Variation Associated with Cytosine Modification in Human Lymphoblastoid Cell Lines.

    PubMed

    Zhang, Xu; Zhang, Wei

    2016-06-01

    Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV.

  1. Histone Octamer

    NASA Technical Reports Server (NTRS)

    1997-01-01

    This is a large 2 mm crystal of histone octamer, grown on STS-81. A very dynamic structure which functions in many aspects of gene regulation from control of gene activity to the more subtle mechanisms of genetic imprinting. Principle Investigator is Dan Carter of New Century Pharmaceuticals.

  2. Histone Octamer

    NASA Technical Reports Server (NTRS)

    1997-01-01

    1 mm histone octamer crystal grown on STS-81. A very dynamic structure which functions in many aspects of gene regulation from control of gene activity to the more subtle mechanisms of genetic imprinting. Principle Investigator is Dan Carter of New Century Pharmaceuticals.

  3. Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.; Zimonjic, D.; Hatch, C.; Bonner, W. )

    1994-03-15

    The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.

  4. Critical role of histone turnover in neuronal transcription and plasticity

    PubMed Central

    Maze, Ian; Wenderski, Wendy; Noh, Kyung-Min; Bagot, Rosemary C.; Tzavaras, Nikos; Purushothaman, Immanuel; Elsässer, Simon J.; Guo, Yin; Ionete, Carolina; Hurd, Yasmin L.; Tamminga, Carol A.; Halene, Tobias; Farrelly, Lorna; Soshnev, Alexey A.; Wen, Duancheng; Rafii, Shahin; Birtwistle, Marc R.; Akbarian, Schahram; Buchholz, Bruce A.; Blitzer, Robert D.; Nestler, Eric J.; Yuan, Zuo-Fei; Garcia, Benjamin A.; Shen, Li; Molina, Henrik; Allis, C. David

    2015-01-01

    Summary Turnover and exchange of nucleosomal histones and their variants, a process long believed to be static in post-replicative cells, remains largely unexplored in brain. Here, we describe a novel mechanistic role for HIRA (histone cell cycle regulator) and proteasomal degradation associated histone dynamics in the regulation of activity-dependent transcription, synaptic connectivity and behavior. We uncover a dramatic developmental profile of nucleosome occupancy across the lifespan of both rodents and humans, with the histone variant H3.3 accumulating to near saturating levels throughout the neuronal genome by mid-adolescence. Despite such accumulation, H3.3 containing nucleosomes remain highly dynamic–in a modification independent manner–to control neuronal- and glial-specific gene expression patterns throughout life. Manipulating H3.3 dynamics in both embryonic and adult neurons confirmed its essential role in neuronal plasticity and cognition. Our findings establish histone turnover as a critical, and previously undocumented, regulator of cell-type specific transcription and plasticity in mammalian brain. PMID:26139371

  5. DNA associated with hyperacetylated histone is preferentially digested by DNase I.

    PubMed Central

    Sealy, L; Chalkley, R

    1978-01-01

    Butyrate-treated cells give rise to massive hyperacetylation of histones and have been used to test the idea that regions of DNA in association with hyperacetylated histones are preferentially solubilized upon digestion with DNase I. Such hyperacetylated histones can be derived from both pre-existing histones or from histone newly synthesized in the presence of butyrate which leads to extreme modification. The DNA in association with both types of hypermodified histone is equally and selectively digested. PMID:673837

  6. Molecular basis for histone acetyltransferase regulation by binding partners, associated domains, and autoacetylation

    PubMed Central

    McCullough, Cheryl E.; Marmorstein, Ronen

    2016-01-01

    Acetylation is a post-translational modification (PTM) that regulates chromatin dynamics and function. Dysregulation of acetylation or acetyltransferase activity has been correlated with several human diseases. Many, if not all histone acetyltransferases (HATs) are regulated in part through tethered domains, association with binding partners or post-translational modification, including predominantly acetylation. This review focuses on what is currently understood at the molecular level of HAT regulation as it occurs via binding partners, associated domains, and autoacetylation. PMID:26555232

  7. Requirement of a novel splicing variant of human histone deacetylase 6 for TGF-{beta}1-mediated gene activation

    SciTech Connect

    Zhuang, Yan; Nguyen, Hong T.; Lasky, Joseph A.; Cao, Subing; Li, Cui; Hu, Jiyao; Guo, Xinyue; Burow, Matthew E.; Shan, Bin

    2010-02-19

    Histone deacetylase 6 (HDAC6) belongs to the family of class IIb HDACs and predominantly deacetylates non-histone proteins in the cytoplasm via the C-terminal deacetylase domain of its two tandem deacetylase domains. HDAC6 modulates fundamental cellular processes via deacetylation of {alpha}-tubulin, cortactin, molecular chaperones, and other peptides. Our previous study indicates that HDAC6 mediates TGF-{beta}1-induced epithelial-mesenchymal transition (EMT) in A549 cells. In the current study, we identify a novel splicing variant of human HDAC6, hHDAC6p114. The hHDAC6p114 mRNA arises from incomplete splicing and encodes a truncated isoform of the hHDAC6p114 protein of 114 kDa when compared to the major isoform hHDAC6p131. The hHDAC6p114 protein lacks the first 152 amino acids from N-terminus in the hHDAC6p131 protein, which harbors a nuclear export signal peptide and 76 amino acids of the N-terminal deacetylase domain. hHDAC6p114 is intact in its deacetylase activity against {alpha}-tubulin. The expression hHDAC6p114 is elevated in a MCF-7 derivative that exhibits an EMT-like phenotype. Moreover, hHDAC6p114 is required for TGF-{beta}1-activated gene expression associated with EMT in A549 cells. Taken together, our results implicate that expression and function of hHDAC6p114 is differentially regulated when compared to hHDAC6p131.

  8. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  9. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  10. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  11. Post-Training Intrahippocampal Inhibition of Class I Histone Deacetylases Enhances Long-Term Object-Location Memory

    ERIC Educational Resources Information Center

    Hawk, Joshua D.; Florian, Cedrick; Abel, Ted

    2011-01-01

    Long-term memory formation involves covalent modification of the histone proteins that package DNA. Reducing histone acetylation by mutating histone acetyltransferases impairs long-term memory, and enhancing histone acetylation by inhibiting histone deacetylases (HDACs) improves long-term memory. Previous studies using HDAC inhibitors to enhance…

  12. Mixtures of SCFA, composed according to physiologically available concentrations in the gut lumen, modulate histone acetylation in human HT29 colon cancer cells.

    PubMed

    Kiefer, Jeannette; Beyer-Sehlmeyer, Gabriele; Pool-Zobel, Beatrice L

    2006-11-01

    Intake of fibre has beneficial properties on gut health. Butyrate, a product of bacterial gut fermentation, is thought to contribute to positive effects by retarding growth and enhancing apoptosis of tumour cells. One mechanism is seen in its capacity to modulate histone acetylation and thereby transcriptional activity of genes. Next to butyrate, propionate and acetate are also major products of gut fermentation and together they may exert different potencies of cellular effects than butyrate alone. Since virtually nothing is known on combination effects by SCFA mixtures, here we had the aim to assess how physiological relevant concentrations and mixtures of SCFA modulate histone acetylation in human colon cells. HT29 colon cancer cells were incubated with mixtures of butyrate, acetate and propionate and with the individual compounds as controls. Histone acetylation was determined with acid-urea gel electrophoresis and immunoblotting. Acetylated histones slowly increased over 24 h and persisted up to 72 h in butyrate-treated HT29 cells. Butyrate (5-40 mM) and propionate (20-40 mM) enhanced histone acetylation significantly after 24 h incubation, whereas acetate (2.5-80 mM) was ineffective. Mixtures of these SCFA also modulated histone acetylation, mainly due to additive effects of butyrate and propionate, but not due to acetate. In conclusion, physiological concentrations of propionate together with butyrate could have more profound biological activities than generally assumed. Together, these SCFA could possibly mediate important processes related to an altered transcriptional gene activation and thus contribute to biological effects possibly related to cancer progression or prevention.

  13. Time course modifications in organotypic culture of human neuroretina.

    PubMed

    Fernandez-Bueno, Iván; Fernández-Sánchez, Laura; Gayoso, Manuel J; García-Gutierrez, María T; Pastor, José C; Cuenca, Nicolás

    2012-11-01

    The purpose of this study was to characterize organ culture of human neuroretina and to establish survival and early degeneration patterns of neural and glial cells. Sixteen neuroretina explants were prepared from 2 postmortem eyes of 2 individuals. Four explants were used as fresh retina controls, and 12 were evaluated at 3, 6, and 9 days of culture. Neuroretina explants (5 × 5 mm) were cultured in Transwell(®) dishes with the photoreceptor layer facing the supporting membrane. Culture medium (Neurobasal A-based) was maintained in contact with the membrane beneath the explant. Cryostat and ultrathin sections were prepared for immunohistochemistry and electron microscopy. Neuroretinal modifications were evaluated after toluidine blue staining and after immunostaining for neuronal and glial cell markers. Ultrastructural changes were analyzed by electron microscopy. From 0 to 9 days in culture, there was progressive retinal degeneration, including early pyknosis of photoreceptor nuclei, cellular vacuolization in the ganglion cell layer, decrease of both plexiform layer thicknesses, disruption and truncation of photoreceptor outer segments (OS), and marked reduction in the number of nuclei at both nuclear layers where the cells were less densely packed. At 3 days there was swelling of cone OS with impairment of pedicles, loss of axons and dendrites of horizontal and rod bipolar cells that stained for calbindin (CB) and protein kinase C (PKC-α), respectively. After 9 days, horizontal cells were pyknotic and without terminal tips. There were similar degenerative processes in the outer plexiform layer for rod bipolar cells and loss of axon terminal lateral varicosities in the inner plexiform layer. Glial fibrillary acidic protein (GFAP) staining did not reveal a dramatic increase of gliosis in Müller cells. However, some Müller cells were CB immunoreactive at 6 days of culture. Over 9 days of culture, human neuroretina explants underwent morphological changes in

  14. CRL4(WDR23)-Mediated SLBP Ubiquitylation Ensures Histone Supply during DNA Replication.

    PubMed

    Brodersen, Mia M L; Lampert, Fabienne; Barnes, Christopher A; Soste, Martin; Piwko, Wojciech; Peter, Matthias

    2016-05-19

    To maintain genome integrity and epigenetic information, mammalian cells must carefully coordinate the supply and deposition of histones during DNA replication. Here we report that the CUL4 E3 ubiquitin ligase complex CRL4(WDR23) directly regulates the stem-loop binding protein (SLBP), which orchestrates the life cycle of histone transcripts including their stability, maturation, and translation. Lack of CRL4(WDR23) activity is characterized by depletion of histones resulting in inhibited DNA replication and a severe slowdown of growth in human cells. Detailed analysis revealed that CRL4(WDR23) is required for efficient histone mRNA 3' end processing to produce mature histone mRNAs for translation. CRL4(WDR23) binds and ubiquitylates SLBP in vitro and in vivo, and this modification activates SLBP function in histone mRNA 3' end processing without affecting its protein levels. Together, these results establish a mechanism by which CUL4 regulates DNA replication and possible additional chromatin transactions by controlling the concerted expression of core histones.

  15. Disruption of IkappaB kinase (IKK)-mediated RelA serine 536 phosphorylation sensitizes human multiple myeloma cells to histone deacetylase (HDAC) inhibitors.

    PubMed

    Dai, Yun; Chen, Shuang; Wang, Li; Pei, Xin-Yan; Funk, Vanessa L; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-09-30

    Post-translational modifications of RelA play an important role in regulation of NF-κB activation. We previously demonstrated that in malignant hematopoietic cells, histone deacetylase inhibitors (HDACIs) induced RelA hyperacetylation and NF-κB activation, attenuating lethality. We now present evidence that IκB kinase (IKK) β-mediated RelA Ser-536 phosphorylation plays a significant functional role in promoting RelA acetylation, inducing NF-κB activation, and limiting HDACI lethality in human multiple myeloma (MM) cells. Immunoblot profiling revealed that although basal RelA phosphorylation varied in MM cells, Ser-536 phosphorylation correlated with IKK activity. Exposure to the pan-HDACIs vorinostat or LBH-589 induced phosphorylation of IKKα/β (Ser-180/Ser-181) and RelA (Ser-536) in MM cells, including cells expressing an IκBα "super-repressor," accompanied by increased RelA nuclear translocation, acetylation, DNA binding, and transactivation activity. These events were substantially blocked by either pan-IKK or IKKβ-selective inhibitors, resulting in marked apoptosis. Consistent with these events, inhibitory peptides targeting either the NF-κB essential modulator (NEMO) binding domain for IKK complex formation or RelA phosphorylation sites also significantly increased HDACI lethality. Moreover, IKKβ knockdown by shRNA prevented Ser-536 phosphorylation and significantly enhanced HDACI susceptibility. Finally, introduction of a nonphosphorylatable RelA mutant S536A, which failed to undergo acetylation in response to HDACIs, impaired NF-κB activation and increased cell death. These findings indicate that HDACIs induce Ser-536 phosphorylation of the NF-κB subunit RelA through an IKKβ-dependent mechanism, an action that is functionally involved in activation of the cytoprotective NF-κB signaling cascade primarily through facilitation of RelA acetylation rather than nuclear translocation. PMID:21816815

  16. HistoneDB 2.0: a histone database with variants--an integrated resource to explore histones and their variants.

    PubMed

    Draizen, Eli J; Shaytan, Alexey K; Mariño-Ramírez, Leonardo; Talbert, Paul B; Landsman, David; Panchenko, Anna R

    2016-01-01

    Compaction of DNA into chromatin is a characteristic feature of eukaryotic organisms. The core (H2A, H2B, H3, H4) and linker (H1) histone proteins are responsible for this compaction through the formation of nucleosomes and higher order chromatin aggregates. Moreover, histones are intricately involved in chromatin functioning and provide a means for genome dynamic regulation through specific histone variants and histone post-translational modifications. 'HistoneDB 2.0--with variants' is a comprehensive database of histone protein sequences, classified by histone types and variants. All entries in the database are supplemented by rich sequence and structural annotations with many interactive tools to explore and compare sequences of different variants from various organisms. The core of the database is a manually curated set of histone sequences grouped into 30 different variant subsets with variant-specific annotations. The curated set is supplemented by an automatically extracted set of histone sequences from the non-redundant protein database using algorithms trained on the curated set. The interactive web site supports various searching strategies in both datasets: browsing of phylogenetic trees; on-demand generation of multiple sequence alignments with feature annotations; classification of histone-like sequences and browsing of the taxonomic diversity for every histone variant. HistoneDB 2.0 is a resource for the interactive comparative analysis of histone protein sequences and their implications for chromatin function. Database URL: http://www.ncbi.nlm.nih.gov/projects/HistoneDB2.0.

  17. Structures of Metal-Substituted Human Histone Deacetylase 8 Provide Mechanistic Inferences on Biological Function

    SciTech Connect

    Dowling, Daniel P.; Gattis, Samuel G.; Fierke, Carol A.; Christianson, David W.

    2010-08-23

    The metal-dependent histone deacetylases (HDACs) adopt an {alpha}/{beta} protein fold first identified in rat liver arginase. Despite insignificant overall amino acid sequence identity, these enzymes share a strictly conserved metal binding site with divergent metal specificity and stoichiometry. HDAC8, originally thought to be a Zn{sup 2+}-metallohydrolase, exhibits increased activity with Co{sup 2+} and Fe{sup 2+} cofactors based on k{sub cat}/K{sub M} (Gantt, S. L., Gattis, S. G., and Fierke, C. A. (2006) Biochemistry 45, 6170-6178). Here, we report the first X-ray crystal structures of metallo-substituted HDAC8, Co{sup 2+}-HDAC8, D101L Co{sup 2+}-HDAC8, D101L Mn{sup 2+}-HDAC8, and D101L Fe{sup 2+}-HDAC8, each complexed with the inhibitor M344. Metal content of protein samples in solution is confirmed by inductively coupled plasma mass spectrometry. For the crystalline enzymes, peaks in Bijvoet difference Fourier maps calculated from X-ray diffraction data collected near the respective elemental absorption edges confirm metal substitution. Additional solution studies confirm incorporation of Cu{sup 2+}; Fe{sup 3+} and Ni{sup 2+} do not bind under conditions tested. The metal dependence of the substrate K{sub M} values and the K{sub i} values of hydroxamate inhibitors that chelate the active site metal are consistent with substrate-metal coordination in the precatalytic Michaelis complex that enhances catalysis. Additionally, although HDAC8 binds Zn{sup 2+} nearly 106-fold more tightly than Fe{sup 2+}, the affinities for both metal ions are comparable to the readily exchangeable metal concentrations estimated in living cells, suggesting that HDAC8 could bind either or both Fe{sup 2+} or Zn{sup 2+} in vivo.

  18. Analysis of the genomic response of human prostate cancer cells to histone deacetylase inhibitors

    PubMed Central

    Kortenhorst, Madeleine SQ; Wissing, Michel D; Rodriguez, Ronald; Kachhap, Sushant K; Jans, Judith JM; Van der Groep, Petra; Verheul, Henk MW; Gupta, Anuj; Aiyetan, Paul O; van der Wall, Elsken; Carducci, Michael A; Van Diest, Paul J; Marchionni, Luigi

    2013-01-01

    Histone deacetylases (HDACs) have emerged as important targets for cancer treatment. HDAC-inhibitors (HDACis) are well tolerated in patients and have been approved for the treatment of patients with cutaneous T-cell lymphoma (CTCL). To improve the clinical benefit of HDACis in solid tumors, combination strategies with HDACis could be employed. In this study, we applied Analysis of Functional Annotation (AFA) to provide a comprehensive list of genes and pathways affected upon HDACi-treatment in prostate cancer cells. This approach provides an unbiased and objective approach to high throughput data mining. By performing AFA on gene expression data from prostate cancer cell lines DU-145 (an HDACi-sensitive cell line) and PC3 (a relatively HDACi-resistant cell line) treated with HDACis valproic acid or vorinostat, we identified biological processes that are affected by HDACis and are therefore potential treatment targets for combination therapy. Our analysis revealed that HDAC-inhibition resulted among others in upregulation of major histocompatibility complex (MHC) genes and deregulation of the mitotic spindle checkpoint by downregulation of genes involved in mitosis. These findings were confirmed by AFA on publicly available data sets from HDACi-treated prostate cancer cells. In total, we analyzed 375 microarrays with HDACi treated and non-treated (control) prostate cancer cells. All results from this extensive analysis are provided as an online research source (available at the journal’s website and at http://luigimarchionni.org/HDACIs.html). By publishing this data, we aim to enhance our understanding of the cellular changes after HDAC-inhibition, and to identify novel potential combination strategies with HDACis for the treatment of prostate cancer patients. PMID:23880963

  19. Plant polyphenols and oxidative metabolites of the herbal alkenylbenzene methyleugenol suppress histone deacetylase activity in human colon carcinoma cells.

    PubMed

    Groh, Isabel Anna Maria; Chen, Chen; Lüske, Claudia; Cartus, Alexander Thomas; Esselen, Melanie

    2013-01-01

    Evidence has been provided that diet and environmental factors directly influence epigenetic mechanisms associated with cancer development in humans. The inhibition of histone deacetylase (HDAC) activity and the disruption of the HDAC complex have been recognized as a potent strategy for cancer therapy and chemoprevention. In the present study, we investigated whether selected plant constituents affect HDAC activity or HDAC1 protein status in the human colon carcinoma cell line HT29. The polyphenols (-)-epigallocatechin-3-gallate (EGCG) and genistein (GEN) as well as two oxidative methyleugenol (ME) metabolites were shown to inhibit HDAC activity in intact HT29 cells. Concomitantly, a significant decrease of the HDAC1 protein level was observed after incubation with EGCG and GEN, whereas the investigated ME metabolites did not affect HDAC1 protein status. In conclusion, dietary compounds were found to possess promising HDAC-inhibitory properties, contributing to epigenetic alterations in colon tumor cells, which should be taken into account in further risk/benefit assessments of polyphenols and alkenylbenzenes.

  20. Plant Polyphenols and Oxidative Metabolites of the Herbal Alkenylbenzene Methyleugenol Suppress Histone Deacetylase Activity in Human Colon Carcinoma Cells

    PubMed Central

    Groh, Isabel Anna Maria; Chen, Chen; Lüske, Claudia; Cartus, Alexander Thomas; Esselen, Melanie

    2013-01-01

    Evidence has been provided that diet and environmental factors directly influence epigenetic mechanisms associated with cancer development in humans. The inhibition of histone deacetylase (HDAC) activity and the disruption of the HDAC complex have been recognized as a potent strategy for cancer therapy and chemoprevention. In the present study, we investigated whether selected plant constituents affect HDAC activity or HDAC1 protein status in the human colon carcinoma cell line HT29. The polyphenols (−)-epigallocatechin-3-gallate (EGCG) and genistein (GEN) as well as two oxidative methyleugenol (ME) metabolites were shown to inhibit HDAC activity in intact HT29 cells. Concomitantly, a significant decrease of the HDAC1 protein level was observed after incubation with EGCG and GEN, whereas the investigated ME metabolites did not affect HDAC1 protein status. In conclusion, dietary compounds were found to possess promising HDAC-inhibitory properties, contributing to epigenetic alterations in colon tumor cells, which should be taken into account in further risk/benefit assessments of polyphenols and alkenylbenzenes. PMID:23476753

  1. Neuronal developmental gene and miRNA signatures induced by histone deacetylase inhibitors in human embryonic stem cells

    PubMed Central

    Meganathan, K; Jagtap, S; Srinivasan, S P; Wagh, V; Hescheler, J; Hengstler, J; Leist, M; Sachinidis, A

    2015-01-01

    Human embryonic stem cells (hESCs) may be applied to develop human-relevant sensitive in vitro test systems for monitoring developmental toxicants. The aim of this study was to identify potential developmental toxicity mechanisms of the histone deacetylase inhibitors (HDAC) valproic acid (VPA), suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA) relevant to the in vivo condition using a hESC model in combination with specific differentiation protocols and genome-wide gene expression and microRNA profiling. Analysis of the gene expression data showed that VPA repressed neural tube and dorsal forebrain (OTX2, ISL1, EMX2 and SOX10)-related transcripts. In addition, VPA upregulates axonogenesis and ventral forebrain-associated genes, such as SLIT1, SEMA3A, DLX2/4 and GAD2. HDACi-induced expression of miR-378 and knockdown of miR-378 increases the expression of OTX2 and EMX2, which supports our hypothesis that HDACi targets forebrain markers through miR-378. In conclusion, multilineage differentiation in vitro test system is very sensitive for monitoring molecular activities relevant to in vivo neuronal developmental toxicity. Moreover, miR-378 seems to repress the expression of the OTX2 and EMX2 and therefore could be a regulator of the development of neural tube and dorsal forebrain neurons. PMID:25950486

  2. General Base-General Acid Catalysis in Human Histone Deacetylase 8.

    PubMed

    Gantt, Sister M Lucy; Decroos, Christophe; Lee, Matthew S; Gullett, Laura E; Bowman, Christine M; Christianson, David W; Fierke, Carol A

    2016-02-01

    Histone deacetylases (HDACs) regulate cellular processes such as differentiation and apoptosis and are targeted by anticancer therapeutics in development and in the clinic. HDAC8 is a metal-dependent class I HDAC and is proposed to use a general acid-base catalytic pair in the mechanism of amide bond hydrolysis. Here, we report site-directed mutagenesis and enzymological measurements to elucidate the catalytic mechanism of HDAC8. Specifically, we focus on the catalytic function of Y306 and the histidine-aspartate dyads H142-D176 and H143-D183. Additionally, we report X-ray crystal structures of four representative HDAC8 mutants: D176N, D176N/Y306F, D176A/Y306F, and H142A/Y306F. These structures provide a useful framework for understanding enzymological measurements. The pH dependence of kcat/KM for wild-type Co(II)-HDAC8 is bell-shaped with two pKa values of 7.4 and 10.0. The upper pKa reflects the ionization of the metal-bound water molecule and shifts to 9.1 in Zn(II)-HDAC8. The H142A mutant has activity 230-fold lower than that of wild-type HDAC8, but the pKa1 value is not altered. Y306F HDAC8 is 150-fold less active than the wild-type enzyme; crystal structures show that Y306 hydrogen bonds with the zinc-bound substrate carbonyl, poised for transition state stabilization. The H143A and H142A/H143A mutants exhibit activity that is >80000-fold lower than that of wild-type HDAC8; the buried D176N and D176A mutants have significant catalytic effects, with more subtle effects caused by D183N and D183A. These enzymological and structural studies strongly suggest that H143 functions as a single general base-general acid catalyst, while H142 remains positively charged and serves as an electrostatic catalyst for transition state stabilization.

  3. A brief histone in time: understanding the combinatorial functions of histone PTMs in the nucleosome context.

    PubMed

    Ng, Marlee K; Cheung, Peter

    2016-02-01

    It has been over 50 years since Allfrey et al. proposed that histone acetylation regulates RNA synthesis, and the study of histone modifications has progressed at an extraordinary pace for the past two decades. In this review, we provide a perspective on some key events and advances in our understanding of histone modifications. We also highlight reagents and tools from past to present that facilitated progress in this research field. Using histone H3 phosphorylation as an underlying thread, we review the rationale that led to the proposal of the histone code hypothesis, as well as examples that illustrate the concepts of combinatorial histone modifications and cross-talk pathways. We further highlight the importance of investigating these mechanisms in the context of nucleosomes rather than just at the histone level and present current and developing approaches for such studies. Overall, research on histone modifications has yielded great mechanistic insights into the regulation of genomic functions, and extending these studies using nucleosomes will further elucidate the complexity of these pathways in a more physiologically relevant context.

  4. AURKA induces EMT by regulating histone modification through Wnt/β-catenin and PI3K/Akt signaling pathway in gastric cancer

    PubMed Central

    Liu, Xi; Li, Zhaoxia; Song, Yue; Wang, Rui; Han, Lei; Wang, Qixue; Jiang, Kui; Kang, Chunsheng; Zhang, Qingyu

    2016-01-01

    Gastric cancer, a highly invasive and aggressive malignancy, is the third leading cause of death from cancer worldwide. Genetic association studies have successfully revealed several important genes consistently associated with gastric cancer to date. However, these robust gastric cancer-associated genes do not fully elucidate the mechanisms underlying the development and progression of the disease. In the present study, we performed an alternative approach, a gene expression-based genome-wide association study (eGWAS) across 13 independent microarray experiments (including 251 gastric cancer cases and 428 controls), to identify top candidates (p<0.00001). Additionally, we conducted gene ontology analysis, pathway analysis and network analysis and identified aurora kinase A (AURKA) as our candidate. We observed that MLN8237, which is a specific inhibitor of AURKA, decreased the β-catenin and the phosphorylation of Akt1 and GSK-3β, as well as blocked the Akt and Wnt signaling pathways. Furthermore, MLN8237 arrested the cells in the G2/M phase. The activity of Wnt and Akt signaling pathways affected the level of histone methylation significantly, and we supposed that MLN8237 affected the level of histone methylation through these two signaling pathways. Additionally, the treatment of MLN8237 influenced the level of H3K4 me1/2/3 and H3K27 me1/2/3. Chip data on cell lines suggested that MLN8237 increases the level of H3K27 me3 on the promoter of Twist and inhibits EMT (epithelial-mesenchymal transition). In summary, AURKA is a potential therapeutic target in gastric cancer and induces EMT through histone methylation. PMID:27121204

  5. Poly (ADP-ribose) polymerase 1 transcriptional regulation: A novel crosstalk between histone modification H3K9ac and ETS1 motif hypomethylation in BRCA1-mutated ovarian cancer

    PubMed Central

    Li, Da; Bi, Fang-Fang; Cao, Ji-Min; Cao, Chen; Li, Chun-Yan; Liu, Bo; Yang, Qing

    2014-01-01

    Poly (ADP-ribose) polymerase 1 (PARP1) plays a critical role in ovarian cancer progression. However, the epigenetic mechanism regulating PARP1 transcription remains largely unknown. Here, we show that the hypomethylated ETS1 motif is a key regulatory element for the PARP1 gene in BRCA1-mutated ovarian cancer. Mechanistically, the ETS1 motif hypomethylation-mediated increase of active histone marker H3K9ac and transcription factor ETS1 enrichment synergistically activates PARP1 transcription. Clinicopathological data indicate that a hypomethylated ETS1 motif was associated with high-grade tumors (P = 0.026) and pN1 (P = 0.002). Univariate survival analysis demonstrated an association between the hypomethylated ETS1 motif and an increased risk of death in BRCA1-mutated ovarian cancer patients. Our findings imply that the genetic (such as BRCA1 mutation) and epigenetic mechanisms (such as hypomethylated ETS1 motif, and histone modification H3K9ac and transcription factor ETS1 binding) are jointly involved in the malignant progression of PARP1-related ovarian cancer. PMID:24448423

  6. Gestational choline supplementation normalized fetal alcohol-induced alterations in histone modifications, DNA methylation and POMC gene expression in β-endorphin-producing POMC neurons of the hypothalamus

    PubMed Central

    Bekdash, Rola A.; Zhang, Changqing; Sarkar, Dipak K.

    2013-01-01

    Background Prenatal exposure to ethanol reduces the expression of hypothalamic proopiomelanocortin (POMC) gene, known to control various physiological functions including the organismal stress response. In this study, we determined whether the changes in POMC neuronal functions are associated with altered expressions of histone-modifying and DNA-methylating enzymes in POMC-producing neurons, since these enzymes are known to be involved in regulation of gene expression. In addition, we tested whether gestational choline supplementation prevents the adverse effects of ethanol on these neurons. Methods Pregnant rat dams were fed with alcohol-containing liquid diet or control diet during gestational days 7 and 21 with or without choline, and their male offspring rats were used during the adult period. Using double-immunohistochemistry, real-time reverse transcription polymerase chain reaction (RT-PCR) and methylation specific RT-PCR, we determined protein and mRNA levels of histone-modifying and DNA-methylating enzymes, and the changes in POMC gene methylation and expression in the hypothalamus of adult male offspring rats. Additionally, we measured the basal and lipopolysaccharide (LPS)-induced corticosterone levels in plasma by enzyme-linked immunoabsorbent assay. Results Prenatal ethanol treatment suppressed hypothalamic levels of protein and mRNA of histone activation marks (H3K4me3, Set7/9, acetylated H3K9, phosphorylated H3S10) increased the repressive marks (H3K9me2, G9a, Setdb1) and DNA methylating enzyme (Dnmt1) and the methyl-CpG-binding protein (MeCP2). The treatment also elevated the level of POMC gene methylation, while it reduced levels of POMC mRNA and β-EP, and elevated corticosterone response to LPS. Gestational choline normalized the ethanol-altered protein and the mRNA levels of H3K4me3, Set7/9, H3K9me2, G9a, Setdb1, Dnmt1 and MeCP2. It also normalizes the changes in POMC gene methylation and gene expression, β-EP production and the corticosterone

  7. Dietary sulforaphane, a histone deacetylase inhibitor for cancer prevention.

    PubMed

    Ho, Emily; Clarke, John D; Dashwood, Roderick H

    2009-12-01

    The reversible acetylation of histones is an important mechanism of gene regulation. During prostate cancer progression, specific modifications in acetylation patterns on histones are apparent. Targeting the epigenome, including the use of histone deacetylase (HDAC) inhibitors, is a novel strategy for cancer chemoprevention. Recently, drugs classified as HDAC inhibitors have shown promise in cancer clinical trials. We have previously found that sulforaphane (SFN), a compound found in cruciferous vegetables, inhibits HDAC activity in human colorectal and prostate cancer cells. Based on the similarity of SFN metabolites and other phytochemicals to known HDAC inhibitors, we previously demonstrated that sulforaphane acted as an HDAC inhibitor in the prostate, causing enhanced histone acetylation, derepression of P21 and Bax, and induction of cell cycle arrest/apoptosis, leading to cancer prevention. The ability of SFN to target aberrant acetylation patterns, in addition to effects on phase 2 enzymes, may make it an effective chemoprevention agent. These studies are important because of the potential to qualify or change recommendations for high-risk prostate cancer patients and thereby increase their survival through simple dietary choices incorporating easily accessible foods into their diets. These studies also will provide a strong scientific foundation for future large-scale human clinical intervention studies.

  8. MHC class II transactivator represses human IL-4 gene transcription by interruption of promoter binding with CBP/p300, STAT6 and NFAT1 via histone hypoacetylation

    PubMed Central

    Zhou, Xiaorong; Jiang, Yang; Lu, Liming; Ding, Qing; Jiao, Zhijun; Zhou, Yun; Xin, Lijun; Chou, Kuang-Yen

    2007-01-01

    In addition to its property of enhancing major histocompatibility complex (MHC) class II expression, the class II transactivator (CIITA) was recently demonstrated to be involved in T helper type 1/type 2 (Th1/Th2) differentiation by regulating interleukin-4 (IL-4) gene transcription. There was however, controversy regarding whether CIITA promotes or suppresses IL-4 expression in the experiments with transgenic mice. To clarify the discrepancy by using simpler experimental systems, human Jurkat T cells that express IL-4 but not interferon-γ, even if stimulated with phorbol 12-myristate 13-acetate plus ionomycin, were used for CIITA transfection. Significant suppression of IL-4 gene expression was demonstrated. Simultaneously, histones H3 and H4 in the IL-4 promoter were hypoacetylated. The suppression could be totally reversed by the histone deacetylatase inhibitor trichostatin A. Furthermore, the IL-4 expression was determined in primarily established human Th1/Th2 cells to which CIITA small interference RNA (siRNA) had been introduced. A substantially increased level of IL-4 was recorded in the CIITA siRNA-transfected Th1 cells, which was in parallel with significantly enhanced acetylation in histone H3 of the IL-4 promoter. Chromatin immunoprecipitation analysis indicated that CIITA abrogated the binding of coactivator CBP/p300 and transcription factors STAT6/NFAT1 to IL-4 promoter in the CIITA-transfected cells. In conclusion, CIITA was active in the repression of transcription activation of human IL-4 gene in both the T-cell line and the primary human CD4 T cells by preventing transcription factors from binding to IL-4 promoter through histone hypoacetylation. Our data confirm a potential significant role of CIITA in controlling Th1/Th2 differentiation via modulation of IL-4 gene activation. PMID:17645498

  9. Histone deacetylase inhibitor AR42 regulates telomerase activity in human glioma cells via an Akt-dependent mechanism.

    PubMed

    Yang, Ya-Luen; Huang, Po-Hsien; Chiu, Hao-Chieh; Kulp, Samuel K; Chen, Ching-Shih; Kuo, Cheng-Ju; Chen, Huan-Da; Chen, Chang-Shi

    2013-05-24

    Epigenetic regulation via abnormal activation of histone deacetylases (HDACs) is a mechanism that leads to cancer initiation and promotion. Activation of HDACs results in transcriptional upregulation of human telomerase reverse transcriptase (hTERT) and increases telomerase activity during cellular immortalization and tumorigenesis. However, the effects of HDAC inhibitors on the transcription of hTERT vary in different cancer cells. Here, we studied the effects of a novel HDAC inhibitor, AR42, on telomerase activity in a PTEN-null U87MG glioma cell line. AR42 increased hTERT mRNA in U87MG glioma cells, but suppressed total telomerase activity in a dose-dependent manner. Further analyses suggested that AR42 decreases the phosphorylation of hTERT via an Akt-dependent mechanism. Suppression of Akt phosphorylation and telomerase activity was also observed with PI3K inhibitor LY294002 further supporting the hypothesis that Akt signaling is involved in suppression of AR42-induced inhibition of telomerase activity. Finally, ectopic expression of a constitutive active form of Akt restored telomerase activity in AR42-treated cells. Taken together, our results demonstrate that the novel HDAC inhibitor AR42 can suppress telomerase activity by inhibiting Akt-mediated hTERT phosphorylation, indicating that the PI3K/Akt pathway plays an important role in the regulation of telomerase activity in response to this HDAC inhibitor.

  10. HUMAN PAPILLOMAVIRUS E7 ENHANCES HYPOXIA-INDUCIBLE FACTOR 1 MEDIATED TRANSCRIPTION BY INHIBITING BINDING OF HISTONE DEACETYLASES

    PubMed Central

    Bodily, Jason M.; Mehta, Kavi P. M.; Laimins, Laimonis A.

    2010-01-01

    Infection by human papillomaviruses (HPVs) leads to the formation of benign lesions, warts, and in some cases, cervical cancer. The formation of these lesions is dependent upon increased expression of pro-angiogenic factors. Angiogenesis is linked to tissue hypoxia through the activity of the oxygen sensitive hypoxia inducible factor 1α (HIF-1α). Our studies indicate that the HPV E7 protein enhances HIF-1 transcriptional activity while E6 functions to counteract the repressive effects of p53. Both high and low risk HPV E7 proteins were found to bind to HIF-1α through a domain located in the the N terminus. Importantly, the ability of E7 to enhance HIF-1 activity mapped to the C terminus and correlated with the displacement of the histone deacetylases HDAC1, HDAC4, and HDAC7 from HIF-1α by E7. Our findings describe a novel role of the E7 oncoprotein in activating the function of a key transcription factor mediating hypoxic responses by blocking the binding of HDACs. PMID:21148070

  11. Intercellular transfer of P-glycoprotein in human blood-brain barrier endothelial cells is increased by histone deacetylase inhibitors

    PubMed Central

    Noack, Andreas; Noack, Sandra; Buettner, Manuela; Naim, Hassan Y.; Löscher, Wolfgang

    2016-01-01

    The blood–brain barrier (BBB) controls the entry of compounds into the brain, thereby regulating brain homeostasis. Efflux transporters such as P-glycoprotein (Pgp) significantly contribute to BBB function. Multiple signaling pathways modulate the expression and activity of Pgp in response to xenobiotics and disease. A non-genetic way of intercellular transfer of Pgp occurs in cancer cells, but whether this also occurs in non-cancer cells such as endothelial cells that form the BBB is not known. A human brain endothelial cell line (hCMEC/D3) was used to study whether cell-to-cell Pgp transfer occurs during co-culturing with Pgp-EGFP expressing hCMEC/D3 cells. The Pgp-EGFP fusion protein was transferred from donor to recipient cells by cell-to-cell contact and Pgp-EGFP enriched vesicles, which were exocytosed by donor cells and endocytosed by adherent recipient cells. Flow cytometry experiments with the Pgp substrate eFLUXX-ID Gold demonstrated that the transferred Pgp is functional in the recipient cells. Exposure of the donor cells with inhibitors of histone deacetylases (HDACs) resulted in an enhanced intercellular Pgp transfer. Non-genetic transfer of a resistance phenotype and its regulation by HDACs is a novel mechanism of altering BBB functionality. This mechanism may have important implications for understanding drug-induced alterations in Pgp expression and activity. PMID:27375084

  12. Investigating Histone Acetylation Stoichiometry and Turnover Rate.

    PubMed

    Fan, J; Baeza, J; Denu, J M

    2016-01-01

    Histone acetylation is a dynamic epigenetic modification that functions in the regulation of DNA-templated reactions, such as transcription. This lysine modification is reversibly controlled by histone (lysine) acetyltransferases and deacetylases. Here, we present methods employing isotopic labeling and mass spectrometry (MS) to comprehensively investigate histone acetylation dynamics. Turnover rates of histone acetylation are determined by measuring the kinetics of labeling from (13)C-labeled precursors of acetyl-CoA, which incorporates (13)C-carbon onto histones via the acetyltransferase reaction. Overall histone acetylation states are assessed from complete protease digestion to single amino acids, which is followed by MS analysis. Determination of site-specific acetylation stoichiometry is achieved by chemically acetylating endogenous histones with isotopic acetic anhydride, followed by trypsin digestion and LC-MS analysis. Combining metabolic labeling with stoichiometric analysis permits determination of both acetylation level and acetylation dynamics. When comparing genetic, diet, or environmental perturbations, these methods permit both a global and site-specific evaluation of how histone acetylation is dynamically regulated.

  13. Investigating Histone Acetylation Stoichiometry and Turnover Rate.

    PubMed

    Fan, J; Baeza, J; Denu, J M

    2016-01-01

    Histone acetylation is a dynamic epigenetic modification that functions in the regulation of DNA-templated reactions, such as transcription. This lysine modification is reversibly controlled by histone (lysine) acetyltransferases and deacetylases. Here, we present methods employing isotopic labeling and mass spectrometry (MS) to comprehensively investigate histone acetylation dynamics. Turnover rates of histone acetylation are determined by measuring the kinetics of labeling from (13)C-labeled precursors of acetyl-CoA, which incorporates (13)C-carbon onto histones via the acetyltransferase reaction. Overall histone acetylation states are assessed from complete protease digestion to single amino acids, which is followed by MS analysis. Determination of site-specific acetylation stoichiometry is achieved by chemically acetylating endogenous histones with isotopic acetic anhydride, followed by trypsin digestion and LC-MS analysis. Combining metabolic labeling with stoichiometric analysis permits determination of both acetylation level and acetylation dynamics. When comparing genetic, diet, or environmental perturbations, these methods permit both a global and site-specific evaluation of how histone acetylation is dynamically regulated. PMID:27423860

  14. A mutational mimic analysis of histone H3 post-translational modifications: specific sites influence the conformational state of H3/H4, causing either positive or negative supercoiling of DNA.

    PubMed

    White, Rachel H; Keberlein, Melissa; Jackson, Vaughn

    2012-10-16

    Histone H3 has specific sites of post-translational modifications that serve as epigenetic signals to cellular machinery to direct various processes. Mutational mimics of these modifications (glutamine for acetylation, methionine and leucine for methylation, and glutamic acid for phosphorylation) were constructed at the relevant sites of the major histone variant, H3.2, and their effects on the conformational equilibrium of the H3/H4 tetramer at physiological ionic strength were determined when bound to or free of DNA. The deposition vehicle used for this analysis was NAP1, nucleosome assembly protein 1. Acetylation mimics in the N-terminus preferentially stabilized the left-handed conformer (DNA negatively supercoiled), and mutations within the globular region preferred the right-handed conformer (DNA positively supercoiled). The methylation mimics in the N-terminus tended to maintain characteristics similar to those of wild-type H3/H4; i.e., the conformational equilibrium maintains similar levels of both left- and right-handed conformers. Phosphorylation mimics facilitated a mixed effect, i.e., when at serines, the left-handed conformer, and at threonines, a mixture of both conformers. When double mutations were present, the conformational equilibrium was shifted dramatically, either leftward or rightward depending on the specific sites. In contrast, these mutations tended not to affect the direction and extent of supercoiling for variants H3.1 and H3.3. Variant H3.3 promoted only the left-handed conformer, and H3.1 tended to maintain both conformers. Additional experiments indicate the importance of a propagation mechanism for ensuring the formation of a particular superhelical state over an extended region of the DNA. The potential relevance of these results to the maintenance of epigenetic information on a gene is discussed.

  15. A mutational mimic analysis of histone H3 post-translational modifications: specific sites influence the conformational state of H3/H4, causing either positive or negative supercoiling of DNA.

    PubMed

    White, Rachel H; Keberlein, Melissa; Jackson, Vaughn

    2012-10-16

    Histone H3 has specific sites of post-translational modifications that serve as epigenetic signals to cellular machinery to direct various processes. Mutational mimics of these modifications (glutamine for acetylation, methionine and leucine for methylation, and glutamic acid for phosphorylation) were constructed at the relevant sites of the major histone variant, H3.2, and their effects on the conformational equilibrium of the H3/H4 tetramer at physiological ionic strength were determined when bound to or free of DNA. The deposition vehicle used for this analysis was NAP1, nucleosome assembly protein 1. Acetylation mimics in the N-terminus preferentially stabilized the left-handed conformer (DNA negatively supercoiled), and mutations within the globular region preferred the right-handed conformer (DNA positively supercoiled). The methylation mimics in the N-terminus tended to maintain characteristics similar to those of wild-type H3/H4; i.e., the conformational equilibrium maintains similar levels of both left- and right-handed conformers. Phosphorylation mimics facilitated a mixed effect, i.e., when at serines, the left-handed conformer, and at threonines, a mixture of both conformers. When double mutations were present, the conformational equilibrium was shifted dramatically, either leftward or rightward depending on the specific sites. In contrast, these mutations tended not to affect the direction and extent of supercoiling for variants H3.1 and H3.3. Variant H3.3 promoted only the left-handed conformer, and H3.1 tended to maintain both conformers. Additional experiments indicate the importance of a propagation mechanism for ensuring the formation of a particular superhelical state over an extended region of the DNA. The potential relevance of these results to the maintenance of epigenetic information on a gene is discussed. PMID:23003102

  16. Sodium arsenite represses the expression of myogenin in C2C12 mouse myoblast cells through histone modifications and altered expression of Ezh2, Glp, and Igf-1

    SciTech Connect

    Hong, Gia-Ming

    2012-05-01

    Arsenic is a toxicant commonly found in water systems and chronic exposure can result in adverse developmental effects including increased neonatal death, stillbirths, and miscarriages, low birth weight, and altered locomotor activity. Previous studies indicate that 20 nM sodium arsenite exposure to C2C12 mouse myocyte cells delayed myoblast differentiation due to reduced myogenin expression, the transcription factor that differentiates myoblasts into myotubes. In this study, several mechanisms by which arsenic could alter myogenin expression were examined. Exposing differentiating C2C12 cells to 20 nM arsenic increased H3K9 dimethylation (H3K9me2) and H3K9 trimethylation (H3K9me3) by 3-fold near the transcription start site of myogenin, which is indicative of increased repressive marks, and reduced H3K9 acetylation (H3K9Ac) by 0.5-fold, indicative of reduced permissive marks. Protein expression of Glp or Ehmt1, a H3-K9 methyltransferase, was also increased by 1.6-fold in arsenic-exposed cells. In addition to the altered histone remodeling status on the myogenin promoter, protein and mRNA levels of Igf-1, a myogenic growth factor, were significantly repressed by arsenic exposure. Moreover, a 2-fold induction of Ezh2 expression, and an increased recruitment of Ezh2 (3.3-fold) and Dnmt3a (∼ 2-fold) to the myogenin promoter at the transcription start site (− 40 to + 42), were detected in the arsenic-treated cells. Together, we conclude that the repressed myogenin expression in arsenic-exposed C2C12 cells was likely due to a combination of reduced expression of Igf-1, enhanced nuclear expression and promoter recruitment of Ezh2, and altered histone remodeling status on myogenin promoter (− 40 to + 42). -- Highlights: ► Igf-1 expression is decreased in C2C12 cells after 20 nM arsenite exposure. ► Arsenic exposure alters histone remodeling on the myogenin promoter. ► Glp expression, a H3–K9 methyltransferase, was increased in arsenic-exposed cells. ► Ezh2

  17. Histones in protistan evolution.

    PubMed

    Rizzo, P J

    1985-01-01

    The potential of comparative studies on histones for use in protistan evolution is discussed, using algal histones as specific examples. A basic premise for the importance of histones in protistan evolution is the observation that these proteins are completely absent in prokaryotes (and cytoplasmic organelles), but with few exceptions, the same five major histone types are found in all higher plants and animals. Since the histone content of the algae and other protists is not constant, some of these organisms may represent transition forms between the prokaryotic and eukaryotic modes of packaging the genetic material. Comparative studies of protistan histones may thus be of help in determining evolutionary relationships. However, several problems are encounter with protistan histones, including difficulties in isolating nuclei, proteolytic degradation, anomalous gel migration of histones, and difficulties in histone identification. Because of the above problems, and the observed variability in protistan histones, it is suggested that several criteria be employed for histone identification in protists.

  18. Targeting histone deacetylases for the treatment of disease

    PubMed Central

    Lawless, M W; Norris, S; O’Byrne, K J; Gray, S G

    2009-01-01

    Abstract The ‘histone code’ is a well-established hypothesis describing the idea that specific patterns of post-translational modifications to histones act like a molecular ‘code’ recognized and used by non-histone proteins to regulate specific chromatin functions. One modification, which has received significant attention, is that of histone acetylation. The enzymes that regulate this modification are described as lysine acetyltransferases or KATs, and histone deacetylases or HDACs. Due to their conserved catalytic domain HDACs have been actively targeted as a therapeutic target. The pro-inflammatory environment is increasingly being recognized as a critical element for both degenerative diseases and cancer. The present review will discuss the current knowledge surrounding the clinical potential and current development of histone deacetylases for the treatment of diseases for which a pro-inflammatory environment plays important roles, and the molecular mechanisms by which such inhibitors may play important functions in modulating the pro-inflammatory environment. PMID:19175682

  19. [Epigenetic modifications in human spermatozoon and its potential role in embryonic development].

    PubMed

    Shaoqin, Ge; Zhenghui, Zhao; Xueqian, Zhang; Yuan, Hao

    2014-05-01

    Spermatogenesis is a highly complex process involving mitotic cell division, meiosis and the process of spermiogenesis, during which unique and extensive chromatin and epigenetic modifications are remodeled to bring about specific epigenetic profiles for spermatozoa. Recent studies have shown that epigenetic modifications in mature spermatozoon play an important role in the developing embryo and its alterations in epigenetic patterns may increase the risk for fertilization failure, dysfunction of embryogenesis, preterm birth, low birthweight, congenital anomalies, perinatal mortality, and several other pregnancy-related complications seen at a higher frequency in babies conceived by in vitro fertilization (IVF). In this review, we assess the significance of epigenetic modifications (DNA methylation, histone retention and modification, RNAs and protamine) in mature spermatozoon and its potential role in embryonic development, and elucidate the relationship between altered epigenetic profile and associated diseases, providing basic information for preventing and treating male infertility, evaluating the epigenetic quality of sperm and reducing the risk of epigenetic diseases with babies conceived by assisted reproductive technology (ART). PMID:24846993

  20. HIV-1 Tat Upregulates Expression of Histone Deacetylase-2 (HDAC2) in Human Neurons: Implication for HIV-Associated Neurocognitive Disorder (HAND)

    PubMed Central

    Saiyed, Zainulabedin M.; Gandhi, Nimisha; Agudelo, Marisela; Napuri, Jessica; Samikkannu, Thangavel; Reddy, Pichili VB; Khatavkar, Pradnya; Yndart, Adriana; Saxena, Shailendra K.; Nair, Madhavan P.N.

    2011-01-01

    Histone deacetylases (HDACs) play a pivotal role in epigenetic regulation of transcription and homeostasis of protein acetylation in histones and other proteins involved in chromatin remodeling. Histone hypoacetylation and transcriptional dysfunction have been shown to be associated with a variety of neurodegenerative diseases. More recently, neuron specific overexpression of HDAC2 has been shown to modulate synaptic plasticity and learning behavior in mice. However, the role of HDAC2 in development of HIV-associated neurocognitive disorders (HAND) is not reported. Herein we report that HIV-1 Tat protein upregulate HDAC2 expression in neuronal cells leading to transcriptional repression of genes involved in synaptic plasticity and neuronal function thereby contributing to the progression of HAND. Our results indicate upregulation of HDAC2 by Tat treatment in dose and time dependant manner by human neuroblastoma SK-N-MC cells and primary human neurons. Further, HDAC2 overexpression was associated with concomitant downregulation in CREB and CaMKIIa genes that are known to regulate neuronal activity. These observed effects were completely blocked by HDAC2 inhibition. These results for the first time suggest the possible role of HDAC2 in development of HAND. Therefore, use of HDAC2 specific inhibitor in combination with HAART may be of therapeutic value in treatment of neurocognitive disorders observed in HIV-1 infected individuals. PMID:21315782

  1. In vivo protein binding sites and nuclease hypersensitivity in the promoter region of a cell cycle regulated human H3 histone gene.

    PubMed Central

    Pauli, U; Chrysogelos, S; Nick, H; Stein, G; Stein, J

    1989-01-01

    The chromatin structure and protein-DNA interactions of a cell cycle regulated human H3 histone gene have been examined at different levels of resolution. Using traditional Southern blot analysis we have investigated the accessibility of the H3 coding region and its flanking sequences to DNase I, S1 nuclease and restriction endonuclease digestion. Using the native genomic blotting method recently developed in our laboratory, two sites of protein-DNA interaction in the proximal 240 bp of the promoter region of this H3 gene were established. Further in vivo analysis of protein-DNA binding sites in intact cells by genomic sequencing revealed, with single nucleotide resolution, the guanine contacts and footprints of the proteins bound to the promoter. The relative locations of protein-DNA interactions in this H3 gene are similar to those identified in vivo and in vitro in a cell cycle dependent human H4 histone gene. The proteins complexed with the H3 histone gene promoter can be dissociated between 0.16 and 0.28 M NaCl. The protein-DNA contacts persist throughout the cell cycle and thus may have a functional relationship with the basal level of transcription of this H3 gene that occurs during and outside of S phase. Images PMID:2539585

  2. Structural insights into acetylated-histone H4 recognition by the bromodomain-PHD finger module of human transcriptional coactivator CBP.

    PubMed

    Plotnikov, Alexander N; Yang, Shuai; Zhou, Thomas Jiachi; Rusinova, Elena; Frasca, Antonio; Zhou, Ming-Ming

    2014-02-01

    Bromodomain functions as the acetyl-lysine binding domains to regulate gene transcription in chromatin. Bromodomains are rapidly emerging as new epigenetic drug targets for human diseases. However, owing to their transient nature and modest affinity, histone-binding selectivity of bromodomains has remained mostly elusive. Here, we report high-resolution crystal structures of the bromodomain-PHD tandem module of human transcriptional coactivator CBP bound to lysine-acetylated histone H4 peptides. The structures reveal that the PHD finger serves a structural role in the tandem module and that the bromodomain prefers lysine-acetylated motifs comprising a hydrophobic or aromatic residue at -2 and a lysine or arginine at -3 or -4 position from the acetylated lysine. Our study further provides structural insights into distinct modes of singly and diacetylated histone H4 recognition by the bromodomains of CBP and BRD4 that function differently as a transcriptional coactivator and chromatin organizer, respectively, explaining their distinct roles in control of gene expression in chromatin.

  3. Histone Ubiquitination and Deubiquitination in Transcription, DNA Damage Response, and Cancer

    PubMed Central

    Cao, Jian; Yan, Qin

    2012-01-01

    Histone post-transcriptional modifications play essential roles in regulation of all DNA related processes. Among them, histone ubiquitination has been discovered for more than three decades. However, its functions are still less well understood than other histone modifications such as methylation and acetylation. In this review, we will summarize our current understanding of histone ubiquitination and deubiquitination. In particular, we will focus on how they are regulated by histone ubiquitin ligases and deubiquitinating enzymes. We will then discuss the roles of histone ubiquitination in transcription and DNA damage response and the crosstalk between histone ubiquitination and other histone modifications. Finally, we will review the important roles of histone ubiquitination in stem cell biology and cancer. PMID:22649782

  4. Resetting the epigenetic histone code in the MRL-lpr/lpr mouse model of lupus by histone deacetylase inhibition.

    PubMed

    Garcia, Benjamin A; Busby, Scott A; Shabanowitz, Jeffrey; Hunt, Donald F; Mishra, Nilamadhab

    2005-01-01

    The baseline level of gene expression varies between healthy controls and systemic lupus erythematosus (SLE) patients, and among SLE patients themselves. These variations may explain the different clinical manifestations and severity of disease observed in SLE. Epigenetic mechanisms, which involve DNA and histone modifications, are predictably associated with distinct transcriptional states. To understand the interplay between various histone modifications, including acetylation and methylation, and lupus disease, we performed differential expression histone modification analysis in splenocytes from the MRL-lpr/lpr mouse model of lupus. Using stable isotope labeling in combination with mass spectrometry, we found global site-specific hypermethylation (except H3 K4 methylation) and hypoacetylation in histone H3 and H4 MRL-lpr/lpr mice compared to control MRL/MPJ mice. Moreover, we have identified novel histone modifications such as H3 K18 methylation, H4 K31 methylation, and H4 K31 acetylation that are differentially expressed in MRL-lpr/lpr mice compared to controls. Finally, in vivo administration of the histone deacetylase inhibitor trichostatin A (TSA) corrected the site-specific hypoacetylation states on H3 and H4 in MRL-lpr/lpr mice with improvement of disease phenotype. Thus, this study is the first to establish the association between aberrant histone codes and pathogenesis of autoimmune disease SLE. These aberrant post-translational histone modifications can therefore be reset with histone deacetylase inhibition in vivo.

  5. Boric acid-dependent decrease in regulatory histone H3 acetylation is not mutagenic in yeast.

    PubMed

    Pointer, Benjamin R; Schmidt, Martin

    2016-07-01

    Candida albicans is a dimorphic yeast commonly found on human mucosal membranes that switches from yeast to hyphal morphology in response to environmental factors. The change to hyphal growth requires histone H3 modifications by the yeast-specific histone acetyltransferase Rtt109. In addition to its role in morphogenesis, Rtt109-dependent acetylation of histone H3 lysine residues 9 and 56 has regulatory functions during DNA replication and repair. Boric acid (BA) is a broad-spectrum agent that specifically inhibits C. albicans hyphal growth, locking the fungus in its harmless commensal yeast state. The present study characterizes the effect of BA on C. albicans histone acetylation in respect to specificity, time-course and significance. We demonstrate that sublethal concentrations of BA reduce H3K9/H3K56 acetylation, both on a basal level and in response to genotoxic stress. Acetylation at other selected histone sites were not affected by BA. qRT-PCR expression analysis of the DNA repair gene Rad51 indicated no elevated level of genotoxic stress during BA exposure. A forward-mutation analysis demonstrated the BA does not increase spontaneous or induced mutations. The findings suggest that DNA repair remains effective even when histone H3 acetylation decreases and dispels the notion that BA treatment impairs genome integrity in yeast. PMID:27190149

  6. Boric acid-dependent decrease in regulatory histone H3 acetylation is not mutagenic in yeast.

    PubMed

    Pointer, Benjamin R; Schmidt, Martin

    2016-07-01

    Candida albicans is a dimorphic yeast commonly found on human mucosal membranes that switches from yeast to hyphal morphology in response to environmental factors. The change to hyphal growth requires histone H3 modifications by the yeast-specific histone acetyltransferase Rtt109. In addition to its role in morphogenesis, Rtt109-dependent acetylation of histone H3 lysine residues 9 and 56 has regulatory functions during DNA replication and repair. Boric acid (BA) is a broad-spectrum agent that specifically inhibits C. albicans hyphal growth, locking the fungus in its harmless commensal yeast state. The present study characterizes the effect of BA on C. albicans histone acetylation in respect to specificity, time-course and significance. We demonstrate that sublethal concentrations of BA reduce H3K9/H3K56 acetylation, both on a basal level and in response to genotoxic stress. Acetylation at other selected histone sites were not affected by BA. qRT-PCR expression analysis of the DNA repair gene Rad51 indicated no elevated level of genotoxic stress during BA exposure. A forward-mutation analysis demonstrated the BA does not increase spontaneous or induced mutations. The findings suggest that DNA repair remains effective even when histone H3 acetylation decreases and dispels the notion that BA treatment impairs genome integrity in yeast.

  7. Histone Deacetylase Inhibitors Interact with Melanoma Differentiation Associated-7/Interleukin-24 to Kill Primary Human Glioblastoma Cells

    PubMed Central

    Hamed, Hossein A.; Yacoub, Adly; Park, Margaret A.; Archer, Kellie; Das, Swadesh K.; Sarkar, Devanand; Grant, Steven; Fisher, Paul B.

    2013-01-01

    We presently demonstrate that histone deacetylase inhibitors (HDACIs) enhance toxicity of melanoma differentiation-associated gene-7/interleukin 24 (mda-7/IL-24) in invasive primary human glioblastoma multiforme (GBM) cells. Additionally, a method is described to augment the efficacy of adenoviral delivery of mda-7/IL-24 in these cells. HDACIs synergized with melanoma differentiation-associated (MDA)-7/IL-24 killing GBM cells. Enhanced lethality correlated with increased autophagy that was dependent on the expression of ceramide synthase 6. HDACIs interacted with MDA-7/IL-24 prolonging generation of reactive oxygen species and Ca2+. Quenching of reactive oxygen species and Ca2+ blocked HDACI and MDA-7/IL-24 killing. In vivo MDA-7/IL-24 prolonged the survival of animals carrying orthotopic tumors, and HDACIs enhanced survival further. A serotype 5/3 adenovirus more effectively delivers mda-7/IL-24 to GBM tumors than a serotype 5 virus. Hence, we constructed a serotype 5/3 adenovirus that conditionally replicates in tumor cells expressing MDA-7/IL-24, in which the adenoviral early region 1A (E1A) gene was driven by the cancer-specific promoter progression elevated gene-3 [Ad.5/3 (INGN 241)-PEG-E1A-mda-7; also called Ad.5/3-CTV (cancer terminator virus)]. Ad.5/3-CTV increased the survival of mice carrying GBM tumors to a significantly greater extent than did a nonreplicative virus Ad.5/3-mda-7. Ad.5/3-CTV exhibited no toxicity in the brains of Syrian hamsters. Collectively our data demonstrate that HDACIs enhance MDA-7/IL-24 lethality, and adenoviral delivery of mda-7/IL-24 combined with tumor-specific viral replication is an effective preclinical GBM therapeutic. PMID:23661648

  8. Impact of cigarette smoking on histone (H2B) to protamine ratio in human spermatozoa and its relation to sperm parameters.

    PubMed

    Hamad, M F; Shelko, N; Kartarius, S; Montenarh, M; Hammadeh, M E

    2014-09-01

    Smoking is strongly associated with abnormalities in histone-to-protamine transition and with alteration of protamine expression in human spermatozoa. A proper protamine to histone ratio is, however, essential for sperm chromatin maturity and DNA integrity. Alterations in these sperm nuclear proteins were observed in infertile men. The present prospective study is aimed at evaluating the possible relationship among smoking, semen quality and the histone-to-protamine transition ratio in mature spermatozoa. Histone H2B and protamine 1 (P1) and 2 (P2) were quantified using acid-urea polyacrylamide gel electrophoresis in the spermatozoa of 35 smokers and 19 non-smokers. Levels of lipid peroxidation marker malondialdehyde (MDA) were measured in seminal plasma by thiobarbituric acid assay. Cotinine concentrations were determined in seminal plasma using an enzyme-linked immunosorbent assay. Histone H2B levels in smokers (292.27 ± 58.24 ng/10(6)) were significantly higher (p = 0.001) than that of non-smokers (109.1 ± 43.70 ng/10(6)), besides, a significant difference (p > 0.0001) was found for the P1 and P2 ratio between smokers (1.71 ± 0.071) and non-smokers (1.05 ± 0.033). The H2B/(H2B+P1 + P2) ratio (0.29 ± 0.71) of smokers were significantly higher (p = <0.0001) than that of non-smokers (0.12 ± 0.01). The concentrations of MDA (μm) (7.13 ± 1.15) and cotinine (ng/mL) (60.44 ± 31.32) in seminal plasma of smokers were significantly higher (p = 0.001) than those in the samples of the non-smoker group (4.42 ± 1.16 and 2.01 ± 2.84 respectively). In addition, smokers showed significantly (p ≤ 0.002) lower sperm count, motility (p = 0.018), vitality (p = 0.009) and membrane integrity (p = 0.0001) than non-smokers. These results reveal that patients who smoke possess a higher proportion of spermatozoa with an alteration of the histone to protamine ratio than patients who do not smoke, and suggest that cigarette smoking may inversely affect male fertility.

  9. The Oncogenic Polycomb Histone Methyltransferase EZH2 Methylates Lysine 120 on Histone H2B and Competes Ubiquitination12

    PubMed Central

    Kogure, Masaharu; Takawa, Masashi; Saloura, Vassiliki; Sone, Kenbun; Piao, Lianhua; Ueda, Koji; Ibrahim, Reem; Tsunoda, Tatsuhiko; Sugiyama, Masanori; Atomi, Yutaka; Nakamura, Yusuke; Hamamoto, Ryuji

    2013-01-01

    The histone methyltransferase enhancer of zeste 2 (EZH2) is known to be a polycomb protein homologous to Drosophila enhancer of zeste and catalyzes the addition of methyl groups to histone H3 at lysine 27 (H3K27). We previously reported that EZH2 was overexpressed in various types of cancer and plays a crucial role in the cell cycle regulation of cancer cells. In the present study, we demonstrated that EZH2 has the function to monomethylate lysine 120 on histone H2B (H2BK120). EZH2-dependent H2BK120 methylation in cancer cells was confirmed with an H2BK120 methylation-specific antibody. Overexpression of EZH2 significantly attenuated the ubiquitination of H2BK120, a key posttranslational modification of histones for transcriptional regulation. Concordantly, knockdown of EZH2 increased the ubiquitination level of H2BK120, suggesting that the methylation of H2BK120 by EZH2 may competitively inhibit the ubiquitination of H2BK120. Subsequent chromatin immunoprecipitation-Seq and microarray analyses identified downstream candidate genes regulated by EZH2 through the methylation of H2BK120. This is the first report to describe a novel substrate of EZH2, H2BK120, unveiling a new aspect of EZH2 functions in human carcinogenesis. PMID:24339737

  10. Reactivation of a silenced H19 gene in human rhabdomyosarcoma by demethylation of DNA but not by histone hyperacetylation

    PubMed Central

    Lynch, Catherine A; Tycko, Benjamin; Bestor, Timothy H; Walsh, Colum P

    2002-01-01

    Background The active copy of the imprinted gene H19 is turned off by inappropriate methylation in several pediatric tumors including Wilms' Tumour and embryonal rhabdomyosarcoma. H19 controls in cis the linked Insulin-like Growth Factor 2 (IGF2) gene, encoding an important growth factor. Recent work has suggested that methylation of a gene may lead to deacetylation of its associated histones and that silenced genes can be reactivated by increasing histone acetylation levels. Results Treatment of a rhabdomyosarcoma cell line which has a silent, methylated H19 gene with histone deacetylase (HDAC) inhibitors under conditions which gave maximal hyperacetylation of histone 4, both globally and at the H19 gene itself could not reactivate H19 or affect the active Insulin-like Growth Factor 2 (IGF2) gene, but caused clear up-regulation of the Tissue-type Plasminogen Activator (TPA) gene, a non-imprinted gene known to respond to changes in histone acetylation. In contrast, mild treatment of the cells with the methylation inhibitor 5-AzaC-2'-deoxycytidine (AzaC) on its own was able to reactivate H19. Combining AzaC treatment with HDAC inhibitors gave a reduced rather than enhanced reactivation. These findings were confirmed in mouse primary liver and kidney explants which maintain normal imprinting, where we also found that the silent Igf2 gene could not be reactivated by HDAC inhibitors. Conclusion These results suggest that DNA methylation rather than histone acetylation is the primary determinant of silencing of H19 in rhabdomyosarcoma. PMID:12234381

  11. Structural and Functional Coordination of DNA and Histone Methylation

    PubMed Central

    Cheng, Xiaodong

    2014-01-01

    One of the most fundamental questions in the control of gene expression in mammals is how epigenetic methylation patterns of DNA and histones are established, erased, and recognized. This central process in controlling gene expression includes coordinated covalent modifications of DNA and its associated histones. This article focuses on structural aspects of enzymatic activities of histone (arginine and lysine) methylation and demethylation and functional links between the methylation status of the DNA and histones. An interconnected network of methyltransferases, demethylases, and accessory proteins is responsible for changing or maintaining the modification status of specific regions of chromatin. PMID:25085914

  12. Determination of histone methylation in mono- and dicotyledonous plants.

    PubMed

    Nic-Can, Geovanny I; De la Peña, Clelia

    2012-01-01

    Epigenetics includes DNA methylation and histones posttranslational modifications such as methylation, acetylation, phosphorylation among others. One of the most abundant modifications in histone tail is the methylation. It has been found that the methylation pattern in the histone H3 may provide understanding of the process involved in cell differentiation, adaptation, and evolution in plants. In this work, we detail a method for isolation of nuclear proteins from small amount of sample to identify global changes in different lysines of the histone H3 tail by using immunodetection. PMID:22610638

  13. Spt6 prevents transcription-coupled loss of posttranslationally modified histone H3

    PubMed Central

    Kato, Hiroaki; Okazaki, Kosuke; Iida, Tetsushi; Nakayama, Jun-ichi; Murakami, Yota; Urano, Takeshi

    2013-01-01

    The tail of histone H3 is an ideal medium for storing epigenetic information because displacement of histone H3 is heavily restricted during transcription. To maintain the locus-specific modifications of histone H3, histone molecules should be retained locally at the original position through multiple rounds of transcription. Here, we found that fission yeast Spt6, a highly conserved RNA polymerase II-interacting histone H3–H4 chaperone, is essential for the maintenance of Lys-4 and Lys-9 methylation of histone H3 in euchromatin and heterochromatin, respectively. In euchromatin, loss of Lys-4 methylated histone H3 and deposition of newly synthesized Lys-56 acetylated histone H3 induced by Spt6 inactivation were coupled with transcription. While in heterochromatin, Spt6 prevents histone turnover and cryptic transcription in parallel with Clr3 histone deacetylase. We propose that Spt6 retains posttranslationally modified histone H3 during transcription to maintain epigenome integrity. PMID:23851719

  14. On your histone mark, SET, methylate!

    PubMed Central

    Binda, Olivier

    2013-01-01

    Lysine methylation of histones and non-histone proteins has emerged in recent years as a posttranslational modification with wide-ranging cellular implications beyond epigenetic regulation. The molecular interactions between lysine methyltransferases and their substrates appear to be regulated by posttranslational modifications surrounding the lysine methyl acceptor. Two very interesting examples of this cross-talk between methyl-lysine sites are found in the SET (Su(var)3–9, Enhancer-of-zeste, Trithorax) domain-containing lysine methyltransferases SET7 and SETDB1, whereby the histone H3 trimethylated on lysine 4 (H3K4me3) modification prevents methylation by SETDB1 on H3 lysine 9 (H3K9) and the histone H3 trimethylated on lysine 9 (H3K9me3) modification prevents methylation by SET7 on H3K4. A similar cross-talk between posttranslational modifications regulates the functions of non-histone proteins such as the tumor suppressor p53 and the DNA methyltransferase DNMT1. Herein, in cis effects of acetylation, phosphorylation, as well as arginine and lysine methylation on lysine methylation events will be discussed. PMID:23625014

  15. Comparison of surface modification chemistries in mouse, porcine, and human islets.

    PubMed

    SoRelle, Jeffrey A; Kanak, Mazhar A; Itoh, Takeshi; Horton, Joshua M; Naziruddin, Bashoo; Kane, Robert R

    2015-03-01

    Beta cell replacement therapy, the transplantation of isolated pancreatic islets by intraportal infusion, offers patients with brittle type 1 diabetes blood glucose regulation with a minimally invasive technique. Chemical modification of islets prior to transplantation, providing a nanothin barrier that potentially includes active protective compounds, has been proposed as a strategy to minimize the inflammatory and immune reactions that often significantly limit graft function and duration. Chemical modification also has the potential to allow the use of alternative sources of islets, such as porcine islets, for transplantation. This investigation compared three orthogonal covalent islet modification techniques across three species (human, porcine, and murine), using multiple measures to determine biocompatibility and effectiveness. All three conjugation chemistries were well tolerated, and the overall efficiency, gross uniformity, and stability of the surface modifications were dependent upon the conjugation chemistry as well as the islet source (human, porcine, or murine). Notably, the reductive modification of surface disulfides was shown to afford intense and long-lasting modification of human islets. This study demonstrates that murine, human, and porcine islets tolerate a variety of covalent modifications, that these modifications are relatively stable, and that the murine islet model may not be predictive for some chemical contexts. PMID:24829144

  16. Alp13, an MRG family protein, is a component of fission yeast Clr6 histone deacetylase required for genomic integrity

    PubMed Central

    Nakayama, Jun-ichi; Xiao, Guoping; Noma, Ken-ichi; Malikzay, Asra; Bjerling, Pernilla; Ekwall, Karl; Kobayashi, Ryuji; Grewal, Shiv I.S.

    2003-01-01

    The post-translational modifications of histones are key to the modulation of chromatin structure. Distinct patterns of modifications established by histone-modifying enzymes control diverse chromosomal processes. Here, we report the purification and molecular characterization of the fission yeast Clr6 histone deacetyl ase involved in higher order chromatin assembly. We show that a chromodomain protein Alp13, which belongs to the conserved MRG protein family linked to cellular senescence in humans, is associated with Clr6. In addition, Clr6 interacts with homologs of the mammalian transcriptional co-repressors Sin3, Pst1 and Pst2, and a WD40 repeat-containing protein, Prw1. Alp13, Pst2 and Prw1 form a stable complex with Clr6 in the nucleus. Deletion of any of these factors causes progressive loss of viability and sensitivity to DNA-damaging agents, and impairs condensation/resolution of chromosomes during mitosis. This is accompanied by hyperacetylation of histones and a reduction in histone H3 Ser10 phosphorylation, which correlates with chromosome condensation during mitosis. These results link the MRG family protein Alp13 to histone deacetylation, and suggest that Clr6 and its associated factors are essential for fundamental chromosomal events. PMID:12773392

  17. The MOZ Histone Acetyltransferase in Epigenetic Signaling and Disease

    PubMed Central

    Carlson, Samuel; Glass, Karen C.

    2016-01-01

    The monocytic leukemic zinc finger (MOZ) histone acetyltransferase (HAT) plays a role in acute myeloid leukemia (AML). It functions as a quaternary complex with the bromodomain PHD finger protein 1 (BRPF1), the human Esa1-associated factor 6 homolog (hEAF6), and the inhibitor of growth 5 (ING5). Each of these subunits contain chromatin reader domains that recognize specific post-translational modifications (PTMs) on histone tails, and this recognition directs the MOZ HAT complex to specific chromatin substrates. The structure and function of these epigenetic reader modules has now been elucidated, and a model describing how the cooperative activity of these domains regulates HAT activity in response to the epigenetic landscape is proposed. The emerging role of epigenetic reader domains in disease, and their therapeutic potential for many types of cancer is also highlighted. PMID:24633655

  18. Identification and characterization of lysine-methylated sites on histones and non-histone proteins.

    PubMed

    Lee, Tzong-Yi; Chang, Cheng-Wei; Lu, Cheng-Tzung; Cheng, Tzu-Hsiu; Chang, Tzu-Hao

    2014-06-01

    Protein methylation is a kind of post-translational modification (PTM), and typically takes place on lysine and arginine amino acid residues. Protein methylation is involved in many important biological processes, and most recent studies focused on lysine methylation of histones due to its critical roles in regulating transcriptional repression and activation. Histones possess highly conserved sequences and are homologous in most species. However, there is much less sequence conservation among non-histone proteins. Therefore, mechanisms for identifying lysine-methylated sites may greatly differ between histones and non-histone proteins. Nevertheless, this point of view was not considered in previous studies. Here we constructed two support vector machine (SVM) models by using lysine-methylated data from histones and non-histone proteins for predictions of lysine-methylated sites. Numerous features, such as the amino acid composition (AAC) and accessible surface area (ASA), were used in the SVM models, and the predictive performance was evaluated using five-fold cross-validations. For histones, the predictive sensitivity was 85.62% and specificity was 80.32%. For non-histone proteins, the predictive sensitivity was 69.1% and specificity was 88.72%. Results showed that our model significantly improved the predictive accuracy of histones compared to previous approaches. In addition, features of the flanking region of lysine-methylated sites on histones and non-histone proteins were also characterized and are discussed. A gene ontology functional analysis of lysine-methylated proteins and correlations of lysine-methylated sites with other PTMs in histones were also analyzed in detail. Finally, a web server, MethyK, was constructed to identify lysine-methylated sites. MethK now is available at http://csb.cse.yzu.edu.tw/MethK/.

  19. A dual affinity-tag strategy for the expression and purification of human linker histone H1.4 in Escherichia coli.

    PubMed

    Ryan, Daniel P; Tremethick, David J

    2016-04-01

    Linker histones are an abundant and critical component of the eukaryotic chromatin landscape. They play key roles in regulating the higher order structure of chromatin and many genetic processes. Higher eukaryotes possess a number of different linker histone subtypes and new data are consistently emerging that indicate these subtypes are functionally distinct. We were interested in studying one of the most abundant human linker histone subtypes, H1.4. We have produced recombinant full-length H1.4 in Escherichia coli. An N-terminal Glutathione-S-Transferase tag was used to promote soluble expression and was combined with a C-terminal hexahistidine tag to facilitate a simple non-denaturing two-step affinity chromatography procedure that results in highly pure full-length H1.4. The purified H1.4 was shown to be functional via in vitro chromatin assembly experiments and remains active after extended storage at -80 °C. PMID:26739785

  20. Involvement of EARLY BUD-BREAK, an AP2/ERF Transcription Factor Gene, in Bud Break in Japanese Pear (Pyrus pyrifolia Nakai) Lateral Flower Buds: Expression, Histone Modifications and Possible Target Genes.

    PubMed

    Anh Tuan, Pham; Bai, Songling; Saito, Takanori; Imai, Tsuyoshi; Ito, Akiko; Moriguchi, Takaya

    2016-05-01

    In the Japanese pear (Pyrus pyrifolia Nakai) 'Kosui', three developmental stages of lateral flower buds have been proposed to occur during ecodormancy to the flowering phase, i.e. rapid enlargement, sprouting and flowering. Here, we report an APETALA2/ethylene-responsive factor (AP2/ERF) transcription factor gene, named pear EARLY BUD-BREAK (PpEBB), which was highly expressed during the rapid enlargement stage occurring prior to the onset of bud break in flower buds. Gene expression analysis revealed that PpEBB expression was dramatically increased during the rapid enlargement stage in three successive growing seasons. PpEBB transcript levels peaked 1 week prior to onset of bud break in 'Kosui' potted plants treated with hydrogen cyanamide or water under forcing conditions. Chromatin immunoprecipitation-quantitative PCR showed that higher levels of active histone modifications (trimethylation of the histone H3 tail at Lys4) in the 5'-upstream and start codon regions of the PpEBB gene were associated with the induced expression level of PpEBB during the rapid enlargement stage. In addition, we provide evidence that PpEBB may interact with and regulate pear four D-type cyclin (PpCYCD3) genes during bud break in 'Kosui' lateral flower buds. PpEBB significantly increased the promoter activities of four PpCYCD3 genes in a dual-luciferase assay using tobacco leaves. Taken together, our findings uncovered aspects of the bud break regulatory mechanism in the Japanese pear and provided further evidence that the EBB family plays an important role in bud break in perennial plants. PMID:26940832

  1. Involvement of EARLY BUD-BREAK, an AP2/ERF Transcription Factor Gene, in Bud Break in Japanese Pear (Pyrus pyrifolia Nakai) Lateral Flower Buds: Expression, Histone Modifications and Possible Target Genes.

    PubMed

    Anh Tuan, Pham; Bai, Songling; Saito, Takanori; Imai, Tsuyoshi; Ito, Akiko; Moriguchi, Takaya

    2016-05-01

    In the Japanese pear (Pyrus pyrifolia Nakai) 'Kosui', three developmental stages of lateral flower buds have been proposed to occur during ecodormancy to the flowering phase, i.e. rapid enlargement, sprouting and flowering. Here, we report an APETALA2/ethylene-responsive factor (AP2/ERF) transcription factor gene, named pear EARLY BUD-BREAK (PpEBB), which was highly expressed during the rapid enlargement stage occurring prior to the onset of bud break in flower buds. Gene expression analysis revealed that PpEBB expression was dramatically increased during the rapid enlargement stage in three successive growing seasons. PpEBB transcript levels peaked 1 week prior to onset of bud break in 'Kosui' potted plants treated with hydrogen cyanamide or water under forcing conditions. Chromatin immunoprecipitation-quantitative PCR showed that higher levels of active histone modifications (trimethylation of the histone H3 tail at Lys4) in the 5'-upstream and start codon regions of the PpEBB gene were associated with the induced expression level of PpEBB during the rapid enlargement stage. In addition, we provide evidence that PpEBB may interact with and regulate pear four D-type cyclin (PpCYCD3) genes during bud break in 'Kosui' lateral flower buds. PpEBB significantly increased the promoter activities of four PpCYCD3 genes in a dual-luciferase assay using tobacco leaves. Taken together, our findings uncovered aspects of the bud break regulatory mechanism in the Japanese pear and provided further evidence that the EBB family plays an important role in bud break in perennial plants.

  2. The epigenetic effects of aspirin: the modification of histone H3 lysine 27 acetylation in the prevention of colon carcinogenesis in azoxymethane- and dextran sulfate sodium-treated CF-1 mice.

    PubMed

    Guo, Yue; Liu, Yue; Zhang, Chengyue; Su, Zheng-Yuan; Li, Wenji; Huang, Mou-Tuan; Kong, Ah-Ng

    2016-06-01

    Colorectal cancer (CRC) is the third most common cancer worldwide. Chronic inflammation appears to enhance the risk of CRC. Emerging evidence has suggested that epigenetic mechanisms play an important role in CRC. Aspirin [acetylsalicylic acid (ASA)] has been shown to prevent CRC; however, the epigenetic mechanisms of its action remain unknown. This study investigated the protective role of ASA in azoxymethane (AOM)-initiated and dextran sulfate sodium (DSS)-promoted colitis-associated colon cancer (CAC) and examined the epigenetic effects, particularly on histone 3 lysine 27 acetylation (H3K27ac), underlying the preventive effect of ASA. CF-1 mice were fed with AIN-93M diet with or without 0.02% ASA from 1 week prior to AOM initiation until the mice were killed 20 weeks after AOM injection. Our results showed that AOM/DSS + ASA significantly suppressed inflammatory colitis symptoms and tumor multiplicity. AOM/DSS + ASA reduced AOM/DSS-induced protein expression and the activity of histone deacetylases (HDACs) and globally restored H3K27ac. Furthermore, AOM/DSS + ASA inhibited AOM/DSS-induced enrichment of H3K27ac in the promoters of inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-α) and interleukin 6 (IL-6) that corresponded to the dramatic suppression of the messenger RNA (mRNA) and protein levels. Surprisingly, no significant changes in the H3K27ac abundance in the prostaglandin-endoperoxide synthase 2 (Cox-2) promoters or in the Cox-2 mRNA and protein expression were observed. Collectively, our results suggest that a potential novel epigenetic mechanism underlies the chemopreventive effects of ASA, and this mechanism attenuates CAC in AOM/DSS-induced CF-1 mice via the inhibition of HDACs and the modification of H3K27ac marks that suppress iNOS, TNF-α and IL-6. PMID:27207670

  3. Evaluation of an enzyme-linked immunosorbent assay based on crude Leishmania histone proteins for serodiagnosis of human infantile visceral leishmaniasis.

    PubMed

    Lakhal, Sami; Mekki, Salima; Ben-Abda, Imène; Mousli, Mohamed; Amri, Fethi; Aoun, Karim; Bouratbine, Aïda

    2012-09-01

    Human visceral leishmaniasis (VL) is routinely diagnosed by detecting IgG that specifically binds to Leishmania antigens. The enzyme-linked immunosorbent assay (ELISA) remains a widely used method. However, the biggest challenge remains the choice of antigen with the highest specificity and sensitivity. This study is aimed at assessing the diagnostic performances of crude Leishmania histone (CLH) protein-based ELISAs in Mediterranean VL patients. The CLH proteins were biochemically purified from promastigote nuclear extracts. Their reactivities were analyzed by Western blotting (WB) using rabbit polyclonal antibodies against Leishmania recombinant histones and sera from VL patients, respectively. Then, the diagnostic potential of CLH proteins was validated by the CLH-based ELISA using 42 infantile VL patients' sera and 70 control subjects. The CLH-based ELISA performance was compared to that of the soluble Leishmania antigen (SLA)- and the recombinant K39 (rK39)-based ELISAs. Analysis of the WB profile with the use of polyclonal antibodies confirmed the histone origin of low molecular mass proteins (12 to 16 kDa). All VL samples tested presented antibodies reacting against different antigen fractions; however, recognition patterns were different depending on the reactivity of each serum. CLH-based ELISA showed an excellent ability to discriminate between VL cases and healthy controls (97.6% sensitivity and 100% specificity). It had a diagnostic performance similar to that of rK39-based ELISA (97.6% sensitivity and 97.1% specificity, P = 0.5) and a better serodiagnosis accuracy than the SLA-based ELISA (85.7% sensitivity and 90% specificity, P < 0.05). Therefore, crude Leishmania histone extract could be a valuable antigen for clinical use.

  4. GRHL2-miR-200-ZEB1 maintains the epithelial status of ovarian cancer through transcriptional regulation and histone modification

    PubMed Central

    Chung, Vin Yee; Tan, Tuan Zea; Tan, Ming; Wong, Meng Kang; Kuay, Kuee Theng; Yang, Zhe; Ye, Jieru; Muller, Julius; Koh, Cheryl M.; Guccione, Ernesto; Thiery, Jean Paul; Huang, Ruby Yun-Ju

    2016-01-01

    Epithelial-mesenchymal transition (EMT), a biological process by which polarized epithelial cells convert into a mesenchymal phenotype, has been implicated to contribute to the molecular heterogeneity of epithelial ovarian cancer (EOC). Here we report that a transcription factor—Grainyhead-like 2 (GRHL2) maintains the epithelial phenotype. EOC tumours with lower GRHL2 levels are associated with the Mes/Mesenchymal molecular subtype and a poorer overall survival. shRNA-mediated knockdown of GRHL2 in EOC cells with an epithelial phenotype results in EMT changes, with increased cell migration, invasion and motility. By ChIP-sequencing and gene expression microarray, microRNA-200b/a is identified as the direct transcriptional target of GRHL2 and regulates the epithelial status of EOC through ZEB1 and E-cadherin. Our study demonstrates that loss of GRHL2 increases the levels of histone mark H3K27me3 on promoters and GRHL2-binding sites at miR-200b/a and E-cadherin genes. These findings support GRHL2 as a pivotal gatekeeper of EMT in EOC via miR-200-ZEB1. PMID:26887977

  5. Genome-wide Screening of Regulators of Catalase Expression: ROLE OF A TRANSCRIPTION COMPLEX AND HISTONE AND tRNA MODIFICATION COMPLEXES ON ADAPTATION TO STRESS.

    PubMed

    García, Patricia; Encinar Del Dedo, Javier; Ayté, José; Hidalgo, Elena

    2016-01-01

    In response to environmental cues, the mitogen-activated protein kinase Sty1-driven signaling cascade activates hundreds of genes to induce a robust anti-stress cellular response in fission yeast. Thus, upon stress imposition Sty1 transiently accumulates in the nucleus where it up-regulates transcription through the Atf1 transcription factor. Several regulators of transcription and translation have been identified as important to mount an integral response to oxidative stress, such as the Spt-Ada-Gcn5-acetyl transferase or Elongator complexes, respectively. With the aim of identifying new regulators of this massive gene expression program, we have used a GFP-based protein reporter and screened a fission yeast deletion collection using flow cytometry. We find that the levels of catalase fused to GFP, both before and after a threat of peroxides, are altered in hundreds of strains lacking components of chromatin modifiers, transcription complexes, and modulators of translation. Thus, the transcription elongation complex Paf1, the histone methylase Set1-COMPASS, and the translation-related Trm112 dimers are all involved in full expression of Ctt1-GFP and in wild-type tolerance to peroxides.

  6. Genome-wide Screening of Regulators of Catalase Expression: ROLE OF A TRANSCRIPTION COMPLEX AND HISTONE AND tRNA MODIFICATION COMPLEXES ON ADAPTATION TO STRESS.

    PubMed

    García, Patricia; Encinar Del Dedo, Javier; Ayté, José; Hidalgo, Elena

    2016-01-01

    In response to environmental cues, the mitogen-activated protein kinase Sty1-driven signaling cascade activates hundreds of genes to induce a robust anti-stress cellular response in fission yeast. Thus, upon stress imposition Sty1 transiently accumulates in the nucleus where it up-regulates transcription through the Atf1 transcription factor. Several regulators of transcription and translation have been identified as important to mount an integral response to oxidative stress, such as the Spt-Ada-Gcn5-acetyl transferase or Elongator complexes, respectively. With the aim of identifying new regulators of this massive gene expression program, we have used a GFP-based protein reporter and screened a fission yeast deletion collection using flow cytometry. We find that the levels of catalase fused to GFP, both before and after a threat of peroxides, are altered in hundreds of strains lacking components of chromatin modifiers, transcription complexes, and modulators of translation. Thus, the transcription elongation complex Paf1, the histone methylase Set1-COMPASS, and the translation-related Trm112 dimers are all involved in full expression of Ctt1-GFP and in wild-type tolerance to peroxides. PMID:26567340

  7. Utilization of Boron Compounds for the Modification of Suberoyl Anilide Hydroxamic Acid as Inhibitor of Histone Deacetylase Class II Homo sapiens

    PubMed Central

    Bakri, Ridla; Parikesit, Arli Aditya; Satriyanto, Cipta Prio; Kerami, Djati; Tambunan, Usman Sumo Friend

    2014-01-01

    Histone deacetylase (HDAC) has a critical function in regulating gene expression. The inhibition of HDAC has developed as an interesting anticancer research area that targets biological processes such as cell cycle, apoptosis, and cell differentiation. In this study, an HDAC inhibitor that is available commercially, suberoyl anilide hydroxamic acid (SAHA), has been modified to improve its efficacy and reduce the side effects of the compound. Hydrophobic cap and zinc-binding group of these compounds were substituted with boron-based compounds, whereas the linker region was substituted with p-aminobenzoic acid. The molecular docking analysis resulted in 8 ligands with ΔGbinding value more negative than the standards, SAHA and trichostatin A (TSA). That ligands were analyzed based on the nature of QSAR, pharmacological properties, and ADME-Tox. It is conducted to obtain a potent inhibitor of HDAC class II Homo sapiens. The screening process result gave one best ligand, Nova2 (513246-99-6), which was then further studied by molecular dynamics simulations. PMID:25214833

  8. Quantitative Histone Mass Spectrometry Identifies Elevated Histone H3 Lysine 27 (Lys27) Trimethylation in Melanoma.

    PubMed

    Sengupta, Deepanwita; Byrum, Stephanie D; Avaritt, Nathan L; Davis, Lauren; Shields, Bradley; Mahmoud, Fade; Reynolds, Matthew; Orr, Lisa M; Mackintosh, Samuel G; Shalin, Sara C; Tackett, Alan J

    2016-03-01

    Normal cell growth is characterized by a regulated epigenetic program that drives cellular activities such as gene transcription, DNA replication, and DNA damage repair. Perturbation of this epigenetic program can lead to events such as mis-regulation of gene transcription and diseases such as cancer. To begin to understand the epigenetic program correlated to the development of melanoma, we performed a novel quantitative mass spectrometric analysis of histone post-translational modifications mis-regulated in melanoma cell culture as well as patient tumors. Aggressive melanoma cell lines as well as metastatic melanoma were found to have elevated histone H3 Lys(27) trimethylation (H3K27me3) accompanied by overexpressed methyltransferase EZH2 that adds the specific modification. The altered epigenetic program that led to elevated H3K27me3 in melanoma cell culture was found to directly silence transcription of the tumor suppressor genes RUNX3 and E-cadherin. The EZH2-mediated silencing of RUNX3 and E-cadherin transcription was also validated in advanced stage human melanoma tissues. This is the first study focusing on the detailed epigenetic mechanisms leading to EZH2-mediated silencing of RUNX3 and E-cadherin tumor suppressors in melanoma. This study underscores the utility of using high resolution mass spectrometry to identify mis-regulated epigenetic programs in diseases such as cancer, which could ultimately lead to the identification of biological markers for diagnostic and prognostic applications. PMID:26621846

  9. Histone Deacetylases and Mechanisms of Regulation of Gene Expression (Histone deacetylases in cancer)

    PubMed Central

    Chen, Hong Ping; Zhao, Yu Tina; Zhao, Ting C

    2016-01-01

    In recent years, it has become widely recognized that histone modification plays a pivotal role in controlling gene expression, and is involved in a wide spectrum of disease regulation. Histone acetylation is a major modification that affects gene transcription and is controlled by histone acetyltransferases (HATs) and histone deacetylases (HDAC). HATs acetylate lysines of histone proteins, resulting in relaxation of chromatin structure, and they also facilitate gene activation. Conversely, HDACs remove acetyl groups from hyperacetylated histones and suppress general gene transcription. In addition to histones, numerous non-histone proteins can be acetylated and deacetylated, and they are also involved in a wide range of disease regulation. To date, there are 18 HDACs in mammals classified into four classes based on homology to yeast HDACs. Accumulating evidence has revealed that HDACs play crucial roles in a variety of biological processes including inflammation, cell proliferation, apoptosis, and carcinogenesis. In this review, we summarize the current state of knowledge of HDACs in carcinogenesis and describe the involvement of HDACs in cancer-associated molecular processes. It is hoped than our understanding of the role of HDACs in cancer will lead to the design of more potent and specific drugs targeting selective HDAC proteins for the treatment of the disease. PMID:25746103

  10. Linker histones in hormonal gene regulation.

    PubMed

    Vicent, G P; Wright, R H G; Beato, M

    2016-03-01

    In the present review, we summarize advances in our knowledge on the role of the histone H1 family of proteins in breast cancer cells, focusing on their response to progestins. Histone H1 plays a dual role in gene regulation by hormones, both as a structural component of chromatin and as a dynamic modulator of transcription. It contributes to hormonal regulation of the MMTV promoter by stabilizing a homogeneous nucleosome positioning, which reduces basal transcription whereas at the same time promoting progesterone receptor binding and nucleosome remodeling. These combined effects enhance hormone dependent gene transcription, which eventually requires H1 phosphorylation and displacement. Various isoforms of histone H1 have specific functions in differentiated breast cancer cells and compact nucleosomal arrays to different extents in vitro. Genome-wide studies show that histone H1 has a key role in chromatin dynamics of hormone regulated genes. A complex sequence of enzymatic events, including phosphorylation by CDK2, PARylation by PARP1 and the ATP-dependent activity of NURF, are required for H1 displacement and gene de-repression, as a prerequisite for further nucleosome remodeling. Similarly, during hormone-dependent gene repression a dedicated enzymatic mechanism controls H1 deposition at promoters by a complex containing HP1γ, LSD1 and BRG1, the ATPase of the BAF complex. Thus, a broader vision of the histone code should include histone H1, as the linker histone variants actively participate in the regulation of the chromatin structure. How modifications of the core histones tails affect H1 modifications and vice versa is one of the many questions that remains to be addressed to provide a more comprehensive view of the histone cross-talk mechanisms.

  11. Computational Methods for De novo Protein Design and its Applications to the Human Immunodeficiency Virus 1, Purine Nucleoside Phosphorylase, Ubiquitin Specific Protease 7, and Histone Demethylases

    PubMed Central

    Bellows, M.L.; Floudas, C.A.

    2010-01-01

    This paper provides an overview of computational de novo protein design methods, highlighting recent advances and successes. Four protein systems are described that are important targets for drug design: human immunodeficiency virus 1, purine nucleoside phosphorylase, ubiquitin specific protease 7, and histone demethylases. Target areas for drug design for each protein are described, along with known inhibitors, focusing on peptidic inhibitors, but also describing some small-molecule inhibitors. Computational design methods that have been employed in elucidating these inhibitors for each protein are outlined, along with steps that can be taken in order to apply computational protein design to a system that has mainly used experimental methods to date. PMID:20210752

  12. All-Trans Retinoic Acid Promotes TGF-β-Induced Tregs via Histone Modification but Not DNA Demethylation on Foxp3 Gene Locus

    PubMed Central

    Li, Zhiyuan; Lan, Qin; Chen, Maogen; Liu, Ya; Xia, Zanxian; Wang, Julie; Han, Yuanping; Shi, Wei; Quesniaux, Valerie; Ryffel, Bernhard; Brand, David; Li, Bin; Liu, Zhongmin; Zheng, Song Guo

    2011-01-01

    Background It has been documented all-trans retinoic acid (atRA) promotes the development of TGF-β-induced CD4+Foxp3+ regulatory T cells (iTreg) that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs. Methodology/Principal Findings Addition of atRA to naïve CD4+CD25− cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3+ iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4+ cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4+ cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4+ cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4+ cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS) elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered. Conclusions/Significance We have identified the cellular and molecular mechanism(s) by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation. PMID:21931768

  13. Methylation of histone H3 lysine 9 occurs during translation

    PubMed Central

    Rivera, Carlos; Saavedra, Francisco; Alvarez, Francisca; Díaz-Celis, César; Ugalde, Valentina; Li, Jianhua; Forné, Ignasi; Gurard-Levin, Zachary A.; Almouzni, Geneviève; Imhof, Axel; Loyola, Alejandra

    2015-01-01

    Histone post-translational modifications are key contributors to chromatin structure and function, and participate in the maintenance of genome stability. Understanding the establishment and maintenance of these marks, along with their misregulation in pathologies is thus a major focus in the field. While we have learned a great deal about the enzymes regulating histone modifications on nucleosomal histones, much less is known about the mechanisms establishing modifications on soluble newly synthesized histones. This includes methylation of lysine 9 on histone H3 (H3K9), a mark that primes the formation of heterochromatin, a critical chromatin landmark for genome stability. Here, we report that H3K9 mono- and dimethylation is imposed during translation by the methyltransferase SetDB1. We discuss the importance of these results in the context of heterochromatin establishment and maintenance and new therapeutic opportunities in pathologies where heterochromatin is perturbed. PMID:26405197

  14. The Human Factors YY1 and LSF Repress the Human Immunodeficiency Virus Type 1 Long Terminal Repeat via Recruitment of Histone Deacetylase 1

    PubMed Central

    Coull, Jason J.; Romerio, Fabio; Sun, Jian-Min; Volker, Janet L.; Galvin, Katherine M.; Davie, James R.; Shi, Yang; Hansen, Ulla; Margolis, David M.

    2000-01-01

    Enigmatic mechanisms restore the resting state in activated lymphocytes following human immunodeficiency virus type 1 (HIV-1) infection, rarely allowing persistent nonproductive infection. We detail a mechanism whereby cellular factors could establish virological latency. The transcription factors YY1 and LSF cooperate in repression of transcription from the HIV-1 long terminal repeat (LTR). LSF recruits YY1 to the LTR via the zinc fingers of YY1. The first two zinc fingers were observed to be sufficient for this interaction in vitro. A mutant of LSF incapable of binding DNA blocked repression. Like other transcriptional repressors, YY1 can function via recruitment of histone deacetylase (HDAC). We find that HDAC1 copurifies with the LTR-binding YY1-LSF repressor complex, the domain of YY1 that interacts with HDAC1 is required to repress the HIV-1 promoter, expression of HDAC1 augments repression of the LTR by YY1, and the deacetylase inhibitor trichostatin A blocks repression mediated by YY1. This novel link between HDAC recruitment and inhibition of HIV-1 expression by YY1 and LSF, in the natural context of a viral promoter integrated into chromosomal DNA, is the first demonstration of a molecular mechanism of repression of HIV-1. YY1 and LSF may establish transcriptional and virological latency of HIV, a state that has recently been recognized in vivo and has significant implications for the long-term treatment of AIDS. PMID:10888618

  15. Biochemical analysis of chromatin containing recombinant Drosophila core histones.

    PubMed

    Levenstein, Mark E; Kadonaga, James T

    2002-03-01

    To investigate the effects of histone modifications upon chromatin structure and function, we studied the assembly and properties of chromatin that contains unmodified recombinant core histones. To this end, we synthesized the Drosophila core histones in Escherichia coli. The purified histones were lacking covalent modifications as well as their N-terminal initiating methionine residues. The recombinant histones were efficiently assembled into periodic nucleosome arrays in a completely purified recombinant system with Drosophila ATP-utilizing chromatin assembly and remodeling factor (ACF), Drosophila nucleosome assembly protein-1, plasmid DNA, and ATP. With the Gal4-VP16 activator and a crude transcription extract, we found that the transcriptional properties of ACF-assembled chromatin containing unmodified histones were similar to those of chromatin containing native histones. We then examined ACF-catalyzed chromatin remodeling with completely purified factors and chromatin consisting of unmodified histones. In these experiments, we observed promoter-specific disruption of the regularity of nucleosome arrays upon binding of Gal4-VP16 as well as nucleosome positioning by R3 Lac repressor and subsequent nucleosome remobilization upon isopropyl-beta-D-thiogalactopyranoside-induced dissociation of R3 from the template. Thus, chromatin assembly and remodeling by ACF can occur in the absence of histone modifications.

  16. Thanatos-associated protein 7 associates with template activating factor-Ibeta and inhibits histone acetylation to repress transcription.

    PubMed

    Macfarlan, Todd; Parker, J Brandon; Nagata, Kyosuke; Chakravarti, Debabrata

    2006-02-01

    The posttranslational modifications of histones on chromatin or a lack thereof is critical in transcriptional regulation. Emerging studies indicate a role for histone-binding proteins in transcriptional activation and repression. We have previously identified template-activating factor-Ibeta (TAF-Ibeta, also called PHAPII, SET, and I(2)(pp2A)) as a component of a cellular complex called inhibitor of acetyltransferases (INHAT) that masks histone acetylation in vitro and blocks histone acetyltransferase (HAT)-dependent transcription in living cells. TAF-Ibeta has also been shown to associate with transcription factors, including nuclear receptors, to regulate their activities. To identify novel interactors of TAF-Ibeta, we employed a yeast two-hybrid screen and identified a previously uncharacterized human protein called thanatos-associated protein-7 (THAP7), a member of a large family of THAP domain-containing putative DNA-binding proteins. In this study we demonstrate that THAP7 associates with TAF-Ibeta in vitro and map their association domains to a C-terminal predicted coiled-coil motif on THAP7 and the central region of TAF-Ibeta. Similarly, stably transfected THAP7 associates with endogenous TAF-Ibeta in intact cells. Like TAF-Ibeta, THAP7 associates with histone H3 and histone H4 and inhibits histone acetylation. The histone-interacting domain of THAP7 is sufficient for this activity in vitro. Promoter-targeted THAP7 can also recruit TAF-Ibeta and silencing mediator of retinoid and thyroid receptors/nuclear hormone receptor corepressor (NCoR) proteins to promoters, and knockdown of TAF-Ibeta by small interfering RNA relieves THAP7-mediated repression, indicating that, like nuclear hormone receptors, THAP7 may represent a novel class of transcription factor that uses TAF-Ibeta as a corepressor to maintain histones in a hypoacetylated, repressed state. PMID:16195249

  17. HistoneDB 2.0: a histone database with variants—an integrated resource to explore histones and their variants

    PubMed Central

    Draizen, Eli J.; Shaytan, Alexey K.; Mariño-Ramírez, Leonardo; Talbert, Paul B.; Landsman, David; Panchenko, Anna R.

    2016-01-01

    Compaction of DNA into chromatin is a characteristic feature of eukaryotic organisms. The core (H2A, H2B, H3, H4) and linker (H1) histone proteins are responsible for this compaction through the formation of nucleosomes and higher order chromatin aggregates. Moreover, histones are intricately involved in chromatin functioning and provide a means for genome dynamic regulation through specific histone variants and histone post-translational modifications. ‘HistoneDB 2.0 – with variants’ is a comprehensive database of histone protein sequences, classified by histone types and variants. All entries in the database are supplemented by rich sequence and structural annotations with many interactive tools to explore and compare sequences of different variants from various organisms. The core of the database is a manually curated set of histone sequences grouped into 30 different variant subsets with variant-specific annotations. The curated set is supplemented by an automatically extracted set of histone sequences from the non-redundant protein database using algorithms trained on the curated set. The interactive web site supports various searching strategies in both datasets: browsing of phylogenetic trees; on-demand generation of multiple sequence alignments with feature annotations; classification of histone-like sequences and browsing of the taxonomic diversity for every histone variant. HistoneDB 2.0 is a resource for the interactive comparative analysis of histone protein sequences and their implications for chromatin function. Database URL: http://www.ncbi.nlm.nih.gov/projects/HistoneDB2.0 PMID:26989147

  18. Potential impact of human mitochondrial replacement on global policy regarding germline gene modification.

    PubMed

    Ishii, Tetsuya

    2014-08-01

    Previous discussions regarding human germline gene modification led to a global consensus that no germline should undergo genetic modification. However, the UK Human Fertilisation and Embryology Authority, having conducted at the UK Government's request a scientific review and a wide public consultation, provided advice to the Government on the pros and cons of Parliament's lifting a ban on altering mitochondrial DNA content of human oocytes and embryos, so as to permit the prevention of maternal transmission of mitochondrial diseases. In this commentary, relevant ethical and biomedical issues are examined and requirements for proceeding with this novel procedure are suggested. Additionally, potentially significant impacts of the UK legalization on global policy concerning germline gene modification are discussed in the context of recent advances in genome-editing technology. It is concluded that international harmonization is needed, as well as further ethical and practical consideration, prior to the legalization of human mitochondrial replacement.

  19. Potential impact of human mitochondrial replacement on global policy regarding germline gene modification.

    PubMed

    Ishii, Tetsuya

    2014-08-01

    Previous discussions regarding human germline gene modification led to a global consensus that no germline should undergo genetic modification. However, the UK Human Fertilisation and Embryology Authority, having conducted at the UK Government's request a scientific review and a wide public consultation, provided advice to the Government on the pros and cons of Parliament's lifting a ban on altering mitochondrial DNA content of human oocytes and embryos, so as to permit the prevention of maternal transmission of mitochondrial diseases. In this commentary, relevant ethical and biomedical issues are examined and requirements for proceeding with this novel procedure are suggested. Additionally, potentially significant impacts of the UK legalization on global policy concerning germline gene modification are discussed in the context of recent advances in genome-editing technology. It is concluded that international harmonization is needed, as well as further ethical and practical consideration, prior to the legalization of human mitochondrial replacement. PMID:24832374

  20. Identification of Posttranslational Modification-Dependent Protein Interactions Using Yeast Surface Displayed Human Proteome Libraries.

    PubMed

    Bidlingmaier, Scott; Liu, Bin

    2015-01-01

    The identification of proteins that interact specifically with posttranslational modifications such as phosphorylation is often necessary to understand cellular signaling pathways. Numerous methods for identifying proteins that interact with posttranslational modifications have been utilized, including affinity-based purification and analysis, protein microarrays, phage display, and tethered catalysis. Although these techniques have been used successfully, each has limitations. Recently, yeast surface-displayed human proteome libraries have been utilized to identify protein fragments with affinity for various target molecules, including phosphorylated peptides. When coupled with fluorescently activated cell sorting and high throughput methods for the analysis of selection outputs, yeast surface-displayed human proteome libraries can rapidly and efficiently identify protein fragments with affinity for any soluble ligand that can be fluorescently detected, including posttranslational modifications. In this review we compare the use of yeast surface display libraries to other methods for the identification of interactions between proteins and posttranslational modifications and discuss future applications of the technology. PMID:26060076

  1. Wdr82 is a C-terminal domain-binding protein that recruits the Setd1A Histone H3-Lys4 methyltransferase complex to transcription start sites of transcribed human genes.

    PubMed

    Lee, Jeong-Heon; Skalnik, David G

    2008-01-01

    Histone H3-Lys4 trimethylation is associated with the transcription start site of transcribed genes, but the molecular mechanisms that control this distribution in mammals are unclear. The human Setd1A histone H3-Lys4 methyltransferase complex was found to physically associate with the RNA polymerase II large subunit. The Wdr82 component of the Setd1A complex interacts with the RNA recognition motif of Setd1A and additionally binds to the Ser5-phosphorylated C-terminal domain of RNA polymerase II, which is involved in initiation of transcription, but does not bind to an unphosphorylated or Ser2-phosphorylated C-terminal domain. Chromatin immunoprecipitation analysis revealed that Setd1A is localized near the transcription start site of expressed genes. Small interfering RNA-mediated depletion of Wdr82 leads to decreased Setd1A expression and occupancy at transcription start sites and reduced histone H3-Lys4 trimethylation at these sites. However, neither RNA polymerase II (RNAP II) occupancy nor target gene expression levels are altered following Wdr82 depletion. Hence, Wdr82 is required for the targeting of Setd1A-mediated histone H3-Lys4 trimethylation near transcription start sites via tethering to RNA polymerase II, an event that is a consequence of transcription initiation. These results suggest a model for how the mammalian RNAP II machinery is linked with histone H3-Lys4 histone methyltransferase complexes at transcriptionally active genes. PMID:17998332

  2. Abrogation of Mitogen-Activated Protein Kinase and Akt Signaling by Vandetanib Synergistically Potentiates Histone Deacetylase Inhibitor-Induced Apoptosis in Human Glioma Cells

    PubMed Central

    Jane, Esther P.; Premkumar, Daniel R.; Addo-Yobo, Steven O.

    2009-01-01

    Vandetanib is a multitargeted tyrosine kinase inhibitor. Our initial studies demonstrated that this agent blocks vascular endothelial growth factor receptor, epidermal growth factor receptor, and platelet-derived growth factor receptor phosphorylation and mitogen-activated protein kinase (MAPK)-mediated signaling in glioma cell lines in a dose-dependent manner. Despite these effects, we observed that vandetanib had little effect on apoptosis induction at clinically achievable concentrations. Because histone deacetylase inhibitors (HDACIs) have been suggested to regulate signaling protein transcription and downstream interactions via modulation of protein chaperone function through the 90-kDa heat shock protein, we investigated whether combining vandetanib with an HDACI could synergistically potentiate signaling pathway inhibition and apoptosis induction in a panel of malignant human glioma cell lines. Proliferation assays, apoptosis induction studies, and Western immunoblot analysis were conducted in cells treated with vandetanib and HDACIs as single agents or in combination. Vandetanib and suberoylanalide hydroxamic acid reduced proliferation in all cell lines when used as single agents, and the combination produced marked potentiation of growth inhibition as assessed by combinatorial methods. These effects were paralleled by potentiation of Akt signaling inhibition and apoptosis induction. Our results indicate that inhibition of histone deacetylation enhances the antiproliferative effect of vandetanib in malignant human glioma cell lines by enhancing inhibition of MAPK, Akt, and other downstream effectors that may have application in combinatorial therapeutics for these tumors. PMID:19622715

  3. Sodium butyrate up-regulates cathelicidin gene expression via activator protein-1 and histone acetylation at the promoter region in a human lung epithelial cell line, EBC-1.

    PubMed

    Kida, Yutaka; Shimizu, Takashi; Kuwano, Koichi

    2006-05-01

    The antimicrobial protein cathelicidin is considered to play an important role in the defense mechanisms against bacterial infection. Recent studies show that sodium butyrate induces cathelicidin gene expression in human colonic, gastric and hepatic cells. However, little is known about the precise regulatory mechanisms underlying sodium butyrate-induced cathelicidin gene expression. In this study, we examined the regulatory mechanisms involved in sodium butyrate-induced cathelicidin gene expression using a human lung epithelial cell line, EBC-1. Our results indicate that sodium butyrate induces both cathelicidin mRNA and protein expression. Moreover, deletion or mutation of a putative activator protein-1 (AP-1) binding site in the cathelicidin gene promoter abrogated the response to sodium butyrate stimulation. Three different mitogen-activated protein (MAP) kinase inhibitors suppressed sodium butyrate-induced transactivation of the cathelicidin promoter. Electrophoretic mobility shift assays (EMSA) showed that nuclear extracts prepared from sodium butyrate-stimulated EBC-1 cells generated specific binding to probe including a putative AP-1 binding site in the cathelicidin gene promoter. Furthermore, chromatin immunoprecipitation (ChIP) assays demonstrated that sodium butyrate augmented histone acetylation of the cathelicidin promoter in EBC-1 cells. Therefore, these results indicate that AP-1 and histone acetylation of the cathelicidin promoter play a critical role in the regulation of inducible cathelicidin gene expression in EBC-1 cells stimulated with sodium butyrate.

  4. Inhibition of histone deacetylase 10 induces thioredoxin-interacting protein and causes accumulation of reactive oxygen species in SNU-620 human gastric cancer cells.

    PubMed

    Lee, Ju-Hee; Jeong, Eun-Goo; Choi, Moon-Chang; Kim, Sung-Hak; Park, Jung-Hyun; Song, Sang-Hyun; Park, Jinah; Bang, Yung-Jue; Kim, Tae-You

    2010-08-01

    Histone deacetylase (HDAC)10, a novel class IIb histone deacetylase, is the most similar to HDAC6, since both contain a unique second catalytic domain. Unlike HDAC6, which is located in the cytoplasm, HDAC10 resides in both the nucleus and cytoplasm. The transcriptional targets of HDAC10 that are associated with HDAC10 gene regulation have not been identified. In the present study, we found that knockdown of HDAC10 significantly increased the mRNA expression levels of thioredoxin-interacting protein (TXNIP) in SNU-620 human gastric cancer cells; whereas inhibition of HDAC1, HDAC2, and HDAC6 did not affect TXNIP expression. TXNIP is the endogenous inhibitor of thioredoxin (TRX), which acts as a cellular antioxidant. Real-time PCR and immunoblot analysis confirmed that inhibition of HDAC10 induced TXNIP expression. Compared to class I only HDAC inhibitors, inhibitors targeting both class I and II upregulated TXNIP, indicating that TXNIP is regulated by class II HDACs such as HDAC10. We further verified that inhibition of HDAC10 induced release of cytochrome c and activated apoptotic signaling molecules through accumulation of reactive oxygen species (ROS). Taken together, our results demonstrate that HDAC10 is involved in transcriptional downregulation of TXNIP, leading to altered ROS signaling in human gastric cancer cells. How TXNIP is preferentially regulated by HDAC10 needs further investigation.

  5. Histone methyltransferases: novel targets for tumor and developmental defects

    PubMed Central

    Yi, Xin; Jiang, Xue-Jun; Li, Xiao-Yan; Jiang, Ding-Sheng

    2015-01-01

    Histone lysine methylation plays a critical role in epigenetic regulation of eukaryotes. To date, studies have shown that lysine residues of K4, K9, K27, K36 and K79 in histone H3 and K20 in histone H4 can be modified by histone methyltransferases (HMTs). Such histone methylation can specifically activate or repress the transcriptional activity to play a key role in gene expression/regulation and biological genetics. Importantly, abnormities of patterns or levels of histone methylation in higher eukaryotes may result in tumorigenesis and developmental defects, suggesting histone methylation will be one of the important targets or markers for treating these diseases. This review will outline the structural characteristics, active sites and specificity of HMTs, correlation between histone methylation and human diseases and lay special emphasis on the progress of the research on H3K36 methylation. PMID:26807165

  6. Epigenetic modifications and human pathologies: cancer and CVD.

    PubMed

    Duthie, Susan J

    2011-02-01

    Epigenetic changes are inherited alterations in DNA that affect gene expression and function without altering the DNA sequence. DNA methylation is one epigenetic process implicated in human disease that is influenced by diet. DNA methylation involves addition of a 1-C moiety to cytosine groups in DNA. Methylated genes are not transcribed or are transcribed at a reduced rate. Global under-methylation (hypomethylation) and site-specific over-methylation (hypermethylation) are common features of human tumours. DNA hypomethylation, leading to increased expression of specific proto-oncogenes (e.g. genes involved in proliferation or metastasis) can increase the risk of cancer as can hypermethylation and reduced expression of tumour suppressor (TS) genes (e.g. DNA repair genes). DNA methyltransferases (DNMT), together with the methyl donor S-adenosylmethionine (SAM), facilitate DNA methylation. Abnormal DNA methylation is implicated not only in the development of human cancer but also in CVD. Polyphenols, a group of phytochemicals consumed in significant amounts in the human diet, effect risk of cancer. Flavonoids from tea, soft fruits and soya are potent inhibitors of DNMT in vitro, capable of reversing hypermethylation and reactivating TS genes. Folates, a group of water-soluble B vitamins found in high concentration in green leafy vegetables, regulate DNA methylation through their ability to generate SAM. People who habitually consume the lowest level of folate or with the lowest blood folate concentrations have a significantly increased risk of developing several cancers and CVD. This review describes how flavonoids and folates in the human diet alter DNA methylation and may modify the risk of human colon cancer and CVD.

  7. Structural insights into yeast histone chaperone Hif1: a scaffold protein recruiting protein complexes to core histones.

    PubMed

    Liu, Hejun; Zhang, Mengying; He, Wei; Zhu, Zhongliang; Teng, Maikun; Gao, Yongxiang; Niu, Liwen

    2014-09-15

    Yeast Hif1 [Hat1 (histone acetyltransferase 1)-interacting factor], a homologue of human NASP (nuclear autoantigenic sperm protein), is a histone chaperone that is involved in various protein complexes which modify histones during telomeric silencing and chromatin reassembly. For elucidating the structural basis of Hif1, in the present paper we demonstrate the crystal structure of Hif1 consisting of a superhelixed TPR (tetratricopeptide repeat) domain and an extended acid loop covering the rear of TPR domain, which represent typical characteristics of SHNi-TPR [Sim3 (start independent of mitosis 3)-Hif1-NASP interrupted TPR] proteins. Our binding assay indicates that Hif1 could bind to the histone octamer via histones H3 and H4. The acid loop is shown to be crucial for the binding of histones and may also change the conformation of the TPR groove. By binding to the core histone complex Hif1 may recruit functional protein complexes to modify histones during chromatin reassembly.

  8. Coffee polyphenols protect human plasma from postprandial carbonyl modifications.

    PubMed

    Sirota, Roman; Gorelik, Shlomit; Harris, Raviv; Kohen, Ron; Kanner, Joseph

    2013-05-01

    The antioxidant capability of coffee polyphenols to inhibit red-meat lipid peroxidation in stomach medium and absorption into blood of malondialdehyde (MDA) in humans was studied. Roasted-ground coffee polyphenols that were found to inhibit lipid peroxidation in stomach medium are 2- to 5-fold more efficient antioxidant than those found in instant coffee. Human plasma from ten volunteers analyzed after a meal of red-meat cutlets (250 g) revealed a rapid accumulation of MDA. The accumulation of MDA in human plasma modified low-density lipoprotein is known to trigger atherogenesis. Consumption of 200 mL roasted coffee by ten volunteers during a meal of red-meat cutlets, resulted after 2 and 4 h in the inhibition by 80 and 50%, respectively, of postprandial plasma MDA absorption. The results obtained in vitro simulated stomach model on MDA accumulation were predictive for the amount of MDA absorbed into circulating human plasma, in vivo. Timing the consumption of coffee during the meals may make it a very active functional food.

  9. Histone Methylation in Nickel-Smelting Industrial Workers

    PubMed Central

    Ma, Li; Bai, Yana; Pu, Hongquan; Gou, Faxiang; Dai, Min; Wang, Hui; He, Jie; Zheng, Tongzhang; Cheng, Ning

    2015-01-01

    Background Nickel is an essential trace metal naturally found in the environment. It is also common in occupational settings, where it associates with various levels of both occupational and nonoccupational exposure In vitro studies have shown that nickel exposure can lead to intracellular accumulation of Ni2+, which has been associated with global decreases in DNA methylation, increases in chromatin condensation, reductions in H3K9me2, and elevated levels of H3K4me3. Histone modifications play an important role in modulating chromatin structure and gene expression. For example, tri-methylation of histone H3k4 has been found to be associated with transcriptional activation, and tri-methylation of H3k27 has been found to be associated with transcriptional repression. Aberrant histone modifications have been found to be associated with various human diseases, including cancer. The purpose of this work was to identify biomarkers for populations with occupational nickel exposure and to examine the relationship between histone methylation and nickel exposure. This may provide a scientific indicator of early health impairment and facilitate exploration of the molecular mechanism underlying cancer pathogenesis. Methods One hundred and forty subjects with occupational exposure to Ni and 140 referents were recruited. H3K4 and H3K27 trimethylation levels were measured in subjects’ blood cells. Results H3K4me3 levels were found to be higher in nickel smelting workers (47.24±20.85) than in office workers (22.65±8.81; P = 0.000), while the opposite was found for levels of H3K27me3(nickel smelting workers, 13.88± 4.23; office workers, 20.67± 5.96; P = 0.000). H3K4me3 was positively (r = 0.267, P = 0.001) and H3K27 was negatively (r = -0.684, P = 0.000) associated with age and length of service in smelting workers. Conclusion This study indicated that occupational exposure to Ni is associated with alterations in levels of histone modification. PMID:26474320

  10. Histone H3 Lysine Methylation in Cognition and Intellectual Disability Disorders

    ERIC Educational Resources Information Center

    Parkel, Sven; Lopez-Atalaya, Jose P.; Barco, Angel

    2013-01-01

    Recent research indicates that epigenetic mechanisms and, in particular, the post-translational modification (PTM) of histones may contribute to memory encoding and storage. Among the dozens of possible histone PTMs, the methylation/demethylation of lysines in the N-terminal tail of histone H3 exhibits particularly strong links with cognitive…

  11. Binding Mode of Acetylated Histones to Bromodomains: Variations on a Common Motif.

    PubMed

    Marchand, Jean-Rémy; Caflisch, Amedeo

    2015-08-01

    Bromodomains, epigenetic readers that recognize acetylated lysine residues in histone tails, are potential drug targets in cancer and inflammation. Herein we review the crystal structures of human bromodomains in complex with histone tails and analyze the main interaction motifs. The histone backbone is extended and occupies, in one of the two possible orientations, the bromodomain surface groove lined by the ZA and BC loops. The acetyl-lysine side chain is buried in the cavity between the four helices of the bromodomain, and its oxygen atom accepts hydrogen bonds from a structural water molecule and a conserved asparagine residue in the BC loop. In stark contrast to this common binding motif, a large variety of ancillary interactions emerge from our analysis. In 10 of 26 structures, a basic side chain (up to five residues up- or downstream in sequence with respect to the acetyl-lysine) interacts with the carbonyl groups of the C-terminal turn of helix αB. Furthermore, the complexes reveal many heterogeneous backbone hydrogen bonds (direct or water-bridged). These interactions contribute unselectively to the binding of acetylated histone tails to bromodomains, which provides further evidence that specific recognition is modulated by combinations of multiple histone modifications and multiple modules of the proteins involved in transcription.

  12. Large-Scale Overproduction and Purification of Recombinant Histone Deacetylase 8 (HDAC8) from the Human-Pathogenic Flatworm Schistosoma mansoni.

    PubMed

    Marek, Martin; Shaik, Tajith B; Duclaud, Sylvie; Pierce, Raymond J; Romier, Christophe

    2016-01-01

    Epigenetic mechanisms underlie the morphological transformations and shifts in virulence of eukaryotic pathogens. The targeting of epigenetics-driven cellular programs thus represents an Achilles' heel of human parasites. Today, zinc-dependent histone deacetylases (HDACs) belong to the most explored epigenetic drug targets in eukaryotic parasites. Here, we describe an optimized protocol for the large-scale overproduction and purification of recombinant smHDAC8, an emerging epigenetic drug target in the multicellular human-pathogenic flatworm Schistosoma mansoni. The strategy employs the robustness of recombinant expression in Escherichia coli together with initial purification through a poly-histidine affinity tag that can be removed by the thrombin protease. This protocol is divided into two steps: (1) large-scale production of smHDAC8 in E. coli, and (2) purification of the target smHDAC8 protein through multiple purification steps. PMID:27246211

  13. Large-Scale Overproduction and Purification of Recombinant Histone Deacetylase 8 (HDAC8) from the Human-Pathogenic Flatworm Schistosoma mansoni.

    PubMed

    Marek, Martin; Shaik, Tajith B; Duclaud, Sylvie; Pierce, Raymond J; Romier, Christophe

    2016-01-01

    Epigenetic mechanisms underlie the morphological transformations and shifts in virulence of eukaryotic pathogens. The targeting of epigenetics-driven cellular programs thus represents an Achilles' heel of human parasites. Today, zinc-dependent histone deacetylases (HDACs) belong to the most explored epigenetic drug targets in eukaryotic parasites. Here, we describe an optimized protocol for the large-scale overproduction and purification of recombinant smHDAC8, an emerging epigenetic drug target in the multicellular human-pathogenic flatworm Schistosoma mansoni. The strategy employs the robustness of recombinant expression in Escherichia coli together with initial purification through a poly-histidine affinity tag that can be removed by the thrombin protease. This protocol is divided into two steps: (1) large-scale production of smHDAC8 in E. coli, and (2) purification of the target smHDAC8 protein through multiple purification steps.

  14. Increased progesterone receptor A expression in labouring human myometrium is associated with decreased promoter occupancy by the histone demethylase JARID1A.

    PubMed

    Chai, S Y; Smith, R; Fitter, J T; Mitchell, C; Pan, X; Ilicic, M; Maiti, K; Zakar, T; Madsen, G

    2014-05-01

    Progesterone regulates female reproductive function predominantly through two nuclear progesterone receptors (PRs), PR-A and PR-B. During human parturition myometrial PR expression is altered to favour PR-A, which activates pro-labour genes. We have previously identified histone H3 lysine 4 trimethylation (H3K4me3) as an activator of myometrial PR-A expression at labour. To further elucidate the mechanisms regulating PR isoform expression in the human uterus at labour, we have (i) determined the methylation profile of the cytosine-guanine dinucleotides (CpG) island in the promoter region of the PR ge