Pedrosa, Ana G; Francisco, Tânia; Bicho, Diana; Dias, Ana F; Barros-Barbosa, Aurora; Hagmann, Vera; Dodt, Gabriele; Rodrigues, Tony A; Azevedo, Jorge E
2018-06-08
PEX1 and PEX6 are two members of the ATPases Associated with diverse cellular Activities (AAA) family and the core components of the receptor export module (REM) of the peroxisomal matrix protein import machinery. Their role is to extract monoubiquitinated PEX5, the peroxisomal protein shuttling receptor, from the peroxisomal membrane docking/translocation module (DTM), so that a new cycle of protein transportation can start. Recent data have shown that PEX1 and PEX6 form a heterohexameric complex which unfolds substrates by processive threading. However, whether the natural substrate of the PEX1.PEX6 complex is monoubiquitinated PEX5 (Ub-PEX5) itself or some Ub-PEX5-interacting component(s) of the DTM remains unknown. In this work, we used an established cell-free in vitro system coupled with photoaffinity crosslinking and protein PEGylation assays to address this problem. We provide evidence suggesting that DTM-embedded Ub-PEX5 interacts directly with both PEX1 and PEX6 through its ubiquitin moiety and that the PEX5 polypeptide chain is globally unfolded during the ATP-dependent extraction event. These findings strongly suggest that DTM-embedded Ub-PEX5 is a bona fide substrate of the PEX1.PEX6 complex. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Mesa-Torres, Noel; Tomic, Nenad; Albert, Armando; Salido, Eduardo; Pey, Angel L
2015-02-13
Peroxisomal biogenesis and function critically depends on the import of cytosolic proteins carrying a PTS1 sequence into this organelle upon interaction with the peroxin Pex5p. Recent structural studies have provided important insights into the molecular recognition of cargo proteins by Pex5p. Peroxisomal import is a key feature in the pathogenesis of primary hyperoxaluria type 1 (PH1), where alanine:glyoxylate aminotransferase (AGT) undergoes mitochondrial mistargeting in about a third of patients. Here, we study the molecular recognition of PTS1 cargo proteins by Pex5p using oligopeptides and AGT variants bearing different natural PTS1 sequences, and employing an array of biophysical, computational and cell biology techniques. Changes in affinity for Pex5p (spanning over 3-4 orders of magnitude) reflect different thermodynamic signatures, but overall bury similar amounts of molecular surface. Structure/energetic analyses provide information on the contribution of ancillary regions and the conformational changes induced in Pex5p and the PTS1 cargo upon complex formation. Pex5p stability in vitro is enhanced upon cargo binding according to their binding affinities. Moreover, we provide evidence that the rational modulation of the AGT: Pex5p binding affinity might be useful tools to investigate mistargeting and misfolding in PH1 by pulling the folding equilibria towards the native and peroxisomal import competent state.
Walton, Paul A; Brees, Chantal; Lismont, Celien; Apanasets, Oksana; Fransen, Marc
2017-10-01
Accumulating evidence indicates that peroxisome functioning, catalase localization, and cellular oxidative balance are intimately interconnected. Nevertheless, it remains largely unclear why modest increases in the cellular redox state especially interfere with the subcellular localization of catalase, the most abundant peroxisomal antioxidant enzyme. This study aimed at gaining more insight into this phenomenon. Therefore, we first established a simple and powerful approach to study peroxisomal protein import and protein-protein interactions in living cells in response to changes in redox state. By employing this approach, we confirm and extend previous observations that Cys-11 of human PEX5, the shuttling import receptor for peroxisomal matrix proteins containing a C-terminal peroxisomal targeting signal (PTS1), functions as a redox switch that modulates the protein's activity in response to intracellular oxidative stress. In addition, we show that oxidative stress affects the import of catalase, a non-canonical PTS1-containing protein, more than the import of a reporter protein containing a canonical PTS1. Furthermore, we demonstrate that changes in the local redox state do not affect PEX5-substrate binding and that human PEX5 does not oligomerize in cellulo, not even when the cells are exposed to oxidative stress. Finally, we present evidence that catalase retained in the cytosol can protect against H 2 O 2 -mediated redox changes in a manner that peroxisomally targeted catalase does not. Together, these findings lend credit to the idea that inefficient catalase import, when coupled with the role of PEX5 as a redox-regulated import receptor, constitutes a cellular defense mechanism to combat oxidative insults of extra-peroxisomal origin. Copyright © 2017 Elsevier B.V. All rights reserved.
Structure and Function of p97 and Pex1/6 Type II AAA+ Complexes.
Saffert, Paul; Enenkel, Cordula; Wendler, Petra
2017-01-01
Protein complexes of the Type II AAA+ (ATPases associated with diverse cellular activities) family are typically hexamers of 80-150 kDa protomers that harbor two AAA+ ATPase domains. They form double ring assemblies flanked by associated domains, which can be N-terminal, intercalated or C-terminal to the ATPase domains. Most prominent members of this family include NSF (N-ethyl-maleimide sensitive factor), p97/VCP (valosin-containing protein), the Pex1/Pex6 complex and Hsp104 in eukaryotes and ClpB in bacteria. Tremendous efforts have been undertaken to understand the conformational dynamics of protein remodeling type II AAA+ complexes. A uniform mode of action has not been derived from these works. This review focuses on p97/VCP and the Pex1/6 complex, which both structurally remodel ubiquitinated substrate proteins. P97/VCP plays a role in many processes, including ER- associated protein degradation, and the Pex1/Pex6 complex dislocates and recycles the transport receptor Pex5 from the peroxisomal membrane during peroxisomal protein import. We give an introduction into existing knowledge about the biochemical and cellular activities of the complexes before discussing structural information. We particularly emphasize recent electron microscopy structures of the two AAA+ complexes and summarize their structural differences.
Interaction of Phospholipase A/Acyltransferase-3 with Pex19p
Uyama, Toru; Kawai, Katsuhisa; Kono, Nozomu; Watanabe, Masahiro; Tsuboi, Kazuhito; Inoue, Tomohito; Araki, Nobukazu; Arai, Hiroyuki; Ueda, Natsuo
2015-01-01
Phospholipase A/acyltransferase (PLA/AT)-3 (also known as H-rev107 or AdPLA) was originally isolated as a tumor suppressor and was later shown to have phospholipase A1/A2 activity. We have also found that the overexpression of PLA/AT-3 in mammalian cells results in specific disappearance of peroxisomes. However, its molecular mechanism remained unclear. In the present study, we first established a HEK293 cell line, which stably expresses a fluorescent peroxisome marker protein (DsRed2-Peroxi) and expresses PLA/AT-3 in a tetracycline-dependent manner. The treatment with tetracycline, as expected, caused disappearance of peroxisomes within 24 h, as revealed by diffuse signals of DsRed2-Peroxi and a remarkable decrease in a peroxisomal membrane protein, PMP70. A time-dependent decrease in ether-type lipid levels was also seen. Because the activation of LC3, a marker of autophagy, was not observed, the involvement of autophagy was unlikely. Among various peroxins responsible for peroxisome biogenesis, Pex19p functions as a chaperone protein for the transportation of peroxisomal membrane proteins. Immunoprecipitation analysis showed that PLA/AT-3 binds to Pex19p through its N-terminal proline-rich and C-terminal hydrophobic domains. The protein level and enzyme activity of PLA/AT-3 were increased by its coexpression with Pex19p. Moreover, PLA/AT-3 inhibited the binding of Pex19 to peroxisomal membrane proteins, such as Pex3p and Pex11βp. A catalytically inactive point mutant of PLA/AT-3 could bind to Pex19p but did not inhibit the chaperone activity of Pex19p. Altogether, these results suggest a novel regulatory mechanism for peroxisome biogenesis through the interaction between Pex19p and PLA/AT-3. PMID:26018079
Phosphorylation of Pex11p does not regulate peroxisomal fission in the yeast Hansenula polymorpha
Thomas, Ann S.; Krikken, Arjen M.; van der Klei, Ida J.; Williams, Chris P.
2015-01-01
Pex11p plays a crucial role in peroxisomal fission. Studies in Saccharomyces cerevisiae and Pichia pastoris indicated that Pex11p is activated by phosphorylation, which results in enhanced peroxisome proliferation. In S. cerevisiae but not in P. pastoris, Pex11p phosphorylation was shown to regulate the protein’s trafficking to peroxisomes. However, phosphorylation of PpPex11p was proposed to influence its interaction with Fis1p, another component of the organellar fission machinery. Here, we have examined the role of Pex11p phosphorylation in the yeast Hansenula polymorpha. Employing mass spectrometry, we demonstrate that HpPex11p is also phosphorylated on a Serine residue present at a similar position to that of ScPex11p and PpPex11p. Furthermore, through the use of mutants designed to mimic both phosphorylated and unphosphorylated forms of HpPex11p, we have investigated the role of this post-translational modification. Our data demonstrate that mutations to the phosphorylation site do not disturb the function of Pex11p in peroxisomal fission, nor do they alter the localization of Pex11p. Also, no effect on peroxisome inheritance was observed. Taken together, these data lead us to conclude that peroxisomal fission in H. polymorpha is not modulated by phosphorylation of Pex11p. PMID:26099236
Structural Insights into Cargo Recognition by the Yeast PTS1 Receptor*
Hagen, Stefanie; Drepper, Friedel; Fischer, Sven; Fodor, Krisztian; Passon, Daniel; Platta, Harald W.; Zenn, Michael; Schliebs, Wolfgang; Girzalsky, Wolfgang; Wilmanns, Matthias; Warscheid, Bettina; Erdmann, Ralf
2015-01-01
The peroxisomal matrix protein import is facilitated by cycling import receptors that shuttle between the cytosol and the peroxisomal membrane. The import receptor Pex5p mediates the import of proteins harboring a peroxisomal targeting signal of type I (PTS1). Purified recombinant Pex5p forms a dimeric complex with the PTS1-protein Pcs60p in vitro with a KD of 0.19 μm. To analyze the structural basis for receptor-cargo recognition, the PTS1 and adjacent amino acids of Pcs60p were systematically scanned for Pex5p binding by an in vitro site-directed photo-cross-linking approach. The cross-linked binding regions of the receptor were subsequently identified by high resolution mass spectrometry. Most cross-links were found with TPR6, TPR7, as well as the 7C-loop of Pex5p. Surface plasmon resonance analysis revealed a bivalent interaction mode for Pex5p and Pcs60p. Interestingly, Pcs60p lacking its C-terminal tripeptide sequence was efficiently cross-linked to the same regions of Pex5p. The KD value of the interaction of truncated Pcs60p and Pex5p was in the range of 7.7 μm. Isothermal titration calorimetry and surface plasmon resonance measurements revealed a monovalent binding mode for the interaction of Pex5p and Pcs60p lacking the PTS1. Our data indicate that Pcs60p contains a second contact site for its receptor Pex5p, beyond the C-terminal tripeptide. The physiological relevance of the ancillary binding region was supported by in vivo import studies. The bivalent binding mode might be explained by a two-step concept as follows: first, cargo recognition and initial tethering by the PTS1-receptor Pex5p; second, lock-in of receptor and cargo. PMID:26359497
Su, Juanjuan; Thomas, Ann S; Grabietz, Tanja; Landgraf, Christiane; Volkmer, Rudolf; Marrink, Siewert J; Williams, Chris; Melo, Manuel N
2018-06-01
Pex11p plays a crucial role in peroxisome fission. Previously, it was shown that a conserved N-terminal amphipathic helix in Pex11p, termed Pex11-Amph, was necessary for peroxisomal fission in vivo while in vitro studies revealed that this region alone was sufficient to bring about tubulation of liposomes with a lipid consistency resembling the peroxisomal membrane. However, molecular details of how Pex11-Amph remodels the peroxisomal membrane remain unknown. Here we have combined in silico, in vitro and in vivo approaches to gain insights into the molecular mechanisms underlying Pex11-Amph activity. Using molecular dynamics simulations, we observe that Pex11-Amph peptides form linear aggregates on a model membrane. Furthermore, we identify mutations that disrupted this aggregation in silico, which also abolished the peptide's ability to remodel liposomes in vitro, establishing that Pex11p oligomerisation plays a direct role in membrane remodelling. In vivo studies revealed that these mutations resulted in a strong reduction in Pex11 protein levels, indicating that these residues are important for Pex11p function. Taken together, our data demonstrate the power of combining in silico techniques with experimental approaches to investigate the molecular mechanisms underlying Pex11p-dependent membrane remodelling. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Nucleotide-dependent assembly of the peroxisomal receptor export complex
Grimm, Immanuel; Saffian, Delia; Girzalsky, Wolfgang; Erdmann, Ralf
2016-01-01
Pex1p and Pex6p are two AAA-ATPases required for biogenesis of peroxisomes. Both proteins form a hetero-hexameric complex in an ATP-dependent manner, which has a dual localization in the cytosol and at the peroxisomal membrane. At the peroxisomal membrane, the complex is responsible for the release of the import receptor Pex5p at the end of the matrix protein import cycle. In this study, we analyzed the recruitment of the AAA-complex to its anchor protein Pex15p at the peroxisomal membrane. We show that the AAA-complex is properly assembled even under ADP-conditions and is able to bind efficiently to Pex15p in vivo. We reconstituted binding of the Pex1/6p-complex to Pex15p in vitro and show that Pex6p mediates binding to the cytosolic part of Pex15p via a direct interaction. Analysis of the isolated complex revealed a stoichiometry of Pex1p/Pex6p/Pex15p of 3:3:3, indicating that each Pex6p molecule of the AAA-complex binds Pex15p. Binding of the AAA-complex to Pex15p in particular and to the import machinery in general is stabilized when ATP is bound to the second AAA-domain of Pex6p and its hydrolysis is prevented. The data indicate that receptor release in peroxisomal protein import is associated with a nucleotide-depending Pex1/6p-cycle of Pex15p-binding and release. PMID:26842748
Pex11mediates peroxisomal proliferation by promoting deformation of the lipid membrane
Yoshida, Yumi; Niwa, Hajime; Honsho, Masanori; Itoyama, Akinori; Fujiki, Yukio
2015-01-01
Pex11p family proteins are key players in peroxisomal fission, but their molecular mechanisms remains mostly unknown. In the present study, overexpression of Pex11pβ caused substantial vesiculation of peroxisomes in mammalian cells. This vesicle formation was dependent on dynamin-like protein 1 (DLP1) and mitochondrial fission factor (Mff), as knockdown of these proteins diminished peroxisomal fission after Pex11pβ overexpression. The fission-deficient peroxisomes exhibited an elongated morphology, and peroxisomal marker proteins, such as Pex14p or matrix proteins harboring peroxisomal targeting signal 1, were discernible in a segmented staining pattern, like beads on a string. Endogenous Pex11pβ was also distributed a striped pattern, but which was not coincide with Pex14p and PTS1 matrix proteins. Altered morphology of the lipid membrane was observed when recombinant Pex11p proteins were introduced into proteo-liposomes. Constriction of proteo-liposomes was observed under confocal microscopy and electron microscopy, and the reconstituted Pex11pβ protein localized to the membrane constriction site. Introducing point mutations into the N-terminal amphiphathic helix of Pex11pβ strongly reduced peroxisomal fission, and decreased the oligomer formation. These results suggest that Pex11p contributes to the morphogenesis of the peroxisomal membrane, which is required for subsequent fission by DLP1. PMID:25910939
Farré, Jean-Claude; Carolino, Krypton; Stasyk, Oleh V; Stasyk, Olena G; Hodzic, Zlatan; Agrawal, Gaurav; Till, Andreas; Proietto, Marco; Cregg, James; Sibirny, Andriy A; Subramani, Suresh
2017-11-24
Peroxisomal membrane proteins (PMPs) traffic to peroxisomes by two mechanisms: direct insertion from the cytosol into the peroxisomal membrane and indirect trafficking to peroxisomes via the endoplasmic reticulum (ER). In mammals and yeast, several PMPs traffic via the ER in a Pex3- and Pex19-dependent manner. In Komagataella phaffii (formerly called Pichia pastoris) specifically, the indirect traffic of Pex2, but not of Pex11 or Pex17, depends on Pex3, but all PMPs tested for indirect trafficking require Pex19. In mammals, the indirect traffic of PMPs also requires PEX16, a protein that is absent in most yeast species. In this study, we isolated PEX36, a new gene in K. phaffii, which encodes a PMP. Pex36 is required for cell growth in conditions that require peroxisomes for the metabolism of certain carbon sources. This growth defect in cells lacking Pex36 can be rescued by the expression of human PEX16, Saccharomyces cerevisiae Pex34, or by overexpression of the endogenous K. phaffii Pex25. Pex36 is not an essential protein for peroxisome proliferation, but in the absence of the functionally redundant protein, Pex25, it becomes essential and less than 20% of these cells show import-incompetent, peroxisome-like structures (peroxisome remnants). In the absence of both proteins, peroxisome biogenesis and the intra-ER sorting of Pex2 and Pex11C are seriously impaired, likely by affecting Pex3 and Pex19 function. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, L.; Desbarats, M.; Viel, J.
1996-08-15
The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less
Alternative splicing suggests extended function of PEX26 in peroxisome biogenesis.
Weller, Sabine; Cajigas, Ivelisse; Morrell, James; Obie, Cassandra; Steel, Gary; Gould, Stephen J; Valle, David
2005-06-01
Matsumoto and colleagues recently identified PEX26 as the gene responsible for complementation group 8 of the peroxisome biogenesis disorders and showed that it encodes an integral peroxisomal membrane protein with a single C-terminal transmembrane domain and a cytosolic N-terminus that interacts with the PEX1/PEX6 heterodimer through direct binding to the latter. They proposed that PEX26 functions as the peroxisomal docking factor for the PEX1/PEX6 heterodimer. Here, we identify new PEX26 disease alleles, localize the PEX6-binding domain to the N-terminal half of the protein (aa 29-174), and show that, at the cellular level, PEX26 deficiency impairs peroxisomal import of both PTS1- and PTS2-targeted matrix proteins. Also, we find that PEX26 undergoes alternative splicing to produce several splice forms--including one, PEX26- delta ex5, that maintains frame and encodes an isoform lacking the transmembrane domain of full-length PEX26 (PEX26-FL). Despite its cytosolic location, PEX26- delta ex5 rescues peroxisome biogenesis in PEX26-deficient cells as efficiently as does PEX26-FL. To test our observation that a peroxisomal location is not required for PEX26 function, we made a chimeric protein (PEX26-Mito) with PEX26 as its N-terminus and the targeting segment of a mitochondrial outer membrane protein (OMP25) at its C-terminus. We found PEX26-Mito localized to the mitochondria and directed all detectable PEX6 and a fraction of PEX1 to this extraperoxisomal location; yet PEX26-Mito retains the full ability to rescue peroxisome biogenesis in PEX26-deficient cells. On the basis of these observations, we suggest that a peroxisomal localization of PEX26 and PEX6 is not required for their function and that the interaction of PEX6 with PEX1 is dynamic. This model predicts that, once activated in an extraperoxisomal location, PEX1 moves to the peroxisome and completes the function of the PEX1/6 heterodimer.
In Vitro Effects of the Endocrine Disruptor p,p'-DDT on Human Follitropin Receptor.
Munier, Mathilde; Grouleff, Julie; Gourdin, Louis; Fauchard, Mathilde; Chantreau, Vanessa; Henrion, Daniel; Coutant, Régis; Schiøtt, Birgit; Chabbert, Marie; Rodien, Patrice
2016-07-01
1-chloro-4-[2,2,2-trichloro-1-(4-chlorophenyl)ethyl]benzene (p,p'-DDT) is a persistent environmental endocrine disruptor (ED). Several studies have shown an association between p,p'-DDT exposure and reproductive abnormalities. To investigate the putative effects of p,p'-DDT on the human follitropin receptor (FSHR) function. We used Chinese hamster ovary (CHO) cells stably expressing human FSHR to investigate the impact of p,p'-DDT on FSHR activity and its interaction with the receptor. At a concentration of 5 μM p,p'-DDT increased the maximum response of the FSHR to follitropin by 32 ± 7.45%. However, 5 μM p,p'-DDT decreased the basal activity and did not influence the maximal response of the closely related LH/hCG receptor to human chorionic gonadotropin (hCG). The potentiating effect of p,p'-DDT was specific for the FSHR. Moreover, in cells that did not express FSHR, p,p'-DDT had no effect on cAMP response. Thus, the potentiating effect of p,p'-DDT was dependent on the FSHR. In addition, p,p'-DDT increased the sensitivity of FSHR to hCG and to a low molecular weight agonist of the FSHR, 3-((5methyl)-2-(4-benzyloxy-phenyl)-5-{[2-[3-ethoxy-4-methoxy-phenyl)-ethylcarbamoyl]-methyl}-4-oxo-thiazolidin-3-yl)-benzamide (16a). Basal activity in response to p,p'-DDT and potentiation of the FSHR response to FSH by p,p'-DDT varied among FSHR mutants with altered transmembrane domains (TMDs), consistent with an effect of p,p'-DDT via TMD binding. This finding was corroborated by the results of simultaneously docking p,p'-DDT and 16a into the FSHR transmembrane bundle. p,p'-DDT acted as a positive allosteric modulator of the FSHR in our experimental model. These findings suggest that G protein-coupled receptors are additional targets of endocrine disruptors. Munier M, Grouleff J, Gourdin L, Fauchard M, Chantreau V, Henrion D, Coutant R, Schiøtt B, Chabbert M, Rodien P. 2016. In vitro effects of the endocrine disruptor p,p'-DDT on human follitropin receptor. Environ Health
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sampathkumar, P.; Roach, C.; Michels, P.A.M.
2009-05-27
Glycosomes are peroxisome-like organelles essential for trypanosomatid parasites. Glycosome biogenesis is mediated by proteins called 'peroxins,' which are considered to be promising drug targets in pathogenic Trypanosomatidae. The first step during protein translocation across the glycosomal membrane of peroxisomal targeting signal 1 (PTS1)-harboring proteins is signal recognition by the cytosolic receptor peroxin 5 (PEX5). The C-terminal PTS1 motifs interact with the PTS1 binding domain (P1BD) of PEX5, which is made up of seven tetratricopeptide repeats. Obtaining diffraction-quality crystals of the P1BD of Trypanosoma brucei PEX5 (TbPEX5) required surface entropy reduction mutagenesis. Each of the seven tetratricopeptide repeats appears to havemore » a residue in the alpha(L) conformation in the loop connecting helices A and B. Five crystal structures of the P1BD of TbPEX5 were determined, each in complex with a hepta- or decapeptide corresponding to a natural or nonnatural PTS1 sequence. The PTS1 peptides are bound between the two subdomains of the P1BD. These structures indicate precise recognition of the C-terminal Leu of the PTS1 motif and important interactions between the PTS1 peptide main chain and up to five invariant Asn side chains of PEX5. The TbPEX5 structures reported here reveal a unique hydrophobic pocket in the subdomain interface that might be explored to obtain compounds that prevent relative motions of the subdomains and interfere selectively with PTS1 motif binding or release in trypanosomatids, and would therefore disrupt glycosome biogenesis and prevent parasite growth.« less
NASA Astrophysics Data System (ADS)
Ehrenfreund, Pascale; Foing, Bernard
2014-05-01
In response to the growing importance of space exploration, the objectives of the COSPAR Panel on Exploration (PEX) are to provide high quality, independent science input to support the development of a global space exploration program while working to safeguard the scientific assets of solar system bodies. PEX engages with COSPAR Commissions and Panels, science foundations, IAA, IAF, UN bodies, and IISL to support in particular national and international space exploration working groups and the new era of planetary exploration. COSPAR's input, as gathered by PEX, is intended to express the consensus view of the international scientific community and should ultimately provide a series of guidelines to support future space exploration activities and cooperative efforts, leading to outstanding scientific discoveries, opportunities for innovation, strategic partnerships, technology progression, and inspiration for people of all ages and cultures worldwide. We shall focus on the lunar exploration aspects, where the COSPAR PEX is building on previous COSPAR, ILEWG and community conferences. An updated COSPAR PEX report is published and available online (Ehrenfreund P. et al, COSPAR planetary exploration panel report, http://www.gwu.edu/~spi/assets/COSPAR_PEX2012.pdf). We celebrate 20 years after the 1st International Conference on Exploration and Utilisation of the Moon at Beatenberg in June 1994. The International Lunar Exploration Working Group (ILEWG) was established the year after in April 1995 at an EGS meeting in Hamburg, Germany. As established in its charter, this working group reports to COSPAR and is charged with developing an international strategy for the exploration of the Moon (http://sci.esa.int/ilewg/ ). It discusses coordination between missions, and a road map for future international lunar exploration and utilisation. It fosters information exchange or potential and real future lunar robotic and human missions, as well as for new scientific and
Blockade of human P2X7 receptor function with a monoclonal antibody.
Buell, G; Chessell, I P; Michel, A D; Collo, G; Salazzo, M; Herren, S; Gretener, D; Grahames, C; Kaur, R; Kosco-Vilbois, M H; Humphrey, P P
1998-11-15
A monoclonal antibody (MoAb) specific for the human P2X7 receptor was generated in mice. As assessed by flow cytometry, the MoAb labeled human blood-derived macrophage cells natively expressing P2X7 receptors and cells transfected with human P2X7 but not other P2X receptor types. The MoAb was used to immunoprecipitate the human P2X7 receptor protein, and in immunohistochemical studies on human lymphoid tissue, P2X7 receptor labeling was observed within discrete areas of the marginal zone of human tonsil sections. The antibody also acted as a selective antagonist of human P2X7 receptors in several functional studies. Thus, whole cell currents, elicited by the brief application of 2',3'-(4-benzoyl)-benzoyl-ATP in cells expressing human P2X7, were reduced in amplitude by the presence of the MoAb. Furthermore, preincubation of human monocytic THP-1 cells with the MoAb antagonized the ability of P2X7 agonists to induce the release of interleukin-1beta.
Negoro, Hiroaki; Sakamoto, Mitsuru; Kotaka, Atsushi; Matsumura, Kengo; Hata, Yoji
2018-02-01
Saccharomyces cerevisiae produces organic acids such as succinate, acetate, and malate during alcoholic fermentation. Since malate contributes to the pleasant taste of sake (a Japanese alcoholic beverage), various methods for breeding high-malate-producing yeast strains have been developed. Here, a high-malate-producing yeast strain F-701H was isolated. This mutant was sensitive to dimethyl succinate (DMS) and harbored a nonsense mutation in the peroxin gene PEX22, which was identified as the cause of high malate production by comparative genome analysis. This mutation, which appeared to cause Pex22p dysfunction, was sufficient to confer increased malate productivity and DMS sensitivity to yeast cells. Next, we investigated the mechanism by which this mutation led to high malate production in yeast cells. Peroxins, such as Pex22p, maintain peroxisomal biogenesis. Analysis of 29 PEX disruptants revealed an increased malate production by deletion of the genes encoding peroxins responsible for importing proteins (containing peroxisomal targeting signal 1, PTS1) into the peroxisomal matrix, and those responsible for the assembly of peroxins themselves in the peroxisomal membrane. A defect in peroxisomal malate dehydrogenase (Mdh3p), harboring endogenous PTS1, inhibited the high malate-producing phenotype in the PEX22 mutant. Moreover, Mdh3p, which was normally sorted to the peroxisomal matrix, was potentially mislocalized to the cytosol in the PEX22 mutant. This suggested that an increase in malate production resulted from the mislocalization of Mdh3p from the peroxisome to the cytoplasm due to the loss of peroxin-mediated transportation. Thus, the present study revealed a novel mechanism for organic acid productions in yeast during sake brewing. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Effect of age on the expression of Pex (Phex) in the mouse.
Meyer, R A; Young, C G; Meyer, M H; Garges, P L; Price, D K
2000-04-01
Pex is a newly discovered gene (also called Phex) whose mutation is the cause of X-linked hypophosphatemia. Other members of this gene family encode endopeptidases that activate or inactivate endocrine and paracrine factors. Though embryonic bone expresses mRNA for the Pex gene at relatively high levels, we have found Pex expression to be widespread in adult organs and to be poorly expressed in adult bone. This led to the hypothesis that Pex mRNA expression changes with age. To test this, genetically normal mice of the B6C3H hybrid strain were studied at 0 (newborn), 2, 3, 10, and 72 weeks of age. Organs known to express Pex were collected, and RNA was extracted from them. Following reverse transcription, cDNA was amplified by the polymerase chain reaction with primers for Pex and G3PDH, a housekeeping gene. The amplimers were separated by electrophoresis, blotted onto nylon membranes, and hybridized with radioactively labeled internal oligonucleotide probes. The radioactivity was quantified, and the data were analyzed as the Pex/G3PDH ratio. The brain samples had high levels of Pex mRNA expression that rose slightly with age. Calvaria, kidney, and lung samples had the highest Pex mRNA expression at birth. In these organs Pex mRNA expression fell with age to undetectable or barely detectable levels. Thymus, heart, and skeletal muscle samples had low Pex mRNA expression at birth that did not change with age. Some organs showed a decline in G3PDH levels with age, but Pex expression decreased more, leading to a reduced Pex/G3PDH ratio. The widespread expression of mRNA for Pex suggests a role beyond that of phosphate homeostasis. The high level of expression in newborn animals suggests a role in growth and development. This seems to occur in addition to its role for the endocrine regulation of phosphate homeostasis by as yet unknown humoral agents that must occur throughout life. In summary, Pex mRNA expression is high in brain and bone at birth. Expression remains
Shabir, Saqib; Cross, William; Kirkwood, Lisa A; Pearson, Joanna F; Appleby, Peter A; Walker, Dawn; Eardley, Ian; Southgate, Jennifer
2013-08-01
In addition to its role as a physical barrier, the urothelium is considered to play an active role in mechanosensation. A key mechanism is the release of transient mediators that activate purinergic P2 receptors and transient receptor potential (TRP) channels to effect changes in intracellular Ca²⁺. Despite the implied importance of these receptors and channels in urothelial tissue homeostasis and dysfunctional bladder disease, little is known about their functional expression by the human urothelium. To evaluate the expression and function of P2X and P2Y receptors and TRP channels, the human ureter and bladder were used to separate urothelial and stromal tissues for RNA isolation and cell culture. RT-PCR using stringently designed primer sets was used to establish which P2 and TRP species were expressed at the transcript level, and selective agonists/antagonists were used to confirm functional expression by monitoring changes in intracellular Ca²⁺ and in a scratch repair assay. The results confirmed the functional expression of P2Y₄ receptors and excluded nonexpressed receptors/channels (P2X₁, P2X₃, P2X₆, P2Y₆, P2Y₁₁, TRPV5, and TRPM8), while a dearth of specific agonists confounded the functional validation of expressed P2X₂, P2X₄, P2Y₁, P2Y₂, TRPV2, TRPV3, TRPV6 and TRPM7 receptors/channels. Although a conventional response was elicited in control stromal-derived cells, the urothelial cell response to well-characterized TRPV1 and TRPV4 agonists/antagonists revealed unexpected anomalies. In addition, agonists that invoked an increase in intracellular Ca²⁺ promoted urothelial scratch repair, presumably through the release of ATP. The study raises important questions about the ligand selectivity of receptor/channel targets expressed by the urothelium. These pathways are important in urothelial tissue homeostasis, and this opens the possibility of selective drug targeting.
Shabir, Saqib; Cross, William; Kirkwood, Lisa A.; Pearson, Joanna F.; Appleby, Peter A.; Walker, Dawn; Eardley, Ian
2013-01-01
In addition to its role as a physical barrier, the urothelium is considered to play an active role in mechanosensation. A key mechanism is the release of transient mediators that activate purinergic P2 receptors and transient receptor potential (TRP) channels to effect changes in intracellular Ca2+. Despite the implied importance of these receptors and channels in urothelial tissue homeostasis and dysfunctional bladder disease, little is known about their functional expression by the human urothelium. To evaluate the expression and function of P2X and P2Y receptors and TRP channels, the human ureter and bladder were used to separate urothelial and stromal tissues for RNA isolation and cell culture. RT-PCR using stringently designed primer sets was used to establish which P2 and TRP species were expressed at the transcript level, and selective agonists/antagonists were used to confirm functional expression by monitoring changes in intracellular Ca2+ and in a scratch repair assay. The results confirmed the functional expression of P2Y4 receptors and excluded nonexpressed receptors/channels (P2X1, P2X3, P2X6, P2Y6, P2Y11, TRPV5, and TRPM8), while a dearth of specific agonists confounded the functional validation of expressed P2X2, P2X4, P2Y1, P2Y2, TRPV2, TRPV3, TRPV6 and TRPM7 receptors/channels. Although a conventional response was elicited in control stromal-derived cells, the urothelial cell response to well-characterized TRPV1 and TRPV4 agonists/antagonists revealed unexpected anomalies. In addition, agonists that invoked an increase in intracellular Ca2+ promoted urothelial scratch repair, presumably through the release of ATP. The study raises important questions about the ligand selectivity of receptor/channel targets expressed by the urothelium. These pathways are important in urothelial tissue homeostasis, and this opens the possibility of selective drug targeting. PMID:23720349
Reach and Cost-Effectiveness of the PrePex Device for Safe Male Circumcision in Uganda
Duffy, Kevin; Galukande, Moses; Wooding, Nick; Dea, Monica; Coutinho, Alex
2013-01-01
Introduction Modelling, supported by the USAID Health Policy Initiative and UNAIDS, performed in 2011, indicated that Uganda would need to perform 4.2 million medical male circumcisions (MMCs) to reach 80% prevalence. Since 2010 Uganda has completed 380,000 circumcisions, and has set a national target of 1 million for 2013. Objective To evaluate the relative reach and cost-effectiveness of PrePex compared to the current surgical SMC method and to determine the effect that this might have in helping to achieve the Uganda national SMC targets. Methods A cross-sectional descriptive cost-analysis study conducted at International Hospital Kampala over ten weeks from August to October 2012. Data collected during the performance of 625 circumcisions using PrePex was compared to data previously collected from 10,000 circumcisions using a surgical circumcision method at the same site. Ethical approval was obtained. Results The moderate adverse events (AE) ratio when using the PrePex device was 2% and no severe adverse events were encountered, which is comparable to the surgical method, thus the AE rate has no effect on the reach or cost-effectiveness of PrePex. The unit cost to perform one circumcision using PrePex is $30.55, 35% ($7.90) higher than the current surgical method, but the PrePex method improves operator efficiency by 60%, meaning that a team can perform 24 completed circumcisions compared to 15 by the surgical method. The cost-effectiveness of PrePex, comparing the cost of performing circumcisions to the future cost savings of potentially averted HIV infections, is just 2% less than the current surgical method, at a device cost price of $20. Conclusion PrePex is a viable SMC tool for scale-up with unrivalled potential for superior reach, however national targets can only be met with effective demand creation and availability of trained human resource. PMID:23717402
Pharmacological characterization of recombinant human and rat P2X receptor subtypes.
Bianchi, B R; Lynch, K J; Touma, E; Niforatos, W; Burgard, E C; Alexander, K M; Park, H S; Yu, H; Metzger, R; Kowaluk, E; Jarvis, M F; van Biesen, T
1999-07-02
ATP functions as a fast neurotransmitter through the specific activation of a family of ligand-gated ion channels termed P2X receptors. In this report, six distinct recombinant P2X receptor subtypes were pharmacologically characterized in a heterologous expression system devoid of endogenous P2 receptor activity. cDNAs encoding four human P2X receptor subtypes (hP2X1, hP2X3, hP2X4, and hP2X7), and two rat P2X receptor subtypes (rP2X2 and rP2X3), were stably expressed in 1321N1 human astrocytoma cells. Furthermore, the rP2X2 and rP2X3 receptor subtypes were co-expressed in these same cells to form heteromultimeric receptors. Pharmacological profiles were determined for each receptor subtype, based on the activity of putative P2 ligands to stimulate Ca2+ influx. The observed potency and kinetics of each response was receptor subtype-specific and correlated with their respective electrophysiological properties. Each receptor subtype exhibited a distinct pharmacological profile, based on its respective sensitivity to nucleotide analogs, diadenosine polyphosphates and putative P2 receptor antagonists. Alphabeta-methylene ATP (alphabeta-meATP), a putative P2X receptor-selective agonist, was found to exhibit potent agonist activity only at the hP2X1, hP2X3 and rP2X3 receptor subtypes. Benzoylbenzoic ATP (BzATP, 2' and 3' mixed isomers), which has been reported to act as a P2X7 receptor-selective agonist, was least active at the rat and human P2X7 receptors, but was a potent (nM) agonist at hP2X1, rP2X3 and hP2X3 receptors. These data comprise a systematic examination of the functional pharmacology of P2X receptor activation.
Degradation of specific aromatic compounds migrating from PEX pipes into drinking water.
Ryssel, Sune Thyge; Arvin, Erik; Lützhøft, Hans-Christian Holten; Olsson, Mikael Emil; Procházková, Zuzana; Albrechtsen, Hans-Jørgen
2015-09-15
Nine specific compounds identified to migrate from polyethylene (PE) and cross-linked polyethylene (PEX) to drinking water were investigated for their degradation in drinking water. Three sample types were studied: field samples (collected at consumer taps), PEX pipe water extractions, and water samples spiked with target compounds. Four compounds were quantified in field samples at concentrations of 0.15-8.0 μg/L. During PEX pipe water extraction 0.42 ± 0.20 mg NVOC/L was released and five compounds quantified (0.5-6.1 μg/L). The degradation of these compounds was evaluated in PEX-pipe water extractions and spiked samples. 4-ethylphenol was degraded within 22 days. Eight compounds were, however, only partially degradable under abiotic and biotic conditions within the timeframe of the experiments (2-4 weeks). Neither inhibition nor co-metabolism was observed in the presence of acetate or PEX pipe derived NVOC. Furthermore, the degradation in drinking water from four different locations with three different water works was similar. In conclusion, eight out of the nine compounds studied would - if being released from the pipes - reach consumers with only minor concentration decrease during water distribution. Copyright © 2015 Elsevier Ltd. All rights reserved.
In Vitro Effects of the Endocrine Disruptor p,p’-DDT on Human Follitropin Receptor
Munier, Mathilde; Grouleff, Julie; Gourdin, Louis; Fauchard, Mathilde; Chantreau, Vanessa; Henrion, Daniel; Coutant, Régis; Schiøtt, Birgit; Chabbert, Marie; Rodien, Patrice
2016-01-01
Background: 1-chloro-4-[2,2,2-trichloro-1-(4-chlorophenyl)ethyl]benzene (p,p′-DDT) is a persistent environmental endocrine disruptor (ED). Several studies have shown an association between p,p′-DDT exposure and reproductive abnormalities. Objectives: To investigate the putative effects of p,p′-DDT on the human follitropin receptor (FSHR) function. Methods and Results: We used Chinese hamster ovary (CHO) cells stably expressing human FSHR to investigate the impact of p,p′-DDT on FSHR activity and its interaction with the receptor. At a concentration of 5 μM p,p′-DDT increased the maximum response of the FSHR to follitropin by 32 ± 7.45%. However, 5 μM p,p′-DDT decreased the basal activity and did not influence the maximal response of the closely related LH/hCG receptor to human chorionic gonadotropin (hCG). The potentiating effect of p,p′-DDT was specific for the FSHR. Moreover, in cells that did not express FSHR, p,p′-DDT had no effect on cAMP response. Thus, the potentiating effect of p,p′-DDT was dependent on the FSHR. In addition, p,p′-DDT increased the sensitivity of FSHR to hCG and to a low molecular weight agonist of the FSHR, 3-((5methyl)-2-(4-benzyloxy-phenyl)-5-{[2-[3-ethoxy-4-methoxy-phenyl)-ethylcarbamoyl]-methyl}-4-oxo-thiazolidin-3-yl)-benzamide (16a). Basal activity in response to p,p′-DDT and potentiation of the FSHR response to FSH by p,p′-DDT varied among FSHR mutants with altered transmembrane domains (TMDs), consistent with an effect of p,p′-DDT via TMD binding. This finding was corroborated by the results of simultaneously docking p,p′-DDT and 16a into the FSHR transmembrane bundle. Conclusion: p,p′-DDT acted as a positive allosteric modulator of the FSHR in our experimental model. These findings suggest that G protein–coupled receptors are additional targets of endocrine disruptors. Citation: Munier M, Grouleff J, Gourdin L, Fauchard M, Chantreau V, Henrion D, Coutant R, Schiøtt B, Chabbert M, Rodien P. 2016
Peroxisomal Pex11 is a pore-forming protein homologous to TRPM channels.
Mindthoff, Sabrina; Grunau, Silke; Steinfort, Laura L; Girzalsky, Wolfgang; Hiltunen, J Kalervo; Erdmann, Ralf; Antonenkov, Vasily D
2016-02-01
More than 30 proteins (Pex proteins) are known to participate in the biogenesis of peroxisomes-ubiquitous oxidative organelles involved in lipid and ROS metabolism. The Pex11 family of homologous proteins is responsible for division and proliferation of peroxisomes. We show that yeast Pex11 is a pore-forming protein sharing sequence similarity with TRPM cation-selective channels. The Pex11 channel with a conductance of Λ=4.1 nS in 1.0M KCl is moderately cation-selective (PK(+)/PCl(-)=1.85) and resistant to voltage-dependent closing. The estimated size of the channel's pore (r~0.6 nm) supports the notion that Pex11 conducts solutes with molecular mass below 300-400 Da. We localized the channel's selectivity determining sequence. Overexpression of Pex11 resulted in acceleration of fatty acids β-oxidation in intact cells but not in the corresponding lysates. The β-oxidation was affected in cells by expression of the Pex11 protein carrying point mutations in the selectivity determining sequence. These data suggest that the Pex11-dependent transmembrane traffic of metabolites may be a rate-limiting step in the β-oxidation of fatty acids. This conclusion was corroborated by analysis of the rate of β-oxidation in yeast strains expressing Pex11 with mutations mimicking constitutively phosphorylated (S165D, S167D) or unphosphorylated (S165A, S167A) protein. The results suggest that phosphorylation of Pex11 is a mechanism that can control the peroxisomal β-oxidation rate. Our results disclose an unexpected function of Pex11 as a non-selective channel responsible for transfer of metabolites across peroxisomal membrane. The data indicate that peroxins may be involved in peroxisomal metabolic processes in addition to their role in peroxisome biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.
Cavaliere, Fabio; Nestola, Valeria; Amadio, Susanna; D'Ambrosi, Nadia; Angelini, Daniela F; Sancesario, Giuseppe; Bernardi, Giorgio; Volonté, Cinzia
2005-02-01
Extracellular nucleotides exert a variety of biological actions through different subtypes of P2 receptors. Here we characterized in the human neuroblastoma SH-SY5Y cells the simultaneous presence of various P2 receptors, belonging to the P2X ionotropic and P2Y metabotropic families. Western blot analysis detected the P2X1,2,4,5,6,7 and P2Y1,2,4,6, but not the P2X3 and P2Y12 receptors. We then investigated which biological effects were mediated by the P2Y4 subtype and its physiological pyrimidine agonist UTP. We found that neuronal differentiation of the SH-SY5Y cells with dibutiryl-cAMP increased the expression of the P2Y4 protein and that UTP itself was able to positively interfere with neuritogenesis. Moreover, transient transfection and activation of P2Y4 also facilitated neuritogenesis in SH-SY5Y cells, as detected by morphological phase contrast analysis and confocal examination of neurofilament proteins NFL. This was concurrent with increased transcription of immediate-early genes linked to differentiation such as cdk-5 and NeuroD6, and activity of AP-1 transcription family members such as c-fos, fos-B, and jun-D. Nevertheless, a prolonged activation of the P2Y4 receptor by UTP also induced cell death, both in naive, differentiated, and P2Y4-transfected SH-SY5Y cells, as measured by direct count of intact nuclei and cytofluorimetric analysis of damaged DNA. Taken together, our data indicate that the high expression and activation of the P2Y4 receptor participates in the neuronal differentiation and commitment to death of SH-SY5Y cells.
Bouchelet, Isabelle; Case, Bruce; Olivier, André; Hamel, Edith
2000-01-01
Using subtype-selective 5-HT1 receptor agonists and/or the 5-HT1 receptor antagonist GR127935, we characterized in vitro the 5-HT receptor that mediates the contraction of human and bovine cerebral arteries. Further, we investigated which sumatriptan-sensitive receptors are present in human coronary artery by reverse-transcriptase polymerase chain reaction (RT–PCR). Agonists with affinity at the 5-HT1B receptor, such as sumatriptan, alniditan and/or IS-159, elicited dose-dependent contraction in both human and bovine cerebral arteries. They behaved as full agonists at the sumatriptan-sensitive 5-HT1 receptors in both species. In contrast, PNU-109291 and LY344864, selective agonists at 5-HT1D and 5-HT1F receptors, respectively, were devoid of any significant vasocontractile activity in cerebral arteries, or did not affect the sumatriptan-induced vasocontraction. The rank order of agonist potency was similar in both species and could be summarized as 5-HT=alniditan>sumatriptan=IS-159>>>PNU-109291=LY344864. In bovine cerebral arteries, the 5-HT1 receptor antagonist GR127935 dose-dependently inhibited the vasoconstrictions elicited by both 5-HT and sumatriptan, with respective pA2 values of 8.0 and 8.6. RT–PCR studies in human coronary arteries showed a strong signal for the 5-HT1B receptor while message for the 5-HT1F receptor was weak and less frequently detected. Expression of 5-HT1D receptor mRNA was not detected in any sample. The present results demonstrate that the triptan-induced contraction in brain vessels is mediated exclusively by the 5-HT1B receptor, which is also present in a majority of human coronary arteries. These results suggest that selective 5-HT1D and 5-HT1F receptor agonists might represent new antimigraine drugs devoid of cerebro- and cardiovascular effects. PMID:10711348
Sade, Hadassah; Baumgartner, Claudia; Hugenmatter, Adrian; Moessner, Ekkehard; Freskgård, Per-Ola; Niewoehner, Jens
2014-01-01
We have adapted an in vitro model of the human blood-brain barrier, the immortalized human cerebral microvascular endothelial cells (hCMEC/D3), to quantitatively measure protein transcytosis. After validating the receptor-mediated transport using transferrin, the system was used to measure transcytosis rates of antibodies directed against potential brain shuttle receptors. While an antibody to the insulin-like growth factor 1 receptor (IGF1R) was exclusively recycled to the apical compartment, the fate of antibodies to the transferrin receptor (TfR) was determined by their relative affinities at extracellular and endosomal pH. An antibody with reduced affinity at pH5.5 showed significant transcytosis, while pH-independent antibodies of comparable affinities at pH 7.4 remained associated with intracellular vesicular compartments and were finally targeted for degradation. PMID:24788759
Serotonin (5-HT) receptor 5A sequence variants affect human plasma triglyceride levels
Zhang, Y.; Smith, E. M.; Baye, T. M.; Eckert, J. V.; Abraham, L. J.; Moses, E. K.; Kissebah, A. H.; Martin, L. J.
2010-01-01
Neurotransmitters such as serotonin (5-hydroxytryptamine, 5-HT) work closely with leptin and insulin to fine-tune the metabolic and neuroendocrine responses to dietary intake. Losing the sensitivity to excess food intake can lead to obesity, diabetes, and a multitude of behavioral disorders. It is largely unclear how different serotonin receptor subtypes respond to and integrate metabolic signals and which genetic variations in these receptor genes lead to individual differences in susceptibility to metabolic disorders. In an obese cohort of families of Northern European descent (n = 2,209), the serotonin type 5A receptor gene, HTR5A, was identified as a prominent factor affecting plasma levels of triglycerides (TG), supported by our data from both genome-wide linkage and targeted association analyses using 28 publicly available and 12 newly discovered single nucleotide polymorphisms (SNPs), of which 3 were strongly associated with plasma TG levels (P < 0.00125). Bayesian quantitative trait nucleotide (BQTN) analysis identified a putative causal promoter SNP (rs3734967) with substantial posterior probability (P = 0.59). Functional analysis of rs3734967 by electrophoretic mobility shift assay (EMSA) showed distinct binding patterns of the two alleles of this SNP with nuclear proteins from glioma cell lines. In conclusion, sequence variants in HTR5A are strongly associated with high plasma levels of TG in a Northern European population, suggesting a novel role of the serotonin receptor system in humans. This suggests a potential brain-specific regulation of plasma TG levels, possibly by alteration of the expression of HTR5A. PMID:20388841
OsPEX11, a Peroxisomal Biogenesis Factor 11, Contributes to Salt Stress Tolerance in Oryza sativa.
Cui, Peng; Liu, Hongbo; Islam, Faisal; Li, Lan; Farooq, Muhammad A; Ruan, Songlin; Zhou, Weijun
2016-01-01
Peroxisomes are single membrane-bound organelles, whose basic enzymatic constituents are catalase and H 2 O 2 -producing flavin oxidases. Previous reports showed that peroxisome is involved in numerous processes including primary and secondary metabolism, plant development and abiotic stress responses. However, knowledge on the function of different peroxisome genes from rice and its regulatory roles in salt and other abiotic stresses is limited. Here, a novel prey protein, OsPEX11 (Os03g0302000), was screened and identified by yeast two-hybrid and GST pull-down assays. Phenotypic analysis of OsPEX11 overexpression seedlings demonstrated that they had better tolerance to salt stress than wild type (WT) and OsPEX11-RNAi seedlings. Compared with WT and OsPEX11-RNAi seedlings, overexpression of OsPEX11 had lower level of lipid peroxidation, Na + /K + ratio, higher activities of antioxidant enzymes (SOD, POD, and CAT) and proline accumulation. Furthermore, qPCR data suggested that OsPEX11 acted as a positive regulator of salt tolerance by reinforcing the expression of several well-known rice transporters ( OsHKT2;1, OsHKT1;5, OsLti6a, OsLti6b, OsSOS1, OsNHX1 , and OsAKT1 ) involved in Na + /K + homeostasis in transgenic plants under salinity. Ultrastructural observations of OsPEX11-RNAi seedlings showed that they were less sensitive to salt stress than WT and overexpression lines. These results provide experimental evidence that OsPEX11 is an important gene implicated in Na + and K + regulation, and plays a critical role in salt stress tolerance by modulating the expression of cation transporters and antioxidant defense. Thus, OsPEX11 could be considered in transgenic breeding for improvement of salt stress tolerance in rice crop.
Gunduz, Mehmet
2016-01-01
Peroxisomal disorders are a group of genetically heterogeneous metabolic diseases related to dysfunction of peroxisomes. Dysmorphic features, neurological abnormalities, and hepatic dysfunction can be presenting signs of peroxisomal disorders. Here we presented dysmorphic facial features and other clinical characteristics in two patients with PEX1 gene mutation. Follow-up periods were 3.5 years and 1 year in the patients. Case I was one-year-old girl that presented with neurodevelopmental delay, hepatomegaly, bilateral hearing loss, and visual problems. Ophthalmologic examination suggested septooptic dysplasia. Cranial magnetic resonance imaging (MRI) showed nonspecific gliosis at subcortical and periventricular deep white matter. Case II was 2.5-year-old girl referred for investigation of global developmental delay and elevated liver enzymes. Ophthalmologic examination findings were consistent with bilateral nystagmus and retinitis pigmentosa. Cranial MRI was normal. Dysmorphic facial features including broad nasal root, low set ears, downward slanting eyes, downward slanting eyebrows, and epichantal folds were common findings in two patients. Molecular genetic analysis indicated homozygous novel IVS1-2A>G mutation in Case I and homozygous p.G843D (c.2528G>A) mutation in Case II in the PEX1 gene. Clinical findings and developmental prognosis vary in PEX1 gene mutation. Kabuki-like phenotype associated with liver pathology may indicate Zellweger spectrum disorders (ZSD). PMID:27882258
Chernova, Irene; Lai, Jian-Ping; Li, Haiying; Schwartz, Lynnae; Tuluc, Florin; Korchak, Helen M.; Douglas, Steven D.; Kilpatrick, Laurie E.
2009-01-01
Substance P (SP) is a potent modulator of monocyte/macrophage function. The SP-preferring receptor neurokinin-1 receptor (NK1R) has two forms: a full-length NK1R (NK1R-F) isoform and a truncated NK1R (NK1R-T) isoform, which lacks the terminal cytoplasmic 96-aa residues. The distribution of these receptor isoforms in human monocytes is not known. We previously identified an interaction among SP, NK1R, and HIV viral strains that use the chemokine receptor CCR5 as a coreceptor, suggesting crosstalk between NK1R and CCR5. The purpose of this study was to determine which form(s) of NK1R are expressed in human peripheral blood monocytes and to determine whether SP affects proinflammatory cellular responses mediated through the CCR5 receptor. Human peripheral blood monocytes were found to express NK1R-T but not NK1R-F. SP interactions with NK1R-T did not mobilize calcium (Ca2+), but SP mobilized Ca2+ when the NK1R-F was transfected into monocytes. However, the NK1R-T was functional in monocytes, as SP enhanced the CCR5 ligand CCL5-elicited Ca2+ mobilization, a response inhibited by the NK1R antagonist aprepitant. SP interactions with the NK1R-T also enhanced CCL5-mediated chemotaxis, which was ERK1/2-dependent. NK1R-T selectively activated ERK2 but increased ERK1 and ERK2 activation by CCL5. Activation of NK1R-T elicited serine phosphorylation of CCR5, indicating that crosstalk between CCL5 and SP may occur at the level of the receptor. Thus, NK1R-T is functional in human monocytes and activates select signaling pathways, and the NK1R-T-mediated enhancement of CCL5 responses does not require the NK1R terminal cytoplasmic domain. PMID:18835883
Human Exploration on the Moon, Mars and NEOs: PEX.2/ICEUM12B
NASA Astrophysics Data System (ADS)
Foing, Bernard H.
2016-07-01
The session COSPAR-16-PEX.2: "Human Exploration on the Moon, Mars and NEOs", co-sponsored by Commissions B, F will include solicited and contributed talks and poster/interactive presentations. It will also be part of the 12th International Conference on Exploration and Utilisation of the Moon ICEUM12B from the ILEWG ICEUM series started in 1994. It will address various themes and COSPAR communities: - Sciences (of, on, from) the Moon enabled by humans - Research from cislunar and libration points - From robotic villages to international lunar bases - Research from Mars & NEOs outposts - Humans to Phobos/Deimos, Mars and NEOS - Challenges and preparatory technologies, field research operations - Human and robotic partnerships and precursor missions - Resource utilisation, life support and sustainable exploration - Stakeholders for human exploration One half-day session will be dedicated to a workshop format and meetings/reports of task groups: Science, Technology, Agencies, Robotic village, Human bases, Society & Commerce, Outreach, Young Explorers. COSPAR has provided through Commissions, Panels and Working Groups (such as ILEWG, IMEWG) an international forum for supporting and promoting the robotic and human exploration of the Moon, Mars and NEOS. Proposed sponsors : ILEWG, ISECG, IKI, ESA, NASA, DLR, CNES, ASI, UKSA, JAXA, ISRO, SRON, CNSA, SSERVI, IAF, IAA, Lockheed Martin, Google Lunar X prize, UNOOSA
In vitro profile of the antidepressant candidate OPC-14523 at rat and human 5-HT1A receptors.
Jordan, Shaun; Chen, Ruoyan; Koprivica, Vuk; Hamilton, Ronald; Whitehead, Richard E; Tottori, Katsura; Kikuchi, Tetsuro
2005-07-11
This study determined the in vitro functional profile of 1-[3-[4-(3-chlorophenyl)-1-piperazinyl]propyl]-5-methoxy-3,4-dihydro-2-quinolinone monomethanesulfonate (OPC-14523) at rat and human serotonin (5-HT) 5-HT1A receptors and binding affinity of OPC-14523 at human frontocortical 5-HT1A receptors. OPC-14523 (1 microM) increased guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS) binding to 5-HT1A receptor-containing regions of rat brain tissue sections (approximately 53% of the effect of 1 microM (+)8-hydroxy-2-(di-n-propylamino)tetralin ((+)8-OH-DPAT) that were blocked by the selective 5-HT1A receptor antagonist N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexanecarboxamide (WAY-100635). OPC-14523 also behaved as a partial agonist in its stimulation of [35S]GTPgammaS binding to membranes from rat hippocampus (pEC50=7.60+/-0.23, Emax=41.1% of the effect of 10 microM (+)8-OH-DPAT), human frontal cortex (pEC50=7.89+/-0.08; Emax=64% of the effect of 10 microM (+)8-OH-DPAT), and Chinese Hamster Ovary cells expressing cloned human 5-HT1A receptors (pEC50=8.0+/-0.11; Emax=85.5% of the effect of 10 microM 5-HT), and all of these effects of OPC-14523 were blocked by WAY-100635. Taken together, these data support the development of OPC-14523 as an antidepressant whose mechanism of action involves potent partial agonist activity at 5-HT1A receptors.
Ratbi, Ilham; Jaouad, Imane Cherkaoui; Elorch, Hamza; Al-Sheqaih, Nada; Elalloussi, Mustapha; Lyahyai, Jaber; Berraho, Amina; Newman, William G; Sefiani, Abdelaziz
2016-10-01
Heimler syndrome (HS) is a rare recessive disorder characterized by sensorineural hearing loss (SNHL), amelogenesis imperfecta, nail abnormalities, and occasional or late-onset retinal pigmentation. It is the mildest form known to date of peroxisome biogenesis disorder caused by hypomorphic mutations of PEX1 and PEX6 genes. We report on a second Moroccan family with Heimler syndrome with early onset, severe visual impairment and important phenotypic overlap with Usher syndrome. The patient carried a novel homozygous missense variant c.3140T > C (p.Leu1047Pro) of PEX1 gene. As standard biochemical screening of blood for evidence of a peroxisomal disorder did not provide a diagnosis in the individuals with HS, patients with SNHL and retinal pigmentation should have mutation analysis of PEX1 and PEX6 genes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Lund, Vidar; Anderson-Glenna, Mary; Skjevrak, Ingun; Steffensen, Inger-Lise
2011-09-01
The objectives of this study were to investigate migration of volatile organic compounds (VOCs) from cross-linked polyethylene (PEX) pipes used for drinking water produced by different production methods, and to evaluate their potential risk for human health and/or influence on aesthetic drinking water quality. The migration tests were carried out in accordance with EN-1420-1, and VOCs were analysed by gas chromatography-mass spectrometry. The levels of VOC migrating from new PEX pipes were generally low, and decreasing with time of pipe use. No association was found between production method of PEX pipes and concentration of migration products. 2,4-di-tert-butyl phenol and methyl tert-butyl ether (MTBE) were two of the major individual components detected. In three new PEX pipes, MTBE was detected in concentrations above the recommended US EPA taste and odour value for drinking water, but decreased below this value after 5 months in service. However, the threshold odour number (TON) values for two pipes were similar to new pipes even after 1 year in use. For seven chemicals for which conclusions on potential health risk could be drawn, this was considered of no or very low concern. However, odour from some of these pipes could negatively affect drinking water for up to 1 year.
Identification of endogenous surrogate ligands for human P2Y receptors through an in silico search.
Hiramoto, Takeshi; Nonaka, Yosuke; Inoue, Kazuko; Yamamoto, Takefumi; Omatsu-Kanbe, Mariko; Matsuura, Hiroshi; Gohda, Keigo; Fujita, Norihisa
2004-05-01
G protein-coupled receptors (GPCRs) are distributed widely throughout the human body, and nearly 50% of current medicines act on a GPCR. GPCRs are considered to consist of seven transmembrane alpha-helices that form an alpha-helical bundle in which agonists and antagonists bind. A 3D structure of the target GPCR is indispensable for designing novel medicines acting on a GPCR. We have previously constructed the 3D structure of human P2Y(1) (hP2Y(1)) receptor, a GPCR, by homology modeling with the 3D structure of bovine rhodopsin as a template. In the present study, we have employed an in silico screening for compounds that could bind to the hP2Y(1)-receptor model using AutoDock 3.0. We selected 21 of the 30 top-ranked compounds, and by measuring intracellular Ca(2+) concentration, we identified 12 compounds that activated or blocked the hP2Y(1) receptor stably expressed in recombinant CHO cells. 5-Phosphoribosyl-1-pyrophosphate (PRPP) was found to activate the hP2Y(1) receptor with a low ED(50) value of 15 nM. The Ca(2+) assays showed it had no significant effect on P2Y(2), P2Y(6), or P2X(2) receptors, but acted as a weak agonist on the P2Y(12) receptor. This is the first study to rationally identify surrogate ligands for the P2Y-receptor family.
Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P
2007-05-01
The P2X(7) receptor exhibits complex pharmacological properties. In this study, binding of a [(3)H]-labelled P2X(7) receptor antagonist to human P2X(7) receptors has been examined to further understand ligand interactions with this receptor. The P2X(7) receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.1(3,7)]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X(7) receptors. Binding of [(3)H]-compound-17 was higher in membranes prepared from cells expressing P2X(7) receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X(7) receptors. Binding was reversible, saturable and modulated by P2X(7) receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. These data demonstrate that human P2X(7) receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X(7) receptor complex enhances subsequent binding to other P2X(7) subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X(7) receptor.
Michel, Anton D; Xing, Mengle; Thompson, Kyla M; Jones, Clare A; Humphrey, Patrick P A
2006-03-18
In this study we have studied decavanadate effects at P2X receptors. Decavanadate competitively blocked 2'- and 3'-O-(4benzoylbenzoyl) ATP (BzATP) stimulated ethidium accumulation in HEK293 cells expressing human recombinant P2X7 receptors (pK(B) 7.5). The effects of decavanadate were rapid (minutes) in both onset and offset and contrasted with the much slower kinetics of pyridoxal 5-phosphate (P5P), Coomassie brilliant blue (CBB) and 1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine (KN62). Decavanadate competitively blocked the slowly reversible, or irreversible, blockade of the P2X7 receptor produced by P5P and oxidised ATP suggesting competition for a common binding site. However, the interaction between decavanadate and KN62 was non-competitive. Decavanadate also blocked P2X2 and P2X4 receptors but with slightly lower potency. These data demonstrate that decavanadate is the first reversible and competitive antagonist of the P2X7 receptor and is a useful tool for studying the mechanism of interaction of ligands with the P2X7 receptor.
Mattiazzi Ušaj, M.; Brložnik, M.; Kaferle, P.; Žitnik, M.; Wolinski, H.; Leitner, F.; Kohlwein, S.D.; Zupan, B.; Petrovič, U.
2015-01-01
Pex11 is a peroxin that regulates the number of peroxisomes in eukaryotic cells. Recently, it was found that a mutation in one of the three mammalian paralogs, PEX11β, results in a neurological disorder. The molecular function of Pex11, however, is not known. Saccharomyces cerevisiae Pex11 has been shown to recruit to peroxisomes the mitochondrial fission machinery, thus enabling proliferation of peroxisomes. This process is essential for efficient fatty acid β-oxidation. In this study, we used high-content microscopy on a genome-wide scale to determine the subcellular localization pattern of yeast Pex11 in all non-essential gene deletion mutants, as well as in temperature-sensitive essential gene mutants. Pex11 localization and morphology of peroxisomes was profoundly affected by mutations in 104 different genes that were functionally classified. A group of genes encompassing MDM10, MDM12 and MDM34 that encode the mitochondrial and cytosolic components of the ERMES complex was analyzed in greater detail. Deletion of these genes caused a specifically altered Pex11 localization pattern, whereas deletion of MMM1, the gene encoding the fourth, endoplasmic-reticulum-associated component of the complex, did not result in an altered Pex11 localization or peroxisome morphology phenotype. Moreover, we found that Pex11 and Mdm34 physically interact and that Pex11 plays a role in establishing the contact sites between peroxisomes and mitochondria through the ERMES complex. Based on these results, we propose that the mitochondrial/cytosolic components of the ERMES complex establish a direct interaction between mitochondria and peroxisomes through Pex11. PMID:25769804
Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P
2007-01-01
Background and Purpose: The P2X7 receptor exhibits complex pharmacological properties. In this study, binding of a [3H]-labelled P2X7 receptor antagonist to human P2X7 receptors has been examined to further understand ligand interactions with this receptor. Experimental Approach: The P2X7 receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.13,7]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X7 receptors. Key Results: Binding of [3H]-compound-17 was higher in membranes prepared from cells expressing P2X7 receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X7 receptors. Binding was reversible, saturable and modulated by P2X7 receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. Conclusions: These data demonstrate that human P2X7 receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X7 receptor complex enhances subsequent binding to other P2X7 subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X7 receptor. PMID:17339830
Long, Fei; Liu, Ying; Liu, Zhenzhen; Li, Song; Yang, Xuejun; Sun, Deguang; Wang, Haibo; Liu, Qinlong; Liang, Rui; Li, Yan; Gao, Zhenming; Shao, Shujuan; Miao, Qing Robert; Wang, Liming
2016-01-01
Nogo-B receptor (NgBR), a type I single transmembrane domain receptor is the specific receptor for Nogo-B. Our previous work demonstrated that NgBR is highly expressed in breast cancer cells, where it promotes epithelial mesenchymal transition (EMT), an important step in metastasis. Here, we show that both in vitro and in vivo increased expression of NgBR contributes to the increased chemoresistance of Bel7402/5FU cells, a stable 5-FU (5-Fluorouracil) resistant cell line related Bel7402 cells. NgBR knockdown abrogates S-phase arrest in Bel7402/5FU cells, which correlates with a reduction in G1/S phase checkpoint proteins p53 and p21. In addition, NgBR suppresses p53 protein levels through activation of the PI3K/Akt/MDM2 pathway, which promotes p53 degradation via the ubiquitin proteasome pathway and thus increases the resistance of human hepatocellular cancer cells to 5-FU. Furthermore, we found that NgBR expression is associated with a poor prognosis of human hepatocellular carcinoma (HCC) patients. These results suggest that targeting NgBR in combination with chemotherapeutic drugs, such as 5-FU, could improve the efficacy of current anticancer treatments. PMID:26840457
Kelley, Keven M; Stenson, Alexandra C; Dey, Rajarashi; Whelton, Andrew J
2014-12-15
Green buildings are increasingly being plumbed with crosslinked polyethylene (PEX) potable water pipe. Tap water quality was investigated at a six month old plumbing system and chemical and odor quality impacts of six PEX pipe brands were examined. Eleven PEX related contaminants were found in the plumbing system; one regulated (toluene) and several unregulated: Antioxidant degradation products, resin solvents, initiator degradation products, or manufacturing aides. Water chemical and odor quality was monitored for new PEX-a, -b and -c pipes with (2 mg/L free chlorine) and without disinfectant over 30 days. Odor and total organic carbon (TOC) levels decreased for all pipes, but odor remained greater than the USA's Environmental Protection Agency's (USEPA) secondary maximum contaminant level. Odors were not attributed to known odorants ethyl-tert-butyl ether (ETBE) or methyl-tert-butyl ether (MTBE). Free chlorine caused odor levels for PEX-a1 pipe to increase from 26 to 75 threshold odor number (TON) on day 3 and affected the rate at which TOC changed for each brand over 30 days. As TOC decreased, the ultraviolet absorbance at 254 nm increased. Pipes consumed as much as 0.5 mg/L as Cl2 during each 3 day stagnation period. Sixteen organic chemicals were identified, including toluene, pyridine, methylene trichloroacetate and 2,4-di-tert-butylphenol. Some were also detected during the plumbing system field investigation. Six brands of PEX pipes sold in the USA and a PEX-a green building plumbing system impacted chemical and drinking water odor quality. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pharmacological profiles of cloned mammalian P2Y-receptor subtypes.
von Kügelgen, Ivar
2006-06-01
Membrane-bound P2-receptors mediate the actions of extracellular nucleotides in cell-to-cell signalling. P2X-receptors are ligand-gated ion channels, whereas P2Y-receptors belong to the superfamily of G-protein-coupled receptors (GPCRs). So far, the P2Y family is composed out of 8 human subtypes that have been cloned and functionally defined; species orthologues have been found in many vertebrates. P2Y1-, P2Y2-, P2Y4-, P2Y6-, and P2Y11-receptors all couple to stimulation of phospholipase C. The P2Y11-receptor mediates in addition a stimulation of adenylate cyclase. In contrast, activation of the P2Y12-, P2Y13-, and P2Y14-receptors causes an inhibition of adenylate cyclase activity. The expression of P2Y1-receptors is widespread. The receptor is involved in blood platelet aggregation, vasodilatation and neuromodulation. It is activated by ADP and ADP analogues including 2-methylthio-ADP (2-MeSADP). 2'-Deoxy-N6-methyladenosine-3',5'-bisphosphate (MRS2179) and 2-chloro-N6-methyl-(N)-methanocarba-2'-deoxyadenosine 3',5'-bisphosphate (MRS2279) are potent and selective antagonists. P2Y2 transcripts are abundantly distributed. One important example for its functional role is the control of chloride ion fluxes in airway epithelia. The P2Y2-receptor is activated by UTP and ATP and blocked by suramin. The P2Y2-agonist diquafosol is used for the treatment of the dry eye disease. P2Y4-receptors are expressed in the placenta and in epithelia. The human P2Y4-receptor has a strong preference for UTP as agonist, whereas the rat P2Y4-receptor is activated about equally by UTP and ATP. The P2Y4-receptor is not blocked by suramin. The P2Y6-receptor has a widespread distribution including heart, blood vessels, and brain. The receptor prefers UDP as agonist and is selectively blocked by 1,2-di-(4-isothiocyanatophenyl)ethane (MRS2567). The P2Y11-receptor may play a role in the differentiation of immunocytes. The human P2Y11-receptor is activated by ATP as naturally occurring agonist and
NASA Astrophysics Data System (ADS)
Siewnicka, Alicja; Fajdek, Bartlomiej; Janiszowski, Krzysztof
2010-01-01
This paper presents a model of the human circulatory system with the possible addition of a parallel assist device, which was developed for the purpose of artificial heart monitoring. Information about an identification experiment of an extracorporeal ventricle assist device POLVAD is included. The modelling methods applied and the corresponding functional blocks in a PExSim package are presented. The results of the simulation for physiological conditions, left ventricle failure and pathological conditions with parallel assistance are included.
Vandament, Lyndsey; Chintu, Naminga; Yano, Nanako; Mugurungi, Owen; Tambatamba, Bushimbwa; Ncube, Gertrude; Xaba, Sinokuthemba; Mpasela, Felton; Muguza, Edward; Mangono, Tichakunda; Madidi, Ngonidzashe; Samona, Alick; Tagar, Elva; Hatzold, Karin
2016-06-01
Results from recent costing studies have put into question potential Voluntary Medical Male Circumcision (VMMC) cost savings with the introduction of the PrePex device. We evaluated the cost drivers and the overall unit cost of VMMC for a variety of service delivery models providing either surgical VMMC or both PrePex and surgery using current program data in Zimbabwe and Zambia. In Zimbabwe, 3 hypothetical PrePex only models were also included. For all models, clients aged 18 years and older were assumed to be medically eligible for PrePex and uptake was based on current program data from sites providing both methods. Direct costs included costs for consumables, including surgical VMMC kits for the forceps-guided method, device (US $12), human resources, demand creation, supply chain, waste management, training, and transport. Results for both countries suggest limited potential for PrePex to generate cost savings when adding the device to current surgical service delivery models. However, results for the hypothetical rural Integrated PrePex model in Zimbabwe suggest the potential for material unit cost savings (US $35 per VMMC vs. US $65-69 for existing surgical models). This analysis illustrates that models designed to leverage PrePex's advantages, namely the potential for integrating services in rural clinics and less stringent infrastructure requirements, may present opportunities for improved cost efficiency and service integration. Countries seeking to scale up VMMC in rural settings might consider integrating PrePex only MC services at the primary health care level to reduce costs while also increasing VMMC access and coverage.
DIRECT MODULATION OF P2X1 RECEPTOR-CHANNELS BY THE LIPID PHOSPHATIDYLINOSITOL 4,5-BISPHOSPHATE
Bernier, Louis-Philippe; Ase, Ariel R.; Tong, Xinkang; Hamel, Edith; Blais, Dominique; Zhao, Qi; Logothetis, Diomedes E.; Séguéla, Philippe
2012-01-01
The P2X1 receptor-channels activated by extracellular ATP contribute to the neurogenic component of smooth muscle contraction in vascular beds and genito-urinary tracts of rodents and humans. In the present study, we investigated the interactions of plasma membrane phosphoinositides with P2X1 ATP receptors and their physiological consequences. In an isolated rat mesenteric artery preparation, we observed a strong inhibition of P2X1-mediated constrictive responses by depletion of PI(4,5)P2 with the PI4-kinase inhibitor wortmannin. Using the Xenopus oocyte expression system, we provided electrophysiological evidence that lowering PI(4,5)P2 levels with wortmannin significantly decreases P2X1 currents amplitude and recovery. Previously reported modulation of recovery of desensitized P2X1 currents by phospholipase C-coupled 5-HT2A metabotropic receptors was also found wortmannin-sensitive. Treatment with wortmannin alters the kinetics of P2X1 activation and inactivation without changing its sensitivity to ATP. The functional impact of wortmannin on P2X1 currents could be reversed by addition of intracellular PI(4,5)P2, but not PI(3,4,5)P3. and direct application of PI(4,5)P2 to excised inside-out macropatches rescued P2X1 currents from rundown. We showed that the proximal region of the intracellular C-terminus of P2X1 subunit directly binds to PI(4,5)P2 and other anionic phospholipids, and we identified the basic residue K364 as a critical determinant for phospholipid binding and sensitivity to wortmannin. Overall, these results indicate that PI(4,5)P2 plays a key role in the expression of full native and heterologous P2X1 function by regulating the amplitude, recovery and kinetics of ionotropic ATP responses through direct receptor-lipid interactions. PMID:18523136
Schutte, Carl; Tshimanga, M; Mugurungi, Owen; Come, Iotamo; Necochea, Edgar; Mahomed, Mehebub; Xaba, Sinokuthemba; Bossemeyer, Debora; Ferreira, Thais; Macaringue, Lucinda; Chatikobo, Pessanai; Gundididza, Patricia; Hatzold, Karin
2016-06-01
The PrePex device has proven to be safe for voluntary medical male circumcision (VMMC) in adults in several African countries. Costing studies were conducted as part of a PrePex/Surgery comparison study in Zimbabwe and a pilot implementation study in Mozambique. The studies calculated per male circumcision unit costs using a cost-analysis approach. Both direct costs (consumable and nonconsumable supplies, device, personnel, associated staff training) and selected indirect costs (capital and support personnel costs) were calculated. The cost comparison in Zimbabwe showed a unit cost per VMMC of $45.50 for PrePex and $53.08 for surgery. The unit cost difference was based on higher personnel and consumable supplies costs for the surgical procedure, which used disposable instrument kits. In Mozambique, the costing analysis estimated a higher unit cost for PrePex circumcision ($40.66) than for surgery ($20.85) because of higher consumable costs, particularly the PrePex device and lower consumable supplies costs for the surgical procedure using reusable instruments. Supplies and direct staff costs contributed 87.2% for PrePex and 65.8% for surgical unit costs in Mozambique. PrePex device male circumcision could potentially be cheaper than surgery in Zimbabwe, especially in settings that lack the infrastructure and personnel required for surgical VMMC, and this might result in programmatic cost savings. In Mozambique, the surgical procedure seems to be less costly compared with PrePex mainly because of higher consumable supplies costs. With reduced device unit costs, PrePex VMMC could become more cost-efficient and considered as complementary for Mozambique's VMMC scale-up program.
Characterization of protoberberine analogs employed as novel human P2X{sub 7} receptor antagonists
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Ga Eun; Lee, Won-Gil; Lee, Song-Yi
The P2X{sub 7} receptor (P2X{sub 7}R), a member of the ATP-gated ion channel family, is regarded as a promising target for therapy of immune-related diseases including rheumatoid arthritis and chronic pain. A group of novel protoberberine analogs (compounds 3-5), discovered by screening of chemical libraries, was here investigated with respect to their function as P2X{sub 7}R antagonists. Compounds 3-5 non-competitively inhibited BzATP-induced ethidium ion influx into hP2X{sub 7}-expressing HEK293 cells, with IC{sub 50} values of 100-300 nM. This antagonistic action on the channel further confirmed that both BzATP-induced inward currents and Ca{sup 2+} influx were strongly inhibited by compounds 3-5more » in patch-clamp and Ca{sup 2+} influx assays. The antagonists also effectively suppressed downstream signaling of P2X{sub 7} receptors including IL-1{beta} release and phosphorylation of ERK1/2 and p38 proteins in hP2X{sub 7}-expressing HEK293 cells or in differentiated human monocytes (THP-1 cells). Moreover, IL-2 secretion from CD3/CD28-stimulated Jurkat T cell was also dramatically inhibited by the antagonist. These results imply that novel protoberberine analogs may modulate P2X{sub 7} receptor-mediated immune responses by allosteric inhibition of the receptor. - Graphical abstract: Display Omitted« less
Hao, Yuan; Chow, Alison W; Yip, Wallace C; Li, Chi H; Wan, Tai F; Tong, Benjamin C; Cheung, King H; Chan, Wood Y; Chen, Yangchao; Cheng, Christopher H; Ko, Wing H
2016-08-01
P2Y receptor activation causes the release of inflammatory cytokines in the bronchial epithelium, whereas G protein-coupled estrogen receptor (GPER), a novel estrogen (E2) receptor, may play an anti-inflammatory role in this process. We investigated the cellular mechanisms underlying the inhibitory effect of GPER activation on the P2Y receptor-mediated Ca(2+) signaling pathway and cytokine production in airway epithelia. Expression of GPER in primary human bronchial epithelial (HBE) or 16HBE14o- cells was confirmed on both the mRNA and protein levels. Stimulation of HBE or 16HBE14o- cells with E2 or G1, a specific agonist of GPER, attenuated the nucleotide-evoked increases in [Ca(2+)]i, whereas this effect was reversed by G15, a GPER-specific antagonist. G1 inhibited the secretion of two proinflammatory cytokines, interleukin (IL)-6 and IL-8, in cells stimulated by adenosine 5'-(γ-thio)triphosphate (ATPγS). G1 stimulated a real-time increase in cAMP levels in 16HBE14o- cells, which could be inhibited by adenylyl cyclase inhibitors. The inhibitory effects of E2 or G1 on P2Y receptor-induced increases in Ca(2+) were reversed by treating the cells with a protein kinase A (PKA) inhibitor. These results demonstrated that the inhibitory effects of G1 or E2 on P2Y receptor-mediated Ca(2+) mobilization and cytokine secretion were due to GPER-mediated activation of a cAMP-dependent PKA pathway. This study has reported, for the first time, the expression and function of GPER as an anti-inflammatory component in human bronchial epithelia, which may mediate through its opposing effects on the pro-inflammatory pathway activated by the P2Y receptors in inflamed airway epithelia.
A comparative study of functional 5-HT4 receptors in human colon, rat oesophagus and rat ileum.
McLean, P G; Coupar, I M; Molenaar, P
1995-05-01
oesophagus. SC 53116 showed no agonist activity in the rat ileum and human colon, but at 1 microM it did antagonize the effect of 5-HT in the human colon with a dose-ratio of 11.3 +/- 0.3. 5. GR 113808 competitively antagonized the 5-HT4 receptor-mediated relaxation of the rat oesophagus with a pA2 value of 8.59 (8.18-9.00) against 5-HT and 9.05 (8.79-9.31) against SC 53116. GR 113808(0.01 microM) also antagonized the 5-HT-induced relaxation of human colonic circular muscle with an apparent pA2 value of 9.02 +/- 0.12. However at 1 microM the apparent pA2 value was significantly lower than that measured at 0.01 and 0.1 microM. GR 113808 (0.01 microM) antagonized the 5-HT4 receptor-mediated relaxation of the rat ileum with an apparent pA2 value of 9.30 +/- 0.21.6. In conclusion, these studies have shown that the human colon, rat oesophagus and rat ileum contain functional 5-HT4 receptors. However, the 5-HT4 receptor agonists displayed differences in these tissues making it necessary to be cautious when extrapolating from animal to human tissue. This emphasizes the importance of the use of human tissue in the development of therapeutic drugs.
Huang, Tai-Yu; Zheng, Donghai; Houmard, Joseph A; Brault, Jeffrey J; Hickner, Robert C; Cortright, Ronald N
2017-04-01
Peroxisomes are indispensable organelles for lipid metabolism in humans, and their biogenesis has been assumed to be under regulation by peroxisome proliferator-activated receptors (PPARs). However, recent studies in hepatocytes suggest that the mitochondrial proliferator PGC-1α (peroxisome proliferator-activated receptor gamma coactivator-1α) also acts as an upstream transcriptional regulator for enhancing peroxisomal abundance and associated activity. It is unknown whether the regulatory mechanism(s) for enhancing peroxisomal function is through the same node as mitochondrial biogenesis in human skeletal muscle (HSkM) and whether fatty acid oxidation (FAO) is affected. Primary myotubes from vastus lateralis biopsies from lean donors (BMI = 24.0 ± 0.6 kg/m 2 ; n = 6) were exposed to adenovirus encoding human PGC-1α or GFP control. Peroxisomal biogenesis proteins (peroxins) and genes ( PEXs ) responsible for proliferation and functions were assessed by Western blotting and real-time qRT-PCR, respectively. [1- 14 C]palmitic acid and [1- 14 C]lignoceric acid (exclusive peroxisomal-specific substrate) were used to assess mitochondrial oxidation of peroxisomal-derived metabolites. After overexpression of PGC-1α, 1 ) peroxisomal membrane protein 70 kDa (PMP70), PEX19, and mitochondrial citrate synthetase protein content were significantly elevated ( P < 0.05), 2 ) PGC-1α , PMP70 , key PEXs , and peroxisomal β-oxidation mRNA expression levels were significantly upregulated ( P < 0.05), and 3 ) a concomitant increase in lignoceric acid oxidation by both peroxisomal and mitochondrial activity was observed ( P < 0.05). These novel findings demonstrate that, in addition to the proliferative effect on mitochondria, PGC-1α can induce peroxisomal activity and accompanying elevations in long-chain and very-long-chain fatty acid oxidation by a peroxisomal-mitochondrial functional cooperation, as observed in HSkM cells. Copyright © 2017 the American Physiological Society.
Inkinen, J; Jayaprakash, B; Ahonen, M; Pitkänen, T; Mäkinen, R; Pursiainen, A; Santo Domingo, J W; Salonen, H; Elk, M; Keinänen-Toivola, M M
2018-02-01
To study the stability of biofilms and water quality in pilot scale drinking water copper and PEX pipes in changing conditions (extra disinfection, magnetic water treatment, MWT). Next-generation sequencing (NGS) of 16S ribosomal RNA genes (rDNA) to describe total bacterial community and ribosomal RNA (rRNA) to describe active bacterial members in addition to traditional microbiological methods were applied. Biofilms from control copper and PEX pipes shared same most abundant bacteria (Methylobacterium spp., Sphingomonas spp., Zymomonas spp.) and average species diversities (Shannon 3·8-4·2) in rDNA and rRNA libraries, whereas few of the taxa differed by their abundance such as lower total Mycobacterium spp. occurrence in copper (<0·02%) to PEX (<0·2%) pipes. Extra disinfection (total chlorine increase from c. 0·5 to 1 mg l -1 ) affected total and active population in biofilms seen as decrease in many bacterial species and diversity (Shannon 2·7, P < 0·01, rRNA) and increase in Sphingomonas spp. as compared to control samples. Furthermore, extra-disinfected copper and PEX samples formed separate clusters in unweighted non-metric multidimensional scaling plot (rRNA) similarly to MWT-treated biofilms of copper (but not PEX) pipes that instead showed higher species diversity (Shannon 4·8, P < 0·05 interaction). Minor chlorine dose addition increased selection pressure and many species were sensitive to chlorination. Pipe material seemed to affect mycobacteria occurrence, and bacterial communities with MWT in copper but not in PEX pipes. This study using rRNA showed that chlorination affects especially active fraction of bacterial communities. Copper and PEX differed by the occurrence of some bacterial members despite similar community profiles. © 2017 The Society for Applied Microbiology.
Lalo, Ulyana; Roberts, Jonathan A.; Evans, Richard J.
2011-01-01
P2X1 receptors are ATP-gated ion channels expressed by smooth muscle and blood cells. Carboxyl-terminally His-FLAG-tagged human P2X1 receptors were stably expressed in HEK293 cells and co-purified with cytoskeletal proteins including actin. Disruption of the actin cytoskeleton with cytochalasin D inhibited P2X1 receptor currents with no effect on the time course of the response or surface expression of the receptor. Stabilization of the cytoskeleton with jasplakinolide had no effect on P2X1 receptor currents but decreased receptor mobility. P2X2 receptor currents were unaffected by cytochalasin, and P2X1/2 receptor chimeras were used to identify the molecular basis of actin sensitivity. These studies showed that the intracellular amino terminus accounts for the inhibitory effects of cytoskeletal disruption similar to that shown for lipid raft/cholesterol sensitivity. Stabilization of the cytoskeleton with jasplakinolide abolished the inhibitory effects of cholesterol depletion on P2X1 receptor currents, suggesting that lipid rafts may regulate the receptor through stabilization of the cytoskeleton. These studies show that the cytoskeleton plays an important role in P2X1 receptor regulation. PMID:21757694
Cellek, S; John, A K; Thangiah, R; Dass, N B; Bassil, A K; Jarvie, E M; Lalude, O; Vivekanandan, S; Sanger, G J
2006-09-01
Previous studies have demonstrated mixed inhibitory and facilitatory effects of 5-hydroxytryptamine-4 (5-HT(4)) receptor agonists on electrical field stimulation (EFS)-induced responses in human isolated colon. Here we report three types of responses to EFS in human isolated colon circular muscle: monophasic cholinergic contraction during EFS, biphasic response (nitrergic relaxation during EFS followed by cholinergic contraction after termination of EFS) and triphasic response (cholinergic contraction followed by nitrergic relaxation during EFS and a tachykininergic contraction after EFS). The effects of two 5-HT(4) receptor agonists, prucalopride and tegaserod were then investigated on monophasic responses only. Each compound inhibited contractions during EFS in a concentration-dependent manner. In the presence of N(omega)-nitro-l-arginine methyl ester (l-NAME) however, prucalopride and tegaserod enhanced the contractions in a concentration-dependent manner. In strips where the tone was elevated with substance-P and treated with scopolamine, EFS-induced relaxations were enhanced by the two agonists. The above observed effects by the two agonists were abolished by 5-HT(4) receptor antagonist SB-204070. The two agonists did not alter the tone raised by substance-P in the presence of scopolamine and l-NAME and did not affect carbachol-induced contractions in the presence of tetrodotoxin. These results suggest that in the circular muscle of human colon, 5-HT(4) receptor agonists simultaneously facilitate the activity of neurones which release the inhibitory and excitatory neurotransmitters, nitric oxide and acetylcholine respectively.
Kim, Y W; Kim, Y K; Kim, D-K; Sheen, Y Y
2008-05-01
1. The in vitro metabolism of 3-((5-(6-methylpyridin-2-yl)-4-(quinoxalin-6-yl)-1H-imidazol-2-yl)methyl)benzamide (IN-1,130), a selective activin receptor-like kinase-5 (ALK5) inhibitor and a candidate drug for fibrotic disease, was studied. 2. The cytochrome P450s (CYPs) responsible for metabolism of IN-1,130 in liver microsomes of rat, mouse, dog, monkey and human, and in human CYP supersomestrade mark, were identified using specific CYP inhibitors. The order of disappearance of IN-1,130 in various liver microsomal systems studied was as follows: monkey, mouse, rat, human, and dog. 3. Five distinct metabolites (M1-M5) were identified in all the above microsomes and their production was substantially inhibited by CYP inhibitors such as SKF-525A and ketoconazole. Among nine human CYP supersomestrade mark examined, CYP3A4, CYP2C8, CYP2D6 1, and CYP2C19 were involved in the metabolism of IN-1,130, and the production of metabolites were significantly inhibited by specific CYP inhibitors. IN-1,130 disappeared fastest in CYP2C8 supersomes. CYP3A4 produced four metabolites of IN-1,130 (M1-M4), whereas supersomes expressing human FMO cDNAs, such as FMO1, FMO3, and FMO5, produced no metabolites. 4. Hence, it is concluded that metabolism of IN-1,130 is mediated by CYP3A4, CYP2C8, CYP2D6 1, and CYP2C19.
X-ray structures define human P2X(3) receptor gating cycle and antagonist action.
Mansoor, Steven E; Lü, Wei; Oosterheert, Wout; Shekhar, Mrinal; Tajkhorshid, Emad; Gouaux, Eric
2016-10-06
P2X receptors are trimeric, non-selective cation channels activated by ATP that have important roles in the cardiovascular, neuronal and immune systems. Despite their central function in human physiology and although they are potential targets of therapeutic agents, there are no structures of human P2X receptors. The mechanisms of receptor desensitization and ion permeation, principles of antagonism, and complete structures of the pore-forming transmembrane domains of these receptors remain unclear. Here we report X-ray crystal structures of the human P2X 3 receptor in apo/resting, agonist-bound/open-pore, agonist-bound/closed-pore/desensitized and antagonist-bound/closed states. The open state structure harbours an intracellular motif we term the 'cytoplasmic cap', which stabilizes the open state of the ion channel pore and creates lateral, phospholipid-lined cytoplasmic fenestrations for water and ion egress. The competitive antagonists TNP-ATP and A-317491 stabilize the apo/resting state and reveal the interactions responsible for competitive inhibition. These structures illuminate the conformational rearrangements that underlie P2X receptor gating and provide a foundation for the development of new pharmacological agents.
X-ray structures define human P2X3 receptor gating cycle and antagonist action
Mansoor, Steven E.; Lü, Wei; Oosterheert, Wout; Shekhar, Mrinal; Tajkhorshid, Emad; Gouaux, Eric
2016-01-01
Summary P2X receptors are trimeric, non-selective cation channels activated by ATP that play important roles in cardiovascular, neuronal and immune systems. Despite their central function in human physiology and as potential targets of therapeutic agents, there are no structures of human P2X receptors. Mechanisms of receptor desensitization and ion permeation, principles of antagonism, and complete structure of the pore-forming transmembrane domains remain unclear. We report x-ray crystal structures of human P2X3 receptor in apo/resting, agonist-bound/open-pore, agonist-bound/desensitized and antagonist-bound closed states. The open state structure harbors an intracellular motif we term the “cytoplasmic cap”, that stabilizes the open state of the ion channel pore and creates lateral, phospholipid-lined cytoplasmic fenestrations for water and ion egress. Competitive antagonists TNP-ATP and A-317491 stabilize the apo/resting state and reveal the interactions responsible for competitive inhibition. These structures illuminate the conformational rearrangements underpinning P2X receptor gating and provide a foundation for development of new pharmacologic agents. PMID:27626375
Liñán-Rico, A; Wunderlich, J E; Enneking, J T; Tso, D R; Grants, I; Williams, K C; Otey, A; Michel, K; Schemann, M; Needleman, B; Harzman, A; Christofi, F L
2015-08-01
The role of purinergic signaling in human ENS is not well understood. We sought to further characterize the neuropharmacology of purinergic receptors in human ENS and test the hypothesis that endogenous purines are critical regulators of neurotransmission. LSCM-Fluo-4/(Ca(2+))-imaging of postsynaptic Ca(2+) transients (PSCaTs) was used as a reporter of synaptic transmission evoked by fiber tract electrical stimulation in human SMP surgical preparations. Pharmacological analysis of purinergic signaling was done in 1,556 neurons (identified by HuC/D-immunoreactivity) in 235 ganglia from 107 patients; P2XR-immunoreactivity was evaluated in 19 patients. Real-time MSORT (Di-8-ANEPPS) imaging tested effects of adenosine on fast excitatory synaptic potentials (fEPSPs). Synaptic transmission is sensitive to pharmacological manipulations that alter accumulation of extracellular purines: Apyrase blocks PSCaTs in a majority of neurons. An ecto-NTPDase-inhibitor 6-N,N-diethyl-D-β,γ-dibromomethyleneATP or adenosine deaminase augments PSCaTs. Blockade of reuptake/deamination of eADO inhibits PSCaTs. Adenosine inhibits fEPSPs and PSCaTs (IC50 = 25 µM), sensitive to MRS1220-antagonism (A3AR). A P2Y agonist ADPβS inhibits PSCaTs (IC50 = 111 nM) in neurons without stimulatory ADPbS responses (EC50 = 960 nM). ATP or a P2X1,2,2/3 (α,β-MeATP) agonist evokes fast, slow, biphasic Ca(2+) transients or Ca(2+) oscillations (ATP,EC50 = 400 mM). PSCaTs are sensitive to P2X1 antagonist NF279. Low (20 nM) or high (5 µM) concentrations of P2X antagonist TNP-ATP block PSCaTs in different neurons; proportions of neurons with P2XR-immunoreactivity follow the order P2X2 > P2X1 > P2X3; P2X1 + P2X2 and P2X3 + P2X2 are co-localized. RT-PCR identified mRNA-transcripts for P2X1-7, P2Y1,2,12-14R. Purines are critical regulators of neurotransmission in human ENS. Purinergic signaling involves P2X1, P2X2, P2X3 channels, P2X1 + P2X2 co-localization and inhibitory P2Y or A3 receptors. These are
Cobos, Enrique J; del Pozo, Esperanza; Baeyens, José M
2007-08-01
We evaluated the effect of haloperidol (HP) and its metabolites on [(3)H](+)-pentazocine binding to sigma(1) receptors in SH-SY5Y human neuroblastoma cells and guinea pig brain P(1), P(2) and P(3) subcellular fractions. Three days after a single i.p. injection in guinea pigs of HP (but not of other sigma(1) antagonists or (-)-sulpiride), [(3)H](+)-pentazocine binding to brain membranes was markedly decreased. Recovery of sigma(1) receptor density to steady state after HP-induced inactivation required more than 30 days. HP-metabolite II (reduced HP, 4-(4-chlorophenyl)-alpha-(4-fluorophenyl)-4-hydroxy-1-piperidinebutanol), but not HP-metabolite I (4-(4-chlorophenyl)-4-hydroxypiperidine), irreversibly blocked sigma(1) receptors in guinea pig brain homogenate and P(2) fraction in vitro. We found similar results in SH-SY5Y cells, which suggests that this process may also take place in humans. HP irreversibly inactivated sigma(1) receptors when it was incubated with brain homogenate and SH-SY5Y cells, but not when incubated with P(2) fraction membranes, which suggests that HP is metabolized to inactivate sigma(1) receptors. Menadione, an inhibitor of the ketone reductase activity that leads to the production of HP-metabolite II, completely prevented HP-induced inactivation of sigma(1) receptors in brain homogenates. These results suggest that HP may irreversibly inactivate sigma(1) receptors in guinea pig and human cells, probably after metabolism to reduced HP.
Scott, F L; Clemons, B; Brooks, J; Brahmachary, E; Powell, R; Dedman, H; Desale, H G; Timony, G A; Martinborough, E; Rosen, H; Roberts, E; Boehm, M F; Peach, R J
2016-06-01
Sphingosine1-phosphate (S1P) receptors mediate multiple events including lymphocyte trafficking, cardiac function, and endothelial barrier integrity. Stimulation of S1P1 receptors sequesters lymphocyte subsets in peripheral lymphoid organs, preventing their trafficking to inflamed tissue sites, modulating immunity. Targeting S1P receptors for treating autoimmune disease has been established in clinical studies with the non-selective S1P modulator, FTY720 (fingolimod, Gilenya™). The purpose of this study was to assess RPC1063 for its therapeutic utility in autoimmune diseases. The specificity and potency of RPC1063 (ozanimod) was evaluated for all five S1P receptors, and its effect on cell surface S1P1 receptor expression, was characterized in vitro. The oral pharmacokinetic (PK) parameters and pharmacodynamic effects were established in rodents, and its activity in three models of autoimmune disease (experimental autoimmune encephalitis, 2,4,6-trinitrobenzenesulfonic acid colitis and CD4(+) CD45RB(hi) T cell adoptive transfer colitis) was assessed. RPC1063 was specific for S1P1 and S1P5 receptors, induced S1P1 receptor internalization and induced a reversible reduction in circulating B and CCR7(+) T lymphocytes in vivo. RPC1063 showed high oral bioavailability and volume of distribution, and a circulatory half-life that supports once daily dosing. Oral RPC1063 reduced inflammation and disease parameters in all three autoimmune disease models. S1P receptor selectivity, favourable PK properties and efficacy in three distinct disease models supports the clinical development of RPC1063 for the treatment of relapsing multiple sclerosis and inflammatory bowel disease, differentiates RPC1063 from other S1P receptor agonists, and could result in improved safety outcomes in the clinic. © 2016 The British Pharmacological Society.
Substance P Receptor Antagonist Suppresses Inflammatory Cytokine Expression in Human Disc Cells.
Kepler, Christopher K; Markova, Dessislava Z; Koerner, John D; Mendelis, Joseph; Chen, Chiu-Ming; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg
2015-08-15
Laboratory study. To evaluate whether blockade of the Substance P (SP) NK1R attenuates its proinflammatory effect on human intervertebral disc cells (IVD), and to evaluate the signaling pathways associated with SP. SP and its receptors are expressed in human IVD cells, and cause upregulation of inflammatory mediators; however, the effects of blocking these receptors have not been studied in human IVD cells. Human annulus fibrosus (AF) and nucleus pulposus (NP) cells were expanded in monolayer, and then suspended in alginate beads. The alginate beads were treated with culture medium first containing a high affinity NK1R antagonist (L-760735) at different concentrations, and then with medium containing both NK1R antagonist and SP at 2 concentrations. Ribonucleic acid was isolated and transcribed into cDNA. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to evaluate expression of interleukin (IL)-1β, IL-6, and IL-8. Western blot analysis was performed to examine levels of the phosphorylated p38 mitogen-activated protein kinase (MAPK), extracellular signal regulated kinase 1/2 (ERK1/2) and nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB p65). The cells were pretreated with specific inhibitors of p38 (SB203580), ERK1/2 (PD98059), and p65 (SM7368) and then stimulated with SP. We detected expression of NK1R, neurokinin receptor 2 (NK2R), and neurokinin receptor 3 (NK3R) in AF and NP cells. Treatment of disc cells with the NK1R antagonist was able to suppress expression of IL-1β, IL-6, and IL-8 in a dose-dependent manner. SP stimulation increased phosphorylation of p38-MAPK and ERK1/2, but not of NFκB p65. This indicates that p38-MAPK and ERK1/2 control SP-induced cytokine expression independently from NF-kB p65. Inhibition of p38 and ERK1/2 activation reduced SP-induced IL-6 production in human disc cells. NK1R is responsible for the proinflammatory effect of SP on IVD cells and this effect can be blocked by
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
Paskulin, D D; Cunha-Filho, J S L; Souza, C A B; Bortolini, M C; Hainaut, P; Ashton-Prolla, P
2012-01-01
p53 has a crucial role in human fertility by regulating the expression of leukemia inhibitory factor (LIF), a secreted cytokine critical for blastocyst implantation. To examine whether TP53 polymorphisms may be involved with in vitro fertilization (IVF) failure and endometriosis (END), we have assessed the associations between TP53 polymorphism in intron 2 (PIN2; G/C, intron 2), PIN3 (one (N, non-duplicated) or two (D, duplicated) repeats of a 16-bp motif, intron 3) and polymorphism in exon 4 (PEX4; C/G, p.P72R, exon 4) in 98 women with END and 115 women with post-IVF failure. In addition, 134 fertile women and 300 women unselected with respect to fertility-related features were assessed. TP53 polymorphisms and haplotypes were identified by amplification refractory mutation system polymerase chain reaction. TP53 PIN3 and PEX4 were associated with both END (P=0.042 and P=0.007, respectively) and IVF (P=0.004 and P=0.009, respectively) when compared with women both selected and unselected for fertility-related features. Haplotypes D-C and N-C were related to higher risk for END (P=0.002, P=0.001, respectively) and failure of IVF (P=0.018 and P=0.002, respectively) when compared with the Fertile group. These results support that specific TP53 haplotypes are associated with an increased risk of END-associated infertility and with post-IVF failure. PMID:23013791
ARF6-dependent regulation of P2Y receptor traffic and function in human platelets.
Kanamarlapudi, Venkateswarlu; Owens, Sian E; Saha, Keya; Pope, Robert J; Mundell, Stuart J
2012-01-01
Adenosine diphosphate (ADP) is a critical regulator of platelet activation, mediating its actions through two G protein-coupled receptors, the P2Y(1) and P2Y(12) purinoceptors. Recently, we demonstrated that P2Y(1) and P2Y(12) purinoceptor activities are rapidly and reversibly modulated in human platelets, revealing that the underlying mechanism requires receptor internalization and subsequent trafficking as an essential part of this process. In this study we investigated the role of the small GTP-binding protein ADP ribosylation factor 6 (ARF6) in the internalization and function of P2Y(1) and P2Y(12) purinoceptors in human platelets. ARF6 has been implicated in the internalization of a number of GPCRs, although its precise molecular mechanism in this process remains unclear. In this study we show that activation of either P2Y(1) or P2Y(12) purinoceptors can stimulate ARF6 activity. Further blockade of ARF6 function either in cell lines or human platelets blocks P2Y purinoceptor internalization. This blockade of receptor internalization attenuates receptor resensitization. Furthermore, we demonstrate that Nm23-H1, a nucleoside diphosphate (NDP) kinase regulated by ARF6 which facilitates dynamin-dependent fission of coated vesicles during endocytosis, is also required for P2Y purinoceptor internalization. These data describe a novel function of ARF6 in the internalization of P2Y purinoceptors and demonstrate the integral importance of this small GTPase upon platelet ADP receptor function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rollins, T.E.; Siciliano, S.; Kobayashi, S.
1991-02-01
The authors have isolated, in an active state, the C5a receptor from human polymorphonuclear leukocytes. The purification was achieved in a single step using a C5a affinity column in which the C5a molecule was coupled to the resin through its N terminus. The purified receptor, like the crude solubilized molecule, exhibited a single class of high-affinity binding sites with a K{sub d} of 30 pM. Further, the binding of C5a retained its sensitivity to guanine nucleotides, implying that the purified receptor contained a guanine nucleotide-binding protein (G protein). SDS/PAGE revealed the presence of three polypeptides with molecular masses of 42,more » 40, and 36 kDa, which were determined to be the C5a-binding subunit and the {alpha} and {beta} subunits of G{sub i}, respectively. The 36- and 40-kDa polypeptides were identified by immunoblotting and by the ability of pertussis toxin to ADP-ribosylate the 40-kDa molecule. These results confirm their earlier hypothesis that the receptor exists as a complex with a G protein in the presence or absence of C5a. The tight coupling between the receptor and G protein should make possible the identification of the G protein(s) involved in the transduction pathways used by C5a to produce its many biological effects.« less
Fujihara, Naoki; Harata, Ken; Neumann, Ulla; Robin, Guillaume P.; O’Connell, Richard
2015-01-01
ABSTRACT The cucumber anthracnose fungus Colletotrichum orbiculare forms specialized cells called appressoria for host penetration. We identified a gene, FAM1, encoding a novel peroxin protein that is essential for peroxisome biogenesis and that associates with Woronin bodies (WBs), dense-core vesicles found only in filamentous ascomycete fungi which function to maintain cellular integrity. The fam1 disrupted mutants were unable to grow on medium containing oleic acids as the sole carbon source and were nonpathogenic, being defective in both appressorium melanization and host penetration. Fluorescent proteins carrying peroxisomal targeting signals (PTSs) were not imported into the peroxisomes of fam1 mutants, suggesting that FAM1 is a novel peroxisomal biogenesis gene (peroxin). FAM1 did not show significant homology to any Saccharomyces cerevisiae peroxins but resembled conserved filamentous ascomycete-specific Pex22-like proteins which contain a predicted Pex4-binding site and are potentially involved in recycling PTS receptors from peroxisomes to the cytosol. C. orbiculare FAM1 complemented the peroxisomal matrix protein import defect of the S. cerevisiae pex22 mutant. Confocal microscopy of Fam1-GFP (green fluorescent protein) fusion proteins and immunoelectron microscopy with anti-Fam1 antibodies showed that Fam1 localized to nascent WBs budding from peroxisomes and mature WBs. Association of Fam1 with WBs was confirmed by colocalization with WB matrix protein CoHex1 (C. orbiculare Hex1) and WB membrane protein CoWsc (C. orbiculare Wsc) and by subcellular fractionation and Western blotting with antibodies to Fam1 and CoHex1. In WB-deficient cohex1 mutants, Fam1 was redirected to the peroxisome membrane. Our results show that Fam1 is a WB-associated peroxin required for pathogenesis and raise the possibility that localized receptor recycling occurs in WBs. PMID:26374121
Investigations into the binding affinities of different human 5-HT4 receptor splice variants.
Irving, Helen R; Tochon-Danguy, Nathalie; Chinkwo, Kenneth A; Li, Jian G; Grabbe, Carmen; Shapiro, Marina; Pouton, Colin W; Coupar, Ian M
2010-01-01
This study examined whether the drug-receptor-binding sites of 5 selected human 5-HT(4) receptor splice variants [h5-HT4(a), h5-HT4(b), h5-HT4(c), h5-HT4(d) and h5-HT4(g)] display preferential affinities towards agonists. The agonists selected on the basis of chemical diversity and clinical relevance were: 5-HT4 benzamides, renzapride, zacopride and prucalopride; the benzimidazolones, DAU 6236 and BIMU 1; the aromatic ketone, RS67333, and the indole carbazimidamide tegaserod. The rank order of affinities ranging across the splice variants was: tegaserod (pKi: 7.38-7.91) > or = Y-36912 (pKi: 7.03-7.85) = BIMU 1 (pKi: 6.92-7.78) > or = DAU 6236 (pKi: 6.79-7.99) > or = 5-HT (pKi: 5.82-7.29) > or = 5-MeOT (pKi: 5.64-6.83) > or = renzapride (pKi: 4.85-5.56). We obtained affinity values for the 5-HT4(b), (d) and (g) variants for RS67333 (pKi: 7:48-8.29), prucalopride (pKi: 6.86-7.37) and zacopride (pKi: 5.88-7.0). These results indicate that the ligands interact with the same conserved site in each splice variant. Some splice variants have a higher affinity for certain agonists and the direction of selectivity followed a common trend of lowest affinity at the (d) variant. However, this trend was not evident in functional experiments. Our findings suggest that it may be possible to design splice variant selective ligands, which may be of relevance for experimental drugs but may be difficult to develop clinically. 2010 S. Karger AG, Basel.
Kelley, Keven M; Stenson, Alexandra C; Cooley, Racheal; Dey, Rajarashi; Whelton, Andrew J
2015-12-01
The influence of four different cleaning methods used for newly installed polyethylene (PEX) pipes on chemical and odor quality was determined. Bench-scale testing of two PEX (type b) pipe brands showed that the California Plumbing Code PEX installation method does not maximize total organic carbon (TOC) removal. TOC concentration and threshold odor number values significantly varied between two pipe brands. Different cleaning methods impacted carbon release, odor, as well the level of drinking water odorant ethyl tert-butyl ether. Both pipes caused odor values up to eight times greater than the US federal drinking water odor limit. Unique to this project was that organic chemicals released by PEX pipe were affected by pipe brand, fill/empty cycle frequency, and the pipe cleaning method selected by the installer.
Burgard, E C; Niforatos, W; van Biesen, T; Lynch, K J; Kage, K L; Touma, E; Kowaluk, E A; Jarvis, M F
2000-12-01
TNP-ATP has become widely recognized as a potent and selective P2X receptor antagonist, and is currently being used to discriminate between subtypes of P2X receptors in a variety of tissues. We have investigated the ability of TNP-ATP to inhibit alpha,beta-methylene ATP (alpha,beta-meATP)-evoked responses in 1321N1 human astrocytoma cells expressing recombinant rat or human P2X(2/3) receptors. Pharmacological responses were measured using electrophysiological and calcium imaging techniques. TNP-ATP was a potent inhibitor of P2X(2/3) receptors, blocking both rat and human receptors with IC(50) values of 3 to 6 nM. In competition studies, 10 to 1000 microM alpha,beta-meATP was able to overcome TNP-ATP inhibition. Schild analysis revealed that TNP-ATP was a competitive antagonist with pA(2) values of -8.7 and -8.2. Inhibition of P2X(2/3) receptors by TNP-ATP was rapid in onset, reversible, and did not display use dependence. Although the onset kinetics of inhibition were concentration-dependent, the TNP-ATP off-kinetics were concentration-independent and relatively slow. Full recovery from TNP-ATP inhibition did not occur until >/=5 s after removal of the antagonist. Because of the slow off-kinetics of TNP-ATP, full competition with alpha,beta-meATP for receptor occupancy could be seen only after both ligands had reached a steady-state condition. It is proposed that the slowly desensitizing P2X(2/3) receptor allowed this competitive interaction to be observed over time, whereas the rapid desensitization of other P2X receptors (P2X(3)) may mask the detection of competitive inhibition by TNP-ATP.
Robinson, Lucy E.; Shridar, Mitesh; Smith, Philip; Murrell-Lagnado, Ruth D.
2014-01-01
P2X7 receptors are nonselective cation channels gated by high extracellular ATP, but with sustained activation, receptor sensitization occurs, whereby the intrinsic pore dilates, making the cell permeable to large organic cations, which eventually leads to cell death. P2X7 receptors associate with cholesterol-rich lipid rafts, but it is unclear how this affects the properties of the receptor channel. Here we show that pore-forming properties of human and rodent P2X7 receptors are sensitive to perturbations of cholesterol levels. Acute depletion of cholesterol with 5 mm methyl-β-cyclodextrin (MCD) caused a substantial increase in the rate of agonist-evoked pore formation, as measured by the uptake of ethidium dye, whereas cholesterol loading inhibited this process. Patch clamp analysis of P2X7 receptor currents carried by Na+ and N-methyl-d-glucamine (NMDG+) showed enhanced activation and current facilitation following cholesterol depletion. This contrasts with the inhibitory effect of methyl-β-cyclodextrin reported for other P2X subtypes. Mutational analysis suggests the involvement of an N-terminal region and a proximal C-terminal region that comprises multiple cholesterol recognition amino acid consensus (CRAC) motifs, in the cholesterol sensitivity of channel gating. These results reveal cholesterol as a negative regulator of P2X7 receptor pore formation, protecting cells from P2X7-mediated cell death. PMID:25281740
Okusha, Yuka; Eguchi, Takanori; Sogawa, Chiharu; Okui, Tatsuo; Nakano, Keisuke; Okamoto, Kuniaki; Kozaki, Ken-Ichi
2018-05-15
Members of matrix metalloproteinase (MMP) family promote cancer cell migration, invasion, and metastasis through alteration of the tumor milieu, intracellular signaling pathways, and transcription. We examined gene expression signatures of colon adenocarcinoma cell lines with different metastatic potentials and found that rapidly metastatic cells powerfully expressed genes encoding MMP3 and MMP9. The non-proteolytic PEX isoform and proteolytic isoforms of MMPs were significantly expressed in the metastatic cells in vitro. Knockdown of MMP3 attenuated cancer cell migration and invasion in vitro and lung metastasis in vivo. Profound nuclear localization of MMP3/PEX was found in tumor-stroma marginal area. In contrast, MMP9 was localized in central area of subcutaneous tumors. Overexpression of the PEX isoform of MMP3 promoted proliferation and migration of the rapidly metastatic cells in vitro. Taken together, the non-proteolytic PEX isoform of MMPs locating in cell nuclei involves proliferation, migration, and subsequent metastasis of aggressive adenocarcinoma cells. © 2018 Wiley Periodicals, Inc.
Cost Analysis of Adult Male Circumcision with the PrePex Device versus Surgery in Rwanda.
Mutabazi, Vincent; Bitega, Jean Paul; Muyenzi Ngeruka, Leon; Nyemazi, Jean Pierre; Dain, Mary; Kaplan, Steven A; Karema, Corine; Binagwaho, Agnes
2014-01-01
In this study from Rwanda, voluntary adult male circumcision costs 33% less with trained nurses using the PrePex device compared with physician-nurse teams performing dorsal-slit surgery. These cost savings and the documented safety, speed, and efficacy of the PrePex procedure, serve Rwanda's HIV prevention program.
Purine ionotropic (P2X) receptors.
Köles, L; Fürst, S; Illes, P
2007-01-01
Purinergic signaling is involved in the proper functioning of virtually all organs of the body. Although in some cases purines have a major influence on physiological functions (e.g. thrombocyte aggregation), more often they are just background modulators contributing to fine tuning of biological events. However, under pathological conditions, when a huge amount of adenosine 5'-triphosphate (ATP) can reach the extracellular space, their significance is increasing. ATP and its various degradation products activate membrane receptors divided into two main classes: the metabotropic P2Y and the ionotropic P2X family. This latter group, the purine ionotropic receptor, is the object of this review. After providing a description about the distribution and functional properties of P2X receptors in the body, their pharmacology will be summarized. In the second part of this review, the role of purines in those organ systems and body functions will be highlighted, where the (patho)physiological role of P2X receptors has been suggested or is even well established. Besides the regulation of organ systems, for instance in the cardiovascular, respiratory, genitourinary or gastrointestinal system, some special issues will also be discussed, such as the role of P2X receptors in pain, tumors, central nervous system (CNS) injury and embryonic development. Several examples will indicate that purine ionotropic receptors might serve as attractive targets for pharmacological interventions in various diseases, and that selective ligands for these receptors will probably constitute important future therapeutic tools in humans.
Changes in the hemagglutinin of H5N1 viruses during human infection – Influence on receptor binding☆
Crusat, Martin; Liu, Junfeng; Palma, Angelina S.; Childs, Robert A.; Liu, Yan; Wharton, Stephen A.; Lin, Yi Pu; Coombs, Peter J.; Martin, Stephen R.; Matrosovich, Mikhail; Chen, Zi; Stevens, David J.; Hien, Vo Minh; Thanh, Tran Tan; Nhu, Le Nguyen Truc; Nguyet, Lam Anh; Ha, Do Quang; van Doorn, H.Rogier; Hien, Tran Tinh; Conradt, Harald S.; Kiso, Makoto; Gamblin, Steve J.; Chai, Wengang; Skehel, John J.; Hay, Alan J.; Farrar, Jeremy; de Jong, Menno D.; Feizi, Ten
2013-01-01
As avian influenza A(H5N1) viruses continue to circulate in Asia and Africa, global concerns of an imminent pandemic persist. Recent experimental studies suggest that efficient transmission between humans of current H5N1 viruses only requires a few genetic changes. An essential step is alteration of the virus hemagglutinin from preferential binding to avian receptors for the recognition of human receptors present in the upper airway. We have identified receptor-binding changes which emerged during H5N1 infection of humans, due to single amino acid substitutions, Ala134Val and Ile151Phe, in the hemagglutinin. Detailed biological, receptor-binding, and structural analyses revealed reduced binding of the mutated viruses to avian-like receptors, but without commensurate increased binding to the human-like receptors investigated, possibly reflecting a receptor-binding phenotype intermediate in adaptation to more human-like characteristics. These observations emphasize that evolution in nature of avian H5N1 viruses to efficient binding of human receptors is a complex multistep process. PMID:24050651
Hatzold, Karin; Reed, Jason; Edgil, Dianna; Jaramillo, Juan; Castor, Delivette; Forsythe, Steven; Xaba, Sinokuthemba; Mugurungi, Owen
2014-01-01
Background Fourteen African countries are scaling up voluntary medical male circumcision (VMMC) for HIV prevention. Several devices that might offer alternatives to the three WHO-approved surgical VMMC procedures have been evaluated for use in adults. One such device is PrePex, which was prequalified by the WHO in May 2013. We utilized data from one of the PrePex field studies undertaken in Zimbabwe to identify cost considerations for introducing PrePex into the existing surgical circumcision program. Methods and Findings We evaluated the cost drivers and overall unit cost of VMMC at a site providing surgical VMMC as a routine service (“routine surgery site”) and at a site that had added PrePex VMMC procedures to routine surgical VMMC as part of a research study (“mixed study site”). We examined the main cost drivers and modeled hypothetical scenarios with varying ratios of surgical to PrePex circumcisions, different levels of site utilization, and a range of device prices. The unit costs per VMMC for the routine surgery and mixed study sites were $56 and $61, respectively. The two greatest contributors to unit price at both sites were consumables and staff. In the hypothetical scenarios, the unit cost increased as site utilization decreased, as the ratio of PrePex to surgical VMMC increased, and as device price increased. Conclusions VMMC unit costs for routine surgery and mixed study sites were similar. Low service utilization was projected to result in the greatest increases in unit price. Countries that wish to incorporate PrePex into their circumcision programs should plan to maximize staff utilization and ensure that sites function at maximum capacity to achieve the lowest unit cost. Further costing studies will be necessary once routine implementation of PrePex-based circumcision is established. PMID:24801515
Enhanced Human-Type Receptor Binding by Ferret-Transmissible H5N1 with a K193T Mutation.
Peng, Wenjie; Bouwman, Kim M; McBride, Ryan; Grant, Oliver C; Woods, Robert J; Verheije, Monique H; Paulson, James C; de Vries, Robert P
2018-05-15
All human influenza pandemics have originated from avian influenza viruses. Although multiple changes are needed for an avian virus to be able to transmit between humans, binding to human-type receptors is essential. Several research groups have reported mutations in H5N1 viruses that exhibit specificity for human-type receptors and promote respiratory droplet transmission between ferrets. Upon detailed analysis, we have found that these mutants exhibit significant differences in fine receptor specificity compared to human H1N1 and H3N2 and retain avian-type receptor binding. We have recently shown that human influenza viruses preferentially bind to α2-6-sialylated branched N-linked glycans, where the sialic acids on each branch can bind to receptor sites on two protomers of the same hemagglutinin (HA) trimer. In this binding mode, the glycan projects over the 190 helix at the top of the receptor-binding pocket, which in H5N1 would create a stearic clash with lysine at position 193. Thus, we hypothesized that a K193T mutation would improve binding to branched N-linked receptors. Indeed, the addition of the K193T mutation to the H5 HA of a respiratory-droplet-transmissible virus dramatically improves both binding to human trachea epithelial cells and specificity for extended α2-6-sialylated N-linked glycans recognized by human influenza viruses. IMPORTANCE Infections by avian H5N1 viruses are associated with a high mortality rate in several species, including humans. Fortunately, H5N1 viruses do not transmit between humans because they do not bind to human-type receptors. In 2012, three seminal papers have shown how these viruses can be engineered to transmit between ferrets, the human model for influenza virus infection. Receptor binding, among others, was changed, and the viruses now bind to human-type receptors. Receptor specificity was still markedly different compared to that of human influenza viruses. Here we report an additional mutation in ferret
DOE Office of Scientific and Technical Information (OSTI.GOV)
Branchek, T.; Adham, N.; Macchi, M.
1990-11-01
The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less
Functionalized Congeners of P2Y1 Receptor Antagonists:
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Castro, Sonia; Maruoka, Hiroshi; Hong, Kunlun
2010-01-01
The P2Y{sub 1} receptor is a prothrombotic G protein-coupled receptor (GPCR) activated by ADP. Preference for the North (N) ring conformation of the ribose moiety of adenine nucleotide 3',5'-bisphosphate antagonists of the P2Y{sub 1} receptor was established by using a ring-constrained methanocarba (a bicyclo[3.1.0]hexane) ring as a ribose substitute. A series of covalently linkable N{sup 6}-methyl-(N)-methanocarba-2'-deoxyadenosine-3',5'-bisphosphates containing extended 2-alkynyl chains was designed, and binding affinity at the human (h) P2Y{sub 1} receptor determined. The chain of these functionalized congeners contained hydrophilic moieties, a reactive substituent, or biotin, linked via an amide. Variation of the chain length and position of anmore » intermediate amide group revealed high affinity of carboxylic congener 8 (K{sub i} 23 nM) and extended amine congener 15 (K{sub i} 132 nM), both having a 2-(1-pentynoyl) group. A biotin conjugate 18 containing an extended {epsilon}-aminocaproyl spacer chain exhibited higher affinity than a shorter biotinylated analogue. Alternatively, click coupling of terminal alkynes of homologous 2-dialkynyl nucleotide derivatives to alkyl azido groups produced triazole derivatives that bound to the P2Y{sub 1} receptor following deprotection of the bisphosphate groups. The preservation of receptor affinity of the functionalized congeners was consistent with new P2Y{sub 1} receptor modeling and ligand docking. Attempted P2Y{sub 1} antagonist conjugation to PAMAM dendrimer carriers by amide formation or palladium-catalyzed reaction between an alkyne on the dendrimer and a 2-iodopurine-derivatized nucleotide was unsuccessful. A dialkynyl intermediate containing the chain length favored in receptor binding was conjugated to an azide-derivatized dendrimer, and the conjugate inhibited ADP-promoted human platelet aggregation. This is the first example of attaching a strategically functionalized P2Y receptor antagonist to a PAMAM
Nandrolone decreases mu opioid receptor expression in SH-SY5Y human neuroblastoma cells.
Guarino, Goffredo; Spampinato, Santi
2008-07-16
Nandrolone and other anabolic androgenic steroids alter the expression and function of neurotransmitter systems and contribute to drug dependence. Nandrolone treatment (10-10 M) caused a time-dependent and concentration-dependent downregulation of mu opioid receptor (MOPr) transcripts in SH-SY5Y human neuroblastoma cells. This effect was prevented by the androgen receptor antagonist hydroxyflutamide. Receptor binding assays confirmed a decrease in MOPr of approximately 40% in nandrolone-treated cells. Treatment with actinomycin D (10 (-5)M), a transcription inhibitor, revealed that nandrolone might regulate MOPr mRNA stability. In SH-SY5Y cells transfected with a human MOPr luciferase promoter/reporter construct, nandrolone did not alter the rate of gene transcription. These results suggest that nandrolone may regulate MOPr expression through posttranscriptional mechanisms requiring the androgen receptor.
Pharmacology of the hypothermic response to 5-HT1A receptor activation in humans.
Lesch, K P; Poten, B; Söhnle, K; Schulte, H M
1990-01-01
The selective 5-HT1A receptor ligand ipsapirone (IPS) caused dose-related hypothermia in humans. The response was attenuated by the nonselective 5-HT1/2 receptor antagonist metergoline and was completely antagonized by the nonselective beta-adrenoceptor antagonist pindolol, which interacts stereoselectively with the 5-HT1A receptor. The selective beta 1-adrenergic antagonist betaxolol had no effect. The findings indicate that IPS-induced hypothermia specifically involves activation of (presynaptic) 5-HT1A receptors. Therefore, the hypothermic response to IPS may provide a convenient in vivo paradigma to assess the function of the presynaptic 5-HT receptor in affective disorders and its involvement in the effects of psychotropic drugs.
Budnik, Lygia Therese; Adam, Balazs; Albin, Maria; Banelli, Barbara; Baur, Xaver; Belpoggi, Fiorella; Bolognesi, Claudia; Broberg, Karin; Gustavsson, Per; Göen, Thomas; Fischer, Axel; Jarosinska, Dorota; Manservisi, Fabiana; O'Kennedy, Richard; Øvrevik, Johan; Paunovic, Elizabet; Ritz, Beate; Scheepers, Paul T J; Schlünssen, Vivi; Schwarzenbach, Heidi; Schwarze, Per E; Sheils, Orla; Sigsgaard, Torben; Van Damme, Karel; Casteleyn, Ludwine
2018-01-01
The WHO has ranked environmental hazardous exposures in the living and working environment among the top risk factors for chronic disease mortality. Worldwide, about 40 million people die each year from noncommunicable diseases (NCDs) including cancer, diabetes, and chronic cardiovascular, neurological and lung diseases. The exposure to ambient pollution in the living and working environment is exacerbated by individual susceptibilities and lifestyle-driven factors to produce complex and complicated NCD etiologies. Research addressing the links between environmental exposure and disease prevalence is key for prevention of the pandemic increase in NCD morbidity and mortality. However, the long latency, the chronic course of some diseases and the necessity to address cumulative exposures over very long periods does mean that it is often difficult to identify causal environmental exposures. EU-funded COST Action DiMoPEx is developing new concepts for a better understanding of health-environment (including gene-environment) interactions in the etiology of NCDs. The overarching idea is to teach and train scientists and physicians to learn how to include efficient and valid exposure assessments in their research and in their clinical practice in current and future cooperative projects. DiMoPEx partners have identified some of the emerging research needs, which include the lack of evidence-based exposure data and the need for human-equivalent animal models mirroring human lifespan and low-dose cumulative exposures. Utilizing an interdisciplinary approach incorporating seven working groups, DiMoPEx will focus on aspects of air pollution with particulate matter including dust and fibers and on exposure to low doses of solvents and sensitizing agents. Biomarkers of early exposure and their associated effects as indicators of disease-derived information will be tested and standardized within individual projects. Risks arising from some NCDs, like pneumoconioses, cancers and
Volatile organic components migrating from plastic pipes (HDPE, PEX and PVC) into drinking water.
Skjevrak, Ingun; Due, Anne; Gjerstad, Karl Olav; Herikstad, Hallgeir
2003-04-01
High-density polyethylene pipes (HDPE), crossbonded polyethylene pipes (PEX) and polyvinyl chloride (PVC) pipes for drinking water were tested with respect to migration of volatile organic components (VOC) to water. The odour of water in contact with plastic pipes was assessed according to the quantitative threshold odour number (TON) concept. A major migrating component from HDPE pipes was 2,4-di-tert-butyl-phenol (2,4-DTBP) which is a known degradation product from antioxidants such as Irgafos 168(R). In addition, a range of esters, aldehydes, ketones, aromatic hydrocarbons and terpenoids were identified as migration products from HDPE pipes. Water in contact with HDPE pipes was assessed with respect to TON, and values > or =4 were determined for five out of seven brands of HDPE pipes. The total amount of VOC released to water during three successive test periods were fairly constant for the HDPE pipes. Corresponding migration tests carried out for PEX pipes showed that VOC migrated in significant amounts into the test water, and TON >/=5 of the test water were observed in all tests. Several of the migrated VOC were not identified. Oxygenates predominated the identified VOC in the test water from PEX pipes. Migration tests of PVC pipes revealed few volatile migrants in the test samples and no significant odour of the test water.
Galukande, Moses; Duffy, Kevin; Bitega, Jean Paul; Rackara, Sam; Bbaale, Denis Sekavuga; Nakaggwa, Florence; Nagaddya, Teddy; Wooding, Nick; Dea, Monica; Coutinho, Alex
2014-01-01
Background Safe Male Circumcision is a proven approach for partial HIV prevention. Several sub Saharan African countries have plans to reach a prevalence of 80% of their adult males circumcised by 2015. These targets require out of ordinary organization, demand creation, timely execution and perhaps the use of SMC devices. Objective To profile Adverse Events rate and acceptance of PrePex, a non surgical device for adult male circumcision. Methods A prospective study, conducted at International Hospital Kampala, Uganda, between August and October 2012. Ethical approval was obtained from Uganda National Council of Science and Technology. Results Of 1,040 men received to undergo SMC, 678 opted for PrePex, 36 were excluded at an initial physical examination screening. 642 were enrolled and consented, and another 17 were excluded before device placement. 625 underwent the procedure. Average age was 24 years (±7). Twelve moderate AEs occurred among 10 participants 12/625, (1.9%). These were all reversible. Five had device displacement, one had an everted foreskin; five had bleeding after the device was removed and one had voiding difficulties. The majority (279 out of 300) of men interviewed complained of some pain within the week of placement. Mean pain score at device placement (using visual analogue scale) was 0.5, at device removal 4.5 and within 2 min of removal the pain score was 1.4. Over 70% of the devices were placed and removed by non-physician clinicians. Presented with a choice, 60% of men chose PrePex over surgical SMC. Close to 90% would recommend the device to their friends. Odour from the necrotic skin was a concern. Removals done 1–2 days earlier than day 7 were beneficial and conferred no extra risk. Conclusion AEs of a moderate or severe nature associated with PrePex were low and reversible. PrePex is feasible for mass safe male circumcision scaling up. PMID:24489754
Ahlemeyer, Barbara; Gottwald, Magdalena; Baumgart-Vogt, Eveline
2012-01-01
SUMMARY Impaired neuronal migration and cell death are commonly observed in patients with peroxisomal biogenesis disorders (PBDs), and in mouse models of this diseases. In Pex11β-deficient mice, we observed that the deletion of a single allele of the Pex11β gene (Pex11β+/− heterozygous mice) caused cell death in primary neuronal cultures prepared from the neocortex and cerebellum, although to a lesser extent as compared with the homozygous-null animals (Pex11β−/− mice). In corresponding brain sections, cell death was rare, but differences between the genotypes were similar to those found in vitro. Because PEX11β has been implicated in peroxisomal proliferation, we searched for alterations in peroxisomal abundance in the brain of heterozygous and homozygous Pex11β-null mice compared with wild-type animals. Deletion of one allele of the Pex11β gene slightly increased the abundance of peroxisomes, whereas the deletion of both alleles caused a 30% reduction in peroxisome number. The size of the peroxisomal compartment did not correlate with neuronal death. Similar to cell death, neuronal development was delayed in Pex11β+/− mice, and to a further extent in Pex11β−/− mice, as measured by a reduced mRNA and protein level of synaptophysin and a reduced protein level of the mature isoform of MAP2. Moreover, a gradual increase in oxidative stress was found in brain sections and primary neuronal cultures from wild-type to heterozygous to homozygous Pex11β-deficient mice. SOD2 was upregulated in neurons from Pex11β+/− mice, but not from Pex11β−/− animals, whereas the level of catalase remained unchanged in neurons from Pex11β+/− mice and was reduced in those from Pex11β−/− mice, suggesting a partial compensation of oxidative stress in the heterozygotes, but a failure thereof in the homozygous Pex11β−/− brain. In conclusion, we report the alterations in the brain caused by the deletion of a single allele of the Pex11β gene. Our data
Liñán-Rico, A.; Wunderlich, JE.; Enneking, JT.; Tso, DR.; Grants, I.; Williams, KC.; Otey, A.; Michel, K.; Schemann, M.; Needleman, B.; Harzman, A.; Christofi, FL.
2015-01-01
Rationale The role of purinergic signaling in the human ENS is not well understood. We sought to further characterize the neuropharmacology of purinergic receptors in human ENS and test the hypothesis that endogenous purines are critical regulators of neurotransmission. Experimental Approach LSCM-Fluo-4-(Ca2+)-imaging of postsynaptic Ca2+ transients (PSCaTs) was used as a reporter of neural activity. Synaptic transmission was evoked by fiber tract electrical stimulation in human SMP surgical preparations. Pharmacological analysis of purinergic signaling was done in 1,556 neurons from 234 separate ganglia 107 patients; immunochemical labeling for P2XRs of neurons in ganglia from 19 patients. Real-time MSORT (Di-8-ANEPPS) imaging was used to test effects of adenosine on fast excitatory synaptic potentials (fEPSPs). Results Synaptic transmission is sensitive to pharmacological manipulations that alter accumulation of extracellular purines. Apyrase blocks PSCaTs in a majority of neurons. An ecto-NTPDase-inhibitor 6-N,N-diethyl-D-β,γ-dibromomethyleneATP or adenosine deaminase augments PSCaTs. Blockade of reuptake/deamination of eADO inhibits PSCaTs. Adenosine inhibits fEPSPs and PSCaTs (IC50=25μM), sensitive to MRS1220-antagonism (A3AR). A P2Y agonist ADPβS inhibits PSCaTs (IC50=111nM) in neurons without stimulatory ADPβS responses (EC50=960nM). ATP or a P2X1,2,2/3 (α,β-MeATP) agonist evokes fast, slow, biphasic Ca2+ transients or Ca2+ oscillations (EC50=400μM). PSCaTs are sensitive to P2X1 antagonist NF279. Low (20nM) or high (5μM) concentrations of P2X antagonist TNP-ATP block PSCaTs in different neurons; proportions of neurons with P2XR-ir follow the order P2X2>P2X1≫P2X3; P2X1+ P2X2 and P2X3+P2X2 are co-localized. RT-PCR identified mRNA-transcripts for P2X1-7,P2Y1,2,12-14R. Responsive neurons were also identified by HuC/D-ir. Conclusions Purines are critical regulators of neurotransmission in the human enteric nervous system. Purinergic signaling involves
Effect of P2X7 Receptor Knockout on AQP-5 Expression of Type I Alveolar Epithelial Cells
Ebeling, Georg; Bläsche, Robert; Hofmann, Falk; Augstein, Antje; Kasper, Michael; Barth, Kathrin
2014-01-01
P2X7 receptors, ATP-gated cation channels, are specifically expressed in alveolar epithelial cells. The pathophysiological function of this lung cell type, except a recently reported putative involvement in surfactant secretion, is unknown. In addition, P2X7 receptor-deficient mice show reduced inflammation and lung fibrosis after exposure with bleomycin. To elucidate the role of the P2X7 receptor in alveolar epithelial type I cells we characterized the pulmonary phenotype of P2X7 receptor knockout mice by using immunohistochemistry, western blot analysis and real-time RT PCR. No pathomorphological signs of fibrosis were found. Results revealed, however, a remarkable loss of aquaporin-5 protein and mRNA in young knockout animals. Additional in vitro experiments with bleomycin treated precision cut lung slices showed a greater sensitivity of the P2X7 receptor knockout mice in terms of aquaporin-5 reduction as wild type animals. Finally, P2X7 receptor function was examined by using the alveolar epithelial cell lines E10 and MLE-12 for stimulation experiments with bleomycin. The in vitro activation of P2X7 receptor was connected with an increase of aquaporin-5, whereas the inhibition of the receptor with oxidized ATP resulted in down regulation of aquaporin-5. The early loss of aquaporin-5 which can be found in different pulmonary fibrosis models does not implicate a specific pathogenetic role during fibrogenesis. PMID:24941004
Rapid resensitization of purinergic receptor function in human platelets.
Mundell, S J; Barton, J F; Mayo-Martin, M B; Hardy, A R; Poole, A W
2008-08-01
Adenosine diphosphate (ADP) is a critical regulator of platelet activation, mediating its actions through two G protein-coupled receptors (GPCRs), the P2Y(1) and P2Y(12) purinergic receptors. Recently, we demonstrated that both receptors desensitize and internalize in human platelets by differential kinase-dependent mechanisms. To demonstrate whether responses to P2Y(1) and P2Y(12) purinergic receptors resensitize in human platelets and determine the role of receptor traffic in this process. These studies were undertaken either in human platelets or in cells stably expressing epitope-tagged P2Y(1) and P2Y(12) purinergic receptor constructs. In this study we show for the first time that responses to both of these receptors can rapidly resensitize following agonist-dependent desensitization in human platelets. Further, we show that in human platelets or in 1321N1 cells stably expressing receptor constructs, the disruption of receptor internalization, dephosphorylation or subsequent receptor recycling is sufficient to block resensitization of purinergic receptor responses. We also show that, in platelets, internalization of both these receptors is dependent upon dynamin, and that this process is required for resensitization of responses. This study is therefore the first to show that both P2Y(1) and P2Y(12) receptor activities are rapidly and reversibly modulated in human platelets, and it reveals that the underlying mechanism requires receptor trafficking as an essential part of this process.
Nagane, Motoo; Shimizu, Saki; Mori, Eiji; Kataoka, Shiro; Shiokawa, Yoshiaki
2010-01-01
Tumor necrosis factor–related apoptosis-inducing ligand (TRAIL/Apo2 L) preferentially induces apoptosis in human tumor cells through its cognate death receptors DR4 or DR5, thereby being investigated as a potential agent for cancer therapy. Here, we applied fully human anti-human TRAIL receptor monoclonal antibodies (mAbs) to specifically target one of death receptors for TRAIL in human glioma cells, which could also reduce potential TRAIL-induced toxicity in humans. Twelve human glioma cell lines treated with several fully human anti-human TRAIL receptor mAbs were sensitive to only anti-DR5 mAbs, whereas they were totally insensitive to anti-DR4 mAb. Treatment with anti-DR5 mAbs exerted rapid cytotoxicity and lead to apoptosis induction. The cellular sensitivity was closely associated with cell-surface expression of DR5. Expression of c-FLIPL, Akt, and Cyclin D1 significantly correlated with sensitivity to anti-DR5 mAbs. Primary cultures of glioma cells were also relatively resistant to anti-DR5 mAbs, exhibiting both lower DR5 and higher c-FLIPL expression. Downregulation of c-FLIPL expression resulted in the sensitization of human glioma cells to anti-DR5 mAbs, whereas overexpression of c-FLIPL conferred resistance to anti-DR5 mAb. Treatment of tumor-burden nude mice with the direct agonist anti-DR5 mAb KMTR2 significantly suppressed growth of subcutaneous glioma xenografts leading to complete regression. Similarly, treatment of nude mice bearing intracerebral glioma xenografts with KMTR2 significantly elongated lifespan without tumor recurrence. These results suggest that DR5 is the predominant TRAIL receptor mediating apoptotic signals in human glioma cells, and sensitivity to anti-DR5 mAbs was determined at least in part by the expression level of c-FLIPL and Akt. Specific targeting of death receptor pathway through DR5 using fully human mAbs might provide a novel therapeutic strategy for intractable malignant gliomas. PMID:20511188
Cyto- and receptor architecture of area 32 in human and macaque brains.
Palomero-Gallagher, Nicola; Zilles, Karl; Schleicher, Axel; Vogt, Brent A
2013-10-01
Human area 32 plays crucial roles in emotion and memory consolidation. It has subgenual (s32), pregenual (p32), dorsal, and midcingulate components. We seek to determine whether macaque area 32 has subgenual and pregenual subdivisions and the extent to which they are comparable to those in humans by means of NeuN immunohistochemistry and multireceptor analysis of laminar profiles. The macaque has areas s32 and p32. In s32, layer IIIa/b neurons are larger than those of layer IIIc. This relationship is reversed in p32. Layer Va is thicker and Vb thinner in s32. Area p32 contains higher kainate, benzodiazepine (BZ), and serotonin (5-HT)1A but lower N-methyl-D-aspartate (NMDA) and α2 receptor densities. Most differences were found in layers I, II, and VI. Together, these differences support the dual nature of macaque area 32. Comparative analysis of human and macaque s32 and p32 supports equivalences in cyto- and receptor architecture. Although there are differences in mean areal receptor densities, there are considerable similarities at the layer level. Laminar receptor distribution patterns in each area are comparable in the two species in layers III-Va for kainate, NMDA, γ-aminobutyric acid (GABA)B , BZ, and 5-HT1A receptors. Multivariate statistical analysis of laminar receptor densities revealed that human s32 is more similar to macaque s32 and p32 than to human p32. Thus, macaque 32 is more complex than hitherto known. Our data suggest a homologous neural architecture in anterior cingulate s32 and p32 in human and macaque brains. © 2013 Wiley Periodicals, Inc.
Variability in H9N2 haemagglutinin receptor-binding preference and the pH of fusion.
Peacock, Thomas P; Benton, Donald J; Sadeyen, Jean-Remy; Chang, Pengxiang; Sealy, Joshua E; Bryant, Juliet E; Martin, Stephen R; Shelton, Holly; McCauley, John W; Barclay, Wendy S; Iqbal, Munir
2017-03-22
H9N2 avian influenza viruses are primarily a disease of poultry; however, they occasionally infect humans and are considered a potential pandemic threat. Little work has been performed to assess the intrinsic biochemical properties related to zoonotic potential of H9N2 viruses. The objective of this study, therefore, was to investigate H9N2 haemagglutinins (HAs) using two well-known correlates for human adaption: receptor-binding avidity and pH of fusion. Receptor binding was characterized using bio-layer interferometry to measure virus binding to human and avian-like receptor analogues and the pH of fusion was assayed by syncytium formation in virus-infected cells at different pHs. We characterized contemporary H9N2 viruses of the zoonotic G1 lineage, as well as representative viruses of the zoonotic BJ94 lineage. We found that most contemporary H9N2 viruses show a preference for sulphated avian-like receptor analogues. However, the 'Eastern' G1 H9N2 viruses displayed a consistent preference in binding to a human-like receptor analogue. We demonstrate that the presence of leucine at position 226 of the HA receptor-binding site correlated poorly with the ability to bind a human-like sialic acid receptor. H9N2 HAs also display variability in their pH of fusion, ranging between pH 5.4 and 5.85 which is similar to that of the first wave of human H1N1pdm09 viruses but lower than the pH of fusion seen in zoonotic H5N1 and H7N9 viruses. Our results suggest possible molecular mechanisms that may underlie the relatively high prevalence of human zoonotic infection by particular H9N2 virus lineages.
Variability in H9N2 haemagglutinin receptor-binding preference and the pH of fusion
Peacock, Thomas P; Benton, Donald J; Sadeyen, Jean-Remy; Chang, Pengxiang; Sealy, Joshua E; Bryant, Juliet E; Martin, Stephen R; Shelton, Holly; McCauley, John W; Barclay, Wendy S; Iqbal, Munir
2017-01-01
H9N2 avian influenza viruses are primarily a disease of poultry; however, they occasionally infect humans and are considered a potential pandemic threat. Little work has been performed to assess the intrinsic biochemical properties related to zoonotic potential of H9N2 viruses. The objective of this study, therefore, was to investigate H9N2 haemagglutinins (HAs) using two well-known correlates for human adaption: receptor-binding avidity and pH of fusion. Receptor binding was characterized using bio-layer interferometry to measure virus binding to human and avian-like receptor analogues and the pH of fusion was assayed by syncytium formation in virus-infected cells at different pHs. We characterized contemporary H9N2 viruses of the zoonotic G1 lineage, as well as representative viruses of the zoonotic BJ94 lineage. We found that most contemporary H9N2 viruses show a preference for sulphated avian-like receptor analogues. However, the ‘Eastern' G1 H9N2 viruses displayed a consistent preference in binding to a human-like receptor analogue. We demonstrate that the presence of leucine at position 226 of the HA receptor-binding site correlated poorly with the ability to bind a human-like sialic acid receptor. H9N2 HAs also display variability in their pH of fusion, ranging between pH 5.4 and 5.85 which is similar to that of the first wave of human H1N1pdm09 viruses but lower than the pH of fusion seen in zoonotic H5N1 and H7N9 viruses. Our results suggest possible molecular mechanisms that may underlie the relatively high prevalence of human zoonotic infection by particular H9N2 virus lineages. PMID:28325922
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, H.; Grubb, J.H.; Sly, W.S.
1990-10-01
The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less
Khan, Mohammed A S; Kang, Jian; Steiner, Theodore S
2004-01-01
Enteroaggregative Escherichia coli (EAEC) is an emerging enteric pathogen that causes acute and chronic diarrhoea in a number of clinical settings. EAEC diarrhoea involves bacterial aggregation, adherence to intestinal epithelial cells and elaboration of several toxigenic bacterial mediators. Flagellin (FliC-EAEC), a major bacterial surface protein of EAEC, causes interleukin (IL)-8 release from several epithelial cell lines. The host response to flagellins from E. coli and several other bacteria is mediated by Toll-like receptor 5 (TLR5), which signals through nuclear factor kappa B (NF-κB) to induce transcription of pro-inflammatory cytokines. p38 mitogen-activating protein (MAP) kinase (MAPK) is a member of a family of stress-related kinases that influences a diverse range of cellular functions including host inflammatory responses to microbial products. We studied the role of p38 MAPK in FliC-EAEC-induced IL-8 secretion from Caco-2 human intestinal epithelial cells and THP-1 human monocytic cells. We found that IL-8 secretion from both cell types is dependent on p38 MAPK, which is phospho-activated in response to FliC-EAEC. The role of TLR5 in p38 MAPK-dependent IL-8 secretion was verified in HEp-2 cells transiently transfected with a TLR5 expression construct. Activation of interleukin-1 receptor-associated kinase (IRAK) was also observed in Caco-2 and TLR5-transfected HEp-2 cells after exposure to FliC-EAEC. Finally, we demonstrated that pharmacological inhibition of p38 MAPK reduced IL-8 transcription and mRNA levels, but did not affect NF-κB activation. Collectively, our results suggest that TLR5 mediates p38 MAPK-dependent IL-8 secretion from epithelial and monocytic cells incubated with FliC-EAEC, and that this effect requires IL-8 promoter activation independent of NF-κB nuclear migration. PMID:15270737
ECX and PEX rheology. Progress report, October--December 1975
DOE Office of Scientific and Technical Information (OSTI.GOV)
West, G.T.
1975-01-01
The objectives of this project are: (1) to evaluate the capillary rheometer as a device to qualitatively measure the extrusion properties of extrusion cast and paste explosives; (2) to study and determine means to distinguish and characterize the rheological properties of different lots of ECX and PEX; and (3) to apply results from (1) and (2) to production loading operations involving ECX and PEX. The second objective (to study and determine means to distinguish and characterize rheological properties) of this project has been accomplished. Testing procedures were finalized, and general knowledge of the rheometer itself was gained. Three batches ofmore » 85/15 (wt. percent) RDX/Sylgard were tested in the Instron Capillary Rheometer. Each lot was statistically distinguishable from the other two lots. One lot exhibited a significantly lower apparent viscosity than the other two lots, which were statistically different from each other, but which were in fairly close agreement.« less
Xu, Qing; Chen, Ling-Xiu; Ran, Dan-Hua; Xie, Wen-Yue; Li, Qi; Zhou, Xiang-Dong
2017-08-15
Bombesin receptor-activated protein (BRAP) is highly expressed in human bronchial epithelial cells. Recent studies have shown that BRAP reduces oxidative stress, inhibits airway inflammation and suppresses nuclear factor kappaB (NF-κB) activity. Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases. Neutrophil elastase (NE) is a potent inducer of mucin5AC (MUC5AC), which is considered the predominant mucin secreted by human airway epithelial cells. Here, we hypothesize that BRAP may regulate NE-induced MUC5AC hypersecretion in a bronchial epithelial cell line (HBE16). We also investigated the underlying mechanism involved in the process. In this study, we found that BRAP was present in HBE16 human bronchial epithelial cells and was significantly increased by NE. Next, we found that the up-regulation of BRAP by pEGFP-N1-BRAP caused a significant decrease in the increased levels of MUC5AC expression, NF-κB activity, and the phosphorylation of extracellular signal-regulated kinases (ERK) and epidermal growth factor receptor (EGFR) induced by NE. Meanwhile, there was a significant decrease in ROS, interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) levels when BRAP was up-regulated by pEGFP-N1-BRAP. Moreover, when cells were transfected with pEGFP-N1-BRAP and pretreated with NF-κB, ERK or EGFR inhibitors before the NE stimulation, there were further decreased in MUC5AC expression, NF-κB activity, and the phosphorylation of ERK and EGFR. These results suggest that BRAP plays an important role in airway inflammation and its overexpression may regulate NE-induced MUC5AC hypersecretion in HBE16 cells via the EGFR/ERK/NF-κB signaling pathway. Copyright © 2017. Published by Elsevier Inc.
Steroid receptors analysis in human mammary tumors by isoelectric focusing in agarose.
Bailleul, S; Gauduchon, P; Malas, J P; Lechevrel, C; Roussel, G; Goussard, J
1988-08-01
A high resolution and quantitative method for isoelectric focusing has been developed to separate the isoforms of estrogen and progesterone receptors in human mammary tumor cytosols stabilized by sodium molybdate. Agarose gels (0.5%) were used. Six samples can be analyzed on one gel in about 2 h, and 35-microliters samples are sufficient to determine the estrogen receptor isoform pattern. The constant yields and the reproducibility of data allow a quantitative analysis of these receptors. Four estrogen receptor isoforms have been observed (pI 4.7, 5.5, 6, and 6.5), isoforms with pI 4.7 and 6.5 being present in all tumors. After incubation at 28 degrees C in high ionic strength, the comparison of isoelectric focusing and high-performance size exclusion chromatography patterns of estrogen receptor confirms the oligomeric structure of the pI 4.7 isoform and suggests a monomeric structure for the pI 6.5 isoform. Under the same conditions of analysis, only one progesterone receptor isoform has been detected with pI 4.7.
Xiong, W; Koo, B-N; Morton, R; Zhang, L
2011-06-16
Δ⁹ tetrahydrocannabinol (THC) and cannabidiol (CBD) are the principal psychoactive and nonpsychoactive components of cannabis. While most THC-induced behavioral effects are thought to depend on endogenous cannabinoid 1 (CB1) receptors, the molecular targets for CBD remain unclear. Here, we report that CBD and THC inhibited the function of human 5-HT(3A) receptors (h5-HT(3A)Rs) expressed in HEK 293 cells. The magnitude of THC and CBD inhibition was maximal 5 min after a continuous incubation with cannabinoids. The EC₅₀ values for CBD and THC-induced inhibition were 110 nM and 322 nM, respectively in HEK 293 cells expressing h5-HT(3A)Rs. In these cells, CBD and THC did not stimulate specific [³⁵S]-GTP-γs binding in membranes, suggesting that the inhibition by cannabinoids is unlikely mediated by a G-protein dependent mechanism. On the other hand, both CBD and THC accelerated receptor desensitization kinetics without significantly changing activation time. The extent of cannabinoid inhibition appeared to depend on receptor desensitization. Reducing receptor desensitization by nocodazole, 5-hydroxyindole and a point-mutation in the large cytoplasmic domain of the receptor significantly decreased CBD-induced inhibition. Similarly, the magnitude of THC and CBD-induced inhibition varied with the apparent desensitization rate of h5-HT(3A)Rs expressed in Xenopus oocytes. For instance, with increasing amount of h5-HT(3A)R cRNA injected into the oocytes, the receptor desensitization rate at steady state decreased. THC and CBD-induced inhibition was correlated with the change in the receptor desensitization rate. Thus, CBD and THC inhibit h5-HT(3A) receptors through a mechanism that is dependent on receptor desensitization. Published by Elsevier Ltd.
Xiong, Wei; Koo, Bon-Nyeo; Morton, Russell; Zhang, Li
2011-01-01
Δ9 tetrahydrocannabinol (THC) and cannabidiol (CBD) are the principal psychoactive and non-psychoactive components of cannabis. While most THC-induced behavioral effects are thought to depend on endogenous cannabinoid 1 (CB1) receptors, the molecular targets for CBD remain unclear. Here, we report that CBD and THC inhibited the function of human 5-HT3A receptors (h5-HT3ARs) expressed in HEK 293 cells. The magnitude of THC and CBD inhibition was maximal 5 min after a continuous incubation with cannabinoids. The EC50 values for CBD and THC-induced inhibition were 110 nM and 322 nM respectively in HEK 293 cells expressing h5-HT3ARs. In these cells, CBD and THC did not stimulate specific [35S]-GTP-γs binding in membranes, suggesting that the inhibition by cannabinoids is unlikely mediated by a G-protein dependent mechanism. On the other hand, both CBD and THC accelerated receptor desensitization kinetics without significantly changing activation time. The extent of cannabinoid inhibition appeared to depend on receptor desensitization. Reducing receptor desensitization by nocodazole, 5-hydroxyindole and a point-mutation in the large cytoplasmic domain of the receptor significantly decreased CBD-induced inhibition. Similarly, the magnitude of THC and CBD-induced inhibition varied with the apparent desensitization rate of h5-HT3ARs expressed in Xenopus oocytes. For instance, with increasing amount of h5-HT3AR cRNA injected into the oocytes, the receptor desensitization rate at steady state decreased. THC and CBD-induced inhibition was correlated with the change in the receptor desensitization rate. Thus, CBD and THC inhibit h5-HT3A receptors through a mechanism that is dependent on receptor desensitization. PMID:21477640
Involvement of substance P and the NK-1 receptor in human pathology.
Muñoz, Miguel; Coveñas, Rafael
2014-07-01
The peptide substance P (SP) shows a widespread distribution in both the central and peripheral nervous systems, but it is also present in cells not belonging to the nervous system (immune cells, liver, lung, placenta, etc.). SP is located in all body fluids, such as blood, cerebrospinal fluid, breast milk, etc. i.e. it is ubiquitous in human body. After binding to the neurokinin-1 (NK-1) receptor, SP regulates many pathophysiological functions in the central nervous system, such as emotional behavior, stress, depression, anxiety, emesis, vomiting, migraine, alcohol addiction, seizures and neurodegeneration. SP has been also implicated in pain, inflammation, hepatitis, hepatotoxicity, cholestasis, pruritus, myocarditis, bronchiolitis, abortus, bacteria and viral infection (e.g., HIV infection) and it plays an important role in cancer (e.g., tumor cell proliferation, antiapoptotic effects in tumor cells, angiogenesis, migration of tumor cells for invasion, infiltration and metastasis). This means that the SP/NK-1 receptor system is involved in the molecular bases of many human pathologies. Thus, knowledge of this system is the key for a better understanding and hence a better management of many human diseases. In this review, we update the involvement of the SP/NK-1 receptor system in the physiopathology of the above-mentioned pathologies and we suggest valuable future therapeutic interventions involving the use of NK-1 receptor antagonists, particularly in the treatment of emesis, depression, cancer, neural degeneration, inflammatory bowel disease, viral infection and pruritus, in which that system is upregulated.
Sauvé, K; Nachman, M; Spence, C; Bailon, P; Campbell, E; Tsien, W H; Kondas, J A; Hakimi, J; Ju, G
1991-01-01
Human interleukin 2 (IL-2) analogs with defined amino acid substitutions were used to identify specific residues that interact with the 55-kDa subunit (p55) or alpha chain of the human IL-2 receptor. Analog proteins containing specific substitutions for Lys-35, Arg-38, Phe-42, or Lys-43 were inactive in competitive binding assays for p55. All of these analogs retained substantial competitive binding to the intermediate-affinity p70 subunit (beta chain) of the receptor complex. The analogs varied in ability to interact with the high-affinity p55/p70 receptor. Despite the lack of binding to p55, all analogs exhibited significant biological activity, as assayed on the murine CTLL cell line. The dissociation constants of Arg-38 and Phe-42 analogs for p70 were consistent with intermediate-affinity binding; the Kd values were not significantly affected by the presence of p55 in binding to the high-affinity IL-2 receptor complex. These results confirm the importance of the B alpha-helix in IL-2 as the locus for p55-receptor binding and support a revised model of IL-2-IL-2 receptor interaction. PMID:2052547
Bhogal, Moninder S; Lanyon-Hogg, Thomas; Johnston, Katherine A; Warriner, Stuart L; Baker, Alison
2016-01-29
Peroxisomes are vital metabolic organelles found in almost all eukaryotic organisms, and they rely exclusively on import of their matrix protein content from the cytosol. In vitro import of proteins into isolated peroxisomal fractions has provided a wealth of knowledge on the import process. However, the common method of protease protection garnered no information on the import of an N-terminally truncated PEX5 (PEX5C) receptor construct or peroxisomal malate dehydrogenase 1 (pMDH1) cargo protein into sunflower peroxisomes because of high degrees of protease susceptibility or resistance, respectively. Here we present a means for analysis of in vitro import through a covalent biotin label transfer and employ this method to the import of PEX5C. Label transfer demonstrates that the PEX5C construct is monomeric under the conditions of the import assay. This technique was capable of identifying the PEX5-PEX14 interaction as the first interaction of the import process through competition experiments. Labeling of the peroxisomal protein import machinery by PEX5C demonstrated that this interaction was independent of added cargo protein, and, strikingly, the interaction between PEX5C and the import machinery was shown to be ATP-dependent. These important mechanistic insights highlight the power of label transfer in studying interactions, rather than proteins, of interest and demonstrate that this technique should be applied to future studies of peroxisomal in vitro import. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Characterization of SB-271046: A potent, selective and orally active 5-HT6 receptor antagonist
Routledge, Carol; Bromidge, Steven M; Moss, Stephen F; Price, Gary W; Hirst, Warren; Newman, Helen; Riley, Graham; Gager, Tracey; Stean, Tania; Upton, Neil; Clarke, Stephen E; Brown, Anthony M; Middlemiss, Derek N
2000-01-01
SB-271046, potently displaced [3H]-LSD and [125I]-SB-258585 from human 5-HT6 receptors recombinantly expressed in HeLa cells in vitro (pKi 8.92 and 9.09 respectively). SB-271046 also displaced [125I]-SB-258585 from human caudate putamen and rat and pig striatum membranes (pKi 8.81, 9.02 and 8.55 respectively). SB-271046 was over 200 fold selective for the 5-HT6 receptor vs 55 other receptors, binding sites and ion channels. In functional studies on human 5-HT6 receptors SB-271046 competitively antagonized 5-HT-induced stimulation of adenylyl cyclase activity with a pA2 of 8.71. SB-271046 produced an increase in seizure threshold over a wide-dose range in the rat maximal electroshock seizure threshold (MEST) test, with a minimum effective dose of ⩽0.1 mg kg−1 p.o. and maximum effect at 4 h post-dose. The level of anticonvulsant activity achieved correlated well with the blood concentrations of SB-271046 (EC50 of 0.16 μM) and brain concentrations of 0.01–0.04 μM at Cmax. These data, together with the observed anticonvulsant activity of other selective 5-HT6 receptor antagonists, SB-258510 (10 mg kg−1, 2–6 h pre-test) and Ro 04-6790 (1–30 mg kg−1, 1 h pre-test), in the rat MEST test, suggest that the anticonvulsant properties of SB-271046 are likely to be mediated by 5-HT6 receptors. Overall, these studies demonstrate that SB-271046 is a potent and selective 5-HT6 receptor antagonist and is orally active in the rat MEST test. SB-271046 represents a valuable tool for evaluating the in vivo central function of 5-HT6 receptors. PMID:10928964
Hinze, Annette Viktoria; Mayer, Peter; Harst, Anja; von Kügelgen, Ivar
2013-12-01
Adenine nucleotides acting at P2X1 receptors are potent vasoconstrictors. Recently, we demonstrated that activation of adenosine A2B receptors on human coronary smooth muscle cells inhibits cell proliferation by the induction of the nuclear receptor subfamily 4, group A, member 1 (NR4A1; alternative notation Nur77). In the present study, we searched for long-term effects mediated by P2X1 receptors by analyzing receptor-mediated changes in cell proliferation and in the expression of NR4A1. Cultured human coronary smooth muscle cells were treated with selective receptor ligands. Effects on proliferation were determined by counting cells and measuring changes in impedance. The induction of transcription factors was assessed by qPCR. The P2X receptor agonist α,β-methylene-ATP and its analog β,γ-methylene-ATP inhibited cell proliferation by about 50 % after 5 days in culture with half-maximal concentrations of 0.3 and 0.08 μM, respectively. The effects were abolished or markedly attenuated by the P2X1 receptor antagonist NF449 (carbonylbis-imino-benzene-triylbis-(carbonylimino)tetrakis-benzene-1,3-disulfonic acid; 100 nM and 1 μM). α,β-methylene-ATP and β,γ-methylene-ATP applied for 30 min to 4 h increased the expression of NR4A1; NF449 blocked or attenuated this effect. Small interfering RNA directed against NR4A1 diminished the antiproliferative effects of α,β-methylene-ATP and β,γ-methylene-ATP. α,β-methylene-ATP (0.1 to 30 μM) decreased migration of cultured human coronary smooth muscle cells in a chamber measuring changes in impedance; NF449 blocked the effect. In conclusion, our results demonstrate for the first time that adenine nucleotides acting at P2X1 receptors inhibit the proliferation of human coronary smooth muscle cells via the induction of the early gene NR4A1.
Functional Properties of Five Dictyostelium discoideum P2X Receptors*
Baines, Abigail; Parkinson, Katie; Sim, Joan A.; Bragg, Laricia; Thompson, Christopher R. L.; North, R. Alan
2013-01-01
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors. PMID:23740252
Functional properties of five Dictyostelium discoideum P2X receptors.
Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan
2013-07-19
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.
ATM Functions at the Peroxisome to Induce Pexophagy in Response to ROS
Alexander, Angela; Kim, Jinhee; Powell, Reid T.; Dere, Ruhee; Tait-Mulder, Jacqueline; Lee, Ji-Hoon; Paull, Tanya T.; Pandita, Raj K.; Charaka, Vijaya K.; Pandita, Tej K.; Kastan, Michael B.; Walker, Cheryl Lyn
2015-01-01
Peroxisomes are highly metabolic, autonomously replicating organelles that generate ROS as a by product of fatty acid β-oxidation. Consequently, cells must maintain peroxisome homeostasis, or risk pathologies associated with too few peroxisomes, such as peroxisome biogenesis disorders, or too many peroxisomes, inducing oxidative damage and promoting diseases such as cancer. We report that the PEX5 peroxisome import receptor binds ataxia-telangiectasia mutated (ATM) and localizes this kinase to the peroxisome. In response to reactive oxygen species (ROS), ATM signaling activates ULK1 and inhibits mTORC1 to induce autophagy. Specificity for autophagy of peroxisomes (pexophagy) is provided by ATM phosphorylation of PEX5 at Ser141, which promotes PEX5 mono-ubiquitination at K209, and recognition of ubiquitinated PEX5 by the autophagy adapter protein p62, directing the autophagosome to peroxisomes to induce pexophagy. These data reveal an important new role for ATM in metabolism as a sensor of ROS that regulates pexophagy. PMID:26344566
Translating 5-HT receptor pharmacology.
Sanger, G J
2009-12-01
Since metoclopramide was first described (in 1964) there have been several attempts to develop compounds which retained gastrointestinal prokinetic activity (via 5-HT(4) receptor activation) but without the limiting side effects associated with dopamine D(2) receptor antagonism. Early compounds (mosapride, cisapride, renzapride, tegaserod) were identified before several of the 5-HT receptors were even described (including 5-HT(4) and 5-HT(2B)), whereas prucalopride came later. Several compounds were hampered by non-selectivity, introducing cardiac liability (cisapride: activity at human Ether-a-go-go Related Gene) or potentially, a reduced intestinal prokinetic activity caused by activity at a second 5-HT receptor (renzapride: antagonism at the 5-HT(3) receptor; tegaserod: antagonism at the 5-HT(2B) receptor). Poor intrinsic activity at gastrointestinal 5-HT(4) receptors has also been an issue (mosapride, tegaserod). Perhaps prucalopride has now achieved the profile of good selectivity of action and high intrinsic activity at intestinal 5-HT(4) receptors, without clinically-meaningful actions on 5-HT(4) receptors in the heart. The progress of this compound for treatment of chronic constipation, as well as competitor molecules such as ATI-7505 and TD-5108, will now be followed with interest as each attempts to differentiate themselves from each other. Perhaps at last, 5-HT(4) receptor agonists are being given the chance to show what they can do.
An effector of the Irish potato famine pathogen antagonizes a host autophagy cargo receptor
Dagdas, Yasin F; Belhaj, Khaoula; Maqbool, Abbas; Chaparro-Garcia, Angela; Pandey, Pooja; Petre, Benjamin; Tabassum, Nadra; Cruz-Mireles, Neftaly; Hughes, Richard K; Sklenar, Jan; Win, Joe; Menke, Frank; Findlay, Kim; Banfield, Mark J; Kamoun, Sophien; Bozkurt, Tolga O
2016-01-01
Plants use autophagy to safeguard against infectious diseases. However, how plant pathogens interfere with autophagy-related processes is unknown. Here, we show that PexRD54, an effector from the Irish potato famine pathogen Phytophthora infestans, binds host autophagy protein ATG8CL to stimulate autophagosome formation. PexRD54 depletes the autophagy cargo receptor Joka2 out of ATG8CL complexes and interferes with Joka2's positive effect on pathogen defense. Thus, a plant pathogen effector has evolved to antagonize a host autophagy cargo receptor to counteract host defenses. DOI: http://dx.doi.org/10.7554/eLife.10856.001 PMID:26765567
Gotzes, F; Balfanz, S; Baumann, A
1994-01-01
Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.
Agonists and antagonists for P2 receptors
Jacobson, Kenneth A.; Costanzi, Stefano; Joshi, Bhalchandra V.; Besada, Pedro; Shin, Dae Hong; Ko, Hyojin; Ivanov, Andrei A.; Mamedova, Liaman
2015-01-01
Recent work has identified nucleotide agonists selective for P2Y1, P2Y2 and P2Y6 receptors and nucleotide antagonists selective for P2Y1, P2Y12 and P2X1 receptors. Selective non-nucleotide antagonists have been reported for P2Y1, P2Y2, P2Y6, P2Y12, P2Y13, P2X2/3/P2X3 and P2X7 receptors. For example, the dinucleotide INS 37217 (Up4dC) potently activates the P2Y2 receptor, and the non-nucleotide antagonist A-317491 is selective for P2X2/3/P2X3 receptors. Nucleotide analogues in which the ribose moiety is substituted by a variety of novel ring systems, including conformation-ally locked moieties, have been synthesized as ligands for P2Y receptors. The focus on conformational factors of the ribose-like moiety allows the inclusion of general modifications that lead to enhanced potency and selectivity. At P2Y1,2,4,11 receptors, there is a preference for the North conformation as indicated with (N)-methanocarba analogues. The P2Y1 antagonist MRS2500 inhibited ADP-induced human platelet aggregation with an IC50 of 0.95 nM. MRS2365, an (N)-methanocarba analogue of 2-MeSADP, displayed potency (EC50) of 0.4 nM at the P2Y1 receptor, with >10 000-fold selectivity in comparison to P2Y12 and P2Y13 receptors. At P2Y6 receptors there is a dramatic preference for the South conformation. Three-dimensional structures of P2Y receptors have been deduced from structure activity relationships (SAR), mutagenesis and modelling studies. Detailed three-dimensional structures of P2X receptors have not yet been proposed. PMID:16805423
The Joint Astrophysical Plasmadynamic Experiment (J-PEX): a high-resolution rocket spectrometer
NASA Astrophysics Data System (ADS)
Barstow, Martin A.; Bannister, Nigel P.; Cruddace, Raymond G.; Kowalski, Michael P.; Wood, Kent S.; Yentis, Daryl J.; Gursky, Herbert; Barbee, Troy W., Jr.; Goldstein, William H.; Kordas, Joseph F.; Fritz, Gilbert G.; Culhane, J. Leonard; Lapington, Jonathan S.
2003-02-01
We report on the successful sounding rocket flight of the high resolution (R=3000-4000) J-PEX EUV spectrometer. J-PEX is a novel normal incidence instrument, which combines the focusing and dispersive elements of the spectrometer into a single optical element, a multilayer-coated grating. The high spectral resolution achieved has had to be matched by unprecedented high spatial resolution in the imaging microchannel plate detector used to record the data. We illustrate the performance of the complete instrument through an analysis of the 220-245Å spectrum of the white dwarf G191-B2B obtained with a 300 second exposure. The high resolution allows us to detect a low-density ionized helium component along the line of sight to the star and individual absorption lines from heavier elements in the photosphere.
Armour, S L; Foord, S; Kenakin, T; Chen, W J
1999-12-01
Receptor-activity-modifying proteins (RAMPs) are a family of single transmembrane domain proteins shown to be important for the transport and ligand specificity of the calcitonin gene-related peptide (CGRP) receptor. In this report, we describe the analysis of pharmacological properties of the human calcitonin receptor (hCTR) coexpressed with different RAMPs with the use of the Xenopus laevis melanophore expression system. We show that coexpression of RAMP3 with human calcitonin receptor changed the relative potency of hCTR to human calcitonin (hCAL) and rat amylin. RAMP1 and RAMP2, in contrast, had little effect on the change of hCTR potency to hCAL or rat amylin. When coexpressed with RAMP3, hCTR reversed the relative potency by a 3.5-fold loss in sensitivity to hCAL and a 19-fold increase in sensitivity to rat amylin. AC66, an inverse agonist, produced apparent simple competitive antagonism of hCAL and rat amylin, as indicated by linear Schild regressions. The potency of AC66 was changed in the blockade of rat amylin but not hCAL responses with RAMP3 coexpression. The mean pK(B) for AC66 to hCAL was 9.4 +/- 0.3 without RAMP3 and 9.45 +/- 0.07 with RAMP3. For the antagonism of AC66 to rat amylin, the pK(B) was 9.25 +/- 0.15 without RAMP3 and 8.2 +/- 0.35 with RAMP3. The finding suggests that RAMP3 might modify the active states of calcitonin receptor in such a way as to create a new receptor phenotype that is "amylin-like." Irrespective of the physiological association of the new receptor species, the finding that a coexpressed membrane protein can completely change agonist and antagonist affinities for a receptor raises implications for screening in recombinant receptor systems.
Martin, G R; Robertson, A D; MacLennan, S J; Prentice, D J; Barrett, V J; Buckingham, J; Honey, A C; Giles, H; Moncada, S
1997-05-01
1. 311C90 (zolmitriptan zomig: (S)-4[[3-[2-(dimethylamino)ethyl]-1H-indol-5-yl]methyl]-2-oxazolidinone) is a novel 5-HT1B/1D receptor agonist with proven efficacy in the acute treatment of migraine. Here, we describe the receptor specificity of the drug and its actions on trigeminal-evoked plasma protein extravasation into the dura mater of the anaesthetized guinea-pig. 2. At the "5-HT1B-like' receptor mediating vascular contraction (rabbit saphenous vein), the compound was a potent (p[A50] = 6.79 +/- 0.06) partial agonist achieving 77 +/- 4% of the maximum effect to 5-hydroxytryptamine (5-HT). In the same experiments, sumatriptan (p[A50] = 6.48 +/- 0.04) was half as potent as 311C90 and produced 97 +/- 2% of the 5-HT maximum effect. Studies in which receptor inactivation methods were used to estimate the affinity (pKA) and efficacy relative to 5-HT (tau rel) for each agonist confirmed that 311C90 exhibits higher affinity than sumatriptan (pKA = 6.63 +/- 0.04 and 6.16 +/- 0.03, respectively) and that both drugs are partial agonists relative to 5-HT (tau rel = 0.61 +/- 0.03 and 0.63 +/- 0.10, respectively, compared to 5-HT = 1.0). 3. Consistent with its effects in rabbit saphenous vein, 311C90 also produced concentration-dependent contractions of primate basilar artery and human epicardial coronary artery rings. In basilar artery, agonist potency (p[A50] = 6.92 +/- 0.07) was similar to that demonstrated in rabbit saphenous vein, again being 2-3 fold higher than for sumatriptan (p[A50] = 6.46 +/- 0.03). Both agonists produced about 50% of the maximum response obtained with 5-HT in the same preparations. In rings of human coronary artery, the absolute potency of 311C90 and sumatriptan was higher than in primate basilar artery (p[A50] = 7.3 +/- 0.1 and 6.7 +/- 0.1, respectively), but maximum effects relative to 5-HT were lower (37 +/- 8% and 35 +/- 7%, respectively). In both types of vessel, the inability of 5-HT1B/1D agonists to achieve the same maximum as the
Bhattarai, Yogesh; Schmidt, Bradley A; Linden, David R; Larson, Eric D; Grover, Madhusudan; Beyder, Arthur; Farrugia, Gianrico; Kashyap, Purna C
2017-07-01
Serotonin [5-hydroxytryptamine (5-HT)], an important neurotransmitter and a paracrine messenger in the gastrointestinal tract, regulates intestinal secretion by its action primarily on 5-HT 3 and 5-HT 4 receptors. Recent studies highlight the role of gut microbiota in 5-HT biosynthesis. In this study, we determine whether human-derived gut microbiota affects host secretory response to 5-HT and 5-HT receptor expression. We used proximal colonic mucosa-submucosa preparation from age-matched Swiss Webster germ-free (GF) and humanized (HM; ex-GF colonized with human gut microbiota) mice. 5-HT evoked a significantly greater increase in short-circuit current (Δ I sc ) in GF compared with HM mice. Additionally, 5-HT 3 receptor mRNA and protein expression was significantly higher in GF compared with HM mice. Ondansetron, a 5-HT 3 receptor antagonist, inhibited 5-HT-evoked Δ I sc in GF mice but not in HM mice. Furthermore, a 5-HT 3 receptor-selective agonist, 2-methyl-5-hydroxytryptamine hydrochloride, evoked a significantly higher Δ I sc in GF compared with HM mice. Immunohistochemistry in 5-HT 3A -green fluorescent protein mice localized 5-HT 3 receptor expression to enterochromaffin cells in addition to nerve fibers. The significant difference in 5-HT-evoked Δ I sc between GF and HM mice persisted in the presence of tetrodotoxin (TTX) but was lost after ondansetron application in the presence of TTX. Application of acetate (10 mM) significantly lowered 5-HT 3 receptor mRNA in GF mouse colonoids. We conclude that host secretory response to 5-HT may be modulated by gut microbiota regulation of 5-HT 3 receptor expression via acetate production. Epithelial 5-HT 3 receptor may function as a mediator of gut microbiota-driven change in intestinal secretion. NEW & NOTEWORTHY We found that gut microbiota alters serotonin (5-HT)-evoked intestinal secretion in a 5-HT 3 receptor-dependent mechanism and gut microbiota metabolite acetate alters 5-HT 3 receptor expression in
Rydzanicz, Małgorzata; Stradomska, Teresa Joanna; Jurkiewicz, Elżbieta; Jamroz, Ewa; Gasperowicz, Piotr; Kostrzewa, Grażyna; Płoski, Rafał; Tylki-Szymańska, Anna
2017-11-01
Zellweger syndrome (ZS) is a consequence of a peroxisome biogenesis disorder (PBD) caused by the presence of a pathogenic mutation in one of the 13 genes from the PEX family. ZS is a severe multisystem condition characterized by neonatal appearance of symptoms and a shorter life. Here, we report a case of ZS with a mild phenotype, due to a novel PEX6 gene mutation. The patient presented subtle craniofacial dysmorphic features and slightly slower psychomotor development. At the age of 2 years, he was diagnosed with adrenal insufficiency, hypoacusis, and general deterioration. Magnetic resonance imaging showed a symmetrical hyperintense signal in the frontal and parietal white matter. Biochemical tests showed elevated liver transaminases, elevated serum very long chain fatty acids, and phytanic acid. After the death of the child at the age of 6 years, molecular diagnostics were continued in order to provide genetic counseling for his parents. Next generation sequencing (NGS) analysis with the TruSight One™ Sequencing Panel revealed a novel homozygous PEX6 p.Ala94Pro mutation. In silico prediction of variant severity suggested its possible benign effect. To conclude, in the milder phenotypes, adrenal insufficiency, hypoacusis, and leukodystrophy together seem to be pathognomonic for ZS.
Molecular Recognition at Purine and Pyrimidine Nucleotide (P2) Receptors
Jacobson, Kenneth A.; Constanzi, Stefano; Ohno, Michihiro; Joshi, Bhalchandra V.; Besada, Pedro; Xu, Bin; Tchilibon, Susanna
2015-01-01
In comparison to other classes of cell surface receptors, the medicinal chemistry at P2X (ligand-gated ion channels) and P2Y (G protein-coupled) nucleotide receptors has been relatively slow to develop. Recent effort to design selective agonists and antagonists based on a combination of library screening, empirical modification of known ligands, and rational design have led to the introduction of potent antagonists of the P2X1 (derivatives of pyridoxal phosphates and suramin), P2X3 (A-317491), P2X7 (derivatives of the isoquinoline KN-62), P2Y1 (nucleotide analogues MRS 2179 and MRS 2279), P2Y2 (thiouracil derivatives such as AR-C126313), and P2Y12 (nucleotide/nucleoside analogues AR-C69931X and AZD6140) receptors. A variety of native agonist ligands (ATP, ADP, UTP, UDP, and UDP-glucose) are currently the subject of structural modification efforts to improve selectivity. MRS2365 is a selective agonist for P2Y1 receptors. The dinucleotide INS 37217 potently activates the P2Y2 receptor. UTP-γ-S and UDP-β-S are selective agonists for P2Y2/P2Y4 and P2Y6 receptors, respectively. The current knowledge of the structures of P2X and P2Y receptors, is derived mainly from mutagenesis studies. Site-directed mutagenesis has shown that ligand recognition in the human P2Y1 receptor involves individual residues of both the TMs (3, 5, 6, and 7), as well as EL 2 and 3. The binding of the negatively-charged phosphate moiety is dependent on positively charged lysine and arginine residues near the exofacial side of TMs 3 and 7. PMID:15078212
Poujade, C; Lavielle, S; Torrens, Y; Beaujouan, J C; Glowinski, J; Marquet, A
1984-09-01
Glycosylated analogues of the C-terminal heptapeptide of substance P either free or blocked on the N-terminal glutamine were synthesized in order to develop a metabolically stable peptide that would have an increased specificity for one type of receptor. Of the analogue described, (N-alpha-Boc-beta-D-Glc-p (1----5) Gln) -Gln-Phe-Phe-Gly-Leu-Met-NH2 is highly resistant to degradation on exposure to rat hypothalamic slices. This glycosylated peptide is about one third as potent as substance P in eliciting contractions of the guinea-pig ileum and is almost devoided of affinity for the 125I-Bolton Hunter-SP specific binding sites on rat brain synaptosomes.
Human GH Receptor-IGF-1 Receptor Interaction: Implications for GH Signaling
Gan, Yujun; Buckels, Ashiya; Liu, Ying; Zhang, Yue; Paterson, Andrew J.; Jiang, Jing; Zinn, Kurt R.
2014-01-01
GH signaling yields multiple anabolic and metabolic effects. GH binds the transmembrane GH receptor (GHR) to activate the intracellular GHR-associated tyrosine kinase, Janus kinase 2 (JAK2), and downstream signals, including signal transducer and activator of transcription 5 (STAT5) activation and IGF-1 gene expression. Some GH effects are partly mediated by GH-induced IGF-1 via IGF-1 receptor (IGF-1R), a tyrosine kinase receptor. We previously demonstrated in non-human cells that GH causes formation of a GHR-JAK2-IGF-1R complex and that presence of IGF-1R (even without IGF-1 binding) augments proximal GH signaling. In this study, we use human LNCaP prostate cancer cells as a model system to further study the IGF-1R's role in GH signaling. GH promoted JAK2 and GHR tyrosine phosphorylation and STAT5 activation in LNCaP cells. By coimmunoprecipitation and a new split luciferase complementation assay, we find that GH augments GHR/IGF-1R complex formation, which is inhibited by a Fab of an antagonistic anti-GHR monoclonal antibody. Short hairpin RNA-mediated IGF-1R silencing in LNCaP cells reduced GH-induced GHR, JAK2, and STAT5 phosphorylation. Similarly, a soluble IGF-1R extracellular domain fragment (sol IGF-1R) interacts with GHR in response to GH and blunts GH signaling. Sol IGF-1R also markedly inhibits GH-induced IGF-1 gene expression in both LNCaP cells and mouse primary osteoblast cells. On the basis of these and other findings, we propose a model in which IGF-1R augments GH signaling by allowing a putative IGF-1R-associated molecule that regulates GH signaling to access the activated GHR/JAK2 complex and envision sol IGF-1R as a dominant-negative inhibitor of this IGF-1R-mediated augmentation. Physiological implications of this new model are discussed. PMID:25211187
Cucchi, Paola; Meini, Stefania; Bressan, Alessandro; Catalani, Claudio; Bellucci, Francesca; Santicioli, Paolo; Lecci, Alessandro; Faiella, Angela; Rotondaro, Luigi; Giuliani, Sandro; Giolitti, Alessandro; Quartara, Laura; Maggi, Carlo Alberto
2005-12-28
The pharmacological characterization of the novel nonpeptide antagonist for the B2 receptor, namely MEN16132 (4-(S)-Amino-5-(4-{4-[2,4-dichloro-3-(2,4-dimethyl-8-quinolyloxymethyl)phenylsulfonamido]-tetrahydro-2H-4-pyranylcarbonyl}piperazino)-5-oxopentyl](trimethyl)ammonium chloride hydrochloride) is presented. The affinity of MEN16132 for the bradykinin B2 receptor has been investigated by means of competition studies at [3H]bradykinin binding to membranes prepared from Chinese Hamster Ovary (CHO) cells expressing the human bradykinin B2 receptor (pKi 10.5), human lung fibroblasts (pKi 10.5), guinea pig airways (pKi 10.0), guinea pig ileum longitudinal smooth muscle (pKi 10.2), or guinea pig cultured colonic myocytes (pKi 10.3). In all assays MEN16132 was as potent as the peptide antagonist Icatibant, and from 3- to 100-fold more potent than the reference nonpeptide antagonists FR173657 or LF16-0687. The selectivity for the bradykinin B2 receptor was checked at the human bradykinin B1 receptor (pKi<5), and at a panel of 26 different receptors and channels. The antagonist potency was measured in functional assays, i.e., in blocking the bradykinin induced inositolphosphates (IP) accumulation at the human (CHO: pKB 10.3) and guinea pig (colonic myocytes: pKB 10.3) B2 receptor, or in antagonizing the bradykinin induced contractile responses in human (detrusor smooth muscle: pKB 9.9) and guinea pig (ileum longitudinal smooth muscle: pKB 10.1) tissues. In both functional assay types MEN16132 exerted a different antagonist pattern, i.e., surmountable at the human and insurmountable at the guinea pig bradykinin B2 receptors. Moreover, the receptor determinants important for the high affinity interaction of MEN16132 with the human bradykinin B2 receptor were investigated by means of radioligand binding studies performed at 24 point-mutated receptors. The results obtained revealed that residues in transmembrane segment 2 (W86A), 3 (I110A), 6 (W256A), and 7 (Y295A, Y295F but
Poblete, Horacio; Oyarzún, Ingrid; Olivero, Pablo; Comer, Jeffrey; Zuñiga, Matías; Sepulveda, Romina V.; Báez-Nieto, David; González Leon, Carlos; González-Nilo, Fernando; Latorre, Ramón
2015-01-01
Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) has been recognized as an important activator of certain transient receptor potential (TRP) channels. More specifically, TRPV1 is a pain receptor activated by a wide range of stimuli. However, whether or not PI(4,5)P2 is a TRPV1 agonist remains open to debate. Utilizing a combined approach of mutagenesis and molecular modeling, we identified a PI(4,5)P2 binding site located between the TRP box and the S4-S5 linker. At this site, PI(4,5)P2 interacts with the amino acid residues Arg-575 and Arg-579 in the S4-S5 linker and with Lys-694 in the TRP box. We confirmed that PI(4,5)P2 behaves as a channel agonist and found that Arg-575, Arg-579, and Lys-694 mutations to alanine reduce PI(4,5)P2 binding affinity. Additionally, in silico mutations R575A, R579A, and K694A showed that the reduction in binding affinity results from the delocalization of PI(4,5)P2 in the binding pocket. Molecular dynamics simulations indicate that PI(4,5)P2 binding induces conformational rearrangements of the structure formed by S6 and the TRP domain, which cause an opening of the lower TRPV1 channel gate. PMID:25425643
Localization of P2X receptor subtypes 2, 3 and 7 in human urinary bladder.
Svennersten, Karl; Hallén-Grufman, Katarina; de Verdier, Petra J; Wiklund, N Peter; Poljakovic, Mirjana
2015-08-08
Voiding dysfunctions are a common problem that has a severe negative impact on the quality of life. Today there is a need for new drug targets for these conditions. The role of ATP receptors in bladder physiology has been studied for some time, primarily in animal models. The aim of this work is to investigate the localization of the ATP receptors P2X2, P2X3 and P2X7 and their colocalization with vimentin and actin in the human urinary bladder. Immunohistochemical analysis was conducted on full-thickness bladder tissues from fundus and trigonum collected from 15 patients undergoing open radical cystectomy due to chronic cystitis, bladder cancer or locally advanced prostate cancer. Colocalization analyses were performed between the three different P2X subtypes and the structural proteins vimentin and actin. Specimens were examined using epifluorescence microscopy and correlation coefficients were calculated for each costaining as well as the mean distance from the laminin positive basal side of the urothelium to the vimentin positive cells located in the suburothelium. P2X2 was expressed in vimentin positive cells located in the suburothelium. Less distinct labelling of P2X2 was also observed in actin positive smooth muscle cells and in the urothelium. P2X3 was expressed in vimentin positive cells surrounding the smooth muscle, and in vimentin positive cells located in the suburothelium. Weaker P2X3 labelling was seen in the urothelium. P2X7 was expressed in the smooth muscle cells and the urothelium. In the suburothelium, cells double positive for P2X2 and vimentin where located closer to the urothelium while cells double positive for P2X3 and vimentin where located further from the urothelium. The results from this study demonstrate that there is a significant difference in the expression of the purinergic P2X2, P2X3 and P2X7 receptors in the different histological layers of the human urinary bladder.
Castro, L Filipe C; Lobo-da-Cunha, Alexandre; Rocha, Maria J; Urbatzka, Ralph; Rocha, Eduardo
2013-01-01
A negative correlation between female gonadal maturation kinetics and size variations of hepatic peroxisomes was earlier documented in brown trout, as a probable impact of serum estrogen changes during the reproductive cycle. Herein, we investigated whether the organelle volume/surface dynamics seen in female brown trout liver peroxisomes - without numerical changes within each hepatocyte - is followed by variations in the expression of the membrane peroxisome protein Pex11α gene. For comparison, we also studied males. We find in females a seasonal variation with the highest Pex11α expression in February, which was statistically different from all other tested periods. Overall, the expression of PEX11α had over a fivefold decrease from February to September. This period coincides with the reproductive transition between the earlier post-spawning gonadal remodeling and preparatory staging and the pre-spawning period. Males did not show changes. Our approach allowed the first characterization of a peroxin gene in a teleost, the Pex11α, while offering a correlation scenario were, as we hypothesized, the peroxisomal size kinetics is paralleled by membrane-related gene alterations (measured herein as proxy of Pex11α gene expression). Our data support and expand previous results on the regulation, function and morphology of peroxisome dynamics in brown trout, with a broader interest. Copyright © 2012 Elsevier Inc. All rights reserved.
O’Keeffe, Mary G.; Thorne, Peter R.; Housley, Gary D.; Robson, Simon C.
2010-01-01
Membrane-bound ectonucleoside triphosphate diphosphohydrolases (E-NTPDases) in the inner ear regulate complex extracellular purinergic type-2 (P2) receptor signalling pathways through hydrolysis of extracellular nucleoside 5′-triphosphates and diphosphates. This study investigated the distribution of NTPDase5 and NTPDase6, two intracellular members of the E-NTPDase family, and linked this to regulation of P2 receptor signalling in the adult rat cochlea. These extracellular ectonucleotidases preferentially hydrolyse nucleoside 5′-diphosphates such as UDP and GDP. Expression of both enzymes at mRNA and protein level was detected in cochlear tissues and there was in vivo release of soluble NTPDase5 and 6 into cochlear fluids. Strong NTPDase5 immunostaining was found in the spiral ganglion neurones and supporting Deiters’ cells of the organ of Corti, while NTPDase6 was confined to the inner hair cells. Upregulation of NTPDase5 after exposure to loud sound indicates a dynamic role for NTPDase5 in cochlear response to stress, whereas NTPDase6 may have more limited extracellular roles. Noise-induced upregulation of co-localised UDP-preferring P2Y6 receptors in the spiral ganglion neurons further supports the involvement of NTPDase5 in regulation of P2Y receptor signalling. Noise stress also induced P2Y14 (UDP- and UDP-glucose preferring) receptor expression in the root processes of the outer sulcus cells, but this was not associated with localization of the E-NTPDases. PMID:20806016
Primitive ATP-activated P2X receptors: discovery, function and pharmacology
Fountain, Samuel J.
2013-01-01
Adenosine 5-triphosphate (ATP) is omnipresent in biology. It is therefore no surprise that organisms have evolved multifaceted roles for ATP, exploiting its abundance and restriction of passive diffusion across biological membranes. A striking role is the emergence of ATP as a bona fide transmitter molecule, whereby the movement of ATP across membranes serves as a chemical message through a direct ligand-receptor interaction. P2X receptors are ligand-gated ion channels that mediate fast responses to the transmitter ATP in mammalian cells including central and sensory neurons, vascular smooth muscle, endothelium, and leukocytes. Molecular cloning of P2X receptors and our understanding of structure-function relationships has provided sequence information with which to query an exponentially expanding wealth of genome sequence information including protist, early animal and human pathogen genomes. P2X receptors have now been cloned and characterized from a number of simple organisms. Such work has led to surprising new cellular roles for the P2X receptors family and an unusual phylogeny, with organisms such as Drosophila and C. elegans notably lacking P2X receptors despite retaining ionotropic receptors for other common transmitters that are present in mammals. This review will summarize current work on the evolutionary biology of P2X receptors and ATP as a signaling molecule, discuss what can be drawn from such studies when considering the action of ATP in higher animals and plants, and outline how simple organisms may be exploited experimentally to inform P2X receptor function in a wider context. PMID:24367292
Mori, Masayuki X; Itsuki, Kyohei; Hase, Hideharu; Sawamura, Seishiro; Kurokawa, Tatsuki; Mori, Yasuo; Inoue, Ryuji
2015-01-01
Transient receptor potential canonical (TRPC) channels are Ca(2+)-permeable, nonselective cation channels that carry receptor-operated Ca(2+) currents (ROCs) triggered by receptor-induced, phospholipase C (PLC)-catalyzed hydrolysis of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2]. Within the vasculature, TRPC channel ROCs contribute to smooth muscle cell depolarization, vasoconstriction, and vascular remodeling. However, TRPC channel ROCs exhibit a variable response to receptor-stimulation, and the regulatory mechanisms governing TRPC channel activity remain obscure. The variability of ROCs may be explained by their complex regulation by PI(4,5)P2 and its metabolites, which differentially affect TRPC channel activity. To resolve the complex regulation of ROCs, the use of voltage-sensing phosphoinositide phosphatases and model simulation have helped to reveal the time-dependent contribution of PI(4,5)P2 and the possible role of PI(4,5)P2 in the regulation of ROCs. These approaches may provide unprecedented insight into the dynamics of PI(4,5)P2 regulation of TRPC channels and the fundamental mechanisms underlying transmembrane ion flow. Within that context, we summarize the regulation of TRPC channels and their coupling to receptor-mediated signaling, as well as the application of voltage-sensing phosphoinositide phosphatases to this research. We also discuss the controversial bidirectional effects of PI(4,5)P2 using a model simulation that could explain the complicated effects of PI(4,5)P2 on different ROCs.
Gilbert, T L; Bennett, T A; Maestas, D C; Cimino, D F; Prossnitz, E R
2001-03-27
After stimulation by ligand, most G protein-coupled receptors (GPCRs) undergo rapid phosphorylation, followed by desensitization and internalization. In the case of the N-formyl peptide receptor (FPR), these latter two processing steps have been shown to be entirely dependent on phosphorylation of the receptor's carboxy terminus. We have previously demonstrated that FPR internalization can occur in the absence of receptor desensitization, indicating that FPR desensitization and internalization are regulated differentially. In this study, we have investigated whether human chemoattractant receptors internalize via clathrin-coated pits. Internalization of the FPR transiently expressed in HEK 293 cells was shown to be dependent upon receptor phosphorylation. Despite this, internalization of the FPR, as well as the C5a receptor, was demonstrated to be independent of the actions of arrestin, dynamin, and clathrin. In addition, we utilized fluorescence microscopy to visualize the FPR and beta(2)-adrenergic receptor as they internalized in the same cell, revealing distinct sites of internalization. Last, we found that a nonphosphorylatable mutant of the FPR, unable to internalize, was competent to activate p44/42 MAP kinase. Together, these results demonstrate not only that the FPR internalizes via an arrestin-, dynamin-, and clathrin-independent pathway but also that signal transduction to MAP kinases occurs in an internalization-independent manner.
Katugampola, Sidath D; Davenport, Anthony P
2001-01-01
The aim of this study was to establish how thromboxane receptors (TP) respond to the increase in levels of plasma thromboxane observed in both cardiac (cardiomyopathy, ischaemic heart disease and pulmonary hypertension) and vascular disease (atherosclerosis of coronary artery disease and accelerated atherosclerosis of saphenous vein grafts).The agonist radioligand [125I]-BOP, bound rapidly to TP receptors in normal human cardiovascular tissue, displaying high affinity in left ventricle (KD 0.23±0.06 nM, Bmax 28.4±5.7 fmol mg−1 protein) and reversibility with a t1/2 of 10 min (n=five individuals±s.e.mean).In the heart, TP receptor density in the right ventricle of primary pulmonary hypertensive patients were significantly increased (66.6±6 fmol mg−1 protein) compared to non-diseased right ventricle (37.9±4.1 fmol mg−1 protein, n=six individuals±s.e.mean, P<0.05).In diseased vessels, TP receptor densities were significantly increased (3 fold in the intimal layer) in atherosclerotic coronary arteries, saphenous vein grafts with severe intimal thickening (n=8 – 12 individuals, P<0.05) and aortic tissue (n=5 – 6 individuals, P<0.05), compared with normal vessels.Losartan, tested at therapeutic doses, competed for [125I]-BOP binding to human vascular tissue, suggesting that some of the anti-hypertensive effects of this AT1 receptor antagonist could also be mediated by blocking human TP receptors.The differential distribution of TP receptors in the human cardiovascular system and the alteration of receptor density, accompanying the increase in endogenous thromboxane levels in cardiovascular disease, suggest that TP receptors represent a significant target for therapeutic interventions and highlights the importance for the development of novel selective antagonist for use in humans. PMID:11724743
Smooth muscle neurokinin-2 receptors mediate contraction in human saphenous veins.
Mechiche, Hakima; Grassin-Delyle, Stanislas; Pinto, Francisco M; Buenestado, Amparo; Candenas, Luz; Devillier, Philippe
2011-05-01
Substance P (SP) and neurokinin A (NKA) are members of the tachykinin peptides family. SP causes endothelial-dependant relaxation but the contractile response to tachykinins in human vessels remains unknown. The objective was to assess the expression and the contractile effects of tachykinins and their receptors in human saphenous veins (SV). Tachykinin expression was assessed with RT-PCR, tachykinin receptors expression with RT-PCR and immunohistochemistry, and functional studies were performed in organ bath. Transcripts of all tachykinin and tachykinin receptor genes were found in SV. NK(1)-receptors were localized in both endothelial and smooth muscle layers of undistended SV, whereas they were only found in smooth muscle layers of varicose SV. The expression of NK(2)- and NK(3)-receptors was limited to the smooth muscle in both preparations. NKA induced concentration-dependent contractions in about half the varicose SV. Maximum effect reached 27.6±5.5% of 90 mM KCl and the pD(2) value was 7.3±0.2. NKA also induced the contraction of undistended veins from bypass and did not cause the relaxation of these vessels after precontraction. The NK(2)-receptor antagonist SR48968 abolished the contraction induced by NKA, and a rapid desensitization of the NK(2)-receptor was observed. In varicose SV, the agonists specific to NK(1)- or NK(3)-receptors did not cause either contraction or relaxation. The stimulation of smooth muscle NK(2)-receptors can induce the contraction of human SV. As SV is richly innervated, tachykinins may participate in the regulation of the tone in this portion of the low pressure vascular system. Copyright © 2011 Elsevier Ltd. All rights reserved.
Mukhin, Y V; Garnovskaya, M N; Collinsworth, G; Grewal, J S; Pendergrass, D; Nagai, T; Pinckney, S; Greene, E L; Raymond, J R
2000-01-01
The hypothesis of this work is that the 'serotonin' or 5-hydroxytryptamine (5-HT)(1A) receptor, which activates the extracellular signal-regulated kinase (ERK) through a G(i)betagamma-mediated pathway, does so through the intermediate actions of reactive oxygen species (ROS). Five criteria were shown to support a key role for ROS in the activation of ERK by the 5-HT(1A) receptor. (1) Antioxidants inhibit activation of ERK by 5-HT. (2) Application of cysteine-reactive oxidant molecules activates ERK. (3) The 5-HT(1A) receptor alters cellular redox properties, and generates both superoxide and hydrogen peroxide. (4) A specific ROS-producing enzyme [NAD(P)H oxidase] is involved in the activation of ERK. (5) There is specificity both in the effects of various chemical oxidizers, and in the putative location of the ROS in the ERK activation pathway. We propose that NAD(P)H oxidase is located in the ERK activation pathway stimulated by the transfected 5-HT(1A) receptor in Chinese hamster ovary (CHO) cells downstream of G(i)betagamma subunits and upstream of or at the level of the non-receptor tyrosine kinase, Src. Moreover, these experiments provide confirmation that the transfected human 5-HT(1A) receptor induces the production of ROS (superoxide and hydrogen peroxide) in CHO cells, and support the possibility that an NAD(P)H oxidase-like enzyme might be involved in the 5-HT-mediated generation of both superoxide and hydrogen peroxide. PMID:10727402
Peeters, Annelies; Fraisl, Peter; van den Berg, Sjoerd; Ver Loren van Themaat, Emiel; Van Kampen, Antoine; Rider, Mark H.; Takemori, Hiroshi; van Dijk, Ko Willems; Van Veldhoven, Paul P.; Carmeliet, Peter; Baes, Myriam
2011-01-01
Hepatic peroxisomes are essential for lipid conversions that include the formation of mature conjugated bile acids, the degradation of branched chain fatty acids, and the synthesis of docosahexaenoic acid. Through unresolved mechanisms, deletion of functional peroxisomes from mouse hepatocytes (L-Pex5−/− mice) causes severe structural and functional abnormalities at the inner mitochondrial membrane. We now demonstrate that the peroxisomal and mitochondrial anomalies trigger energy deficits, as shown by increased AMP/ATP and decreased NAD+/NADH ratios. This causes suppression of gluconeogenesis and glycogen synthesis and up-regulation of glycolysis. As a consequence, L-Pex5−/− mice combust more carbohydrates resulting in lower body weights despite increased food intake. The perturbation of carbohydrate metabolism does not require a long term adaptation to the absence of functional peroxisomes as similar metabolic changes were also rapidly induced by acute elimination of Pex5 via adenoviral administration of Cre. Despite its marked activation, peroxisome proliferator-activated receptor α (PPARα) was not causally involved in these metabolic perturbations, because all abnormalities still manifested when peroxisomes were eliminated in a peroxisome proliferator-activated receptor α null background. Instead, AMP-activated kinase activation was responsible for the down-regulation of glycogen synthesis and induction of glycolysis. Remarkably, PGC-1α was suppressed despite AMP-activated kinase activation, a paradigm not previously reported, and they jointly contributed to impaired gluconeogenesis. In conclusion, lack of functional peroxisomes from hepatocytes results in marked disturbances of carbohydrate homeostasis, which are consistent with adaptations to an energy deficit. Because this is primarily due to impaired mitochondrial ATP production, these L-Pex5-deficient livers can also be considered as a model for secondary mitochondrial hepatopathies. PMID
Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi
2016-03-01
Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 m
High throughput functional assays for P2X receptors.
Namovic, Marian T; Jarvis, Michael F; Donnelly-Roberts, Diana
2012-06-01
Adenosine triphosphate (ATP) activates two receptor superfamilies, metabotropic P2Y and ionotropic P2X receptors. The P2X receptors are nonselective cation channels that are widely expressed on excitable cells including neurons, glia, and smooth muscle cells. The protocols in this unit are useful for evaluating ligands that interact with P2X receptors on native cells or that are cloned and expressed in recombinant heterologous cell systems. Calcium imaging methods are described for the pharmacological characterization of fast or slowly desensitizing P2X receptors. While these methods are readily applicable to a wide variety of ligand-gated ion channels, the protocols provided herein detail how they can be used to measure activation of homomeric P2X3 (fast desensitizing) and heteromeric P2X2/3 (slowly desensitizing) receptors. Appropriate agonists and/or calcium dyes can be substituted to assess activity at other P2X receptor subtypes. An additional protocol is provided for measuring P2X7 receptor-mediated pore formation in THP-1, a native human acute monocytic leukemia cell line that can be used to study homomeric P2X7 (non-desensitizing) receptors that are expressed on macrophages and microglial cells. © 2012 by John Wiley & Sons, Inc.
Nakazawa, Takehito; Izuno, Ayako; Horii, Masato; Kodera, Rina; Nishimura, Hiroshi; Hirayama, Yuichiro; Tsunematsu, Yuta; Miyazaki, Yasumasa; Awano, Tatsuya; Muraguchi, Hajime; Watanabe, Kenji; Sakamoto, Masahiro; Takabe, Keiji; Watanabe, Takashi; Isagi, Yuji; Honda, Yoichi
2017-12-01
Peroxisomes are well-known organelles that are present in most eukaryotic organisms. Mutant phenotypes caused by the malfunction of peroxisomes have been shown in many fungi. However, these have never been investigated in Agaricomycetes, which include white-rot fungi that degrade wood lignin in nature almost exclusively and play an important role in the global carbon cycle. Based on the results of a forward genetics study to identify mutations causing defects in the ligninolytic activity of the white-rot Agaricomycete Pleurotus ostreatus, we report phenotypes of pex1 disruptants in P. ostreatus, which are defective in two major features of white-rot Agaricomycetes: lignin biodegradation and mushroom formation. Pex1 disruption was also shown to cause defects in the hyphal growth of P. ostreatus on certain sawdust and minimum media. We also demonstrated that pex1 is essential for fruiting initiation in the non-wood decaying Agaricomycete Coprinopsis cinerea. However, unlike P. ostreatus, significant defects in hyphal growth on the aforementioned agar medium were not observed in C. cinerea. This result, together with previous C. cinerea genetic studies, suggests that the regulation mechanisms for the utilization of carbon sources are altered during the evolution of Agaricomycetes or Agaricales. Copyright © 2017 Elsevier Inc. All rights reserved.
Onuma, Takashi; Tanabe, Kumiko; Kito, Yuko; Tsujimoto, Masanori; Uematsu, Kodai; Enomoto, Yukiko; Matsushima-Nishiwaki, Rie; Doi, Tomoaki; Nagase, Kiyoshi; Akamatsu, Shigeru; Tokuda, Haruhiko; Ogura, Shinji; Iwama, Toru; Kozawa, Osamu; Iida, Hiroki
2017-08-01
Sphingosine 1-phosphate (S1P) is as an extracellular factor that acts as a potent lipid mediator by binding to specific receptors, S1P receptors (S1PRs). However, the precise role of S1P in human platelets that express S1PRs has not yet been fully clarified. We previously reported that heat shock protein 27 (HSP27) is released from human platelets accompanied by its phosphorylation stimulated by collagen. In the present study, we investigated the effect of S1P on the collagen-induced platelet activation. S1P pretreatment markedly attenuated the collagen-induced aggregation. Co-stimulation with S1P and collagen suppressed collagen-induced platelet activation, but the effect was weaker than that of S1P-pretreatment. The collagen-stimulated secretion of platelet-derived growth factor (PDGF)-AB and the soluble CD40 ligand (sCD40L) release were significantly reduced by S1P. In addition, S1P suppressed the collagen-induced release of HSP27 as well as the phosphorylation of HSP27. S1P significantly suppressed the collagen-induced phosphorylation of p38 mitogen-activated protein kinase. S1P increased the levels of GTP-bound Gαi and GTP-bound Gα13 coupled to S1PPR1 and/or S1PR4. CYM50260, a selective S1PR4 agonist, but not SEW2871, a selective S1PR1 agonist, suppressed the collagen-stimulated platelet aggregation, PDGF-AB secretion and sCD40L release. In addition, CYM50260 reduced the release of phosphorylated-HSP27 by collagen as well as the phosphorylation of HSP27. The selective S1PR4 antagonist CYM50358, which failed to affect collagen-induced HSP27 phosphorylation, reversed the S1P-induced attenuation of HSP27 phosphorylation by collagen. These results strongly suggest that S1P inhibits the collagen-induced human platelet activation through S1PR4 but not S1PR1. Copyright © 2017 Elsevier Ltd. All rights reserved.
Krump-Konvalinkova, Vera; Yasuda, Satoshi; Rubic, Tina; Makarova, Natalia; Mages, Jörg; Erl, Wolfgang; Vosseler, Claudia; Kirkpatrick, C James; Tigyi, Gabor; Siess, Wolfgang
2005-03-01
Sphingosine 1-phosphate (S1P) is a bioactive phospholipid acting both as a ligand for the G protein-coupled receptors S1P1-5 and as a second messenger. Because S1P1 knockout is lethal in the transgenic mouse, an alternative approach to study the function of S1P1 in endothelial cells is needed. All human endothelial cells analyzed expressed abundant S1P1 transcripts. We permanently silenced (by RNA interference) the expression of S1P1 in the human endothelial cell lines AS-M.5 and ISO-HAS.1. The S1P1 knock-down cells manifested a distinct morphology and showed neither actin ruffles in response to S1P nor an angiogenic reaction. In addition, these cells were more sensitive to oxidant stress-mediated injury. New S1P1-dependent gene targets were identified in human endothelial cells. S1P1 silencing decreased the expression of platelet-endothelial cell adhesion molecule-1 and VE-cadherin and abolished the induction of E-selectin after cell stimulation with lipopolysaccharide or tumor necrosis factor-alpha. Microarray analysis revealed downregulation of further endothelial specific transcripts after S1P1 silencing. Long-term silencing of S1P1 enabled us for the first time to demonstrate the involvement of S1P1 in key functions of endothelial cells and to identify new S1P1-dependent gene targets.
Complement C5a receptor antagonism by protamine and poly-L-Arg on human leukocytes.
Olsen, U B; Selmer, J; Kahl, J U
1988-01-01
It is shown that protamine selectively and dose-dependently inhibits complement C5a-induced leukocyte responses such as histamine release from basophils, chemiluminescence and beta-glucuronidase release from neutrophils. Protamine produces parallel rightward displacements of the C5a dose-response curves. The inhibitory capacity of the polypeptide is reversible and disappears following repeated washing of exposed cells. In neutrophils poly-L-Arg similarly and specifically antagonizes C5a-induced chemiluminescence and enzyme release. This polymer alone, however, degranulates basophils and neutrophils, leading to histamine and enzyme release, respectively. It is concluded that on human neutrophils the arginine-rich polycations protamine and poly-L-Arg exhibit a competitive C5a receptor antagonism. In addition, protamine inhibits the C5a receptors on basophils. It is hypothesized that molecular conformations of the arginine-rich polycations might bind reversibly to, and block negatively charged groups at the C5a-receptor sites.
Martín-Cora, Francisco J; Pazos, Angel
2003-01-01
The main aim of this investigation was to delineate the distribution of the 5-HT7 receptor in human brain. Autoradiographic studies in guinea-pig and rat brain were also carried out in order to revisit and compare the anatomical distribution of 5-HT7 receptors in different mammalian species.Binding studies were performed in rat frontal cortex membranes using 10 nM [3H]mesulergine in the presence of raclopride (10 μM) and DOI (0.8 μM). Under these conditions, a binding site with pharmacological characteristics consistent with those of the 5-HT7 receptors was identified (rank order of binding affinity values: 5-CT>5-HT>5-MeOT>mesulergine ≈methiothepin>8-OH-DPAT=spiperone ≈(+)-butaclamol≫imipramine ≈(±)-pindolol≫ondansetron ≈clonidine ≈prazosin).The autoradiographic studies revealed that the anatomical distribution of 5-HT7 receptors throughout the human brain was heterogenous. High densities were found over the caudate and putamen nuclei, the pyramidal layer of the CA2 field of the hippocampus, the centromedial thalamic nucleus, and the dorsal raphe nucleus. The inner layer of the frontal cortex, the dentate gyrus of the hippocampus, the subthalamic nucleus and superior colliculus, among others, presented intermediate concentrations of 5-HT7 receptors. A similar brain anatomical distribution of 5-HT7 receptors was observed in all three mammalian species studied.By using [3H]mesulergine, we have mapped for the first time the anatomical distribution of 5-HT7 receptors in the human brain, overcoming the limitations previously found in radiometric studies with other radioligands, and also revisiting the distribution in guinea-pig and rat brain. PMID:14656806
FRET-based sensors for the human M1-, M3-, and M5-acetylcholine receptors.
Ziegler, Nicole; Bätz, Julia; Zabel, Ulrike; Lohse, Martin J; Hoffmann, Carsten
2011-02-01
Based on the recently developed approach to generate fluorescence resonance energy transfer (FRET)-based sensors to measure GPCR activation, we generated sensor constructs for the human M(1)-, M(3)-, and M(5)-acetylcholine receptor. The receptors were labeled with cyan fluorescent protein (CFP) at their C-terminus, and with fluorescein arsenical hairpin binder (FlAsH) via tetra-cysteine tags inserted in the third intracellular loop. We then measured FRET between the donor CFP and the acceptor FlAsH in living cells and real time. Agonists like acetylcholine, carbachol, or muscarine activate each receptor construct with half-maximal activation times between 60 and 70ms. Removal of the agonist caused the reversal of the signal. Compared with all other agonists, oxotremorine M differed in two major aspects: it caused significantly slower signals at M(1)- and M(5)-acetylcholine receptors and the amplitude of these signals was larger at the M(1)-acetylcholine receptor. Concentration-response curves for the agonists reveal that all agonists tested, with the mentioned exception of oxotremorine M, caused similar maximal FRET-changes as acetylcholine for the M(1)-, M(3)- and M(5)-acetylcholine receptor constructs. Taken together our data support the notion that orthosteric agonists behave similar at different muscarinic receptor subtypes but that kinetic differences can be observed for receptor activation. Copyright © 2010 Elsevier Ltd. All rights reserved.
Boecker, Werner; van Horn, Laura; Stenman, Göran; Stürken, Christine; Schumacher, Udo; Loening, Thomas; Liesenfeld, Lukas; Korsching, Eberhard; Gläser, Doreen; Tiemann, Katharina; Buchwalow, Igor
2018-05-09
Understanding the mechanisms regulating human mammary epithelium requires knowledge of the cellular constituents of this tissue. Different and partially contradictory definitions and concepts describing the cellular hierarchy of mammary epithelium have been proposed, including our studies of keratins K5 and/or K14 as markers of progenitor cells. Furthermore, we and others have suggested that the p53 homolog p63 is a marker of human breast epithelial stem cells. In this investigation, we expand our previous studies by testing whether immunohistochemical staining with monospecific anti-keratin antibodies in combination with an antibody against the stem cell marker p63 might help refine the different morphologic phenotypes in normal breast epithelium. We used in situ multilabel staining for p63, different keratins, the myoepithelial marker smooth muscle actin (SMA), the estrogen receptor (ER), and Ki67 to dissect and quantify the cellular components of 16 normal pre- and postmenopausal human breast epithelial tissue samples at the single-cell level. Importantly, we confirm the existence of K5+ only cells and suggest that they, in contrast to the current view, are key luminal precursor cells from which K8/18+ progeny cells evolve. These cells are further modified by the expression of ER and Ki67. We have also identified a population of p63+K5+ cells that are only found in nipple ducts. Based on our findings, we propose a new concept of the cellular hierarchy of human breast epithelium, including K5 luminal lineage progenitors throughout the ductal-lobular axis and p63+K5+ progenitors confined to the nipple ducts.
Arrestin Scaffolds NHERF1 to the P2Y12 Receptor to Regulate Receptor Internalization*
Nisar, Shaista P.; Cunningham, Margaret; Saxena, Kunal; Pope, Robert J.; Kelly, Eamonn; Mundell, Stuart J.
2012-01-01
We have recently shown in a patient with mild bleeding that the PDZ-binding motif of the platelet G protein-coupled P2Y12 receptor (P2Y12R) is required for effective receptor traffic in human platelets. In this study we show for the first time that the PDZ motif-binding protein NHERF1 exerts a major role in potentiating G protein-coupled receptor (GPCR) internalization. NHERF1 interacts with the C-tail of the P2Y12R and unlike many other GPCRs, NHERF1 interaction is required for effective P2Y12R internalization. In vitro and prior to agonist stimulation P2Y12R/NHERF1 interaction requires the intact PDZ binding motif of this receptor. Interestingly on receptor stimulation NHERF1 no longer interacts directly with the receptor but instead binds to the receptor via the endocytic scaffolding protein arrestin. These findings suggest a novel model by which arrestin can serve as an adaptor to promote NHERF1 interaction with a GPCR to facilitate effective NHERF1-dependent receptor internalization. PMID:22610101
Arrestin scaffolds NHERF1 to the P2Y12 receptor to regulate receptor internalization.
Nisar, Shaista P; Cunningham, Margaret; Saxena, Kunal; Pope, Robert J; Kelly, Eamonn; Mundell, Stuart J
2012-07-13
We have recently shown in a patient with mild bleeding that the PDZ-binding motif of the platelet G protein-coupled P2Y(12) receptor (P2Y(12)R) is required for effective receptor traffic in human platelets. In this study we show for the first time that the PDZ motif-binding protein NHERF1 exerts a major role in potentiating G protein-coupled receptor (GPCR) internalization. NHERF1 interacts with the C-tail of the P2Y(12)R and unlike many other GPCRs, NHERF1 interaction is required for effective P2Y(12)R internalization. In vitro and prior to agonist stimulation P2Y(12)R/NHERF1 interaction requires the intact PDZ binding motif of this receptor. Interestingly on receptor stimulation NHERF1 no longer interacts directly with the receptor but instead binds to the receptor via the endocytic scaffolding protein arrestin. These findings suggest a novel model by which arrestin can serve as an adaptor to promote NHERF1 interaction with a GPCR to facilitate effective NHERF1-dependent receptor internalization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun
1996-08-01
The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less
Trophic Activity of Human P2X7 Receptor Isoforms A and B in Osteosarcoma
Giuliani, Anna Lisa; Colognesi, Davide; Ricco, Tiziana; Roncato, Carlotta; Capece, Marina; Amoroso, Francesca; Wang, Qi Guang; De Marchi, Elena; Gartland, Allison; Di Virgilio, Francesco; Adinolfi, Elena
2014-01-01
The P2X7 receptor (P2X7R) is attracting increasing attention for its involvement in cancer. Several recent studies have shown a crucial role of P2X7R in tumour cell growth, angiogenesis and invasiveness. In this study, we investigated the role of the two known human P2X7R functional splice variants, the full length P2X7RA and the truncated P2X7RB, in osteosarcoma cell growth. Immunohistochemical analysis of a tissue array of human osteosarcomas showed that forty-four, of a total fifty-four tumours (81.4%), stained positive for both P2X7RA and B, thirty-one (57.4%) were positive using an anti-P2X7RA antibody, whereas fifteen of the total number (27.7%) expressed only P2X7RB. P2X7RB positive tumours showed increased cell density, at the expense of extracellular matrix. The human osteosarcoma cell line Te85, which lacks endogenous P2X7R expression, was stably transfected with either P2X7RA, P2X7RB, or both. Receptor expression was a powerful stimulus for cell growth, the most efficient growth-promoting isoform being P2X7RB alone. Growth stimulation was matched by increased Ca2+ mobilization and enhanced NFATc1 activity. Te85 P2X7RA+B cells presented pore formation as well as spontaneous extracellular ATP release. The ATP release was sustained in all clones by P2X7R agonist (BzATP) and reduced following P2X7R antagonist (A740003) application. BzATP also increased cell growth and activated NFATc1 levels. On the other hand cyclosporin A (CSA) affected both NFATc1 activation and cell growth, definitively linking P2X7R stimulation to NFATc1 and cell proliferation. All transfected clones also showed reduced RANK-L expression, and an overall decreased RANK-L/OPG ratio. Mineralization was increased in Te85 P2X7RA+B cells while it was significantly diminished in Te85 P2X7RB clones, in agreement with immunohistochemical results. In summary, our data show that the majority of human osteosarcomas express P2X7RA and B and suggest that expression of either isoform is differently
Skog, Johan; Mei, Ya-Fang; Wadell, Göran
2002-06-01
Most currently used adenovirus vectors are based upon adenovirus serotypes 2 and 5 (Ad2 and Ad5), which have limited efficiencies for gene transfer to human neural cells. Both serotypes bind to the known adenovirus receptor, CAR (coxsackievirus and adenovirus receptor), and have restricted cell tropism. The purpose of this study was to find vector candidates that are superior to Ad5 in infecting human neural tumours. Using flow cytometry, the vector candidates Ad4p, Ad11p and Ad17p were compared to the commonly used adenovirus vector Ad5v for their binding capacity to neural cell lines derived from glioblastoma, medulloblastoma and neuroblastoma cell lines. The production of viral structural proteins and the CAR-binding properties of the different serotypes were also assessed in these cells. Computer-based models of the fibre knobs of Ad4p and Ad17 were created based upon the crystallized fibre knob structure of adenoviruses and analysed for putative receptor-interacting regions that differed from the fibre knob of Ad5. The non CAR-binding vector candidate Ad11p showed clearly the best binding capacity to all of the neural cell lines, binding more than 90% of cells of all of the neural cell lines tested, in contrast to 20% or less for the commonly used vector Ad5v. Ad4p and Ad11p were also internalized and produced viral proteins more successfully than Ad5. Ad4p showed a low binding ability but a very efficient capacity for infection in cell culture. Ad17p virions neither bound or efficiently infected any of the neural cell lines studied.
Laubinger, W; Reiser, G
1999-01-29
Nucleotide receptors are of considerable importance in the treatment of lung diseases, such as cystic fibrosis. Because diadenosine polyphosphates may also be of significance as signalling molecules in lung, as they are in a variety of tissues, in the present work we investigated the binding sites for [3H]diadenosine-5',5'''-P1,P4-tetraphosphate (Ap4A) in plasma membranes from rat lung and studied their possible coupling to G proteins. We present evidence for a single high-affinity binding site for [3H]Ap4A with similar affinity for other diadenosine polyphosphates ApnA (n = 2 to 6). Displacement studies with different nucleotides revealed that the [3H]Ap4A binding site was different from P2X and P2Y2 receptor binding sites. Pretreatment of lung membranes with GTPgammaS or GTP in the presence of Mg2+ increased the Ki for Ap4A from 91 nM to 5.1 microM, which is indicative of G protein coupling. The putative coupling to G proteins was further confirmed by the enhancement of [35S]GTPgammaS binding (to Galpha proteins) to lung membranes by Ap4A (63% increase over basal) in a concentration-dependent manner. Therefore, our data for the first time provide evidence of a G protein-coupled Ap4A binding site in lung membranes.
Pathophysiological consequences of receptor mistraffic: Tales from the platelet P2Y12 receptor.
Cunningham, Margaret R; Aungraheeta, Riyaad; Mundell, Stuart J
2017-07-05
Genetic variations in G protein-coupled receptor (GPCR) genes can disrupt receptor function in a wide variety of human genetic diseases, including platelet bleeding disorders. Platelets are critical for haemostasis with inappropriate platelet activation leading to the development of arterial thrombosis, which can result in heart attack and stroke whilst decreased platelet activity is associated with an increased risk of bleeding. GPCRs expressed on the surface of platelets play key roles in regulating platelet activity and therefore function. Receptors include purinergic receptors (P2Y 1 and P2Y 12 ), proteinase-activated receptor (PAR1 and PAR4) and thromboxane receptors (TPα), among others. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis. With the advance of genomic technologies, there has been a substantial increase in the identification of naturally occurring rare and common GPCR variants. These variants include single-nucleotide polymorphisms (SNPs) and insertion or deletions that have the potential to alter GPCR expression or function. A number of defects in platelet GPCRs that disrupt receptor function have now been characterized in patients with mild bleeding disorders. This review will focus on rare, function-disrupting variants of platelet GPCRs with particular emphasis upon mutations in the P2Y 12 receptor gene that affect receptor traffic to modulate platelet function. Further this review will outline how the identification and characterization of function-disrupting GPCR mutations provides an essential link in translating our detailed understanding of receptor traffic and function in cell line studies into relevant human biological systems. Copyright © 2017. Published by Elsevier B.V.
Jacobson, K A; Kim, Y C; King, B F
2000-07-03
1,4-Dihydropyridines are regarded as privileged structures for drug design, i.e. they tend to bind to a wide variety of receptor sites. We have shown that upon appropriate manipulation of the substituent groups on a 1,4-dihydropyridine template, high affinity and selectivity for the A(3) subtype of adenosine receptors ('P1 receptors') may be attained. In the present study we have begun to extend this approach to P2 receptors which are activated by ATP and other nucleotides. Nicardipine, a representative dihydropyridine, used otherwise as an L-type calcium channel blocker, was shown to be an antagonist at recombinant rat P2X(2) (IC(50)=25 microM) and P2X(4) (IC(50) approximately 220 microM) receptors expressed in Xenopus oocytes. Thus, this class of compounds represents a suitable lead for enhancement of affinity through chemical synthesis. In an attempt to modify the 1,4-dihydropyridine structure with a predicted P2 receptor recognition moiety, we have replaced one of the ester groups with a negatively charged phosphonate group. Several 4-phenyl-5-phosphonato-1,4-dihydropyridine derivatives, MRS 2154 (2, 6-dimethyl), MRS 2155 (6-methyl-2-phenyl), and MRS 2156 (2-methyl-6-phenyl), were synthesized through three component condensation reactions. These derivatives were not pure antagonists of the effects of ATP at P2X(2) receptors, rather were either inactive (MRS 2156) or potentiated the effects of ATP in a concentration-dependent manner (MRS 2154 in the 0.3-10 microM range and MRS 2155 at >1 microM). Antagonism of the effects of ATP at P2X(2) receptor superimposed on the potentiation was also observed at >10 microM (MRS 2154) or 0.3-1 microM (MRS 2155). Thus, while a conventional dihydropyridine, nicardipine, was found to antagonize rat P2X(2) receptors ninefold more potently than P2X(4) receptors, the effects of novel, anionic 5-phosphonate analogues at the receptor were more complex.
Meyer, Nuala J; Reilly, John P; Anderson, Brian J; Palakshappa, Jessica A; Jones, Tiffanie K; Dunn, Thomas G; Shashaty, Michael G S; Feng, Rui; Christie, Jason D; Opal, Steven M
2018-01-01
Plasma interleukin-1 beta may influence sepsis mortality, yet recombinant human interleukin-1 receptor antagonist did not reduce mortality in randomized trials. We tested for heterogeneity in the treatment effect of recombinant human interleukin-1 receptor antagonist by baseline plasma interleukin-1 beta or interleukin-1 receptor antagonist concentration. Retrospective subgroup analysis of randomized controlled trial. Multicenter North American and European clinical trial. Five hundred twenty-nine subjects with sepsis and hypotension or hypoperfusion, representing 59% of the original trial population. Random assignment of placebo or recombinant human interleukin-1 receptor antagonist × 72 hours. We measured prerandomization plasma interleukin-1 beta and interleukin-1 receptor antagonist and tested for statistical interaction between recombinant human interleukin-1 receptor antagonist treatment and baseline plasma interleukin-1 receptor antagonist or interleukin-1 beta concentration on 28-day mortality. There was significant heterogeneity in the effect of recombinant human interleukin-1 receptor antagonist treatment by plasma interleukin-1 receptor antagonist concentration whether plasma interleukin-1 receptor antagonist was divided into deciles (interaction p = 0.046) or dichotomized (interaction p = 0.028). Interaction remained present across different predicted mortality levels. Among subjects with baseline plasma interleukin-1 receptor antagonist above 2,071 pg/mL (n = 283), recombinant human interleukin-1 receptor antagonist therapy reduced adjusted mortality from 45.4% to 34.3% (adjusted risk difference, -0.12; 95% CI, -0.23 to -0.01), p = 0.044. Mortality in subjects with plasma interleukin-1 receptor antagonist below 2,071 pg/mL was not reduced by recombinant human interleukin-1 receptor antagonist (adjusted risk difference, +0.07; 95% CI, -0.04 to +0.17), p = 0.230. Interaction between plasma interleukin-1 beta concentration and recombinant human
Rauly-Lestienne, Isabelle; Boutet-Robinet, Elisa; Ailhaud, Marie-Christine; Newman-Tancredi, Adrian; Cussac, Didier
2007-10-01
5-HT(7) receptors are present in thalamus and limbic structures, and a possible role of these receptors in the pathology of schizophrenia has been evoked. In this study, we examined binding affinity and agonist/antagonist/inverse agonist properties at these receptors of a large series of antipsychotics, i.e., typical, atypical, and third generation compounds preferentially targeting D(2) and 5-HT(1A) sites. Adenylyl cyclase (AC) activity was measured in HEK293 cells stably expressing the human (h) 5-HT(7a) receptor isoform. 5-HT and 5-CT increased cyclic adenosine monophosphate level by about 20-fold whereas (+)-8-OH-DPAT, the antidyskinetic agent sarizotan, and the novel antipsychotic compound bifeprunox exhibited partial agonist properties at h5-HT(7a) receptors stimulating AC. Other compounds antagonized 5-HT-induced AC activity with pK (B) values which correlated with their pK (i) as determined by competition binding vs [(3)H]5-CT. The selective 5-HT(7) receptor ligand, SB269970, was the most potent antagonist. For antipsychotic compounds, the following rank order of antagonism potency (pK (B)) was ziprasidone > tiospirone > SSR181507 > or = clozapine > or = olanzapine > SLV-314 > SLV-313 > or = aripiprazole > or = chlorpromazine > nemonapride > haloperidol. Interestingly, pretreatment of HEK293-h5-HT(7a) cells with forskolin enhanced basal AC activity and revealed inverse agonist properties for both typical and atypical antipsychotics as well as for aripiprazole. In contrast, other novel antipsychotics exhibited diverse 5-HT(7a) properties; SLV-313 and SLV-314 behaved as quasi-neutral antagonists, SSR181507 acted as an inverse agonist, and bifeprunox as a partial agonist, as mentioned above. In conclusion, the differential properties of third generation antipsychotics at 5-HT(7) receptors may influence their antipsychotic profile.
Oeljeklaus, Silke; Reinartz, Benedikt S; Wolf, Janina; Wiese, Sebastian; Tonillo, Jason; Podwojski, Katharina; Kuhlmann, Katja; Stephan, Christian; Meyer, Helmut E; Schliebs, Wolfgang; Brocard, Cécile; Erdmann, Ralf; Warscheid, Bettina
2012-04-06
The importomer complex plays an essential role in the biogenesis of peroxisomes by mediating the translocation of matrix proteins across the organellar membrane. A central part of this highly dynamic import machinery is the docking complex consisting of Pex14p, Pex13p, and Pex17p that is linked to the RING finger complex (Pex2p, Pex10p, Pex12p) via Pex8p. To gain detailed knowledge on the molecular players governing peroxisomal matrix protein import and, thus, the integrity and functionality of peroxisomes, we aimed at a most comprehensive investigation of stable and transient interaction partners of Pex14p, the central component of the importomer. To this end, we performed a thorough quantitative proteomics study based on epitope tagging of Pex14p combined with dual-track stable isotope labeling with amino acids in cell culture-mass spectrometry (SILAC-MS) analysis of affinity-purified Pex14p complexes and statistics. The results led to the establishment of the so far most extensive Pex14p interactome, comprising 9 core and further 12 transient components. We confirmed virtually all known Pex14p interaction partners including the core constituents of the importomer as well as Pex5p, Pex11p, Pex15p, and Dyn2p. More importantly, we identified new transient interaction partners (Pex25p, Hrr25p, Esl2p, prohibitin) that provide a valuable resource for future investigations on the functionality, dynamics, and regulation of the peroxisomal importomer.
Endocannabinoids Stimulate Human Melanogenesis via Type-1 Cannabinoid Receptor*
Pucci, Mariangela; Pasquariello, Nicoletta; Battista, Natalia; Di Tommaso, Monia; Rapino, Cinzia; Fezza, Filomena; Zuccolo, Michela; Jourdain, Roland; Finazzi Agrò, Alessandro; Breton, Lionel; Maccarrone, Mauro
2012-01-01
We show that a fully functional endocannabinoid system is present in primary human melanocytes (normal human epidermal melanocyte cells), including anandamide (AEA), 2-arachidonoylglycerol, the respective target receptors (CB1, CB2, and TRPV1), and their metabolic enzymes. We also show that at higher concentrations AEA induces normal human epidermal melanocyte apoptosis (∼3-fold over controls at 5 μm) through a TRPV1-mediated pathway that increases DNA fragmentation and p53 expression. However, at lower concentrations, AEA and other CB1-binding endocannabinoids dose-dependently stimulate melanin synthesis and enhance tyrosinase gene expression and activity (∼3- and ∼2-fold over controls at 1 μm). This CB1-dependent activity was fully abolished by the selective CB1 antagonist SR141716 or by RNA interference of the receptor. CB1 signaling engaged p38 and p42/44 mitogen-activated protein kinases, which in turn activated the cyclic AMP response element-binding protein and the microphthalmia-associated transcription factor. Silencing of tyrosinase or microphthalmia-associated transcription factor further demonstrated the involvement of these proteins in AEA-induced melanogenesis. In addition, CB1 activation did not engage the key regulator of skin pigmentation, cyclic AMP, showing a major difference compared with the regulation of melanogenesis by α-melanocyte-stimulating hormone through melanocortin 1 receptor. PMID:22431736
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest
Empowering human cardiac progenitor cells by P2Y14 nucleotide receptor overexpression.
Khalafalla, Farid G; Kayani, Waqas; Kassab, Arwa; Ilves, Kelli; Monsanto, Megan M; Alvarez, Roberto; Chavarria, Monica; Norman, Benjamin; Dembitsky, Walter P; Sussman, Mark A
2017-12-01
Autologous cardiac progenitor cell (CPC) therapy is a promising approach for treatment of heart failure (HF). There is an unmet need to identify inherent deficits in aged/diseased human CPCs (hCPCs) derived from HF patients in the attempts to augment their regenerative capacity prior to use in the clinical setting. Here we report significant functional correlations between phenotypic properties of hCPCs isolated from cardiac biopsies of HF patients, clinical parameters of patients and expression of the P2Y 14 purinergic receptor (P2Y 14 R), a crucial detector for extracellular UDP-sugars released during injury/stress. P2Y 14 R is downregulated in hCPCs derived from HF patients with lower ejection fraction or diagnosed with diabetes. Augmenting P2Y 14 R expression levels in aged/diseased hCPCs antagonizes senescence and improves functional responses. This study introduces purinergic signalling modulation as a potential strategy to rejuvenate and improve phenotypic characteristics of aged/functionally compromised hCPCs prior to transplantation in HF patients. Autologous cardiac progenitor cell therapy is a promising alternative approach to current inefficient therapies for heart failure (HF). However, ex vivo expansion and pharmacological/genetic modification of human cardiac progenitor cells (hCPCs) are necessary interventions to rejuvenate aged/diseased cells and improve their regenerative capacities. This study was designed to assess the potential of improving hCPC functional capacity by targeting the P2Y 14 purinergic receptor (P2Y 14 R), which has been previously reported to induce regenerative and anti-senescence responses in a variety of experimental models. c-Kit + hCPCs were isolated from cardiac biopsies of multiple HF patients undergoing left ventricular assist device implantation surgery. Significant correlations existed between the expression of P2Y 14 R in hCPCs and clinical parameters of HF patients. P2Y 14 R was downregulated in hCPCs derived from
NASA Astrophysics Data System (ADS)
Li, Yaohui
2017-04-01
Drought is one of the most common and frequent nature disasters in the world, particularly in China under the continental monsoonal climate with great variation. About thirty percent of economic loss caused by natural disasters is contributed by droughts in China, which is by far the most damaging weather disasters because of its long duration and extensive hazard areas. Droughts not only have a serious impact on the agriculture, water resources, ecology, natural environment, but also seriously affect the socio-economic such as human health, energy and transportation. Worsely, under the background of climate change, droughts in show increases in frequency, duration and scope in many places around the world, particularly northern China. Nowadays, droughts have aroused extensive concern of the scientists, governments and international community, and became one of the important scientific issues in geoscience research. However, most of researches on droughts in China so far were focused on the causes or regulars of one type of droughts (the atmosphere, agriculture or hydrological) from the perspective of the atmospheric circulation anomalies. Few of them considered a whole cycle of the drought-forming process from atmosphere-land interaction to agricultural/ecological one in terms of the land-atmosphere interaction; meanwhile, the feedback mechanism with the drought and land-atmosphere interaction is still unclear as well. All of them is because of lack of the relevant comprehensive observation experiment. "Land-atmosphere interaction and disaster-causing process of drought in northern China: observation and experiment" (DroughtPEX_China)is just launched in this requirement and background. DroughtPEX_China is supported by Special Scientific Research Fund of Public Welfare Industry (Meteorological) of China (Grant No.GYHY201506001)—"Drought Meteorology Scientific Research Project—the disaster-causing process and mechanism of drought in northern China". This project
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gualdrón-López, Melisa; Michels, Paul A.M., E-mail: paul.michels@uclouvain.be
Highlights: ► Most eukaryotic cells have a single gene for the peroxin PEX5. ► PEX5 is sensitive to in vitro proteolysis in distantly related organisms. ► TbPEX5 undergoes N-terminal truncation in vitro and possibly in vivo. ► Truncated TbPEX5 is still capable of binding PTS1-containing proteins. ► PEX5 truncation is physiologically relevant or an evolutionary conserved artifact. -- Abstract: Glycolysis in kinetoplastid protists such as Trypanosoma brucei is compartmentalized in peroxisome-like organelles called glycosomes. Glycosomal matrix-protein import involves a cytosolic receptor, PEX5, which recognizes the peroxisomal-targeting signal type 1 (PTS1) present at the C-terminus of the majority of matrix proteins.more » PEX5 appears generally susceptible to in vitro proteolytic processing. On western blots of T. brucei, two PEX5 forms are detected with apparent M{sub r} of 100 kDa and 72 kDa. 5′-RACE-PCR showed that TbPEX5 is encoded by a unique transcript that can be translated into a protein of maximally 72 kDa. However, recombinant PEX5 migrates aberrantly in SDS–PAGE with an apparent M{sub r} of 100 kDa, similarly as observed for the native peroxin. In vitro protease susceptibility analysis of native and {sup 35}S-labelled PEX5 showed truncation of the 100 kDa form at the N-terminal side by unknown parasite proteases, giving rise to the 72 kDa form which remains functional for PTS1 binding. The relevance of these observations is discussed.« less
Eswara, Manoja B K; Clayton, Ashley; Mangroo, Dev
2012-12-01
Utp8p is an essential nucleolar protein that channels aminoacyl-tRNAs from aminoacyl-tRNA synthetases in the nucleolus to the nuclear tRNA export receptors located in the nucleoplasm and nuclear pore complex in Saccharomyces cerevisiae. Utp8p is also part of the U3 snoRNA-associated protein complex involved in 18S rRNA biogenesis in the nucleolus. We report that Utp22p, which is another member of the U3 snoRNA-associated protein complex, is also an intranuclear component of the nuclear tRNA export machinery. Depletion of Utp22p results in nuclear retention of mature tRNAs derived from intron-containing and intronless precursors. Moreover, Utp22p copurifies with the nuclear tRNA export receptor Los1p, the aminoacyl-tRNA synthetase Tys1p and Utp8p, but not with the RanGTPase Gsp1p and the nuclear tRNA export receptor Msn5p. Utp22p interacts directly with Utp8p and Los1p in a tRNA-independent manner in vitro. Utp22p also interacts directly with Tys1p, but this binding is stimulated when Tys1p is bound to tRNA. However, Utp22p, unlike Utp8p, does not bind tRNA saturably. These data suggest that Utp22p recruits Utp8p to aminoacyl-tRNA synthetases in the nucleolus to collect aminoacyl-tRNA and then accompanies the Utp8p-tRNA complex to deliver the aminoacyl-tRNAs to Los1p but not Msn5p. It is possible that Nrap/Nol6, the mammalian orthologue of Utp22p, plays a role in channelling aminoacyl-tRNA to the nuclear tRNA export receptor exportin-t.
Newman-Tancredi, Adrian; Assié, Marie-Bernadette; Leduc, Nathalie; Ormière, Anne-Marie; Danty, Nathalie; Cosi, Cristina
2005-09-01
Serotonin 5-HT1A receptors are promising targets in the management of schizophrenia but little information exists about affinity and efficacy of novel antipsychotics at these sites. We addressed this issue by comparing binding affinity at 5-HT1A receptors with dopamine rD2 receptors, which are important targets for antipsychotic drug action. Agonist efficacy at 5-HT1A receptors was determined for G-protein activation and adenylyl cyclase activity. Whereas haloperidol, thioridazine, risperidone and olanzapine did not interact with 5-HT1A receptors, other antipsychotic agents exhibited agonist properties at these sites. E(max) values (% effect induced by 10 microM of 5-HT) for G-protein activation at rat brain 5-HT1A receptors: sarizotan (66.5), bifeprunox (35.9), SSR181507 (25.8), nemonapride (25.7), ziprasidone (20.6), SLV313 (19), aripiprazole (15), tiospirone (8.9). These data were highly correlated with results obtained at recombinant human 5-HT1A receptors in determinations of G-protein activation and inhibition of forskolin-stimulated adenylyl cyclase. In binding-affinity determinations, the antipsychotics exhibited diverse properties at r5-HT1A receptors: sarizotan (pK(i)=8.65), SLV313 (8.64), SSR181507 (8.53), nemonapride (8.35), ziprasidone (8.30), tiospirone (8.22), aripiprazole (7.42), bifeprunox (7.19) and clozapine (6.31). The affinity ratios of the ligands at 5-HT1A vs. D2 receptors also varied widely: ziprasidone, SSR181507 and SLV313 had similar affinities whereas aripiprazole, nemonapride and bifeprunox were more potent at D2 than 5-HT1A receptors. Taken together, these data indicate that aripiprazole has low efficacy and modest affinity at 5-HT1A receptors, whereas bifeprunox has low affinity but high efficacy. In contrast, SSR181507 has intermediate efficacy but high affinity, and is likely to have more prominent 5-HT1A receptor agonist properties. Thus, the contribution of 5-HT1A receptor activation to the pharmacological profile of action of the
[Influenza virus receptors in the human airway].
Shinya, Kyoko; Kawaoka, Yoshihiro
2006-06-01
Avian influenza A (H5N1) virus infections have resulted in more than 100 human deaths; yet, human-to-human transmission is rare. We demonstrated that the epithelial cells in the upper respiratory tract of humans mainly possess sialic acid linked to galactose by alpha 2,6 linkages (SA alpha 2,6Gal), a molecule preferentially recognized by human viruses. However, many cells in the respiratory bronchioles and alveoli possess SA alpha 2,3Gal, which is preferentially recognized by avian viruses. These facts are consistent with the observation that H5N1 viruses can be directly transmitted from birds to humans and cause serious lower respiratory tract damage in humans. Furthermore, this anatomical difference in receptor prevalence may explain why the spread of H5N1 viruses among humans is limited. However, since some H5N1 viruses isolated from humans recognize human virus receptors, additional changes must be required for these viruses to acquire the ability for efficient human-to-human transmission.
Lee, Min Jung; Cho, Kang Hun; Park, Hyun Min; Sung, Hyun Jung; Choi, Sunghak; Im, Weonbin
2014-07-15
DA-6886, the gastrointestinal prokinetic benzamide derivative is a novel 5-HT4 receptor agonist being developed for the treatment of constipation-predominant irritable bowel syndrome (IBS-C). The purpose of this study was to characterize in vitro and in vivo pharmacological profile of DA-6886. We used various receptor binding assay, cAMP accumulation assay, organ bath experiment and colonic transit assay in normal and chemically constipated mice. DA-6886 exhibited high affinity and selectivity to human 5-HT4 receptor splice variants, with mean pKi of 7.1, 7.5, 7.9 for the human 5-HT4a, 5-HT4b and 5-HT4d, respectively. By contrast, DA-6886 did not show significant affinity for several receptors including dopamine D2 receptor, other 5-HT receptors except for 5-HT2B receptor (pKi value of 6.2). The affinity for 5-HT4 receptor was translated into functional agonist activity in Cos-7 cells expressing 5-HT4 receptor splice variants. Furthermore, DA-6886 induced relaxation of the rat oesophagus preparation (pEC50 value of 7.4) in a 5-HT4 receptor antagonist-sensitive manner. The evaluation of DA-6886 in CHO cells expressing hERG channels revealed that it inhibited hERG channel current with an pIC50 value of 4.3, indicating that the compound was 1000-fold more selective for the 5-HT4 receptor over hERG channels. In the normal ICR mice, oral administration of DA-6886 (0.4 and 2mg/kg) resulted in marked stimulation of colonic transit. Furthermore, in the loperamide-induced constipation mouse model, 2mg/kg of DA-6886 significantly improved the delay of colonic transit, similar to 10mg/kg of tegaserod. Taken together, DA-6886 is a highly potent and selective 5-HT4 receptor agonist to accelerate colonic transit in mice, which might be therapeutic agent having a favorable safety profile in the treatment of gastrointestinal motor disorders such as IBS-C and chronic constipation. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Liping; Oshima, Tadayuki; Fukui, Hirokazu; Watari, Jiro; Miwa, Hiroto
2017-07-01
Immune-mediated mucosal inflammation characterized by the release of interleukin (IL)-8 is associated with gastroesophageal reflux disease. ATP released by human esophageal epithelial cells (HEECs) mediates the release of cytokines through P2 nucleotide receptors that are present on various cells, including HEECs. This study characterized and identified human esophageal epithelial P2 receptors that are responsible for ATP-mediated release of IL-8 by using a human esophageal stratified squamous epithelial model. Primary HEECs were cultured with the use of an air-liquid interface (ALI) system. The ATP analogue adenosine 5'-O-3-thiotriphosphate (ATP-γ-S) was added to the basolateral compartment, and IL-8 release was measured. Involvement of the P2Y2 receptor was assessed with the use of selective and non-selective receptor antagonists and a P2Y2 receptor agonist. Expression of the P2Y2 receptor was assessed using western blotting and immunohistochemistry. Adenosine triphosphate-γ-S induced IL-8 release through the P2Y2 receptor. A P2Y2 receptor antagonist but not a P2X3 receptor antagonist or a P2Y1 receptor antagonist blocked ATP-γ-S-mediated IL-8 release. Conversely, a P2Y2 receptor agonist induced IL-8 release. Western blotting and immunohistochemistry of the P2Y2 receptor showed strong expression of the P2Y2 receptor on ALI-cultured HEECs and in human esophagus. Inhibition of extracellular signal-regulated kinase but not of protein kinase C blocked the ATP-mediated release of IL-8. ATP-γ-S induced phosphorylation of extracellular signal-regulated kinase, and a P2Y2 receptor antagonist blocked this phosphorylation. Interleukin-8 release after purinergic stimulation in ALI-cultured HEECs is mediated through P2Y2 receptor activation. ATP-induced IL-8 release maybe involved in the pathogenesis of refractory gastroesophageal reflux disease. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
The T-cell antigen CD5 acts as a receptor and substrate for the protein-tyrosine kinase p56lck.
Raab, M; Yamamoto, M; Rudd, C E
1994-01-01
CD5 is a T-cell-specific antigen which binds to the B-cell antigen CD72 and acts as a coreceptor in the stimulation of T-cell growth. CD5 associates with the T-cell receptor zeta chain (TcR zeta)/CD3 complex and is rapidly phosphosphorylated on tyrosine residues as a result of TcR zeta/CD3 ligation. However, despite this, the mechanism by which CD5 generates intracellular signals is unclear. In this study, we demonstrate that CD5 is coupled to the protein-tyrosine kinase p56lck and can act as a substrate for p56lck. Coexpression of CD5 with p56lck in the baculovirus expression system resulted in the phosphorylation of CD5 on tyrosine residues. Further, anti-CD5 and anti-p56lck coprecipitated each other in a variety of detergents, including Nonidet P-40 and Triton X-100. Anti-CD5 also precipitated the kinase from various T cells irrespective of the expression of TcR zeta/CD3 or CD4. No binding between p59fyn(T) and CD5 was detected in T cells. The binding of p56lck to CD5 induced a 10- to 15-fold increase in p56lck catalytic activity, as measured by in vitro kinase analysis. In vivo labelling with 32P(i) also showed a four- to fivefold increase in Y-394 occupancy in p56lck when associated with CD5. The use of glutathione S-transferase-Lck fusion proteins in precipitation analysis showed that the SH2 domain of p56lck could recognize CD5 as expressed in the baculovirus expression system. CD5 interaction with p56lck represents a novel variant of a receptor-kinase complex in which receptor can also serve as substrate. The CD5-p56lck interaction is likely to play roles in T-cell signalling and T-B collaboration. Images PMID:7513045
Becic, Tina; Kero, Darko; Vukojevic, Katarina; Mardesic, Snjezana; Saraga-Babic, Mirna
2018-04-01
The expression pattern of fibroblast growth factors FGF8 and FGF2 and their receptor FGFR1, transcription factors MSX-1 and MSX-2, as well as cell proliferation (Ki-67) and cell death associated caspase-3, p19 and RIP5 factors were analyzed in histological sections of eight 4th-9th-weeks developing human limbs by immunohistochemistry and semi-thin sectioning. Increasing expression of all analyzed factors (except FGF8) characterized both the multilayered human apical ectodermal ridge (AER), sub-ridge mesenchyme (progress zone) and chondrocytes in developing human limbs. While cytoplasmic co-expression of MSX-1 and MSX-2 was observed in both limb epithelium and mesenchyme, p19 displayed strong cytoplasmic expression in non-proliferating cells. Nuclear expression of Ki-67 proliferating cells, and partly of MSX-1 and MSX-2 was detected in the whole limb primordium. Strong expression of factors p19 and RIP5, both in the AER and mesenchyme of human developing limbs indicates their possible involvement in control of cell senescence and cell death. In contrast to animal studies, expression of FGFR1 in the surface ectoderm and p19 in the whole limb primordium might reflect interspecies differences in limb morphology. Expression of FGF2 and downstream RIP5 gene, and transcription factors Msx-1 and MSX-2 did not show human-specific changes in expression pattern. Based on their spatio-temporal expression during human limb development, our study indicates role of FGFs and Msx genes in stimulation of cell proliferation, limb outgrowth, digit elongation and separation, and additionally MSX-2 in control of vasculogenesis. The cascade of orchestrated gene expressions, including the analyzed developmental factors, jointly contribute to the complex human limb development. Copyright © 2018 Elsevier GmbH. All rights reserved.
Stevenson, S C; Rollence, M; White, B; Weaver, L; McClelland, A
1995-01-01
The adenovirus fiber protein is responsible for attachment of the virion to cell surface receptors. The identity of the cellular receptor which mediates binding is unknown, although there is evidence suggesting that two distinct adenovirus receptors interact with the group C (adenovirus type 5 [Ad5]) and the group B (Ad3) adenoviruses. In order to define the determinants of adenovirus receptor specificity, we have carried out a series of competition binding experiments using recombinant native fiber polypeptides from Ad5 and Ad3 and chimeric fiber proteins in which the head domains of Ad5 and Ad3 were exchanged. Specific binding of fiber to HeLa cell receptors was assessed with radiolabeled protein synthesized in vitro, and by competition analysis with baculovirus-expressed fiber protein. Fiber produced in vitro was found as both monomer and trimer, but only the assembled trimers had receptor binding activity. Competition data support the conclusion that Ad5 and Ad3 interact with different cellular receptors. The Ad5 receptor distribution on several cell lines was assessed with a fiber binding flow cytometric assay. HeLa cells were found to express high levels of receptor, while CHO and human diploid fibroblasts did not. A chimeric fiber containing the Ad5 fiber head domain blocked the binding of Ad5 fiber but not Ad3 fiber. Similarly, a chimeric fiber containing the Ad3 fiber head blocked the binding of labeled Ad3 fiber but not Ad5 fiber. In addition, the isolated Ad3 fiber head domain competed effectively with labeled Ad3 fiber for binding to HeLa cell receptors. These results demonstrate that the determinants of receptor binding are located in the head domain of the fiber and that the isolated head domain is capable of trimerization and binding to cellular receptors. Our results also show that it is possible to change the receptor specificity of the fiber protein by manipulation of sequences contained in the head domain. Modification or replacement of the fiber
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.
1995-04-10
The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less
CCR5 chemokine receptor gene polymorphisms in ocular toxoplasmosis.
de Faria Junior, Geraldo M; Ayo, Christiane M; de Oliveira, Amanda P; Lopes, Alessandro G; Frederico, Fábio B; Silveira-Carvalho, Aparecida P; Previato, Mariana; Barbosa, Amanda P; Murata, Fernando H A; de Almeida Junior, Gildásio Castello; Siqueira, Rubens Camargo; de Mattos, Luiz C; Brandão de Mattos, Cinara C
2018-02-01
CC chemokine receptor type 5 (CCR5) is a chemokine receptor that influences the immune response to infectious and parasitic diseases. This study aimed to determine whether the CCR5Δ32 and CCR5 59029 A/G polymorphisms are associated with the development of ocular toxoplasmosis in humans. Patients with positive serology for Toxoplasma gondii were analyzed and grouped as 'with ocular toxoplasmosis' (G1: n=160) or 'without ocular toxoplasmosis' (G2: n=160). A control group (G3) consisted of 160 individuals with negative serology. The characterization of the CCR5Δ32 and CCR5 59029 A/G polymorphisms was by PCR and by PCR-RFLP, respectively. The difference between the groups with respect to the mean age (G1: mean age: 47.3, SD±19.3, median: 46 [range: 18-95]; G2: mean age: 61.3, SD±13.7, median: 61 [range: 21-87]; G3: mean age: 38.8, SD±17.9, median: 34 [range: 18-80]) was statistically significant (G1 vs.G2: p-value <0.0001; t=7.21; DF=318; G1 vs.G3: p-value <0.0001; t=4.32; DF=318; G2 vs. G3: p-value <0.0001; t=9.62; DF=318). The Nagelkerke r 2 value was 0.040. There were statistically significant differences for the CCR5/CCR5 (p-value=0.008; OR=0.261), AA (p-value=0.007; OR=2.974) and AG genotypes (p-value=0.018; OR=2.447) between G1 and G2. Individuals with the CCR5/CCR5 genotype and simultaneously the CCR5-59029 AA or AG genotypes have a greater risk of developing ocular toxoplasmosis (4% greater), which may be associated with a strong and persistent inflammatory response in ocular tissue. Copyright © 2017 Elsevier B.V. All rights reserved.
Important roles of P2Y receptors in the inflammation and cancer of digestive system.
Wan, Han-Xing; Hu, Jian-Hong; Xie, Rei; Yang, Shi-Ming; Dong, Hui
2016-05-10
Purinergic signaling is important for many biological processes in humans. Purinoceptors P2Y are widely distributed in human digestive system and different subtypes of P2Y receptors mediate different physiological functions from metabolism, proliferation, differentiation to apoptosis etc. The P2Y receptors are essential in many gastrointestinal functions and also involve in the occurrence of some digestive diseases. Since different subtypes of P2Y receptors are present on the same cell of digestive organs, varying subtypes of P2Y receptors may have opposite or synergetic functions on the same cell. Recently, growing lines of evidence strongly suggest the involvement of P2Y receptors in the pathogenesis of several digestive diseases. In this review, we will focus on their important roles in the development of digestive inflammation and cancer. We anticipate that as the special subtypes of P2Y receptors are studied in depth, specific modulators for them will have good potentials to become promising new drugs to treat human digestive diseases in the near future.
Li, Hewang; Armando, Ines; Yu, Peiying; Escano, Crisanto; Mueller, Susette C.; Asico, Laureano; Pascua, Annabelle; Lu, Quansheng; Wang, Xiaoyan; Villar, Van Anthony M.; Jones, John E.; Wang, Zheng; Periasamy, Ammasi; Lau, Yuen-Sum; Soares-da-Silva, Patricio; Creswell, Karen; Guillemette, Gaétan; Sibley, David R.; Eisner, Gilbert; Felder, Robin A.; Jose, Pedro A.
2008-01-01
Hypertension is a multigenic disorder in which abnormal counterregulation between dopamine and Ang II plays a role. Recent studies suggest that this counterregulation results, at least in part, from regulation of the expression of both the antihypertensive dopamine 5 receptor (D5R) and the prohypertensive Ang II type 1 receptor (AT1R). In this report, we investigated the in vivo and in vitro interaction between these GPCRs. Disruption of the gene encoding D5R in mice increased both blood pressure and AT1R protein expression, and the increase in blood pressure was reversed by AT1R blockade. Activation of D5R increased the degradation of glycosylated AT1R in proteasomes in HEK cells and human renal proximal tubule cells heterologously and endogenously expressing human AT1R and D5R. Confocal microscopy, Förster/fluorescence resonance energy transfer microscopy, and fluorescence lifetime imaging microscopy revealed that activation of D5R initiated ubiquitination of the glycosylated AT1R at the plasma membrane. The regulated degradation of AT1R via a ubiquitin/proteasome pathway by activation of D5R provides what we believe to be a novel mechanism whereby blood pressure can be regulated by the interaction of 2 counterregulatory GPCRs. Our results therefore suggest that treatments for hypertension might be optimized by designing compounds that can target the AT1R and the D5R. PMID:18464932
Structural and Molecular Modeling Features of P2X Receptors
Alves, Luiz Anastacio; da Silva, João Herminio Martins; Ferreira, Dinarte Neto Moreira; Fidalgo-Neto, Antonio Augusto; Teixeira, Pedro Celso Nogueira; de Souza, Cristina Alves Magalhães; Caffarena, Ernesto Raúl; de Freitas, Mônica Santos
2014-01-01
Currently, adenosine 5′-triphosphate (ATP) is recognized as the extracellular messenger that acts through P2 receptors. P2 receptors are divided into two subtypes: P2Y metabotropic receptors and P2X ionotropic receptors, both of which are found in virtually all mammalian cell types studied. Due to the difficulty in studying membrane protein structures by X-ray crystallography or NMR techniques, there is little information about these structures available in the literature. Two structures of the P2X4 receptor in truncated form have been solved by crystallography. Molecular modeling has proven to be an excellent tool for studying ionotropic receptors. Recently, modeling studies carried out on P2X receptors have advanced our knowledge of the P2X receptor structure-function relationships. This review presents a brief history of ion channel structural studies and shows how modeling approaches can be used to address relevant questions about P2X receptors. PMID:24637936
Bombesin-like peptide receptors in human bronchial epithelial cells.
Kane, M A; Toi-Scott, M; Johnson, G L; Kelley, K K; Boose, D; Escobedo-Morse, A
1996-01-01
Northern blot and RNAse protection assays previously failed to detect bombesin-like peptide (BLP) receptors in normal human lung tissue, but by RT/PCR cultured human bronchial epithelial (HBE) cells expressed all three BLP receptor subtypes, predominantly neuromedin B (NMB) receptor. By RT/PCR, we found expression of all three BLP receptor subtypes by human lung tissue and confirmed NMB receptor expression in six out of six HBE samples. However, transformed HBE BEAS B2B cells expressed only gastrin-releasing peptide (GRP) receptors; saturable, high-affinity (Kd = 3.5 nM) specific [125I]GRP binding confirmed functional GRP receptor, with M(r) = 75 kDa and immunologic cross-reactivity with GRP receptor from human small-cell lung carcinoma (SCLC) NCI-H345 cells. Altered regulation of BLP receptors may accompany transformation of normal lung cells to cancer.
Anatomical relationships between serotonin 5-HT2A and dopamine D2 receptors in living human brain.
Ishii, Tatsuya; Kimura, Yasuyuki; Ichise, Masanori; Takahata, Keisuke; Kitamura, Soichiro; Moriguchi, Sho; Kubota, Manabu; Zhang, Ming-Rong; Yamada, Makiko; Higuchi, Makoto; Okubo, Yoshinori; Suhara, Tetsuya
2017-01-01
Seven healthy volunteers underwent PET scans with [18F]altanserin and [11C]FLB 457 for 5-HT2A and D2 receptors, respectively. As a measure of receptor density, a binding potential (BP) was calculated from PET data for 76 cerebral cortical regions. A correlation matrix was calculated between the binding potentials of [18F]altanserin and [11C]FLB 457 for those regions. The regional relationships were investigated using a bicluster analysis of the correlation matrix with an iterative signature algorithm. We identified two clusters of regions. The first cluster identified a distinct profile of correlation coefficients between 5-HT2A and D2 receptors, with the former in regions related to sensorimotor integration (supplementary motor area, superior parietal gyrus, and paracentral lobule) and the latter in most cortical regions. The second cluster identified another distinct profile of correlation coefficients between 5-HT2A receptors in the bilateral hippocampi and D2 receptors in most cortical regions. The observation of two distinct clusters in the correlation matrix suggests regional interactions between 5-HT2A and D2 receptors in sensorimotor integration and hippocampal function. A bicluster analysis of the correlation matrix of these neuroreceptors may be beneficial in understanding molecular networks in the human brain.
Sterle, Igor; Zupančič, Daša; Romih, Rok
2014-01-01
Terminal differentiation of urothelium is a prerequisite for blood-urine barrier formation and enables normal sensory function of the urinary bladder. In this study, urothelial differentiation of normal human urothelium and of low and high grade papillary urothelial carcinomas was correlated with the expression and localization of purinergic receptors (P2X3, and P2X5) and transient receptor potential vanilloid channels (TRPV1, and TRPV4). Western blotting and immunofluorescence of uroplakins together with scanning electron microscopy of urothelial apical surface demonstrated terminal differentiation of normal urothelium, partial differentiation of low grade carcinoma, and poor differentiation of high grade carcinoma. P2X3 was expressed in normal urothelium as well as in low grade carcinoma and in both cases immunolabeling was stronger in the superficial cells. P2X3 expression decreased in high grade carcinoma. P2X5 expression was detected in normal urothelium and in high grade carcinoma, while in low grade carcinoma its expression was diminished. The expression of TRPV1 decreased in low grade and even more in high grade carcinoma when compared with normal urothelium, while TRPV4 expression was unchanged in all samples. Our results suggest that sensory proteins P2X3 and TRPV1 are in correlation with urothelial differentiation, while P2X5 and TRPV4 have unique expression patterns. PMID:24868547
Sterle, Igor; Zupančič, Daša; Romih, Rok
2014-01-01
Terminal differentiation of urothelium is a prerequisite for blood-urine barrier formation and enables normal sensory function of the urinary bladder. In this study, urothelial differentiation of normal human urothelium and of low and high grade papillary urothelial carcinomas was correlated with the expression and localization of purinergic receptors (P2X3, and P2X5) and transient receptor potential vanilloid channels (TRPV1, and TRPV4). Western blotting and immunofluorescence of uroplakins together with scanning electron microscopy of urothelial apical surface demonstrated terminal differentiation of normal urothelium, partial differentiation of low grade carcinoma, and poor differentiation of high grade carcinoma. P2X3 was expressed in normal urothelium as well as in low grade carcinoma and in both cases immunolabeling was stronger in the superficial cells. P2X3 expression decreased in high grade carcinoma. P2X5 expression was detected in normal urothelium and in high grade carcinoma, while in low grade carcinoma its expression was diminished. The expression of TRPV1 decreased in low grade and even more in high grade carcinoma when compared with normal urothelium, while TRPV4 expression was unchanged in all samples. Our results suggest that sensory proteins P2X3 and TRPV1 are in correlation with urothelial differentiation, while P2X5 and TRPV4 have unique expression patterns.
P2X receptor characterization and IL-1/IL-1Ra release from human endothelial cells.
Wilson, H L; Varcoe, R W; Stokes, L; Holland, K L; Francis, S E; Dower, S K; Surprenant, A; Crossman, D C
2007-05-01
The pro-inflammatory cytokine, interleukin-1beta (IL-1beta), has been implicated in the pathogenesis of atherosclerosis, potentially via its release from vascular endothelium. Endothelial cells (EC) synthesize IL-1beta in response to inflammatory stimuli, but the demonstration and mechanism of release of IL-1 from ECs remains unclear. In activated monocytes, efficient release of bioactive IL-1beta occurred via activation of ATP-gated P2X(7) receptors (P2X(7)Rs). Activation of P2X(7)R in ECs from human umbilical vein (HUVECs) released IL-1 receptor antagonist (IL-1Ra). The purpose of this study was to provide a quantitative investigation of P2XR expression and function, in parallel with IL-1beta and IL-1Ra synthesis, processing and release, in HUVECs under pro-inflammatory conditions. Quantitative RT-PCR, immunoblotting, ELISA, flow cytometry, and whole-cell patch clamp recordings were used to determine protein expression and receptor function. IL-8-luciferase-reporter was used as an IL-1 sensitive bioassay. HUVECs expressed P2X(4)R and P2X(7)R subtypes and both were significantly up-regulated under inflammatory conditions. P2X(7)R currents were increased 3-fold by inflammatory stimuli, whereas no P2X(4)R-mediated currents were detected. Caspase-1, but not IL-1beta, was present intracellularly under basal conditions; inflammatory stimuli activated the synthesis of intracellular pro-IL-1beta and increased caspase-1 levels. Activation of P2X(7)Rs resulted in low-level release of bioactive IL-1beta and simultaneous release of IL-1Ra. The net biological effect of release was anti-inflammatory. Endothelial P2X(7)Rs induced secretion of both pro- and anti-inflammatory IL-1 receptor ligands, the balance of which may provide a means for altering the inflammatory state of the arterial vessel wall.
Khalafalla, Farid G; Greene, Steven; Khan, Hashim; Ilves, Kelli; Monsanto, Megan M; Alvarez, Roberto; Chavarria, Monica; Nguyen, Jonathan; Norman, Benjamin; Dembitsky, Walter P; Sussman, Mark A
2017-11-10
Autologous stem cell therapy using human c-Kit + cardiac progenitor cells (hCPCs) is a promising therapeutic approach for treatment of heart failure (HF). However, hCPCs derived from aged patients with HF with genetic predispositions and comorbidities of chronic diseases exhibit poor proliferative and migratory capabilities, which impair overall reparative potential for injured myocardium. Therefore, empowering functionally compromised hCPCs with proregenerative molecules ex vivo is crucial for improving the therapeutic outcome in patients with HF. To improve hCPC proliferation and migration responses that are critical for regeneration by targeting proregenerative P2Y 2 nucleotide receptor (P2Y 2 R) activated by extracellular ATP and UTP molecules released following injury/stress. c-Kit + hCPCs were isolated from cardiac tissue of patients with HF undergoing left ventricular assist device implantation surgery. Correlations between P2 nucleotide receptor expression and hCPC growth kinetics revealed downregulation of select P2 receptors, including P2Y 2 R, in slow-growing hCPCs compared with fast growers. hCPC proliferation and migration significantly improved by overexpressing or stimulating P2Y 2 R. Mechanistically, P2Y 2 R-induced proliferation and migration were dependent on activation of YAP (yes-associated protein)-the downstream effector of Hippo signaling pathway. Proliferation and migration of functionally impaired hCPCs are enhanced by P2Y 2 R-mediated YAP activation, revealing a novel link between extracellular nucleotides released during injury/stress and Hippo signaling-a central regulator of cardiac regeneration. Functional correlations exist between hCPC phenotypic properties and P2 purinergic receptor expression. Lack of P2Y 2 R and other crucial purinergic stress detectors could compromise hCPC responsiveness to presence of extracellular stress signals. These findings set the stage for subsequent studies to assess purinergic signaling modulation as a
Ecke, Denise; Hanck, Theodor; Tulapurkar, Mohan E; Schäfer, Rainer; Kassack, Matthias; Stricker, Rolf; Reiser, Georg
2008-01-01
Nucleotides signal through purinergic receptors such as the P2 receptors, which are subdivided into the ionotropic P2X receptors and the metabotropic P2Y receptors. The diversity of functions within the purinergic receptor family is required for the tissue-specificity of nucleotide signalling. In the present study, hetero-oligomerization between two metabotropic P2Y receptor subtypes is established. These receptors, P2Y1 and P2Y11, were found to associate together when co-expressed in HEK293 cells. This association was detected by co-pull-down, immunoprecipitation and FRET (fluorescence resonance energy transfer) experiments. We found a striking functional consequence of the interaction between the P2Y11 receptor and the P2Y1 receptor where this interaction promotes agonist-induced internalization of the P2Y11 receptor. This is remarkable because the P2Y11 receptor by itself is not able to undergo endocytosis. Co-internalization of these receptors was also seen in 1321N1 astrocytoma cells co-expressing both P2Y11 and P2Y1 receptors, upon stimulation with ATP or the P2Y1 receptor-specific agonist 2-MeS-ADP. 1321N1 astrocytoma cells do not express endogenous P2Y receptors. Moreover, in HEK293 cells, the P2Y11 receptor was found to functionally associate with endogenous P2Y1 receptors. Treatment of HEK293 cells with siRNA (small interfering RNA) directed against the P2Y1 receptor diminished the agonist-induced endocytosis of the heterologously expressed GFP-P2Y11 receptor. Pharmacological characteristics of the P2Y11 receptor expressed in HEK293 cells were determined by recording Ca2+ responses after nucleotide stimulation. This analysis revealed a ligand specificity which was different from the agonist profile established in cells expressing the P2Y11 receptor as the only metabotropic nucleotide receptor. Thus the hetero-oligomerization of the P2Y1 and P2Y11 receptors allows novel functions of the P2Y11 receptor in response to extracellular nucleotides.
P2X and P2Y receptors as possible targets of therapeutic manipulations in CNS illnesses.
Köles, Laszlo; Furst, Susanna; Illes, Peter
2005-03-01
Adenine and/or uridine nucleotide-sensitive receptors are classified into two types belonging to the ligand-gated ionotropic family (P2X) and the metabotropic, G-protein-coupled family (P2Y). In humans, seven different P2X receptors (P2X(1-7)) and eight different P2Y receptors (P2Y(1), P2Y(2), P2Y(4), P2Y(6), P2Y(11-14)) have been detected hitherto. All P2 receptors are expressed in the CNS, with the preferential expression of the P2X(2), P2X(4), P2X(6) and P2Y(1) receptors in neurons. In addition to the neurotransmitter and modulator functions, neurite outgrowth, proliferation of glial cells and the expression of transmitter receptors at target cells have also been suggested to be regulated by extracellular nucleotides in the nervous system. In spite of the expanding knowledge in the purinergic research field, the present therapeutic utilization of P2 receptor ligands is mostly related to peripheral diseases such as thromboembolic disorders and cystic fibrosis. In this review we provide some evidence that P2 receptors play an important role in the regulation of CNS functions related to hippocampal activity, the mesolimbic dopaminergic system and the nociceptive system. The role of purinergic receptors located on astrocytes/microglia and implications of these receptors for neurodegenerative/neuroinflammatory disorders, CNS injury and epilepsy will be highlighted as well. (c) 2005 Prous Science. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sonier, Brigitte; Arseneault, Madeleine; Institut National de la Recherche Scientifique-Institut Armand-Frappier, Montreal, Que.
2006-05-19
Serotonin (5-hydroxytryptamine, 5-HT) has been described as a mitogen in a variety of cell types and carcinomas. It exerts its mitogenic effect by interacting with a wide range of 5-HT receptor types. Certain studies suggest that some selective serotonin re-uptake inhibitors promote breast cancer in animals and humans. This study attempts to clarify the role of serotonin in promoting the growth of neoplastic mammary cells. Expression of the 5-HT{sub 2A} serotoninergic receptor subtype in MCF-7 cells was determined by RT-PCR, Western blotting, and immunofluorescence analysis. The mitogenic effect of 5-HT on MCF-7 cells was determined by means of the MTTmore » proliferation assay. We have demonstrated that the 5-HT{sub 2A} receptor subtype is fully expressed in the MCF-7 human breast cancer cell line, in terms of encoding mRNA and receptor protein. Automated sequencing has confirmed that the 5-HT{sub 2A} receptor present in this cell line is identical to the 5-HT{sub 2A} receptor found in human platelets and in human cerebral cortex. Furthermore, this receptor was found by immunofluorescence to be on the plasma membrane. MTT proliferation assays revealed that 5-HT and DOI, a selective 5-HT{sub 2A} receptor subtype agonist, stimulated MCF-7 cell. These results indicate that 5-HT plays a mitogenic role in neoplastic mammary cells. Our data also indicate that 5-HT exerts this positive growth effect on MCF-7 cells through, in part, the 5-HT{sub 2A} receptor subtype, which is fully expressed in this cell line.« less
Gounni, A S; Gregory, B; Nutku, E; Aris, F; Latifa, K; Minshall, E; North, J; Tavernier, J; Levit, R; Nicolaides, N; Robinson, D; Hamid, Q
2000-09-15
Interleukin-9 (IL-9) has been implicated in the pathogenesis of allergic disorders. To examine the interaction between IL-9 and eosinophils, we evaluated mature peripheral blood eosinophils for their expression of the specific alpha-subunit of the IL-9 receptor (IL-9R-alpha). The expression of IL-9R-alpha by human eosinophils was detected at the messenger RNA (mRNA) and protein levels by reverse transcriptase-polymerase chain reaction (RT-PCR), flow cytometry, and immunocytochemical analysis, respectively. Functional analyses demonstrated that recombinant human (rh)IL-9 inhibited in vitro peripheral blood human eosinophil apoptosis in a concentration-dependent manner. We then examined the role of IL-9 in eosinophil differentiation using the human cord blood CD34(+) cells and human promyelocytic leukemia cells (HL-60). The addition of IL-9 to CD34(+) cells cultured in IL-3 and IL-5 enhanced eosinophil development, and IL-9 alone induced the expression of IL-5R-alpha. IL-9 also up-regulated the IL-5R-alpha chain cell surface expression during terminal eosinophil differentiation of the HL-60 cell line. Our findings suggest that IL-9 may potentiate in vivo eosinophil function by increasing their survival and IL-5-mediated differentiation and maturation. Taken together, these results suggest a mechanism by which IL-9 potentiates airway and tissue eosinophilia.
Comparative receptor mapping of serotoninergic 5-HT3 and 5-HT4 binding sites*
NASA Astrophysics Data System (ADS)
López-Rodríguez, María L.; Morcillo, María José; Benhamú, Bellinda; Rosado, María Luisa
1997-11-01
The clinical use of currently available drugs acting at the5-HT4 receptor has been hampered by their lack of selectivityover 5-HT3 binding sites. For this reason, there is considerableinterest in the medicinal chemistry of these serotonin receptor subtypes, andsignificant effort has been made towards the discovery of potent and selectiveligands. Computer-aided conformational analysis was used to characterizeserotoninergic 5-HT3 and 5-HT4 receptorrecognition. On the basis of the generally accepted model of the5-HT3 antagonist pharmacophore, we have performed a receptormapping of this receptor binding site, following the active analog approach(AAA) defined by Marshall. The receptor excluded volume was calculated as theunion of the van der Waals density maps of nine active ligands(pKi ≥ 8.9), superimposed in pharmacophoric conformations.Six inactive analogs (pKi < 7.0) were subsequently used todefine the essential volume, which in its turn can be used to define theregions of steric intolerance of the 5-HT3 receptor. Five activeligands (pKi ≥ 9.3) at 5-HT4 receptors wereused to construct an antagonist pharmacophore for this receptor, and todetermine its excluded volume by superimposition of pharmacophoricconformations. The volume defined by the superimposition of five inactive5-HT4 receptor analogs that possess the pharmacophoric elements(pKi ≤ 6.6) did not exceed the excluded volume calculated forthis receptor. In this case, the inactivity may be due to the lack of positiveinteraction of the amino moiety with a hypothetical hydrophobic pocket, whichwould interact with the voluminous substituents of the basic nitrogen ofactive ligands. The difference between the excluded volumes of both receptorshas confirmed that the main difference is indeed in the basic moiety. Thus,the 5-HT3 receptor can only accommodate small substituents inthe position of the nitrogen atom, whereas the 5-HT4 receptorrequires more voluminous groups. Also, the basic nitrogen is located at ca
A new role for ATM in selective autophagy of peroxisomes (pexophagy).
Tripathi, Durga Nand; Zhang, Jiangwei; Jing, Ji; Dere, Ruhee; Walker, Cheryl Lyn
2016-01-01
Peroxisomes are autonomously replicating and highly metabolic organelles necessary for β-oxidation of fatty acids, a process that generates large amounts of reactive oxygen species (ROS). Maintaining a balance between biogenesis and degradation of peroxisomes is essential to maintain cellular redox balance, but how cells do this has remained somewhat of a mystery. While it is known that peroxisomes can be degraded via selective autophagy (pexophagy), little is known about how mammalian cells regulate pexophagy to maintain peroxisome homeostasis. We have uncovered a mechanism for regulating pexophagy in mammalian cells that defines a new role for ATM (ATM serine/threonine kinase) kinase as a "first responder" to peroxisomal ROS. ATM is delivered to the peroxisome by the PEX5 import receptor, which recognizes an SRL sequence located at the C terminus of ATM to localize this kinase to peroxisomes. In response to ROS, the ATM kinase is activated and performs 2 functions: i) it signals to AMPK, which activates TSC2 to suppresses MTORC1 and phosphorylates ULK1 to induce autophagy, and ii) targets specific peroxisomes for pexophagy by phosphorylating PEX5 at Ser141, which triggers ubiquitination of PEX5 at Lys209 and binding of the autophagy receptor protein SQSTM1/p62 to induce pexophagy.
A new role for ATM in selective autophagy of peroxisomes (pexophagy)
Tripathi, Durga Nand; Zhang, Jiangwei; Jing, Ji; Dere, Ruhee; Walker, Cheryl Lyn
2016-01-01
abstract Peroxisomes are autonomously replicating and highly metabolic organelles necessary for β-oxidation of fatty acids, a process that generates large amounts of reactive oxygen species (ROS). Maintaining a balance between biogenesis and degradation of peroxisomes is essential to maintain cellular redox balance, but how cells do this has remained somewhat of a mystery. While it is known that peroxisomes can be degraded via selective autophagy (pexophagy), little is known about how mammalian cells regulate pexophagy to maintain peroxisome homeostasis. We have uncovered a mechanism for regulating pexophagy in mammalian cells that defines a new role for ATM (ATM serine/threonine kinase) kinase as a “first responder” to peroxisomal ROS. ATM is delivered to the peroxisome by the PEX5 import receptor, which recognizes an SRL sequence located at the C terminus of ATM to localize this kinase to peroxisomes. In response to ROS, the ATM kinase is activated and performs 2 functions: i) it signals to AMPK, which activates TSC2 to suppresses MTORC1 and phosphorylates ULK1 to induce autophagy, and ii) targets specific peroxisomes for pexophagy by phosphorylating PEX5 at Ser141, which triggers ubiquitnation of PEX5 at Lys209 and binding of the autophagy receptor protein SQSTM1/p62 to induce pexophagy. PMID:27050462
Preiksaitis, H G; Krysiak, P S; Chrones, T; Rajgopal, V; Laurier, L G
2000-12-01
Esophageal peristalsis is dependent on activation of muscarinic receptors, but little is known about the roles of specific receptor subtypes in the human esophagus. We examined muscarinic receptor expression and function in human esophageal smooth muscle obtained from patients undergoing resection for cancer. [(3)H]Quinuclidinyl benzylate (QNB)-specific binding was similar in longitudinal muscle (B(max) = 106 +/- 22 fmol/mg of protein, K(d) = 68 +/- 9 pM) and circular muscle (B(max) = 81 +/- 16 fmol/mg of protein, K(d) = 79 +/- 15 pM). Subtype-selective antagonists inhibited [(3)H]QNB similarly in muscle from both layers. Further analysis of antagonist inhibition of [(3)H]QNB binding showed a major site (60-70%) with antagonist affinity profile consistent with the M2 subtype and a second site that could not be classified. Reverse transcription-polymerase chain reaction and immunoblotting demonstrated the presence of all five known muscarinic receptor subtypes, and immunocytochemistry on acutely isolated smooth muscle cells confirmed the expression of each subtype on the muscle cells. Subtype-selective antagonists had similar inhibitory effects on carbachol-evoked contractions in longitudinal muscle and circular muscle strips with pA(2) values of 9.5 +/- 0.1 and 9.6 +/- 0.2 for 4-diphenylacetoxy-N-methylpiperidine methiodide, 7.1 +/- 0.1 and 7.0 +/- 0.2 for pirenzepine, and 6.2 +/- 0.2 and 6.4 +/- 0.2 for methoctramine, respectively. We conclude that human esophageal smooth muscle expresses muscarinic receptor subtypes M1 through M5. The antagonist sensitivity profile for muscle contraction is consistent with activation of the M3 subtype.
Milne, Roger L.; Goode, Ellen L.; García-Closas, Montserrat; Couch, Fergus J.; Severi, Gianluca; Hein, Rebecca; Fredericksen, Zachary; Malats, Núria; Zamora, M. Pilar; Pérez, Jose Ignacio Arias; Benítez, Javier; Dörk, Thilo; Schürmann, Peter; Karstens, Johann H.; Hillemanns, Peter; Cox, Angela; Brock, Ian W.; Elliot, Graeme; Cross, Simon S.; Seal, Sheila; Turnbull, Clare; Renwick, Anthony; Rahman, Nazneen; Shen, Chen-Yang; Yu, Jyh-Cherng; Huang, Chiun-Sheng; Hou, Ming-Feng; Nordestgaard, Børge G.; Bojesen, Stig E.; Lanng, Charlotte; Alnæs, Grethe Grenaker; Kristensen, Vessela; Børrensen-Dale, Anne-Lise; Hopper, John L.; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Lambrechts, Diether; Yesilyurt, Betül T.; Floris, Giuseppe; Leunen, Karin; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Chang-Claude, Jenny; Wang-Gohrke, Shan; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Barile, Monica; Giles, Graham G.; Baglietto, Laura; John, Esther M.; Miron, Alexander; Chanock, Stephen J.; Lissowska, Jolanta; Sherman, Mark E.; Figueroa, Jonine D.; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Zalutsky, Iosif V.; Rogov, Yuri I.; Fasching, Peter A.; Bayer, Christian M.; Ekici, Arif B.; Beckmann, Matthias W.; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Meindl, Alfons; Heil, Joerg; Bartram, Claus R.; Schmutzler, Rita K.; Thomas, Gilles D.; Hoover, Robert N.; Fletcher, Olivia; Gibson, Lorna J.; Silva, Isabel dos Santos; Peto, Julian; Nickels, Stefan; Flesch-Janys, Dieter; Anton-Culver, Hoda; Ziogas, Argyrios; Sawyer, Elinor; Tomlinson, Ian; Kerin, Michael; Miller, Nicola; Schmidt, Marjanka K.; Broeks, Annegien; Van ‘t Veer, Laura J.; Tollenaar, Rob A.E.M.; Pharoah, Paul D.P.; Dunning, Alison M.; Pooley, Karen A.; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Kraft, Peter; Lindstrom, Sara; Chen, Xiaoqing; Beesley, Jonathan; Hamann, Ute; Harth, Volker; Justenhoven, Christina; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Hooning, Maartje; Hollestelle, Antoinette; Oldenburg, Rogier A.; Tilanus-Linthorst, Madeleine; Khusnutdinova, Elza; Bermisheva, Marina; Prokofieva, Darya; Farahtdinova, Albina; Olson, Janet E.; Wang, Xianshu; Humphreys, Manjeet K.; Wang, Qin; Chenevix-Trench, Georgia; Easton, Douglas F.
2014-01-01
Background The single nucleotide polymorphism 5p12-rs10941679has been found to be associated with risk of breast cancer, particularly estrogen receptor (ER)-positive disease. We aimed to further explore this association overall, and by tumor histopathology, in the Breast Cancer Association Consortium. Methods Data were combined from 37 studies, including 40,972 invasive cases, 1,398 cases of ductal carcinoma in situ (DCIS) and 46,334 controls, all of white European ancestry, as well as 3,007 invasive cases and 2,337 controls of Asian ancestry. Associations overall and by tumor invasiveness and histopathology were assessed using logistic regression. Results For white Europeans, the per-allele odds ratio (OR) associated with 5p12-rs10941679 was 1.11 (95% confidence interval [CI] =1.08–1.14, P=7×10−18) for invasive breast cancer and 1.10 (95%CI=1.01–1.21, P=0.03) for DCIS. For Asian women, the estimated OR for invasive disease was similar (OR=1.07, 95%CI=0.99–1.15, P=0.09). Further analyses suggested that the association in white Europeans was largely limited to progesterone receptor (PR)-positive disease (per-allele OR=1.16, 95%CI=1.12–1.20, P=1×10−18 versus OR=1.03, 95%CI=0.99–1.07, P=0.2 for PR-negative disease; P-heterogeneity=2×10−7); heterogeneity by estrogen receptor status was not observed (P=0.2) once PR status was accounted for. The association was also stronger for lower-grade tumors (per-allele OR [95%CI]=1.20 [1.14–1.25], 1.13 [1.09–1.16] and 1.04 [0.99–1.08] for grade 1, 2 and 3/4, respectively; P–trend=5×10−7). Conclusion 5p12 is a breast cancer susceptibility locus for PR-positive, lower gradebreast cancer. Impact Multi-centre fine-mapping studies of this region are needed as a first step to identifying the causal variant or variants. PMID:21795498
Vázquez-Cuevas, F G; Cruz-Rico, A; Garay, E; García-Carrancá, A; Pérez-Montiel, D; Juárez, B; Arellano, R O
2013-01-01
Purinergic signalling has been proposed as an intraovarian regulatory mechanism. Of the receptors responsible for purinergic transmission, the P2X7 receptor is an ATP-gated cationic channel that displays a broad spectrum of cellular functions ranging from apoptosis to cell proliferation and tumourigenesis. In the present study, we investigated the functional expression of P2X7 receptors in ovarian surface epithelium (OSE). P2X7 protein was detected in the OSE layer of the mouse, both in situ and in primary cultures. In cultures, 2'(3')-O-(4-Benzoylbenzoyl)adenosine-5'-triphosphate (BzATP) activation of P2X7 receptors increased [Ca(2+)]i and induced apoptosis. The functionality of the P2X7 receptor was investigated in situ by intrabursal injection of BzATP on each day of the oestrous cycle and evaluation of apoptosis 24h using the terminal deoxyribonucleotidyl transferase-mediated dUTP-fluorescein nick end-labelling (TUNEL) assay. Maximum effects of BzATP were observed during pro-oestrus, with the effects being blocked by A438079, a specific P2X7 receptor antagonist. Immunofluorescence staining for P2X7 protein revealed more robust expression during pro-oestrus and in OSE regions behind the antral follicles, strongly supporting the notion that the differences in apoptosis can be explained by increased receptor expression, which is regulated during the oestrous cycle. Finally, P2X7 receptor expression was detected in the OSE layer of human ovaries, with receptor expression maintained in human ovaries diagnosed with cancer, as well as in the human ovarian carcinoma SKOV3 cell line.
Holbrook, Joanna D; Gill, Catherine H; Zebda, Noureddine; Spencer, Jon P; Leyland, Rebecca; Rance, Kim H; Trinh, Han; Balmer, Gemma; Kelly, Fiona M; Yusaf, Shahnaz P; Courtenay, Nicola; Luck, Jane; Rhodes, Andrew; Modha, Sundip; Moore, Stephen E; Sanger, Gareth J; Gunthorpe, Martin J
2009-01-01
The 5-HT(3) receptor is a member of the 'Cys-loop' family of ligand-gated ion channels that mediate fast excitatory and inhibitory transmission in the nervous system. Current evidence points towards native 5-HT(3) receptors originating from homomeric assemblies of 5-HT(3A) or heteromeric assembly of 5-HT(3A) and 5-HT(3B). Novel genes encoding 5-HT(3C), 5-HT(3D), and 5-HT(3E) have recently been described but the functional importance of these proteins is unknown. In the present study, in silico analysis (confirmed by partial cloning) indicated that 5-HT(3C), 5-HT(3D), and 5-HT(3E) are not human-specific as previously reported: they are conserved in multiple mammalian species but are absent in rodents. Expression profiles of the novel human genes indicated high levels in the gastrointestinal tract but also in the brain, Dorsal Root Ganglion (DRG) and other tissues. Following the demonstration that these subunits are expressed at the cell membrane, the functional properties of the recombinant human subunits were investigated using patch clamp electrophysiology. 5-HT(3C), 5-HT(3D), and 5-HT(3E) were all non-functional when expressed alone. Co-transfection studies to determine potential novel heteromeric receptor interactions with 5-HT(3A) demonstrated that the expression or function of the receptor was modified by 5-HT(3C) and 5-HT(3E), but not 5-HT(3D). The lack of distinct effects on current rectification, kinetics or pharmacology of 5-HT(3A) receptors does not however provide unequivocal evidence to support a direct contribution of 5-HT(3C) or 5-HT(3E) to the lining of the ion channel pore of novel heteromeric receptors. The functional and pharmacological contributions of these novel subunits to human biology and diseases such as irritable bowel syndrome for which 5-HT(3) receptor antagonists have major clinical usage, therefore remains to be fully determined.
Substance P reduces TNF-α-induced apoptosis in human tenocytes through NK-1 receptor stimulation.
Backman, Ludvig J; Eriksson, Daniella E; Danielson, Patrik
2014-10-01
It has been hypothesised that an upregulation of the neuropeptide substance P (SP) and its preferred receptor, the neurokinin-1 receptor (NK-1 R), is a causative factor in inducing tenocyte hypercellularity, a characteristic of tendinosis, through both proliferative and antiapoptotic stimuli. We have demonstrated earlier that SP stimulates proliferation of human tenocytes in culture. The aim of this study was to investigate whether SP can mediate an antiapoptotic effect in tumour necrosis factor-α (TNF-α)-induced apoptosis of human tenocytes in vitro. A majority (approximately 75%) of tenocytes in culture were immunopositive for TNF Receptor-1 and TNF Receptor-2. Exposure of the cells to TNF-α significantly decreased cell viability, as shown with crystal violet staining. TNF-α furthermore significantly increased the amount of caspase-10 and caspase-3 mRNA, as well as both BID and cleaved-poly ADP ribosome polymerase (c-PARP) protein. Incubation of SP together with TNF-α resulted in a decreased amount of BID and c-PARP, and in a reduced lactate dehydrogenase release, as compared to incubation with TNF-α alone. The SP effect was blocked with a NK-1 R inhibitor. This study shows that SP, through stimulation of the NK-1 R, has the ability to reduce TNF-α-induced apoptosis of human tenocytes. Considering that SP has previously been shown to stimulate tenocyte proliferation, the study confirms SP as a potent regulator of cell-turnover in tendon tissue, capable of stimulating hypercellularity through different mechanisms. This gives further support for the theory that the upregulated amount of SP seen in tendinosis could contribute to hypercellularity. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Newman-Tancredi, Adrian; Cussac, Didier; Quentric, Yann; Touzard, Manuelle; Verrièle, Laurence; Carpentier, Nathalie; Millan, Mark J
2002-11-01
Although certain antiparkinson agents interact with serotonin (5-HT) receptors, little information is available concerning functional actions. Herein, we characterized efficacies of apomorphine, bromocriptine, cabergoline, lisuride, piribedil, pergolide, roxindole, and terguride at human (h)5-HT(1A), h5-HT(1B), and h5-HT(1D) receptors [guanosine 5'-O-(3-[(35)S]thio)triphosphate ([(35)S]GTPgammaS) binding], and at h5-HT(2A), h5-HT(2B), and h5-HT(2C) receptors (depletion of membrane-bound [(3)H]phosphatydilinositol). All drugs stimulated h5-HT(1A) receptors with efficacies (compared with 5-HT, 100%) ranging from modest (apomorphine, 35%) to high (cabergoline, 93%). At h5-HT(1B) receptors, efficacies varied from mild (terguride, 37%) to marked (cabergoline, 102%) and potencies were modest (pEC(50) values of 5.8-7.6): h5-HT(1D) sites were activated with a similar range of efficacies and greater potency (7.1-8.5). Piribedil and apomorphine were inactive at h5-HT(1B) and h5-HT(1D) receptors. At h5-HT(2A) receptors, terguride, lisuride, bromocriptine, cabergoline, and pergolide displayed potent (7.6-8.8) agonist properties (49-103%), whereas apomorphine and roxindole were antagonists and piribedil was inactive. Only pergolide (113%/8.2) and cabergoline (123%/8.6) displayed pronounced agonist properties at h5-HT(2B) receptors. At 5-HT(2C) receptors, lisuride, bromocriptine, pergolide, and cabergoline were efficacious (75-96%) agonists, apomorphine and terguride were antagonists, and piribedil was inactive. MDL100,907 and SB242,084, selective antagonists at 5-HT(2A) and 5-HT(2C) receptors, respectively, abolished these actions of pergolide, cabergoline, and bromocriptine. In conclusion, antiparkinson agents display markedly different patterns of agonist and antagonist properties at multiple 5-HT receptor subtypes. Although all show modest (agonist) activity at 5-HT(1A) sites, their contrasting actions at 5-HT(2A) and 5-HT(2C) sites may be of particular significance to their
Impaired P2X1 Receptor-Mediated Adhesion in Eosinophils from Asthmatic Patients.
Wright, Adam; Mahaut-Smith, Martyn; Symon, Fiona; Sylvius, Nicolas; Ran, Shaun; Bafadhel, Mona; Muessel, Michelle; Bradding, Peter; Wardlaw, Andrew; Vial, Catherine
2016-06-15
Eosinophils play an important role in the pathogenesis of asthma and can be activated by extracellular nucleotides released following cell damage or inflammation. For example, increased ATP concentrations were reported in bronchoalveolar lavage fluids of asthmatic patients. Although eosinophils are known to express several subtypes of P2 receptors for extracellular nucleotides, their function and contribution to asthma remain unclear. In this article, we show that transcripts for P2X1, P2X4, and P2X5 receptors were expressed in healthy and asthmatic eosinophils. The P2X receptor agonist α,β-methylene ATP (α,β-meATP; 10 μM) evoked rapidly activating and desensitizing inward currents (peak 18 ± 3 pA/pF at -60 mV) in healthy eosinophils, typical of P2X1 homomeric receptors, which were abolished by the selective P2X1 antagonist NF449 (1 μM) (3 ± 2 pA/pF). α,β-meATP-evoked currents were smaller in eosinophils from asthmatic patients (8 ± 2 versus 27 ± 5 pA/pF for healthy) but were enhanced following treatment with a high concentration of the nucleotidase apyrase (17 ± 5 pA/pF for 10 IU/ml and 11 ± 3 pA/pF for 0.32 IU/ml), indicating that the channels are partially desensitized by extracellular nucleotides. α,β-meATP (10 μM) increased the expression of CD11b activated form in eosinophils from healthy, but not asthmatic, donors (143 ± 21% and 108 ± 11% of control response, respectively). Furthermore, α,β-meATP increased healthy (18 ± 2% compared with control 10 ± 1%) but not asthmatic (13 ± 1% versus 10 ± 0% for control) eosinophil adhesion. Healthy human eosinophils express functional P2X1 receptors whose activation leads to eosinophil αMβ2 integrin-dependent adhesion. P2X1 responses are constitutively reduced in asthmatic compared with healthy eosinophils, probably as the result of an increase in extracellular nucleotide concentration. Copyright © 2016 by The American Association of Immunologists, Inc.
Wang, Rui; Xu, Ying; Wu, Hong-Li; Li, Ying-Bo; Li, Yu-Hua; Guo, Jia-Bin; Li, Xue-Jun
2008-01-06
Curcuma longa is a main constituent of many traditional Chinese medicines, such as Xiaoyao-san, used to manage mental disorders effectively. Curcumin is a major active component of C. longa and its antidepressant-like effect has been previously demonstrated in the forced swimming test. The purpose of this study was to explore the possible contribution of serotonin (5-HT) receptors in the behavioral effects induced by curcumin in this animal model of depression. 5-HT was depleted by the tryptophan hydroxylase inhibitor p-chlorophenylalanine (PCPA, 100 mg/kg, i.p.) prior to the administration of curcumin, and the consequent results showed that PCPA blocked the anti-immobility effect of curcumin in forced swimming test, suggesting the involvement of the serotonergic system. Moreover, pre-treatment of pindolol (10 mg/kg, i.p., a beta-adrenoceptors blocker/5-HT(1A/1B) receptor antagonist), 4-(2'-methoxy-phenyl)-1-[2'-(n-2''-pyridinyl)-p-iodobenzamino-]ethyl-piperazine (p-MPPI, 1 mg/kg, s.c., a selective 5-HT(1A) receptor antagonist), or 1-(2-(1-pyrrolyl)-phenoxy)-3-isopropylamino-2-propanol (isamoltane, 2.5 mg/kg, i.p., a 5-HT(1B) receptor antagonist) was found to prevent the effect of curcumin (10 mg/kg) in forced swimming test. On the other hand, a sub-effective dose of curcumin (2.5 mg/kg, p.o.) produced a synergistic effect when given jointly with (+)-8-hydroxy-2-(di-n-propylamino)tetralin, (8-OH-DPAT, 1 mg/kg, i.p., a 5-HT(1A) receptor agonist), anpirtoline (0.25 mg/kg, i.p., a 5-HT(1B) receptor agonist) or ritanserin (4 mg/kg, i.p., a 5-HT(2A/2C) receptor antagonist), but not with ketanserin (5 mg/kg, i.p., a 5-HT(2A/2C) receptor antagonist with higher affinity to 5-HT(2A) receptor) or R(-)-1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI, 1 mg/kg, i.p., a 5-HT(2A) receptor agonist). Taken together, these results indicate that the antidepressant-like effect of curcumin in the forced swimming test is related to serotonergic system and may be mediated by, at least
Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu
2017-08-02
Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
Elhusseiny, A; Cohen, Z; Olivier, A; Stanimirović, D B; Hamel, E
1999-07-01
Acetylcholine is an important regulator of local cerebral blood flow. There is, however, limited information available on the possible sites of action of this neurotransmitter on brain intraparenchymal microvessels. In this study, a combination of molecular and functional approaches was used to identify which of the five muscarinic acetylcholine receptors (mAChR) are present in human brain microvessels and their intimately associated astroglial cells. Microvessel and capillary fractions isolated from human cerebral cortex were found by reverse transcriptase-polymerase chain reaction to express m2, m3, and, occasionally, m1 and m5 receptor subtypes. To localize these receptors to a specific cellular compartment of the vessel wall, cultures of human brain microvascular endothelial and smooth muscle cells were used, together with cultured human brain astrocytes. Endothelial cells invariably expressed m2 and m5 receptors, and occasionally the m1 receptor; smooth muscle cells exhibited messages for all except the m4 mAChR subtypes, whereas messages for all five muscarinic receptors were identified in astrocytes. In all three cell types studied, acetylcholine induced a pirenzepine-sensitive increase (62% to 176%, P<0.05 to 0.01) in inositol trisphosphate, suggesting functional coupling of m1, m3, or m5 mAChR to a phospholipase C signaling cascade. Similarly, coupling of m2 or m4 mAChR to adenylate cyclase inhibition in endothelial cells and astrocytes, but not in smooth muscle cells, was demonstrated by the ability of carbachol to significantly reduce (44% to 50%, P<0.05 to 0.01) the forskolin-stimulated increase in cAMP levels. This effect was reversed by the mAChR antagonist AFDX 384. The results indicate that microvessels are able to respond to neurally released acetylcholine and that mAChR, distributed in different vascular and astroglial compartments, could regulate cortical perfusion and, possibly, blood-brain barrier permeability, functions that could become
Desai, Pankaj B; Nallani, Srikanth C; Sane, Rucha S; Moore, Linda B; Goodwin, Bryan J; Buckley, Donna J; Buckley, Arthur R
2002-05-01
Tamoxifen is a widely utilized antiestrogen in the treatment and chemoprevention of breast cancer. Clinical studies document that tamoxifen administration markedly enhances the systemic elimination of other drugs. Additionally, tamoxifen enhances its own clearance following repeated dosing. The mechanisms that underlie these clinically important events remain unresolved. Here, we report that tamoxifen and its metabolite 4-hydroxytamoxifen markedly induce cytochrome P450 3A4, a drug-metabolizing enzyme of central importance, in primary cultures of human hepatocytes. Tamoxifen and 4-hydroxytamoxifen (1-10 microM) significantly increased the CYP3A4 expression and activity (measured as the rate of testosterone 6beta-hydroxylation). Maximal induction was achieved at the 5 microM level. At this level, tamoxifen and 4-hydroxytamoxifen caused a 1.5- to 3.3-fold (mean, 2.1-fold) and 3.4- to 17-fold (mean, 7.5-fold) increase in the CYP3A4 activity, respectively. In comparison, rifampicin treatment resulted in a 6- to 16-fold (mean, 10.5-fold) increase. We also observed corresponding increase in the CYP3A4 immunoreactive protein and mRNA levels. Furthermore, tamoxifen and 4-hydroxytamoxifen efficaciously activated the human pregnane X receptor (hPXR; also known as the steroid xenobiotic receptor), a key regulator of CYP3A4 expression. The efficacy of tamoxifen and 4-hydroxytamoxifen relative to rifampicin for hPXR activation was approximately 30 and 60%, respectively. Our results indicate that the mechanism of tamoxifen-mediated alteration in drug clearance pathways in humans may involve CYP3A4 induction by the parent drug and/or its metabolite. Furthermore, the CYP3A4 induction may be a result of hPXR activation. These findings have important implications for optimizing the use of tamoxifen and in the development of newer antiestrogens.
Cao, Maria D.; Döpkens, Mailin; Krishnamachary, Balaji; Vesuna, Farhad; Gadiya, Mayur M.; Loenning, Per E.; Bhujwalla, Zaver M.; Gribbestad, Ingrid S.; Glunde, Kristine
2012-01-01
Altered choline phospholipid metabolism is a hallmark of cancer, leading to malignant choline metabolite profiles consisting of low glycerophosphocholine (GPC) and high phosphocholine (PC) in human breast cancers. Glycerophosphocholine phosphodiesterase (GPC-PDE) catalyzes the degradation of GPC to free choline and glycerol-3-phosphate. The gene(s) encoding for the GPC-PDE(s) responsible for GPC degradation in breast cancers have not yet been identified. Here we have demonstrated for the first time that the GPC-PDE encoded by glycerophosphodiester phosphodiesterase domain containing 5 (GDPD5) is associated with breast cancer malignancy. Two human breast cancer cell lines (n=8 and 10) and primary human breast tumor samples (n=19) were studied with combined magnetic resonance spectroscopy (MRS) and qRT-PCR to investigate several isoforms of GDPD expression with respect to choline phospholipid metabolite levels. Out of five GDPDs tested, GDPD5 was found to be significantly overexpressed in highly malignant estrogen receptor negative (ER−) compared to weakly malignant estrogen receptor positive (ER+) human breast cancer cells (P=0.027) and breast tumors from patients (P=0.015). GDPD5 showed significantly positive correlations with PC (P<0.001), total choline (tCho) (P=0.007) and PC/GPC (P<0.001) levels in human breast tumors. GDPD5 showed a trend towards negative correlation with GPC levels (P=0.130). Human breast cancers with malignant choline metabolite profiles consisting of low GPC and high PC levels highly co-expressed GDPD5, choline kinase alpha (CHKA), and phosphatidylcholine-specific phospholipase D1 (PLD1), while cancers containing high GPC and relatively low PC levels displayed low co-expression of GDPD5, CHKA, and PLD1. GDPD5, CHKA and PLD1 were significantly overexpressed in highly malignant ER− tumors in our patient cohort. Our study identified GDPD5 as a GPC-PDE that likely participates in regulating choline phospholipid metabolism in breast cancer
Choi, Won-Tak; An, Jing
2014-01-01
Chemokines and their receptors are implicated in a wide range of human diseases, including acquired immune deficiency syndrome (AIDS). The entry of human immunodeficiency virus type 1 (HIV-1) into a cell is initiated by the interaction of the virus’s surface envelope proteins with two cell surface components of the target cell, namely CD4 and a chemokine co-receptor, usually CXCR4 or CCR5. Typical anti-HIV-1 agents include protease and reverse transcriptase inhibitors, but the targets of these agents tend to show rapid mutation rates. As such, strategies based on HIV-1 co-receptors have appeal because they target invariant host determinants. Chemokines and their receptors are also of general interest since they play important roles in numerous physiological and pathological processes in addition to AIDS. Therefore, intensive basic and translational research is ongoing for the dissection of their structure – function relationships in an effort to understand the molecular mechanism of chemokine – receptor interactions and signal transductions across cellular membranes. This paper reviews and discusses recent advances and the translation of new knowledge and discoveries into novel interventional strategies for clinical application. PMID:21565895
Characteristics of recombinantly expressed rat and human histamine H3 receptors.
Wulff, Birgitte S; Hastrup, Sven; Rimvall, Karin
2002-10-18
Human and rat histamine H(3) receptors were recombinantly expressed and characterized using receptor binding and a functional cAMP assay. Seven of nine agonists had similar affinities and potencies at the rat and human histamine H(3) receptor. S-alpha-methylhistamine had a significantly higher affinity and potency at the human than rat receptor, and for 4-[(1R*,2R*)-2-(5,5-dimethyl-1-hexynyl)cyclopropyl]-1H-imidazole (Perceptin) the preference was the reverse. Only two of six antagonists had similar affinities and potencies at the human and the rat histamine H(3) receptor. Ciproxifan, thioperamide and (1R*,2R*)-trans-2-imidazol-4 ylcyclopropyl) (cyclohexylmethoxy) carboxamide (GT2394) had significantly higher affinities and potencies at the rat than at the human histamine H(3) receptor, while for N-(4-chlorobenzyl)-N-(7-pyrrolodin-1-ylheptyl)guanidine (JB98064) the preference was the reverse. All antagonists also showed potent inverse agonism properties. Iodoproxyfan, Perceptin, proxyfan and GR175737, compounds previously described as histamine H(3) receptor antagonists, acted as full or partial agonists at both the rat and the human histamine H(3) receptor. Copyright 2002 Elsevier Science B.V.
Kanagarajadurai, Karuppiah; Malini, Manoharan; Bhattacharya, Aditi; Panicker, Mitradas M; Sowdhamini, Ramanathan
2009-12-01
The serotonergic system has been implicated in emotional and cognitive function. In particular, 5-HT(2A) (5-hydroxytrytamine receptor 2A) is attributed to a number of disorders like schizophrenia, depression, eating disorders and anxiety. 5-HT(2A), being a GPCR (G-protein coupled receptor), is important in the pharmaceutical industry as a proven target for these disorders. Despite their extensive clinical importance, the structural studies of this protein is lacking due to difficulties in determining its crystal structure. We have performed sequence analysis and molecular modeling of 5-HT(2A) that has revealed a set of conserved residues and motifs considered to play an important role in maintaining structural integrity and function of the receptor. The analysis also revealed a set of residues specific to the receptor which distinguishes them from other members of the subclass and their orthologs. Further, starting from the model structure of human 5-HT(2A) receptor, docking studies were attempted to envisage how it might interact with eight of its ligands (such as serotonin, dopamine, DOI, LSD, haloperidol, ketanserin, risperidone and clozapine). The binding studies of dopamine to 5-HT(2A) receptor can bring up better understanding in the etiology of a number of neurological disorders involving both these two receptors. Our sequence analysis and study of interactions of this receptor with other ligands reveal additional residue hotspots such as Asn 363 and Tyr 370. The function of these residues can be further analyzed by rational design of site-directed mutagenesis. Two distinct binding sites are identified which could play important roles in ligand binding and signaling.
Tachykinins and tachykinin receptors in human uterus.
Patak, Eva; Candenas, M Luz; Pennefather, Jocelyn N; Ziccone, Sebastian; Lilley, Alison; Martín, Julio D; Flores, Carlos; Mantecón, Antonio G; Story, Margot E; Pinto, Francisco M
2003-06-01
(1) Studies were undertaken to determine the nature of the receptors mediating contractile effects of tachykinins in the uteri of nonpregnant women, and to analyse the expression of preprotachykinins (PPT), tachykinin receptors and the cell-surface peptidase, neprilysin (NEP), in the myometrium from pregnant and nonpregnant women. (2) The neurokinin B (NKB) precursor PPT-B was expressed in higher levels in the myometrium from nonpregnant than from pregnant women. Faint expression of PPT-A mRNA was detectable in the myometrium from nonpregnant but not pregnant women. PPT-C, the gene encoding the novel tachykinin peptide hemokinin-1 (HK-1), was present in trace amounts in the uteri from both pregnant and nonpregnant women. (3) Tachykinin NK(2) receptors were more strongly expressed in tissues from nonpregnant than from pregnant women. NK(1) receptor mRNA was present in low levels in tissues from both pregnant and nonpregnant women. A low abundance transcript corresponding to the NK(3) receptor was present only in tissues from nonpregnant women. (4) The mRNA expression of the tachykinin-degrading enzyme NEP was lower in tissues from nonpregnant than from pregnant women. (5) Substance P (SP), neurokinin A (NKA) and NKB, in the presence of the peptidase inhibitors thiorphan, captopril and bestatin, produced contractions of myometrium from nonpregnant women. The order of potency was NKA>SP>/=NKB. The potency of NKA was unchanged in the absence of peptidase inhibitors. (6) The tachykinin NK(2) receptor-selective agonist [Lys(5)MeLeu(9)Nle(10)]NKA(4-l0) was approximately equipotent with NKA, but the tachykinin NK(1) and NK(3) receptor-selective agonists [Sar(9)Met(O(2))(11)]SP and [MePhe(7)]NKB were ineffective in the myometrium from nonpregnant women. (7) The uterotonic effects of [Lys(5)MeLeu(9)Nle(10)]NKA(4-10) were antagonized by the tachykinin NK(2) receptor-selective antagonist SR48968. Neither atropine, nor phentolamine nor tetrodotoxin affected responses to [Lys(5
Matsumoto, Y; Kawatani, M; Simizu, S; Tanaka, T; Takada, M; Imoto, M
2000-01-01
The broad-spectrum antagonist of neuropeptide receptor, [D-Arg1, D-Phe5, D-Trp7,9, Leu11]substance P, induced apoptosis selectively in human small cell lung carcinoma (SCLC) cells, which express gastrin-releasing peptide receptor, but not in other types of tumor cells as well as normal cells. The addition of gastrin-releasing peptide or bombesin and the inhibitor of caspase-3 suppressed [D-Arg1, D-Phe5, D-Trp7,9, Leu11]substance P-induced apoptosis. Moreover, [D-Arg1, D-Phe5, D-Trp7,9, Leu11]substance P-induced apoptosis was not suppressed by Bcl-2 over-expression. Thus, blockage of gastrin-releasing peptide receptor-mediated signaling may provide a novel therapeutic option in SCLC which has become resistant to conventional chemotherapeutic agents.
Constitutively active 5-HT2/α1 receptors facilitate muscle spasms after human spinal cord injury
D'Amico, Jessica M.; Murray, Katherine C.; Li, Yaqing; Chan, K. Ming; Finlay, Mark G.; Bennett, David J.
2013-01-01
In animals, the recovery of motoneuron excitability in the months following a complete spinal cord injury is mediated, in part, by increases in constitutive serotonin (5-HT2) and norepinephrine (α1) receptor activity, which facilitates the reactivation of calcium-mediated persistent inward currents (CaPICs) without the ligands serotonin and norepinephrine below the injury. In this study we sought evidence for a similar role of constitutive monoamine receptor activity in the development of spasticity in human spinal cord injury. In chronically injured participants with partially preserved sensory and motor function, the serotonin reuptake inhibitor citalopram facilitated long-lasting reflex responses (spasms) previously shown to be mediated by CaPICs, suggesting that in incomplete spinal cord injury, functional descending sources of monoamines are present to activate monoamine receptors below the lesion. However, in participants with motor or motor/sensory complete injuries, the inverse agonist cyproheptadine, which blocks both ligand and constitutive 5-HT2/α1 receptor activity, decreased long-lasting reflexes, whereas the neutral antagonist chlorpromazine, which only blocks ligand activation of these receptors, had no effect. When tested in noninjured control participants having functional descending sources of monoamines, chlorpromazine was effective in reducing CaPIC-mediated motor unit activity. On the basis of these combined results, it appears that in severe spinal cord injury, facilitation of persistent inward currents and muscle spasms is mainly mediated by the activation of constitutive 5-HT2 and α1 receptor activity. Drugs that more selectively block these constitutively active monoamine receptors may provide better oral control of spasticity, especially in motor complete spinal cord injury where reducing motoneuron excitability is the primary goal. PMID:23221402
A comparative study of functional 5-HT4 receptors in human colon, rat oesophagus and rat ileum.
McLean, P. G.; Coupar, I. M.; Molenaar, P.
1995-01-01
1. The pharmacological properties of 5-hydroxytryptamine (5-HT), the 5-HT4 receptor agonists, DAU 6236 and SC 53116 and the 5-HT4 receptor antagonist, GR 1130808, were studied in the rat oesophagus, rat ileum and human colon. 2. 5-HT relaxed the longitudinal muscle of the rat oesophagus and rat ileum and the circular muscle of the human colon. Absolute values of relaxation were measured and showed the order of the maximum responses, rat oesophagus >> human colon > rat ileum with EC50 values of 189 +/- 15 nM, 157 +/- 4 nM, 306 +/- 72 nM, respectively. 5-HT also inhibited the spontaneous contractions of the human colon with an EC50 value of 119 +/- 1 nM. The effect of 5-HT on the human colon was not affected by methysergide (10 microM) or ondansetron (1 microM). 3. The use of the uptake and metabolism inhibitors, cocaine (30 microM) and pargyline (100 microM), did not increase the potency of 5-HT in the rat oesophagus or human colon. In the rat oesophagus, cocaine (30 microM) produced a reduction in carbachol-induced tone of 22.2 +/- 0.6% and reduced the 5-HT maximum effect by 52.0 +/- 0.4%. 4. The compounds, DAU 6236 and SC 53116, showed a different pattern of potencies and efficacies in the rat oesophagus, rat ileum and human colon compared to 5-HT. DAU 6236 relaxed the human colonic circular muscle with an EC50 value of 129 +/- 16 nM but its efficacy was less than that of 5-HT. DAU 6236 (1 microM) also antagonized the 5-HT-induced relaxation of the human colon with a dose-ratio of 9.9. In the rat oesophagus and rat ileum, DAU 6236 was inactive in the majority of tissues. In the minority of oesophagus tissues that did respond the EC50 value was 1.2 +/- 0.7 microM. DAU 6236 also antagonized the effect of 5-HT in the rat oesophagus in a non-surmountable fashion. SC 53116 relaxed the rat oesophagus with an EC50 value of 91 +/- 4 nM, with an efficacy less than that observed to 5-HT; however, at 200 nM it did not antagonize the 5-HT-induced relaxation of the rat
Klein, MT; Teitler, M
2011-01-01
BACKGROUND AND PURPOSE The human 5-hydroxytryptamine7 (h5-HT7) receptor is Gs-coupled and stimulates the production of the intracellular signalling molecule cAMP. Previously, we reported a novel property of the h5-HT7 receptor: pseudo-irreversible antagonists irreversibly inhibit forskolin-stimulated (non-receptor-mediated) cAMP production. Herein, we sought to determine if competitive antagonists also affect forskolin-stimulated activity and if this effect is common among other Gs-coupled receptors. EXPERIMENTAL APPROACH Recombinant cell lines expressing h5-HT7 receptors or other receptors of interest were briefly exposed to antagonists; cAMP production was then stimulated by forskolin and quantified by an immunocompetitive assay. KEY RESULTS In human embryonic kidney 293 cells stably expressing h5-HT7 receptors, all competitive antagonists inhibited nearly 100% of forskolin-stimulated cAMP production. This effect was insensitive to pertussis toxin, that is, not Gi/o-mediated. Potency to inhibit forskolin-stimulated activity strongly correlated with h5-HT7 binding affinity (r2= 0.91), indicating that the antagonists acted through h5-HT7 receptors to inhibit forskolin. Potency and maximal effects of clozapine, a prototypical competitive h5-HT7 antagonist, were unaffected by varying forskolin concentration. Antagonist interaction with h5-HT6, human β1, β2, and β3 adrenoceptors did not inhibit forskolin's activity. CONCLUSIONS AND IMPLICATIONS The inhibition of adenylate cyclase, as measured by forskolin's activity, is an underlying property of antagonist interaction with h5-HT7 receptors; however, this is not a common property of other Gs-coupled receptors. This phenomenon may be involved in the roles played by h5-HT7 receptors in human physiology. Development of h5-HT7 antagonists that do not elicit this effect would aid in the elucidation of its mechanisms and shed light on its possible physiological relevance. PMID:21198551
Gambaryan, A S; Tuzikov, A B; Bovin, N V; Yamnikova, S S; Lvov, D K; Webster, R G; Matrosovich, M N
2003-01-01
To study whether influenza virus receptors in chickens differ from those in other species, we compared the binding of lectins and influenza viruses with known receptor specificity to cell membranes and gangliosides from epithelial tissues of ducks, chickens, and African green monkeys. We found that chicken cells contained Neu5Ac alpha(2-6)Gal-terminated receptors recognized by Sambucus nigra lectin and by human viruses. This finding explains how some recent H9N2 viruses replicate in chickens despite their human virus-like receptor specificity. Duck virus bound to gangliosides with short sugar chains that were abundant in duck intestine. Human and chicken viruses did not bind to these gangliosides and bound more strongly than duck virus to gangliosides with long sugar chains that were found in chicken intestinal and monkey lung tissues. Chicken and duck viruses also differed by their ability to recognize the structure of the third sugar moiety in Sia2-3Gal-terminated receptors. Chicken viruses preferentially bound to Neu5Ac alpha(2-3)Gal beta(1-4)GlcNAc-containing synthetic sialylglycopolymer, whereas duck viruses displayed a higher affinity for Neu5Ac alpha(2-3)Gal beta(1-3)GalNAc-containing polymer. Our data indicate that sialyloligosaccharide receptors in different avian species are not identical and provide a potential explanation for the differences between the hemagglutinin and neuraminidase proteins of duck and chicken viruses.
Newman-Tancredi, A; Rivet, J-M; Cussac, D; Touzard, M; Chaput, C; Marini, L; Millan, M J
2003-09-01
This study employed [(35)S]guanosine 5'- O-(3-thiotriphosphate) ([(35)S]GTPgammaS) binding to compare the actions of antipsychotic agents known to stimulate cloned, human 5-HT(1A) receptors with those of reference agonists at postsynaptic 5-HT(1A) receptors. In rat hippocampal membranes, the following order of efficacy was observed (maximum efficacy, E(max), values relative to 5-HT=100): (+)8-OH-DPAT (85), flesinoxan (62), eltoprazine (60), S14506 (59), S16924 (48), buspirone (41), S15535 (22), clozapine (22), ziprasidone (21), pindolol (7), p-MPPI (0), WAY100,635 (0), spiperone (0). Despite differences in species and tissue source, the efficacy and potency (pEC(50)) of agonists (with the exception of clozapine) correlated well with those determined previously at human 5-HT(1A) receptors expressed in Chinese hamster ovary (CHO) cells. In contrast, clozapine was more potent at hippocampal membranes. The selective antagonists p-MPPI and WAY100,635 abolished stimulation of binding by (+)8-OH-DPAT, clozapine and S16924 (p-MPPI), indicating that these actions were mediated specifically by 5-HT(1A) receptors. Clozapine and S16924 also attenuated 5-HT- and (+)8-OH-DPAT-stimulated [(35)S]GTPgammaS binding, consistent with partial agonist properties. In [(35)S]GTPgammaS autoradiographic studies, 5-HT-induced stimulation, mediated through 5-HT(1A) receptors, was more potent in the septum (pEC(50) approximately 6.5) than in the dentate gyrus of the hippocampus (pEC(50) approximately 5) suggesting potential differences in coupling efficiency or G protein expression. Though clozapine (30 and 100 microM) did not enhance [(35)S]GTPgammaS labelling in any structure, S16924 (10 micro M) modestly increased [(35)S]GTPgammaS labelling in the dentate gyrus. On the other hand, both these antipsychotic agents attenuated 5-HT (10 microM)-stimulated [(35)S]GTPgammaS binding in the dentate gyrus and septum. In conclusion, clozapine, S16924 and ziprasidone act as partial agonists for G
Wang, Xia; Li, Long; Guan, Ruijuan; Zhu, Danian; Song, Nana; Shen, Linlin
2017-01-01
Extracellular ATP performs multiple important functions via activation of P2 receptors on the cell surface. P2Y receptors play critical roles in ATP evoked response in human lung adenocarcinoma cells (A549 cells). Emodin is an anthraquinone derivative originally isolated from Chinese rhubarb, possesses anticancer properties. In this study we examined the inhibiting effects of emodin on proliferation, migration and epithelial-mesenchymal transition (EMT) by suppressing P2Y receptors-dependent Ca2+ increase and nuclear factor-κB (NF-KB) signaling in A549 cells. A549 cells were pretreated with emodin before stimulation with ATP for the indicated time. Then, intracellular Ca2+ concentration ([Ca2+]i) was measured by Fluo-8/AM staining. Cell proliferation and cell cycle progression were tested by CCK8 assay and flow cytometry In addition, wound healing and western blot were performed to determine cell migration and related protein levels (Bcl-2, Bax, claudin-1, NF-κB). Emodin blunted ATP/UTP-induced increase of [Ca2+]i and cell proliferation concentration-dependently Meanwhile, it decreased ATP-induced cells accumulation in the S phase. Furthermore, emodin altered protein abundance of Bcl-2, Bax and claudin-1 and attenuated EMT caused by ATP. Such ATP-induced cellular reactions were also inhibited by a nonselective P2Y receptors antagonist, suramin, in a similar way to emodin. Besides, emodin could inhibit activation of NF-κB, thus suppressed ATP-induced proliferation, migration and EMT. Our results demonstrated that emodin inhibits ATP-induced proliferation, migration, EMT by suppressing P2Y receptors-mediated [Ca2+]i increase and NF-κB signaling in A549 cells. © 2017 The Author(s). Published by S. Karger AG, Basel.
Grant, Phillip; Ahlemeyer, Barbara; Karnati, Srikanth; Berg, Timm; Stelzig, Ingra; Nenicu, Anca; Kuchelmeister, Klaus; Crane, Denis I; Baumgart-Vogt, Eveline
2013-10-01
Catalase and ABCD3 are frequently used as markers for the localization of peroxisomes in morphological experiments. Their abundance, however, is highly dependent on metabolic demands, reducing the validity of analyses of peroxisomal abundance and distribution based solely on these proteins. We therefore attempted to find a protein which can be used as an optimal marker for peroxisomes in a variety of species, tissues, cell types and also experimental designs, independently of peroxisomal metabolism. We found that the biogenesis protein peroxin 14 (PEX14) is present in comparable amounts in the membranes of every peroxisome and is optimally suited for immunoblotting, immunohistochemistry, immunofluorescence, and immunoelectron microscopy. Using antibodies against PEX14, we could visualize peroxisomes with almost undetectable catalase content in various mammalian tissue sections (submandibular and adrenal gland, kidney, testis, ovary, brain, and pancreas from mouse, cat, baboon, and human) and cell cultures (primary cells and cell lines). Peroxisome labeling with catalase often showed a similar tissue distribution to the mitochondrial enzyme mitochondrial superoxide dismutase (both responsible for the degradation of reactive oxygen species), whereas ABCD3 exhibited a distinct labeling only in cells involved in lipid metabolism. We increased the sensitivity of our methods by using QuantumDots™, which have higher emission yields compared to classic fluorochromes and are unsusceptible to photobleaching, thereby allowing more exact quantification without artificial mistakes due to heterogeneity of individual peroxisomes. We conclude that PEX14 is indeed the best marker for labeling of peroxisomes in a variety of tissues and cell types in a consistent fashion for comparative morphometry.
Heusler, Peter; Newman-Tancredi, Adrian; Loock, Timothé; Cussac, Didier
2008-02-26
Antipsychotic drugs act preferentially via dopamine D(2) receptor blockade, but interaction with serotonin 5-HT(1A) receptors has attracted interest as additional target for antipsychotic treatment. As receptor internalisation is considered crucial for drug action, we tested the propensity of antipsychotics to internalise human (h)D(2S) receptors and h5-HT(1A) receptors. Agonist-induced internalisation of hemaglutinin (HA)-tagged hD(2S) and HA-h5-HT(1A) receptors expressed in HEK293 cells was increased by coexpression of G-protein coupled receptor kinase 2 and beta-arrestin2. At the HA-hD(2S) receptor, dopamine, quinpirole and bromocriptine behaved as full agonists, while S(-)-3-(3-hydroxyphenyl)-N-n-propylpiperidine [(-)-3PPP] and sarizotan were partial agonists. The typical antipsychotic, haloperidol, and the atypical compounds, olanzapine, nemonapride, ziprasidone and clozapine did not internalise HA-hD(2S) receptors, whereas aripiprazole potently internalised these receptors (>50% relative efficacy). Among antipsychotics with combined D(2)/5-HT(1A) properties, bifeprunox and (3-exo)-8-benzoyl-N-[[(2S)7-chloro-2,3-dihydro-1,4-benzodioxin-1-yl]methyl]-8-azabicyclo-[3.2.1]octane-3-methanamine (SSR181507) partially internalised HA-hD(2S) receptors, piperazine, 1-(2,3-dihydro-1,4-benzodioxin-5-yl)-4-[[5-(4-fluorophenyl)-3-pyridinyl]methyl (SLV313) and N-[(2,2-dimethyl-2,3-dihydro-benzofuran-7-yloxy)ethyl]-3-(cyclopent-1-enyl)-benzylamine (F15063) were inactive. At the HA-h5-HT(1A) receptor, serotonin, (+)-8-hydroxy-2-(di-n-propylamino)tetralin [(+)-8-OH-DPAT] and sarizotan were full agonists, buspirone acted as partial agonist. (-)-Pindolol showed little activity and no internalising properties were manifested for the 5-HT(1A) receptor antagonist N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]-ethyl]-N-(2-pyridinyl)cyclohexanecarboxamide (WAY100635). Most antipsychotics induced HA-h5-HT(1A) receptor internalisation, with an efficacy rank order: nemonapride>F15063>SSR181507
Receptor tyrosine kinase EphA5 is a functional molecular target in human lung cancer.
Staquicini, Fernanda I; Qian, Ming D; Salameh, Ahmad; Dobroff, Andrey S; Edwards, Julianna K; Cimino, Daniel F; Moeller, Benjamin J; Kelly, Patrick; Nunez, Maria I; Tang, Ximing; Liu, Diane D; Lee, J Jack; Hong, Waun Ki; Ferrara, Fortunato; Bradbury, Andrew R M; Lobb, Roy R; Edelman, Martin J; Sidman, Richard L; Wistuba, Ignacio I; Arap, Wadih; Pasqualini, Renata
2015-03-20
Lung cancer is often refractory to radiotherapy, but molecular mechanisms of tumor resistance remain poorly defined. Here we show that the receptor tyrosine kinase EphA5 is specifically overexpressed in lung cancer and is involved in regulating cellular responses to genotoxic insult. In the absence of EphA5, lung cancer cells displayed a defective G1/S cell cycle checkpoint, were unable to resolve DNA damage, and became radiosensitive. Upon irradiation, EphA5 was transported into the nucleus where it interacted with activated ATM (ataxia-telangiectasia mutated) at sites of DNA repair. Finally, we demonstrate that a new monoclonal antibody against human EphA5 sensitized lung cancer cells and human lung cancer xenografts to radiotherapy and significantly prolonged survival, thus suggesting the likelihood of translational applications. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Receptor tyrosine kinase EphA5 is a functional molecular target in human lung cancer
Staquicini, Fernanda I.; Qian, Ming D.; Salameh, Ahmad; ...
2015-03-20
Lung cancer is often refractory to radiotherapy, but molecular mechanisms of tumor resistance remain poorly defined. Here we show that the receptor tyrosine kinase EphA5 is specifically overexpressed in lung cancer and is involved in regulating cellular responses to genotoxic insult. In the absence of EphA5, lung cancer cells displayed a defective G1/S cell cycle checkpoint, were unable to resolve DNA damage, and became radiosensitive. Upon irradiation, EphA5 was transported into the nucleus where it interacted with activated ATM (ataxia-telangiectasia mutated) at sites of DNA repair. In conclusion, we demonstrate that a new monoclonal antibody against human EphA5 sensitized lungmore » cancer cells and human lung cancer xenografts to radiotherapy and significantly prolonged survival, thus suggesting the likelihood of translational applications.« less
Ugarte-Berzal, Estefanía; Bailón, Elvira; Amigo-Jiménez, Irene; Albar, Juan Pablo; García-Marco, José A; García-Pardo, Angeles
2014-05-30
(pro)MMP-9 binds to CLL cells through the PEX9 domain and contributes to CLL progression. To biochemically characterize this interaction and identify potential therapeutic targets, we prepared GST-PEX9 forms containing structural blades B1B2 or B3B4. We recently described a sequence in blade B4 (P3 sequence) that bound α4β1 integrin and partially impaired cell adhesion and migration. We have now studied the possible contribution of the B1B2 region to cell interaction with PEX9. CLL cells bound to GST-B1B2 and CD44 was the primary receptor. GST-B1B2 inhibited CLL cell migration as effectively as GST-B3B4. Overlapping synthetic peptides spanning the B1B2 region identified the sequence FDAIAEIGNQLYLFKDGKYW, present in B1 and contained in peptide P6, as the most effective site. P6 inhibited cell adhesion to PEX9 in a dose-dependent manner and with an IC50 value of 90 μM. P6 also inhibited cell adhesion to hyaluronan but had no effect on adhesion to VCAM-1 (α4β1 integrin ligand), confirming its specific interaction with CD44. Spatial localization analyses mapped P6 to the central cavity of PEX9, in close proximity to the previously identified P3 sequence. Both P6 and P3 equally impaired cell adhesion to (pro)MMP-9. Moreover, P6 synergistically cooperated with P3, resulting in complete inhibition of CLL cell binding to PEX9, chemotaxis, and transendothelial migration. Thus, P6 is a novel sequence in PEX9 involved in cell-PEX9/(pro)MMP-9 binding by interacting with CD44. Targeting both sites, P6 and P3, should efficiently prevent (pro)MMP-9 binding to CLL cells and its pathological consequences. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Adie, E J; Kalinka, S; Smith, L; Francis, M J; Marenghi, A; Cooper, M E; Briggs, M; Michael, N P; Milligan, G; Game, S
2002-11-01
G protein-coupled receptors (GPCRs) are the largest family of proteins involved in transmembrane signal transduction and are actively studied because of their suitability as therapeutic small-molecule drug targets. Agonist activation of GPCRs almost invariably results in the receptor being desensitized. One of the key events in receptor desensitization is the sequestration of the receptor from the cell surface into acidic intracellular endosomes. Therefore, a convenient, generic, and noninvasive monitor of this process is desirable. A novel, pH-sensitive, red-excited fluorescent dye, CypHer 5, was synthesized. This dye is non-fluorescent at neutral pH and is fluorescent at acidic pH. Anti-epitope antibodies labeled with this dye were internalized in an agonist concentration- and time-dependent manner, following binding on live cells to a range of GPCRs that had been modified to incorporate the epitope tags in their extracellular N-terminal domain. This resulted in a large signal increase over background. When protonated, the red fluorescence of CypHer 5 provides a generic reagent suitable for monitoring the internalization of GPCRs into acidic vesicles. This approach should be amenable to the study of many other classes of cell surface receptors that also internalize following stimulation.
Xing, Shu; Grol, Matthew W.; Grutter, Peter H.; Dixon, S. Jeffrey; Komarova, Svetlana V.
2016-01-01
Extracellular ATP acts on the P2X family of ligand-gated ion channels and several members of the P2Y family of G protein-coupled receptors to mediate intercellular communication among many cell types including bone-forming osteoblasts. It is known that multiple P2 receptors are expressed on osteoblasts (P2X2,5,6,7 and P2Y1,2,4,6). In the current study, we investigated complex interactions within the P2 receptor network using mathematical modeling. To characterize individual P2 receptors, we extracted data from published studies of overexpressed human and rodent (rat and mouse) receptors and fit their dependencies on ATP concentration using the Hill equation. Next, we examined responses induced by an ensemble of endogenously expressed P2 receptors. Murine osteoblastic cells (MC3T3-E1 cells) were loaded with fluo-4 and stimulated with varying concentrations of extracellular ATP. Elevations in the concentration of cytosolic free calcium ([Ca2+]i) were monitored by confocal microscopy. Dependence of the calcium response on ATP concentration exhibited a complex pattern that was not explained by the simple addition of individual receptor responses. Fitting the experimental data with a combination of Hill equations from individual receptors revealed that P2Y1 and P2X7 mediated the rise in [Ca2+]i at very low and high ATP concentrations, respectively. Interestingly, to describe responses at intermediate ATP concentrations, we had to assume that a receptor with a K1∕2 in that range (e.g. P2Y4 or P2X5) exerts an inhibitory effect. This study provides new insights into the interactions among individual P2 receptors in producing an ensemble response to extracellular ATP. PMID:27468270
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jingjing; Xu, Chen; Department of Orthopedics, Changzheng Hospital Affiliated to Second Military Medical University, 415th Feng Yang Road, Shanghai, 200003
Abstracts: MicroRNAs (miRNAs) are important endogenous gene regulators that play key roles in prostate cancer development and metastasis. However, specific miRNA expression patterns in prostate cancer tissues from Chinese patients remain largely unknown. In this study, we compared miRNA expression patterns in 65 pairs of prostate cancer and para-cancer tissues by RNA sequencing and found that miR-182-5p was the most up-regulated miRNA in prostate cancer tissues. The result was validated using realtime PCR in 18 pairs of prostate cancer and para-cancer tissues. In in vitro analysis, it was confirmed that miR-182-5p promotes prostate cancer cell proliferation, invasion and migration and inhibitmore » apoptosis. In addition, the androgen receptor directly regulated the transcription of miR-182-5p, which could target to the 3′UTR of ARRDC3 mRNA and affect the expression of ARRDC3 and its downstream gene ITGB4. For the in vivo experiment, miR-182-5p overexpression also promoted the growth and progression of prostate cancer tumors. In this regard, we suggest that miR-182-5p may be a key androgen receptor-regulated factor that contributes to the development and metastasis of Chinese prostate cancers and may be a potential target for the early diagnosis and therapeutic studies of prostate cancer. -- Highlights: •miR-182-5p is the mostly up-regulated miRNA in Chinese prostate cancer. •miR-182-5p is regulated by androgen receptor. •miR-182-5p promotes prostate cancer progression. •miR-182-5p regulates ARRDC3/ITGB4 pathway.« less
Identification of Odorant-Receptor Interactions by Global Mapping of the Human Odorome
Audouze, Karine; Tromelin, Anne; Le Bon, Anne Marie; Belloir, Christine; Petersen, Rasmus Koefoed; Kristiansen, Karsten; Brunak, Søren; Taboureau, Olivier
2014-01-01
The human olfactory system recognizes a broad spectrum of odorants using approximately 400 different olfactory receptors (hORs). Although significant improvements of heterologous expression systems used to study interactions between ORs and odorant molecules have been made, screening the olfactory repertoire of hORs remains a tremendous challenge. We therefore developed a chemical systems level approach based on protein-protein association network to investigate novel hOR-odorant relationships. Using this new approach, we proposed and validated new bioactivities for odorant molecules and OR2W1, OR51E1 and OR5P3. As it remains largely unknown how human perception of odorants influence or prevent diseases, we also developed an odorant-protein matrix to explore global relationships between chemicals, biological targets and disease susceptibilities. We successfully experimentally demonstrated interactions between odorants and the cannabinoid receptor 1 (CB1) and the peroxisome proliferator-activated receptor gamma (PPARγ). Overall, these results illustrate the potential of integrative systems chemical biology to explore the impact of odorant molecules on human health, i.e. human odorome. PMID:24695519
Structural Determinants for Naturally Evolving H5N1 Hemagglutinin to Switch its Receptor Specificity
Tharakaraman, Kannan; Raman, Rahul; Viswanathan, Karthik; Stebbins, Nathan W.; Jayaraman, Akila; Krishnan, Arvind; Sasisekharan, V.; Sasisekharan, Ram
2013-01-01
SUMMARY Of the factors governing human-to-human transmission of the highly pathogenic avian-adapted H5N1 virus, the most critical is the acquisition of mutations on the viral hemagglutinin (HA) to “quantitatively switch” its binding from avian to human glycan receptors. Herein, we describe a structural framework that outlines a necessary set of H5 HA receptor binding site (RBS) features required for the H5 HA to quantitatively switch its preference to human receptors. We show here that the same RBS HA mutations that lead to aerosol transmission of A/Vietnam/1203/04 and A/Indonesia/5/05 viruses, when introduced in currently circulating H5N1, do not lead to quantitative switch in receptor preference. We demonstrate that HAs from circulating clades require as few as a single base-pair mutation to quantitatively switch their binding to human receptors. The mutations identified by this study can be used to monitor the emergence of strains having human-to-human transmission potential. PMID:23746829
Giuliani, S; Patacchini, R; Barbanti, G; Turini, D; Rovero, P; Quartara, L; Giachetti, A; Maggi, C A
1993-11-01
The tachykinin (NK2) receptor-mediating contraction of the human isolated bladder to NKA was investigated by studying the affinities of eight structurally different receptor-selective antagonists (linear peptides, cyclic peptides and pseudopeptides, nonpeptide NK2 receptor antagonists). The affinities of the antagonists were compared to those measured for the same ligands at the NK2 receptors previously characterized in the rabbit pulmonary artery and hamster trachea. In the presence of a cocktail of peptidase inhibitors (bestatin captopril and thiorphan, 1 microM each) no significant correlation was found between pA2 values measured in the human bladder vs. those measured in the other two NK2 receptor-bearing preparation. In the presence of the aminopeptidase inhibitor amastatin, however, pA2 values of linear antagonists bearing an N-terminal Asp residue MEN 10,207 and MEN 10,376 were significantly enhanced and these pA2 values were used for analysis; a significant correlation was found between pA2 values measured in the human urinary bladder and rabbit pulmonary artery. The pseudopeptide analog of NKA (4-10), MDL 28,564 which also bears a N-terminal Asp residue behaved as an agonist and its action was enhanced by amastatin. We conclude that the NK2 receptor-mediating contraction of the human urinary bladder smooth muscle is similar to that previously characterized in the rabbit pulmonary artery (NK2A receptor category); in the human bladder smooth muscle an amastatin-sensitive peptidase (possibly aminopeptidase A) limits biological activity of linear peptide derivatives of NKA bearing a N-terminal Asp residue.
Milne, Roger L; Goode, Ellen L; García-Closas, Montserrat; Couch, Fergus J; Severi, Gianluca; Hein, Rebecca; Fredericksen, Zachary; Malats, Núria; Zamora, M Pilar; Arias Pérez, Jose Ignacio; Benítez, Javier; Dörk, Thilo; Schürmann, Peter; Karstens, Johann H; Hillemanns, Peter; Cox, Angela; Brock, Ian W; Elliot, Graeme; Cross, Simon S; Seal, Sheila; Turnbull, Clare; Renwick, Anthony; Rahman, Nazneen; Shen, Chen-Yang; Yu, Jyh-Cherng; Huang, Chiun-Sheng; Hou, Ming-Feng; Nordestgaard, Børge G; Bojesen, Stig E; Lanng, Charlotte; Grenaker Alnæs, Grethe; Kristensen, Vessela; Børrensen-Dale, Anne-Lise; Hopper, John L; Dite, Gillian S; Apicella, Carmel; Southey, Melissa C; Lambrechts, Diether; Yesilyurt, Betül T; Floris, Giuseppe; Leunen, Karin; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Chang-Claude, Jenny; Wang-Gohrke, Shan; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Barile, Monica; Giles, Graham G; Baglietto, Laura; John, Esther M; Miron, Alexander; Chanock, Stephen J; Lissowska, Jolanta; Sherman, Mark E; Figueroa, Jonine D; Bogdanova, Natalia V; Antonenkova, Natalia N; Zalutsky, Iosif V; Rogov, Yuri I; Fasching, Peter A; Bayer, Christian M; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Meindl, Alfons; Heil, Joerg; Bartram, Claus R; Schmutzler, Rita K; Thomas, Gilles D; Hoover, Robert N; Fletcher, Olivia; Gibson, Lorna J; dos Santos Silva, Isabel; Peto, Julian; Nickels, Stefan; Flesch-Janys, Dieter; Anton-Culver, Hoda; Ziogas, Argyrios; Sawyer, Elinor; Tomlinson, Ian; Kerin, Michael; Miller, Nicola; Schmidt, Marjanka K; Broeks, Annegien; Van 't Veer, Laura J; Tollenaar, Rob A E M; Pharoah, Paul D P; Dunning, Alison M; Pooley, Karen A; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J; Hankinson, Susan E; Kraft, Peter; Lindstrom, Sara; Chen, Xiaoqing; Beesley, Jonathan; Hamann, Ute; Harth, Volker; Justenhoven, Christina; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Hooning, Maartje; Hollestelle, Antoinette; Oldenburg, Rogier A; Tilanus-Linthorst, Madeleine; Khusnutdinova, Elza; Bermisheva, Marina; Prokofieva, Darya; Farahtdinova, Albina; Olson, Janet E; Wang, Xianshu; Humphreys, Manjeet K; Wang, Qin; Chenevix-Trench, Georgia; Easton, Douglas F
2011-10-01
The single-nucleotide polymorphism (SNP) 5p12-rs10941679 has been found to be associated with risk of breast cancer, particularly estrogen receptor (ER)-positive disease. We aimed to further explore this association overall, and by tumor histopathology, in the Breast Cancer Association Consortium. Data were combined from 37 studies, including 40,972 invasive cases, 1,398 cases of ductal carcinoma in situ (DCIS), and 46,334 controls, all of white European ancestry, as well as 3,007 invasive cases and 2,337 controls of Asian ancestry. Associations overall and by tumor invasiveness and histopathology were assessed using logistic regression. For white Europeans, the per-allele OR associated with 5p12-rs10941679 was 1.11 (95% CI = 1.08-1.14, P = 7 × 10(-18)) for invasive breast cancer and 1.10 (95% CI = 1.01-1.21, P = 0.03) for DCIS. For Asian women, the estimated OR for invasive disease was similar (OR = 1.07, 95%CI = 0.99-1.15, P = 0.09). Further analyses suggested that the association in white Europeans was largely limited to progesterone receptor (PR)-positive disease (per-allele OR = 1.16, 95% CI = 1.12-1.20, P = 1 × 10(-18) vs. OR = 1.03, 95% CI = 0.99-1.07, P = 0.2 for PR-negative disease; P(heterogeneity) = 2 × 10(-7)); heterogeneity by ER status was not observed (P = 0.2) once PR status was accounted for. The association was also stronger for lower grade tumors [per-allele OR (95% CI) = 1.20 (1.14-1.25), 1.13 (1.09-1.16), and 1.04 (0.99-1.08) for grade 1, 2, and 3/4, respectively; P(trend) = 5 × 10(-7)]. 5p12 is a breast cancer susceptibility locus for PR-positive, lower grade breast cancer. Multicenter fine-mapping studies of this region are needed as a first step to identifying the causal variant or variants. ©2011 AACR
McLean, P. G.; Coupar, I. M.
1996-01-01
1. The nature of the receptor coupling mechanism of the 5-hydroxytryptamine4 (5-HT4) receptor in the circular smooth muscle of the human colon has been further investigated. 2. 5-HT stimulated cyclic AMP generation and caused a relaxation in a concentration-dependent fashion, with EC50 values of 175.5 and 274.9 nM respectively. DAU 6236 increased cyclic AMP formation and caused a relaxant effect but was a partial agonist relative to 5-HT. 3. The 5-HT4 receptor antagonist, GR 113808, inhibited cyclic AMP formation and relaxation induced by 5-HT with -log Ki values of 9.1 (cyclic AMP) and 8.9 (relaxation) and apparent pA2 values of 9.2 (cyclic AMP) and 9.5 (relaxation). 4. Ondansetron and methysergide failed to inhibit cyclic AMP formation or the relaxation induced by 5-HT. 5. The phosphodiesterase inhibitor, IBMX, produced a concentration-dependent relaxation (EC50 = 30 microM) and at 1 microM it enhanced the 5-HT-induced relaxation producing a leftward shift of the 5-HT concentration-effect curve with a concentration-ratio of 4.1. Rolipram caused a concentration-dependent relaxation (EC50 = 564.8 nM) and at 200 nm caused a leftward shift of the concentration-effect curve to 5-HT with a concentration-ratio of 5.5. 6. Application of the adenylyl cyclase inhibitor, SQ 22536 (0.1 mM), and the protein kinase inhibitors, H7 (100 nM) and H89 (200 nM), inhibited the relaxant effect of 5-HT inducing a rightward shift of the concentration-effect curve with concentration-ratios of 10.1, 2.7 and 4.2 respectively. 7. Forskolin stimulated cyclic AMP production and caused a relaxation. The maximum relaxant effect of forskolin (6 microM, 13.8 +/- 1.9 cm.s) was not significantly different from the maximum relaxant effect of 5-HT (10 microM, 12.7 +/- 4.9 cm.s). However, the cyclic AMP levels stimulated by forskolin (6 microM, 49.3 +/- 6.6 pmol mg-1) were markedly greater than those stimulated by 5-HT (10 microM, 7.6 +/- 2.0 pmol mg-1). 8. In conclusion, these results indicate that
McLean, P G; Coupar, I M
1996-06-01
1. The nature of the receptor coupling mechanism of the 5-hydroxytryptamine4 (5-HT4) receptor in the circular smooth muscle of the human colon has been further investigated. 2. 5-HT stimulated cyclic AMP generation and caused a relaxation in a concentration-dependent fashion, with EC50 values of 175.5 and 274.9 nM respectively. DAU 6236 increased cyclic AMP formation and caused a relaxant effect but was a partial agonist relative to 5-HT. 3. The 5-HT4 receptor antagonist, GR 113808, inhibited cyclic AMP formation and relaxation induced by 5-HT with -log Ki values of 9.1 (cyclic AMP) and 8.9 (relaxation) and apparent pA2 values of 9.2 (cyclic AMP) and 9.5 (relaxation). 4. Ondansetron and methysergide failed to inhibit cyclic AMP formation or the relaxation induced by 5-HT. 5. The phosphodiesterase inhibitor, IBMX, produced a concentration-dependent relaxation (EC50 = 30 microM) and at 1 microM it enhanced the 5-HT-induced relaxation producing a leftward shift of the 5-HT concentration-effect curve with a concentration-ratio of 4.1. Rolipram caused a concentration-dependent relaxation (EC50 = 564.8 nM) and at 200 nm caused a leftward shift of the concentration-effect curve to 5-HT with a concentration-ratio of 5.5. 6. Application of the adenylyl cyclase inhibitor, SQ 22536 (0.1 mM), and the protein kinase inhibitors, H7 (100 nM) and H89 (200 nM), inhibited the relaxant effect of 5-HT inducing a rightward shift of the concentration-effect curve with concentration-ratios of 10.1, 2.7 and 4.2 respectively. 7. Forskolin stimulated cyclic AMP production and caused a relaxation. The maximum relaxant effect of forskolin (6 microM, 13.8 +/- 1.9 cm.s) was not significantly different from the maximum relaxant effect of 5-HT (10 microM, 12.7 +/- 4.9 cm.s). However, the cyclic AMP levels stimulated by forskolin (6 microM, 49.3 +/- 6.6 pmol mg-1) were markedly greater than those stimulated by 5-HT (10 microM, 7.6 +/- 2.0 pmol mg-1). 8. In conclusion, these results indicate that
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803
Tachykinins and tachykinin receptors in human uterus
Patak, Eva; Luz Candenas, M; Pennefather, Jocelyn N; Ziccone, Sebastian; Lilley, Alison; Martín, Julio D; Flores, Carlos; Mantecón, Antonio G; Story, Margot E; Pinto, Francisco M
2003-01-01
Studies were undertaken to determine the nature of the receptors mediating contractile effects of tachykinins in the uteri of nonpregnant women, and to analyse the expression of preprotachykinins (PPT), tachykinin receptors and the cell-surface peptidase, neprilysin (NEP), in the myometrium from pregnant and nonpregnant women. The neurokinin B (NKB) precursor PPT-B was expressed in higher levels in the myometrium from nonpregnant than from pregnant women. Faint expression of PPT-A mRNA was detectable in the myometrium from nonpregnant but not pregnant women. PPT-C, the gene encoding the novel tachykinin peptide hemokinin-1 (HK-1), was present in trace amounts in the uteri from both pregnant and nonpregnant women. Tachykinin NK2 receptors were more strongly expressed in tissues from nonpregnant than from pregnant women. NK1 receptor mRNA was present in low levels in tissues from both pregnant and nonpregnant women. A low abundance transcript corresponding to the NK3 receptor was present only in tissues from nonpregnant women. The mRNA expression of the tachykinin-degrading enzyme NEP was lower in tissues from nonpregnant than from pregnant women. Substance P (SP), neurokinin A (NKA) and NKB, in the presence of the peptidase inhibitors thiorphan, captopril and bestatin, produced contractions of myometrium from nonpregnant women. The order of potency was NKA≫SP≥NKB. The potency of NKA was unchanged in the absence of peptidase inhibitors. The tachykinin NK2 receptor-selective agonist [Lys5MeLeu9Nle10]NKA(4–l0) was approximately equipotent with NKA, but the tachykinin NK1 and NK3 receptor-selective agonists [Sar9Met(O2)11]SP and [MePhe7]NKB were ineffective in the myometrium from nonpregnant women. The uterotonic effects of [Lys5MeLeu9Nle10]NKA(4–10) were antagonized by the tachykinin NK2 receptor-selective antagonist SR48968. Neither atropine, nor phentolamine nor tetrodotoxin affected responses to [Lys5MeLeu9Nle10]NKA(4–10). These data are consistent with a
O'Keeffe, Mary G; Thorne, Peter R; Housley, Gary D; Robson, Simon C; Vlajkovic, Srdjan M
2010-04-01
Ectonucleoside triphosphate diphosphohydrolases (E-NTPDases) regulate complex extracellular P2 receptor signalling pathways in mammalian tissues by hydrolysing extracellular nucleotides to the respective nucleosides. All enzymes from this family (NTPDase1-8) are expressed in the adult rat cochlea. This study reports the changes in expression of NTPDase5 and NTPDase6 in the developing rat cochlea. These two intracellular members of the E-NTPDase family can be released in a soluble form and show preference for nucleoside 5'-diphosphates, such as UDP and GDP. Here, we demonstrate differential spatial and temporal patterns for NTPDase5 and NTPDase6 expression during cochlear development, which are indicative of both cytosolic and extracellular action via pyrimidines. NTPDase5 is noted during the early postnatal period in developing sensory hair cells and supporting Deiters' cells of the organ of Corti, and primary auditory neurons located in the spiral ganglion. In contrast, NTPDase6 is confined to the embryonic and early postnatal hair cell bundles. NTPDase6 immunolocalisation in the developing cochlea underpins its putative role in hair cell bundle development, probably via cytosolic action, whilst NTPDase5 may have a broader extracellular role in the development of sensory and neural tissues in the rat cochlea. Both NTPDase5 and NTPDase6 colocalize with UDP-preferring P2Y(4), P2Y(6) and P2Y(14) receptors during cochlear development, but this strong association was lost in the adult cochlea. Spatiotemporal topographic expression of NTPDase5 and NTPDase6 and P2Y receptors in adult and developing cochlear tissues provide strong support for the role of pyrimidinergic signalling in cochlear development.
PLC-mediated PI(4,5)P2 hydrolysis regulates activation and inactivation of TRPC6/7 channels
Itsuki, Kyohei; Imai, Yuko; Hase, Hideharu; Okamura, Yasushi; Inoue, Ryuji
2014-01-01
Transient receptor potential classical (or canonical) (TRPC)3, TRPC6, and TRPC7 are a subfamily of TRPC channels activated by diacylglycerol (DAG) produced through the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) by phospholipase C (PLC). PI(4,5)P2 depletion by a heterologously expressed phosphatase inhibits TRPC3, TRPC6, and TRPC7 activity independently of DAG; however, the physiological role of PI(4,5)P2 reduction on channel activity remains unclear. We used Förster resonance energy transfer (FRET) to measure PI(4,5)P2 or DAG dynamics concurrently with TRPC6 or TRPC7 currents after agonist stimulation of receptors that couple to Gq and thereby activate PLC. Measurements made at different levels of receptor activation revealed a correlation between the kinetics of PI(4,5)P2 reduction and those of receptor-operated TRPC6 and TRPC7 current activation and inactivation. In contrast, DAG production correlated with channel activation but not inactivation; moreover, the time course of channel inactivation was unchanged in protein kinase C–insensitive mutants. These results suggest that inactivation of receptor-operated TRPC currents is primarily mediated by the dissociation of PI(4,5)P2. We determined the functional dissociation constant of PI(4,5)P2 to TRPC channels using FRET of the PLCδ Pleckstrin homology domain (PHd), which binds PI(4,5)P2, and used this constant to fit our experimental data to a model in which channel gating is controlled by PI(4,5)P2 and DAG. This model predicted similar FRET dynamics of the PHd to measured FRET in either human embryonic kidney cells or smooth muscle cells, whereas a model lacking PI(4,5)P2 regulation failed to reproduce the experimental data, confirming the inhibitory role of PI(4,5)P2 depletion on TRPC currents. Our model also explains various PLC-dependent characteristics of channel activity, including limitation of maximum open probability, shortening of the peak time, and the bell-shaped response of
Protective role for miR-9-5p in the fibrogenic transformation of human dermal fibroblasts.
Miguel, Verónica; Busnadiego, Oscar; Fierro-Fernández, Marta; Lamas, Santiago
2016-01-01
Excessive accumulation of extracellular matrix (ECM) proteins is the hallmark of fibrotic diseases, including skin fibrosis. This response relies on the activation of dermal fibroblasts that evolve into a pro-fibrogenic phenotype. One of the major players in this process is the cytokine transforming growth factor-β (TGF-β). MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression affecting a wide range of pathophysiological events including fibrogenesis. MicroRNA-9-5p (miR-9-5p) has been shown to exert a protective role in lung and peritoneal fibrosis. This study aimed to evaluate the role of miR-9-5p in skin fibrosis. miR-9-5p is up-regulated in TGF-β1-treated human dermal fibroblasts (HDFs). In silico identification of miR-9-5p targets spotted the type II TGF-β receptor (TGFBR2) as a potential TGF-β signaling-related effector for this miRNA. Consistently, over-expression of miR-9-5p in HDFs down-regulated TGFBR2 at both the mRNA and protein levels and reduced the phosphorylation of Smad2 and the translocation of Smad2/3 to the nucleus. In keeping, over-expression of miR-9-5p significantly delayed TGF-β1-dependent transformation of dermal fibroblasts, decreasing the expression of ECM protein collagen, type I, alpha 1 (Col1α1), and fibronectin (FN), the amount of secreted collagen proteins, and the expression of the archetypal myofibroblast marker alpha-smooth muscle actin (α-SMA). By contrast, specific inhibition of miR-9-5p resulted in enhanced presence of fibrosis markers. The expression of miR-9-5p was also detected in the skin and plasma in the mouse model of bleomycin-induced dermal fibrosis. Using lentiviral constructs, we demonstrated that miR-9-5p over-expression was also capable of deterring fibrogenesis in this same model. miR-9-5p significantly prevents fibrogenesis in skin fibrosis. This is mediated by an abrogation of TGF-β-mediated signaling through the down-regulation of TGFBR2 expression in HDFs
Tulapurkar, M E; Laubinger, W; Nahum, V; Fischer, B; Reiser, G
2004-01-01
P2Y-nucleotide receptors represent important targets for drug development. The lack of stable and receptor specific agonists, however, has prevented successful therapeutic applications. A novel series of P-boronated ATP derivatives (ATP-α-B) were synthesized by substitution of a nonbridging O at Pα with a BH3 group. This introduces a chiral center, thus resulting in diastereoisomers. In addition, at C2 of the adenine ring a further substitution was made (Cl- or methylthio-). The pairs of diastereoisomers were denoted here as A and B isomers. Here, we tested the receptor subtype specificity of these analogs on HEK 293 cells stably expressing rat P2Y1 and rat P2Y2 receptors, respectively, both attached to the fluorescent marker protein GFP (rP2Y1-GFP, rP2Y2-GFP). We investigated agonist-induced receptor endocytosis, [Ca2+]i rise and arachidonic acid (AA) release. Agonist-induced endocytosis of rP2Y1-GFP was more pronounced for the A isomers than the corresponding B counterparts for all ATP-α-B analogs. Both 2-MeS-substituted diastereoisomers induced a greater degree of agonist-induced receptor endocytosis as compared to the 2-Cl-substituted derivatives. Endocytosis results are in accordance with the potency to induce Ca2+ release by these compounds in HEK 293 cells stably transfected with rP2Y1. In case of rP2Y2-GFP, the borano-nucleotides were very weak agonists in comparison to UTP and ATP in terms of Ca2+ release, AA release and in inducing receptor endocytosis. The different ATP-α-B derivatives and also the diastereoisomers were equally ineffective. Thus, the new agonists may be considered as potent and highly specific agonist drug candidates for P2Y1 receptors. The difference in activity of the ATP analogs at P2Y receptors could be used as a tool to investigate structural differences between P2Y receptor subtypes. PMID:15197109
miR-539-5p inhibits experimental choroidal neovascularization by targeting CXCR7.
Feng, Yifan; Wang, Jing; Yuan, Yuanzhi; Zhang, Xi; Shen, Minqian; Yuan, Fei
2018-03-01
Stromal cell-derived factor-1 (SDF-1) has been previously confirmed to participate in the formation of choroidal neovascularization (CNV) via its receptor, CXC chemokine receptor (CXCR) 4; CXCR7 is a recently identified receptor for SDF-1. The molecular mechanisms and therapeutic value of CXCR7 in CNV remain undefined. In this study, experimental CNV was induced by laser photocoagulation in Brown-Norway pigmented rats, and aberrant CXCR7 overexpression was detected in the retinal pigment epithelial/choroid/sclera tissues of laser-injured eyes. Blockade of CXCR7 activation via CXCR7 knockdown or neutralizing Ab administration inhibited SDF-1-induced cell survival and the tubular formation of human retinal microvascular endothelial cells (HRMECs) in vitro and reduced CNV leakage and lesion size in vivo. By using microRNA array screening and bioinformatic analyses, we identified miR-539-5p as a regulator of CXCR7. Transfection of HRMECs and choroid-retinal endothelial (RF/6A) cells with the miR-539-5p mimic inhibited their survival and tube formation, whereas CXCR7 overexpression rescued the suppressive effect of miR-539-5p. The antiangiogenic activities of the miR-539-5p mimic were additionally demonstrated in vivo by intravitreal injection. ERK1/2 and AKT signaling downstream of CXCR7 is involved in the miR-539-5p regulation of endothelial cell behaviors. These findings suggest that the manipulation of miR-539-5p/CXCR7 levels may have important therapeutic implications in CNV-associated diseases.-Feng, Y., Wang, J., Yuan, Y., Zhang, X., Shen, M., Yuan, F. miR-539-5p inhibits experimental choroidal neovascularization by targeting CXCR7.
Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.
Schuetz, J D; Guzelian, P S
1995-03-14
We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.
Srinivasan, Subhashini; Mir, Fozia; Huang, Jin-Sheng; Khasawneh, Fadi T.; Lam, Stephen C.-T.; Le Breton, Guy C.
2009-01-01
ADP plays an integral role in the process of hemostasis by signaling through two platelet G-protein-coupled receptors, P2Y1 and P2Y12. The recent use of antagonists against these two receptors has contributed a substantial body of data characterizing the ADP signaling pathways in human platelets. Specifically, the results have indicated that although P2Y1 receptors are involved in the initiation of platelet aggregation, P2Y12 receptor activation appears to account for the bulk of the ADP-mediated effects. Based on this consideration, emphasis has been placed on the development of a new class of P2Y12 antagonists (separate from clopidogrel and ticlopidine) as an approach to the treatment of thromboembolic disorders. The present work examined the molecular mechanisms by which two of these widely used adenosine-based P2Y12 antagonists (2-methylthioadenosine 5′-monophosphate triethylammonium salt (2MeSAMP) and ARC69931MX), inhibit human platelet activation. It was found that both of these compounds raise platelet cAMP to levels that substantially inhibit platelet aggregation. Furthermore, the results demonstrated that this elevation of cAMP did not require Gi signaling or functional P2Y12 receptors but was mediated through activation of a separate G protein-coupled pathway, presumably involving Gs. However, additional experiments revealed that neither 2MeSAMP nor ARC69931MX (cangrelor) increased cAMP through activation of A2a, IP, DP, or EP2 receptors, which are known to couple to Gs. Collectively, these findings indicate that 2MeSAMP and ARC69931MX interact with an unidentified platelet G protein-coupled receptor that stimulates cAMP-mediated inhibition of platelet function. This inhibition is in addition to that derived from antagonism of P2Y12 receptors. PMID:19346255
P2 receptor-stimulation influences axonal outgrowth in the developing hippocampus in vitro.
Heine, C; Heimrich, B; Vogt, J; Wegner, A; Illes, P; Franke, Heike
2006-01-01
Extracellular ATP might act as a trophic factor on growing axons during development of the CNS via P2 receptors. In the present study the postnatal presence of selected P2 receptor subtypes was analyzed and their putative trophic capacity in entorhino-hippocampal slice co-cultures of mouse brain was tested. The effect of the P2 receptor ligands 2-methylthioadenosine-5'-triphosphate (P2X/Y receptor agonist) and pyridoxalphosphate-6-azophenyl-2',4'-disulphonic acid (P2X/Y receptor antagonist) on axonal growth and fiber density of biocytin-labeled hippocampal projections was compared both with untreated cultures and with cultures treated with artificial cerebrospinal fluid. After 10 days in vitro, double immunofluorescence labeling revealed the expression of P2X(1), P2X(2), P2X(4) as well as P2Y(1) and P2Y(2) receptors in the examined regions of entorhinal fiber termination. Further, quantitative analysis of identified biocytin-traced entorhinal fibers showed a significant increase in fiber density in the dentate gyrus after incubation of the slices with the P2 receptor agonist 2-methylthioadenosine-5'-triphosphate. This neurite outgrowth promoting effect was completely abolished by the P2 receptor antagonist pyridoxalphosphate-6-azophenyl-2',4'-disulphonic acid. Our in vitro data indicate that ATP via its P2X and P2Y receptors can shape hippocampal connectivity during development.
Donoso, María Verónica; Norambuena, Andrés; Navarrete, Camilo; Poblete, Inés; Velasco, Alfredo; Huidobro-Toro, Juan Pablo
2014-02-01
To assess the role of the P2X1 receptors (P2X1R) in the longitudinal and circular layers of the human vas deferens, ex vivo-isolated strips or rings were prepared from tissue biopsies to record isometric contractions. To ascertain its membrane distribution, tissue extracts were analyzed by immunoblotting following sucrose gradient ultracentrifugation. ATP, alpha,beta-methylene ATP, or electrical field stimulation elicited robust contractions of the longitudinal layer but not of the circular layer which demonstrated inconsistent responses. Alpha,beta-methylene ATP generated stronger and more robust contractions than ATP. In parallel, prostatic segments of the rat vas deferens were examined. The motor responses in both species were not sustained but decayed within the first minute, showing desensitization to additional applications. Cross-desensitization was established between alpha,beta-methylene ATP or ATP-evoked contractions and electrical field stimulation-induced contractions. Full recovery of the desensitized motor responses required more than 30 min and showed a similar pattern in human and rat tissues. Immunoblot analysis of the human vas deferens extracts revealed a P2X1R oligomer of approximately 200 kDa under nonreducing conditions, whereas dithiothreitol-treated extracts showed a single band of approximately 70 kDa. The P2X1R was identified in ultracentrifugation fractions containing 15%-29% sucrose; the receptor localized in the same fractions as flotillin-1, indicating that it regionalized into smooth muscle lipid rafts. In conclusion, ATP plays a key role in human vas deferens contractile responses of the longitudinal smooth muscle layer, an effect mediated through P2X1Rs.
Critical roles of chemokine receptor CCR5 in regulating glioblastoma proliferation and invasion.
Zhao, Lanfu; Wang, Yuan; Xue, Yafei; Lv, Wenhai; Zhang, Yufu; He, Shiming
2015-11-01
Glioblastoma (GBM) is the most prevalent malignant primary brain tumor in adults and exhibits a spectrum of aberrantly aggressive phenotype. Tumor cell proliferation and invasion are critically regulated by chemokines and their receptors. Recent studies have shown that the chemokine CCL5 and its receptor CCR5 play important roles in tumor invasion and metastasis. Nonetheless, the roles of the CCR5 in GBM still remain unclear. The present study provides the evidence that the chemokine receptor CCR5 is highly expressed and associated with poor prognosis in human GBM. Mechanistically, CCL5-CCR5 mediates activation of Akt, and subsequently induces proliferation and invasive responses in U87 and U251 cells. Moreover, down-regulation of CCR5 significantly inhibited the growth of glioma in U87 tumor xenograft mouse model. Finally, high CCR5 expression in GBM is correlated with increased p-Akt expression in patient samples. Together, these findings suggest that the CCR5 is a critical molecular event associated with gliomagenesis. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Molecular structure of P2X receptors.
Egan, Terrance M; Cox, Jane A; Voigt, Mark M
2004-01-01
P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.
Optical control of trimeric P2X receptors and acid-sensing ion channels.
Browne, Liam E; Nunes, João P M; Sim, Joan A; Chudasama, Vijay; Bragg, Laricia; Caddick, Stephen; North, R Alan
2014-01-07
P2X receptors are trimeric membrane proteins that function as ion channels gated by extracellular ATP. We have engineered a P2X2 receptor that opens within milliseconds by irradiation at 440 nm, and rapidly closes at 360 nm. This requires bridging receptor subunits via covalent attachment of 4,4'-bis(maleimido)azobenzene to a cysteine residue (P329C) introduced into each second transmembrane domain. The cis-trans isomerization of the azobenzene pushes apart the outer ends of the transmembrane helices and opens the channel in a light-dependent manner. Light-activated channels exhibited similar unitary currents, rectification, calcium permeability, and dye uptake as P2X2 receptors activated by ATP. P2X3 receptors with an equivalent mutation (P320C) were also light sensitive after chemical modification. They showed typical rapid desensitization, and they could coassemble with native P2X2 subunits in pheochromocytoma cells to form light-activated heteromeric P2X2/3 receptors. A similar approach was used to open and close human acid-sensing ion channels (ASICs), which are also trimers but are unrelated in sequence to P2X receptors. The experiments indicate that the opening of the permeation pathway requires similar and substantial movements of the transmembrane helices in both P2X receptors and ASICs, and the method will allow precise optical control of P2X receptors or ASICs in intact tissues.
Optical control of trimeric P2X receptors and acid-sensing ion channels
Browne, Liam E.; Nunes, João P. M.; Sim, Joan A.; Chudasama, Vijay; Bragg, Laricia; Caddick, Stephen; Alan North, R.
2014-01-01
P2X receptors are trimeric membrane proteins that function as ion channels gated by extracellular ATP. We have engineered a P2X2 receptor that opens within milliseconds by irradiation at 440 nm, and rapidly closes at 360 nm. This requires bridging receptor subunits via covalent attachment of 4,4'-bis(maleimido)azobenzene to a cysteine residue (P329C) introduced into each second transmembrane domain. The cis–trans isomerization of the azobenzene pushes apart the outer ends of the transmembrane helices and opens the channel in a light-dependent manner. Light-activated channels exhibited similar unitary currents, rectification, calcium permeability, and dye uptake as P2X2 receptors activated by ATP. P2X3 receptors with an equivalent mutation (P320C) were also light sensitive after chemical modification. They showed typical rapid desensitization, and they could coassemble with native P2X2 subunits in pheochromocytoma cells to form light-activated heteromeric P2X2/3 receptors. A similar approach was used to open and close human acid-sensing ion channels (ASICs), which are also trimers but are unrelated in sequence to P2X receptors. The experiments indicate that the opening of the permeation pathway requires similar and substantial movements of the transmembrane helices in both P2X receptors and ASICs, and the method will allow precise optical control of P2X receptors or ASICs in intact tissues. PMID:24367083
In vitro contractile effects of neurokinin receptor blockade in the human ureter.
Nakada, S Y; Jerde, T J; Bjorling, D E; Saban, R
2001-10-01
We identified the predominance of neurokinin-2 receptors and evaluated the inhibition of spontaneous contraction via the blockade of neurokinin-2 receptors in human ureteral segments. Excess ureteral segments from human subjects undergoing donor nephrectomy or reconstructive procedures were suspended in tissue baths containing Krebs buffer. After spontaneous contractions were recorded, tissues were incubated with 1 microM. solutions of phosphoramidon and captopril (to inhibit peptide degradation) and either the neurokinin-1 receptor antagonist CP 99,994, the neurokinin-2 receptor antagonist SR 48,968, the neurokinin-3 receptor antagonist SR 142,801 or dimethyl sulfoxide (control) for 1 hour. Contraction magnitude and frequency were again recorded and compared with spontaneous levels. Concentration-response curves to the tachykinins substance P, and neurokinins A and B were determined in the presence and absence of antagonists. Neurokinin A increased contractility at lower concentrations than substance P or neurokinin B (p <0.013). Neurokinin-2 receptor blockade produced a 100-fold rightward shift of the concentration-response curves (p <0.013), while neurokinins 1 and 3 receptor blockade had no effect. SR 48,968 significantly reduced contractility during the 1-hour incubation period, causing a 97% reduction in spontaneous rates compared with a 29% reduction in control tissues. CP 99,994 and SR 142,801 had no significant effect. Neurokinin-2 is the predominant receptor subtype responsible for tachykinin induced contraction of human ureteral smooth muscle. In vitro treatment with the neurokinin-2 antagonist SR 48,968 reduces the spontaneous contraction rate by 97% in vitro. Neurokinin-2 receptor antagonists may have clinical applications for ureteral disease.
The role of GABAB receptors in human reinforcement learning.
Ort, Andres; Kometer, Michael; Rohde, Judith; Seifritz, Erich; Vollenweider, Franz X
2014-10-01
Behavioral evidence from human studies suggests that the γ-aminobutyric acid type B receptor (GABAB receptor) agonist baclofen modulates reinforcement learning and reduces craving in patients with addiction spectrum disorders. However, in contrast to the well established role of dopamine in reinforcement learning, the mechanisms by which the GABAB receptor influences reinforcement learning in humans remain completely unknown. To further elucidate this issue, a cross-over, double-blind, placebo-controlled study was performed in healthy human subjects (N=15) to test the effects of baclofen (20 and 50mg p.o.) on probabilistic reinforcement learning. Outcomes were the feedback-induced P2 component of the event-related potential, the feedback-related negativity, and the P300 component of the event-related potential. Baclofen produced a reduction of P2 amplitude over the course of the experiment, but did not modulate the feedback-related negativity. Furthermore, there was a trend towards increased learning after baclofen administration relative to placebo over the course of the experiment. The present results extend previous theories of reinforcement learning, which focus on the importance of mesolimbic dopamine signaling, and indicate that stimulation of cortical GABAB receptors in a fronto-parietal network leads to better attentional allocation in reinforcement learning. This observation is a first step in our understanding of how baclofen may improve reinforcement learning in healthy subjects. Further studies with bigger sample sizes are needed to corroborate this conclusion and furthermore, test this effect in patients with addiction spectrum disorder. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.
Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Xueyong; Viswanathan, Karthik; Raman, Rahul
Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA) mutants from ferret-transmissible H5N1 viruses of A/Viet Nam/1203/04 and A/Indonesia/5/05 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6 linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3 linked sialosides.more » Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogues reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.« less
Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants
Zhu, Xueyong; Viswanathan, Karthik; Raman, Rahul; ...
2015-11-01
Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA) mutants from ferret-transmissible H5N1 viruses of A/Viet Nam/1203/04 and A/Indonesia/5/05 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6 linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3 linked sialosides.more » Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogues reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.« less
Pharmacological characterization of human recombinant melatonin mt1 and MT2 receptors
Browning, Christopher; Beresford, Isabel; Fraser, Neil; Giles, Heather
2000-01-01
We have pharmacologically characterized recombinant human mt1 and MT2 receptors, stably expressed in Chinese hamster ovary cells (CHO-mt1 and CHO-MT2), by measurement of [3H]-melatonin binding and forskolin-stimulated cyclic AMP (cAMP) production. [3H]-melatonin bound to mt1 and MT2 receptors with pKD values of 9.89 and 9.56 and Bmax values of 1.20 and 0.82 pmol mg−1 protein, respectively. Whilst most melatonin receptor agonists had similar affinities for mt1 and MT2 receptors, a number of putative antagonists had substantially higher affinities for MT2 receptors, including luzindole (11 fold), GR128107 (23 fold) and 4-P-PDOT (61 fold). In both CHO-mt1 and CHO-MT2 cells, melatonin inhibited forskolin-stimulated accumulation of cyclic AMP in a concentration-dependent manner (pIC50 9.53 and 9.74, respectively) causing 83 and 64% inhibition of cyclic AMP production at 100 nM, respectively. The potencies of a range of melatonin receptor agonists were determined. At MT2 receptors, melatonin, 2-iodomelatonin and 6-chloromelatonin were essentially equipotent, whilst at the mt1 receptor these agonists gave the rank order of potency of 2-iodomelatonin>melatonin>6-chloromelatonin. In both CHO-mt1 and CHO-MT2 cells, melatonin-induced inhibition of forskolin-stimulated cyclic AMP production was antagonized in a concentration-dependent manner by the melatonin receptor antagonist luzindole, with pA2 values of 5.75 and 7.64, respectively. Melatonin-mediated responses were abolished by pre-treatment of cells with pertussis toxin, consistent with activation of Gi/Go G-proteins. This is the first report of the use of [3H]-melatonin for the characterization of recombinant mt1 and MT2 receptors. Our results demonstrate that these receptor subtypes have distinct pharmacological profiles. PMID:10696085
VIP/PACAP receptor mediation of cutaneous active vasodilation during heat stress in humans.
Kellogg, Dean L; Zhao, Joan L; Wu, Yubo; Johnson, John M
2010-07-01
Vasoactive intestinal peptide (VIP) is implicated in cutaneous active vasodilation in humans. VIP and the closely related pituitary adenylate cyclase activating peptide (PACAP) act through several receptor types: VIP through VPAC1 and VPAC2 receptors and PACAP through VPAC1, VPAC2, and PAC1 receptors. We examined participation of VPAC2 and/or PAC1 receptors in cutaneous vasodilation during heat stress by testing the effects of their specific blockade with PACAP6-38. PACAP6-38 dissolved in Ringer's was administered by intradermal microdialysis at one forearm site while a control site received Ringer's solution. Skin blood flow was monitored by laser-Doppler flowmetry (LDF). Blood pressure was monitored noninvasively and cutaneous vascular conductance (CVC) calculated. A 5- to 10-min baseline period was followed by approximately 70 min of PACAP6-38 (100 microM) perfusion at one site in normothermia and a 3-min period of body cooling. Whole body heating was then performed to engage cutaneous active vasodilation and was maintained until CVC had plateaued at an elevated level at all sites for 5-10 min. Finally, 58 mM sodium nitroprusside was perfused through both microdialysis sites to effect maximal vasodilation. No CVC differences were found between control and PACAP6-38-treated sites during normothermia (19 +/- 3%max untreated vs. 20 +/- 3%max, PACAP6-38 treated; P > 0.05 between sites) or cold stress (11 +/- 2%max untreated vs. 10 +/- 2%max, PACAP6-38 treated, P > 0.05 between sites). PACAP6-38 attenuated the increase in CVC during whole body heating when compared with untreated sites (59 +/- 3%max untreated vs. 46 +/- 3%max, PACAP6-38 treated, P < 0.05). We conclude that VPAC2 and/or PAC1 receptor activation is involved in cutaneous active vasodilation in humans.
Musset, Boris; Clark, Robert A.; DeCoursey, Thomas E.; Petheo, Gabor L.; Geiszt, Miklos; Chen, Yumin; Cornell, John E.; Eddy, Carlton A.; Brzyski, Robert G.; El Jamali, Amina
2012-01-01
Physiological and pathological processes in spermatozoa involve the production of reactive oxygen species (ROS), but the identity of the ROS-producing enzyme system(s) remains a matter of speculation. We provide the first evidence that NOX5 NADPH oxidase is expressed and functions in human spermatozoa. Immunofluorescence microscopy detected NOX5 protein in both the flagella/neck region and the acrosome. Functionally, spermatozoa exposed to calcium ionophore, phorbol ester, or H2O2 exhibited superoxide anion production, which was blocked by addition of superoxide dismutase, a Ca2+ chelator, or inhibitors of either flavoprotein oxidases (diphenylene iododonium) or NOX enzymes (GKT136901). Consistent with our previous overexpression studies, we found that H2O2-induced superoxide production by primary sperm cells was mediated by the non-receptor tyrosine kinase c-Abl. Moreover, the HV1 proton channel, which was recently implicated in spermatozoa motility, was required for optimal superoxide production by spermatozoa. Immunoprecipitation experiments suggested an interaction among NOX5, c-Abl, and HV1. H2O2 treatment increased the proportion of motile sperm in a NOX5-dependent manner. Statistical analyses showed a pH-dependent correlation between superoxide production and enhanced sperm motility. Collectively, our findings show that NOX5 is a major source of ROS in human spermatozoa and indicate a role for NOX5-dependent ROS generation in human spermatozoa motility. PMID:22291013
McKenzie, Marcus E; Malinin, Alex I; Bell, Christopher R; Dzhanashvili, Alex; Horowitz, Eric D; Oshrine, Benjamin R; Atar, Dan; Serebruany, Victor L
2003-04-01
Platelet inhibition after aspirin therapy reduces the risk for the development of acute coronary syndromes. However, the mechanism by which aspirin affect platelets other than by prostaglandin blockade is unclear. We sought to determine the in vitro effects of aspirin on the surface expression of nine platelet receptors using whole blood flow cytometry. Blood from 24 healthy volunteers was incubated for 30 min with 1.8 and 7.2 mg/l phosphate-buffered saline-diluted acetylsalicylic acid in the presence or absence of apyrase. Platelet serotonin release, and the surface expression of platelet receptors with or without apyrase were determined using the following monoclonal antibodies: anit-CD41 [glycoprotein (GP)IIb/IIIa], CD42b (GPIb), CD62p (P-selectin), CD51/CD61 (vitronectin receptor), CD31 [platelet/endothelial cellular adhesion molecule-1 (PECAM-1)], CD107a [lysosomal associated membrane protein (LAMP)-1], CD107b (LAMP-2), CD63 (LIMP or LAMP-3), and CD151 (PETA-3). Samples were then immediately fixed with 2% paraformaldehyde, and run on the flow cytometer within 48 h. Aspirin does not affect serotonin release from human platelets. Dose-dependent inhibition of GPIIb/IIIa, P-selectin, CD63, and CD107a receptor expression was observed in the aspirin-treated whole-blood samples. Apyrase potentiates the effects of aspirin, and independently inhibits PECAM-1. In addition to the known effect of irreversibly inhibiting platelet cyclooxygenase-1, thereby blocking thromboxane A(2) synthesis, it appears that aspirin exhibits direct effects on selective major platelet receptors.
Glas, Martin; Coch, Christoph; Trageser, Daniel; Dassler, Juliane; Simon, Matthias; Koch, Philipp; Mertens, Jerome; Quandel, Tamara; Gorris, Raphaela; Reinartz, Roman; Wieland, Anja; Von Lehe, Marec; Pusch, Annette; Roy, Kristin; Schlee, Martin; Neumann, Harald; Fimmers, Rolf; Herrlinger, Ulrich; Brüstle, Oliver; Hartmann, Gunther; Besch, Robert; Scheffler, Björn
2013-06-01
Cellular heterogeneity, for example, the intratumoral coexistence of cancer cells with and without stem cell characteristics, represents a potential root of therapeutic resistance and a significant challenge for modern drug development in glioblastoma (GBM). We propose here that activation of the innate immune system by stimulation of innate immune receptors involved in antiviral and antitumor responses can similarly target different malignant populations of glioma cells. We used short-term expanded patient-specific primary human GBM cells to study the stimulation of the cytosolic nucleic acid receptors melanoma differentiation-associated gene 5 (MDA5) and retinoic acid-inducible gene I (RIG-I). Specifically, we analyzed cells from the tumor core versus "residual GBM cells" derived from the tumor resection margin as well as stem cell-enriched primary cultures versus specimens without stem cell properties. A portfolio of human, nontumor neural cells was used as a control for these studies. The expression of RIG-I and MDA5 could be induced in all of these cells. Receptor stimulation with their respective ligands, p(I:C) and 3pRNA, led to in vitro evidence for an effective activation of the innate immune system. Most intriguingly, all investigated cancer cell populations additionally responded with a pronounced induction of apoptotic signaling cascades revealing a second, direct mechanism of antitumor activity. By contrast, p(I:C) and 3pRNA induced only little toxicity in human nonmalignant neural cells. Granted that the challenge of effective central nervous system (CNS) delivery can be overcome, targeting of RIG-I and MDA5 could thus become a quintessential strategy to encounter heterogeneous cancers in the sophisticated environments of the brain. Copyright © 2013 AlphaMed Press.
Watanabe, Yohei; Ibrahim, Madiha S.; Ellakany, Hany F.; Kawashita, Norihito; Mizuike, Rika; Hiramatsu, Hiroaki; Sriwilaijaroen, Nogluk; Takagi, Tatsuya; Suzuki, Yasuo; Ikuta, Kazuyoshi
2011-01-01
Highly pathogenic avian influenza A virus subtype H5N1 is currently widespread in Asia, Europe, and Africa, with 60% mortality in humans. In particular, since 2009 Egypt has unexpectedly had the highest number of human cases of H5N1 virus infection, with more than 50% of the cases worldwide, but the basis for this high incidence has not been elucidated. A change in receptor binding affinity of the viral hemagglutinin (HA) from α2,3- to α2,6-linked sialic acid (SA) is thought to be necessary for H5N1 virus to become pandemic. In this study, we conducted a phylogenetic analysis of H5N1 viruses isolated between 2006 and 2009 in Egypt. The phylogenetic results showed that recent human isolates clustered disproportionally into several new H5 sublineages suggesting that their HAs have changed their receptor specificity. Using reverse genetics, we found that these H5 sublineages have acquired an enhanced binding affinity for α2,6 SA in combination with residual affinity for α2,3 SA, and identified the amino acid mutations that produced this new receptor specificity. Recombinant H5N1 viruses with a single mutation at HA residue 192 or a double mutation at HA residues 129 and 151 had increased attachment to and infectivity in the human lower respiratory tract but not in the larynx. These findings correlated with enhanced virulence of the mutant viruses in mice. Interestingly, these H5 viruses, with increased affinity to α2,6 SA, emerged during viral diversification in bird populations and subsequently spread to humans. Our findings suggested that emergence of new H5 sublineages with α2,6 SA specificity caused a subsequent increase in human H5N1 influenza virus infections in Egypt, and provided data for understanding the virus's pandemic potential. PMID:21637809
Potential therapeutic targets for ATP-gated P2X receptor ion channels.
Li, Zhiyuan; Liang, Dong; Chen, Ling
2008-04-01
P2X receptors make up a novel family of ligand-gated ion channels that are activated by binding of extracellular ATP. These receptors can form a number of homomeric and heteromeric ion channels, which are widely distributed throughout the human body. They are thought to play an important role in many cellular processes, including synaptic transmission and thrombocyte aggregation. These ion channels are also involved in the pathology of several disease states, including chronic inflammation and neuropathic pain, and thus are the potential targets for drug development. The recent discovery of potent and highly selective antagonists for P2X(7) receptors, through the use of high-throughput screening, has helped to further understand the P2X receptor pharmacology and provided new evidence that P2X(7) receptors play a specific role in chronic pain states. In this review, we discuss how the P2X family of ion channels has distinguished itself as a potential new drug target. We are optimistic that safe and effective candidate drugs will be suitable for progression into clinical development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilder, Richard B.; Curcio, Lisa D.; Khanijou, Rajesh K.
2010-11-01
Purpose: To report our results with accelerated partial breast irradiation (APBI) in terms of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER-2/neu) status. Methods and Materials: Between February 2003 and June 2009, 209 women with early-stage breast carcinomas were treated with APBI using multicatheter, MammoSite, or Contura brachytherapy to 34 Gy in 10 fractions twice daily over 5-7 days. Three patient groups were defined by receptor status: Group 1: ER or PR (+) and HER-2/neu (-) (n = 180), Group 2: ER and PR (-) and HER-2/neu (+) (n = 10), and Group 3:more » ER, PR, and HER-2/neu (-) (triple negative breast cancer, n = 19). Median follow-up was 22 months. Results: Group 3 patients had significantly higher Scarff-Bloom-Richardson scores (p < 0.001). The 3-year ipsilateral breast tumor control rates for Groups 1, 2, and 3 were 99%, 100%, and 100%, respectively (p = 0.15). Group 3 patients tended to experience relapse in distant sites earlier than did non-Group 3 patients. The 3-year relapse-free survival rates for Groups 1, 2, and 3 were 100%, 100%, and 81%, respectively (p = 0.046). The 3-year cause-specific and overall survival rates for Groups 1, 2, and 3 were 100%, 100%, and 89%, respectively (p = 0.002). Conclusions: Triple negative breast cancer patients typically have high-grade tumors with significantly worse relapse-free, cause-specific, and overall survival. Longer follow-up will help to determine whether these patients also have a higher risk of ipsilateral breast tumor relapse.« less
Kumar, T Santhosh; Zhou, Si-Yuan; Joshi, Bhalchandra V; Balasubramanian, Ramachandran; Yang, Tiehong; Liang, Bruce T; Jacobson, Kenneth A
2010-03-25
P2X receptor activation protects in heart failure models. MRS2339 3, a 2-chloro-AMP derivative containing a (N)-methanocarba (bicyclo[3.1.0]hexane) system, activates this cardioprotective channel. Michaelis-Arbuzov and Wittig reactions provided phosphonate analogues of 3, expected to be stable in vivo due to the C-P bond. After chronic administration via a mini-osmotic pump (Alzet), some analogues significantly increased intact heart contractile function in calsequestrin-overexpressing mice (genetic model of heart failure) compared to vehicle-infused mice (all inactive at the vasodilatory P2Y(1) receptor). Two phosphonates, (1'S,2'R,3'S,4'R,5'S)-4'-(6-amino-2-chloropurin-9-yl)-2',3'-(dihydroxy)-1'-(phosphonomethylene)-bicyclo[3.1.0]hexane, 4 (MRS2775), and its homologue 9 (MRS2935), both 5'-saturated, containing a 2-Cl substitution, improved echocardiography-derived fractional shortening (20.25% and 19.26%, respectively, versus 13.78% in controls), while unsaturated 5'-extended phosphonates, all 2-H analogues, and a CH(3)-phosphonate were inactive. Thus, chronic administration of nucleotidase-resistant phosphonates conferred a beneficial effect, likely via cardiac P2X receptor activation. Thus, we have greatly expanded the range of carbocyclic nucleotide analogues that represent potential candidates for the treatment of heart failure.
[Effect of bemethyl on cytochrome P-450-dependent monoxygenases in the human liver and lymphocytes].
Sorokina, E A; Sibiriak, S V; Sergeeva, S A
2002-01-01
Effects of the actoprotector bemithyl (50 mg/kg, p.o.) upon a single or five-fold administration on the cytochrome P-450 and b5 content and the isoform-specific and nonspecific monooxygenase activity [aminopyrine-N-demethylase, aniline-p-hydroxylase, 4-nitroanisole-o-demethylase,2,5-diphenyloxazole-p-hydroxylase, 7-ethoxyresorufin-o-deethylase (EROD), benzyloxyresorufin-o-debenzylase (BROD)] in rat liver were evaluated. In addition, the influence of bemithyl (0.(1)-100 microM) on the development of EROD and BROD activity was studied on the mitogen-stimulated human lymphocytes in vitro. Administered in rats, bemithyl exhibited the properties of a cytochrome P-450 inductor of the mixed type, which was manifested by an increase in the total cytochrome P-450 content in liver microsomes and in the monooxygenase activity related to both Ah-receptor-dependent and -independent isoforms (except for the aniline-p-hydroxylase activity). The induction of the monooxygenase activity realized by Ah-receptor-dependent isoforms (4-nitroanisole-o-demethylase, 2,5-diphenyloxazole-p-hydroxylase, and EROD activity) was more pronounced, reaching maximum upon a single drug administration. Acting upon the human lymphocytes in vitro, high concentrations of bemithyl increased expression of the EROD activity, while low drug concentrations stimulated the BROD activity.
A double transgenic mouse model expressing human pregnane X receptor and cytochrome P450 3A4
Ma, Xiaochao; Cheung, Connie; Krausz, Kristopher W.; Shah, Yatrik M.; Wang, Ting; Idle, Jeffrey R.; Gonzalez, Frank J.
2008-01-01
Cytochrome P450 3A4 (CYP3A4), the most abundant human P450 in liver, participates in the metabolism of ∼50% of clinically used drugs. The pregnane X receptor (PXR), a member of the nuclear receptor superfamily, is the major activator of CYP3A4 transcription. However, due to species differences in response to PXR ligands, it is problematic to use rodents to assess CYP3A4 regulation and function. The generation of double transgenic mice expressing human PXR and CYP3A4 (TgCYP3A4/hPXR) would provide a means to this problem. In the current study, a TgCYP3A4/hPXR mouse model was generated by bacterial artificial chromosome transgenesis in Pxr-null mice. In TgCYP3A4/hPXR mice, CYP3A4 was strongly induced by rifampicin, a human-specific PXR ligand, but not by pregnenolone 16α-carbonitrile, a rodent-specific PXR ligand. Consistent with CYP3A expression, hepatic CYP3A activity increased ∼five-fold in TgCYP3A4/hPXR mice pretreated with rifampicin. Most anti-human immunodeficiency virus protease inhibitors are CYP3A substrates and their interactions with rifamycins are a source of major concern in patients co-infected with human immunodeficiency virus and Mycobacterium tuberculosis. By using TgCYP3A4/hPXR mice, human PXR-CYP3A4 mediated rifampicin-protease inhibitor interactions were recapitulated, as the metabolic stability of amprenavir, nelfinavir, and saquinavir decreased 52%, 53%, and 99% respectively in the liver microsomes of TgCYP3A4/hPXR mice pretreated with rifampicin. In vivo, rifampicin pretreatment resulted in ∼80% decrease in the area under serum amprenavir concentration-time curve in TgCYP3A4/hPXR mice. These results suggest that the TgCYP3A4/hPXR mouse model could serve as a useful tool for studies on CYP3A4 transcription and function in vivo. PMID:18799805
Obiero, Walter; Young, Marisa R; Bailey, Robert C
2013-01-01
Male circumcision (MC) reduces the risk of heterosexual HIV acquisition in men by approximately 60%. MC programs for HIV prevention are currently being scaled-up in fourteen countries in sub-Saharan Africa. The current standard surgical technique for MC in many sub-Saharan African countries is the forceps-guided male circumcision (FGMC) method. The PrePex male circumcision (PMC) method could replace FGMC and potentially reduce MC programming costs. We compared the potential costs of introducing the PrePex device into MC programming to the cost of the forceps-guided method. Data were obtained from the Nyanza Reproductive Health Society (NRHS), an MC service delivery organization in Kenya, and from the Kenya Ministry of Health. Analyses are based on 48,265 MC procedures performed in four Districts in western Kenya from 2009 through 2011. Data were entered into the WHO/UNAIDS Decision Makers Program Planning Tool. The tool assesses direct and indirect costs of MC programming. Various sensitivity analyses were performed. Costs were discounted at an annual rate of 6% and are presented in United States Dollars. Not including the costs of the PrePex device or referral costs for men with phimosis/tight foreskin, the costs of one MC surgery were $44.54-$49.02 and $54.52-$55.29 for PMC and FGMC, respectively. The PrePex device is unlikely to result in significant cost-savings in comparison to the forceps-guided method. MC programmers should target other aspects of the male circumcision minimum package for improved cost efficiency.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Levy, F.O.; Tasken, K.; Solberg, R.
1994-08-01
The human gene for the 5-HT{sub 1E} serotonin receptor was recently cloned, but no chromosomal assignment has yet been given to this gene (locus HTR1E). In this work, we demonstrate by two independent polymerase chain reactions on a panel of human-hamster somatic cell hybrid genomic DNA that the 5-HT{sub 1E} serotonin receptor gene is localized on human chromosome 6. Furthermore, by means of in situ hybridization to human metaphase chromosomes, using the cloned 5-HT{sub 1E} receptor gene (phage clone {lambda}-S31) as a probe, we demonstrate that this gene is localized to the q14-q15 region on chromosome 6. Screening of genomicmore » DNA from 15 unrelated Caucasian individuals, using as a probe the open reading frame of the cloned 5-HT{sub 1E} receptor gene, did not reveal any restriction fragment length polymorphisms with the enzymes BamHI, BanII, BglII, EcoRI, HincII, HindIII, HinfI, MspI, PstI, and PvuII. Since the 5-HT{sub 1E} receptor is found mainly in the cerebral cortex and abnormal function of the serotonergic system has been implicated in a variety of neurologic and psychiatric diseases, the precise chromosomal assignment of the 5-HT{sub 1E} receptor gene is the crucial first step toward the evaluation of this locus as a candidate for mutations in such syndromes. 28 refs., 2 figs., 2 tabs.« less
PExFInS: An Integrative Post-GWAS Explorer for Functional Indels and SNPs
Cheng, Zhongshan; Chu, Hin; Fan, Yanhui; Li, Cun; Song, You-Qiang; Zhou, Jie; Yuen, Kwok-Yung
2015-01-01
Expression quantitative trait loci (eQTLs) mapping and linkage disequilibrium (LD) analysis have been widely employed to interpret findings of genome-wide association studies (GWAS). With the availability of deep sequencing data of 423 lymphoblastoid cell lines (LCLs) from six global populations and the microarray expression data, we performed eQTL analysis, identified more than 228 K SNP cis-eQTLs and 21 K indel cis-eQTLs and generated a LCL cis-eQTL database. We demonstrate that the percentages of population-shared and population-specific cis-eQTLs are comparable; while indel cis-eQTLs in the population-specific subsection make more contribution to gene expression variations than those in the population-shared subsection. We found cis-eQTLs, especially the population-shared cis-eQTLs are significantly enriched toward transcription start site. Moreover, the National Human Genome Research Institute cataloged GWAS SNPs are enriched for LCL cis-eQTLs. Specifically, 32.8% GWAS SNPs are LCL cis-eQTLs, among which 12.5% can be tagged by indel cis-eQTLs, suggesting the fundamental contribution of indel cis-eQTLs to GWAS association signals. To search for functional indels and SNPs tagging GWAS SNPs, a pipeline Post-GWAS Explorer for Functional Indels and SNPs (PExFInS) has been developed, integrating LD analysis, functional annotation from public databases, cis-eQTL mapping with our LCL cis-eQTL database and other published cis-eQTL datasets. PMID:26612672
5-HT7 receptor activation: procognitive and antiamnesic effects.
Meneses, A; Perez-Garcia, G; Liy-Salmeron, G; Ponce-López, T; Lacivita, E; Leopoldo, M
2015-02-01
The serotonin (5-hydroxytryptamine (5-HT)) 5-HT7 receptor is localized in brain areas mediating memory; however, the role of this receptor on memory remains little explored. First, demonstrating the associative nature of Pavlovian/instrumental autoshaping (P/I-A) task, rats were exposed (three sessions) to CS-US (Pavlovian autoshaping), truly random control, free operant, and presentations of US or CS, and they were compared with rats trained-tested for one session to the P/I-A procedure. Also, effects of the 5-HT7 receptor agonist LP-211 administered intraperitoneally after training was determined on short- (1.5 h) and long-term memory 24 and 48 h) and on scopolamine-induced memory impairment and cAMP production. Autoshaping and its behavioral controls were studied. Other animals were subjected to an autoshaping training session and immediately afterwards were given (intraperitoneal) vehicle or LP-211 (0.1-10 mg/kg) and/or scopolamine (0.2 mg/kg) and tested for short-term memory (STM) and long-term memory (LTM); their brains were extracted for the cAMP ELISA immunoassay. P/I-A group produced the higher %CR. LP-211 did not affect STM; nonetheless, at 0.5 and 1.0 mg/kg, it improved LTM. The 5-HT7 receptor antagonist SB-269970 (SB; 10.0 mg/kg) alone had no effect; nevertheless, the LP-211 (1.0 mg/kg) LTM facilitation was reversed by SB. The scopolamine (0.2 mg/kg) induced-decrement in CR was accompanied by significant increased cAMP production. The scopolamine-induced decrement in CR and increments in cAMP were significantly attenuated by LP-211. Autoshaping is a reliable associative learning task whose consolidation is facilitated by the 5-HT7 receptor agonist LP-211.
Adaptation of avian influenza A (H6N1) virus from avian to human receptor-binding preference
Wang, Fei; Qi, Jianxun; Bi, Yuhai; Zhang, Wei; Wang, Min; Zhang, Baorong; Wang, Ming; Liu, Jinhua; Yan, Jinghua; Shi, Yi; Gao, George F
2015-01-01
The receptor-binding specificity of influenza A viruses is a major determinant for the host tropism of the virus, which enables interspecies transmission. In 2013, the first human case of infection with avian influenza A (H6N1) virus was reported in Taiwan. To gather evidence concerning the epidemic potential of H6 subtype viruses, we performed comprehensive analysis of receptor-binding properties of Taiwan-isolated H6 HAs from 1972 to 2013. We propose that the receptor-binding properties of Taiwan-isolated H6 HAs have undergone three major stages: initially avian receptor-binding preference, secondarily obtaining human receptor-binding capacity, and recently human receptor-binding preference, which has been confirmed by receptor-binding assessment of three representative virus isolates. Mutagenesis work revealed that E190V and G228S substitutions are important to acquire the human receptor-binding capacity, and the P186L substitution could reduce the binding to avian receptor. Further structural analysis revealed how the P186L substitution in the receptor-binding site of HA determines the receptor-binding preference change. We conclude that the human-infecting H6N1 evolved into a human receptor preference. PMID:25940072
TGF-β1 Downregulates the Expression of CX3CR1 by Inducing miR-27a-5p in Primary Human NK Cells
Regis, Stefano; Caliendo, Fabio; Dondero, Alessandra; Casu, Beatrice; Romano, Filomena; Loiacono, Fabrizio; Moretta, Alessandro; Bottino, Cristina; Castriconi, Roberta
2017-01-01
Activity of human natural killer (NK) cells against cancer cells is deeply suppressed by TGF-β1, an immunomodulatory cytokine that is released and activated in the tumor microenvironment. Moreover, our previous data showed that TGF-β1 modifies the chemokine receptor repertoire of NK cells. In particular, it decreases the expression of CX3CR1 that drives these effectors toward peripheral tissues, including tumor sites. To identify possible mechanisms mediating chemokine receptors modulation, we analyzed the microRNA profile of TGF-β1-treated primary NK cells. The analysis pointed out miR-27a-5p as a possible modulator of CX3CR1. We demonstrated the functional interaction of miR-27a-5p with the 3′ untranslated region (3′UTR) of CX3CR1 mRNA by two different experimental approaches: by the use of a luciferase assay based on a reporter construct containing the CX3CR1 3′UTR and by transfection of primary NK cells with a miR-27a-5p inhibitor. We also showed that the TGF-β1-mediated increase of miR-27a-5p expression is a consequence of miR-23a-27a-24-2 cluster induction. Moreover, we demonstrated that miR-27a-5p downregulates the surface expression of CX3CR1. Finally, we showed that neuroblastoma cells induced in resting NK cells a downregulation of the CX3CR1 expression that was paralleled by a significant increase of miR-27a-5p expression. Therefore, the present study highlights miR-27a-5p as a pivotal TGF-β1-induced regulator of CX3CR1 expression. PMID:28791023
TGF-β1 Downregulates the Expression of CX3CR1 by Inducing miR-27a-5p in Primary Human NK Cells.
Regis, Stefano; Caliendo, Fabio; Dondero, Alessandra; Casu, Beatrice; Romano, Filomena; Loiacono, Fabrizio; Moretta, Alessandro; Bottino, Cristina; Castriconi, Roberta
2017-01-01
Activity of human natural killer (NK) cells against cancer cells is deeply suppressed by TGF-β1, an immunomodulatory cytokine that is released and activated in the tumor microenvironment. Moreover, our previous data showed that TGF-β1 modifies the chemokine receptor repertoire of NK cells. In particular, it decreases the expression of CX 3 CR1 that drives these effectors toward peripheral tissues, including tumor sites. To identify possible mechanisms mediating chemokine receptors modulation, we analyzed the microRNA profile of TGF-β1-treated primary NK cells. The analysis pointed out miR-27a-5p as a possible modulator of CX 3 CR1. We demonstrated the functional interaction of miR-27a-5p with the 3' untranslated region (3'UTR) of CX 3 CR1 mRNA by two different experimental approaches: by the use of a luciferase assay based on a reporter construct containing the CX 3 CR1 3'UTR and by transfection of primary NK cells with a miR-27a-5p inhibitor. We also showed that the TGF-β1-mediated increase of miR-27a-5p expression is a consequence of miR-23a-27a-24-2 cluster induction. Moreover, we demonstrated that miR-27a-5p downregulates the surface expression of CX 3 CR1. Finally, we showed that neuroblastoma cells induced in resting NK cells a downregulation of the CX 3 CR1 expression that was paralleled by a significant increase of miR-27a-5p expression. Therefore, the present study highlights miR-27a-5p as a pivotal TGF-β1-induced regulator of CX 3 CR1 expression.
Canela, Laia; Fernández-Dueñas, Víctor; Albergaria, Catarina; Watanabe, Masahiko; Lluís, Carme; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Luján, Rafael; Ciruela, Francisco
2009-10-01
Metabotropic glutamate (mGlu) receptors mediate in part the CNS effects of glutamate. These receptors interact with a large array of intracellular proteins in which the final role is to regulate receptor function. Here, using co-immunoprecipitation and pull-down experiments we showed a close and specific interaction between mGlu(5) receptor and NECAB2 in both transfected human embryonic kidney cells and rat hippocampus. Interestingly, in pull-down experiments increasing concentrations of calcium drastically reduced the ability of these two proteins to interact, suggesting that NECAB2 binds to mGlu(5) receptor in a calcium-regulated manner. Immunoelectron microscopy detection of NECAB2 and mGlu(5) receptor in the rat hippocampal formation indicated that both proteins are codistributed in the same subcellular compartment of pyramidal cells. In addition, the NECAB2/mGlu(5) receptor interaction regulated mGlu(5b)-mediated activation of both inositol phosphate accumulation and the extracellular signal-regulated kinase/mitogen-activated protein kinase pathway. Overall, these findings indicate that NECAB2 by its physical interaction with mGlu(5b) receptor modulates receptor function.
Pharmacological characterization of nucleotide P2Y receptors on endothelial cells of the mouse aorta
Guns, Pieter-Jan D F; Korda, András; Crauwels, Herta M; Van Assche, Tim; Robaye, Bernard; Boeynaems, Jean-Marie; Bult, Hidde
2005-01-01
Nucleotides regulate various effects including vascular tone. This study was aimed to characterize P2Y receptors on endothelial cells of the aorta of C57BL6 mice. Five adjacent segments (width 2 mm) of the thoracic aorta were mounted in organ baths to measure isometric force development. Nucleotides evoked complete (adenosine 5′ triphosphate (ATP), uridine 5′ triphosphate (UTP), uridine 5′ diphosphate (UDP); >90%) or partial (adenosine 5′ diphosphate (ADP)) relaxation of phenylephrine precontracted thoracic aortic rings of C57BL6 mice. Relaxation was abolished by removal of the endothelium and was strongly suppressed (>90%) by inhibitors of nitric oxide synthesis. The rank order of potency was: UDP∼UTP∼ADP>adenosine 5′-[γ-thio] triphosphate (ATPγS)>ATP, with respective pD2 values of 6.31, 6.24, 6.22, 5.82 and 5.40. These results are compatible with the presence of P2Y1 (ADP>ATP), P2Y2 or P2Y4 (ATP and UTP) and P2Y6 (UDP) receptors. P2Y4 receptors were not involved, since P2Y4-deficient mice displayed unaltered responses to ATP and UTP. The purinergic receptor antagonist suramin exerted surmountable antagonism for all agonists. Its apparent pKb for ATP (4.53±0.07) was compatible with literature, but the pKb for UTP (5.19±0.03) was significantly higher. This discrepancy suggests that UTP activates supplementary non-P2Y2 receptor subtype(s). Further, pyridoxal-phosphate-6-azophenyl-2′-4′-disulphonic acid (PPADS) showed surmountable (UTP, UDP), nonsurmountable (ADP) or no antagonism (ATP). Finally, 2′-deoxy-N6-methyladenosine3′,5′-bisphosphate (MRS2179) inhibited ADP-evoked relaxation only. Taken together, these results point to the presence of functional P2Y1 (ADP), P2Y2 (ATP, UTP) and P2Y6 (UDP) receptors on murine aorta endothelial cells. The identity of the receptor(s) mediating the action of UTP is not fully clear and other P2Y subtypes might be involved in UTP-evoked vasodilatation. PMID:15997227
Allosterism in human complement component 5a ((h)C5a): a damper of C5a receptor (C5aR) signaling.
Rana, Soumendra; Sahoo, Amita Rani; Majhi, Bharat Kumar
2016-06-01
The phenomena of allosterism continues to advance the field of drug discovery, by illuminating gainful insights for many key processes, related to the structure-function relationships in proteins and enzymes, including the transmembrane G-protein coupled receptors (GPCRs), both in normal as well as in the disease states. However, allosterism is completely unexplored in the native protein ligands, especially when a small covalent change significantly modulates the pharmacology of the protein ligands toward the signaling axes of the GPCRs. One such example is the human C5a ((h)C5a), the potent cationic anaphylatoxin that engages C5aR and C5L2 to elicit numerous immunological and non-immunological responses in humans. From the recently available structure-function data, it is clear that unlike the mouse C5a ((m)C5a), the (h)C5a displays conformational heterogeneity. However, the molecular basis of such conformational heterogeneity, otherwise allosterism in (h)C5a and its precise contribution toward the overall C5aR signaling is not known. This study attempts to decipher the functional role of allosterism in (h)C5a, by exploring the inherent conformational dynamics in (m)C5a, (h)C5a and in its point mutants, including the proteolytic mutant des-Arg(74)-(h)C5a. Prima facie, the comparative molecular dynamics study, over total 500 ns, identifies Arg(74)-Tyr(23) and Arg(37)-Phe(51) "cation-π" pairs as the molecular "allosteric switches" on (h)C5a that potentially functions as a damper of C5aR signaling.
Ravi, R. Gnana; Kim, Hak Sung; Servos, Jörg; Zimmermann, Herbert; Lee, Kyeong; Maddileti, Savitri; Boyer, José L.; Harden, T. Kendall; Jacobson, Kenneth A.
2016-01-01
Preference for the Northern (N) ring conformation of the ribose moiety of nucleotide 5′-triphosphate agonists at P2Y1, P2Y2, P2Y4, and P2Y11 receptors, but not P2Y6 receptors, was established using a ring-constrained methanocarba (a 3.1.0-bicyclohexane) ring as a ribose substitute (Kim et al. J. Med. Chem. 2002, 45, 208–218.). We have now combined the ring-constrained (N)-methanocarba modification of adenine nucleotides with other functionalities known to enhance potency at P2 receptors. The potency of the newly synthesized analogues was determined in the stimulation of phospholipase C through activation of turkey erythrocyte P2Y1 or human P2Y1 and P2Y2 receptors stably expressed in astrocytoma cells. An (N)-methanocarba-2-methylthio-ADP analogue displayed an EC50 at the hP2Y1 receptor of 0.40 nM and was 55-fold more potent than the corresponding triphosphate and 16-fold more potent than the riboside 5′-diphosphate. 2-Cl–(N)-methanocarba-ATP and its N6-Me analogue were also highly selective, full agonists at P2Y1 receptors. The (N)-methanocarba-2-methylthio and 2-chloromonophosphate analogues were full agonists exhibiting micromolar potency at P2Y1 receptors, while the corresponding ribosides were inactive. Although β,γ-methylene-ATP was inactive at P2Y receptors, β,γ-methylene-(N)-methanocarba-ATP was a potent hP2Y1 receptor agonist with an EC50 of 160 nM and was selective versus hP2Y2 and hP2Y4 receptors. The rates of hydrolysis of Northern (N) and Southern (S) methanocarba analogues of AMP by rat 5′-ectonucleotidase were negligible. The rates of hydrolysis of the corresponding triphosphates by recombinant rat NTPDase1 and 2 were studied. Both isomers were hydrolyzed by NTPDase 1 at about half the rate of ATP hydrolysis. The (N) isomer was hardly hydrolyzed by NTPDase 2, while the (S) isomer was hydrolyzed at one-third of the rate of ATP hydrolysis. This suggests that new, more stable and selective nucleotide agonists may be designed on the basis of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lappalainen, J.; Ozaki, N.; Goldman, D.
1995-05-20
The function of brain serotonin-2C (5-HT{sub 2C}) receptors, including behavioral and neurochemical responses to 5-HT{sub 2C} agonist challenge, has been suggested to be abnormal in individuals with neuropsychiatric disorders. Thus, it is important to identify polymorphisms and functional variants within this gene. Using SSCP analysis, the authors identified a Cys{sub 23}-Ser{sub 23} substitution (designated 5-HT{sub 2Ccys} and 5-HT{sub 2Cser}) in the first hydrophobic region of the human 5-HT{sub 2C} receptor. Allele frequencies in unrelated Caucasians were 0.13 and 0.87 for 5-HT{sub 2Cser} and 5-HT{sub 2Ccys}, respectively. DNAs from informative CEPH families were typed for this polymorphism and analyzed with respectmore » to 20 linked markers on the X chromosome. Linkage analysis placed the 5-HT{sub 2C} receptor gene (HTR2C) on Xq24. To evaluate whether this amino acid substitution causes a variant function of this receptor, recombinant human 5-HT{sub 2Ccys} and 5-HT{sub 2Cser} receptors were expressed in Xenopus oocytes and tested for responses to 5-HT using electrophysiological techniques. Concentration-response curves for 5-HT were not significantly different in oocytes expressing either form of the receptor, suggesting that the 5-HT{sub 2Ccys} and 5-HT{sub 2Cser} receptor proteins may not differ in their responses to serotonin under baseline physiological conditions. 43 refs., 3 figs., 1 tab.« less
Expression of serotonin receptors in human lower esophageal sphincter
LI, HE-FEI; LIU, JUN-FENG; ZHANG, KE; FENG, YONG
2015-01-01
Serotonin (5-HT) is a neurotransmitter and vasoactive amine that is involved in the regulation of a large number of physiological functions. The wide variety of 5-HT-mediated functions is due to the existence of different classes of serotonergic receptors in the mammalian gastrointestinal tract and nervous system. The aim of this study was to explore the expression of multiple types of 5-HT receptor (5-HT1AR, 5-HT2AR, 5-HT3AR, 5-HT4R, 5-HT5AR, 5-HT6R and 5-HT7R) in sling and clasp fibers from the human lower esophageal sphincter (LES). Muscle strips of sling and clasp fibers from the LES were obtained from patients undergoing esophagogastrectomy, and circular muscle strips from the esophagus and stomach were used as controls. Reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR and western blotting were used to investigate the expression of the various 5-HT receptor types. Messenger RNA for all seven 5-HT receptor types was identified in the sling and clasp fibers of the LES. At the mRNA level, the expression levels were highest for 5-HT3AR and 5-HT4R, and lowest for 5-HT5AR, 5-HT6R and 5-HT7R. At the protein level, the expression levels were highest for 5-HT3AR and 5-HT4R, followed by 5-HT1AR and 5-HT2AR; 5-HT7R was also detected at a low level. The expression of 5-HT5AR and 5-HT6R proteins was not confirmed. The results indicate that a variety of 5-HT receptor types can be detected in the human LES and probably contribute to LES function. PMID:25452775
Cho, Young Rae; Jang, Hyeon Soon; Kim, Won; Park, Sun Young; Sohn, Uy Dong
2010-10-01
It is well-known that electrical field stimulation (EFS)-induced contraction is mediated by a cholinergic mechanism and other neurotransmitters. NO, ATP, calcitonin gene-related peptide (CGRP), and substance P are released by EFS. To investigate the purinergic mechanism involved in the EFS-induced contraction, purinegic receptors antagonists were used. Suramine, a non-selective P2 receptor antagonist, reduced the contraction induced by EFS. NF023 (10(-7)~10(-4) M), a selective P2X antagonist, inhibited the contraction evoked by EFS. Reactive blue (10(-6)~10(-4) M), selective P2Y antagonist, also blocked the contraction in a dose-dependent manner. In addition, P2X agonist α,β-methylene 5'-adenosine triphosphate (αβMeATP, 10(-7)~10(-5) M) potentiated EFS-induced contraction in a dose-dependent manner. P2Y agonist adenosine 5'-[β-thio]diphosphate trilithium salt (ADPβS, 10(-7)~10(-5) M) also potentiated EFS-induced contractions in a dose-dependent manner. Ecto-ATPase activator apyrase (5 and 10 U/ml) reduced EFS-induced contractions. Inversely, 6-N,N-diethyl-D-β,γ-dibromomethylene 5'-triphosphate triammonium (ARL 67156, 10(-4) M) increased EFS-induced contraction. These data suggest that endogenous ATP plays a role in EFS-induced contractions which are mediated through both P2X-receptors and P2Y-receptors stimulation in cat esophageal smooth muscle.
Rabiner, Eugenii A; Gunn, Roger N; Wilkins, Martin R; Sedman, Ewen; Grasby, Paul M
2002-09-01
The use of so-called, atypical antipsychotic medication is becoming more widespread in the treatment of psychotic disorders. EMD 128 130 is a novel compound acting as an agonist at the 5-HT1A receptor, and as an antagonist at the dopamine-2 (D2) receptor. This dual action may confer additional benefits over selective D2 antagonists in the treatment of psychotic disorders. In this study, we investigated the occupancy of EMD 128 130 in vivo at the human D2 and 5-HT1A receptors with positron emission tomography using the radiotracers [11C]raclopride and [11C]WAY-100635. Seven healthy volunteers were examined before and after 5 days of treatment with EMD 128 130, administered in an incremental dose building up to 50 mg, b.d. A significant occupancy was demonstrated at the human D2 receptor (40% following a dose of 50 mg, b.d.) while there was no consistent effect observed at the 5-HT1A receptor, despite a similar affinity of EMD 128 130 for cloned human D2 and 5-HT1A receptors, and the presence of typical, central 5-HT1A agonist side-effects. The differential effects of EMD 128 130 at the D2 and the 5-HT1A receptor (antagonist at D2 receptor, agonist at the 5-HTIA receptor) may explain the differences in occupancy observed.
Shepheard, Stephanie R; Chataway, Tim; Schultz, David W; Rush, Robert A; Rogers, Mary-Louise
2014-01-01
Objective biomarkers for amyotrophic lateral sclerosis would facilitate the discovery of new treatments. The common neurotrophin receptor p75 is up regulated and the extracellular domain cleaved from injured neurons and peripheral glia in amyotrophic lateral sclerosis. We have tested the hypothesis that urinary levels of extracellular neurotrophin receptor p75 serve as a biomarker for both human motor amyotrophic lateral sclerosis and the SOD1(G93A) mouse model of the disease. The extracellular domain of neurotrophin receptor p75 was identified in the urine of amyotrophic lateral sclerosis patients by an immuno-precipitation/western blot procedure and confirmed by mass spectrometry. An ELISA was established to measure urinary extracellular neurotrophin receptor p75. The mean value for urinary extracellular neurotrophin receptor p75 from 28 amyotrophic lateral sclerosis patients measured by ELISA was 7.9±0.5 ng/mg creatinine and this was significantly higher (p<0.001) than 12 controls (2.6±0.2 ng/mg creatinine) and 19 patients with other neurological disease (Parkinson's disease and Multiple Sclerosis; 4.1±0.2 ng/mg creatinine). Pilot data of disease progression rates in 14 MND patients indicates that p75NTR(ECD) levels were significantly higher (p = 0.0041) in 7 rapidly progressing patients as compared to 7 with slowly progressing disease. Extracellular neurotrophin receptor p75 was also readily detected in SOD1(G93A) mice by immuno-precipitation/western blot before the onset of clinical symptoms. These findings indicate a significant relation between urinary extracellular neurotrophin receptor p75 levels and disease progression and suggests that it may be a useful marker of disease activity and progression in amyotrophic lateral sclerosis.
Kim, Hyunsoo; Walsh, Matthew C.; Takegahara, Noriko; ...
2017-03-15
Excessive bone resorption by osteoclasts (OCs) can result in serious clinical outcomes, including bone loss that may weaken skeletal or periodontal strength. Proper bone homeostasis and skeletal strength are maintained by balancing OC function with the bone-forming function of osteoblasts. Unfortunately, current treatments that broadly inhibit OC differentiation or function may also interfere with coupled bone formation. We therefore identified a factor, the purinergic receptor P2X5 that is highly expressed during the OC maturation phase, and which we show here plays no apparent role in early bone development and homeostasis, but which is required for osteoclast-mediated inflammatory bone loss andmore » hyper-multinucleation of OCs. We further demonstrate that P2X5 is required for ATP-mediated inflammasome activation and IL-1β production by OCs, and that P2X5-deficient OC maturation is rescued in vitro by addition of exogenous IL-1β. These findings identify a mechanism by which OCs react to inflammatory stimuli, and may identify purinergic signaling as a therapeutic target for bone loss related inflammatory conditions.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hyunsoo; Walsh, Matthew C.; Takegahara, Noriko
Excessive bone resorption by osteoclasts (OCs) can result in serious clinical outcomes, including bone loss that may weaken skeletal or periodontal strength. Proper bone homeostasis and skeletal strength are maintained by balancing OC function with the bone-forming function of osteoblasts. Unfortunately, current treatments that broadly inhibit OC differentiation or function may also interfere with coupled bone formation. We therefore identified a factor, the purinergic receptor P2X5 that is highly expressed during the OC maturation phase, and which we show here plays no apparent role in early bone development and homeostasis, but which is required for osteoclast-mediated inflammatory bone loss andmore » hyper-multinucleation of OCs. We further demonstrate that P2X5 is required for ATP-mediated inflammasome activation and IL-1β production by OCs, and that P2X5-deficient OC maturation is rescued in vitro by addition of exogenous IL-1β. These findings identify a mechanism by which OCs react to inflammatory stimuli, and may identify purinergic signaling as a therapeutic target for bone loss related inflammatory conditions.« less
Post-translational regulation of P2X receptor channels: modulation by phospholipids
Bernier, Louis-Philippe; Ase, Ariel R.; Séguéla, Philippe
2013-01-01
P2X receptor channels mediate fast excitatory signaling by ATP and play major roles in sensory transduction, neuro-immune communication and inflammatory response. P2X receptors constitute a gene family of calcium-permeable ATP-gated cation channels therefore the regulation of P2X signaling is critical for both membrane potential and intracellular calcium homeostasis. Phosphoinositides (PIPn) are anionic signaling phospholipids that act as functional regulators of many types of ion channels. Direct PIPn binding was demonstrated for several ligand- or voltage-gated ion channels, however no generic motif emerged to accurately predict lipid-protein binding sites. This review presents what is currently known about the modulation of the different P2X subtypes by phospholipids and about critical determinants underlying their sensitivity to PIPn levels in the plasma membrane. All functional mammalian P2X subtypes tested, with the notable exception of P2X5, have been shown to be positively modulated by PIPn, i.e., homomeric P2X1, P2X2, P2X3, P2X4, and P2X7, as well as heteromeric P2X1/5 and P2X2/3 receptors. Based on various results reported on the aforementioned subtypes including mutagenesis of the prototypical PIPn-sensitive P2X4 and PIPn-insensitive P2X5 receptor subtypes, an increasing amount of functional, biochemical and structural evidence converges on the modulatory role of a short polybasic domain located in the proximal C-terminus of P2X subunits. This linear motif, semi-conserved in the P2X family, seems necessary and sufficient for encoding direct modulation of ATP-gated channels by PIPn. Furthermore, the physiological impact of the regulation of ionotropic purinergic responses by phospholipids on pain pathways was recently revealed in the context of native crosstalks between phospholipase C (PLC)-linked metabotropic receptors and P2X receptor channels in dorsal root ganglion sensory neurons and microglia. PMID:24324400
Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.
Murase, Akio; Nakao, Kazunari; Takada, Junji
2008-01-01
In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.
Hippocampal 5-HT1A Receptor and Spatial Learning and Memory
Glikmann-Johnston, Yifat; Saling, Michael M.; Reutens, David C.; Stout, Julie C.
2015-01-01
Spatial cognition is fundamental for survival in the topographically complex environments inhabited by humans and other animals. The hippocampus, which has a central role in spatial cognition, is characterized by high concentration of serotonin (5-hydroxytryptamine; 5-HT) receptor binding sites, particularly of the 1A receptor (5-HT1A) subtype. This review highlights converging evidence for the role of hippocampal 5-HT1A receptors in spatial learning and memory. We consider studies showing that activation or blockade of the 5-HT1A receptors using agonists or antagonists, respectively, lead to changes in spatial learning and memory. For example, pharmacological manipulation to induce 5-HT release, or to block 5-HT uptake, have indicated that increased extracellular 5-HT concentrations maintain or improve memory performance. In contrast, reduced levels of 5-HT have been shown to impair spatial memory. Furthermore, the lack of 5-HT1A receptor subtype in single gene knockout mice is specifically associated with spatial memory impairments. These findings, along with evidence from recent cognitive imaging studies using positron emission tomography (PET) with 5-HT1A receptor ligands, and studies of individual genetic variance in 5-HT1A receptor availability, strongly suggests that 5-HT, mediated by the 5-HT1A receptor subtype, plays a key role in spatial learning and memory. PMID:26696889
Villar, Van Anthony M.; Jones, John Edward; Armando, Ines; Asico, Laureano D.; Escano, Crisanto S.; Lee, Hewang; Wang, Xiaoyan; Yang, Yu; Pascua-Crusan, Annabelle M.; Palmes-Saloma, Cynthia P.; Felder, Robin A.; Jose, Pedro A.
2013-01-01
The peripheral dopaminergic system plays a crucial role in blood pressure regulation through its actions on renal hemodynamics and epithelial ion transport. The dopamine D5 receptor (D5R) interacts with sorting nexin 1 (SNX1), a protein involved in receptor retrieval from the trans-Golgi network. In this report, we elucidated the spatial, temporal, and functional significance of this interaction in human renal proximal tubule cells and HEK293 cells stably expressing human D5R and in mice. Silencing of SNX1 expression via RNAi resulted in the failure of D5R to internalize and bind GTP, blunting of the agonist-induced increase in cAMP production and decrease in sodium transport, and up-regulation of angiotensin II receptor expression, of which expression was previously shown to be negatively regulated by D5R. Moreover, siRNA-mediated depletion of renal SNX1 in C57BL/6J and BALB/cJ mice resulted in increased blood pressure and blunted natriuretic response to agonist in salt-loaded BALB/cJ mice. These data demonstrate a crucial role for SNX1 in D5R trafficking and that SNX1 depletion results in D5R dysfunction and thus may represent a novel mechanism for the pathogenesis of essential hypertension. PMID:23152498
Brown, H M; Meech, R W
1979-01-01
1. Intracellular pH (pH1) was measured in Balanus photoreceptors using pH-sensitive glass micro-electrodes. The average pH1 of twelve photoreceptors which had been dark adapted for at least 30 min was 7.3 +/- 0.07 (S.D.). 2. Illumination reduced the recorded pH1 by as much as 0.2 pH unit. The change in pH1 was graded with light intensity. 3. When the cells were exposed to CO2 in the dark, pH1 declined monophasically. Saline equilibrated with 2% CO2; 98% O2 produced a steady reduction in pH1 of about 0.25 unit in 2--3 min. The buffering capacity of the receptor cell cytoplasm calculated from such experiments is approximately 15 slykes. 4. In the presence of HCO3-1, CO2 saline produced smaller, biphasic changes in pH1. 5. The membrane depolarization produced by a bright flash (depolarizing receptor potential) was reversibly reduced in the presence of external CO2 or by injection of H+. Iontophoretic injection of HCO2- increased the amplitude of the receptor potential. 6. In individual cells there was a close correlation between the amplitude of the receptor potential and pH1. 7. Saline equilibrated with CO2 reduced the light induced current (recorded under voltage-clamp) by 40--50% without affecting its reversal potential. 8. Exposure of the receptor to 95% CO2 saline for several minutes (pH0 5.5) not only abolished the receptor potential but also reversibly decreased the K conductance of the membrane in the dark. These effects were not reproduced by pH0 5.5 buffered saline or by a 5 min exposure to saline equilibrated with N2. 9. It is suggested that changes in pH1 induced by light modulate the sensitivity of the receptor under physiological conditions. PMID:43890
The Molecular Determinants of Small-Molecule Ligand Binding at P2X Receptors
Pasqualetto, Gaia; Brancale, Andrea; Young, Mark T.
2018-01-01
P2X receptors are trimeric eukaryotic ATP-gated cation channels. Extracellular ATP—their physiological ligand—is released as a neurotransmitter and in conditions of cell damage such as inflammation, and substantial evidence implicates P2X receptors in diseases including neuropathic pain, cancer, and arthritis. In 2009, the first P2X crystal structure, Danio rerio P2X4 in the apo- state, was published, and this was followed in 2012 by the ATP-bound structure. These structures transformed our understanding of the conformational changes induced by ATP binding and the mechanism of ligand specificity, and enabled homology modeling of mammalian P2X receptors for ligand docking and rational design of receptor modulators. P2X receptors are attractive drug targets, and a wide array of potent, subtype-selective modulators (mostly antagonists) have been developed. In 2016, crystal structures of human P2X3 in complex with the competitive antagonists TNP-ATP and A-317491, and Ailuropoda melanoleuca P2X7 in complex with a series of allosteric antagonists were published, giving fascinating insights into the mechanism of channel antagonism. In this article we not only summarize current understanding of small-molecule modulator binding at P2X receptors, but also use this information in combination with previously published structure-function data and molecular docking experiments, to hypothesize a role for the dorsal fin loop region in differential ATP potency, and describe novel, testable binding conformations for both the semi-selective synthetic P2X7 agonist 2′-(3′)-O-(4-benzoyl)benzoyl ATP (BzATP), and the P2X4-selective positive allosteric modulator ivermectin. We find that the distal benzoyl group of BzATP lies in close proximity to Lys-127, a residue previously implicated in BzATP binding to P2X7, potentially explaining the increased potency of BzATP at rat P2X7 receptors. We also present molecular docking of ivermectin to rat P2X4 receptors, illustrating a plausible
P2 receptor subtypes in the cardiovascular system.
Kunapuli, S P; Daniel, J L
1998-01-01
Extracellular nucleotides have been implicated in a number of physiological functions. Nucleotides act on cell-surface receptors known as P2 receptors, of which several subtypes have been cloned. Both ATP and ADP are stored in platelets and are released upon platelet activation. Furthermore, nucleotides are also released from damaged or broken cells. Thus during vascular injury nucleotides play an important role in haemostasis through activation of platelets, modulation of vascular tone, recruitment of neutrophils and monocytes to the site of injury, and facilitation of adhesion of leucocytes to the endothelium. Nucleotides also moderate these functions by generating nitric oxide and prostaglandin I2 through activation of endothelial cells, and by activating different receptor subtypes on vascular smooth muscle cells. In the heart, P2 receptors regulate contractility through modulation of L-type Ca2+ channels, although the molecular mechanisms involved are still under investigation. Classical pharmacological studies have identified several P2 receptor subtypes in the cardiovascular system. Molecular pharmacological studies have clarified the nature of some of these receptors, but have complicated the picture with others. In platelets, the classical P2T receptor has now been resolved into three P2 receptor subtypes: the P2Y1, P2X1 and P2TAC receptors (the last of these, which is coupled to the inhibition of adenylate cyclase, is yet to be cloned). In peripheral blood leucocytes, endothelial cells, vascular smooth muscle cells and cardiomyocytes, the effects of classical P2X, P2Y and P2U receptors have been found to be mediated by more than one P2 receptor subtype. However, the exact functions of these multiple receptor subtypes remain to be understood, as P2-receptor-selective agonists and antagonists are still under development. PMID:9841859
Cloning and characterization of two novel zebrafish P2X receptor subunits.
Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M
2002-07-26
In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.
Giuliani, S; Barbanti, G; Turini, D; Quartara, L; Rovero, P; Giachetti, A; Maggi, C A
1991-10-22
The contractile effect of substance P, neurokinin A, receptor selective agonists for tachykinin receptors and NK2 tachykinin receptor antagonists was investigated in mucosa-free circular strips of the human isolated colon. Neurokinin A and substance P produced concentration-dependent contractions which approached 80-90% of the maximal response to carbachol. Neurokinin A was about 370 times more potent than substance P. The action of neurokinin A and substance P was not modified by peptidase inhibitors (bestatin, captopril and thiorphan, 1 microM each). The NK2 receptor selective agonist, [beta-Ala8]neurokinin A-(4-10) closely mimicked the response to neurokinin A while NK1 and NK3 receptor selective agonists were active only at microM concentrations. The pseudopeptide, MDL 28,564, which is one of the most selective NK2 ligands available, behaved as a full agonist. Responses to [beta-Ala8]neurokinin A were antagonized by NK2 receptor selective antagonists, with the rank order of potency MEN 10,376 greater than L 659,877 much greater than R 396. These data indicate that NK2 tachykinin receptors play a dominant role in determining the contraction of the circular muscle of the human colon to peptides of this family. The NK2 receptor subtype responsible for this effect belongs to the same subtype (NK2A) previously identified in the rabbit pulmonary artery and guinea-pig bronchi.
Subunit arrangement in P2X receptors.
Jiang, Lin-Hua; Kim, Miran; Spelta, Valeria; Bo, Xuenong; Surprenant, Annmarie; North, R Alan
2003-10-01
ATP-gated ionotropic receptors (P2X receptors) are distributed widely in the nervous system. For example, a hetero-oligomeric receptor containing both P2X2 and P2X3 subunits is involved in primary afferent sensation. Each subunit has two membrane-spanning domains. We have used disulfide bond formation between engineered cysteines to demonstrate close proximity between the outer ends of the first transmembrane domain of one subunit and the second transmembrane domain of another. After expression in HEK 293 cells of such modified P2X2 or P2X4 subunits, the disulfide bond formation is evident because an ATP-evoked channel opening requires previous reduction with dithiothreitol. In the hetero-oligomeric P2X2/3 receptor the coexpression of doubly substituted subunits with wild-type partners allows us to deduce that the hetero-oligomeric channel contains adjacent P2X3 subunits but does not contain adjacent P2X2 subunits. The results suggest a "head-to-tail" subunit arrangement in the quaternary structure of P2X receptors and show that a trimeric P2X2/3 receptor would have the composition P2X2(P2X3)2.
Human dopamine receptor and its uses
Civelli, Olivier; Van Tol, Hubert Henri-Marie
1999-01-01
The present invention is directed toward the isolation, characterization and pharmacological use of the human D4 dopamine receptor. The nucleotide sequence of the gene corresponding to this receptor and alleleic variant thereof are provided by the invention. The invention also includes recombinant eukaryotic expression constructs capable of expressing the human D4 dopamine receptor in cultures of transformed eukaryotic cells. The invention provides cultures of transformed eukaryotic cells which synthesize the human D4 dopamine receptor, and methods for characterizing novel psychotropic compounds using such cultures.
Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit
2017-04-01
Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tyagi, Kriti; Gupta, Deepali; Saini, Ekta; Choudhary, Shilpa; Jamwal, Abhishek; Alam, Mohd Shoeb; Zeeshan, Mohammad; Tyagi, Rupesh K; Sharma, Yagya D
2015-01-01
The monkey malaria parasite Plasmodium knowlesi also infect humans. There is a lack of information on the molecular mechanisms that take place between this simian parasite and its heterologous human host erythrocytes leading to this zoonotic disease. Therefore, we investigated here the binding ability of P. knowlesi tryptophan-rich antigens (PkTRAgs) to the human erythrocytes and sharing of the erythrocyte receptors between them as well as with other commonly occurring human malaria parasites. Six PkTRAgs were cloned and expressed in E.coli as well as in mammalian CHO-K1 cell to determine their human erythrocyte binding activity by cell-ELISA, and in-vitro rosetting assay, respectively. Three of six PkTRAgs (PkTRAg38.3, PkTRAg40.1, and PkTRAg67.1) showed binding to human erythrocytes. Two of them (PkTRAg40.1 and PkTRAg38.3) showed cross-competition with each other as well as with the previously described P.vivax tryptophan-rich antigens (PvTRAgs) for human erythrocyte receptors. However, the third protein (PkTRAg67.1) utilized the additional but different human erythrocyte receptor(s) as it did not cross-compete for erythrocyte binding with either of these two PkTRAgs as well as with any of the PvTRAgs. These three PkTRAgs also inhibited the P.falciparum parasite growth in in-vitro culture, further indicating the sharing of human erythrocyte receptors by these parasite species and the biological significance of this receptor-ligand interaction between heterologous host and simian parasite. Recognition and sharing of human erythrocyte receptor(s) by PkTRAgs with human parasite ligands could be part of the strategy adopted by the monkey malaria parasite to establish inside the heterologous human host.
Tyagi, Kriti; Gupta, Deepali; Saini, Ekta; Choudhary, Shilpa; Jamwal, Abhishek; Alam, Mohd. Shoeb; Zeeshan, Mohammad; Tyagi, Rupesh K.; Sharma, Yagya D.
2015-01-01
Background The monkey malaria parasite Plasmodium knowlesi also infect humans. There is a lack of information on the molecular mechanisms that take place between this simian parasite and its heterologous human host erythrocytes leading to this zoonotic disease. Therefore, we investigated here the binding ability of P. knowlesi tryptophan-rich antigens (PkTRAgs) to the human erythrocytes and sharing of the erythrocyte receptors between them as well as with other commonly occurring human malaria parasites. Methods Six PkTRAgs were cloned and expressed in E.coli as well as in mammalian CHO-K1 cell to determine their human erythrocyte binding activity by cell-ELISA, and in-vitro rosetting assay, respectively. Results Three of six PkTRAgs (PkTRAg38.3, PkTRAg40.1, and PkTRAg67.1) showed binding to human erythrocytes. Two of them (PkTRAg40.1 and PkTRAg38.3) showed cross-competition with each other as well as with the previously described P.vivax tryptophan-rich antigens (PvTRAgs) for human erythrocyte receptors. However, the third protein (PkTRAg67.1) utilized the additional but different human erythrocyte receptor(s) as it did not cross-compete for erythrocyte binding with either of these two PkTRAgs as well as with any of the PvTRAgs. These three PkTRAgs also inhibited the P.falciparum parasite growth in in-vitro culture, further indicating the sharing of human erythrocyte receptors by these parasite species and the biological significance of this receptor-ligand interaction between heterologous host and simian parasite. Conclusions Recognition and sharing of human erythrocyte receptor(s) by PkTRAgs with human parasite ligands could be part of the strategy adopted by the monkey malaria parasite to establish inside the heterologous human host. PMID:26393350
1,4-Naphthoquinones potently inhibiting P2X7 receptor activity.
Faria, R X; Oliveira, F H; Salles, J P; Oliveira, A S; von Ranke, N L; Bello, M L; Rodrigues, C R; Castro, H C; Louvis, A R; Martins, D L; Ferreira, V F
2018-01-01
P2X7 receptor (P2X7R) is an ATP-gated ion-channel with potential therapeutic applications. In this study, we prepared and searched a series of 1,4-naphthoquinones derivatives to evaluate their antagonistic effect on both human and murine P2X7 receptors. We explored the structure-activity relationship and binding mode of the most active compounds using a molecular modeling approach. Biological analysis of this series (eight analogues and two compounds) revealed significant in vitro inhibition against both human and murine P2X7R. Further characterization revealed that AN-03 and AN-04 had greater potency than BBG and A740003 in inhibiting dye uptake, IL-1β release, and carrageenan-induced paw edema in vivo. Moreover, we used electrophysiology and molecular docking analysis for characterizing AN-03 and AN-04 action mechanism. These results suggest 1,4-napthoquinones, mainly AN-04, as potential leads to design new P2X7R blockers and anti-inflammatory drugs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Kanjanamekanant, K; Luckprom, P; Pavasant, P
2013-04-01
Mechanical stress is an important factor in maintaining homeostasis of the periodontium. Interleukin-1beta (IL-1β) and adenosine triphosphate (ATP) are considered potent inflammatory mediators. In macrophages, ATP-activated P2X7 receptor is involved in IL-1β processing and release. Our previous works demonstrated mechanical stress-induced expression of osteopontin and RANKL through the ATP/P2Y1 receptor in human periodontal ligament (HPDL) cells. This study was designed to examine the effect of mechanical stress on IL-1β expression in HPDL cells, as well as the mechanism and involvement of ATP and the P2 purinergic receptor. Cultured HPDL cells were treated with continuous compressive loading. IL-1β expression was analyzed at both mRNA and protein levels, using RT-PCR and ELISA, respectively. Cell viability was examined using the MTT assay. ATP was also used to stimulate HPDL cells. Inhibitors, antagonists and the small interfering RNA (siRNA) technique were used to investigate the role of ATP and the specific P2 subtypes responsible for IL-1β induction along with the intracellular mechanism. Mechanical stress could up-regulate IL-1β expression through the release of ATP in HPDL cells. ATP alone was also capable of increasing IL-1β expression. The induction of IL-1β was markedly inhibited by inhibitors and by siRNA targeting the P2X7 receptor. ATP-stimulated IL-1β expression was also diminished by intracellular calcium inhibitors. Our work clearly indicates the capability of HPDL cells to respond directly to mechanical stimulation. The results signified the important roles of ATP/P2 purinergic receptors, as well as intracellular calcium signaling, in mechanical stress-induced inflammation via up-regulation of the proinflammatory cytokine, IL-1β, in HPDL cells. © 2012 John Wiley & Sons A/S.
Terrón, J. A.
1996-01-01
1. The relaxant effect of 5-hydroxytryptamine (5-HT) in the dog isolated coronary artery deprived of endothelium is mediated by a receptor unrelated to the 5-HT1, 5-HT2, 5-HT3 or 5-HT4 types. Based upon the pharmacological characteristics of this relaxant 5-HT receptor and those reported for the new members of the 5-HT receptor family, the present study explored the possibility that the relaxant 5-HT receptor referred to above, corresponds to the cloned 5-ht7 subtype. Thus, the relaxing and/or blocking effects of several 5-HT receptor drugs as well as some typical and atypical antipsychotic drugs with high affinity for the cloned 5-ht7 receptor in precontracted ring segments were analyzed. 2. 5-HT, 5-carboxamidotryptamine (5-CT) and 5-methoxytryptamine, but not 8-OH-DPAT or sumatriptan, produced concentration-dependent relaxations in endothelium-denuded canine coronary artery rings precontracted with prostaglandin F2a (2 microM). Clozapine (1 microM) produced in some cases a small relaxing effect and antagonized 5-HT- and 5-CT-induced relaxation suggesting a partial agonist effect. In the presence of the 5-HT1D receptor antagonist, GR127935 (100 nM), the rank order of agonist potency was 5-CT > 5-HT > clozapine > or = 5-methoxytryptamine. 8-OH-DPAT and sumatriptan remained inactive as agonists. 3. In GR127935-treated preparations, methiothepin (3 nM) and mianserin (1 microM), as well as the antipsychotics, clozapine (1 microM), pimozide (300 nM), risperidone (3 nM) and spiperone (1 microM), failed to induce a significant relaxation in prostaglandin F2x-precontracted vessels, but produced significant rightward displacements of the concentration-response curves to 5-HT and 5-CT without significantly reducing the Emax. In a final set of experiments with 5-CT, metergoline (100 nM) and mesulergine (300 nM) behaved as competitive antagonists. In contrast, lisuride (3 nM) noncompetitively antagonized 5-CT-induced relaxation. The estimated affinity (apparent pKa values) of
Tsukada, Junko; Tahara, Atsuo; Tomura, Yuichi; Wada, Koh-ichi; Kusayama, Toshiyuki; Ishii, Noe; Yatsu, Takeyuki; Uchida, Wataru; Taniguchi, Nobuaki; Tanaka, Akihiro
2001-01-01
YM471, (Z)-4′-{4,4-difluoro-5-[2-(4-dimethylaminopiperidino)-2-oxoethylidene]-2,3,4,5-tetrahydro-1H-1-benzoazepine-1-carbonyl}-2-phenylbenzanilide monohydrochloride, is a newly synthesized potent vasopressin (AVP) receptor antagonist. Its effects on binding to and signal transduction by cloned human AVP receptors (V1A, V1B and V2) stably expressed in Chinese hamster ovary (CHO) cells, and oxytocin receptors in human uterine smooth muscle cells (USMC) were studied. YM471 potently inhibited specific [3H]-AVP binding to V1A and V2 receptors with Ki values of 0.62 nM and 1.19 nM, respectively. In contrast, YM471 exhibited much lower affinity for V1B and oxytocin receptors with Ki values of 16.4 μM and 31.6 nM, respectively. In CHO cells expressing V1A receptors, YM471 potently inhibited AVP-induced intracellular Ca2+ concentration ([Ca2+]i) increase, exhibiting an IC50 value of 0.56 nM. However, in human USMC expressing oxytocin receptors, YM471 exhibited much lower potency in inhibiting oxytocin-induced [Ca2+]i increase (IC50=193 nM), and did not affect AVP-induced [Ca2+]i increase in CHO cells expressing V1B receptors. Furthermore, in CHO cells expressing V2 receptors, YM471 potently inhibited the production of cyclic AMP stimulated by AVP with an IC50 value of 1.88 nM. In all assays, YM471 showed no agonistic activity. These results demonstrate that YM471 is a potent, nonpeptide human V1A and V2 receptor antagonist which will be a valuable tool in defining the physiologic and pharmacologic actions of AVP. PMID:11429400
Tsukada, J; Tahara, A; Tomura, Y; Wada Ki; Kusayama, T; Ishii, N; Yatsu, T; Uchida, W; Taniguchi, N; Tanaka, A
2001-07-01
YM471, (Z)-4'-[4,4-difluoro-5-[2-(4-dimethylaminopiperidino)-2-oxoethylidene]-2,3,4,5-tetrahydro-1H-1-benzoazepine-1-carbonyl]-2-phenylbenzanilide monohydrochloride, is a newly synthesized potent vasopressin (AVP) receptor antagonist. Its effects on binding to and signal transduction by cloned human AVP receptors (V(1A), V(1B) and V(2)) stably expressed in Chinese hamster ovary (CHO) cells, and oxytocin receptors in human uterine smooth muscle cells (USMC) were studied. YM471 potently inhibited specific [(3)H]-AVP binding to V(1A) and V(2) receptors with K(i) values of 0.62 nM and 1.19 nM, respectively. In contrast, YM471 exhibited much lower affinity for V(1B) and oxytocin receptors with K(i) values of 16.4 microM and 31.6 nM, respectively. In CHO cells expressing V(1A) receptors, YM471 potently inhibited AVP-induced intracellular Ca(2+) concentration ([Ca(2+)](i)) increase, exhibiting an IC(50) value of 0.56 nM. However, in human USMC expressing oxytocin receptors, YM471 exhibited much lower potency in inhibiting oxytocin-induced [Ca(2+)](i) increase (IC(50)=193 nM), and did not affect AVP-induced [Ca(2+)](i) increase in CHO cells expressing V(1B) receptors. Furthermore, in CHO cells expressing V(2) receptors, YM471 potently inhibited the production of cyclic AMP stimulated by AVP with an IC(50) value of 1.88 nM. In all assays, YM471 showed no agonistic activity. These results demonstrate that YM471 is a potent, nonpeptide human V(1A) and V(2) receptor antagonist which will be a valuable tool in defining the physiologic and pharmacologic actions of AVP.
Structural basis of ligand recognition in 5-HT3 receptors
Kesters, Divya; Thompson, Andrew J; Brams, Marijke; van Elk, René; Spurny, Radovan; Geitmann, Matthis; Villalgordo, Jose M; Guskov, Albert; Helena Danielson, U; Lummis, Sarah C R; Smit, August B; Ulens, Chris
2013-01-01
The 5-HT3 receptor is a pentameric serotonin-gated ion channel, which mediates rapid excitatory neurotransmission and is the target of a therapeutically important class of anti-emetic drugs, such as granisetron. We report crystal structures of a binding protein engineered to recognize the agonist serotonin and the antagonist granisetron with affinities comparable to the 5-HT3 receptor. In the serotonin-bound structure, we observe hydrophilic interactions with loop E-binding site residues, which might enable transitions to channel opening. In the granisetron-bound structure, we observe a critical cation–π interaction between the indazole moiety of the ligand and a cationic centre in loop D, which is uniquely present in the 5-HT3 receptor. We use a series of chemically tuned granisetron analogues to demonstrate the energetic contribution of this electrostatic interaction to high-affinity ligand binding in the human 5-HT3 receptor. Our study offers the first structural perspective on recognition of serotonin and antagonism by anti-emetics in the 5-HT3 receptor. PMID:23196367
The discovery of tropane-derived CCR5 receptor antagonists.
Armour, Duncan R; de Groot, Marcel J; Price, David A; Stammen, Blanda L C; Wood, Anthony; Perros, Manos; Burt, Catherine
2006-04-01
The development of compound 1, a piperidine-based CCR5 receptor antagonist with Type I CYP2D6 inhibition, into the tropane-derived analogue 5, is described. This compound, which is devoid of CYP2D6 liabilities, is a highly potent ligand for the CCR5 receptor and has broad-spectrum activity against a range of clinically relevant HIV isolates. The identification of human ether a-go-go-related gene channel inhibition within this series is described and the potential for QTc interval prolongation discussed. Furthermore, structure activity relationship (SAR) around the piperidine moiety is also described.
El-Tayeb, Ali; Griessmeier, Kerstin J; Müller, Christa E
2005-12-15
The selective antagonist radioligand [(3)H]2-propylthioadenosine-5'-adenylic acid (1,1-dichloro-1-phosphonomethyl-1-phosphonyl) anhydride ([(3)H]PSB-0413) was prepared by catalytic hydrogenation of its propargyl precursor with a high specific radioactivity of 74Ci/mmol. In preliminary saturation binding studies, [(3)H]PSB-0413 showed high affinity for platelet P2Y(12) receptors with a K(D) value of 4.57nM. Human platelets had a high density of P2Y(12) receptors exhibiting a B(max) value of 7.66pmol/mg of protein.
Kawano, Ayumi; Kadomatsu, Remi; Ono, Miyu; Kojima, Shuji; Tsukimoto, Mitsutoshi; Sakamoto, Hikaru
2015-01-01
Extracellular nucleotides, such as ATP, are released from cells in response to various stimuli and act as intercellular signaling molecules through activation of P2 receptors. Exposure to the ultraviolet radiation A (UVA) component of sunlight causes molecular and cellular damage, and in this study, we investigated the involvement of extracellular nucleotides and P2 receptors in the UVA-induced cellular response. Human keratinocyte-derived HaCaT cells were irradiated with a single dose of UVA (2.5 J/cm2), and ATP release and interleukin (IL)-6 production were measured. ATP was released from cells in response to UVA irradiation, and the release was blocked by pretreatment with inhibitors of gap junction hemichannels or P2X7 receptor antagonist. IL-6 production was increased after UVA irradiation, and this increase was inhibited by ecto-nucleotidase or by antagonists of P2Y11 or P2Y13 receptor. These results suggest that UVA-induced IL-6 production is mediated by release of ATP through hemichannels and P2X7 receptor, followed by activation of P2Y11 and P2Y13 receptors. Interestingly, P2Y11 and P2Y13 were associated with the same pattern of IL-6 production, though they trigger different intracellular signaling cascades: Ca2+-dependent and PI3K-dependent, respectively. Thus, IL-6 production in response to UVA-induced ATP release involves at least two distinct pathways, mediated by activation of P2Y11 and P2Y13 receptors. PMID:26030257
Ma, Rong; Cui, Xiaolan
2014-01-01
CHO-derived recombinant proteins for human therapeutic are used commonly. There are noninfectious endogenous retroviruses in CHO cells. Validation study for inactivation process is required. Murine xenotropic gamma retrovirus (X-MulV) is a model virus in validation study. In our previous study, optimum conditions for X-MulV inactivation were sifted. In this study, we performed a further research on low pH inactivation for evaluation of X-MulV clearance in manufacturing of recombinant human TNF-α receptor immunoglobulin G fusion proteins (rhTNF-α) for injection. Cell-based infectivity assay was used for the evaluation of X-MulV clearance. RhTNF-α were spiked with X-MulV and were inactivated at pH 3.60 ∼ 3.90, 25 ± 2 °C, and 0 ∼ 240 min, respectively. Samples incubated at the conditions for 15 ∼ 180 min were not inactivated effectively. For 4 h incubation, log10 reductions were achieved 5.0 log10. Biological activity of rhTNF-α incubated at pH 3.60, 25 °C for 4 h, which was assayed on murine L929 fibroblasts cells, was not affected by low pH. Env gene of X-MulV, which was detected by conventional PCR method for the first time, was not detected after incubation at pH 3.60, and it may be the mechanism of low pH inactivation. Copyright © 2013. Published by Elsevier Ltd.
Ketelslegers, J M; Catt, K J
1978-07-03
The interaction between enzymatically radioiodinated human follitropin and the follitropin receptors in testis homogenate was investigated in immature and adult rats. The 125I-labeled human follitropin exhibited high binding activity with specific binding of up to 17% in the presence of an excess of testis homogenate. Approx. 50% of the bound hormone could be eluted at pH 5, and the receptor purified tracer exhibited a 3.6-fold increase in binding activity when compared with the original tracer preparation. Quantitative analysis of equilibrium binding data was performed with corrections for the measured specific activity and maximum binding activity of the tracer hormone. The equilibrium association constants (Ka) determined 24 degrees C were not significantly different in immature and adult rat testis, and the mean value for Ka was 3.9 . 10(9) M-1. At 37 degrees C, the Ka value obtained using immature rat testis was 1.3 . 10(10) M-1. The association of 125I-labeled human follitropin with immature rat testis homogenate was time and temperature dependent. In the presence of an excess of unlabeled hormone, 30--60% of the preformed hormone . receptor complex was dissociated after 24 h incubation. A specific and sensitive radioligand-receptor assay for follitropin was developed using immature rat testis homogenate. The minimum detectable dose of purified human follitropin was 0.6 ng, and human urinary and pituitary follitropin, ovine follitropin and pregnant mare serum gonadotropin reacted in the assay with equivalent slopes. The potencies of highly purified pregnent mare serum gonadotropin and highly purified human follitropin were similar in the radioligand-receptor assay, consistent with the follitropin bioactivity of the equine gonadotropin.
Role of the serotonin 5-HT(2A) receptor in learning.
Harvey, John A
2003-01-01
This study reviews the role of the serotonin 5-HT2A receptor in learning as measured by the acquisition of the rabbit's classically conditioning nictitating membrane response, a component of the eyeblink response. Agonists at the 5-HT2A receptor including LSD (d-lysergic acid diethylamide) enhanced associative learning at doses that produce cognitive effects in humans. Some antagonists such as BOL (d-bromolysergic acid diethylamide), LY53,857, and ketanserin acted as neutral antagonists in that they had no effect on learning, whereas others (MDL11,939, ritanserin, and mianserin) acted as inverse agonists in that they retarded learning through an action at the 5-HT2A receptor. These results were placed in the context of what is known concerning the anatomical distribution and electrophysiological effects of 5-HT2A receptor activation in frontal cortex and hippocampus, as well as the role of cortical 5-HT2A receptors in schizophrenia. It was concluded that the 5-HT2A receptor demonstrates constitutive activity, and that variations in this activity can produce profound alterations in cognitive states.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connolly, T.M.; Majerus, P.W.
1986-05-01
Phosphoinositide breakdown in response to thrombin stimulation of human platelets generates messenger molecules that activate PKC (diglyceride) and mobilize Ca/sup + +/ (inositol tris-phosphates). The water soluble products of phospholipase C-mediated metabolism of phosphatidylinositol 4,5-diphosphate are inositol 1,4,5 P/sub 3/ (IP/sub 3/) and inositol 1:2-cyclic 4,5 P/sub 3/ (cIP/sub 3/). A specific phosphatase, IP/sub 3/ 5'-p'tase, cleaves the 5 phosphate from IP/sub 3/ or cIP/sub 3/ to form IP/sub 2/ or cIP/sub 2/ and P/sub i/, none of which mobilizes Ca/sup + +/. Thus, the IP/sub 3/ 5'-p'tase may regulate cellular responses to IP/sub 3/ or cIP/sub 3/. The authorsmore » find that IP/sub 3/ 5'-p'tase isolated from human platelets is phosphorylated by rat brain PKC, resulting in a 4-fold increase in IP/sub 3/ 5'-p'tase activity. The authors phosphorylated IP/sub 3/ 5'-p'tase using ..gamma.. /sup 32/P-ATP and found that the labeled enzyme comigrated on SDS-PAGE with the previously described 40K protein phosphorylated in response to thrombin stimulation of platelets. The similarity of the PKC-phosphorylated IP/sub 3/ 5'-p'tase observed in vitro and the thrombin-stimulated phosphorylated 40K protein known to be phosphorylated by PKC in vivo, suggests that these proteins may be the same. These results suggest that platelet Ca/sup + +/ mobilization maybe regulated by PKC phosphorylation of the IP/sub 3/ 5'-p'tase and can explain the observation that phorbol ester treatment of intact human platelets results in decreased production of IP/sub 3/ and decreased Ca/sup + +/ mobilization upon subsequent thrombin addition.« less
Rickli, Anna; Luethi, Dino; Reinisch, Julian; Buchy, Danièle; Hoener, Marius C; Liechti, Matthias E
2015-12-01
N-2-methoxybenzyl-phenethylamines (NBOMe drugs) are newly used psychoactive substances with poorly defined pharmacological properties. The aim of the present study was to characterize the receptor binding profiles of a series of NBOMe drugs compared with their 2,5-dimethoxy-phenethylamine analogs (2C drugs) and lysergic acid diethylamide (LSD) in vitro. We investigated the binding affinities of 2C drugs (2C-B, 2C-C, 2C-D, 2C-E, 2C-H, 2C-I, 2C-N, 2C-P, 2C-T-2, 2C-T-4, 2C-T-7, and mescaline), their NBOMe analogs, and LSD at monoamine receptors and determined functional 5-hydroxytryptamine-2A (5-HT2A) and 5-HT2B receptor activation. Binding at and the inhibition of monoamine uptake transporters were also determined. Human cells that were transfected with the respective human receptors or transporters were used (with the exception of trace amine-associated receptor-1 [TAAR1], in which rat/mouse receptors were used). All of the compounds potently interacted with serotonergic 5-HT2A, 5-HT2B, 5-HT2C receptors and rat TAAR1 (most Ki and EC50: <1 μM). The N-2-methoxybenzyl substitution of 2C drugs increased the binding affinity at serotonergic 5-HT2A, 5-HT2C, adrenergic α1, dopaminergic D1-3, and histaminergic H1 receptors and monoamine transporters but reduced binding to 5-HT1A receptors and TAAR1. As a result, NBOMe drugs were very potent 5-HT2A receptor agonists (EC50: 0.04-0.5 μM) with high 5-HT2A/5-HT1A selectivity and affinity for adrenergic α1 receptors (Ki: 0.3-0.9 μM) and TAAR1 (Ki: 0.06-2.2 μM), similar to LSD, but not dopaminergic D1-3 receptors (most Ki:>1 μM), unlike LSD. The binding profile of NBOMe drugs predicts strong hallucinogenic effects, similar to LSD, but possibly more stimulant properties because of α1 receptor interactions. Copyright © 2015 Elsevier Ltd. All rights reserved.
P2X receptor ligands and pain.
Shieh, Char-Chang; Jarvis, Michael F; Lee, Chih-Hung; Perner, Richard J
2006-08-01
P2X receptors belong to a superfamily of ligand-gated ion channels that conduct the influx of Ca(2+), Na(+) and K(+) cations following activation by extracellular nucleotides such as ATP. Molecular cloning studies have identified seven subunits, namely P2X(1-7), that share approximately 40 - 50% identity in amino acid sequences within the subfamily. Using gene-silencing, pharmacological and electrophysiological approaches, recent studies have revealed roles for P2X(2), P2X(3), P2X(4) and P2X(7) receptors in nociceptive signalling. Homomeric P2X(3) and heteromeric P2X(2/3) receptors are highly localised in the peripheral sensory afferent neurons that conduct nociceptive sensory information to the spinal chord and brain. The discovery of A-317491, a selective and potent non-nucleotide P2X(3) antagonist, provided a pharmacological tool to determine the site and mode of action of P2X(3)-containing receptors in different pain behaviours, including neuropathic, inflammatory and visceral pain. Other P2X receptors (P2X(4) and P2X(7)) that are predominantly expressed in microglia, macrophages and cells of immune origin can trigger the release of cytokines, such as IL-1-beta and TNF-alpha. Genetic disruption of P2X(4) and P2X(7) signalling has been demonstrated to reduce inflammatory and neuropathic pain, suggesting that these two receptors might serve as integrators of neuroinflammation and pain. This article provides an overview of recent scientific literature and patents focusing on P2X(3), P2X(4) and P2X(7) receptors, and the identification of small molecule ligands for the potential treatment of neuropathic and inflammatory pain.
Crystal Structure of an LSD-Bound Human Serotonin Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wacker, Daniel; Wang, Sheng; McCorvy, John D.
The prototypical hallucinogen LSD acts via serotonin receptors, and here we describe the crystal structure of LSD in complex with the human serotonin receptor 5-HT2B. The complex reveals conformational rearrangements to accommodate LSD, providing a structural explanation for the conformational selectivity of LSD’s key diethylamide moiety. LSD dissociates exceptionally slow from both 5-HT2BR and 5-HT2AR—a major target for its psychoactivity. Molecular dynamics (MD) simulations suggest that LSD’s slow binding kinetics may be due to a “lid” formed by extracellular loop 2 (EL2) at the entrance to the binding pocket. A mutation predicted to increase the mobility of this lid greatlymore » accelerates LSD’s binding kinetics and selectively dampens LSD-mediated β-arrestin2 recruitment. This study thus reveals an unexpected binding mode of LSD; illuminates key features of its kinetics, stereochemistry, and signaling; and provides a molecular explanation for LSD’s actions at human serotonin receptors.« less
Crystal Structure of an LSD-Bound Human Serotonin Receptor.
Wacker, Daniel; Wang, Sheng; McCorvy, John D; Betz, Robin M; Venkatakrishnan, A J; Levit, Anat; Lansu, Katherine; Schools, Zachary L; Che, Tao; Nichols, David E; Shoichet, Brian K; Dror, Ron O; Roth, Bryan L
2017-01-26
The prototypical hallucinogen LSD acts via serotonin receptors, and here we describe the crystal structure of LSD in complex with the human serotonin receptor 5-HT 2B . The complex reveals conformational rearrangements to accommodate LSD, providing a structural explanation for the conformational selectivity of LSD's key diethylamide moiety. LSD dissociates exceptionally slow from both 5-HT 2B R and 5-HT 2A R-a major target for its psychoactivity. Molecular dynamics (MD) simulations suggest that LSD's slow binding kinetics may be due to a "lid" formed by extracellular loop 2 (EL2) at the entrance to the binding pocket. A mutation predicted to increase the mobility of this lid greatly accelerates LSD's binding kinetics and selectively dampens LSD-mediated β-arrestin2 recruitment. This study thus reveals an unexpected binding mode of LSD; illuminates key features of its kinetics, stereochemistry, and signaling; and provides a molecular explanation for LSD's actions at human serotonin receptors. PAPERCLIP. Copyright © 2017 Elsevier Inc. All rights reserved.
Activation of prostaglandin EP receptors by lubiprostone in rat and human stomach and colon.
Bassil, A K; Borman, R A; Jarvie, E M; McArthur-Wilson, R J; Thangiah, R; Sung, E Z H; Lee, K; Sanger, G J
2008-05-01
Lubiprostone (Amitiza), a possible ClC-2 channel opener derived from prostaglandin E(1) and indicated for the treatment of constipation, increases chloride ion transport and fluid secretion into the intestinal lumen. As lubiprostone may also directly modulate gastrointestinal motility, we investigated its actions and the possible involvement of prostaglandin EP receptor activation on rat and human isolated gastrointestinal preparations. Rat and human isolated preparations were mounted in tissue baths for isometric recording. The effects of lubiprostone on muscle tension and on electrically stimulated, neuronal contractions were investigated in the absence and presence of EP receptor antagonists. In rat and human stomach longitudinal muscle, lubiprostone induced a contraction (pEC(50) of 7.0+/-0.0, n=4 and 6.4+/-0.2, n=3, respectively), which was inhibited by pretreatment with the EP(1) receptor antagonist, EP(1)A 300 nM (pEC(50) reduced to 6.2+/-0.2, n=6), but not by the EP(3) or EP(4) receptor antagonists (L-798106 and GW627368X, respectively, 1 microM, P>0.05). Lubiprostone also reduced electrically stimulated, neuronal contractions in rat and human colon circular muscle preparations (pIC(50) of 8.9+/-0.4, n=7 and 8.7+/-0.9, n=6, respectively), an effect mediated pre-junctionally. This effect was reduced by the EP(4) receptor antagonist (pIC(50) of 6.7+/-1.1, n=7 and 7.7+/-0.4, n=6, respectively) but not by EP(1) or EP(3) receptor antagonists. In rats and humans, lubiprostone contracts stomach longitudinal muscle and inhibits neuronally mediated contractions of colon circular muscle. Experiments are now needed to determine if this additional activity of lubiprostone contributes to its clinical efficacy and/or side-effect profile.
Usmani, Khawja A; Chen, Weichao G; Sadeque, Abu J M
2012-04-01
Lorcaserin, a selective serotonin 5-hydroxytryptamine 2C receptor agonist, is being developed for weight management. The oxidative metabolism of lorcaserin, mediated by recombinant human cytochrome P450 (P450) and flavin-containing monooxygenase (FMO) enzymes, was examined in vitro to identify the enzymes involved in the generation of its primary oxidative metabolites, N-hydroxylorcaserin, 7-hydroxylorcaserin, 5-hydroxylorcaserin, and 1-hydroxylorcaserin. Human CYP1A2, CYP2A6, CYP2B6, CYP2C19, CYP2D6, CYP3A4, and FMO1 are major enzymes involved in N-hydroxylorcaserin; CYP2D6 and CYP3A4 are enzymes involved in 7-hydroxylorcaserin; CYP1A1, CYP1A2, CYP2D6, and CYP3A4 are enzymes involved in 5-hydroxylorcaserin; and CYP3A4 is an enzyme involved in 1-hydroxylorcaserin formation. In 16 individual human liver microsomal preparations (HLM), formation of N-hydroxylorcaserin was correlated with CYP2B6, 7-hydroxylorcaserin was correlated with CYP2D6, 5-hydroxylorcaserin was correlated with CYP1A2 and CYP3A4, and 1-hydroxylorcaserin was correlated with CYP3A4 activity at 10.0 μM lorcaserin. No correlation was observed for N-hydroxylorcaserin with any P450 marker substrate activity at 1.0 μM lorcaserin. N-Hydroxylorcaserin formation was not inhibited by CYP1A2, CYP2A6, CYP2B6, CYP2C19, CYP2D6, and CYP3A4 inhibitors at the highest concentration tested. Furafylline, quinidine, and ketoconazole, selective inhibitors of CYP1A2, CYP2D6, and CYP3A4, respectively, inhibited 5-hydroxylorcaserin (IC(50) = 1.914 μM), 7-hydroxylorcaserin (IC(50) = 0.213 μM), and 1-hydroxylorcaserin formation (IC(50) = 0.281 μM), respectively. N-Hydroxylorcaserin showed low and high K(m) components in HLM and 7-hydroxylorcaserin showed lower K(m) than 5-hydroxylorcaserin and 1-hydroxylorcaserin in HLM. The highest intrinsic clearance was observed for N-hydroxylorcaserin, followed by 7-hydroxylorcaserin, 5-hydroxylorcaserin, and 1-hydroxylorcaserin in HLM. Multiple human P450 and FMO enzymes catalyze
Assessing the role of metabotropic glutamate receptor 5 in multiple nociceptive modalities.
Zhu, Chang Z; Wilson, Sonya G; Mikusa, Joseph P; Wismer, Carol T; Gauvin, Donna M; Lynch, James J; Wade, Carrie L; Decker, Michael W; Honore, Prisca
2004-12-15
Preclinical data, performed in a limited number of pain models, suggest that functional blockade of metabotropic glutamate (mGlu) receptors may be beneficial for pain management. In the present study, effects of 2-methyl-6-(phenylethynyl)-pyridine (MPEP), a potent, selective mGlu5 receptor antagonist, were examined in a wide variety of rodent nociceptive and hypersensitivity models in order to fully characterize the potential analgesic profile of mGlu5 receptor blockade. Effects of 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP), as potent and selective as MPEP at mGlu5/mGlu1 receptors but more selective than MPEP at N-methyl-aspartate (NMDA) receptors, were also evaluated in selected nociceptive and side effect models. MPEP (3-30 mg/kg, i.p.) produced a dose-dependent reversal of thermal and mechanical hyperalgesia following complete Freund's adjuvant (CFA)-induced inflammatory hypersensitivity. Additionally, MPEP (3-30 mg/kg, i.p.) decreased thermal hyperalgesia observed in carrageenan-induced inflammatory hypersensitivity without affecting paw edema, abolished acetic acid-induced writhing activity in mice, and was shown to reduce mechanical allodynia and thermal hyperalgesia observed in a model of post-operative hypersensitivity and formalin-induced spontaneous pain. Furthermore, at 30 mg/kg, i.p., MPEP significantly attenuated mechanical allodynia observed in three neuropathic pain models, i.e. spinal nerve ligation, sciatic nerve constriction and vincristine-induced neuropathic pain. MTEP (3-30 mg/kg, i.p.) also potently reduced CFA-induced thermal hyperalgesia. However, at 100 mg/kg, i.p., MPEP and MTEP produced central nerve system (CNS) side effects as measured by rotarod performance and exploratory locomotor activity. These results suggest a role for mGlu5 receptors in multiple nociceptive modalities, though CNS side effects may be a limiting factor in developing mGlu5 receptor analgesic compounds.
Pittenger, Christopher; Adams, Thomas. G.; Gallezot, Jean-Dominique; Crowley, Michael J.; Nabulsi, Nabeel; Ropchan, James; Gao, Hong; Kichuk, Stephen A.; Simpson, Ryan; Billingslea, Eileen; Hannestad, Jonas; Bloch, Michael; Mayes, Linda; Bhagwagar, Zubin; Carson, Richard E.
2016-01-01
Obsessive-compulsive disorder (OCD) is characterized by impaired sensorimotor gating, as measured using prepulse inhibition (PPI). This effect may be related to abnormalities in the serotonin (5-HT) system. 5-HT1B agonists can impair PPI, produce OCD-like behaviors in animals, and exacerbate OCD symptoms in humans. We measured 5-HT1B receptor availability using 11C-P943 positron emission tomography (PET) in unmedicated, non-depressed OCD patients (n = 12) and matched healthy controls (HC; n = 12). Usable PPI data were obtained from 20 of these subjects (10 from each group). There were no significant main effects of OCD diagnosis on 5-HT1B receptor availability (11C-P943 BPND); however, the relationship between PPI and 11C-P943 BPND differed dramatically and significantly between groups. 5-HT1B receptor availability in the basal ganglia and thalamus correlated positively with PPI in controls; these correlations were lost or even reversed in the OCD group. In cortical regions there were no significant correlations with PPI in controls, but widespread positive correlations in OCD patients. Positive correlations between 5-HT1B receptor availability and PPI were consistent across diagnostic groups only in two structures, the orbitofrontal cortex and the amygdala. Differential associations of 5-HT1B receptor availability with PPI in patients suggest functionally important alterations in the serotonergic regulation of cortical/subcortical balance in OCD. PMID:26919057
Ishchenko, Yevheniia; Novosolova, Nataliia; Khafizov, Kamil; Bart, Geneviève; Timonina, Arina; Fayuk, Dmitriy; Skorinkin, Andrei; Giniatullin, Rashid
2017-07-05
Serine 275, a conserved residue of the left flipper region of ATP-gated P2X3 receptors, plays a key role in both agonist binding and receptor desensitization. It is conserved in most of the P2X receptors except P2X7 and P2X6. By combining experimental patch-clamp and modeling approaches, we explored the role of the corresponding residue in the rat P2X7 receptor (rP2X7) by replacing the phenylalanine at position 288 with serine and characterizing the membrane currents generated by either the wild-type (WT) or the mutated rP2X7 receptor. F288S, an rP2X7 mutation, slowed the deactivation subsequent to 2 and 20 s applications of 1 mM ATP. F288S also prevented sensitization (a progressive current growth) observed with the WT in response to a 20 s application of 1 mM ATP. Increasing the ATP concentration to 5 mM promoted sensitization also in the mutated rP2X7 receptor, accelerating the deactivation rate to typical WT values. YO-PRO1 uptake in cells expressing either the WT or the F288S P2X7 receptor was consistent with recorded membrane current data. Interestingly, in the human P2X7 (hP2X7) receptor, substitution Y288S did not change the deactivation rate, while the Y288F mutant generated a "rat-like" phenotype with a fast deactivation rate. Our combined experimental, kinetic, and molecular modeling data suggest that the rat F288S novel phenotype is due to a slower rate of ATP binding and/or unbinding and stabilization of nonsensitized receptor states.
Krivokrysenko, Vadim I; Toshkov, Ilia A; Gleiberman, Anatoli S; Krasnov, Peter; Shyshynova, Inna; Bespalov, Ivan; Maitra, Ratan K; Narizhneva, Natalya V; Singh, Vijay K; Whitnall, Mark H; Purmal, Andrei A; Shakhov, Alexander N; Gudkov, Andrei V; Feinstein, Elena
2015-01-01
There are currently no approved medical radiation countermeasures (MRC) to reduce the lethality of high-dose total body ionizing irradiation expected in nuclear emergencies. An ideal MRC would be effective even when administered well after radiation exposure and would counteract the effects of irradiation on the hematopoietic system and gastrointestinal tract that contribute to its lethality. Entolimod is a Toll-like receptor 5 agonist with demonstrated radioprotective/mitigative activity in rodents and radioprotective activity in non-human primates. Here, we report data from several exploratory studies conducted in lethally irradiated non-human primates (rhesus macaques) treated with a single intramuscular injection of entolimod (in the absence of intensive individualized supportive care) administered in a mitigative regimen, 1-48 hours after irradiation. Following exposure to LD50-70/40 of radiation, injection of efficacious doses of entolimod administered as late as 25 hours thereafter reduced the risk of mortality 2-3-fold, providing a statistically significant (P<0.01) absolute survival advantage of 40-60% compared to vehicle treatment. Similar magnitude of survival improvement was also achieved with drug delivered 48 hours after irradiation. Improved survival was accompanied by predominantly significant (P<0.05) effects of entolimod administration on accelerated morphological recovery of hematopoietic and immune system organs, decreased severity and duration of thrombocytopenia, anemia and neutropenia, and increased clonogenic potential of the bone marrow compared to control irradiated animals. Entolimod treatment also led to reduced apoptosis and accelerated crypt regeneration in the gastrointestinal tract. Together, these data indicate that entolimod is a highly promising potential life-saving treatment for victims of radiation disasters.
Skals, Marianne
2016-01-01
α-Hemolysin (HlyA) from Escherichia coli and leukotoxin A (LtxA) from Aggregatibacter actinomycetemcomitans are important virulence factors in ascending urinary tract infections and aggressive periodontitis, respectively. The extracellular signaling molecule ATP is released immediately after insertion of the toxins into plasma membranes and, via P2X receptors, is essential for the erythrocyte damage inflicted by these toxins. Moreover, ATP signaling is required for the ensuing recognition and phagocytosis of damaged erythrocytes by the monocytic cell line THP-1. Here, we investigate how these toxins affect THP-1 monocyte function. We demonstrate that both toxins trigger early ATP release and a following increase in the intracellular Ca2+ concentration ([Ca2+]i) in THP-1 monocytes. The HlyA- and LtxA-induced [Ca2+]i response is diminished by the P2 receptor antagonist in a pattern that fits the functional P2 receptor expression in these cells. Both toxins are capable of lysing THP-1 cells, with LtxA being more aggressive. Either desensitization or blockage of P2X1, P2X4, or P2X7 receptors markedly reduces toxin-induced cytolysis. This pattern is paralleled in freshly isolated human monocytes from healthy volunteers. Interestingly, only a minor fraction of the toxin-damaged THP-1 monocytes eventually lyse. P2X7 receptor inhibition generally prevents cell damage, except from a distinct cell shrinkage that prevails in response to the toxins. Moreover, we find that preexposure to HlyA preserves the capacity of THP-1 monocytes to phagocytose damaged erythrocytes and may induce readiness to discriminate between damaged and healthy erythrocytes. These findings suggest a new pharmacological target for protecting monocytes during exposure to pore-forming cytolysins during infection or injury. PMID:27528275
du Jardin, Kristian Gaarn; Jensen, Jesper Bornø; Sanchez, Connie; Pehrson, Alan L
2014-01-01
We previously reported that the investigational multimodal antidepressant, vortioxetine, reversed 5-HT depletion-induced memory deficits while escitalopram and duloxetine did not. The present report studied the effects of vortioxetine and the potential impact of its 5-HT1A receptor agonist and 5-HT3 receptor antagonist properties on 5-HT depletion-induced memory deficits. Recognition and spatial working memory were assessed in the object recognition (OR) and Y-maze spontaneous alternation (SA) tests, respectively. 5-HT depletion was induced in female Long-Evans rats using 4-cholro-DL-phenylalanine methyl ester HCl (PCPA) and receptor occupancies were determined by ex vivo autoradiography. Rats were acutely dosed with vortioxetine, ondansetron (5-HT3 receptor antagonist) or flesinoxan (5-HT1A receptor agonist). The effects of chronic vortioxetine administration on 5-HT depletion-induced memory deficits were also assessed. 5-HT depletion reliably impaired memory performance in both the tests. Vortioxetine reversed PCPA-induced memory deficits dose-dependently with a minimal effective dose (MED) ≤0.1mg/kg (∼80% 5-HT3 receptor occupancy; OR) and ≤3.0mg/kg (5-HT1A, 5-HT1B, 5-HT3 receptor occupancy: ∼15%, 60%, 95%) in SA. Ondansetron exhibited a MED ≤3.0μg/kg (∼25% 5-HT3 receptor occupancy; OR), but was inactive in the SA test. Flesinoxan had a MED ≤1.0mg/kg (∼25% 5-HT1A receptor occupancy; SA); only 1.0mg/kg ameliorated deficits in the NOR. Chronic p.o. vortioxetine administration significantly improved memory performance in OR and occupied 95%, 66%, and 9.5% of 5-HT3, 5-HT1B, and 5-HT1A receptors, respectively. Vortioxetine's effects on SA performance may involve 5-HT1A receptor agonism, but not 5-HT3 receptor antagonism, whereas the effects on OR performance may involve 5-HT3 receptor antagonism and 5-HT1A receptor agonism. Copyright © 2013 Elsevier B.V. and ECNP. All rights reserved.
VIP/PACAP receptor mediation of cutaneous active vasodilation during heat stress in humans
Zhao, Joan L.; Wu, Yubo; Johnson, John M.
2010-01-01
Vasoactive intestinal peptide (VIP) is implicated in cutaneous active vasodilation in humans. VIP and the closely related pituitary adenylate cyclase activating peptide (PACAP) act through several receptor types: VIP through VPAC1 and VPAC2 receptors and PACAP through VPAC1, VPAC2, and PAC1 receptors. We examined participation of VPAC2 and/or PAC1 receptors in cutaneous vasodilation during heat stress by testing the effects of their specific blockade with PACAP6–38. PACAP6–38 dissolved in Ringer's was administered by intradermal microdialysis at one forearm site while a control site received Ringer's solution. Skin blood flow was monitored by laser-Doppler flowmetry (LDF). Blood pressure was monitored noninvasively and cutaneous vascular conductance (CVC) calculated. A 5- to 10-min baseline period was followed by ∼70 min of PACAP6–38 (100 μM) perfusion at one site in normothermia and a 3-min period of body cooling. Whole body heating was then performed to engage cutaneous active vasodilation and was maintained until CVC had plateaued at an elevated level at all sites for 5–10 min. Finally, 58 mM sodium nitroprusside was perfused through both microdialysis sites to effect maximal vasodilation. No CVC differences were found between control and PACAP6–38-treated sites during normothermia (19 ± 3%max untreated vs. 20 ± 3%max, PACAP6–38 treated; P > 0.05 between sites) or cold stress (11 ± 2%max untreated vs. 10 ± 2%max, PACAP6–38 treated, P > 0.05 between sites). PACAP6–38 attenuated the increase in CVC during whole body heating when compared with untreated sites (59 ± 3%max untreated vs. 46 ± 3%max, PACAP6–38 treated, P < 0.05). We conclude that VPAC2 and/or PAC1 receptor activation is involved in cutaneous active vasodilation in humans. PMID:20395540
Peroxisome protein import: a complex journey.
Baker, Alison; Lanyon-Hogg, Thomas; Warriner, Stuart L
2016-06-15
The import of proteins into peroxisomes possesses many unusual features such as the ability to import folded proteins, and a surprising diversity of targeting signals with differing affinities that can be recognized by the same receptor. As understanding of the structure and function of many components of the protein import machinery has grown, an increasingly complex network of factors affecting each step of the import pathway has emerged. Structural studies have revealed the presence of additional interactions between cargo proteins and the PEX5 receptor that affect import potential, with a subtle network of cargo-induced conformational changes in PEX5 being involved in the import process. Biochemical studies have also indicated an interdependence of receptor-cargo import with release of unloaded receptor from the peroxisome. Here, we provide an update on recent literature concerning mechanisms of protein import into peroxisomes. © 2016 The Author(s).
Sun, Honglei; Pu, Juan; Wei, Yandi; Sun, Yipeng; Hu, Jiao; Liu, Litao; Xu, Guanlong; Gao, Weihua; Li, Chong; Zhang, Xuxiao; Huang, Yinhua; Chang, Kin-Chow; Liu, Xiufan
2016-01-01
ABSTRACT Since May 2014, highly pathogenic avian influenza H5N6 virus has been reported to cause six severe human infections three of which were fatal. The biological properties of this subtype, in particular its relative pathogenicity and transmissibility in mammals, are not known. We characterized the virus receptor-binding affinity, pathogenicity, and transmissibility in mice and ferrets of four H5N6 isolates derived from waterfowl in China from 2013-2014. All four H5N6 viruses have acquired a binding affinity for human-like SAα2,6Gal-linked receptor to be able to attach to human tracheal epithelial and alveolar cells. The emergent H5N6 viruses, which share high sequence similarity with the human isolate A/Guangzhou/39715/2014 (H5N6), were fully infective and highly transmissible by direct contact in ferrets but showed less-severe pathogenicity than the parental H5N1 virus. The present results highlight the threat of emergent H5N6 viruses to poultry and human health and the need to closely track their continual adaptation in humans. IMPORTANCE Extended epizootics and panzootics of H5N1 viruses have led to the emergence of the novel 2.3.4.4 clade of H5 virus subtypes, including H5N2, H5N6, and H5N8 reassortants. Avian H5N6 viruses from this clade have caused three fatalities out of six severe human infections in China since the first case in 2014. However, the biological properties of this subtype, especially the pathogenicity and transmission in mammals, are not known. Here, we found that natural avian H5N6 viruses have acquired a high affinity for human-type virus receptor. Compared to the parental clade 2.3.4 H5N1 virus, emergent H5N6 isolates showed less severe pathogenicity in mice and ferrets but acquired efficient in-contact transmission in ferrets. These findings suggest that the threat of avian H5N6 viruses to humans should not be ignored. PMID:27122581
Sun, Honglei; Pu, Juan; Wei, Yandi; Sun, Yipeng; Hu, Jiao; Liu, Litao; Xu, Guanlong; Gao, Weihua; Li, Chong; Zhang, Xuxiao; Huang, Yinhua; Chang, Kin-Chow; Liu, Xiufan; Liu, Jinhua
2016-07-15
Since May 2014, highly pathogenic avian influenza H5N6 virus has been reported to cause six severe human infections three of which were fatal. The biological properties of this subtype, in particular its relative pathogenicity and transmissibility in mammals, are not known. We characterized the virus receptor-binding affinity, pathogenicity, and transmissibility in mice and ferrets of four H5N6 isolates derived from waterfowl in China from 2013-2014. All four H5N6 viruses have acquired a binding affinity for human-like SAα2,6Gal-linked receptor to be able to attach to human tracheal epithelial and alveolar cells. The emergent H5N6 viruses, which share high sequence similarity with the human isolate A/Guangzhou/39715/2014 (H5N6), were fully infective and highly transmissible by direct contact in ferrets but showed less-severe pathogenicity than the parental H5N1 virus. The present results highlight the threat of emergent H5N6 viruses to poultry and human health and the need to closely track their continual adaptation in humans. Extended epizootics and panzootics of H5N1 viruses have led to the emergence of the novel 2.3.4.4 clade of H5 virus subtypes, including H5N2, H5N6, and H5N8 reassortants. Avian H5N6 viruses from this clade have caused three fatalities out of six severe human infections in China since the first case in 2014. However, the biological properties of this subtype, especially the pathogenicity and transmission in mammals, are not known. Here, we found that natural avian H5N6 viruses have acquired a high affinity for human-type virus receptor. Compared to the parental clade 2.3.4 H5N1 virus, emergent H5N6 isolates showed less severe pathogenicity in mice and ferrets but acquired efficient in-contact transmission in ferrets. These findings suggest that the threat of avian H5N6 viruses to humans should not be ignored. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Burcher, Elizabeth; Shang, Fei; Warner, Fiona J; Du, Qin; Lubowski, David Z; King, Denis W; Liu, Lu
2008-01-01
Neurokinin A (NKA) is an important spasmogen in human colon. We examined inflammatory disease-related changes in the tachykinin NK(2) receptor system in human sigmoid colon circular muscle, using functional, radioligand binding, and quantitative reverse transcription-polymerase chain reaction methods. In circular muscle strips, indomethacin enhanced contractile responses to NKA (p < 0.01) and to the NK(2) receptor-selective agonist [Lys(5),MeLeu(9),Nle(10)]-NKA(4-10) (p < 0.05) in both normal and acute diverticular disease (DD) specimens, indicating NK(2) receptor-mediated release of relaxant prostanoids. Contractile responses to both tachykinins were reduced in strips from DD (p < 0.001) and ulcerative colitis (UC) (p < 0.05) specimens. Responses to acetylcholine were no different in other strips from the same disease patients, demonstrating that the change in responsiveness to tachykinins in disease is specifically mediated by the NK(2) receptor. In membranes from UC specimens, receptor affinity for (125)I-NKA (median K(D) 0.91 nM, n = 16) was lower (p < 0.01) than that in age-matched control specimens (K(D) 0.55 nM, n = 40), whereas K(D) (0.65 nM, n = 28) in DD was no different from control. No disease-related changes in receptor number (B(max)) were found (mean, 2.0-2.5 fmol/mg of wet weight tissue), suggesting that the reduced contractile responses in disease are not due to a loss of receptor number. Different mechanisms may account for the reduced contractility in DD compared with UC. A gender-related difference in receptor density was seen in controls, with B(max) lower in females (1.77 fmol/mg, n = 15) than in males (2.60 fmol/mg, n = 25, p = 0.01). In contrast, no gender-related differences were seen in NK(2) receptor mRNA in control colonic muscle, indicating that the gender difference is a post-translational event.
ATP excites mouse vomeronasal sensory neurons through activation of P2X receptors.
Vick, J S; Delay, R J
2012-09-18
Purinergic signaling through activation of P2X and P2Y receptors is critically important in the chemical senses. In the mouse main olfactory epithelium (MOE), adenosine 5'-triphosphate (ATP) elicits an increase in intracellular calcium ([Ca(2+)](I)) and reduces the responsiveness of olfactory sensory neurons to odorants through activation of P2X and P2Y receptors. We investigated the role of purinergic signaling in vomeronasal sensory neuron (VSN)s from the mouse vomeronasal organ (VNO), an olfactory organ distinct from the MOE that responds to many conspecific chemical cues. Using a combination of calcium imaging and patch-clamp electrophysiology with isolated VSNs, we demonstrated that ATP elicits an increase in [Ca(2+)](I) and an inward current with similar EC(50)s. Neither adenosine nor the P2Y receptor ligands adenosine 5'-diphosphate, uridine 5'-triphosphate, and uridine-5'-disphosphate could mimic either effect of ATP. Moreover, the increase in [Ca(2+)](I) required the presence of extracellular calcium and the inward current elicited by ATP was partially blocked by the P2X receptor antagonists pyridoxal-phosphate-6-azophenyl-2',4'-disulfonate and 2',3'-O-(2,4,6-trinitrophenyl) adenosine 5'-triphosphate. Consistent with the activation of P2X receptors, we detected gene expression of the P2X1 and 3 receptors in the VNO by Reverse transcription polymerase chain reaction (RT-PCR). When co-delivered with dilute urine, a natural stimulus, ATP significantly increased the inward current above that elicited by dilute urine or ATP alone. Mechanical stimulation of the VNO induced the release of ATP, detected by luciferin-luciferase luminometry, and this release of ATP was completely abolished in the presence of the connexin/pannexin hemichannel blocker, carbenoxolone. We conclude that the release of ATP could occur during the activity of the vasomotor pump that facilitates the movement of chemicals into the VNO for detection by VSNs. This mechanism could lead to a
Bednarek, Maria A; MacNeil, Tanya; Tang, Rui; Fong, Tung M; Cabello, M Angeles; Maroto, Marta; Teran, Ana
2007-05-01
Alpha-melanotropin, Ac-Ser(1)-Tyr-Ser-Met-Glu-His(6)-Phe(7)-Arg(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2)(1), is a non-selective endogenous agonist for the melanocortin receptor 5; the receptor present in various peripheral tissues and in the brain, cortex and cerebellum. Most of the synthetic analogs of alphaMSH, including a broadly used and more potent the NDP-alphaMSH peptide, Ac-Ser(1)-Tyr-Ser-Nle(4)-Glu-His(6)-D-Phe(7)-Arg(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2), are also not particularly selective for MC5R. To elucidate physiological functions of the melanocortin receptor 5 in rodents and humans, the receptor subtype selective research tools are needed. We report herein syntheses and pharmacological evaluation in vitro of several analogs of NDP-alphaMSH which are highly potent and specific agonists for the human MC5R. The new linear peptides, of structures and solubility properties similar to those of the endogenous ligand alphaMSH, are exemplified by compound 7, Ac-Ser(1)-Tyr-Ser-Met-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2) (Oic: octahydroindole-2-COOH, 4,4'-Bip: 4,4'-biphenylalanine, Pip: pipecolic acid), shortly NODBP-alphaMSH, which has an IC(50)=0.74 nM (binding assay) and EC(50)=0.41 (cAMP production assay) at hMC5R nM and greater than 3500-fold selectivity with respect to the melanocortin receptors 1b, 3 and 4. A shorter peptide derived from NODBP-alphaMSH: Ac-Nle-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8)-Trp(9) -NH(2) (17) was measured to be an agonist only 10-fold less potent at hMC5R than the full length parent peptide. In the structure of this smaller analog, the Nle-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8) segment was found to be critical for high agonist potency, while the C-terminal Trp(9) residue was shown to be required for high hMC5R selectivity versus hMC1b,3,4R.
Ferrando, Maria Laura; Willemse, Niels; Zaccaria, Edoardo; Pannekoek, Yvonne; van der Ende, Arie; Schultsz, Constance
2017-01-01
Streptococcus suis is a zoonotic pathogen, causing meningitis and septicemia. We previously demonstrated that the gastrointestinal tract (GIT) is an entry site for zoonotic S. suis infection. Here we studied the contribution of Streptococcal adhesin Protein (SadP) to host-pathogen interaction at GIT level. SadP expression in presence of Intestinal Epithelial Cells (IEC) was compared with expression of other virulence factors by measuring transcript levels using quantitative Real Time PCR (qRT-PCR). SadP variants were identified by phylogenetic analysis of complete DNA sequences. The interaction of SadP knockout and complementation mutants with IEC was tested in vitro. Expression of sadP was significantly increased in presence of IEC. Sequence analysis of 116 invasive strains revealed five SadP sequence variants, correlating with genotype. SadP1, present in zoonotic isolates of clonal complex 1, contributed to binding to both human and porcine IEC and translocation across human IEC. Antibodies against the globotriaosylceramide Gb3/CD77 receptor significantly inhibited adhesion to human IEC. SadP is involved in the host-pathogen interaction in the GIT. Differences between SadP variants may determine different affinities to the Gb3/CD77 host-receptor, contributing to variation in adhesion capacity to host IEC and thus to S. suis zoonotic potential.
Reptile Toll-like receptor 5 unveils adaptive evolution of bacterial flagellin recognition.
Voogdt, Carlos G P; Bouwman, Lieneke I; Kik, Marja J L; Wagenaar, Jaap A; van Putten, Jos P M
2016-01-07
Toll-like receptors (TLR) are ancient innate immune receptors crucial for immune homeostasis and protection against infection. TLRs are present in mammals, birds, amphibians and fish but have not been functionally characterized in reptiles despite the central position of this animal class in vertebrate evolution. Here we report the cloning, characterization, and function of TLR5 of the reptile Anolis carolinensis (Green Anole lizard). The receptor (acTLR5) displays the typical TLR protein architecture with 22 extracellular leucine rich repeats flanked by a N- and C-terminal leucine rich repeat domain, a membrane-spanning region, and an intracellular TIR domain. The receptor is phylogenetically most similar to TLR5 of birds and most distant to fish TLR5. Transcript analysis revealed acTLR5 expression in multiple lizard tissues. Stimulation of acTLR5 with TLR ligands demonstrated unique responsiveness towards bacterial flagellin in both reptile and human cells. Comparison of acTLR5 and human TLR5 using purified flagellins revealed differential sensitivity to Pseudomonas but not Salmonella flagellin, indicating development of species-specific flagellin recognition during the divergent evolution of mammals and reptiles. Our discovery of reptile TLR5 fills the evolutionary gap regarding TLR conservation across vertebrates and provides novel insights in functional evolution of host-microbe interactions.
Reptile Toll-like receptor 5 unveils adaptive evolution of bacterial flagellin recognition
Voogdt, Carlos G. P.; Bouwman, Lieneke I.; Kik, Marja J. L.; Wagenaar, Jaap A.; van Putten, Jos P. M.
2016-01-01
Toll-like receptors (TLR) are ancient innate immune receptors crucial for immune homeostasis and protection against infection. TLRs are present in mammals, birds, amphibians and fish but have not been functionally characterized in reptiles despite the central position of this animal class in vertebrate evolution. Here we report the cloning, characterization, and function of TLR5 of the reptile Anolis carolinensis (Green Anole lizard). The receptor (acTLR5) displays the typical TLR protein architecture with 22 extracellular leucine rich repeats flanked by a N- and C-terminal leucine rich repeat domain, a membrane-spanning region, and an intracellular TIR domain. The receptor is phylogenetically most similar to TLR5 of birds and most distant to fish TLR5. Transcript analysis revealed acTLR5 expression in multiple lizard tissues. Stimulation of acTLR5 with TLR ligands demonstrated unique responsiveness towards bacterial flagellin in both reptile and human cells. Comparison of acTLR5 and human TLR5 using purified flagellins revealed differential sensitivity to Pseudomonas but not Salmonella flagellin, indicating development of species-specific flagellin recognition during the divergent evolution of mammals and reptiles. Our discovery of reptile TLR5 fills the evolutionary gap regarding TLR conservation across vertebrates and provides novel insights in functional evolution of host-microbe interactions. PMID:26738735
Olson, Marnie L.; Sandison, Mairi E.; Chalmers, Susan; McCarron, John G.
2012-01-01
Summary Increases in cytosolic Ca2+ concentration ([Ca2+]c) mediated by inositol (1,4,5)-trisphosphate [Ins(1,4,5)P3, hereafter InsP3] regulate activities that include division, contraction and cell death. InsP3-evoked Ca2+ release often begins at a single site, then regeneratively propagates through the cell as a Ca2+ wave. The Ca2+ wave consistently begins at the same site on successive activations. Here, we address the mechanisms that determine the Ca2+ wave initiation site in intestinal smooth muscle cells. Neither an increased sensitivity of InsP3 receptors (InsP3R) to InsP3 nor regional clustering of muscarinic receptors (mAChR3) or InsP3R1 explained the selection of an initiation site. However, examination of the overlap of mAChR3 and InsP3R1 localisation, by centre of mass analysis, revealed that there was a small percentage (∼10%) of sites that showed colocalisation. Indeed, the extent of colocalisation was greatest at the Ca2+ wave initiation site. The initiation site might arise from a selective delivery of InsP3 from mAChR3 activity to particular InsP3Rs to generate faster local [Ca2+]c increases at sites of colocalisation. In support of this hypothesis, a localised subthreshold ‘priming’ InsP3 concentration applied rapidly, but at regions distant from the initiation site, shifted the wave to the site of the priming. Conversely, when the Ca2+ rise at the initiation site was rapidly and selectively attenuated, the Ca2+ wave again shifted and initiated at a new site. These results indicate that Ca2+ waves initiate where there is a structural and functional coupling of mAChR3 and InsP3R1, which generates junctions in which InsP3 acts as a highly localised signal by being rapidly and selectively delivered to InsP3R1. PMID:22946060
Ou, Amber; Gu, Ben J; Wiley, James S
2018-04-01
Activation of P2X7 receptors is widely recognised to initiate proinflammatory responses. However P2X7 also has a dual function as a scavenger receptor which is active in the absence of ATP and plasma proteins and may be important in central nervous system (CNS) diseases. Here, we investigated both P2X7 pore formation and its phagocytic function in fresh human monocytes (as a model of microglia) by measuring ATP-induced ethidium dye uptake and fluorescent bead uptake respectively. This was studied in monocytes expressing various polymorphic variants as well as in the presence of different P2X7 antagonists and ionic media. P2X7-mediated phagocytosis was found to account for about half of Latrunculin (or Cytochalasin D)-sensitive bead engulfment by fresh human monocytes. Monocytes harbouring P2X7 Ala348Thr or Glu496Ala polymorphic variants showed increase or loss of ethidium uptake respectively, but these changes in pore formation did not always correspond to the changes in phagocytosis of YG beads. Unlike pore function, P2X7-mediated phagocytosis was not affected by three potent selective P2X7 antagonists and remained identical in Na + and K + media. Taken together, our results show that P2X7 is a scavenger receptor with important function in the CNS but its phagocytic function has features distinct from its pore function. Both P2X7 pore formation and P2X7-mediated phagocytosis should be considered in the design of new P2X7 antagonists for the treatment of CNS diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Human olfactory receptor responses to odorants
Mainland, Joel D; Li, Yun R; Zhou, Ting; Liu, Wen Ling L; Matsunami, Hiroaki
2015-01-01
Although the human olfactory system is capable of discriminating a vast number of odors, we do not currently understand what chemical features are encoded by olfactory receptors. In large part this is due to a paucity of data in a search space covering the interactions of hundreds of receptors with billions of odorous molecules. Of the approximately 400 intact human odorant receptors, only 10% have a published ligand. Here we used a heterologous luciferase assay to screen 73 odorants against a clone library of 511 human olfactory receptors. This dataset will allow other researchers to interrogate the combinatorial nature of olfactory coding. PMID:25977809
Song, Kee Jae; Kim, Na Hyun; Lee, Gi Bong; Kim, Ji Hoon; Kwon, Jin Ho; Kim, Kyung-Su
2013-05-01
If cholesterol in the cell membrane is depleted by treating cells with methyl-β-cyclodextrin (MβCD), the activities of transmembrane receptors are altered in a cell-specific and/or receptor-specific manner. The proinflammatory cytokines, IL-1β is potent inducers of MUC5AC mRNA and protein synthesis in human airway epithelial cells. Cells activated by IL-1β showed increased phosphorylation of extracellular signal regulated kinase (ERK) and p38 mitogen-activated protein kinase (MAPK). Thus, we investigated the effects of cholesterol depletion on the expression of MUC5AC in human airway epithelial cells and whether these alterations to MUC5AC expression were related to MAPK activity. After NCI-H292 cells were pretreated with 1% MβCD before adding IL-1β for 24 hours, MUC5AC mRNA expression was determined by reverse transcription- polymerase chain reaction (RT-PCR) and real time-PCR. Cholesterol depletion by MβCD was measured by modified microenzymatic fluorescence assay and filipin staining. The phosphorylation of IL-1 receptor, ERK and p38 MAPK, was analyzed by western blot. Cholesterol in the cell membrane was significantly depleted by treatment with MβCD on cells. IL-1β-induced MUC5AC mRNA expression was decreased by MβCD and this decrease occurred IL-1-receptor- specifically. Moreover, we have shown that MβCD suppressed the activation of ERK1/2 and p38 MAPK in cells activated with IL-1β. This result suggests that MβCD-mediated suppression of IL-1β-induced MUC5AC mRNA operated via the ERK- and p38 MAPK-dependent pathway. Cholesterol depletion in NCI-H292 cell membrane may be considered an anti-hypersecretory method since it effectively inhibits mucus secretion of respiratory epithelial cells.
Acetylcholine receptors in the human retina
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hutchins, J.B.; Hollyfield, J.G.
1985-11-01
Evidence for a population of acetylcholine (ACh) receptors in the human retina is presented. The authors have used the irreversible ligand TH-propylbenzilylcholine mustard (TH-PrBCM) to label muscarinic receptors. TH- or SVI-alpha-bungarotoxin (alpha-BTx) was used to label putative nicotinic receptors. Muscarinic receptors are apparently present in the inner plexiform layer of the retina. Autoradiographic grain densities are reduced in the presence of saturating concentrations of atropine, quinuclidinyl benzilate or scopolamine; this indicates that TH-PrBCM binding is specific for a population of muscarinic receptors in the human retina. Binding sites for radiolabeled alpha-BTx are found predominantly in the inner plexiform layer ofmore » the retina. Grain densities are reduced in the presence of d-tubocurarine, indicating that alpha-BTx may bind to a pharmacologically relevant nicotinic ACh receptor. This study provides evidence for cholinergic neurotransmission in the human retina.« less
Design of chimeric peptide ligands to galanin receptors and substance P receptors.
Langel, U; Land, T; Bartfai, T
1992-06-01
Several chimeric peptides were synthesized and found to be high-affinity ligands for both galanin and substance P receptors in membranes from the rat hypothalamus. The peptide galantide, composed of the N-terminal part of galanin and C-terminal part of substance P (SP), galanin-(1-12)-Pro-SP-(5-11) amide, which is the first galanin antagonist to be reported, recognizes two classes of galanin binding sites (KD(1) less than 0.1 nM and KD(2) approximately 6 nM) in the rat hypothalamus, while it appears to bind to a single population of SP receptors (KD approximately 40 nM). The chimeric peptide has higher affinity towards galanin receptors than the endogenous peptide galanin-(1-29) (KD approximately 1 nM) or its N-terminal fragment galanin-(1-13) (KD approximately 1 microM), which constitutes the N-terminus of the chimeric peptide. Galantide has also higher affinity for the SP receptors than the C-terminal SP fragment-(4-11) amide (KD = 0.4 microM), which constitutes its C-terminal portion. Substitution of amino acid residues, which is of importance for recognition of galanin by galanin receptors, such as [Trp2], in the galanin portion of the chimeric peptide or substitution of ([Phe7] or [Met11]-amide) in the SP portion of chimeric peptide both cause significant loss in affinity of the analogs of galantide for both the galanin- and the SP-receptors. These results suggest that the high affinity of the chimeric peptide, galantide, may in part be accounted for by simultaneous recognition/binding to both receptors.(ABSTRACT TRUNCATED AT 250 WORDS)
Characterization of the Igf-II Binding Site of the IGF-II/MAN-6-P Receptor Extracellular Domain.
NASA Astrophysics Data System (ADS)
Garmroudi, Farideh
1995-01-01
In mammals, insulin-like growth factor II (IGF -II) and glycoproteins bearing the mannose 6-phosphate (Man -6-P) recognition marker bind with high affinity to the same receptor. The functional consequences of IGF-II binding to the receptor at the cell surface are not clear. In these studies, we sought to broaden our understanding of the functional regions of the receptor regarding its IGF -II binding site. The IGF-II binding/cross-linking domain of the IGF-II/Man-6-P receptor was mapped by sequencing receptor fragments covalently attached to IGF-II. Purified rat placental or bovine liver receptors were affinity-labeled, with ^{125}I-IGF-II and digested with endoproteinase Glu-C. Analysis of digests by gel electrophoresis revealed a major radiolabeled band of 18 kDa, which was purified by gel filtration chromatography followed by reverse-phase HPLC and electroblotting. Sequence analysis revealed that, the peptide S(H)VNSXPMF, located within extracellular repeat 10 and beginning with serine 1488 of the bovine receptor, was the best candidate for the IGF-II cross-linked peptide. These data indicated that residues within repeats 10-11 were important for IGF -II binding. To define the location of the IGF-II binding site further, a nested set of six human receptor cDNA constructs was designed to produce epitope-tagged fusion proteins encompassing the region between repeats 8 and 11 of the human IGF-II/Man-6-P receptor extracellular domain. These truncated receptors were transiently expressed in COS-7 cells, immunoprecipitated and analyzed for their abilities to bind and cross-link to IGF-II. All of the constructs were capable of binding/cross-linking to IGF-II, except for the 9.0-11 construct. Displacement curve analysis indicated that the truncated receptors were approximately equivalent in IGF-II binding affinity, but were of 5- to 10-fold lower affinity than full-length receptors. Sequencing of the 9.0-11 construct indicated the presence of a point mutation
Leurs, R.; Smit, M. J.; Menge, W. M.; Timmerman, H.
1994-01-01
1. The gene for the human histamine H2 receptor was stably expressed in Chinese hamster ovary (CHO) cells and characterized by [125I]-iodoaminopotentidine binding studies. In addition, the coupling of the expressed receptor protein to a variety of signal transduction pathways was investigated. 2. After cotransfection of CHO cells with pCMVhumH2 and pUT626, a phleomycine-resistant clonal cell line (CHOhumH2) was isolated that expressed 565 +/- 35 fmol kg-1 protein binding sites with high affinity (0.21 +/- 0.02 nM) for the H2 antagonist, [125I]-iodoaminopotentidine. 3. Displacement studies with a variety of H2 antagonists indicated that the encoded protein was indistinguishable from the H2 receptor identified in human brain membranes and guinea-pig right atrium. The Ki-values observed in the various preparations correlated very well (r2 = 0.996-0.920). 4. Displacement studies with histamine showed that a limited fraction (32 +/- 6%) of the binding sites showed a high affinity for histamine (2 +/- 1.2 microM); the shallow displacement curves were reflected by a Hill-coefficient significantly different from unity (nH = 0.58 +/- 0.09). The addition of 100 microM Gpp(NH)p resulted in a steepening of the displacement curve (nH = 0.79 +/- 0.02) and a loss of high affinity sites for histamine. 5. Displacement studies with other agonists indicated that the recently developed specific H2 agonists, amthamine and amselamine, showed an approximately 4-5 fold higher affinity for the human H2 receptor than histamine. 6. Stimulation of CHOhumH2 cells with histamine resulted in a rapid rise of the intracellular cyclic AMP levels. After 10 min an approximately 10 fold increase in cyclic AMP could be measured.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 4 PMID:7921611
Idzko, Marco; Dichmann, Stefan; Ferrari, Davide; Di Virgilio, Francesco; la Sala, Andrea; Girolomoni, Giampiero; Panther, Elisabeth; Norgauer, Johannes
2002-08-01
Dendritic cells (DCs) are considered the principal initiators of immune response because of their ability to migrate into peripheral tissues and lymphoid organs, process antigens, and activate naive T cells. There is evidence that extracellular nucleotides regulate certain functions of DCs via G-protein-coupled P2Y receptors (P2YR) and ion-channel-gated P2X receptors (P2XR). Here we investigated the chemotactic activity and analyzed the migration-associated intracellular signaling events such as actin reorganization and Ca(++) transients induced by common P2R agonists such as adenosine 5'-triphosphate (ATP) and 2-methylthioadenosine triphosphate, the P2YR agonists UTP and adenosine 5'-diphosphate (ADP), or the P2XR agonists alphabeta-methylenadenosine-5'-triphosphate and 2',3'-(4-benzoyl)benzoyl-ATP. The common P2R agonists and the selective P2YR agonists turned out to be potent chemotactic stimuli for immature DCs, but not for mature DCs. In contrast, P2XR agonists had only marginal chemotactic activity in both DC types. Chemotaxis was paralleled by a rise in the intracellular Ca(++) concentration and by actin polymerization. Studies with pertussis toxin implicated that intracellular signaling events such as actin polymerization, mobilization of intracellular Ca(++), and migration induced by nucleotides was mediated via G(i/o) protein-coupled P2YR. Moreover, functional studies revealed selective down-regulation of this G(i/o) protein-coupled chemotactic P2YR responsiveness during maturation, although immature and mature DCs expressed similar amounts of mRNA for the P2R subtypes (P2Y(2)R, P2Y(4)R, P2Y(5)R, P2Y(7)R, P2Y(11)R and P2X(1)R, P2X(4)R, P2X(7)R), and no major differences in respect to the mRNA expression of these receptors could be observed by semiquantitative reverse transcription and polymerase chain reaction (RT-PCR). In summary, our data describe a differential chemotactic response of immature and mature DCs to nucleotides, and lend further support to
Glutamate Delta-1 Receptor Regulates Metabotropic Glutamate Receptor 5 Signaling in the Hippocampus.
Suryavanshi, Pratyush S; Gupta, Subhash C; Yadav, Roopali; Kesherwani, Varun; Liu, Jinxu; Dravid, Shashank M
2016-08-01
The delta family of ionotropic glutamate receptors consists of glutamate delta-1 (GluD1) and glutamate delta-2 receptors. We have previously shown that GluD1 knockout mice exhibit features of developmental delay, including impaired spine pruning and switch in the N-methyl-D-aspartate receptor subunit, which are relevant to autism and other neurodevelopmental disorders. Here, we identified a novel role of GluD1 in regulating metabotropic glutamate receptor 5 (mGlu5) signaling in the hippocampus. Immunohistochemical analysis demonstrated colocalization of mGlu5 with GluD1 punctas in the hippocampus. Additionally, GluD1 protein coimmunoprecipitated with mGlu5 in the hippocampal membrane fraction, as well as when overexpressed in human embryonic kidney 293 cells, demonstrating that GluD1 and mGlu5 may cooperate in a signaling complex. The interaction of mGlu5 with scaffold protein effector Homer, which regulates mechanistic target of rapamycin (mTOR) signaling, was abnormal both under basal conditions and in response to mGlu1/5 agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) in GluD1 knockout mice. The basal levels of phosphorylated mTOR and protein kinase B, the signaling proteins downstream of mGlu5 activation, were higher in GluD1 knockout mice, and no further increase was induced by DHPG. We also observed higher basal protein translation and an absence of DHPG-induced increase in GluD1 knockout mice. In accordance with a role of mGlu5-mediated mTOR signaling in synaptic plasticity, DHPG-induced internalization of surface α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor subunits was impaired in the GluD1 knockout mice. These results demonstrate that GluD1 interacts with mGlu5, and loss of GluD1 impairs normal mGlu5 signaling potentially by dysregulating coupling to its effector. These studies identify a novel role of the enigmatic GluD1 subunit in hippocampal function. Copyright © 2016 by The American Society for Pharmacology and Experimental
Sheldrick, R L; Rabe, K F; Fischer, A; Magnussen, H; Coleman, R A
1995-11-01
The tachykinin-receptors mediating contraction of human bronchus have been characterized using both tachykinin-receptor selective agonists and blocking drugs under conditions where tachykinin metabolism by endogenous peptidases has been controlled, and true equilibrium conditions have been established. The findings that neurokinin A (EC50 = 2 nM) is the most potent agonist, and the NK2-receptor selective agonist, GR64349, is only 3-fold weaker, whereas agonists selective for NK1-receptors, substance P methyl ester, or NK3-receptors, senktide, are inactive, suggest that this effect is mediated exclusively by NK2-receptors. This is supported by observations that GR64349 is antagonised by the selective NK2-receptor blocking drugs, MEN10207 (pA2 = 6.7), R396 (pA2 = 6.1), (+/-)SR48968 (pA2 = 8.4) and GR159897 (pA2 = 8.6), but not by the NK1-receptor blocking drug, GR82334 (pA2 < 5). In approximately half of the preparations, the peptidase inhibitors, phosphoramidon (1 microM) and bestatin (100 microM), caused a marked and well-maintained contraction (approximately 20% of neurokinin A maximum), which may indicate a role for endogenous tachykinins in the regulation of tone in this preparation. This is supported by the finding that neurokinin A-immunoreactive nerve fibres are located around intrinsic neurones of local ganglia and within the smooth muscle layer of this preparation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feltz, S.M.; Swanson, M.L.; Wemmie, J.A.
1988-05-03
Treatment of human placenta membranes at pH 8.5 in the presence of 2.0 mM dithiothreitol (DTT) for 5 min, followed by the simultaneous removal of the DTT and pH adjustment of pH 7.6, resulted in the formation of a functional ..cap alpha beta.. heterodimeric insulin-like growth factor 1 (IGF-1) receptor complex from the native ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state. The membrane-bound ..cap alpha beta.. heterodimeric complex displayed similar curvilinear /sup 125/I-IGF-1 equilibrium binding compared to the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric complex. /sup 125/I-IGF-1 binding to both the isolated ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta..more » heterodimeric complexes demonstrated a marked straightening of the Scatchard plots, compared to the placenta membrane-bound IGF-1 receptors, with a 2-fold increase in the high-affinity binding component. IGF-1 stimulation of IGF-1 receptor autophosphorylation indicated that the ligand-dependent activation of ..cap alpha beta.. heterodimeric protein kinase activity occurred concomitant with the reassociation into a covalent ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric state. These data demonstrate that (i) a combination of alkaline pH and DTT treatment of human placenta membranes results in the formation of an ..cap alpha beta.. heterodimeric IGF-1 receptor complex, (ii) unlike the insulin receptor, high-affinity homogeneous IGF-1 binding occurs in both the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta.. heterodimeric complexes, and (iii) IGF-1-dependent autophosphorylation of the ..cap alpha beta.. heterodimeric IGF-1 receptor complex correlates wit an IGF-1 dependent covalent reassociation into an ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state.« less
Barchasz, E; Naline, E; Molimard, M; Moreau, J; Georges, O; Emonds-Alt, X; Advenier, C
1999-08-20
Interleukin-1beta has been reported to induce airway hyperresponsiveness in several animal models. In this study, we have investigated whether interleukin-1beta was able to potentiate the contractions of human isolated small bronchi (internal diameter < or = 1 mm) provoked by a specific tachykinin NK1 receptor agonist, [Sar9,Met(O2)11]substance P. Pre-incubation of human isolated small bronchi with interleukin-1beta (10 ng/ml, in Krebs-Henseleit solution, at 21 degrees C for 15 h) potentiated the contractile response to [Sar9,Met(O2)11]substance P. It also increased the [Sar9,Met(O2)11]substance P-induced release of thromboxane B2, the stable metabolite of thromboxane A2. Indomethacin (10(-6) M), a non-specific cyclooxygenase inhibitor, or GR 32191 ((1R-(1alpha(Z)),2beta,3beta,5alpha))-(+)-7-(5-(((1,1' -biphenyl)-4-yl)-methoxy)-3-hydroxy-2-(1-piperidinyl)cyclopentyl)-4-hept enoic acid, hydrochloride) (10(-6) M), a prostanoid TP-receptor antagonist, blocked the contractions induced by [Sar9,Met(O2)11]substance P both in control experiments and after interleukin-1beta pre-treatment, indicating that prostanoids and thromboxane receptors are directly implicated in the [Sar9,Met(O2)11]substance P-induced contractile response. The thromboxane mimetic U-46619 (10(-8)-10(-6) M) (9,11-dideoxy-11alpha,9alpha-epoxymethano-prostaglandin F2alpha)-induced contractions of human isolated small bronchi were not enhanced by interleukin-1beta pre-treatment, suggesting that no up-regulation of thromboxane receptors occurred. Furthermore, the cyclooxygenase-2 inhibitor CGP 28238 (6-(2,4-difluorophenoxy)-5-methyl-sulfonylamino-1-indanon e) (10(-6) M) had no direct effect on [Sar9,Met(O2)11]substance P-provoked contractions, but inhibited the interleukin-1beta-induced potentiation of [Sar9,Met(O2)11]substance P response. In conclusion, our results show that interleukin-1beta pre-treatment is able to potentiate the contractions of isolated human small bronchi provoked by [Sar9,Met(O2
Jiang, Xi-Ling; Shen, Hong-Wu; Yu, Ai-Ming
2015-02-01
5-Methoxy-N,N-dimethyltryptamine (5-MeO-DMT) and harmaline are serotonin (5-HT) analogs often abused together, which alters thermoregulation that may indicate the severity of serotonin toxicity. Our recent studies have revealed that co-administration of monoamine oxidase inhibitor harmaline leads to greater and prolonged exposure to 5-HT agonist 5-MeO-DMT that might be influenced by cytochrome P450 2D6 (CYP2D6) status. This study was to define the effects of harmaline and 5-MeO-DMT on thermoregulation in wild-type and CYP2D6-humanized (Tg-CYP2D6) mice, as well as the involvement of 5-HT receptors. Animal core body temperatures were monitored noninvasively in the home cages after implantation of telemetry transmitters and administration of drugs. Harmaline (5 and 15 mg/kg, i.p.) alone was shown to induce hypothermia that was significantly affected by CYP2D6 status. In contrast, higher doses of 5-MeO-DMT (10 and 20 mg/kg) alone caused hyperthermia. Co-administration of harmaline (2, 5 or 15 mg/kg) remarkably potentiated the hyperthermia elicited by 5-MeO-DMT (2 or 10 mg/kg), which might be influenced by CYP2D6 status at certain dose combination. Interestingly, harmaline-induced hypothermia was only attenuated by 5-HT1A receptor antagonist WAY-100635, whereas 5-MeO-DMT- and harmaline-5-MeO-DMT-induced hyperthermia could be suppressed by either WAY-100635 or 5-HT2A receptor antagonists (MDL-100907 and ketanserin). Moreover, stress-induced hyperthermia under home cage conditions was not affected by WAY-100635 but surprisingly attenuated by MDL-100907 and ketanserin. Our results indicate that co-administration of monoamine oxidase inhibitor largely potentiates 5-MeO-DMT-induced hyperthermia that involves the activation of both 5-HT1A and 5-HT2A receptors. These findings shall provide insights into development of anxiolytic drugs and new strategies to relieve the lethal hyperthermia in serotonin toxicity.
Jiang, Xi-Ling; Shen, Hong-Wu; Yu, Ai-Ming
2014-01-01
5-Methoxy-N,N-dimethyltryptamine (5-MeO-DMT) and harmaline are serotonin (5-HT) analogs often abused together, which alters thermoregulation that may indicate the severity of serotonin toxicity. Our recent studies have revealed that co-administration of monoamine oxidase inhibitor harmaline leads to greater and prolonged exposure to 5-HT agonist 5-MeO-DMT that might be influenced by cytochrome P450 2D6 (CYP2D6) status. This study was to define the effects of harmaline and 5-MeO-DMT on thermoregulation in wild-type and CYP2D6-humanized (Tg-CYP2D6) mice, as well as the involvement of 5-HT receptors. Animal core body temperatures were monitored noninvasively in the home cages after implantation of telemetry transmitters and administration of drugs. Harmaline (5 and 15 mg/kg, i.p.) alone was shown to induce hypothermia that was significantly affected by CYP2D6 status. In contrast, higher doses of 5-MeO-DMT (10 and 20 mg/kg) alone caused hyperthermia. Co-administration of harmaline (2, 5 or 15 mg/kg) remarkably potentiated the hyperthermia elicited by 5-MeO-DMT (2 or 10 mg/kg), which might be influenced by CYP2D6 status at certain dose combination. Interestingly, harmaline-induced hypothermia was only attenuated by 5-HT1A receptor antagonist WAY-100635, whereas 5-MeO-DMT- and harmaline-5-MeO-DMT-induced hyperthermia could be suppressed by either WAY-100635 or 5-HT2A receptor antagonists (MDL-100907 and ketanserin). Moreover, stress-induced hyperthermia under home cage conditions was not affected by WAY-100635 but surprisingly attenuated by MDL-100907 and ketanserin. Our results indicate that co-administration of monoamine oxidase inhibitor largely potentiates 5-MeO-DMT-induced hyperthermia that involves the activation of both 5-HT1A and 5-HT2A receptors. These findings shall provide insights into development of anxiolytic drugs and new strategies to relieve the lethal hyperthermia in serotonin toxicity. PMID:25446678
Errasti, A E; Rey-Ares, V; Daray, F M; Rogines-Velo, M P; Sardi, S P; Paz, C; Podestá, E J; Rothlin, R P
2001-08-01
In isolated human umbilical vein (HUV), the contractile response to des-Arg9-bradykinin (des-Arg9-BK), selective BK B1 receptor agonist, increases as a function of the incubation time. Here, we evaluated whether cyclooxygenase (COX) pathway is involved in BK B1-sensitized response obtained in 5-h incubated HUV rings. The effect of different concentrations of indomethacin, sodium salicylate, ibuprofen, meloxicam, lysine clonixinate or NS-398 administrated 30 min before concentration-response curves (CRC) was studied. All treatments produced a significant rightward shift of the CRC to des-Arg9-BK in a concentration-dependent manner, which provides pharmacological evidence that COX pathway is involved in the BK B1 responses. Moreover, in this tissue, the NS-398 pKb (5.2) observed suggests that COX-2 pathway is the most relevant. The strong correlation between published pIC50 for COX-2 and the NSAIDs' pKbs estimated further supports the hypothesis that COX-2 metabolites are involved in BK B1 receptor-mediated responses. In other rings, indomethacin (30, 100 micromol/l) or NS-398 (10, 30 micromol/l) produced a significant rightward shift of the CRC to BK, selective BK B2 agonist, and its pKbs were similar to the values to inhibit BK B1 receptor responses, suggesting that COX-2 pathway also is involved in BK B2 receptor responses. Western blot analysis shows that COX-1 and COX-2 isoenzymes are present before and after 5-h in vitro incubation and apparently COX-2 does not suffer additional induction.
Regulation of P2Y1 receptor traffic by sorting Nexin 1 is retromer independent.
Nisar, Shaista; Kelly, Eamonn; Cullen, Pete J; Mundell, Stuart J
2010-04-01
The activity and traffic of G-protein coupled receptors (GPCRs) is tightly controlled. Recent work from our laboratory has shown that P2Y(1) and P2Y(12) responsiveness is rapidly and reversibly modulated in human platelets and that the underlying mechanism requires receptor trafficking as an essential part of this process. However, little is known about the molecular mechanisms underlying P2Y receptor traffic. Sorting nexin 1 (SNX1) has been shown to regulate the endosomal sorting of cell surface receptors either to lysosomes where they are downregulated or back to the cell surface. These functions may in part be due to interactions of SNX1 with the mammalian retromer complex. In this study, we investigated the role of SNX1 in P2Y receptor trafficking. We show that P2Y(1) receptors recycle via a slow recycling pathway that is regulated by SNX1, whereas P2Y(12) receptors return to the cell surface via a rapid route that is SNX1 independent. SNX1 inhibition caused a dramatic increase in the rate of P2Y(1) receptor recycling, whereas inhibition of Vps26 and Vps35 known to be present in retromer had no effect, indicating that SNX1 regulation of P2Y(1) receptor recycling is retromer independent. In addition, inhibition of SNX4, 6 and 17 proteins did not affect P2Y(1) receptor recycling. SNX1 has also been implicated in GPCR degradation; however, we provide evidence that P2Y receptor degradation is SNX1 independent. These data describe a novel function of SNX1 in the regulation of P2Y(1) receptor recycling and suggest that SNX1 plays multiple roles in endocytic trafficking of GPCRs.
Vitalis, Tania; Ansorge, Mark S.; Dayer, Alexandre G.
2013-01-01
Cortical circuits control higher-order cognitive processes and their function is highly dependent on their structure that emerges during development. The construction of cortical circuits involves the coordinated interplay between different types of cellular processes such as proliferation, migration, and differentiation of neural and glial cell subtypes. Among the multiple factors that regulate the assembly of cortical circuits, 5-HT is an important developmental signal that impacts on a broad diversity of cellular processes. 5-HT is detected at the onset of embryonic telencephalic formation and a variety of serotonergic receptors are dynamically expressed in the embryonic developing cortex in a region and cell-type specific manner. Among these receptors, the ionotropic 5-HT3A receptor and the metabotropic 5-HT6 receptor have recently been identified as novel serotonergic targets regulating different aspects of cortical construction including neuronal migration and dendritic differentiation. In this review, we focus on the developmental impact of serotonergic systems on the construction of cortical circuits and discuss their potential role in programming risk for human psychiatric disorders. PMID:23801939
Peng, X; Katz, M; Gerzanich, V; Anand, R; Lindstrom, J
1994-03-01
The alpha-bungarotoxin-binding acetylcholine receptors from the human neuroblastoma cell line SH-SY5Y were found to cross-react with some monoclonal antibodies to alpha 7 subunits of nicotinic acetylcholine receptors from chicken brain. The human alpha 7 subunit cDNA from SH-SY5Y was cloned, revealing 94% amino acid sequence identity to rat alpha 7 subunits and 92% identity to chicken alpha 7 subunits. Native human alpha 7 receptors showed affinities for some ligands similar to those previously observed with native chicken alpha 7 receptors, but for other ligands there were large species-specific differences in binding affinity. These results paralleled properties of alpha 7 homomers expressed in Xenopus oocytes. Human alpha 7 homomers exhibited rapidly desensitizing, inwardly rectifying, agonist-induced, cation currents that triggered Ca(2+)-sensitive Cl- channels in the oocytes. A change in efficacy from partial agonist for chicken alpha 7 homomers to full agonist for human alpha 7 homomers was exhibited by 1,1-dimethyl-4-phenylpiperazinium. This result reveals a large species-specific pharmacological difference, despite small differences in alpha 7 sequences. This is important for understanding the effects of these drugs in humans and for identifying amino acids that may contribute to the acetylcholine binding site, for analysis by in vitro mutagenesis. These results also characterize properties of native alpha 7 receptors and alpha 7 homomers that will provide criteria for functional properties expected of structural subunits, when these can be identified, cloned, and coexpressed with alpha 7 subunits.
Cushing, Leah; Winkler, Aaron; Jelinsky, Scott A; Lee, Katherine; Korver, Wouter; Hawtin, Rachael; Rao, Vikram R; Fleming, Margaret; Lin, Lih-Ling
2017-11-10
Interleukin-1 receptor-associated kinase 4 (IRAK4) plays a critical role in innate immune signaling by Toll-like receptors (TLRs), and loss of IRAK4 activity in mice and humans increases susceptibility to bacterial infections and causes defects in TLR and IL1 ligand sensing. However, the mechanism by which IRAK4 activity regulates the production of downstream inflammatory cytokines is unclear. Using transcriptomic and biochemical analyses of human monocytes treated with a highly potent and selective inhibitor of IRAK4, we show that IRAK4 kinase activity controls the activation of interferon regulatory factor 5 (IRF5), a transcription factor implicated in the pathogenesis of multiple autoimmune diseases. Following TLR7/8 stimulation by its agonist R848, chemical inhibition of IRAK4 abolished IRF5 translocation to the nucleus and thus prevented IRF5 binding to and activation of the promoters of inflammatory cytokines in human monocytes. We also found that IKKβ, an upstream IRF5 activator, is phosphorylated in response to the agonist-induced TLR signaling. Of note, IRAK4 inhibition blocked IKKβ phosphorylation but did not block the nuclear translocation of NFκB, which was surprising, given the canonical role of IKKβ in phosphorylating IκB to allow NFκB activation. Moreover, pharmacological inhibition of either IKKβ or the serine/threonine protein kinase TAK1 in monocytes blocked TLR-induced cytokine production and IRF5 translocation to the nucleus, but not nuclear translocation of NFκB. Taken together, our data suggest a mechanism by which IRAK4 activity regulates TAK1 and IKKβ activation, leading to the nuclear translocation of IRF5 and induction of inflammatory cytokines in human monocytes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Activation of prostaglandin EP receptors by lubiprostone in rat and human stomach and colon
Bassil, A K; Borman, R A; Jarvie, E M; McArthur-Wilson, R J; Thangiah, R; Sung, E Z H; Lee, K; Sanger, G J
2008-01-01
Background and purpose: Lubiprostone (Amitiza), a possible ClC-2 channel opener derived from prostaglandin E1 and indicated for the treatment of constipation, increases chloride ion transport and fluid secretion into the intestinal lumen. As lubiprostone may also directly modulate gastrointestinal motility, we investigated its actions and the possible involvement of prostaglandin EP receptor activation on rat and human isolated gastrointestinal preparations. Experimental approach: Rat and human isolated preparations were mounted in tissue baths for isometric recording. The effects of lubiprostone on muscle tension and on electrically stimulated, neuronal contractions were investigated in the absence and presence of EP receptor antagonists. Key results: In rat and human stomach longitudinal muscle, lubiprostone induced a contraction (pEC50 of 7.0±0.0, n=4 and 6.4±0.2, n=3, respectively), which was inhibited by pretreatment with the EP1 receptor antagonist, EP1A 300 nM (pEC50 reduced to 6.2±0.2, n=6), but not by the EP3 or EP4 receptor antagonists (L-798106 and GW627368X, respectively, 1 μM, P>0.05). Lubiprostone also reduced electrically stimulated, neuronal contractions in rat and human colon circular muscle preparations (pIC50 of 8.9±0.4, n=7 and 8.7±0.9, n=6, respectively), an effect mediated pre-junctionally. This effect was reduced by the EP4 receptor antagonist (pIC50 of 6.7±1.1, n=7 and 7.7±0.4, n=6, respectively) but not by EP1 or EP3 receptor antagonists. Conclusions and implications: In rats and humans, lubiprostone contracts stomach longitudinal muscle and inhibits neuronally mediated contractions of colon circular muscle. Experiments are now needed to determine if this additional activity of lubiprostone contributes to its clinical efficacy and/or side-effect profile. PMID:18332851
P2Y6 Receptor Activation Promotes Inflammation and Tissue Remodeling in Pulmonary Fibrosis
Müller, Tobias; Fay, Susanne; Vieira, Rodolfo Paula; Karmouty-Quintana, Harry; Cicko, Sanja; Ayata, Cemil Korcan; Zissel, Gernot; Goldmann, Torsten; Lungarella, Giuseppe; Ferrari, Davide; Di Virgilio, Francesco; Robaye, Bernard; Boeynaems, Jean-Marie; Lazarowski, Eduardo R.; Blackburn, Michael R.; Idzko, Marco
2017-01-01
Idiopathic pulmonary fibrosis (IPF) is a disease with a poor prognosis and very few available treatment options. The involvement of the purinergic receptor subtypes P2Y2 and P2X7 in fibrotic lung disease has been demonstrated recently. In this study, we investigated the role of P2Y6 receptors in the pathogenesis of IPF in humans and in the animal model of bleomycin-induced lung injury. P2Y6R expression was upregulated in lung structural cells but not in bronchoalveolar lavage (BAL) cells derived from IPF patients as well as in animals following bleomycin administration. Furthermore, BAL fluid levels of the P2Y6R agonist uridine-5′-diphosphate were elevated in animals with bleomycin-induced pulmonary fibrosis. Inflammation and fibrosis following bleomycin administration were reduced in P2Y6R-deficient compared to wild-type animals confirming the pathophysiological relevance of P2Y6R subtypes for fibrotic lung diseases. Experiments with bone marrow chimeras revealed the importance of P2Y6R expression on lung structural cells for pulmonary inflammation and fibrosis. Similar effects were obtained when animals were treated with the P2Y6R antagonist MRS2578. In vitro studies demonstrated that proliferation and secretion of the pro-inflammatory/pro-fibrotic cytokine IL-6 by lung fibroblasts are P2Y6R-mediated processes. In summary, our results clearly demonstrate the involvement of P2Y6R subtypes in the pathogenesis of pulmonary fibrosis. Thus, blocking pulmonary P2Y6 receptors might be a new target for the treatment of IPF. PMID:28878780
Agonist properties of N,N-dimethyltryptamine at serotonin 5-HT2A and 5-HT2C receptors.
Smith, R L; Canton, H; Barrett, R J; Sanders-Bush, E
1998-11-01
Extensive behavioral and biochemical evidence suggests an agonist role at the 5-HT2A receptor, and perhaps the 5-HT2C receptor, in the mechanism of action of hallucinogenic drugs. However the published in vitro pharmacological properties of N,N-dimethyltryptamine (DMT), an hallucinogenic tryptamine analog, are not consistent with this hypothesis. We, therefore, undertook an extensive investigation into the properties of DMT at 5-HT2A and 5-HT2C receptors. In fibroblasts transfected with the 5-HT2A receptor or the 5-HT2C receptor, DMT activated the major intracellular signaling pathway (phosphoinositide hydrolysis) to an extent comparable to that produced by serotonin. Because drug efficacy changes with receptor density and cellular microenvironment, we also examined the properties of DMT in native preparations using a behavioral and biochemical approach. Rats were trained to discriminate an antagonist ketanserin from an agonist 1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI) in a two-lever choice paradigm. Pharmacological studies showed that responding on the DOI and ketanserin lever reflected agonist and antagonist activity at 5-HT2A receptors, and hence, was a suitable model for evaluating the in vivo functional properties of DMT. Like other 5-HT2A receptor agonists, DMT substituted fully for DOI. Intact choroid plexus was used to evaluate the agonist properties at endogenous 5-HT2C receptors; DMT was a partial agonist at 5-HT2C receptors in this native preparation. Thus, we conclude that DMT behaves as an agonist at both 5-HT2A and 5-HT2A receptors. One difference was evident in that the 5-HT2C, but not the 5-HT2A, receptor showed a profound desensitization to DMT over time. This difference is interesting in light of the recent report that the hallucinogenic activity of DMT does not tolerate in humans and suggests the 5-HT2C receptor plays a less prominent role in the action of DMT.
Hrycay, E G; Bandiera, S M
2009-12-01
The present review focuses on the expression, function and regulation of mouse cytochrome P450 (Cyp) enzymes. Information compiled for mouse Cyp enzymes is compared with data collected for human CYP enzymes. To date, approximately 40 pairs of orthologous mouse-human CYP genes have been identified that encode enzymes performing similar metabolic functions. Recent knowledge concerning the tissue expression of mouse Cyp enzymes from families 1 to 51 is summarized. The catalytic activities of microsomal, mitochondrial and recombinant mouse Cyp enzymes are discussed and their involvement in the metabolism of exogenous and endogenous compounds is highlighted. The role of nuclear receptors, such as the aryl hydrocarbon receptor, constitutive androstane receptor and pregnane X receptor, in regulating the expression of mouse Cyp enzymes is examined. Targeted disruption of selected Cyp genes has generated numerous Cyp null mouse lines used to decipher the role of Cyp enzymes in metabolic, toxicological and biological processes. In conclusion, the laboratory mouse is an indispensable model for exploring human CYP-mediated activities.
Mager, Peter P; Weber, Anje; Illes, Peter
2004-01-01
No details on P2X receptor architecture had been known at the atomic resolution level. Using comparative homology-based molecular modelling and threading, it was attempted to predict the three-dimensional structure of P2X receptors. This prediction could not be carried out, however, because important properties of the P2X family differ considerably from that of the potential template proteins. This paper reviews an alternative approach consisting of three research fields: bioinformatics, structural modelling, and a variety of the results of biological experiments. Starting point is the amino acid sequence. Using the sequential data, the first step is a secondary structure prediction. The resulting secondary structure is converted into a three-dimensional geometry. Then, the secondary and tertiary structures are optimized by using the quantum chemistry RHF/3-21G minimal basic set and the all-atom molecular mechanics AMBER96 force field. The fold of the membrane-embedded protein is simulated by a suitable dielectricum. The structure is refined using a conjugate gradient minimizer (Fletcher-Reeves modification of the Polak-Ribiere method). The results of the geometry optimization were checked by a Ramanchandran plot, rotamer analysis, all-atom contact dots, and the C(beta) deviation. As additional tools for the model building, multiple alignment analysis and comparative sequence-function analysis were used. The approach is exemplified on the membrane-embedded, ligand-gated P2X3 receptor subunit, a monovalent-bivalent cation channel-forming glycoprotein that is activated by extracellular adenosine 5'-triphosphate. From these results, a topology of the pore-forming motif of the P2X3 receptor subunit was proposed. It is believed that a fully functional P2X channel requires a precise coupling between (i) two distinct peptide modules, an extracellularly occurring ATP-binding module and a pore module that includes a long transmembrane and short intracellular part, (ii) an
Do receptors get pregnant too? Adrenergic receptor alterations in human pregnancy.
Smiley, R M; Finster, M
1996-01-01
In this review we discuss adrenergic receptor number and function during pregnancy, with emphasis on evidence that pregnancy results in specific receptor alterations from the nonpregnant state. Changes in adrenergic receptor function or distribution in vascular smooth muscle may be in part responsible for the decreased vascular responsiveness seen in human pregnancy, and the lack of the normal alterations may be a part of the syndromes of gestational hypertension, including preeclampsia-eclampsia. The onset of labor may be influenced by adrenergic modulation, and receptor or postreceptor level molecular alterations may trigger or facilitate normal or preterm labor. Human studies are emphasized when possible to assess the role of adrenergic signal transduction regulation in the physiology and pathophysiology of normal and complicated human pregnancy.
Wei, Wei; Zhu, Wenjun; Cheng, Jiasen; Xie, Jiatao; Li, Bo; Jiang, Daohong; Li, Guoqing; Yi, Xianhong
2013-01-01
Coniothyrium minitans is a sclerotial parasite of the plant-pathogenic fungus Sclerotinia sclerotiorum, and conidial production and parasitism are two important aspects for commercialization of this biological control agent. To understand the mechanism of conidiation and parasitism at the molecular level, we constructed a transfer DNA (tDNA) insertional library with the wild-type strain ZS-1. A conidiation-deficient mutant, ZS-1TN22803, was uncovered through screening of this library. This mutant could produce pycnidia on potato dextrose agar (PDA), but most were immature and did not bear conidia. Moreover, this mutant lost the ability to parasitize or rot the sclerotia of S. sclerotiorum. Analysis of the tDNA flanking sequences revealed that a peroxisome biogenesis factor 6 (PEX6) homolog of Saccharomyces cerevisiae, named CmPEX6, was disrupted by the tDNA insertion in this mutant. Targeted gene replacement and gene complementation tests confirmed that a null mutation of CmPEX6 was responsible for the phenotype of ZS-1TN22803. Further analysis showed that both ZS-1TN22803 and the targeted replacement mutants could not grow on PDA medium containing oleic acid, and they produced much less nitric oxide (NO) and hydrogen peroxide (H2O2) than wild-type strain ZS-1. The conidiation of ZS-1TN22803 was partially restored by adding acetyl-CoA or glyoxylic acid to the growth media. Our results suggest that fatty acid β-oxidation, reactive oxygen and nitrogen species, and possibly other unknown pathways in peroxisomes are involved in conidiation and parasitism by C. minitans. PMID:23563946
Liu, Yue; Canal, Clinton E; Cordova-Sintjago, Tania C; Zhu, Wanying; Booth, Raymond G
2017-01-18
While exploring the structure-activity relationship of 4-phenyl-2-dimethylaminotetralins (PATs) at serotonin 5-HT 2C receptors, we discovered that relatively minor modification of PAT chemistry impacts function at 5-HT 2C receptors. In HEK293 cells expressing human 5-HT 2C-INI receptors, for example, (-)-trans-3'-Br-PAT and (-)-trans-3'-Cl-PAT are agonists regarding Gα q -inositol phosphate signaling, whereas (-)-trans-3'-CF 3 -PAT is an inverse agonist. To investigate the ligand-receptor interactions that govern this change in function, we performed site-directed mutagenesis of 14 amino acids of the 5-HT 2C receptor based on molecular modeling and reported G protein-coupled receptor crystal structures, followed by molecular pharmacology studies. We found that S3.36, T3.37, and F5.47 in the orthosteric binding pocket are critical for affinity (K i ) of all PATs tested, we also found that F6.44, M6.47, C7.45, and S7.46 are primarily involved in regulating EC/IC 50 functional potencies of PATs. We discovered that when residue S5.43, N6.55, or both are mutated to alanine, (-)-trans-3'-CF 3 -PAT switches from inverse agonist to agonist function, and when N6.55 is mutated to leucine, (-)-trans-3'-Br-PAT switches from agonist to inverse agonist function. Notably, most point-mutations that affected PAT pharmacology did not significantly alter affinity (K D ) of the antagonist radioligand [ 3 H]mesulergine, but every mutation tested negatively impacted serotonin binding. Also, amino acid mutations differentially affected the pharmacology of other commercially available 5-HT 2C ligands tested. Collectively, the data show that functional outcomes shared by different ligands are mediated by different amino acids and that some 5-HT 2C receptor residues important for pharmacology of one ligand are not necessarily important for another ligand.
Pharmacological characterization of P2X7 receptors in rat peritoneal cells.
Chen, Y-W; Donnelly-Roberts, D L; Namovic, M T; Gintant, G A; Cox, B F; Jarvis, M F; Harris, R R
2005-03-01
P2X(7) receptor activation by ATP results in the release of IL-1beta and IL-18. Prolonged stimulation can lead to pore formation and cell death. In this study we pharmacologically characterized P2X(7) receptors on rat peritoneal cells (RPC) and on 1321N1 cells transfected with rat P2X(7) receptor (1321rP2X(7)-11). RPC were isolated from rats by lavage. P2X(7) agonist induced pore formation in RPC was measured by EtBr uptake. P2X(7)-stimulated pore formation and Ca(++) influx in 1321rP2X(7)-11 cells were measured by a fluorometric imaging plate reader. The effects of pyridoxal phosphate-6-azo phenyl -2'-4'-disulfonic acid (PPADS) on pore formation and Ca(++) influx were examined in both RPC and 1321rP2X(7)-11. P2X(7)-mediated IL-1beta release in RPC and the effect of PPADS were determined. RPC express functional P2X(7) receptors that were activated by ATP analogs with a rank order of potency of 2'- 3'-O-(4-Benzoylbenzoyl) adenosine 5'-triphosphate (BzATP) > ATP > alpha,beta-methylene ATP. Activation of P2X(7) receptors by BzATP was inhibited by PPADS. Similar results were also obtained in 1321rP2X(7)-11 cells. Activation of P2X(7) receptors on RPC resulted in IL-1 beta secretion, which was inhibited by PPADS. RPC express functional P2X(7) receptors that form pores and mediate the release of IL-1beta.
Fieger, Sarah M; Wong, Brett J
2010-09-01
Mechanisms underlying the robust cutaneous vasodilatation in response to local heating of human skin remain unresolved. Adenosine receptor activation has been shown to induce vasodilatation via nitric oxide, and a substantial portion of the plateau phase to local heating of human skin has been shown to be dependent on nitric oxide. The purpose of this study was to investigate a potential role for adenosine receptor activation in cutaneous thermal hyperaemia in humans. Six subjects were equipped with four microdialysis fibres on the ventral forearm. Sites were randomly assigned to receive one of the following four treatments: (1) lactated Ringer solution to serve as a control; (2) 4 mM theophylline, a competitive, non-selective A(1)/A(2) adenosine receptor antagonist; (3) 10 mM Nomega(-)-nitro-L-arginine methyl ester (L-NAME) to inhibit NO synthase; or (4) combined 4 mm theophylline + 10 mM L-NAME. Following baseline measurements, each site was locally heated from a baseline temperature of 33 degrees C to 42 degrees C at a rate of 1 degrees C (10 s)(-1), and skin blood flow was monitored via laser-Doppler flowmetry (LDF). Cutaneous vascular conductance (CVC) was calculated as LDF divided by mean arterial pressure and normalized to maximal values (CVC(max)) via local heating to 43 degrees C and infusion of 28 mM sodium nitroprusside. The initial peak was significantly reduced in theophylline (68 +/- 2% CVC(max)) and L-NAME sites (54 +/- 5% CVC(max)) compared with control sites (81 +/- 2% CVC(max); P < 0.01 and P < 0.001, respectively). Combined theophylline + L-NAME (52 +/- 5% CVC(max)) reduced the initial peak compared with control and theophylline sites, but was not significantly different compared with L-NAME sites. The secondary plateau was attenuated in theophylline (77 +/- 2% CVC(max)), L-NAME (60 +/- 2% CVC(max)) and theophylline + L-NAME (53 +/- 1% CVC(max)) compared with control sites (94 +/- 2% CVC(max); P < 0.001 for all conditions). The secondary plateau
Schmidt, Philipp; Ritscher, Lars; Dong, Elizabeth N.; Hermsdorf, Thomas; Cöster, Maxi; Wittkopf, Doreen; Meiler, Jens
2013-01-01
The ADP receptor P2Y12 belongs to the superfamily of G protein–coupled receptors (GPCRs), and its activation triggers platelet aggregation. Therefore, potent antagonists, such as clopidogrel, are of high clinical relevance in prophylaxis and treatment of thromboembolic events. P2Y12 displays an elevated basal activity in vitro, and as such, inverse agonists may be therapeutically beneficial compared with antagonists. Only a few inverse agonists of P2Y12 have been described. To expand this limited chemical space and improve understanding of structural determinants of inverse agonist-receptor interaction, this study screened a purine compound library for lead structures using wild-type (WT) human P2Y12 and 28 constitutively active mutants. Results showed that ATP and ATP derivatives are agonists at P2Y12. The potency at P2Y12 was 2-(methylthio)-ADP > 2-(methylthio)-ATP > ADP > ATP. Determinants required for agonistic ligand activity were identified. Molecular docking studies revealed a binding pocket for the ATP derivatives that is bordered by transmembrane helices 3, 5, 6, and 7 in human P2Y12, with Y105, E188, R256, Y259, and K280 playing a particularly important role in ligand interaction. N-Methyl-anthraniloyl modification at the 3′-OH of the 2′-deoxyribose leads to ligands (mant-deoxy-ATP [dATP], mant-deoxy-ADP) with inverse agonist activity. Inverse agonist activity of mant-dATP was found at the WT human P2Y12 and half of the constitutive active P2Y12 mutants. This study showed that, in addition to ADP and ATP, other ATP derivatives are not only ligands of P2Y12 but also agonists. Modification of the ribose within ATP can result in inverse activity of ATP-derived ligands. PMID:23093496
Purinergic P2X receptors: structural models and analysis of ligand-target interaction.
Dal Ben, Diego; Buccioni, Michela; Lambertucci, Catia; Marucci, Gabriella; Thomas, Ajiroghene; Volpini, Rosaria
2015-01-07
The purinergic P2X receptors are ligand-gated cation channels activated by the endogenous ligand ATP. They assemble as homo- or heterotrimers from seven cloned subtypes (P2X1-7) and all trimer subunits present a common topology consisting in intracellular N- and C- termini, two transmembrane domains and a large extracellular domain. These membrane proteins are present in virtually all mammalian tissues and regulate a large variety of responses in physio- and pathological conditions. The development of ligands that selectively activate or block specific P2X receptor subtypes hence represents a promising strategy to obtain novel pharmacological tools for the treatment of pain, cancer, inflammation, and neurological, cardiovascular, and endocrine diseases. The publication of the crystal structures of zebrafish P2X4 receptor in inactive and ATP-bound active forms provided structural data for the analysis of the receptor structure, the interpretation of mutagenesis data, and the depiction of ligand binding and receptor activation mechanism. In addition, the availability of ATP-competitive ligands presenting selectivity for P2X receptor subtypes supports the design of new potent and selective ligands with possibly improved pharmacokinetic profiles, with the final aim to obtain new drugs. This study describes molecular modelling studies performed to develop structural models of the human and rat P2X receptors in inactive and active states. These models allowed to analyse the role of some non-conserved residues at ATP binding site and to study the receptor interaction with some non-specific or subtype selective agonists and antagonists. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Jarvis, Michael F.
2013-01-01
The study of P2X receptors has long been handicapped by a poverty of small-molecule tools that serve as selective agonists and antagonists. There has been progress, particularly in the past 10 years, as cell-based high-throughput screening methods were applied, together with large chemical libraries. This has delivered some drug-like molecules in several chemical classes that selectively target P2X1, P2X3, or P2X7 receptors. Some of these are, or have been, in clinical trials for rheumatoid arthritis, pain, and cough. Current preclinical research programs are studying P2X receptor involvement in pain, inflammation, osteoporosis, multiple sclerosis, spinal cord injury, and bladder dysfunction. The determination of the atomic structure of P2X receptors in closed and open (ATP-bound) states by X-ray crystallography is now allowing new approaches by molecular modeling. This is supported by a large body of previous work using mutagenesis and functional expression, and is now being supplemented by molecular dynamic simulations and in silico ligand docking. These approaches should lead to P2X receptors soon taking their place alongside other ion channel proteins as therapeutically important drug targets. PMID:23253448
Human sweet taste receptor mediates acid-induced sweetness of miraculin
Koizumi, Ayako; Tsuchiya, Asami; Nakajima, Ken-ichiro; Ito, Keisuke; Terada, Tohru; Shimizu-Ibuka, Akiko; Briand, Loïc; Asakura, Tomiko; Misaka, Takumi; Abe, Keiko
2011-01-01
Miraculin (MCL) is a homodimeric protein isolated from the red berries of Richadella dulcifica. MCL, although flat in taste at neutral pH, has taste-modifying activity to convert sour stimuli to sweetness. Once MCL is held on the tongue, strong sweetness is sensed over 1 h each time we taste a sour solution. Nevertheless, no molecular mechanism underlying the taste-modifying activity has been clarified. In this study, we succeeded in quantitatively evaluating the acid-induced sweetness of MCL using a cell-based assay system and found that MCL activated hT1R2-hT1R3 pH-dependently as the pH decreased from 6.5 to 4.8, and that the receptor activation occurred every time an acid solution was applied. Although MCL per se is sensory-inactive at pH 6.7 or higher, it suppressed the response of hT1R2-hT1R3 to other sweeteners at neutral pH and enhanced the response at weakly acidic pH. Using human/mouse chimeric receptors and molecular modeling, we revealed that the amino-terminal domain of hT1R2 is required for the response to MCL. Our data suggest that MCL binds hT1R2-hT1R3 as an antagonist at neutral pH and functionally changes into an agonist at acidic pH, and we conclude this may cause its taste-modifying activity. PMID:21949380
Lee, Mike; Choi, Sungwon; Halldén, Gunnel; Yo, Sek Jin; Schichnes, Denise
2009-01-01
P2Y5 is a G protein-coupled receptor that binds and is activated by lysophosphatidic acid (LPA). We determined that P2Y5 transcript is expressed along the intestinal mucosa and investigated the intracellular pathways induced by P2Y5 activation, which could contribute to LPA effects on intestinal cell adhesion. P2Y5 heterologously expressed in CHO and small intestinal hBRIE 380i cells was activated by LPA resulting in an increase in intracellular calcium ([Ca2+]i) when the cells concurrently expressed GαΔ6qi5myr. P2Y5 activation also increased the phosphorylation of ERK1/2 that was sensitive to pertussis toxin. Together these indicate that P2Y5 activation by LPA induces an increase in [Ca2+]i and ERK1/2 phosphorylation through Gαi. We discovered that P2Y5 was activated by farnesyl pyrophosphate (FPP) without a detectable change in [Ca2+]i. The activation of P2Y5 by LPA or FPP induced the activity of a serum response element (SRE)-linked luciferase reporter that was inhibited by the RGS domain of p115RhoGEF, C3 exotoxin, and Y-27632, suggesting the involvement of Gα12/13, Rho GTPase, and ROCK, respectively. However, only LPA-mediated induction of SRE reporter activity was sensitive to inhibitors targeting p38 MAPK, PI3K, PLC, and PKC. In addition, only LPA transactivated the epidermal growth factor receptor, leading to an induction of ERK1/2 phosphorylation. These observations correlate with our subsequent finding that P2Y5 activation by LPA, and not FPP, reduced intestinal cell adhesion. This study elucidates a mechanism whereby LPA can act as a luminal and/or serosal cue to alter mucosal integrity. PMID:19679818
Das, Payel; Li, Jingyuan; Royyuru, Ajay K; Zhou, Ruhong
2009-08-01
Historically, influenza pandemics have been triggered when an avian influenza virus or a human/avian reassorted virus acquires the ability to replicate efficiently and become transmissible in the human population. Most critically, the major surface glycoprotein hemagglutinin (HA) must adapt to the usage of human-like (alpha-2,6-linked) sialylated glycan receptors. Therefore, identification of mutations that can switch the currently circulating H5N1 HA receptor binding specificity from avian to human might provide leads to the emergence of pandemic H5N1 viruses. To define such mutations in the H5 subtype, here we provide a computational framework that combines molecular modeling with extensive free energy simulations. Our results show that the simulated binding affinities are in good agreement with currently available experimental data. Moreover, we predict that one double mutation (V135S and A138S) in HA significantly enhances alpha-2,6-linked receptor recognition by the H5 subtype. Our simulations indicate that this double mutation in H5N1 HA increases the binding affinity to alpha-2,6-linked sialic acid receptors by 2.6 +/- 0.7 kcal/mol per HA monomer that primarily arises from the electrostatic interactions. Further analyses reveal that introduction of this double mutation results in a conformational change in the receptor binding pocket of H5N1 HA. As a result, a major rearrangement occurs in the hydrogen-bonding network of HA with the human receptor, making the human receptor binding pattern of double mutant H5N1 HA surprisingly similar to that observed in human H1N1 HA. These large scale molecular simulations on single and double mutants thus provide new insights into our understanding toward human adaptation of the avian H5N1 virus. 2009 Wiley Periodicals, Inc.
Cavaliere, Fabio; Amadio, Susanna; Angelini, Daniela F; Sancesario, Giuseppe; Bernardi, Giorgio; Volonté, Cinzia
2004-10-15
It is well established that both extracellular ATP and glutamate exert a critical role during metabolic impairment, that several P2 receptor subunits are directly involved in this action and that a strong relationship exists between glutamatergic and purinergic signals. Therefore, here we studied the molecular behavior of the purinergic metabotropic P2Y(4) and the glutamatergic ionotropic NMDAR1 receptors during hypoglycemic cell death. We find that these proteins are oppositely modulated during glucose starvation (P2Y(4) is induced, whereas NMDAR1 is inhibited) and that both P2 and NMDA antagonists can restore basal protein expression levels. Moreover, double immunofluorescence experiments with confocal laser microscopy reveal co-localization at the membrane level between the P2Y(4) and NMDAR1 receptors, in both homologous (cerebellar granule neurons) and heterologous (Hek-293) cellular systems. This is furthermore confirmed by co-immunoprecipitation experiments. Finally, when we express the P2Y(4) receptor in the heterologous SH-SY5Y neuronal cell line, hypoglycemia then causes severe cell death and simultaneous downregulation of the NMDAR1 protein. In summary, our work establishes a potential molecular interplay between P2Y(4) and NMDAR1 receptors during glucose deprivation and the causative role of the P2Y(4) during cell death.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Identification of P2X3 and P2X7 Purinergic Receptors Activated by ATP in Rat Lacrimal Gland
Vrouvlianis, Joanna; Scott, Rachel; Dartt, Darlene A.
2011-01-01
Purpose. To identify the type of purinergic receptors activated by adenosine triphosphate (ATP) in rat lacrimal gland and to determine their role in protein secretion. Methods. Purinergic receptors were identified by RT-PCR, Western blot analysis, and immunofluorescence techniques. Acini from rat lacrimal gland were isolated by collagenase digestion. Acini were incubated with the fluorescence indicator fura-2 tetra-acetoxylmethyl ester, and intracellular [Ca2+] ([Ca2+]i) was determined. Protein secretion was measured by fluorescence assay. Results. The authors previously showed that P2X7 receptors were functional in the lacrimal gland. In this study, they show that P2X1–4, and P2X6receptors were identified in the lacrimal gland by RT-PCR, Western blot, and immunofluorescence analyses. P2X5 receptors were not detected. ATP increased [Ca2+]i and protein secretion in a concentration-dependent manner. Removal of extracellular Ca2+ significantly reduced the ATP-stimulated increase in [Ca2+]i. Repeated applications of ATP caused desensitization of the [Ca2+]i response. Incubation with the P2X1 receptor inhibitor NF023 did not alter ATP-stimulated [Ca2+]i. Incubation with zinc, which potentiates P2X2 and P2X4 receptor responses, or lowering the pH to 6.8, which potentiates P2X2 receptor responses, did not alter the ATP-stimulated [Ca2+]i. P2X3 receptor inhibitors A-317491 and TNP-ATP significantly decreased ATP-stimulated [Ca2+]i and protein secretion, whereas the P2X3 receptor agonist α,β methylene ATP significantly increased them. The P2X7 receptor inhibitor A438079 had no effect on ATP-stimulated [Ca2+]i at 10−6 M but did have an effect at 10−4 M. Conclusions. Purinergic receptors P2X1–4 and P2X6 are present in the lacrimal gland. ATP uses P2X3 and P2X7 receptors to stimulate an increase in [Ca2+]i and protein secretion. PMID:21421865
Zhang, Guohua; Chen, Wenling; Lao, Lijun; Marvizón, Juan Carlos G.
2010-01-01
The contribution of CB1 receptors in the spinal cord to cannabinoid analgesia is still unclear. The objective of this study was to investigate the effect of CB1 receptors on substance P release from primary afferent terminals in the spinal cord. Substance P release was measured as NK1 receptor internalization in lamina I neurons. It was induced in spinal cord slices by dorsal root stimulation and in live rats by a noxious stimulus. In spinal cord slices, the CB1 receptor antagonists AM251, AM281 and rimonabant partially but potently inhibited NK1 receptor internalization induced by electrical stimulation of the dorsal root. This was due to an inhibition of substance P release and not of NK1 receptor internalization itself, because AM251 and AM281 did not inhibit NK1 receptor internalization induced by exogenous substance P. The CB1 receptor agonist ACEA increased NK1 receptor internalization evoked by dorsal root stimulation. The effects of AM251 and ACEA cancelled each other. In vivo, AM251 injected intrathecally decreased NK1 receptor internalization in spinal segments L5 and L6 induced by noxious hind paw clamp. Intrathecal AM251 also produced analgesia to radiant heat stimulation of the paw. The inhibition by AM251 of NK1 receptor internalization was reversed by antagonists of μ-opioid and GABAB receptors. This indicates that CB1 receptors facilitate substance P release by inhibiting the release of GABA and opioids next to primary afferent terminals, producing disinhibition. This results in a pronociceptive effect of CB1 receptors in the spinal cord. PMID:20074214
Luethi, Dino; Liechti, Matthias E
2018-05-29
Pharmacological profiles of new psychoactive substances (NPSs) can be established rapidly in vitro and provide information on potential psychoactive effects in humans. The present study investigated whether specific in vitro monoamine transporter and receptor interactions can predict effective psychoactive doses in humans. We correlated previously assessed in vitro data of stimulants and psychedelics with human doses that are reported on the Internet and in books. For stimulants, dopamine and norepinephrine transporter inhibition potency was positively correlated with human doses, whereas serotonin transporter inhibition potency was inversely correlated with human doses. Serotonin 5-hydroxytryptamine-2A (5-HT2A) and 5-HT2C receptor affinity was significantly correlated with psychedelic doses, but 5-HT1A receptor affinity and 5-HT2A and 5-HT2B receptor activation potency were not. The rapid assessment of in vitro pharmacological profiles of NPSs can help to predict psychoactive doses and effects in humans and facilitate the appropriate scheduling of NPSs.
Caseley, Emily A; Muench, Stephen P; Fishwick, Colin W; Jiang, Lin-Hua
2016-09-15
The P2X7 receptor (P2X7R) plays an important role in diverse conditions associated with tissue damage and inflammation, meaning that the human P2X7R (hP2X7R) is an attractive therapeutic target. The crystal structures of the zebrafish P2X4R in the closed and ATP-bound open states provide an unprecedented opportunity for structure-guided identification of new ligands. The present study performed virtual screening of ∼100,000 structurally diverse compounds against the ATP-binding pocket in the hP2X7R. This identified three compounds (C23, C40 and C60) out of 73 top-ranked compounds by testing against hP2X7R-mediated Ca(2+) responses. These compounds were further characterised using Ca(2+) imaging, patch-clamp current recording, YO-PRO-1 uptake and propidium iodide cell death assays. All three compounds inhibited BzATP-induced Ca(2+) responses concentration-dependently with IC50s of 5.1±0.3μM, 4.8±0.8μM and 3.2±0.2μM, respectively. C23 and C40 inhibited BzATP-induced currents in a reversible and concentration-dependent manner, with IC50s of 0.35±0.3μM and 1.2±0.1μM, respectively, but surprisingly C60 did not affect BzATP-induced currents up to 100μM. They suppressed BzATP-induced YO-PRO-1 uptake with IC50s of 1.8±0.9μM, 1.0±0.1μM and 0.8±0.2μM, respectively. Furthermore, these three compounds strongly protected against ATP-induced cell death. Among them, C40 and C60 exhibited strong specificity towards the hP2X7R over the hP2X4R and rP2X3R. In conclusion, our study reports the identification of three novel hP2X7R antagonists with micromolar potency for the first time using a structure-based approach, including the first P2X7R antagonist with preferential inhibition of large pore formation. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Eardley, D; McGee, R
1985-08-07
Substance P stimulates substance P receptors but also inhibits ion conductance through nicotinic acetylcholine receptors. Substance P analogs, classified as agonists or antagonists based on their actions on smooth muscle, were tested to determine if they also could act at nicotinic receptors on the pheochromocytoma, PC12. All of the analogs tested, [D-Pro2, D-Trp7,9]SP, [D-Arg1, D-Pro2, D-Trp7,9, Leu11]SP, [pGlu5, MePhe8, Sar9]SP-(5-11), and [D-Pro4, D-Trp7,9,10]SP-(4-11), inhibited agonist-induced uptake of 86Rb+ through the nicotinic receptors at concentrations quite similar to those required for action at substance P receptors on smooth muscle. Thus, the chemical modifications in the analogs do not substantially alter their ability to inhibit nicotinic receptors.
A PYY Q62P variant linked to human obesity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Kavaslar, Nihan; Schackwitz, Wendy
2005-06-27
Members of the pancreatic polypeptide family and the irreceptors have been implicated in the control of food intake in rodents and humans. To investigate whether nucleotide changes in these candidate genes result in abnormal weight in humans, we sequenced the coding exons and splice sites of seven family members (NPY, PYY, PPY, NPY1R, NPY2R, NPY4R, and NPY5R) in a large cohort of extremely obese (n=379) and lean (n=378) individuals. In total we found eleven rare non-synonymous variants, four of which exhibited familial segregation, NPY1R L53P and PPY P63L with leanness and NPY2R D42G and PYY Q62P with obesity. Functional analysismore » of the obese variants revealed NPY2R D42G to have reduced cell surface expression, while previous cell culture based studies indicated variant PYY Q62P to have altered receptor binding selectivity and we show that it fails to reduce food intake through mouse peptide injection experiments. These results support that rare non-synonymous variants within these genes can alter susceptibility to human body mass index extremes.« less
Steinberg, Anna; Frederiksen, Simona D; Blixt, Frank W; Warfvinge, Karin; Edvinsson, Lars
2016-12-01
Migraine and Cluster Headache (CH) are two primary headaches with severe disease burden. The disease expression and the mechanisms involved are poorly known. In some attacks of migraine and in most attacks of CH, there is a release of vasoactive intestinal peptide (VIP) originating from parasympathetic cranial ganglia such as the sphenopalatine ganglion (SPG). Patients suffering from these diseases are often deprived of effective drugs. The aim of the study was to examine the localization of the botulinum toxin receptor element synaptic vesicle glycoprotein 2A (SV-2A) and the vesicular docking protein synaptosomal-associated protein 25 (SNAP25) in human and rat SPG. Additionally the expression of the neurotransmitters pituitary adenylate cyclase activating polypeptide (PACAP-38), nitric oxide synthase (nNOS), VIP and 5-hydroxttryptamine subtype receptors (5-HT1B,1D,1F) were examined. SPG from adult male rats and from humans, the later removed at autopsy, were prepared for immunohistochemistry using specific antibodies against neurotransmitters, 5-HT1B,1D,1F receptors, and botulinum toxin receptor elements. We found that the selected neurotransmitters and 5-HT receptors were expressed in rat and human SPG. In addition, we found SV2-A and SNAP25 expression in both rat and human SPG. We report that all three 5-HT receptors studied occur in neurons and satellite glial cells (SGCs) of the SPG. 5-HT1B receptors were in addition found in the walls of intraganglionic blood vessels. Recent focus on the SPG has emphasized the role of parasympathetic mechanisms in the pathophysiology of mainly CH. The development of next generation's drugs and treatment of cranial parasympathetic symptoms, mediated through the SPG, can be modulated by treatment with BoNT-A and 5-HT receptor agonists.
A family of membrane-shaping proteins at ER subdomains regulates pre-peroxisomal vesicle biogenesis.
Joshi, Amit S; Huang, Xiaofang; Choudhary, Vineet; Levine, Tim P; Hu, Junjie; Prinz, William A
2016-11-21
Saccharomyces cerevisiae contains three conserved reticulon and reticulon-like proteins that help maintain ER structure by stabilizing high membrane curvature in ER tubules and the edges of ER sheets. A mutant lacking all three proteins has dramatically altered ER morphology. We found that ER shape is restored in this mutant when Pex30p or its homologue Pex31p is overexpressed. Pex30p can tubulate membranes both in cells and when reconstituted into proteoliposomes, indicating that Pex30p is a novel ER-shaping protein. In contrast to the reticulons, Pex30p is low abundance, and we found that it localizes to subdomains in the ER. We show that these ER subdomains are the sites where most preperoxisomal vesicles (PPVs) are generated. In addition, overproduction or deletion of Pex30p or Pex31p alters the size, shape, and number of PPVs. Our findings suggest that Pex30p and Pex31p help shape and generate regions of the ER where PPV biogenesis occurs.
Douglas, Stephen A; Naselsky, Diane; Ao, Zhaohui; Disa, Jyoti; Herold, Christopher L; Lynch, Frank; Aiyar, Nambi V
2004-01-01
In an effort to identify endogenous, native mammalian urotensin-II (U-II) receptors (UT), a diverse range of human, primate and rodent cell lines (49 in total) were screened for the presence of detectable [125I]hU-II binding sites. UT mRNA (Northern blot, PCR) and protein (immunocytochemistry) were evident in human skeletal muscle tissue and cells. [125I]hU-II bound to a homogenous population of high-affinity, saturable (Kd 67.0±11.8 pM, Bmax 9687±843 sites cell−1) receptors in the skeletal muscle (rhabdomyosarcoma) cell line SJRH30. Radiolabel was characteristically slow to dissociate (⩽15% dissociation 90 min). A lower density of high-affinity U-II binding sites was also evident in the rhabdomyosarcoma cell line TE671 (1667±165 sites cell−1, Kd 74±8 pM). Consistent with the profile recorded in human recombinant UT-HEK293 cells, [125I]hU-II binding to SJRH30 cells was selectively displaced by both mammalian and fish U-II isopeptides (Kis 0.5±0.1–1.2±0.3 nM) and related analogues (hU-II[4-11]>[Cys5,10]Acm hU-II; Kis 0.4±0.1 and 864±193 nM, respectively). U-II receptor activation was functionally coupled to phospholipase C-mediated [Ca2+]i mobilization (EC50 6.9±2.2 nM) in SJRH30 cells. The present study is the first to identify the presence of ‘endogenous' U-II receptors in SJRH30 and TE671 cells. SJRH30 cells, in particular, might prove to be of utility for (a) investigating the pharmacological properties of hU-II and related small molecule antagonists at native human UT and (b) delineating the role of this neuropeptide in the (patho)physiological regulation of mammalian neuromuscular function. PMID:15210573
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuwasako, Kenji, E-mail: kuwasako@med.miyazaki-u.ac.jp; Sekiguchi, Toshio; Nagata, Sayaka
2016-02-19
Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM{sub 1} receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM{sub 1} receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM{sub 1} receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific [{sup 125}I]AM binding andmore » AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β{sub 2}-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM{sub 1} receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.« less
Rago, V; Romeo, F; Giordano, F; Ferraro, A; Carpino, A
2016-01-01
Estrogens are involved in growth, differentiation and pathogenesis of human prostate through the mediation of the classical estrogen receptors ERα and ERβ. The G protein-coupled estrogen receptor (GPER) is a 'novel' mediator of estrogen signaling which has been recently recognized in some human reproductive tissues, but its expression in the prostate gland is still unknown. Here, we investigated GPER in benign (from 5 patients) and neoplastic prostatic tissues (from 50 patients) by immunohistochemical analysis and Western blotting. Normal areas of benign prostates revealed a strong GPER immunoreactivity in the basal epithelial cells while luminal epithelial cells were unreactive and stromal cells were weakly immunostained. GPER was also immunolocalized in adenocarcinoma samples but the immunoreactivity of tumoral areas decreased from Gleason pattern 2 to Gleason pattern 4. Furthermore, a strong GPER immunostaining was also revealed in cells of pre-neoplastic lesions (high-grade prostatic intra-epithelial neoplasia). Western blot analysis of benign and tumor protein extracts showed the presence of a ~42 kDa band, consistent with the GPER molecular weight. An increase in both pAkt and p cAMP-response-binding protein (pCREB) levels was also observed in poorly differentiated PCa samples. Finally, this work identified GPER in the epithelial basal cells of benign human prostate, with a different localization with respect to the classical estrogen receptors. Furthermore, the expression of GPER in prostatic adenocarcinoma cells was also observed but with a modulation of the immunoreactivity according to tumor cell arrangements. © 2015 American Society of Andrology and European Academy of Andrology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pande, Priyadarshini; Mosleh, Tariq A.; Aust, Ann E.
Crocidolite, containing 27% iron by weight, is the most carcinogenic form of asbestos. Crocidolite fibers are endocytized by {alpha}{sub v}{beta}{sub 5} integrin receptors in rabbit pleural mesothelial cells. We show here that crocidolite fibers are endocytized in human lung epithelial (A549) cells and in primary small airway epithelial (SAEC) cells. Presence of the integrin {alpha}{sub v}{beta}{sub 5} blocking antibody, P1F6, significantly reduced the uptake of crocidolite fibers in A549 cells. Thus, the integrin {alpha}{sub v}{beta}{sub 5} receptor is involved in endocytosis of crocidolite fibers in A549 cells as well. Previously, it has been observed that asbestos fibers lead to changesmore » in the intracellular redox environment, i.e. a marked decrease in intracellular glutathione concentrations and an increase in the extracellular glutathione in A549 cells. In addition, the decrease in intracellular glutathione was found to be largely independent of iron present on the surface of the fiber. A549 cells were treated with crocidolite in the presence of endocytosis inhibitor cytochalasin D. Our data indicate that, upon preventing endocytosis, we were able to reverse the decrease in total intracellular glutathione. The decrease in total intracellular glutathione could also be prevented in the presence of the monoclonal antibody P1F6. Thus, we observed that endocytosis of crocidolite fibers via integrin {alpha}{sub v}{beta}{sub 5} receptor is linked to the marked decrease in total intracellular glutathione in A549 cells.« less
Highly Pathogenic Influenza A(H5Nx) Viruses with Altered H5 Receptor-Binding Specificity
Guo, Hongbo; de Vries, Erik; McBride, Ryan; Dekkers, Jojanneke; Peng, Wenjie; Bouwman, Kim M.; Nycholat, Corwin; Verheije, M. Helene; Paulson, James C.; van Kuppeveld, Frank J.M.
2017-01-01
Emergence and intercontinental spread of highly pathogenic avian influenza A(H5Nx) virus clade 2.3.4.4 is unprecedented. H5N8 and H5N2 viruses have caused major economic losses in the poultry industry in Europe and North America, and lethal human infections with H5N6 virus have occurred in Asia. Knowledge of the evolution of receptor-binding specificity of these viruses, which might affect host range, is urgently needed. We report that emergence of these viruses is accompanied by a change in receptor-binding specificity. In contrast to ancestral clade 2.3.4 H5 proteins, novel clade 2.3.4.4 H5 proteins bind to fucosylated sialosides because of substitutions K222Q and S227R, which are unique for highly pathogenic influenza virus H5 proteins. North American clade 2.3.4.4 virus isolates have retained only the K222Q substitution but still bind fucosylated sialosides. Altered receptor-binding specificity of virus clade 2.3.4.4 H5 proteins might have contributed to emergence and spread of H5Nx viruses. PMID:27869615
Pathophysiological roles of P2 receptors in glial cells.
Abbracchio, Maria P; Verderio, Claudia
2006-01-01
Extracellular nucleotides act through specific receptors on target cells: the seven ionotropic P2X and the eight G protein-coupled P2Y receptors. All these receptors are expressed by brain astroglia and microglia. In astrocytes, P2 receptors have been implicated in short-term calcium-dependent cell-cell communication. Upon mechanical stimulation or activation by other transmitters, astrocytes release ATP and respond to ATP with a propagating wave of intracellular calcium increases, allowing a homotypic astrocyte-astrocyte communication, as well as an heterotypic signalling which also involves neurons, oligodendrocytes and microglia. Astrocytic P2 receptors also mediate reactive astrogliosis, a reaction contributing to neuronal death in neurodegenerative diseases. Signalling leading to inflammatory astrogliosis involves induction of cyclo-oxygenase 2 through stimulation of ERK1,2 and of the transcriptional factors AP-1 and NF-kappaB. Microglia also express several P2 receptors linked to intracellular calcium increases. P2 receptor subtypes are differentially regulated by typical proinflammatory signals for these cells (e.g. lipopolysaccharide), suggesting specific roles in brain immune responses. Globally, these findings highlight the roles of P2 receptors in glial cell pathophysiology suggesting a contribution to neurodegenerative diseases characterized by excessive gliosis and neuro-inflammation. They also open up the possibility of modulating brain damage by ligands selectively targeting the specific P2 receptor subtypes involved in the gliotic response.
Purinergic P2Y12 Receptor Activation in Eosinophils and the Schistosomal Host Response.
Muniz, Valdirene S; Baptista-Dos-Reis, Renata; Benjamim, Claudia F; Mata-Santos, Hilton A; Pyrrho, Alexandre S; Strauch, Marcelo A; Melo, Paulo A; Vicentino, Amanda R R; Silva-Paiva, Juliana; Bandeira-Melo, Christianne; Weller, Peter F; Figueiredo, Rodrigo T; Neves, Josiane S
2015-01-01
Identifying new target molecules through which eosinophils secrete their stored proteins may reveal new therapeutic approaches for the control of eosinophilic disorders such as host immune responses to parasites. We have recently reported the expression of the purinergic P2Y12 receptor (P2Y12R) in human eosinophils; however, its functional role in this cell type and its involvement in eosinophilic inflammation remain unknown. Here, we investigated functional roles of P2Y12R in isolated human eosinophils and in a murine model of eosinophilic inflammation induced by Schistosoma mansoni (S. mansoni) infection. We found that adenosine 5'-diphosphate (ADP) induced human eosinophils to secrete eosinophil peroxidase (EPO) in a P2Y12R dependent manner. However, ADP did not interfere with human eosinophil apoptosis or chemotaxis in vitro. In vivo, C57Bl/6 mice were infected with cercariae of the Belo Horizonte strain of S. mansoni. Analyses performed 55 days post infection revealed that P2Y12R blockade reduced the granulomatous hepatic area and the eosinophilic infiltrate, collagen deposition and IL-13/IL-4 production in the liver without affecting the parasite oviposition. As found for humans, murine eosinophils also express the P2Y12R. P2Y12R inhibition increased blood eosinophilia, whereas it decreased the bone marrow eosinophil count. Our results suggest that P2Y12R has an important role in eosinophil EPO secretion and in establishing the inflammatory response in the course of a S. mansoni infection.
Identification of 6H1 as a P2Y purinoceptor: P2Y5.
Webb, T E; Kaplan, M G; Barnard, E A
1996-02-06
We have determined the identity of the orphan G-protein coupled receptor cDNA, 6H1, present in activated chicken T cells, as a subtype of P2Y purinoceptor. This identification is based on first on the degree of sequence identity shared with recently cloned members of the P2Y receptor family and second on the pharmacological profile. Upon transient expression in COS-7 cells the 6H1 receptor bound the radiolabel [35S]dATP alpha S specifically and with high affinity (Kd, 10 nM). This specific binding could be competitively displaced by a range of ligands active at P2 purinoceptors, with ATP being the most active (K (i)), 116 nM). Such competition studies have established the following rank order of activity: ATP ADP 2-methylthioATP alpha, beta-methylene ATP, UTP, thus confirming 6H1 as a member of the growing family of P2Y purinoceptors. As the fifth receptor of this type to be identified we suggest that it be named P2Y5.
Gray, J A; Sheffler, D J; Bhatnagar, A; Woods, J A; Hufeisen, S J; Benovic, J L; Roth, B L
2001-11-01
The effect of endocytosis inhibitors on 5-hydroxytryptamine(2A) (5-HT(2A)) receptor desensitization and resensitization was examined in transiently transfected human embryonic kidney (HEK) 293 cells and in C6 glioma cells that endogenously express 5-HT(2A) receptors. In HEK-293 cells, 5-HT(2A) receptor desensitization was unaffected by cotransfection with a dominant-negative mutant of dynamin (DynK44A), a truncation mutant of arrestin-2 [Arr2(319-418)], or by two well-characterized chemical inhibitors of endocytosis: concanavalin A (conA) and phenylarsine oxide (PAO). In contrast, beta 2-adrenergic receptor desensitization was significantly potentiated by each of these treatments in HEK-293 cells. In C6 glioma cells, however, DynK44A, Arr2(319-418), conA, and PAO each resulted in the potentiation of 5-HT(2A) and beta-adrenergic receptor desensitization. The cell-type-specific effect of Arr2(319-418) on 5-HT(2A) receptor desensitization was not related to the level of GRK2 or GRK5 expression. Interestingly, although beta 2-adrenergic receptor resensitization was potently blocked by cotransfection with DynK44A, 5-HT(2A) receptor resensitization was enhanced, suggesting the existence of a novel cell-surface mechanism for 5-HT(2A) receptor resensitization in HEK-293 cells. In addition, Arr2(319-418) had no effect on 5-HT(2A) receptor resensitization in HEK-293 cells, although it attenuated the resensitization of the beta 2-adrenergic receptor. However, in C6 glioma cells, both DynK44A and Arr2(319-418) significantly reduced 5-HT(2A) receptor resensitization. Taken together, these results provide the first convincing evidence of cell-type-specific roles for endocytosis inhibitors in regulating GPCR activity. Additionally, these results imply that novel GRK and arrestin-independent mechanisms of 5-HT(2A) receptor desensitization and resensitization exist in HEK-293 cells.
Liu, Fan; Chen, Yan; Zhu, Gu; Hysi, Pirro G; Wu, Sijie; Adhikari, Kaustubh; Breslin, Krystal; Pospiech, Ewelina; Hamer, Merel A; Peng, Fuduan; Muralidharan, Charanya; Acuna-Alonzo, Victor; Canizales-Quinteros, Samuel; Bedoya, Gabriel; Gallo, Carla; Poletti, Giovanni; Rothhammer, Francisco; Bortolini, Maria Catira; Gonzalez-Jose, Rolando; Zeng, Changqing; Xu, Shuhua; Jin, Li; Uitterlinden, André G; Ikram, M Arfan; van Duijn, Cornelia M; Nijsten, Tamar; Walsh, Susan; Branicki, Wojciech; Wang, Sijia; Ruiz-Linares, Andrés; Spector, Timothy D; Martin, Nicholas G; Medland, Sarah E; Kayser, Manfred
2018-02-01
Shape variation of human head hair shows striking variation within and between human populations, while its genetic basis is far from being understood. We performed a series of genome-wide association studies (GWASs) and replication studies in a total of 28 964 subjects from 9 cohorts from multiple geographic origins. A meta-analysis of three European GWASs identified 8 novel loci (1p36.23 ERRFI1/SLC45A1, 1p36.22 PEX14, 1p36.13 PADI3, 2p13.3 TGFA, 11p14.1 LGR4, 12q13.13 HOXC13, 17q21.2 KRTAP, and 20q13.33 PTK6), and confirmed 4 previously known ones (1q21.3 TCHH/TCHHL1/LCE3E, 2q35 WNT10A, 4q21.21 FRAS1, and 10p14 LINC00708/GATA3), all showing genome-wide significant association with hair shape (P < 5e-8). All except one (1p36.22 PEX14) were replicated with nominal significance in at least one of the 6 additional cohorts of European, Native American and East Asian origins. Three additional previously known genes (EDAR, OFCC1, and PRSS53) were confirmed at the nominal significance level. A multivariable regression model revealed that 14 SNPs from different genes significantly and independently contribute to hair shape variation, reaching a cross-validated AUC value of 0.66 (95% CI: 0.62-0.70) and an AUC value of 0.64 in an independent validation cohort, providing an improved accuracy compared with a previous model. Prediction outcomes of 2504 individuals from a multiethnic sample were largely consistent with general knowledge on the global distribution of hair shape variation. Our study thus delivers target genes and DNA variants for future functional studies to further evaluate the molecular basis of hair shape in humans. © The Author(s) 2017. Published by Oxford University Press.
Liu, Fan; Chen, Yan; Zhu, Gu; Hysi, Pirro G; Wu, Sijie; Adhikari, Kaustubh; Breslin, Krystal; Pośpiech, Ewelina; Hamer, Merel A; Peng, Fuduan; Muralidharan, Charanya; Acuna-Alonzo, Victor; Canizales-Quinteros, Samuel; Bedoya, Gabriel; Gallo, Carla; Poletti, Giovanni; Rothhammer, Francisco; Bortolini, Maria Catira; Gonzalez-Jose, Rolando; Zeng, Changqing; Xu, Shuhua; Jin, Li; Uitterlinden, André G; Ikram, M Arfan; van Duijn, Cornelia M; Nijsten, Tamar; Walsh, Susan; Branicki, Wojciech; Wang, Sijia; Ruiz-Linares, Andrés; Spector, Timothy D; Martin, Nicholas G; Medland, Sarah E; Kayser, Manfred
2018-01-01
Abstract Shape variation of human head hair shows striking variation within and between human populations, while its genetic basis is far from being understood. We performed a series of genome-wide association studies (GWASs) and replication studies in a total of 28 964 subjects from 9 cohorts from multiple geographic origins. A meta-analysis of three European GWASs identified 8 novel loci (1p36.23 ERRFI1/SLC45A1, 1p36.22 PEX14, 1p36.13 PADI3, 2p13.3 TGFA, 11p14.1 LGR4, 12q13.13 HOXC13, 17q21.2 KRTAP, and 20q13.33 PTK6), and confirmed 4 previously known ones (1q21.3 TCHH/TCHHL1/LCE3E, 2q35 WNT10A, 4q21.21 FRAS1, and 10p14 LINC00708/GATA3), all showing genome-wide significant association with hair shape (P < 5e-8). All except one (1p36.22 PEX14) were replicated with nominal significance in at least one of the 6 additional cohorts of European, Native American and East Asian origins. Three additional previously known genes (EDAR, OFCC1, and PRSS53) were confirmed at the nominal significance level. A multivariable regression model revealed that 14 SNPs from different genes significantly and independently contribute to hair shape variation, reaching a cross-validated AUC value of 0.66 (95% CI: 0.62–0.70) and an AUC value of 0.64 in an independent validation cohort, providing an improved accuracy compared with a previous model. Prediction outcomes of 2504 individuals from a multiethnic sample were largely consistent with general knowledge on the global distribution of hair shape variation. Our study thus delivers target genes and DNA variants for future functional studies to further evaluate the molecular basis of hair shape in humans. PMID:29220522
Effects of Constant Flickering Light on Refractive Status, 5-HT and 5-HT2A Receptor in Guinea Pigs.
Li, Bing; Luo, Xiumei; Li, Tao; Zheng, Changyue; Ji, Shunmei; Ma, Yuanyuan; Zhang, Shuangshuang; Zhou, Xiaodong
2016-01-01
To investigate the effects of constant flickering light on refractive development, the role of serotonin (i.e.5-hydroxytryptamine, 5-HT)and 5-HT2A receptor in myopia induced by flickering light in guinea pigs. Forty-five guinea pigs were randomly divided into three groups: control, form deprivation myopia (FDM) and flickering light induced myopia (FLM) groups(n = 15 for each group). The right eyes of the FDM group were covered with semitransparent hemispherical plastic shells serving as eye diffusers. Guinea pigs in FLM group were raised with illumination of a duty cycle of 50% at a flash frequency of 0.5Hz. The refractive status, axial length (AL), corneal radius of curvature(CRC) were measured by streak retinoscope, A-scan ultrasonography and keratometer, respectively. Ultramicroscopy images were taken by electron microscopy. The concentrations of 5-HTin the retina, vitreous body and retinal pigment epithelium (RPE) were assessed by high performance liquid chromatography, the retinal 5-HT2A receptor expression was evaluated by immunohistofluorescence and western blot. The refraction of FDM and FLM eyes became myopic from some time point (the 4th week and the 6th week, respectively) in the course of the experiment, which was indicated by significantly decreased refraction and longer AL when compared with the controls (p<0.05). The concentrations of 5-HT in the retina, vitreous body and RPE of FDM and FLM eyes were significantly increased in comparison with those of control eyes (both p<0.05). Similar to FDM eyes, the expression of retinal 5-HT2A receptor in FLM eyes was significantly up-regulated compared to that of control eyes (both p<0.05). Western blot analysis showed that retinal 5-HT2A receptor level elevated less in the FLM eyes than that in the FDM eyes. Moreover, the levels of norepinephrine and epinephrine in FDM and FLM groups generally decreased when compared with control groups (all p<0.05). Constant flickering light could cause progressive myopia in
Physiology and pathophysiology of the 5-HT3 receptor.
Färber, L; Haus, U; Späth, M; Drechsler, S
2004-01-01
The 5-HT3 receptor is a ligand-gated cation channel located in the central and peripheral nervous system; it has also been detected on a variety of other cells. In the periphery, it is found on autonomic neurons and on neurons of the sensory and enteric nervous system. In the CNS, the 5-HT3 receptor has been localized in the area postrema, nucleus tractus solitarii, nucleus vaudatus, nucleus accumbens, amygdala, hippocampus, entorhinal, frontal, cingulate cortex, and in the dorsal horn ganglia. Further extraneuronal locations include among others lymphocytes, monocytes, and foetal tissue. 5-HT3 receptors modulate the release of neurotransmitters and neuropeptides like dopamine, cholecystokinin, acetylcholine, GABA, substance P, and serotonin itself. They have been demonstrated to be involved in sensory transmission, regulation of autonomic functions, integration of the vomiting reflex, pain processing and control of anxiety. While the physiologic functions of the 5-HT3 receptor are discrete and difficult to detect, it plays a key role in certain pathologic situations related to increased serotonin release. Clinical development of 5-HT3 receptor antagonists revealed a remarkable range of activities. 5-HT3 receptor antagonists do not modify any aspect of normal behaviour in animals or induce pronounced changes of physiological functions in healthy subjects. Clinical efficacy was shown for various forms of emesis like chemotherapy-induced, radiotherapy-induced, and postoperative emesis, diarrhoea-predominant irritable bowel syndrome, anxiety, chronic fatigue syndrome, alcohol abuse, and in pain syndromes such as fibromyalgia and migraine. Most recent data also suggest that 5-HT3 receptor antagonists are effective for the treatment of other rheumatic diseases such as rheumatoid arthritis, tendinopathies, periarthropathies, and myofascial pain. Other possible indications under discussion are chronic heart pain and bulimia. Unfortunately, experimental findings do not yet
A Promising Therapeutic Target for Metabolic Diseases: Neuropeptide Y Receptors in Humans.
Yi, Min; Li, Hekai; Wu, Zhiye; Yan, Jianyun; Liu, Qicai; Ou, Caiwen; Chen, Minsheng
2018-01-01
Human neuropeptide Y (hNPY) is one of the most widely expressed neurotransmitters in the human central and peripheral nervous systems. It consists of 36 highly conserved amino acid residues, and was first isolated from the porcine hypothalamus in 1982. While it is the most recently discovered member of the pancreatic polypeptide family (which includes neuropeptide Y, gut-derived hormone peptide YY, and pancreatic polypeptide), NPY is the most abundant peptide found in the mammalian brain. In order to exert particular functions, NPY needs to bind to the NPY receptor to activate specific signaling pathways. NPY receptors belong to the class A or rhodopsin-like G-protein coupled receptor (GPCR) family and signal via cell-surface receptors. By binding to GPCRs, NPY plays a crucial role in various biological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Abnormal regulation of NPY is involved in the development of a wide range of diseases, including obesity, hypertension, atherosclerosis, epilepsy, metabolic disorders, and many cancers. Thus far, five receptors have been cloned from mammals (Y1, Y2, Y4, Y5, and y6), but only four of these (hY1, hY2, hY4, and hY5) are functional in humans. In this review, we summarize the structural characteristics of human NPY receptors and their role in metabolic diseases. © 2018 The Author(s). Published by S. Karger AG, Basel.
Saleh, A; Picher, M; Kammouni, W; Figarella, C; Merten, M D
1999-11-12
Human submucosal tracheal glands are now believed to play a major role in the physiopathology of cystic fibrosis, a genetic disease in which ATP is used as a therapeutic agent. However, actions of ATP on tracheal gland cells are not well known. ATP binds to P2 receptors and induced secretory leucocyte protease inhibitor (SLPI) secretion through formation of cyclic adenosine monophosphate and mobilization of intracellular [Ca(2+)]. Since diadenosine polyphosphates (ApnA) are also endogenous effectors of P2 receptors, we investigated their effects in a cell line (MM39) of human tracheal gland cells. Diadenosine tetraphosphates (Ap4A) induced significant stimulation (+50+/-12%) of SLPI secretion and to a similar extent to that of ATP (+65+/-10%). No significant effects were observed with diadenosine triphosphate (Ap3A), diadenosine pentaphosphate (Ap5A), ADP and 2-methylthio-adenosine triphosphate (2-MeS-ATP). Since Ap4A was weakly hydrolyzed (<2% of total), and the hydrolysis product was only inosine which is ineffective on cells, this Ap4A effect was not due to Ap4A hydrolysis in ATP and adenosine monophosphate (AMP). A mixture of Ap4A and ATP elicited only partial additive effects on SLPI secretion. ADP was shown to be a potent antagonist of ATP and Ap4A receptors, with IC(50)s of 0.8 and 2 microM, respectively. 2-MeS-ATP also showed antagonistic properties with IC(50)s of 20 and 30 microM for ATP- and Ap4A-receptors, respectively. Single cell intracellular calcium ([Ca(2+)](i)) measurements showed similar transient increases of [Ca(2+)](i) after ATP or Ap4A challenges. ATP desensitized the cell [Ca(2+)](i) responses to ATP and Ap4A, and Ap4A also desensitized the cell response to Ap4A. Nevertheless, Ap4A did not desensitize the cell [Ca(2+)](i) responses to ATP. In conclusion, both P2Y2-ATP-receptors and Ap4A-P2D-receptors seem to be present in tracheal gland cells. Ap4A may only bind to P2D-receptors whilst ATP may bind to both Ap4A- and ATP-receptors.
Dopamine D2-like receptor signaling suppresses human osteoclastogenesis.
Hanami, Kentaro; Nakano, Kazuhisa; Saito, Kazuyoshi; Okada, Yosuke; Yamaoka, Kunihiro; Kubo, Satoshi; Kondo, Masahiro; Tanaka, Yoshiya
2013-09-01
Dopamine, a major neurotransmitter, transmits signals via five different seven-transmembrane G protein-coupled receptors termed D1 to D5. Although the relevance of neuroendocrine system to bone metabolism has been emerging, the precise effects of dopaminergic signaling upon osteoclastogenesis remain unknown. Here, we demonstrate that human monocyte-derived osteoclast precursor cells express all dopamine-receptor subtypes. Dopamine and dopamine D2-like receptor agonists such as pramipexole and quinpirole reduced the formation of TRAP-positive multi-nucleated cells, cathepsin K mRNA expression, and pit formation area in vitro. These inhibitory effects were reversed by pre-treatment with a D2-like receptor antagonist haloperidol or a Gαi inhibitor pertussis toxin, but not with the D1-like receptor antagonist SCH-23390. Dopamine and dopamine D2-like receptor agonists, but not a D1-like receptor agonist, suppressed intracellular cAMP concentration as well as RANKL-meditated induction of c-Fos and NFATc1 mRNA expression in human osteoclast precursor cells. Finally, the dopamine D2-like receptor agonist suppressed LPS-induced osteoclast formation in murine bone marrow culture ex vivo. These findings indicate that dopaminergic signaling plays an important role in bone homeostasis via direct effects upon osteoclast differentiation and further suggest that the clinical use of neuroleptics is likely to affect bone mass. Copyright © 2013 Elsevier Inc. All rights reserved.
Wang, Shuang-Yan; Chen, Lei; Xue, Yan; Xia, Yu-Jun
2015-12-01
[Sar9, Met(O2)11] termed Substance P (SP), is an effective and selective agonist for the neurokinin‑1 (NK‑1) receptors, which are synthetic peptides, similar in structure to SP. SP is an important neurotransmitter or neuromodulator mediated by neurokinin receptors, namely the SP receptor in the central nervous system. The excitatory effects induced by SP may be selectively inhibited by a neurokinin‑1 receptor antagonist, such as SR140333B. It has been proposed that Parkinson's disease (PD) is primarily caused by the loss of trophic peptidergic neurotransmitter, possibly SP, which may lead to the degeneration of neurons. In previous studies, 1‑methyl‑4‑phenylpyridinium (MPP+) has been frequently utilized to establish animal or cell models of PD. In the present study, to further investigate the effects of SP in PD, MPP+ was employed to investigate the promising anti‑apoptotic effects of SP, and examine the underlying mechanisms of the pathology in the MES23.5 dopaminergic cell line. The results indicated that MPP+‑triggered apoptosis was prevented by treatment with SP. SP treatment also decreased the MPP+‑triggered Ca2+ influx, caspase‑3 re‑activity, reactive oxygen species production and mitochondrial membrane potential decrease. Treatment with MPP+ also induced phosphorylation of c‑Jun N‑terminal kinase and p38 mitogen‑activated protein kinase. In addition, treatment with SP inhibited the MPP+‑triggered neurotoxicity in MES23.5 cells. However, no changes were observed in SR140333B+SP+MPP+‑treated MES23.5 cell lines. In conclusion, SP could protect the cells from MPP+‑induced cytotoxicity by inhibiting the apoptosis via NK-1 receptors.
Ionotropic glutamate receptor expression in human white matter.
Christensen, Pia Crone; Samadi-Bahrami, Zahra; Pavlov, Vlady; Stys, Peter K; Moore, G R Wayne
2016-09-06
Glutamate is the key excitatory neurotransmitter of the central nervous system (CNS). Its role in human grey matter transmission is well understood, but this is less clear in white matter (WM). Ionotropic glutamate receptors (iGluR) are found on both neuronal cell bodies and glia as well as on myelinated axons in rodents, and rodent WM tissue is capable of glutamate release. Thus, rodent WM expresses many of the components of the traditional grey matter neuron-to-neuron synapse, but to date this has not been shown for human WM. We demonstrate the presence of iGluRs in human WM by immunofluorescence employing high-resolution spectral confocal imaging. We found that the obligatory N-methyl-d-aspartic acid (NMDA) receptor subunit GluN1 and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluA4 co-localized with myelin, oligodendroglial cell bodies and processes. Additionally, GluA4 colocalized with axons, often in distinct clusters. These findings may explain why human WM is vulnerable to excitotoxic events following acute insults such as stroke and traumatic brain injury and in more chronic inflammatory conditions such as multiple sclerosis (MS). Further exploration of human WM glutamate signalling could pave the way for developing future therapies modulating the glutamate-mediated damage in these and other CNS disorders. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Sun, Qian-Quan; Dale, Nicholas
1998-01-01
In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870
Neurotensin receptors in human neoplasms: high incidence in Ewing's sarcomas.
Reubi, J C; Waser, B; Schaer, J C; Laissue, J A
1999-07-19
Receptors for regulatory peptides, such as somatostatin or vasoactive intestinal peptide (VIP), expressed at high density by neoplastic cells, can be instrumental for tumor diagnosis and therapy. Little is known about the expression of neurotensin receptors in human tumors. In the present study, 464 human neoplasms of various types were investigated for their neurotensin receptor content by in vitro receptor autoradiography on tissue sections using 125I-[Tyr3]-neurotensin as radioligand. Neurotensin receptors were identified and localized in tumor cells of 11/17 Ewing's sarcomas, 21/40 meningiomas, 10/23 astrocytomas, 5/13 medulloblastomas, 7/24 medullary thyroid cancers and 2/8 small cell lung cancers. They were rarely found in non-small cell lung cancers and breast carcinomas; they were absent in prostate, ovarian, renal cell and hepatocellular carcinomas, neuroendocrine gut tumors, pituitary adenomas, schwannomas, neuroblastomas and lymphomas. When present, the receptors bound with nanomolar affinity neurotensin and acetyl-neurotensin-(8-13), with lower affinity neuromedin N, diethylenetriamine penta-acetic acidneurotensin-(8-13) and SR 48692, but not neurotensin-(1-11). They were all of the NT1 type, without high affinity for levocabastine. Further, in 2 receptor-positive Ewing's sarcomas, neurotensin mRNA was detected by in situ hybridization techniques. Since neurotensin is known to stimulate cell proliferation, the presence of neurotensin receptors in human neoplasia may be of biological relevance, possibly as an integrative part of an autocrine feedback mechanism of tumor growth stimulation.
The protein arginine methyltransferase PRMT5 promotes D2-like dopamine receptor signaling
Likhite, Neah; Jackson, Christopher A.; Liang, Mao-Shih; Krzyzanowski, Michelle C.; Lei, Pedro; Wood, Jordan F.; Birkaya, Barbara; Michaels, Kerry L.; Andreadis, Stelios T.; Clark, Stewart D.; Yu, Michael C.; Ferkey, Denise M.
2017-01-01
Protein arginine methylation regulates diverse functions of eukaryotic cells, including gene expression, the DNA damage response, and circadian rhythms. We showed that arginine residues within the third intracellular loop of the human D2 dopamine receptor, which are conserved in the DOP-3 receptor in the nematode Caenorhabditis elegans, were methylated by protein arginine methyl-transferase 5 (PRMT5). By mutating these arginine residues, we further showed that their methylation enhanced the D2 receptor–mediated inhibition of cyclic adenosine monophosphate (cAMP) signaling in cultured human embryonic kidney (HEK) 293T cells. Analysis of prmt-5–deficient worms indicated that methylation promoted the dopamine-mediated modulation of chemosensory and locomotory behaviors in C. elegans through the DOP-3 receptor. In addition to delineating a previously uncharacterized means of regulating GPCR (heterotrimeric guanine nucleotide–binding protein–coupled receptor) signaling, these findings may lead to the development of a new class of pharmacological therapies that modulate GPCR signaling by changing the methylation status of these key proteins. PMID:26554819
Mazzone, S B; Hinrichsen, C F; Geraghty, D P
1997-09-01
Substance P (SP) is a key neurotransmitter involved in the brain stem integration of carotid body chemoreceptor reflexes. In this study, the characteristics and location of SP receptors in the rat brain stem and their regulation by hypoxia were investigated using homogenate radioligand binding and quantitative autoradiography. Specific binding of [125I] Bolton-Hunter SP (BHSP) to brain stem homogenates was saturable (approximately 0.3 nM) and to a single class of high-affinity sites (K(d), 0.16 nM; maximum density of binding sites, 0.43 fmol/mg wet weight tissue). The order of potency of agonists for inhibition of BHSP binding was SP > [Sar9Met(O2)11]SP > neurokinin A > septide > neurokinin B > [Nle10]-neurokinin A(4-10) = senktide, and for nonpeptide antagonists, RP 67580 > CP-96,345 > RP 68651 = CP-96,344, consistent with binding to NK1 receptors. The effect of single and multiple, 5-min bouts of hypoxia (8.5% O2/91.5% N2) on BHSP binding was investigated using quantitative autoradiography. Binding sites were localized to the lateral, medial and commissural nucleus of the solitary tract (NTS), the hypoglossal nucleus, central gray and the spinal trigeminal tract and nucleus (Sp5 and nSp5, respectively). Five min after a single bout of hypoxia, the density of BHSP binding sites had decreased significantly (P < .05) in the medial NTS (-33%) and lateral NTS (-24%) when compared to normoxic controls. However, the normal receptor complement was restored within 60 min of the hypoxic challenge. In the Sp5, a significant decrease (P < .05) in binding was observed 5 min after hypoxia which was still apparent after 60 min. In contrast, the density of BHSP binding sites in the hypoglossal nucleus decreased slowly and was significantly lower (P < .05) than normoxic controls 60 min after hypoxia. Five min after repetitive hypoxia (3 x 5 min bouts), BHSP binding in the NTS was reduced by more than 40%. Studies in homogenates showed that the affinity of SP for BHSP binding
Discovery of 3-aryl-4-isoxazolecarboxamides as TGR5 receptor agonists.
Evans, Karen A; Budzik, Brian W; Ross, Sean A; Wisnoski, David D; Jin, Jian; Rivero, Ralph A; Vimal, Mythily; Szewczyk, George R; Jayawickreme, Channa; Moncol, David L; Rimele, Thomas J; Armour, Susan L; Weaver, Susan P; Griffin, Robert J; Tadepalli, Sarva M; Jeune, Michael R; Shearer, Todd W; Chen, Zibin B; Chen, Lihong; Anderson, Donald L; Becherer, J David; De Los Frailes, Maite; Colilla, Francisco Javier
2009-12-24
A series of 3-aryl-4-isoxazolecarboxamides identified from a high-throughput screening campaign as novel, potent small molecule agonists of the human TGR5 G-protein coupled receptor is described. Subsequent optimization resulted in the rapid identification of potent exemplars 6 and 7 which demonstrated improved GLP-1 secretion in vivo via an intracolonic dose coadministered with glucose challenge in a canine model. These novel TGR5 receptor agonists are potentially useful therapeutics for metabolic disorders such as type II diabetes and its associated complications.
Ren, H; Stiles, G L
1994-01-01
The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148
Madne, Tarunkumar Hemraj; Dockrell, Mark Edward Carl
2018-04-30
Alternative splicing is an important gene regulation process to distribute proteins in health and diseases. Extra Domain A+ Fibronectin (EDA+Fn) is an alternatively spliced form of fibronectin (Fn) protein, present in the extra cellular matrix (ECM) and a recognised marker of various pathologies. TGFβ1 has been shown to induce alternative splicing of EDA+Fn in many cell types. Podocytes are spectacular cell type and play a key role in filtration and synthesise ECM proteins in renal physiology and pathology. In our previous study we have demonstrated expression and alternative splicing of EDA+Fn in basal condition in human podocytes culture. TGFβ1 further induced the basal expression and alternative splicing of EDA+Fn through Alk5 receptor and SR proteins. In this study, we have investigated TGFβ1 mediated signalling involved in alternative splicing of EDA+Fn in human podocytes. We have performed western blotting to characterise the expression of the EDA+Fn protein and other signalling proteins and RT-PCR to look for signalling pathways involved in regulation of alternative splicing of EDA+Fn in conditionally immortalised human podocytes culture.We have used TGFβ1 as a stimulator and SB431542, SB202190 and LY294002 for inhibitory studies. In this work, we have demonstrated in human podocytes culture TGFβ1 2.5ng/ml induced phosphorylation of Smad1/5/8, Smad2 and Smad3 via the ALK5 receptor. TGFβ1 significantly induced the PI3K/Akt pathway and the PI3K/Akt pathway inhibitor LY294002 significantly downregulated basal as well as TGFβ1 induced alternative splicing of EDA+Fn in human podocytes. In addition to this, TGFβ1 significantly induced the p38 MAP kinase signalling pathway and p38 MAP kinase signalling pathway inhibitor SB202190 downregulated the TGFβ1-mediated alternative splicing of EDA+Fn in human podocytes. The results with PI3K and p38 MAP kinase signalling pathway suggest that inhibiting PI3K signalling pathway downregulated the basal alternative
DOE Office of Scientific and Technical Information (OSTI.GOV)
B Eckenroth; A Steere; N Chasteen
2011-12-31
Delivery of iron to cells requires binding of two iron-containing human transferrin (hTF) molecules to the specific homodimeric transferrin receptor (TFR) on the cell surface. Through receptor-mediated endocytosis involving lower pH, salt, and an unidentified chelator, iron is rapidly released from hTF within the endosome. The crystal structure of a monoferric N-lobe hTF/TFR complex (3.22-{angstrom} resolution) features two binding motifs in the N lobe and one in the C lobe of hTF. Binding of Fe{sub N}hTF induces global and site-specific conformational changes within the TFR ectodomain. Specifically, movements at the TFR dimer interface appear to prime the TFR to undergomore » pH-induced movements that alter the hTF/TFR interaction. Iron release from each lobe then occurs by distinctly different mechanisms: Binding of His349 to the TFR (strengthened by protonation at low pH) controls iron release from the C lobe, whereas displacement of one N-lobe binding motif, in concert with the action of the dilysine trigger, elicits iron release from the N lobe. One binding motif in each lobe remains attached to the same {alpha}-helix in the TFR throughout the endocytic cycle. Collectively, the structure elucidates how the TFR accelerates iron release from the C lobe, slows it from the N lobe, and stabilizes binding of apohTF for return to the cell surface. Importantly, this structure provides new targets for mutagenesis studies to further understand and define this system.« less
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p
Variation in umami perception and in candidate genes for the umami receptor in mice and humans1234
Shirosaki, Shinya; Ohkuri, Tadahiro; Sanematsu, Keisuke; Islam, AA Shahidul; Ogiwara, Yoko; Kawai, Misako; Yoshida, Ryusuke; Ninomiya, Yuzo
2009-01-01
The unique taste induced by monosodium glutamate is referred to as umami taste. The umami taste is also elicited by the purine nucleotides inosine 5′-monophosphate and guanosine 5′-monophosphate. There is evidence that a heterodimeric G protein–coupled receptor, which consists of the T1R1 (taste receptor type 1, member 1, Tas1r1) and the T1R3 (taste receptor type 1, member 3, Tas1r3) proteins, functions as an umami taste receptor for rodents and humans. Splice variants of metabotropic glutamate receptors, mGluR1 (glutamate receptor, metabotropic 1, Grm1) and mGluR4 (glutamate receptor, metabotropic 4, Grm4), also have been proposed as taste receptors for glutamate. The taste sensitivity to umami substances varies in inbred mouse strains and in individual humans. However, little is known about the relation of umami taste sensitivity to variations in candidate umami receptor genes in rodents or in humans. In this article, we summarize current knowledge of the diversity of umami perception in mice and humans. Furthermore, we combine previously published data and new information from the single nucleotide polymorphism databases regarding variation in the mouse and human candidate umami receptor genes: mouse Tas1r1 (TAS1R1 for human), mouse Tas1r3 (TAS1R3 for human), mouse Grm1 (GRM1 for human), and mouse Grm4 (GRM4 for human). Finally, we discuss prospective associations between variation of these genes and umami taste perception in both species. PMID:19625681
Ferrante, E; Pellegrini, C; Bondioni, S; Peverelli, E; Locatelli, M; Gelmini, P; Luciani, P; Peri, A; Mantovani, G; Bosari, S; Beck-Peccoz, P; Spada, A; Lania, A
2006-09-01
Somatostatin analogs currently used in the treatment of acromegaly and other neuroendocrine tumors inhibit hormone secretion and cell proliferation by binding to somatostatin receptor type (SST) 2 and 5. The antiproliferative pathways coupled to these receptors have been only partially characterized. The aim of this study was to evaluate the effect of octreotide and super selective SST2 (BIM23120) and SST5 (BIM23206) analogs on apoptotic activity and apoptotic gene expression in human somatotroph tumor cells. Eight somatotroph tumors expressing similar levels of SST2 and SST5 evaluated by real-time PCR and western blot analyses were included in the study. In cultured cells obtained from these tumors, octreotide induced a dose-dependent increase of caspase-3 activity (160+/-20% vs basal at 10 nM) and cleaved cytokeratin 18 levels (172+/-25% vs basal) at concentrations higher than 0.1 nM. This effect was due to SST2 activation since BIM23120 elicited comparable responses, while BIM23206 was ineffective. BIM23120-stimulated apoptosis was dependent on phosphatases, since it was abrogated by the inhibitor orthovanadate, and independent from the induction of apoptosis-related genes, such as p53, p63, p73, Bcl-2, Bax, BID, BIK, TNFSF8, and FADD. In somatotroph tumors, both BIM23120 and BIM2306 caused growth arrest as indicated by the increase in p27 and decrease in cyclin D1 expression. In conclusion, the present study showed that octreotide-induced apoptosis in human somatotroph tumor cells by activating SST2. This effect, together with the cytostatic action exerted by both SST2 and SST5 analogs, might account for the tumor shrinkage observed in acromegalic patients treated with long-acting somatostatin analogs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsuzaki, Shinichi; Ishizuka, Tamotsu, E-mail: tamotsui@showa.gunma-u.ac.jp; Yamada, Hidenori
Highlights: {yields} The involvement of extracellular acidification in airway remodeling was investigated. {yields} Extracellular acidification alone induced CTGF production in human ASMCs. {yields} Extracellular acidification enhanced TGF-{beta}-induced CTGF production in human ASMCs. {yields} Proton-sensing receptor OGR1 was involved in acidic pH-stimulated CTGF production. {yields} OGR1 may play an important role in airway remodeling in asthma. -- Abstract: Asthma is characterized by airway inflammation, hyper-responsiveness and remodeling. Extracellular acidification is known to be associated with severe asthma; however, the role of extracellular acidification in airway remodeling remains elusive. In the present study, the effects of acidification on the expression of connectivemore » tissue growth factor (CTGF), a critical factor involved in the formation of extracellular matrix proteins and hence airway remodeling, were examined in human airway smooth muscle cells (ASMCs). Acidic pH alone induced a substantial production of CTGF, and enhanced transforming growth factor (TGF)-{beta}-induced CTGF mRNA and protein expression. The extracellular acidic pH-induced effects were inhibited by knockdown of a proton-sensing ovarian cancer G-protein-coupled receptor (OGR1) with its specific small interfering RNA and by addition of the G{sub q/11} protein-specific inhibitor, YM-254890, or the inositol-1,4,5-trisphosphate (IP{sub 3}) receptor antagonist, 2-APB. In conclusion, extracellular acidification induces CTGF production through the OGR1/G{sub q/11} protein and inositol-1,4,5-trisphosphate-induced Ca{sup 2+} mobilization in human ASMCs.« less
Del'Guidice, Thomas; Lemay, Francis; Lemasson, Morgane; Levasseur-Moreau, Jean; Manta, Stella; Etievant, Adeline; Escoffier, Guy; Doré, François Y; Roman, François S; Beaulieu, Jean-Martin
2014-01-01
Polymorphisms in the gene encoding the serotonin synthesis enzyme Tph2 have been identified in mental illnesses, including bipolar disorder, major depression, autism, schizophrenia, and ADHD. Deficits in cognitive flexibility and perseverative behaviors are shared common symptoms in these disorders. However, little is known about the impact of Tph2 gene variants on cognition. Mice expressing a human TPH2 variant (Tph2-KI) were used to investigate cognitive consequences of TPH2 loss of function and pharmacological treatments. We applied a recently developed behavioral assay, the automated H-maze, to study cognitive functions in Tph2-KI mice. This assay involves the consecutive discovery of three different rules: a delayed alternation task, a non-alternation task, and a delayed reversal task. Possible contribution of locomotion, reward, and sensory perception were also investigated. The expression of loss-of-function mutant Tph2 in mice was associated with impairments in reversal learning and cognitive flexibility, accompanied by perseverative behaviors similar to those observed in human clinical studies. Pharmacological restoration of 5-HT synthesis with 5-hydroxytryptophan or treatment with the 5-HT2C receptor agonist CP809.101 reduced cognitive deficits in Tph2-KI mice and abolished perseveration. In contrast, treatment with the psychostimulant methylphenidate exacerbated cognitive deficits in mutant mice. Results from this study suggest a contribution of TPH2 in the regulation of cognition. Furthermore, identification of a role for a 5-HT2 receptor agonist as a cognition-enhancing agent in mutant mice suggests a potential avenue to explore for the personalized treatment of cognitive symptoms in humans with reduced 5-HT synthesis and TPH2 polymorphisms. PMID:24196946
Agonists and antagonists acting at P2X receptors: selectivity profiles and functional implications.
Lambrecht, G
2000-11-01
P2X receptors are nucleotide-gated cation channels composed of homomeric or heteromeric assemblies of three subunits. In the past 7 years, an extended series (P2X1-7) of P2X subunits has been cloned from vertebrate tissues. In this rapidly expanding field, one of the main current challenges is to relate the cloned P2X receptor subtypes to the diverse physiological responses mediated by the native P2X receptors. However, the paucity of useful ligands, especially subtype-selective agonists and antagonists as well as radioligands, acts as a considerable impediment to progress. Most of the ligands available are highly limited in terms of their kinetics of action, receptor-affinity, subtype-selectivity and P2X receptor-specificity. Their suspected ability to be a substrate for ecto-nucleotidases or to inhibit these enzymes also complicates their use. A number of new antagonists at P2X receptors have recently been described which to some degree are more potent and more selective than earlier antagonists like suramin or pyridoxal-5'-phosphate-6-azophenyl 2',4'-disulfonate (PPADS). This work moves us closer to the ideal goal of classifying the recombinant and native P2X receptor subtypes on the basis of antagonist profiles. This review begins with a brief account of the current status of P2X receptors. It then focuses on the pharmacological properties of a series of key P2 receptor agonists and antagonists and will finish with the discussion of some related therapeutic possibilities.
Revisiting the role of hCG: new regulation of the angiogenic factor EG-VEGF and its receptors.
Brouillet, S; Hoffmann, P; Chauvet, S; Salomon, A; Chamboredon, S; Sergent, F; Benharouga, M; Feige, J J; Alfaidy, N
2012-05-01
Endocrine gland-derived vascular endothelial growth factor (EG-VEGF) is an angiogenic factor reported to be specific for endocrine tissues, including the placenta. Its biological activity is mediated via two G protein-coupled receptors, prokineticin receptor 1 (PROKR1) and prokineticin receptor 2 (PROKR2). We have recently shown that (i) EG-VEGF expression peaks between the 8th and 11th weeks of gestation, (ii) its mRNA and protein levels are up-regulated by hypoxia, (iii) EG-VEGF is a negative regulator of trophoblast invasion and (iv) its circulating levels are increased in preeclampsia (PE), the most threatening pathology of pregnancy. Here, we investigated the regulation of the expression of EG-VEGF and its receptors by hCG, a key pregnancy hormone that is also deregulated in PE. During the first trimester of pregnancy, hCG and EG-VEGF exhibit the same pattern of expression, suggesting that EG-VEGF is potentially regulated by hCG. Both placental explants (PEX) and primary cultures of trophoblasts from the first trimester of pregnancy were used to investigate this hypothesis. Our results show that (i) LHCGR, the hCG receptor, is expressed both in cyto- and syncytiotrophoblasts, (ii) hCG increases EG-VEGF, PROKR1 and PROKR2 mRNA and protein expression in a dose- and time-dependent manner, (iii) hCG increases the release of EG-VEGF from PEX conditioned media, (iv) hCG effects are transcriptional and post-transcriptional and (v) the hCG effects are mediated by cAMP via cAMP response elements present in the EG-VEGF promoter region. Altogether, these results demonstrate a new role for hCG in the regulation of EG-VEGF and its receptors, an emerging regulatory system in placental development.
Burrows, Jeremy N; Cumming, John G; Fillery, Shaun M; Hamlin, Gordon A; Hudson, Julian A; Jackson, Ruth J; McLaughlin, Sharon; Shaw, John S
2005-01-03
Investigation of weak screening hits led to the identification of N-alkyl-N-[1-(3,3-diphenylpropyl)piperidin-4-yl]-2-phenylacetamides and N-alkyl-N-[1-(3,3-diphenylpropyl)piperidin-4-yl]-N'-benzylureas as potent, selective ligands for the human CCR5 chemokine receptor.
Principles and properties of ion flow in P2X receptors
Samways, Damien S. K.; Li, Zhiyuan; Egan, Terrance M.
2014-01-01
P2X receptors are a family of trimeric ion channels that are gated by extracellular adenosine 5′-triphosphate (ATP). These receptors have long been a subject of intense research interest by virtue of their vital role in mediating the rapid and direct effects of extracellular ATP on membrane potential and cytosolic Ca2+ concentration, which in turn underpin the ability of ATP to regulate a diverse range of clinically significant physiological functions, including those associated with the cardiovascular, sensory, and immune systems. An important aspect of an ion channel's function is, of course, the means by which it transports ions across the biological membrane. A concerted effort by investigators over the last two decades has culminated in significant advances in our understanding of how P2X receptors conduct the inward flux of Na+ and Ca2+ in response to binding by ATP. However, this work has relied heavily on results from current recordings of P2X receptors altered by site-directed mutagenesis. In the absence of a 3-dimensional channel structure, this prior work provided only a vague and indirect appreciation of the relationship between structure, ion selectivity and flux. The recent publication of the crystal structures for both the closed and open channel conformations of the zebrafish P2X4 receptor has thus proved a significant boon, and has provided an important opportunity to overview the amassed functional data in the context of a working 3-dimensional model of a P2X receptor. In this paper, we will attempt to reconcile the existing functional data regarding ion permeation through P2X receptors with the available crystal structure data, highlighting areas of concordance and discordance as appropriate. PMID:24550775
2012-01-01
Background Somatostatin (SST) via five Gi coupled receptors namely SSTR1-5 is known to inhibit cell proliferation by cytostatic and cytotoxic mechanisms. Heterodimerization plays a crucial role in modulating the signal transduction pathways of SSTR subtypes. In the present study, we investigated human SSTR2/SSTR3 heterodimerization, internalization, MAPK signaling, cell proliferation and apoptosis in HEK-293 cells in response to SST and specific agonists for SSTR2 and SSTR3. Results Although in basal conditions, SSTR2 and SSTR3 colocalize at the plasma membrane and exhibit heterodimerization, the cell surface distribution of both receptors decreased upon agonist activation and was accompanied by a parallel increase in intracellular colocalization. Receptors activation by SST and specific agonists significantly decreased cAMP levels in cotransfected cells in comparison to control. Agonist-mediated modulation of pERK1/2 was time and concentration-dependent, and pronounced in serum-deprived conditions. pERK1/2 was inhibited in response to SST; conversely receptor-specific agonist treatment caused inhibition at lower concentration and activation at higher concentration. Strikingly, ERK1/2 phosphorylation was sustained upon prolonged treatment with SST but not with receptor-specific agonists. On the other hand, SST and receptor-specific agonists modulated p38 phosphorylation time-dependently. The receptor activation in cotransfected cells exhibits Gi-dependent inhibition of cell proliferation attributed to increased PARP-1 expression and TUNEL staining, whereas induction of p21 and p27Kip1 suggests a cytostatic effect. Conclusion Our study provides new insights in SSTR2/SSTR3 mediated signaling which might help in better understanding of the molecular interactions involving SSTRs in tumor biology. PMID:22651821
Anterior Lens Capsule and Iris Thicknesses in Pseudoexfoliation Syndrome.
Batur, Muhammed; Seven, Erbil; Tekin, Serek; Yasar, Tekin
2017-11-01
The aim of this study was to evaluate anatomic properties of the lens capsule and iris by anterior segment optical coherence tomography (AS-OCT) in patients with pseudoexfoliation (PEX). This prospective study included 62 eyes of 62 patients with PEX syndrome and 43 eyes of 43 age- and gender-matched controls. All subjects underwent full ophthalmologic examinations including AS-OCT. Pupillary diameter, midperipheral stromal iris thickness, central and temporal lens capsule thicknesses, and peripheral pseudoexfoliation material thickness on the anterior lens capsule surface were measured and recorded. Mean age was 66.8 ± 9.3 years in the PEX group and 65.5 ± 8.9 years in the control group (p = 0.44). The PEX group consisted of 62 patients: 38 men (61.3%) and 24 women (38.7%); the control group included 43 subjects: 25 men (58.1%) and 18 women (41.9%). Pupillary diameter after pharmacologic mydriasis was 21% smaller in the PEX group than controls. Mean midperipheral iris thickness was 36 ± 7.2 μm (7.8%) thinner in the PEX group than that of control group (p = 0.047). The central anterior capsule was a mean of 3.40 ± 0.51 μm (18%) thicker in the PEX group compared to the control group (p = 0.0001). The temporal anterior lens capsule was a mean of 0.17 ± 0.15 μm thicker in the PEX group compared to the control group (p = 0.81). With high-resolution OCT imaging, it has become possible to evaluate the anterior lens capsule without histologic examination and demonstrate that it is thicker than normal in PEX patients.
Imran, Saima; Ferretti, Patrizia; Vrzal, Radim
2015-01-01
Some environmental pollutants derived from industrial processes have been suggested to be responsible for neurological impairment in children, especially in heavily polluted areas. Since these compounds are usually activators of aryl hydrocarbon receptor (AhR), it would be important to better understand the molecular pathways downstream of AhR leading to neural deficits. To this purpose, appropriate in vitro human neural model is much needed. Here we have investigated whether undifferentiated and neuronally differentiated human neuroblastoma cells, SH-SY5Y cells, can provide a suitable model for monitoring AhR activity induced by environmental pollutants, focusing on 2,3,7,8-tetrachlordibenzo-p-dioxin (TCDD), a known activator of AhR. Further characterization of differentiated SH-SY5Y showed an increase in AhRR (aryl hydrocarbon receptor repressor), no change in ARNT1 (AhR nuclear translocator 1), and a decrease in ARNT2 expression with differentiation; in contrast, AhR was undetectable in both undifferentiated and differentiated cells. Nonetheless, treatment of parental as well as differentiated SH-SY5Y cells with TCDD resulted in the induction of AhR-regulated genes, CYP1A1 and CYP1B1; AhRR expression was also affected, but to a much smaller extent. These results indicate that undifferentiated SH-SY5Y are less sensitive to TCDD than neuronally differentiated ones, suggesting a higher resistance of the undifferentiated tumor cells to toxic insults. They also suggest that TCDD in these cells may not act via direct activation of AhR that is undetectable in SH-SY5Y as well as in differentiated neurons. Hence, these cells do not provide an appropriate model for studying ligand-mediated activation of AhR.
Hyoscine butylbromide potently blocks human nicotinic acetylcholine receptors in SH-SY5Y cells.
Weiser, Thomas; Just, Stefan
2009-02-06
Hyoscine butylbromide (HBB; tradenames: Buscopan/Buscapina is an antispasmodic drug for the treatment of abdominal pain associated with gastrointestinal cramping. As a hyoscine derivative, this compound competitively inhibits muscarinic acetylcholine (ACh) receptors on smooth muscle cells in the gastrointestinal tract. Preliminary investigations suggested that it might also inhibit nicotinic ACh receptors. This study investigated the effect of HBB on nicotinic ACh receptor-mediated membrane currents in SH-SY5Y cells. ACh and nicotine application-induced comparable membrane currents with EC(50) values of 25.9+/-0.6 and 40.1+/-0.4microM, respectively. When coapplied with 100microM ACh, HBB concentration-dependently suppressed currents with an IC(50) value of 0.19+/-0.04microM, and was approximately seven-times more potent than the ganglionic blocker, hexamethonium (IC(50)=1.3+/-0.3microM). Increasing the agonist concentration to 5mM did not affect the amount of block by HBB, which suggests a non-competitive mode of action. These functional in vitro data demonstrate for the first time that HBB blocks neuronal nicotinic ACh receptors in the same concentration range as it inhibits muscarinic ACh receptors. If one hypothesizes that HBB might also affect nicotinic receptors in autonomic neurons in vivo (e. g. in the enteric nervous system), this effect could contribute to its spasmolytic activity.
Human glutathione S-transferase P1-1 functions as an estrogen receptor α signaling modulator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Xiyuan; An, Byoung Ha; Kim, Min Jung
2014-09-26
Highlights: • GSTP induces the classical ERα signaling event. • The functional GSTP is a prerequisite for GSTP-induced ERα transcription activity. • The expression of RIP140, a transcription cofactor, was inhibited by GSTP protein. • We propose the novel non-enzymatic role of GSTP. - Abstract: Estrogen receptor α (ERα) plays a crucial role in estrogen-mediated signaling pathways and exerts its action as a nuclear transcription factor. Binding of the ligand-activated ERα to the estrogen response element (ERE) is a central part of ERα-associated signal transduction pathways and its aberrant modulation is associated with many disease conditions. Human glutathione S-transferase P1-1more » (GSTP) functions as an enzyme in conjugation reactions in drug metabolism and as a regulator of kinase signaling pathways. It is overexpressed in tumors following chemotherapy and has been associated with a poor prognosis in breast cancer. In this study, a novel regulatory function of GSTP has been proposed in which GSTP modulates ERE-mediated ERα signaling events. Ectopic expression of GSTP was able to induce the ERα and ERE-mediated transcriptional activities in ERα-positive but GSTP-negative MCF7 human breast cancer cells. This inductive effect of GSTP on the ERE-transcription activity was diminished when the cells express a mutated form of the enzyme or are treated with a GSTP-specific chemical inhibitor. It was found that GSTP inhibited the expression of the receptor interacting protein 140 (RIP140), a negative regulator of ERα transcription, at both mRNA and protein levels. Our study suggests a novel non-enzymatic role of GSTP which plays a significant role in regulating the classical ERα signaling pathways via modification of transcription cofactors such as RIP140.« less
Ballet, Steven; Mayorov, Alexander V.; Cai, Minying; Tymecka, Dagmara; Chandler, Kevin B.; Palmer, Erin S.; Van Rompaey, Karolien; Misicka, Aleksandra; Tourwé, Dirk; Hruby, Victor J.
2008-01-01
In search of new selective antagonists and/or agonists for the human melanocortin receptor subtypes hMC1R to hMC5R to elucidate the specific biological roles of each GPCR, we modified the structures of the superagonist MT-II (Ac-Nle-c[Asp-His-D-Phe-Arg-Trp-Lys]-NH2) and the hMC3R/hMC4R antagonist SHU9119 (Ac-Nle-c[Asp-His-D-Nal(2′)-Arg-Trp-Lys]-NH2) by replacing the His-D-Phe and His-D-Nal(2′) fragments in MT-II and SHU9119, respectively, with Aba-Xxx (4-amino-1,2,4,5-tetrahydro-2-benzazepin-3-one-Xxx) dipeptidomimetics (Xxx = D-Phe/pCl-D-Phe/D-Nal(2′)). Employment of the Aba mimetic yielded novel selective high affinity hMC3R and hMC3R/hMC5R antagonists. PMID:17314042
Serotonin 2A receptor agonist binding in the human brain with [11C]Cimbi-36
Ettrup, Anders; da Cunha-Bang, Sophie; McMahon, Brenda; Lehel, Szabolcs; Dyssegaard, Agnete; Skibsted, Anine W; Jørgensen, Louise M; Hansen, Martin; Baandrup, Anders O; Bache, Søren; Svarer, Claus; Kristensen, Jesper L; Gillings, Nic; Madsen, Jacob; Knudsen, Gitte M
2014-01-01
[11C]Cimbi-36 was recently developed as a selective serotonin 2A (5-HT2A) receptor agonist radioligand for positron emission tomography (PET) brain imaging. Such an agonist PET radioligand may provide a novel, and more functional, measure of the serotonergic system and agonist binding is more likely than antagonist binding to reflect 5-HT levels in vivo. Here, we show data from a first-in-human clinical trial with [11C]Cimbi-36. In 29 healthy volunteers, we found high brain uptake and distribution according to 5-HT2A receptors with [11C]Cimbi-36 PET. The two-tissue compartment model using arterial input measurements provided the most optimal quantification of cerebral [11C]Cimbi-36 binding. Reference tissue modeling was feasible as it induced a negative but predictable bias in [11C]Cimbi-36 PET outcome measures. In five subjects, pretreatment with the 5-HT2A receptor antagonist ketanserin before a second PET scan significantly decreased [11C]Cimbi-36 binding in all cortical regions with no effects in cerebellum. These results confirm that [11C]Cimbi-36 binding is selective for 5-HT2A receptors in the cerebral cortex and that cerebellum is an appropriate reference tissue for quantification of 5-HT2A receptors in the human brain. Thus, we here describe [11C]Cimbi-36 as the first agonist PET radioligand to successfully image and quantify 5-HT2A receptors in the human brain. PMID:24780897
Tachykinin receptor expression and function in human esophageal smooth muscle.
Kovac, Jason R; Chrones, Tom; Preiksaitis, Harold G; Sims, Stephen M
2006-08-01
Tachykinins are present in enteric nerves of the gastrointestinal tract and cause contraction of esophageal smooth muscle; however, the mechanisms involved are not understood. Our aim was to characterize tachykinin signaling in human esophageal smooth muscle. We investigated functional effects of tachykinins on human esophageal smooth muscle using tension recordings and isolated cells, receptor expression with reverse transcription (RT)-polymerase chain reaction (PCR) and immunoblotting, intracellular Ca2+ responses using fluorescent indicator dyes, and membrane currents with patch-clamp electrophysiology. The mammalian tachykinins [substance P and neurokinin (NK) A and NKB] elicited concentration-dependent contractions of human esophageal smooth muscle. These responses were not affected by muscarinic receptor or neuronal blockade indicating a direct effect on smooth muscle cells (SMCs). Immunofluorescence and RT-PCR identified tachykinin receptors (NK1, NK2, and NK3) on SMCs. Contraction was mediated through a combination of Ca2+ release from intracellular stores and influx through L-type Ca2+ channels. NK2 receptor blockade inhibited the largest proportion of tachykinin-evoked responses. NKA evoked a nonselective cation current (I(NSC)) with properties similar to that elicited by muscarinic stimulation. The following paradigm is suggested: tachykinin receptor binding to SMCs releases Ca2+ from stores along with activation of I(NSC), which in turn results in membrane depolarization, L-type Ca2+ channel opening, rise of Ca2+ concentration, and contraction. These studies reveal new aspects of tachykinin signaling in human esophageal SMCs. Excitatory tachykinin pathways may represent targets for pharmacological intervention in disorders of esophageal dysmotility.
Rational Design of Potent Antagonists to the Human Growth Hormone Receptor
NASA Astrophysics Data System (ADS)
Fuh, Germaine; Cunningham, Brian C.; Fukunaga, Rikiro; Nagata, Shigekazu; Goeddel, David V.; Wells, James A.
1992-06-01
A hybrid receptor was constructed that contained the extracellular binding domain of the human growth hormone (hGH) receptor linked to the transmembrane and intracellular domains of the murine granulocyte colony-stimulating factor receptor. Addition of hGH to a myeloid leukemia cell line (FDC-P1) that expressed the hybrid receptor caused proliferation of these cells. The mechanism for signal transduction of the hybrid receptor required dimerization because monoclonal antibodies to the hGH receptor were agonists whereas their monovalent fragments were not. Receptor dimerization occurs sequentially-a receptor binds to site 1 on hGH, and then a second receptor molecule binds to site 2 on hGH. On the basis of this sequential mechanism, which may occur in many other cytokine receptors, inactive hGH analogs were designed that were potent antagonists to hGH-induced cell proliferation. Such antagonists could be useful for treating clinical conditions of hGH excess, such as acromegaly.
Thomas, Elizabeth A.; Carson, Monica J.; Neal, Michael J.; Sutcliffe, J. Gregor
1997-01-01
The effects of oleamide, an amidated lipid isolated from the cerebrospinal fluid of sleep-deprived cats, on serotonin receptor-mediated responses were investigated in cultured mammalian cells. In rat P11 cells, which endogenously express the 5-hydroxytryptamine2A (5HT2A) receptor, oleamide significantly potentiated 5HT-induced phosphoinositide hydrolysis. In HeLa cells expressing the 5HT7 receptor subtype, oleamide caused a concentration-dependent increase in cAMP accumulation but with lower efficacy than that observed by 5HT. This effect was not observed in untransfected HeLa cells. Clozapine did not prevent the increase in cAMP elicited by oleamide, and ketanserin caused an ≈65% decrease. In the presence of 5HT, oleamide had the opposite effect on cAMP, causing insurmountable antagonism of the concentration-effect curve to 5HT, but had no effect on cAMP levels elicited by isoproterenol or forskolin. These results indicate that oleamide can modulate 5HT-mediated signal transduction at different subtypes of mammalian 5HT receptors. Additionally, our data indicate that oleamide acts at an apparent allosteric site on the 5HT7 receptor and elicits functional responses via activation of this site. This represents a unique mechanism of activation for 5HT G protein-coupled receptors and suggests that G protein-coupled neurotransmitter receptors may act like their iontropic counterparts (i.e., γ-aminobutyric acid type A receptors) in that there may be several binding sites on the receptor that regulate functional activity with varying efficacies. PMID:9391162
Tuladhar, B R; Womack, M D; Naylor, R J
2000-01-01
The pharmacological characterization of a 5-HT receptor-mediated contractile response in the mouse isolated ileum is described. In the presence of methysergide (1 μM), 5-hydroxytryptamine (5-HT, 0.3–100 μM) produced phasic concentration-dependent contractions of segments of the mouse isolated ileum with a pEC50 value of 5.47±0.09. The 5-HT3 receptor selective agonists m-chlorophenylbiguanide (0.3–100 μM, pEC50 5.81±0.04), 1-phenylbiguanide (3–100 μM, pEC50 5.05±0.06) and 2-methyl-5-HT (3–100 μM, pEC50 5.00±0.07) acted as full agonists to induce contractile responses. 5-methoxytryptamine (0.1–100 μM), RS 67506 (0.1–100 μM) and α-methyl-5-HT (0.1–100 μM) failed to mimic the 5-HT responses. The contractile response to 5-HT was not antagonized by either 5-HT2 receptor antagonists ritanserin (0.1 μM) or ketanserin (1 μM) nor the 5-HT4 receptor antagonist SB 204070 (0.1 μM). The 5-HT3 receptor selective antagonists granisetron (0.3–1 nM), tropisetron (1–10 nM), ondansetron (10 nM–1 μM) and MDL 72222 (10 nM–1 μM) caused rightward displacement of the concentration-response curves to 5-HT. The lower concentrations of the antagonists caused approximate parallel rightward shifts of the concentration-response curves to 5-HT with apparent pKB values for granisetron (9.70±0.39), tropisetron (9.18±0.20), ondansetron (8.84±0.24) and MDL 72222 (8.65±0.35). But higher concentrations of antagonists resulted in a progressive reduction in the maximum responses. The contractile response to 5-HT was abolished by tetrodotoxin (0.3 μM); atropine (0.1 and 1 μM) decreased the maximum response of the 5-HT concentration-response curve by approximately 65%. It is concluded that a neuronally located 5-HT3 receptor mediates a contractile response to 5-HT in the mouse ileum. The 5-HT3 receptor in the mouse ileum has a different pharmacological profile to that reported for the guinea-pig ileum. PMID:11139451
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnston, Jason W.; Coussens, Nathan P.; Allen, Simon
Nontypeable Haemophilus influenzae is an opportunistic human pathogen causing otitis media in children and chronic bronchitis and pneumonia in patients with chronic obstructive pulmonary disease. The outer membrane of nontypeable H. influenzae is dominated by lipooligosaccharides (LOS), many of which incorporate sialic acid as a terminal nonreducing sugar. Sialic acid has been demonstrated to be an important factor in the survival of the bacteria within the host environment. H. influenzae is incapable of synthesizing sialic acid and is dependent on scavenging free sialic acid from the host environment. To achieve this, H. influenzae utilizes a tripartite ATP-independent periplasmic transporter. Inmore » this study, we characterize the binding site of the extracytoplasmic solute receptor (SiaP) from nontypeable H. influenzae strain 2019. A crystal structure of N-acetyl-5-neuraminic acid (Neu5Ac)-bound SiaP was determined to 1.4 {angstrom} resolution. Thermodynamic characterization of Neu5Ac binding shows this interaction is enthalpically driven with a substantial unfavorable contribution from entropy. This is expected because the binding of SiaP to Neu5Ac is mediated by numerous hydrogen bonds and has several buried water molecules. Point mutations targeting specific amino acids were introduced in the putative binding site. Complementation with the mutated siaP constructs resulted either in full, partial, or no complementation, depending on the role of specific residues. Mass spectrometry analysis of the O-deacylated LOS of the R127K point mutation confirmed the observation of reduced incorporation of Neu5Ac into the LOS. The decreased ability of H. influenzae to import sialic acid had negative effects on resistance to complement-mediated killing and viability of biofilms in vitro, confirming the importance of sialic acid transport to the bacterium.« less
Gene Transfer and Molecular Cloning of the Human NGF Receptor
NASA Astrophysics Data System (ADS)
Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita
1986-04-01
Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.
α5-GABAA receptors negatively regulate MYC-amplified medulloblastoma growth
Sengupta, Soma; Weeraratne, Shyamal Dilhan; Sun, Hongyu; Phallen, Jillian; Rallapalli, Sundari K.; Teider, Natalia; Kosaras, Bela; Amani, Vladimir; Pierre-Francois, Jessica; Tang, Yujie; Nguyen, Brian; Yu, Furong; Schubert, Simone; Balansay, Brianna; Mathios, Dimitris; Lechpammer, Mirna; Archer, Tenley C.; Tran, Phuoc; Reimer, Richard J.; Cook, James M.; Lim, Michael; Jensen, Frances E.; Pomeroy, Scott L.; Cho, Yoon-Jae
2013-01-01
Neural tumors often express neurotransmitter receptors as markers of their developmental lineage. Although these receptors have been well characterized in electrophysiological, developmental and pharmacological settings, their importance in the maintenance and progression of brain tumors, and importantly, the effect of their targeting in brain cancers remains obscure. Here, we demonstrate high levels of GABR5, which encodes the α-subunit of the GABAA receptor complex, in aggressive MYC-driven, “Group 3” medulloblastomas. We hypothesized that modulation of α-GABAA receptors alters medulloblastoma cell survival and monitored biological and electrophysiological responses of GABR5-expressing medulloblastoma cells upon pharmacological targeting of the GABAA receptor. While antagonists, inverse agonists and non-specific positive allosteric modulators had limited effects on medulloblastoma cells, a highly specific and potent α5-GABAA receptor agonist, QHii066, resulted in marked membrane depolarization and a significant decrease in cell survival. This effect was GABR5 dependent and mediated through the induction of apoptosis as well as accumulation of cells in S and G2 phases of the cell cycle. Chemical genomic profiling of QHii066-treated medulloblastoma cells confirmed inhibition of MYC-related transcriptional activity and revealed an enrichment of HOX5 target gene expression. siRNA-mediated knockdown of HOX5 markedly blunted the response of medulloblastoma cells to QHii066. Furthermore, QHii066 sensitized GABR5 positive medulloblastoma cells to radiation and chemotherapy consistent with the role of HOX5 in directly regulating p53 expression and inducing apoptosis. Thus, our results provide novel insights into the synthetic lethal nature of α5-GABAA receptor activation in MYC-driven/Group 3 medulloblastomas and propose its targeting as a novel strategy for the management of this highly aggressive tumor. PMID:24196163
Neurotrophins and their receptors in human lingual tonsil: an immunohistochemical analysis.
Artico, Marco; Bronzetti, Elena; Felici, Laura M; Alicino, Valentina; Ionta, Brunella; Bronzetti, Benedetto; Magliulo, Giuseppe; Grande, Claudia; Zamai, Loris; Pasquantonio, Guido; De Vincentiis, Marco
2008-11-01
Lymphoid organs are supplied by many nerve endings associated with different kinds of cells and macrophages. The role of this innervation on the release of locally active molecules is still unclear. Lingual tonsils belong to Waldeyer's Ring, in close association with palatine tonsils and nasopharyngeal (adenoids) tonsils, thus constituting part of NALT (nasal-associated lymphoid tissue) together with the tubal tonsils and lateral pharyngeal bands. In this study, we focused our attention on the expression of some neurotrophins (NTs) and their high- and low-affinity receptors in human lingual tonsils. Light immunohistochemistry showed that human tonsillar samples were generally positive for all the NTs investigated (NGF, BDNF, NT-3, NT-4) and their receptors (TrKA, TrKB, TrKC and p75) with some different expression levels. NGF and TrKC were strongly expressed in macrophages, but weakly in lymphocytes. However, BDNF and TrKB was highly expressed in lymphocytes and weaker in macrophages. The low-affinity receptor for NGF, p75, was mainly moderately expressed in the analysed samples. These results suggest the presence of a pattern of neurotrophin innervation in the human lingual tonsil which may play a role in sustaining inflammatory conditions and in modulating a close interaction between the nervous system and the different immune cellular subtypes.
Characterization of mGluR5R, a novel, metabotropic glutamate receptor 5-related gene.
Bates, Brian; Xie, Yuhong; Taylor, Noel; Johnson, Jeremy; Wu, Leeying; Kwak, Seung; Blatcher, Maria; Gulukota, Kamalakar; Paulsen, Janet E
2002-12-30
We report here the isolation of a novel gene termed mGluR5R (mGluR5-related). The N-terminus of mGluR5R is highly similar to the extracellular domain of metabotropic glutamate receptor 5 (mGluR5) whereas the C-terminus bears similarity to the testis-specific gene, RNF18. mGluR5R is expressed in the human CNS in a coordinate fashion with mGluR5. Although the sequence suggests that mGluR5R may be a secreted glutamate binding protein, we found that when expressed in HEK293 cells it was membrane associated and not secreted. Furthermore, mGluR5R was incapable of binding the metabotropic glutamate receptor class I selective agonist, quisqualate. Although mGluR5R could not form disulfide-mediated covalent homodimers, it was able to form a homomeric complex, presumably through noncovalent interactions. mGluR5R also formed noncovalent heteromeric associations with an engineered construct of the extracellular domain of mGluR5 as well as with full-length mGluR5 and mGluR1alpha. The ability of mGluR5R to associate with mGluR1alpha and mGluR5 suggests that it may be a modulator of class I metabotropic glutamate receptor function.
Chen, Yakun; Tang, Yong; Robbins, Gregory T.
2010-01-01
Differential regulation of drug-metabolizing enzymes (DMEs) is a common cause of adverse drug effects in cancer therapy. Due to the extremely important role of cytochrome P450 3A4 (CYP3A4) in drug metabolism and the dominant regulation of human pregnane X receptor (hPXR) on CYP3A4, finding inhibitors for hPXR could provide a unique tool to control drug efficacies in cancer therapy. Camptothecin (CPT) was demonstrated as a novel and potent inhibitor (IC50 = 0.58 μM) of an hPXR-mediated transcriptional regulation on CYP3A4 in this study. In contrast, one of its analogs, irinotecan (CPT-11), was found to be an hPXR agonist in the same tests. CPT disrupted the interaction of hPXR with steroid receptor coactivator-1 but had effects on neither the competition of ligand binding nor the formation of the hPXR and retinoid X receptor α heterodimer, nor the interaction between the regulatory complex and DNA-responsive elements. CPT treatment resulted in delayed metabolism of nifedipine in human hepatocytes treated with rifampicin, suggesting a potential prevention of drug-drug interactions between CYP3A4 inducers and CYP3A4-metabolized drugs. Because CPT is the leading compound of topoisomerase I inhibitors, which comprise a quickly developing class of anticancer agents, the findings indicate the potential of a new class of compounds to modify hPXR activity as agonists/inhibitors and are important in the development of CPT analogs. PMID:20504912
Medicinal chemistry of P2X receptors: allosteric modulators.
Müller, Christa E
2015-01-01
P2X receptors are trimeric ligand-gated ion channels whose potential as novel drug targets for a number of diseases has been recognized. They are mainly involved in inflammatory processes, including neuroinflammation, and pain sensation. The orthosteric binding site is lined by basic amino acid residues that bind the negatively charged agonist ATP. Therefore it is not easy to develop orthosteric ligands that possess drug-like properties for such a highly polar binding site. However, ligand-gated ion channels offer multiple additional binding sites for allosteric ligands, positive or negative allosteric modulators enhancing or blocking receptor function. So far, the P2X3 (and P2X2/3), as well as the P2X7 receptor subtype have been the main focus of drug development efforts. A number of potent and selective allosteric antagonists have been developed to block these receptors. We start to see the development of novel allosteric ligands also for the other P2X receptor subtypes, P2X1, P2X2 and especially P2X4. The times when only poor, non-selective, non-drug-like tools for studying P2X receptor function were available have been overcome. The first clinical studies with allosteric P2X3 and P2X7 antagonists suggest that P2X therapeutics may soon become a reality.
Molecular recognition at adenine nucleotide (P2) receptors in platelets.
Jacobson, Kenneth A; Mamedova, Liaman; Joshi, Bhalchandra V; Besada, Pedro; Costanzi, Stefano
2005-04-01
Transmembrane signaling through P2Y receptors for extracellular nucleotides controls a diverse array of cellular processes, including thrombosis. Selective agonists and antagonists of the two P2Y receptors present on the platelet surface-the G (q)-coupled P2Y (1) subtype and the G (i)-coupled P2Y (12) subtype-are now known. High-affinity antagonists of each have been developed from nucleotide structures. The (N)-methanocarba bisphosphate derivatives MRS2279 and MRS2500 are potent and selective P2Y (1) receptor antagonists. The carbocyclic nucleoside AZD6140 is an uncharged, orally active P2Y (12) receptor antagonist of nM affinity. Another nucleotide receptor on the platelet surface, the P2X (1) receptor, the activation of which may also be proaggregatory, especially under conditions of high shear stress, has high-affinity ligands, although high selectivity has not yet been achieved. Although alpha,beta-methylene-adenosine triphosphate (ATP) is the classic agonist for the P2X (1) receptor, where it causes rapid desensitization, the agonist BzATP is among the most potent in activating this subtype. The aromatic sulfonates NF279 and NF449 are potent antagonists of the P2X (1) receptor. The structures of the two platelet P2Y receptors have been modeled, based on a rhodopsin template, to explain the basis for nucleotide recognition within the putative transmembrane binding sites. The P2Y (1) receptor model, especially, has been exploited in the design and optimization of antagonists targeted to interact selectively with that subtype.
Hay, Colin W.; Shanley, Lynne; Davidson, Scott; Cowie, Philip; Lear, Marissa; McGuffin, Peter; Riedel, Gernot; McEwan, Iain J.; MacKenzie, Alasdair
2014-01-01
Summary Expression or introduction of the neuropeptide substance-P (SP; encoded by the TAC1 gene in humans and Tac1 in rodents) in the amygdala induces anxiety related behaviour in rodents. In addition, pharmacological antagonism of the main receptor of SP in humans; NK1, is anxiolytic. In the current study, we show that the Tac1 locus is up-regulated in primary rat amygdala neurones in response to activation of the glucocorticoid receptor (GR); a classic component of the stress response. Using a combination of bioinformatics, electrophoretic mobility shift assays (EMSA) and reporter plasmid magnetofection into rat primary amygdala neurones we identified a highly conserved GR response sequence (2GR) in the human TAC1 promoter that binds GR in response to dexamethasone (Dex) or forskolin. We also identified a second GR binding site in the human promoter that was polymorphic and whose T-allele is only found in Japanese and Chinese populations. We present evidence that the T-allele of SNPGR increases the activity of the TAC1 promoter through de-sequestration or de-repression of 2GR. The identification of Dex/forskolin response elements in the TAC1 promoter in amygdala neurones suggests a possible link in the chain of molecular events connecting GR activation and anxiety. In addition, the discovery of a SNP which can alter this response may have implications for our understanding of the role of regulatory variation in susceptibility to stress in specific populations. PMID:25001955
Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C
1987-01-26
Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.
Effects of Constant Flickering Light on Refractive Status, 5-HT and 5-HT2A Receptor in Guinea Pigs
Li, Tao; Zheng, Changyue; Ji, Shunmei; Ma, Yuanyuan; Zhang, Shuangshuang; Zhou, Xiaodong
2016-01-01
Purpose To investigate the effects of constant flickering light on refractive development, the role of serotonin (i.e.5-hydroxytryptamine, 5-HT)and 5-HT2A receptor in myopia induced by flickering light in guinea pigs. Methods Forty-five guinea pigs were randomly divided into three groups: control, form deprivation myopia (FDM) and flickering light induced myopia (FLM) groups(n = 15 for each group). The right eyes of the FDM group were covered with semitransparent hemispherical plastic shells serving as eye diffusers. Guinea pigs in FLM group were raised with illumination of a duty cycle of 50% at a flash frequency of 0.5Hz. The refractive status, axial length (AL), corneal radius of curvature(CRC) were measured by streak retinoscope, A-scan ultrasonography and keratometer, respectively. Ultramicroscopy images were taken by electron microscopy. The concentrations of 5-HTin the retina, vitreous body and retinal pigment epithelium (RPE) were assessed by high performance liquid chromatography, the retinal 5-HT2A receptor expression was evaluated by immunohistofluorescence and western blot. Results The refraction of FDM and FLM eyes became myopic from some time point (the 4th week and the 6th week, respectively) in the course of the experiment, which was indicated by significantly decreased refraction and longer AL when compared with the controls (p<0.05). The concentrations of 5-HT in the retina, vitreous body and RPE of FDM and FLM eyes were significantly increased in comparison with those of control eyes (both p<0.05). Similar to FDM eyes, the expression of retinal 5-HT2A receptor in FLM eyes was significantly up-regulated compared to that of control eyes (both p<0.05). Western blot analysis showed that retinal 5-HT2A receptor level elevated less in the FLM eyes than that in the FDM eyes. Moreover, the levels of norepinephrine and epinephrine in FDM and FLM groups generally decreased when compared with control groups (all p<0.05). Conclusions Constant flickering
Modulation of P2X7 Receptor during Inflammation in Multiple Sclerosis
Amadio, Susanna; Parisi, Chiara; Piras, Eleonora; Fabbrizio, Paola; Apolloni, Savina; Montilli, Cinzia; Luchetti, Sabina; Ruggieri, Serena; Gasperini, Claudio; Laghi-Pasini, Franco; Battistini, Luca; Volonté, Cinzia
2017-01-01
Multiple sclerosis (MS) is characterized by macrophage accumulation and inflammatory infiltrates into the CNS contributing to demyelination. Because purinergic P2X7 receptor (P2X7R) is known to be abundantly expressed on cells of the hematopoietic lineage and of the nervous system, we further investigated its phenotypic expression in MS and experimental autoimmune encephalomyelitis conditions. By quantitative reverse transcription polymerase chain reaction and flow cytometry, we analyzed the P2X7R expression in human mononuclear cells of peripheral blood from stable and acute relapsing-remitting MS phases. Human monocytes were also challenged in vitro with pro-inflammatory stimuli such as the lipopolysaccharide, or the P2X7R preferential agonist 2′(3′)-O-(4 Benzoylbenzoyl)adenosine 5′-triphosphate, before evaluating P2X7R protein expression. Finally, by immunohistochemistry and immunofluorescence confocal analysis, we investigated the P2X7R expression in frontal cortex from secondary progressive MS cases. We demonstrated that P2X7R is present and inhibited on peripheral monocytes isolated from MS donors during the acute phase of the disease, moreover it is down-regulated in human monocytes after pro-inflammatory stimulation in vitro. P2X7R is instead up-regulated on astrocytes in the parenchyma of frontal cortex from secondary progressive MS patients, concomitantly with monocyte chemoattractant protein-1 chemokine, while totally absent from microglia/macrophages or oligodendrocytes, despite the occurrence of inflammatory conditions. Our results suggest that inhibition of P2X7R on monocytes and up-regulation in astrocytes might contribute to sustain inflammatory mechanisms in MS. By acquiring further knowledge about P2X7R dynamics and identifying P2X7R as a potential marker for the disease, we expect to gain insights into the molecular pathways of MS. PMID:29187851
Valerian extract and valerenic acid are partial agonists of the 5-HT5a receptor in vitro.
Dietz, Birgit M; Mahady, Gail B; Pauli, Guido F; Farnsworth, Norman R
2005-08-18
Insomnia is the most frequently encountered sleep complaint worldwide. While many prescription drugs are used to treat insomnia, extracts of valerian (Valeriana officinalis L., Valerianaceae) are also used for the treatment of insomnia and restlessness. To determine novel mechanisms of action, radioligand binding studies were performed with valerian extracts (100% methanol, 50% methanol, dichloromethane [DCM], and petroleum ether [PE]) at the melatonin, glutamate, and GABA(A) receptors, and 8 serotonin receptor subtypes. Both DCM and PE extracts had strong binding affinity to the 5-HT(5a) receptor, but only weak binding affinity to the 5-HT(2b) and the serotonin transporter. Subsequent binding studies focused on the 5-HT(5a) receptor due to the distribution of this receptor in the suprachiasmatic nucleus of the brain, which is implicated in the sleep-wake cycle. The PE extract inhibited [(3)H]lysergic acid diethylamide (LSD) binding to the human 5-HT(5a) receptor (86% at 50 microg/ml) and the DCM extract inhibited LSD binding by 51%. Generation of an IC(50) curve for the PE extract produced a biphasic curve, thus GTP shift experiments were also performed. In the absence of GTP, the competition curve was biphasic (two affinity sites) with an IC(50) of 15.7 ng/ml for the high-affinity state and 27.7 microg/ml for the low-affinity state. The addition of GTP (100 microM) resulted in a right-hand shift of the binding curve with an IC(50) of 11.4 microg/ml. Valerenic acid, the active constituent of both extracts, had an IC(50) of 17.2 microM. These results indicate that valerian and valerenic acid are new partial agonists of the 5-HT(5a) receptor.
Valerian extract and valerenic acid are partial agonists of the 5-HT5a receptor in vitro
Dietz, Birgit M.; Mahady, Gail B.; Pauli, Guido F.; Farnsworth, Norman R.
2018-01-01
Insomnia is the most frequently encountered sleep complaint worldwide. While many prescription drugs are used to treat insomnia, extracts of valerian (Valeriana officinalis L., Valerianaceae) are also used for the treatment of insomnia and restlessness. To determine novel mechanisms of action, radioligand binding studies were performed with valerian extracts (100% methanol, 50% methanol, dichloromethane [DCM], and petroleum ether [PE]) at the melatonin, glutamate, and GABAA receptors, and 8 serotonin receptor subtypes. Both DCM and PE extracts had strong binding affinity to the 5-HT5a receptor, but only weak binding affinity to the 5-HT2b and the serotonin transporter. Subsequent binding studies focused on the 5-HT5a receptor due to the distribution of this receptor in the suprachiasmatic nucleus of the brain, which is implicated in the sleep–wake cycle. The PE extract inhibited [3H]lysergic acid diethylamide (LSD) binding to the human 5-HT5a receptor (86% at 50 μg/ml) and the DCM extract inhibited LSD binding by 51%. Generation of an IC50 curve for the PE extract produced a biphasic curve, thus GTP shift experiments were also performed. In the absence of GTP, the competition curve was biphasic (two affinity sites) with an IC50 of 15.7 ng/ml for the high-affinity state and 27.7 μg/ml for the low-affinity state. The addition of GTP (100 AM) resulted in a right-hand shift of the binding curve with an IC50 of 11.4 μg/ml. Valerenic acid, the active constituent of both extracts, had an IC50 of 17.2 AM. These results indicate that valerian and valerenic acid are new partial agonists of the 5-HT5a receptor. PMID:15921820
The Metabotropic Purinergic P2Y Receptor Family as Novel Drug Target in Epilepsy.
Alves, Mariana; Beamer, Edward; Engel, Tobias
2018-01-01
Epilepsy encompasses a heterogeneous group of neurological syndromes which are characterized by recurrent seizures affecting over 60 million people worldwide. Current anti-epileptic drugs (AEDs) are mainly designed to target ion channels and/or GABA or glutamate receptors. Despite recent advances in drug development, however, pharmacoresistance in epilepsy remains as high as 30%, suggesting the need for the development of new AEDs with a non-classical mechanism of action. Neuroinflammation is increasingly recognized as one of the key players in seizure generation and in the maintenance of the epileptic phenotype. Consequently, targeting signaling molecules involved in inflammatory processes may represent new avenues to improve treatment in epilepsy. Nucleotides such as adenosine-5'-triphosphate (ATP) and uridine-5'-triphosphate (UTP) are released in the brain into the extracellular space during pathological conditions such as increased neuronal firing or cell death. Once released, these nucleotides bind to and activate specific purinergic receptors termed P2 receptors where they mediate the release of gliotransmitters and drive neuronal hyperexcitation and neuroinflammatory processes. This includes the fast acting ionotropic P2X channels and slower-acting G-protein-coupled P2Y receptors. While the expression and function of P2X receptors has been well-established in experimental models of epilepsy, emerging evidence is now also suggesting a prominent role for the P2Y receptor subfamily in seizure generation and the maintenance of epilepsy. In this review we discuss data supporting a role for the P2Y receptor family in epilepsy and the most recent finding demonstrating their involvement during seizure-induced pathology and in epilepsy.
Polymorphism and genetic mapping of the human oxytocin receptor gene on chromosome 3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Michelini, S.; Urbanek, M.; Goldman, D.
1995-06-19
Centrally administered oxytocin has been reported to facilitate affiliative and social behaviors, in functional harmony with its well-known peripheral effects on uterine contraction and milk ejection. The biological effects of oxytocin could be perturbed by mutations occurring in the sequence of the oxytocin receptor gene, and it would be of interest to establish the position of this gene on the human linkage map. Therefore we identified a polymorphism at the human oxytocin receptor gene. A portion of the 3{prime} untranslated region containing a 30 bp CA repeat was amplified by polymerase chain reaction (PCR), revealing a polymorphism with two allelesmore » occurring with frequencies of 0.77 and 0.23 in a sample of Caucasian CEPH parents (n = 70). The CA repeat polymorphism we detected was used to map the human oxytocin receptor to chromosome 3p25-3p26, in a region which contains several important genes, including loci for Von Hippel-Lindau disease (VHL) and renal cell carcinoma. 53 refs., 2 figs., 1 tab.« less
Reciprocal regulation of platelet responses to P2Y and thromboxane receptor activation.
Barton, J F; Hardy, A R; Poole, A W; Mundell, S J
2008-03-01
Thromboxane A(2) and ADP are two major platelet agonists that stimulate two sets of G protein-coupled receptors to activate platelets. Although aggregation responses to ADP and thromboxane desensitize, there are no reports currently addressing whether activation by one agonist may heterologously desensitize responses to the other. To demonstrate whether responses to ADP or U46619 may be modulated by prior treatment of platelets with the alternate agonist, revealing a level of cross-desensitization between receptor systems. Here we show that pretreatment of platelets with either agonist substantially desensitizes aggregation responses to the other agonist. Calcium responses to thromboxane receptor activation are desensitized by preactivation of P2Y(1) but not P2Y(12) receptors. This heterologous desensitization is mediated by a protein kinase C (PKC)-independent mechanism. Reciprocally, calcium responses to ADP are desensitized by pretreatment of platelets with the thromboxane analogue, U46619, and P2Y(12)-mediated inhibition of adenylate cyclase is also desensitized by pretreatment with U46619. In this direction, desensitization is comprised of two components, a true heterologous component that is PKC-independent, and a homologous component that is mediated through stimulated release of dense granule ADP. This study reveals cross-desensitization between ADP and thromboxane receptor signaling in human platelets. Cross-desensitization is mediated by protein kinases, involving PKC-dependent and independent pathways, and indicates that alterations in the activation state of one receptor may have effects upon the sensitivity of the other receptor system.
Yamazaki, Mayako; Okabe, Mayuko; Yamamoto, Noriyuki; Yarimizu, Junko; Harada, Katsuya
2015-03-01
Despite the human 5-HT5A receptor being cloned in 1994, the biological function of this receptor has not been extensively characterized due to a lack of specific ligands. We recently reported that the selective 5-HT5A receptor antagonist ASP5736 ameliorated cognitive impairment in several animal models of schizophrenia. Given that areas of the brain with high levels of 5-HT5A receptor expression, such as the hippocampus and cerebral cortex, have important functions in cognition and memory, we evaluated the chemically diverse, potent and brain-penetrating 5-HT5A receptor antagonists ASP5736, AS2030680, and AS2674723 in rodent models of cognitive dysfunction associated with dementia. Each of these compounds exhibited a high affinity for recombinant 5-HT5A receptors that was comparable to that of the non-selective ligand of this receptor, lysergic acid diethylamide (LSD). Although each compound had a low affinity for other receptors, 5-HT5A was the only receptor for which all three compounds had a high affinity. Each of the three compounds ameliorated scopolamine-induced working memory deficit in mice and improved reference memory impairment in aged rats at similar doses. Further, ASP5736 decreased the binding of LSD to 5-HT5A receptors in the olfactory bulb of rats in a dose-dependent manner and occupied 15%-50% of brain 5-HT5A receptors at behaviorally effective doses. These results indicate that the 5-HT5A receptor is involved in learning and memory and that treatment with 5-HT5A receptor antagonists might be broadly effective for cognitive impairment associated with not only schizophrenia but also dementia. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
P2X receptors, sensory neurons and pain.
Bele, Tanja; Fabbretti, Elsa
2015-01-01
Pain represents a very large social and clinical problem since the current treatment provides insufficient pain relief. Plasticity of pain receptors together with sensitisation of sensory neurons, and the role of soluble mediators released from non-neuronal cells render difficult to understand the spatial and temporal scale of pain development, neuronal responses and disease progression. In pathological conditions, ATP is one of the most powerful mediators that activates P2X receptors that behave as sensitive ATP-detectors, such as neuronal P2X3 receptor subtypes and P2X4 and P2X7 receptors expressed on non-neuronal cells. Dissecting the molecular mechanisms occurring in sensory neurons and in accessory cells allows to design appropriate tissue- and cell- targeted approaches to treat chronic pain.
Substance P receptor desensitization requires receptor activation but not phospholipase C
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugiya, Hiroshi; Putney, J.W. Jr.
1988-08-01
Previous studies have shown that exposure of parotid acinar cells to substance P at 37{degree}C results in activation of phospholipase C, formation of ({sup 3}H)inositol 1,4,5-trisphosphate (IP{sub 3}), and persistent desensitization of the substance P response. In cells treated with antimycin in medium containing glucose, ATP was decreased to {approximately}20% of control values, IP{sub 3} formation was completely inhibited, but desensitization was unaffected. When cells were treated with antimycin in the absence of glucose, cellular ATP was decreased to {approximately}5% of control values, and both IP{sub 3} formation and desensitization were blocked. A series of substance P-related peptides increased themore » formation of ({sup 3}H)IP{sub 3} and induced desensitization of the substance P response with a similar rank order of potencies. The substance P antagonist, (D-Pro{sup 2}, D-Try{sup 7,9})-substance P, inhibited substance P-induced IP{sub 3} formation and desensitization but did not induce desensitization. These results suggest that the desensitization of substance P-induced IP{sub 3} formation requires agonist activation of a P-type substance P receptor, and that one or more cellular ATP-dependent processes are required for this reaction. However, activation of phospholipase C and the generation of inositol phosphates does not seem to be a prerequisite for desensitization.« less
5-HT Radioligands for Human Brain Imaging With PET and SPECT
Paterson, Louise M.; Kornum, Birgitte R.; Nutt, David J.; Pike, Victor W.; Knudsen, Gitte M.
2014-01-01
The serotonergic system plays a key modulatory role in the brain and is the target for many drug treatments for brain disorders either through reuptake blockade or via interactions at the 14 subtypes of 5-HT receptors. This review provides the history and current status of radioligands used for positron emission tomography (PET) and single photon emission computerized tomography (SPECT) imaging of human brain serotonin (5-HT) receptors, the 5-HT transporter (SERT), and 5-HT synthesis rate. Currently available radioligands for in vivo brain imaging of the 5-HT system in humans include antagonists for the 5-HT1A, 5-HT1B, 5-HT2A, and 5-HT4 receptors, and for SERT. Here we describe the evolution of these radioligands, along with the attempts made to develop radioligands for additional serotonergic targets. We describe the properties needed for a radioligand to become successful and the main caveats. The success of a PET or SPECT radioligand can ultimately be assessed by its frequency of use, its utility in humans, and the number of research sites using it relative to its invention date, and so these aspects are also covered. In conclusion, the development of PET and SPECT radioligands to image serotonergic targets is of high interest, and successful evaluation in humans is leading to invaluable insight into normal and abnormal brain function, emphasizing the need for continued development of both SPECT and PET radioligands for human brain imaging. PMID:21674551
Patil, Nitin A; Bathgate, Ross A D; Kocan, Martina; Ang, Sheng Yu; Tailhades, Julien; Separovic, Frances; Summers, Roger; Grosse, Johannes; Hughes, Richard A; Wade, John D; Hossain, Mohammed Akhter
2016-04-01
Insulin-like peptide 5 (INSL5) is an orexigenic peptide hormone belonging to the relaxin family of peptides. It is expressed primarily in the L-cells of the colon and has a postulated key role in regulating food intake. Its G protein-coupled receptor, RXFP4, is a potential drug target for treating obesity and anorexia. We studied the effect of modification of the C-terminus of the A and B-chains of human INSL5 on RXFP4 binding and activation. Three variants of human INSL5 were prepared using solid phase peptide synthesis and subsequent sequential regioselective disulfide bond formation. The peptides were synthesized as C-terminal acids (both A- and B-chains with free C-termini, i.e., the native form), amides (both chains as the C-terminal amide) and one analog with the C-terminus of its A-chain as the amide and the C-terminus of the B-chain as the acid. The results showed that C-terminus of the B-chain is more important than that of the A-chain for RXFP4 binding and activity. Amidation of the A-chain C-terminus does not have any effect on the INSL5 activity. The difference in RXFP4 binding and activation between the three peptides is believed to be due to electrostatic interaction of the free carboxylate of INSL5 with a positively charged residue (s), either situated within the INSL5 molecule itself or in the receptor extracellular loops.
Hossain, Zakir; Sugawara, Tatsuya; Hirata, Takashi
2013-03-01
Biofunctional marine compounds have recently received substantial attention for their nutraceutical characteristics. In this study, we investigated the apoptosis-inducing effects of sphingoid bases prepared from sea cucumber using human hepatoma HepG2 cells. Apoptotic effects were determined by cell viability assay, DNA fragmentation assay, caspase-3 and caspase-8 activities. The expression levels of apoptosis-inducing death receptor-5 (DR5) and p-AKT were assayed by western blot analysis, and mRNA expression of bax, GADD45 and PPARγ was assayed by quantitative RT-PCR analysis. Sphingoid bases from sea cucumber markedly reduced the cell viability of HepG2 cells. DNA fragmentation indicative of apoptosis was observed in a dose-dependent manner. The expression levels of the apoptosis inducer protein Bax were increased by the sphingoid bases from sea cucumber. GADD45, which plays an important role in apoptosis-inducing pathways, was markedly upregulated by sphingoid bases from sea cucumber. Upregulation of PPARγ mRNA was also observed during apoptosis induced by the sphingoid bases. The expression levels of DR5 and p-AKT proteins were increased and decreased, respectively, as a result of the effects of sphingoid bases from sea cucumber. The results indicate that sphingoid bases from sea cucumber induce apoptosis in HepG2 cells through upregulation of DR5, Bax, GADD45 and PPARγ and downregulation of p-AKT. Our results show for the first time the functional properties of marine sphingoid bases as inducers of apoptosis in HepG2 cells.
Grant, M B; Wargovich, T J; Ellis, E A; Tarnuzzer, R; Caballero, S; Estes, K; Rossing, M; Spoerri, P E; Pepine, C
1996-12-17
The molecular and cellular processes that induce rapid atherosclerotic plaque progression in patients with unstable angina and initiate restenosis following coronary interventional procedures are uncertain. We examined primary (de novo) and restenotic lesions retrieved at the time of directional coronary atherectomy for expression of insulin-like-growth factor-I (IGF-I). IGF-I receptor, and five IGF binding proteins (IGFBPs), IGFBP-1, IGFBP-2, IGFBP-3, IGFBP-4, and IGFBP-5 in smooth muscle cells (SMCs) using colloidal gold immunocytochemistry. IGF-1, its receptor and binding proteins were not detected in SMCs of normal coronary arteries. IGF-I localized primarily in synthetic smooth muscle cells (sSMCs) in both de novo and restenotic plaques. IGF-I receptor localized on sSMCs and their processes and colocalized with IGF-I. Although morphometric analysis of IGF-I and IGF-I receptor immunoreactivity in sSMCs of de novo and restenotic lesions showed comparable levels of IGF-I (3.2 +/- 1.0 and 2.9 +/- 0.9, respectively). IGF-I receptor was significantly higher in de novo lesions as compared to restenotic lesions (10.7 +/- 2.5 and 4.2 +/- 1.3, P < 0.05, respectively). IGFBP-1, IGFBP-2, IGFBP-3, IGFBP-4 and IGFBP-5 localized in the cytoplasm of sSMCs and in the extracellular matrix. Quantitative reverse transcription polymerase chain reaction (QRT-PCR) performed on de novo atherectomy specimens identified mRNA for IGF-I, IGF-I receptor, IGFBP-1, IGFBP-2, IGFBP-4, IGFBP-5 levels and detected mRNA for IGFBP-3. The expression of IGF-I, IGF-I receptor, and IGFBPs in atherectomy plaques suggests that the development of coronary obstructive lesions may be a result of changes in the IGF system.
Human Freud-2/CC2D1B: a novel repressor of postsynaptic serotonin-1A receptor expression.
Hadjighassem, Mahmoud R; Austin, Mark C; Szewczyk, Bernadeta; Daigle, Mireille; Stockmeier, Craig A; Albert, Paul R
2009-08-01
Altered expression of serotonin-1A (5-HT1A) receptors, both presynaptic in the raphe nuclei and post-synaptic in limbic and cortical target areas, has been implicated in mood disorders such as major depression and anxiety. Within the 5-HT1A receptor gene, a powerful dual repressor element (DRE) is regulated by two protein complexes: Freud-1/CC2D1A and a second, unknown repressor. Here we identify human Freud-2/CC2D1B, a Freud-1 homologue, as the second repressor. Freud-2 distribution was examined with Northern and Western blot, reverse transcriptase polymerase chain reaction, and immunohistochemistry/immunofluorescence; Freud-2 function was examined by electrophoretic mobility shift, reporter assay, and Western blot. Freud-2 RNA was widely distributed in brain and peripheral tissues. Freud-2 protein was enriched in the nuclear fraction of human prefrontal cortex and hippocampus but was weakly expressed in the dorsal raphe nucleus. Freud-2 immunostaining was co-localized with 5-HT1A receptors, neuronal and glial markers. In prefrontal cortex, Freud-2 was expressed at similar levels in control and depressed male subjects. Recombinant hFreud-2 protein bound specifically to 5' or 3' human DRE adjacent to the Freud-1 site. Human Freud-2 showed strong repressor activity at the human 5-HT1A or heterologous promoter in human HEK-293 5-HT1A-negative cells and neuronal SK-N-SH cells, a model of postsynaptic 5-HT1A receptor-positive cells. Furthermore, small interfering RNA knockdown of endogenous hFreud-2 expression de-repressed 5-HT1A promoter activity and increased levels of 5-HT1A receptor protein in SK-N-SH cells. Human Freud-2 binds to the 5-HT1A DRE and represses the human 5-HT1A receptor gene to regulate its expression in non-serotonergic cells and neurons.
Wiltshire, Rachael; Nelson, Vicky; Kho, Dan Ting; Angel, Catherine E; O'Carroll, Simon J; Graham, E Scott
2016-01-27
Herein we show that S1P rapidly and acutely reduces the focal adhesion strength and barrier tightness of brain endothelial cells. xCELLigence biosensor technology was used to measure focal adhesion, which was reduced by S1P acutely and this response was mediated through both S1P1 and S1P2 receptors. S1P increased secretion of several pro-inflammatory mediators from brain endothelial cells. However, the magnitude of this response was small in comparison to that mediated by TNFα or IL-1β. Furthermore, S1P did not significantly increase cell-surface expression of any key cell adhesion molecules involved in leukocyte recruitment, included ICAM-1 and VCAM-1. Finally, we reveal that S1P acutely and dynamically regulates microvascular endothelial barrier tightness in a manner consistent with regulated rapid opening followed by closing and strengthening of the barrier. We hypothesise that the role of the S1P receptors in this process is not to cause barrier dysfunction, but is related to controlled opening of the endothelial junctions. This was revealed using real-time measurement of barrier integrity using ECIS ZΘ TEER technology and endothelial viability using xCELLigence technology. Finally, we show that these responses do not occur simply though the pharmacology of a single S1P receptor but involves coordinated action of S1P1 and S1P2 receptors.
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
5-HT2A receptor activation is necessary for CO2-induced arousal
Smith, Haleigh R.; MacAskill, Amanda; Richerson, George B.
2015-01-01
Hypercapnia-induced arousal from sleep is an important protective mechanism pertinent to a number of diseases. Most notably among these are the sudden infant death syndrome, obstructive sleep apnea and sudden unexpected death in epilepsy. Serotonin (5-HT) plays a significant role in hypercapnia-induced arousal. The mechanism of 5-HT's role in this protective response is unknown. Here we sought to identify the specific 5-HT receptor subtype(s) involved in this response. Wild-type mice were pretreated with antagonists against 5-HT receptor subtypes, as well as antagonists against adrenergic, cholinergic, histaminergic, dopaminergic, and orexinergic receptors before challenge with inspired CO2 or hypoxia. Antagonists of 5-HT2A receptors dose-dependently blocked CO2-induced arousal. The 5-HT2C receptor antagonist, RS-102221, and the 5-HT1A receptor agonist, 8-OH-DPAT, attenuated but did not completely block CO2-induced arousal. Blockade of non-5-HT receptors did not affect CO2-induced arousal. None of these drugs had any effect on hypoxia-induced arousal. 5-HT2 receptor agonists were given to mice in which 5-HT neurons had been genetically eliminated during embryonic life (Lmx1bf/f/p) and which are known to lack CO2-induced arousal. Application of agonists to 5-HT2A, but not 5-HT2C, receptors, dose-dependently restored CO2-induced arousal in these mice. These data identify the 5-HT2A receptor as an important mediator of CO2-induced arousal and suggest that, while 5-HT neurons can be independently activated to drive CO2-induced arousal, in the absence of 5-HT neurons and endogenous 5-HT, 5-HT receptor activation can act in a permissive fashion to facilitate CO2-induced arousal via another as yet unidentified chemosensor system. PMID:25925320
The role of metabotropic glutamate receptor mGlu5 in control of micturition and bladder nociception.
Hu, Youmin; Dong, Li; Sun, Biying; Guillon, Marlene A; Burbach, Leah R; Nunn, Philip A; Liu, Xingrong; Vilenski, Olga; Ford, Anthony P D W; Zhong, Yu; Rong, Weifang
2009-01-23
In micturition control, the roles of ionotropic glutamate (iGlu) receptors NMDA and AMPA are well established, whereas little is known about the function of metabotropic glutamate (mGlu) receptors. Since antagonists for mGlu5 receptors are efficacious in animal models of inflammatory and neuropathic pain, we examined whether mGlu5 receptors play a role in the voiding reflex and bladder nociception and, if so, via centrally or peripherally localized receptors. The mGlu5 receptor antagonist MPEP dose-dependently increased the micturition threshold (MT) volume in the volume-induced micturition reflex (VIMR) model in anesthetized rats. Following doses of 5.2, 15.5 and 51.7micromol/kg of MPEP (intraduodenal), the MT was increased by 24.7+/-5.0%, 97.2+/-12.5% (P<0.01) and 128.0+/-28.3% (P<0.01) from the baseline, respectively (n=4-5; compared with 0.8+/-9.1% in the vehicle group). Infusing MPEP (0.3, 1mM) directly into the bladder also raised MT. However, the efficacious plasma concentrations of MPEP following intravesical dosing were similar to that after intraduodenal dosing (EC(50) of 0.11 and 0.27microM, respectively, P>0.05). MPEP also dose-dependently attenuated the visceromotor responses (VMR, total number of abdominal EMG spikes during phasic bladder distension) in anesthetized rats. The VMR was decreased to 1332.4+/-353.9 from control of 2886.5+/-692.2 spikes/distension (n=6, P<0.01) following MPEP (10micromol/kg, iv). Utilizing the isolated mouse bladder/pelvic nerve preparation, we found that neither MPEP (up to 3microM) nor MTEP (up to 10microM) affected afferent discharge in response to bladder distension (n=4-6). In contrast, MPEP attenuated the responses of the mesenteric nerves to distension of the mouse jejunum in vitro. These data suggest that mGlu5 receptors play facilitatory roles in the processing of afferent input from the urinary bladder, and that central rather than peripheral mGlu5 receptors appear to be responsible.
Darman, P S; Landis, G C; Smits, J R; Hirning, L D; Gulya, K; Yamamura, H I; Burks, T F; Hruby, V J
1985-03-15
Three new cyclic substance P analogues were prepared to examine the possible role of a pseudocyclic turn structure for receptor recognition. In the guinea pig isolated ileum [Cys5, Cys11]-SP5-11-NH2 and [Cys6, Cys11]-SP5-11-NH2 were inactive at concentrations up to 100 microM, while [Cys5, Cys6, Nle11]-SP was a weak agonist. The order of relative affinities on the rat brain radioreceptor assay was as follows: [Cys5, Cys6, Nle11]-SP greater than [Cys5, Cys11]-SP5-11-NH2 greater than [Cys6, Cys11]-SP5-11-NH2. We interpret these results to indicate that a pseudocyclic structure of the 5-11 sequence may not be an important factor involved in the receptor recognition of substance P.
Jiang, Jun-xia; Zhang, Shui-juan; Xiong, Yao-kang; Jia, Yong-liang; Sun, Yan-hong; Lin, Xi-xi; Shen, Hui-juan; Xie, Qiang-min; Yan, Xiao-feng
2015-01-01
Cytochrome P-450 epoxygenase (EPOX)-derived epoxyeicosatrienoic acids (EETs), 5-lipoxygenase (5-LO), and leukotriene B4 (LTB4), the product of 5-LO, all play a pivotal role in the vascular inflammatory process. We have previously shown that EETs can alleviate oxidized low-density lipoprotein (ox-LDL)-induced endothelial inflammation in primary rat pulmonary artery endothelial cells (RPAECs). Here, we investigated whether ox-LDL can promote LTB4 production through the 5-LO pathway. We further explored how exogenous EETs influence ox-LDL-induced LTB4 production and activity. We found that treatment with ox-LDL increased the production of LTB4 and further led to the expression and release of both monocyte chemoattractant protein-1 (MCP-1/CCL2) and intercellular adhesion molecule-1 (ICAM-1). All of the above ox-LDL-induced changes were attenuated by the presence of 11,12-EET and 14,15-EET, as these molecules inhibited the 5-LO pathway. Furthermore, the LTB4 receptor 1 (BLT1 receptor) antagonist U75302 attenuated ox-LDL-induced ICAM-1 and MCP-1/CCL2 expression and production, whereas LY255283, a LTB4 receptor 2 (BLT2 receptor) antagonist, produced no such effects. Moreover, in RPAECs, we demonstrated that the increased expression of 5-LO and BLT1 following ox-LDL treatment resulted from the activation of nuclear factor-κB (NF-κB) via the p38 mitogen-activated protein kinase (MAPK) pathway. Our results indicated that EETs suppress ox-LDL-induced LTB4 production and subsequent inflammatory responses by downregulating the 5-LO/BLT1 receptor pathway, in which p38 MAPK phosphorylation activates NF-κB. These results suggest that the metabolism of arachidonic acid via the 5-LO and EPOX pathways may present a mutual constraint on the physiological regulation of vascular endothelial cells.
Xiong, Yao-kang; Jia, Yong-liang; Sun, Yan-hong; Lin, Xi-xi; Shen, Hui-juan; Xie, Qiang-min; Yan, Xiao-feng
2015-01-01
Cytochrome P-450 epoxygenase (EPOX)-derived epoxyeicosatrienoic acids (EETs), 5-lipoxygenase (5-LO), and leukotriene B4 (LTB4), the product of 5-LO, all play a pivotal role in the vascular inflammatory process. We have previously shown that EETs can alleviate oxidized low-density lipoprotein (ox-LDL)-induced endothelial inflammation in primary rat pulmonary artery endothelial cells (RPAECs). Here, we investigated whether ox-LDL can promote LTB4 production through the 5-LO pathway. We further explored how exogenous EETs influence ox-LDL-induced LTB4 production and activity. We found that treatment with ox-LDL increased the production of LTB4 and further led to the expression and release of both monocyte chemoattractant protein-1 (MCP-1/CCL2) and intercellular adhesion molecule-1 (ICAM-1). All of the above ox-LDL-induced changes were attenuated by the presence of 11,12-EET and 14,15-EET, as these molecules inhibited the 5-LO pathway. Furthermore, the LTB4 receptor 1 (BLT1 receptor) antagonist U75302 attenuated ox-LDL-induced ICAM-1 and MCP-1/CCL2 expression and production, whereas LY255283, a LTB4 receptor 2 (BLT2 receptor) antagonist, produced no such effects. Moreover, in RPAECs, we demonstrated that the increased expression of 5-LO and BLT1 following ox-LDL treatment resulted from the activation of nuclear factor-κB (NF-κB) via the p38 mitogen-activated protein kinase (MAPK) pathway. Our results indicated that EETs suppress ox-LDL-induced LTB4 production and subsequent inflammatory responses by downregulating the 5-LO/BLT1 receptor pathway, in which p38 MAPK phosphorylation activates NF-κB. These results suggest that the metabolism of arachidonic acid via the 5-LO and EPOX pathways may present a mutual constraint on the physiological regulation of vascular endothelial cells. PMID:26035589
Andó, R D; Méhész, B; Gyires, K; Illes, P; Sperlágh, B
2010-03-01
This study was undertaken to compare the analgesic activity of antagonists acting at P2X1, P2X7, and P2Y12 receptors and agonists acting at P2Y1, P2Y2, P2Y4, and P2Y6 receptors in neuropathic, acute, and inflammatory pain. The effect of the wide spectrum P2 receptor antagonist PPADS, the selective P2X7 receptor antagonist Brilliant Blue G (BBG), the P2X1 receptor antagonist (4,4',4'',4-[carbonylbis(imino-5,1,3-benzenetriyl-bis(carbonylimino))]tetrakis-1,3-benzenedisulfonic acid, octasodium salt (NF449) and (8,8'-[carbonylbis(imino-3,1-phenylenecarbonylimino)]bis-1,3,5-naphthalene-trisulphonic acid, hexasodium salt (NF023), the P2Y12 receptor antagonist (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9-yl)-2-(2,2-dimethyl-propionyloxymethyl)-propylester (MRS2395), the selective P2Y1 receptor agonist ([[(1R,2R,3S,4R,5S)-4-[6-amino-2-(methylthio)-9H-purin-9-yl]-2,3-dihydroxybicyclo[3.1.0]hex-1-yl]methyl] diphosphoric acid mono ester trisodium salt (MRS2365), the P2Y2/P2Y4 agonist uridine-5'-triphosphate (UTP), and the P2Y4/P2Y6 agonist uridine-5'-diphosphate (UDP) were examined on mechanical allodynia in the Seltzer model of neuropathic pain, on acute thermal nociception, and on the inflammatory pain and oedema induced by complete Freund's adjuvant (CFA). MRS2365, MRS2395 and UTP, but not the other compounds, significantly alleviated mechanical allodynia in the neuropathic pain model, with the following rank order of minimal effective dose (mED) values: MRS2365 > MRS2395 > UTP. All compounds had a dose-dependent analgesic action in acute pain except BBG, which elicited hyperalgesia at a single dose. The rank order of mED values in acute pain was the following: MRS2365 > MRS2395 > NF449 > NF023 > UDP = UTP > PPADS. MRS2365 and MRS2395 had a profound, while BBG had a mild effect on inflammatory pain, with a following rank order of mED values: MRS2395 > MRS2365 > BBG. None of the tested compounds had significant action on oedema evoked by intraplantar
A review of granisetron, 5-hydroxytryptamine3 receptor antagonists, and other antiemetics.
Hsu, Eric S
2010-01-01
Nausea and vomiting are 2 of the most upsetting adverse reactions of chemotherapy. Current guidelines propose 5-hydroxytryptamine3 (5-HT3) receptor antagonists as a pharmacologic intervention for acute and delayed nausea and vomiting [chemotherapy-induced nausea and vomiting (CINV)] associated with moderately and highly emetogenic chemotherapy. Meanwhile, both postoperative nausea and vomiting (PONV) and postdischarge nausea and vomiting are challenging situations after surgeries and procedures. Prophylactic and therapeutic combinations of antiemetics are recommended in patients at high risk of suffering from PONV and postdischarge nausea and vomiting. Granisetron (Kytril) is a selective 5-HT3 receptor antagonist that does not induce or inhibit the hepatic cytochrome P-450 system in vitro. There are also 4 other antagonists of 5-HT3 receptor (dolasetron, ondansetron, palonosetron, and tropisetron) being metabolized via the CYP2D6 and are subject to potential genetic polymorphism. The launch of a new class of antiemetics, the substance P/neurokinin1 receptor antagonists, was attributed to the scientific update on the central generator responsible for emesis and role of substance P. There has been mounting interest in exploring integrative medicine, either acupuncture or acustimulation of P6 (Nei-Kuwan), to complement the western medicine for prevention and management of nausea and vomiting. The potential application of cannabinoids, either alone or in combination with other agents of different mechanism, could contribute further to improve outcome in CINV. Implementation of future treatment guidelines for more effective management of CINV and PONV could certainly improve the efficacy and outcome of cancer and postoperative care.
Structure of the CCR5 Chemokine Receptor-HIV Entry Inhibitor Maraviroc Complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Qiuxiang; Zhu, Ya; Li, Jian
2013-10-21
The CCR5 chemokine receptor acts as a co-receptor for HIV-1 viral entry. Here we report the 2.7 angstrom–resolution crystal structure of human CCR5 bound to the marketed HIV drug maraviroc. The structure reveals a ligand-binding site that is distinct from the proposed major recognition sites for chemokines and the viral glycoprotein gp120, providing insights into the mechanism of allosteric inhibition of chemokine signaling and viral entry. A comparison between CCR5 and CXCR4 crystal structures, along with models of co-receptor–gp120-V3 complexes, suggests that different charge distributions and steric hindrances caused by residue substitutions may be major determinants of HIV-1 co-receptor selectivity.more » These high-resolution insights into CCR5 can enable structure-based drug discovery for the treatment of HIV-1 infection.« less
Joo, Jeongmin; Wu, Zhexue; Lee, Boram; Shon, Jong Cheol; Lee, Taeho; Lee, In-Kyu; Sim, Taebo; Kim, Kyung-Hee; Kim, Nam Doo; Kim, Seong Heon; Liu, Kwang-Hyeon
2015-04-01
GSK5182 (4-[(Z)-1-[4-(2-dimethylaminoethyloxy)phenyl]-hydroxy-2-phenylpent-1-enyl]phenol) is a specific inverse agonist for estrogen-related receptor γ, a member of the orphan nuclear receptor family that has important functions in development and homeostasis. This study was performed to elucidate the metabolites of GSK5182 and to characterize the enzymes involved in its metabolism. Incubation of human liver microsomes with GSK5182 in the presence of NADPH resulted in the formation of three metabolites, M1, M2 and M3. M1 and M3 were identified as N-desmethyl-GSK5182 and GSK5182 N-oxide, respectively, on the basis of liquid chromatography-tandem mass spectrometric (LC-MS/MS) analysis. M2 was suggested to be hydroxy-GSK5182 through interpretation of its MS/MS fragmentation pattern. In addition, the specific cytochrome P450 (P450) and flavin-containing monooxygenase (FMO) isoforms responsible for GSK5182 oxidation to the three metabolites were identified using a combination of correlation analysis, chemical inhibition in human liver microsomes and metabolism by expressed recombinant P450 and FMO isoforms. GSK5182 N-demethylation and hydroxylation is mainly mediated by CYP3A4, whereas FMO1 and FMO3 contribute to the formation of GSK5182 N-oxide from GSK5182. The present data will be useful for understanding the pharmacokinetics and drug interactions of GSK5182 in vivo. Copyright © 2014 John Wiley & Sons, Ltd.
Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.
Yu, J C; Pickard, J D; Davenport, A P
1995-11-01
1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okajima, F.; Sho, K.; Kondo, Y.
1988-08-01
Exposure of FRTL-5 thyroid cells to ATP (1 microM to 1 mM) resulted in the stimulation of I- efflux in association with the induction of inositol trisphosphate production and intracellular Ca2+ mobilization. Nonhydrolyzable ATP derivatives, ADP and GTP, were also as effective in magnitude as ATP, whereas neither AMP nor adenosine exerted significant effect on I- efflux, suggesting a P2-purinergic receptor-mediated activation of I- efflux. Treatment of the cells with the islet-activating protein (IAP) pertussis toxin, which ADP-ribosylated a 41,000 mol wt membrane protein, effectively suppressed the phosphoinositide response to ATP in addition to ATP-dependent I- efflux at agonist concentrationsmore » below 10 microM. In contrast, the I- efflux stimulated by TSH, A23187, or phorbol myristate acetate was insusceptible to IAP. The IAP substrate, probably GTP-binding protein, is hence proposed to mediate the activation of P2-purinergic receptor-linked phospholipase-C in FRTL-5 cells. However, the responses to ATP, its nonhydrolyzable derivatives, or ADP at the higher agonist concentrations, especially above 100 microM, were only partially inhibited by IAP, even though the IAP substrate was totally ADP ribosylated by the toxin. The responses to GTP in the whole concentration range tested were not influenced by IAP treatment. Thus, signals arising from the P2-receptor might be transduced to phospholipase-C by two different pathways, i.e. IAP-sensitive and insensitive ones, and result in the stimulation of I- efflux.« less
Koellensperger, Gunda; Daubert, Simon; Erdmann, Ralf; Hann, Stephan; Rottensteiner, Hanspeter
2007-11-01
We determined the zinc binding stoichiometry of peroxisomal RING finger proteins by measuring sulfur/metal ratios using inductively coupled plasma-mass spectrometry coupled to size exclusion chromatography, a strategy that provides a fast and quantitative overview on the binding of metals in proteins. As a quality control, liquid chromatography-electrospray ionisation-time of flight-mass spectrometry was used to measure the molar masses of the intact proteins. The RING fingers of Pex2p, Pex10p, and Pex12p showed a stoichiometry of 2.0, 2.1, and 1.2 mol zinc/mol protein, respectively. Thus, Pex2p and Pex10p possess a typical RING domain with two coordinated zinc atoms, whereas that of Pex12p coordinates only a single zinc atom.
Zylberg, Jacques; Ecke, Denise; Fischer, Bilha; Reiser, Georg
2007-01-01
The P2Y11-R (P2Y11 receptor) is a less explored drug target. We computed an hP2Y11-R (human P2Y11) homology model with two templates, bovine-rhodopsin (2.6 Å resolution; 1 Å=0.1 nm) and a hP2Y1–ATP complex model. The hP2Y11-R model was refined using molecular dynamics calculations and validated by virtual screening methods, with an enrichment factor of 5. Furthermore, mutational analyses of Arg106, Glu186, Arg268, Arg307 and Ala313 confirmed the adequacy of our hP2Y11-R model and the computed ligand recognition mode. The E186A and R268A mutants reduced the potency of ATP by one and three orders of magnitude respectively. The R106A and R307A mutants were functionally inactive. We propose that residues Arg106, Arg268, Arg307 and Glu186 are involved in ionic interactions with the phosphate moiety of ATP. Arg307 is possibly also H-bonded to N6 of ATP via the backbone carbonyl. Activity of ATP at the F109I mutant revealed that the proposed π-stacking of Phe109 with the adenine ring is a minor interaction. The mutation A313N, which is part of a hydrophobic pocket in the vicinity of the ATP C-2 position, partially explains the high activity of 2-MeS-ATP at P2Y1-R as compared with the negligible activity at the P2Y11-R. Inactivity of ATP at the Y261A mutant implies that Tyr261 acts as a molecular switch, as in other G-protein-coupled receptors. Moreover, analysis of cAMP responses seen with the mutants showed that the efficacy of coupling of the P2Y11-R with Gs is more variable than coupling with Gq. Our model also indicates that Ser206 forms an H-bond with Pγ (the γ-phosphate of the triphosphate chain of ATP) and Met310 interacts with the adenine moiety. PMID:17338680
Death receptor 3 signaling enhances proliferation of human regulatory T cells.
Bittner, Sebastian; Knoll, Gertrud; Ehrenschwender, Martin
2017-04-01
Exploiting regulatory T cells (Tregs) to control aberrant immune reactions is a promising therapeutic approach, but is hampered by their relative paucity. In mice, activation of death receptor 3 (DR3), a member of the TNF-receptor superfamily (TNFRSF), increases Treg frequency and efficiently controls exuberant immune activation. For human Tregs, neither DR3 expression nor potential functions have been described. Here, we show that human Tregs express DR3 and demonstrate DR3-mediated activation of p38, ERK, and NFκB. DR3 stimulation enhances Treg expansion ex vivo while retaining their suppressive capacity. In summary, our results establish a functional role for DR3 signaling in human Tregs and could potentially help to tailor Treg-based therapies. © 2017 Federation of European Biochemical Societies.
Morgan, Drake; Felsing, Daniel; Kondabolu, Krishnakanth; Rowland, Neil E.; Robertson, Kimberly L.; Sakhuja, Rajeev; Booth, Raymond G.
2014-01-01
Development of 5-HT2C agonists for treatment of neuropsychiatric disorders, including psychoses, substance abuse, and obesity, has been fraught with difficulties, because the vast majority of reported 5-HT2C selective agonists also activate 5-HT2A and/or 5-HT2B receptors, potentially causing hallucinations and/or cardiac valvulopathy. Herein is described a novel, potent, and efficacious human 5-HT2C receptor agonist, (−)-trans-(2S,4R)-4-(3′[meta]-bromophenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine (−)-MBP), that is a competitive antagonist and inverse agonist at human 5-HT2A and 5-HT2B receptors, respectively. (−)-MBP has efficacy comparable to the prototypical second-generation antipsychotic drug clozapine in three C57Bl/6 mouse models of drug-induced psychoses: the head-twitch response elicited by [2,5]-dimethoxy-4-iodoamphetamine; hyperlocomotion induced by MK-801 [(5R,10S)-(+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine hydrogen maleate (dizocilpine maleate)]; and hyperlocomotion induced by amphetamine. (−)-MBP, however, does not alter locomotion when administered alone, distinguishing it from clozapine, which suppresses locomotion. Finally, consumption of highly palatable food by mice was not increased by (−)-MBP at a dose that produced at least 50% maximal efficacy in the psychoses models. Compared with (−)-MBP, the enantiomer (+)-MBP was much less active across in vitro affinity and functional assays using mouse and human receptors and also translated in vivo with comparably lower potency and efficacy. Results indicate a 5-HT2C receptor-specific agonist, such as (−)-MBP, may be pharmacotherapeutic for psychoses, without liability for obesity, hallucinations, heart disease, sedation, or motoric disorders. PMID:24563531
Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R
2017-04-01
Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.
Rafehi, Muhammad; Burbiel, Joachim C; Attah, Isaac Y; Abdelrahman, Aliaa; Müller, Christa E
2017-03-01
The G q protein-coupled, ATP- and UTP-activated P2Y 2 receptor is a potential drug target for a range of different disorders, including tumor metastasis, inflammation, atherosclerosis, kidney disorders, and osteoporosis, but pharmacological studies are impeded by the limited availability of suitable antagonists. One of the most potent and selective antagonists is the thiouracil derivative AR-C118925. However, this compound was until recently not commercially available and little is known about its properties. We therefore developed an improved procedure for the synthesis of AR-C118925 and two derivatives to allow up-scaling and assessed their potency in calcium mobilization assays on the human and rat P2Y 2 receptors recombinantly expressed in 1321N1 astrocytoma cells. The compound was further evaluated for inhibition of P2Y 2 receptor-induced β-arrestin translocation. AR-C118925 behaved as a competitive antagonist with pA 2 values of 37.2 nM (calcium assay) and 51.3 nM (β-arrestin assay). Selectivity was assessed vs. related receptors including P2X, P2Y, and adenosine receptor subtypes, as well as ectonucleotidases. AR-C118925 showed at least 50-fold selectivity against the other investigated targets, except for the P2X1 and P2X3 receptors which were blocked by AR-C118925 at concentrations of about 1 μM. AR-C118925 is soluble in buffer at pH 7.4 (124 μM) and was found to be metabolically highly stable in human and mouse liver microsomes. In Caco2 cell experiments, the compound displayed moderate permeability indicating that it may show limited peroral bioavailability. AR-C118925 appears to be a useful pharmacological tool for in vitro and in vivo studies.
Allosteric modulation of ATP-gated P2X receptor channels
Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo
2013-01-01
Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805
Autoradiography of P2x ATP receptors in the rat brain.
Balcar, V. J.; Li, Y.; Killinger, S.; Bennett, M. R.
1995-01-01
1. Binding of a P2x receptor specific radioligand, [3H]-alpha,beta-methylene adenosine triphosphate ([3H]-alpha,beta-MeATP) to sections of rat brain was reversible and association/dissociation parameters indicated that it consisted of two saturable components. Non-specific binding was very low (< 7% at 10 nM ligand concentration). 2. The binding was completely inhibited by suramin (IC50 approximately 14-26 microM) but none of the ligands specific for P2y receptors such as 2-methylthio-adenosine triphosphate (2-methyl-S-ATP) and 2-chloro-adenosine triphosphate (2-C1-ATP) nor 2-methylthio-adenosine diphosphate (2-methyl-S-ADP) a ligand for the P2 receptor on blood platelets ('P2T' type) produced strong inhibitions except for P1,P4-di(adenosine-5')tetraphosphate (Ap4A). 3. Inhibitors of Na+,K(+)-dependent adenosine triphosphatase (ATPase) ouabain, P1-ligand adenosine and an inhibitor of transport of, respectively, adenosine and cyclic nucleotides, dilazep, had no effect. 4. The highest density of P2x binding sites was found to be in the cerebellar cortex but the binding sites were present in all major brain regions, especially in areas known to receive strong excitatory innervation. Images Figure 2 PMID:7670731
Opiate receptor blockade on human granulosa cells inhibits VEGF release.
Lunger, Fabian; Vehmas, Anni P; Fürnrohr, Barbara G; Sopper, Sieghart; Wildt, Ludwig; Seeber, Beata
2016-03-01
The objectives of this study were to determine whether the main opioid receptor (OPRM1) is present on human granulosa cells and if exogenous opiates and their antagonists can influence granulosa cell vascular endothelial growth factor (VEGF) production via OPRM1. Granulosa cells were isolated from women undergoing oocyte retrieval for IVF. Complementary to the primary cells, experiments were conducted using COV434, a well-characterized human granulosa cell line. Identification and localization of opiate receptor subtypes was carried out using Western blot and flow cytometry. The effect of opiate antagonist on granulosa cell VEGF secretion was assessed by enzyme-linked immunosorbent assay. For the first time, the presence of OPRM1 on human granulosa cells is reported. Blocking of opiate signalling using naloxone, a specific OPRM1 antagonist, significantly reduced granulosa cell-derived VEGF levels in both COV434 and granulosa-luteal cells (P < 0.01). The presence of opiate receptors and opiate signalling in granulosa cells suggest a possible role in VEGF production. Targeting this signalling pathway could prove promising as a new clinical option in the prevention and treatment of ovarian hyperstimulation syndrome. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
ATAR, a novel tumor necrosis factor receptor family member, signals through TRAF2 and TRAF5.
Hsu, H; Solovyev, I; Colombero, A; Elliott, R; Kelley, M; Boyle, W J
1997-05-23
Members of tumor necrosis factor receptor (TNFR) family signal largely through interactions with death domain proteins and TRAF proteins. Here we report the identification of a novel TNFR family member ATAR. Human and mouse ATAR contain 283 and 276 amino acids, respectively, making them the shortest known members of the TNFR superfamily. The receptor is expressed mainly in spleen, thymus, bone marrow, lung, and small intestine. The intracellular domains of human and mouse ATAR share only 25% identity, yet both interact with TRAF5 and TRAF2. This TRAF interaction domain resides at the C-terminal 20 amino acids. Like most other TRAF-interacting receptors, overexpression of ATAR activates the transcription factor NF-kappaB. Co-expression of ATAR with TRAF5, but not TRAF2, results in synergistic activation of NF-kappaB, suggesting potentially different roles for TRAF2 and TRAF5 in post-receptor signaling.
Hay, Colin W; Shanley, Lynne; Davidson, Scott; Cowie, Philip; Lear, Marissa; McGuffin, Peter; Riedel, Gernot; McEwan, Iain J; MacKenzie, Alasdair
2014-09-01
Expression or introduction of the neuropeptide substance-P (SP; encoded by the TAC1 gene in humans and Tac1 in rodents) in the amygdala induces anxiety related behaviour in rodents. In addition, pharmacological antagonism of the main receptor of SP in humans; NK1, is anxiolytic. In the current study, we show that the Tac1 locus is up-regulated in primary rat amygdala neurones in response to activation of the glucocorticoid receptor (GR); a classic component of the stress response. Using a combination of bioinformatics, electrophoretic mobility shift assays (EMSA) and reporter plasmid magnetofection into rat primary amygdala neurones we identified a highly conserved GR response sequence (2GR) in the human TAC1 promoter that binds GR in response to dexamethasone (Dex) or forskolin. We also identified a second GR binding site in the human promoter that was polymorphic and whose T-allele is only found in Japanese and Chinese populations. We present evidence that the T-allele of SNPGR increases the activity of the TAC1 promoter through de-sequestration or de-repression of 2GR. The identification of Dex/forskolin response elements in the TAC1 promoter in amygdala neurones suggests a possible link in the chain of molecular events connecting GR activation and anxiety. In addition, the discovery of a SNP which can alter this response may have implications for our understanding of the role of regulatory variation in susceptibility to stress in specific populations. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Expression and function of 5-HT4 receptors in the mouse enteric nervous system.
Liu, Mintsai; Geddis, Matthew S; Wen, Ying; Setlik, Wanda; Gershon, Michael D
2005-12-01
The aim of the current study was to identify enteric 5-HT(4) splice variants, locate enteric 5-HT(4) receptors, determine the relationship, if any, of the 5-HT(4) receptor to 5-HT(1P) activity, and to ascertain the function of 5-HT(4) receptors in enteric neurophysiology. 5-HT(4a), 5-HT(4b), 5-HT(4e), and 5-HT(4f) isoforms were found in mouse brain and gut. The ratio of 5-HT(4) expression to that of the neural marker, synaptophysin, was higher in gut than in brain but was similar in small and large intestines. Submucosal 5-HT(4) expression was higher than myenteric. Although transcripts encoding 5-HT(4a) and 5-HT(4b) isoforms were more abundant, those encoding 5-HT(4e) and 5-HT(4f) were myenteric plexus specific. In situ hybridization revealed the presence of transcripts encoding 5-HT(4) receptors in subsets of enteric neurons, interstitial cells of Cajal, and smooth muscle cells. IgY antibodies to mouse 5-HT(4) receptors were raised, affinity purified, and characterized. Nerve fibers in the circular muscle and the neuropil in ganglia of both plexuses were highly 5-HT(4) immunoreactive, although only a small subset of neurons contained 5-HT(4) immunoreactivity. No 5-HT(4)-immunoreactive nerves were detected in the mucosa. 5-HT and 5-HT(1P) agonists evoked a G protein-mediated long-lasting inward current that was neither mimicked by 5-HT(4) agonists nor blocked by 5-HT(4) antagonists. In contrast, the 5-HT(4) agonists renzapride and tegaserod increased the amplitudes of nicotinic evoked excitatory postsynaptic currents. Enteric neuronal 5-HT(4) receptors thus are presynaptic and probably exert their prokinetic effects by strengthening excitatory neurotransmission.
Newman-Tancredi, A; Verrièle, L; Touzard, M; Millan, M J
2001-10-05
5-HT(1A) receptors are implicated in the aetiology of schizophrenia. Herein, the influence of 15 antipsychotics on the binding of the selective 'neutral' antagonist, [3H]WAY100,635 ([3H]N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-(2-pyridinyl)-cyclo-hexanecarboxamide), was examined at human 5-HT(1A) receptors expressed in Chinese Hamster Ovary cells. In competition binding experiments, 5-HT displayed biphasic isotherms which were shifted to the right in the presence of the G-protein uncoupling agent, GTPgammaS (100 microM). In analogy, the isotherms of ziprasidone, quetiapine and S16924 (((R-2-[1-[2-(2,3-dihydro-benzo[1,4]dioxin-5-yloxy)-ethyl]-pyrrolidin-3yl]-1-(4-fluoro-phenyl)-ethanone), were displaced to the right by GTPgammaS, consistent with agonist actions. Binding of several other antipsychotics, such as ocaperidone, olanzapine and risperidone, was little influenced by GTPgammaS. Isotherms of the neuroleptics, haloperidol, chlorpromazine and thioridazine were shifted to the left in the presence of GTPgammaS, suggesting inverse agonist properties. For most ligands, the magnitude of affinity changes induced by GTPgammaS (alteration in pK(i) values) correlated well with their previously determined efficacies in [35S]GTPgammaS binding studies [Eur. J. Pharmacol. 355 (1998) 245]. In contrast, the affinity of the 'atypical' antipsychotic agent, clozapine, which is a known partial agonist at 5-HT(1A) receptors, was less influenced by GTPgammaS. When the ratio of high-/low-affinity values was plotted against efficacy, hyperbolic isotherms were obtained, consistent with a modified ternary complex model which assumes that receptors can adopt active conformations in the absence of agonist. In conclusion, modulation of [3H]-WAY100,635 binding by GTPgammaS differentiated agonist vs. inverse agonist properties of antipsychotics at 5-HT(1A) receptors. These may contribute to differing profiles of antipsychotic activity.
The P2X4 purinergic receptor regulates hepatic myofibroblast activation during liver fibrogenesis.
Le Guilcher, Camille; Garcin, Isabelle; Dellis, Olivier; Cauchois, Florent; Tebbi, Ali; Doignon, Isabelle; Guettier, Catherine; Julien, Boris; Tordjmann, Thierry
2018-05-23
Liver fibrosis is characterized by the accumulation of extracellular matrix produced by hepatic myofibroblasts (hMF), the activation of which is critical to the fibrogenic process. Extracellular adenosine triphosphate, released by dying or stressed cells, and its purinergic receptors, constitute a powerful signaling network after injury. Although the P2X4 purinergic receptor (P2X4) is highly expressed in the liver, its functions in hMF had never been investigated during liver fibrogenesis. In vivo, bile duct ligation (BDL) and methionine- and choline-deficient (MCD) diet were performed in WT and P2X4 knock-out (P2X4-KO) mice. In vitro, hMF were isolated from mouse (WT and P2X4-KO) and human liver. P2X4 pharmacological inhibition (in vitro and in vivo) and P2X4 siRNAs (in vitro) were used. Histological, biochemical and cell culture analysis allowed us to study P2X4 expression and its involvement in the regulation of fibrogenic and fibrolytic factors, as well as of hMF activation markers and properties. P2X4 genetic invalidation or pharmacological inhibition protected mice from liver fibrosis and hMF accumulation after BDL or MCD diet. Human and mouse hMF expressed P2X4, mainly in lysosomes. Invalidation of P2X4 in human and mouse hMF blunted their activation marker expression and their fibrogenic properties. We finally showed that P2X4 regulates calcium entry and lysosomal exocytosis in hMF, with impact on ATP release, pro-fibrogenic secretory profile, and on transcription factor activation. P2X4 expression and activation is critical for hMF to sustain their activated and fibrogenic phenotype. Therefore, the inactivation of P2X4 may be of therapeutic interest during liver fibrotic diseases. During chronic injury, the liver often repairs with fibrotic tissue for which there is currently no treatment. We found that a previously unexplored pathway involving the purinergic receptor "P2X4", can modulate fibrotic liver repair, and could be considered for future
NASA Astrophysics Data System (ADS)
Keith, D.; Dykema, J. A.; Keutsch, F. N.
2017-12-01
Stratospheric Controlled Perturbation Experiment (SCoPEx), is a scientific experiment to advance understanding of stratospheric aerosols. It aims to make quantitative measurements of aerosol microphysics and atmospheric chemistry to improve large-scale models used to assess the risks and benefits of solar geoengineering. A perturbative experiment requires: (a) means to create a well-mixed, small perturbed volume, and (b) observation of time evolution of chemistry and aerosols in the volume. SCoPEx will used a propelled balloon gondola containing all instruments and drive system. The propeller wake forms a well-mixed volume (roughly 1 km long and 100 meters in diameter) that serves as an experimental `beaker' into which aerosols (e.g., < 1 kg of 0.3 µm radius CaCO3 particles) at can be injected; while, the propellers allow the gondola to move at speeds up to 3 m/sec relative to the local air mass driving the gondola back forth through the volume to measure properties of the perturbed air mass. This presentation will provide an overview of the experiment including (a) a systems engineering perspective from high-level scientific questions through instrument selection, mission design, and proposed operations and data analysis; (b) instruments, include current status of integration testing; (c) payload engineering including structure, power and mass budget, etc; (d) results from CFD simulation of propeller wake and simulation of chemistry and aerosol microphysics; and finally (e) proposed concept of operations and schedule. We will also provide an overview of the plans for governance including management of health safety and environmental risks, transparency, public engagement, and larger questions about governance of solar geoengineering experiments. Finally, we will briefly present results of laboratory experiments of the interaction of chemical such as ClONO2 and HCl on particle surfaces relevant for stratospheric solar geoengineering.
Human eosinophils - potential pharmacological model applied in human histamine H4 receptor research.
Grosicki, Marek; Kieć-Kononowicz, Katarzyna
2015-01-01
Histamine and histamine receptors are well known for their immunomodulatory role in inflammation. In this review we describe the role of histamine and histamine H4 receptor on human eosinophils. In the first part of article we provide short summary of histamine and histamine receptors role in physiology and histamine related therapeutics used in clinics. We briefly describe the human histamine receptor H4 and its ligands, as well as human eosinophils. In the second part of the review we provide detailed description of known histamine effects on eosinophils including: intracellular calcium concentration flux, actin polymerization, cellular shape change, upregulation of adhesion proteins and cellular chemotaxis. We provide proofs that these effects are mainly connected with the activation of histamine H4 receptor. When examining experimental data we discuss the controversial results and limitations of the studies performed on isolated eosinophils. In conclusion we believe that studies on histamine H4 receptor on human eosinophils can provide interesting new biomarkers that can be used in clinical studies of histamine receptors, that in future might result in the development of new strategies in the treatment of chronic inflammatory conditions like asthma or allergy, in which eosinophils are involved.
Expression profiling of G-protein-coupled receptors in human urothelium and related cell lines.
Ochodnický, Peter; Humphreys, Sian; Eccles, Rachel; Poljakovic, Mirjana; Wiklund, Peter; Michel, Martin C
2012-09-01
What's known on the subject? and What does the study add? Urothelium emerged as a crucial integrator of sensory inputs and outputs in the bladder wall, and urothelial G-protein-coupled receptors (GPCRs) may represent plausible targets for treatment of various bladder pathologies. Urothelial cell lines provide a useful tool to study urothelial receptor function, but their validity as models for native human urothelium remains unclear. We characterize the mRNA expression of genes coding for GPCRs in human freshly isolated urothelium and compare the expression pattern with those in human urothelial cell lines. To characterize the mRNA expression pattern of genes coding for G-protein-coupled receptors (GPCRs) in human freshly isolated urothelium. To compare GPCR expression in human urothelium-derived cell lines to explore the suitability of these cell lines as model systems to study urothelial function. Native human urothelium (commercially sourced) and human urothelium-derived non-cancer (UROtsa and TERT-NHUC) and cancer (J82) cell lines were used. For mRNA expression profiling we used custom-designed real-time polymerase chain reaction array for 40 receptors and several related genes. Native urothelium expressed a wide variety of GPCRs, including α(1A), α(1D) and all subtypes of α(2) and β adrenoceptors. In addition, M(2) and M(3) cholinergic muscarinic receptors, angiotensin II AT(1) receptor, serotonin 5-HT(2A) receptor and all subtypes of bradykinin, endothelin, cannabinoid, tachykinin and sphingosine-1-phosphate receptors were detected. Nerve growth factor and both its low- and high-affinity receptors were also expressed in urothelium. In all cell lines expression of most GPCRs was markedly downregulated, with few exceptions. In UROtsa cells, but much less in other cell lines, the expression of β(2) adrenoceptors, M(3) muscarinic receptors, B(1) and B(2) bradykinin receptors, ET(B) endothelin receptors and several subtypes of sphingosine-1-phosphate
Smith, Stephanie MC; Mitchell, Gordon S; Friedle, Scott A; Sibigtroth, Christine M; Vinit, Stéphane; Watters, Jyoti J
2013-01-01
Hypoxia and increased extracellular nucleotides are frequently coincident in the brainstem. Extracellular nucleotides are potent modulators of microglial inflammatory gene expression via P2X purinergic receptor activation. Although hypoxia is also known to modulate inflammatory gene expression, little is known about how hypoxia or P2X receptor activation alone affects inflammatory molecule production in brainstem microglia, nor how hypoxia and P2X receptor signaling interact when they occur together. In the study reported here, we investigated the ability of a brief episode of hypoxia (2 hours) in the presence and absence of the nonselective P2X receptor agonist 2′(3′)-O-(4-benzoylbenzoyl)adenosine-5′-triphosphate (BzATP) to promote inflammatory gene expression in brainstem microglia in adult rats. We evaluated inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNFα), and interleukin (IL)-6 messenger RNA levels in immunomagnetically isolated brainstem microglia. While iNOS and IL-6 gene expression increased with hypoxia and BzATP alone, TNFα expression was unaffected. Surprisingly, BzATP-induced inflammatory effects were lost after hypoxia, suggesting that hypoxia impairs proinflammatory P2X-receptor signaling. We also evaluated the expression of key P2X receptors activated by BzATP, namely P2X1, P2X4, and P2X7. While hypoxia did not alter their expression, BzATP upregulated P2X4 and P2X7 mRNAs; these effects were ablated in hypoxia. Although both P2X4 and P2X7 receptor expression correlated with increased microglial iNOS and IL-6 levels in microglia from normoxic rats, in hypoxia, P2X7 only correlated with IL-6, and P2X4 correlated only with iNOS. In addition, correlations between P2X7 and P2X4 were lost following hypoxia, suggesting that P2X4 and P2X7 receptor signaling differs in normoxia and hypoxia. Together, these data suggest that hypoxia suppresses P2X receptor-induced inflammatory gene expression, indicating a potentially
Molecular mechanisms of platelet P2Y(12) receptor regulation.
Cunningham, Margaret R; Nisar, Shaista P; Mundell, Stuart J
2013-02-01
Platelets are critical for haemostasis, however inappropriate activation can lead to the development of arterial thrombosis, which can result in heart attack and stroke. ADP is a key platelet agonist that exerts its actions via stimulation of two surface GPCRs (G-protein-coupled receptors), P2Y(1) and P2Y(12). Similar to most GPCRs, P2Y receptor activity is tightly regulated by a number of complex mechanisms including receptor desensitization, internalization and recycling. In the present article, we review the molecular mechanisms that underlie P2Y(1) and P2Y(12) receptor regulation, with particular emphasis on the structural motifs within the P2Y(12) receptor, which are required to maintain regulatory protein interaction. The implications of these findings for platelet responsiveness are also discussed.
Clemons, B; Brooks, J; Brahmachary, E; Powell, R; Dedman, H; Desale, H G; Timony, G A; Martinborough, E; Rosen, H; Roberts, E; Boehm, M F; Peach, R J
2016-01-01
Background and Purpose Sphingosine1‐phosphate (S1P) receptors mediate multiple events including lymphocyte trafficking, cardiac function, and endothelial barrier integrity. Stimulation of S1P1 receptors sequesters lymphocyte subsets in peripheral lymphoid organs, preventing their trafficking to inflamed tissue sites, modulating immunity. Targeting S1P receptors for treating autoimmune disease has been established in clinical studies with the non‐selective S1P modulator, FTY720 (fingolimod, Gilenya™). The purpose of this study was to assess RPC1063 for its therapeutic utility in autoimmune diseases. Experimental Approach The specificity and potency of RPC1063 (ozanimod) was evaluated for all five S1P receptors, and its effect on cell surface S1P1 receptor expression, was characterized in vitro. The oral pharmacokinetic (PK) parameters and pharmacodynamic effects were established in rodents, and its activity in three models of autoimmune disease (experimental autoimmune encephalitis, 2,4,6‐trinitrobenzenesulfonic acid colitis and CD4+CD45RBhi T cell adoptive transfer colitis) was assessed. Key Results RPC1063 was specific for S1P1 and S1P5 receptors, induced S1P1 receptor internalization and induced a reversible reduction in circulating B and CCR7+ T lymphocytes in vivo. RPC1063 showed high oral bioavailability and volume of distribution, and a circulatory half‐life that supports once daily dosing. Oral RPC1063 reduced inflammation and disease parameters in all three autoimmune disease models. Conclusions and Implications S1P receptor selectivity, favourable PK properties and efficacy in three distinct disease models supports the clinical development of RPC1063 for the treatment of relapsing multiple sclerosis and inflammatory bowel disease, differentiates RPC1063 from other S1P receptor agonists, and could result in improved safety outcomes in the clinic. PMID:26990079
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lv, Jianwei; Tianjin Institute of Orthopedics in Traditional Chinese and Western Medicine, No. 155, Munan Road, Tianjin 300050; Sun, Xiaolei
2015-08-14
Schwann cells (SCs) play an essentially supportive role in the regeneration of injured peripheral nerve system (PNS). As Netrin-1 is crucial for the normal development of nervous system (NS) and can direct the process of damaged PNS regeneration, our study was designed to determine the role of Netrin-1 in RSC96 Schwann cells (an immortalized rat Schwann cell line) proliferation and migration. Our studies demonstrated that Netrin-1 had no effect on RSC96 cells proliferation, while significantly promoted RSC96 cells migration. The Netrin-1-induced RSC96 cells migration was significantly attenuated by inhibition of p38 and PI3K through pretreatment with SB203580 and LY294002 respectively,more » but not inhibition of MEK1/2 and JNK by U0126-EtOH and SP600125 individually. Treatment with Netrin-1 enhanced the phosphorylation of p38 and Akt. QRT-PCR indicated that Netrin-1 and only its receptors Unc5a, Unc5b and Neogenin were expressed in RSC96 cells, among which Unc5b expressed the most. And UNC5B protein was significantly increased after stimulated by Netrin-1. In conclusion, we show here that Netrin-1-enhanced SCs migration is mediated by activating p38 MAPK and PI3K-Akt signal cascades via receptor UNC5B, which suggests that Netrin-1 could serve as a new therapeutic strategy and has potential application value for PNS regeneration. - Highlights: • Netrin-1 attracts RSC96 Schwann cells migration in a dose dependent manner. • Netrin-1 induced Schwann cells migration is p38 and PI3K-Akt signaling dependent. • UNC5B may be dominant receptor mediating Netrin-1′ effect on RSC96 cells motility. • Netrin-1 may promote peripheral nerve repair by enhancing Schwann cells motility.« less
P2X7 receptor antagonism: Implications in diabetic retinopathy.
Platania, Chiara Bianca Maria; Giurdanella, Giovanni; Di Paola, Luisa; Leggio, Gian Marco; Drago, Filippo; Salomone, Salvatore; Bucolo, Claudio
2017-08-15
Diabetic retinopathy (DR) is the most frequent complication of diabetes and one of leading causes of blindness worldwide. Early phases of DR are characterized by retinal pericyte loss mainly related to concurrent inflammatory process. Recently, an important link between P2X7 receptor (P2X7R) and inflammation has been demonstrated indicating this receptor as potential pharmacological target in DR. Here we first carried out an in silico molecular modeling study in order to characterize the allosteric pocket in P2X7R, and identify a suitable P2X7R antagonist through molecular docking. JNJ47965567 was identified as the hit compound in docking calculations, as well as for its absorption, distribution, metabolism and excretion (ADME) profile. As an in vitro model of early diabetic retinopathy, human retinal pericytes were exposed to high glucose (25mM, 48h) that caused a significant (p<0.05) release of IL-1β and LDH. The block of P2X7R by JNJ47965567 significantly (p<0.05) reverted the damage elicited by high glucose, detected as IL-1β and LDH release. Overall, our findings suggest that the P2X7R represents an attractive pharmacological target to manage the early phase of diabetic retinopathy, and the compound JNJ47965567 is a good template to discover other P2X7R selective antagonists. Copyright © 2017 Elsevier Inc. All rights reserved.
Farb, Thomas B; Adeva, Marta; Beauchamp, Thomas J; Cabrera, Over; Coates, David A; Meredith, Tamika DeShea; Droz, Brian A; Efanov, Alexander; Ficorilli, James V; Gackenheimer, Susan L; Martinez-Grau, Maria A; Molero, Victoriano; Ruano, Gema; Statnick, Michael A; Suter, Todd M; Syed, Samreen K; Toledo, Miguel A; Willard, Francis S; Zhou, Xin; Bokvist, Krister B; Barrett, David G
2017-11-01
Incretin and insulin responses to nutrient loads are suppressed in persons with diabetes, resulting in decreased glycemic control. Agents including sulfonylureas and dipeptidyl peptidase-4 inhibitors (DPP4i) partially reverse these effects and provide therapeutic benefit; however, their modes of action limit efficacy. Because somatostatin (SST) has been shown to suppress insulin and glucagonlike peptide-1 (GLP-1) secretion through the Gi-coupled SST receptor 5 (SSTR5) isoform in vitro, antagonism of SSTR5 may improve glycemic control via intervention in both pathways. Here, we show that a potent and selective SSTR5 antagonist reverses the blunting effects of SST on insulin secretion from isolated human islets, and demonstrate that SSTR5 antagonism affords increased levels of systemic GLP-1 in vivo. Knocking out Sstr5 in mice provided a similar increase in systemic GLP-1 levels, which were not increased further by treatment with the antagonist. Treatment of mice with the SSTR5 antagonist in combination with a DPP4i resulted in increases in systemic GLP-1 levels that were more than additive and resulted in greater glycemic control compared with either agent alone. In isolated human islets, the SSTR5 antagonist completely reversed the inhibitory effect of exogenous SST-14 on insulin secretion. Taken together, these data suggest that SSTR5 antagonism should increase circulating GLP-1 levels and stimulate insulin secretion (directly and via GLP-1) in humans, improving glycemic control in patients with diabetes. Copyright © 2017 Endocrine Society.
Andó, RD; Méhész, B; Gyires, K; Illes, P; Sperlágh, B
2010-01-01
Background and purpose: This study was undertaken to compare the analgesic activity of antagonists acting at P2X1, P2X7, and P2Y12 receptors and agonists acting at P2Y1, P2Y2, P2Y4, and P2Y6 receptors in neuropathic, acute, and inflammatory pain. Experimental approach: The effect of the wide spectrum P2 receptor antagonist PPADS, the selective P2X7 receptor antagonist Brilliant Blue G (BBG), the P2X1 receptor antagonist (4,4′,4″,4-[carbonylbis(imino-5,1,3-benzenetriyl-bis(carbonylimino))]tetrakis-1,3-benzenedisulfonic acid, octasodium salt (NF449) and (8,8′-[carbonylbis(imino-3,1-phenylenecarbonylimino)]bis-1,3,5-naphthalene-trisulphonic acid, hexasodium salt (NF023), the P2Y12 receptor antagonist (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9-yl)-2-(2,2-dimethyl-propionyloxymethyl)-propylester (MRS2395), the selective P2Y1 receptor agonist ([[(1R,2R,3S,4R,5S)-4-[6-amino-2-(methylthio)-9H-purin-9-yl]-2,3-dihydroxybicyclo[3.1.0]hex-1-yl]methyl] diphosphoric acid mono ester trisodium salt (MRS2365), the P2Y2/P2Y4 agonist uridine-5′-triphosphate (UTP), and the P2Y4/P2Y6 agonist uridine-5′-diphosphate (UDP) were examined on mechanical allodynia in the Seltzer model of neuropathic pain, on acute thermal nociception, and on the inflammatory pain and oedema induced by complete Freund's adjuvant (CFA). Key results: MRS2365, MRS2395 and UTP, but not the other compounds, significantly alleviated mechanical allodynia in the neuropathic pain model, with the following rank order of minimal effective dose (mED) values: MRS2365 > MRS2395 > UTP. All compounds had a dose-dependent analgesic action in acute pain except BBG, which elicited hyperalgesia at a single dose. The rank order of mED values in acute pain was the following: MRS2365 > MRS2395 > NF449 > NF023 > UDP = UTP > PPADS. MRS2365 and MRS2395 had a profound, while BBG had a mild effect on inflammatory pain, with a following rank order of mED values: MRS2395 > MRS2365 > BBG. None of the tested
Strong, Paul V; Greenwood, Benjamin N; Fleshner, Monika
2009-05-01
Rats exposed to an uncontrollable stressor demonstrate a constellation of behaviors such as exaggerated freezing and deficits in shuttle box escape learning. These behaviors in rats have been called learned helplessness and have been argued to model human stress-related mood disorders. Learned helplessness is thought to be caused by hyperactivation of serotonin (5-HT) neurons in the dorsal raphe nucleus (DRN) and a subsequent exaggerated release of 5-HT in DRN projection sites. Blocking 5-HT(2C) receptors in the face of an increase in serotonin can alleviate anxiety behaviors in some animal models. However, specific 5-HT receptor subtypes involved in learned helplessness remain unknown. The current experiments tested the hypothesis that 5-HT(2C) receptor activation is necessary and sufficient for the expression of learned helplessness. The selective 5-HT(2C) receptor antagonist SB 242084 (1.0 mg/kg) administered i.p. to adult male Fischer 344 rats prior to shuttle box behavioral testing, but not before stress, blocked stress-induced deficits in escape learning but had no effect on the exaggerated shock-elicited freezing. The selective 5-HT(2C) receptor agonist CP-809101 was sufficient to produce learned helplessness-like behaviors in the absence of prior stress and these effects were blocked by pretreatment with SB 242084. Results implicate the 5-HT(2C) receptor subtype in mediating the shuttle box escape deficits produced by exposure to uncontrollable stress and suggest that different postsynaptic 5-HT receptor subtypes underlie the different learned helplessness behaviors.
NASA Astrophysics Data System (ADS)
Werrlein, Robert J.; Braue, Catherine R.
2004-06-01
Sulfur mustard (SM; bis(2-chloroethyl) sulfide) is a chemical warfare agent that produces persistent, incapacitating blisters of the skin. The lesions inducing vesication remain elusive, and there is no completely effective treatment. Using mulitphoton microscopy and immunofluorescent staining, we found that exposing human epidermal keratinocytes (HEK) and intact epidermis to SM (400 μm for 5 min) caused progressive collapse of the keratin (K5/K14) cytoskeleton and depletion of α6β integrins. We now report that SM causes concomitant disruption nad collapse of the basal cell's α3β1-integrin receptors. At 1 h postexposure, images of Alexa488-conjugated HEK/α3β1 integrins showed almost complete withdrawal and disappearance of retraction fibers and a progressive loss of polarized mobility. With stero imaging, in vitro expression of this SM effect was characterized by collapse and abutment of adjacent cell membranes. At 2 h postexposure, there was an average 13% dorso-ventral collapse of HEK membranes that paralleled progressive collapse of the K5/K14 cytoskeleton. α3β1 integrin, like α6β4 integrin, is a regulator of cytoskeletal assembly, a receptor for laminin 5 and a mediator of HEK attachment to the basement membrane. Our images indicate that SM disrupts these receptors. We suggest that the progressive disruption destabilizes and potentiates blistering of the epidermal-dermal junction.
Knocking out P2X receptors reduces transmitter secretion in taste buds.
Huang, Yijen A; Stone, Leslie M; Pereira, Elizabeth; Yang, Ruibiao; Kinnamon, John C; Dvoryanchikov, Gennady; Chaudhari, Nirupa; Finger, Thomas E; Kinnamon, Sue C; Roper, Stephen D
2011-09-21
In response to gustatory stimulation, taste bud cells release a transmitter, ATP, that activates P2X2 and P2X3 receptors on gustatory afferent fibers. Taste behavior and gustatory neural responses are largely abolished in mice lacking P2X2 and P2X3 receptors [P2X2 and P2X3 double knock-out (DKO) mice]. The assumption has been that eliminating P2X2 and P2X3 receptors only removes postsynaptic targets but that transmitter secretion in mice is normal. Using functional imaging, ATP biosensor cells, and a cell-free assay for ATP, we tested this assumption. Surprisingly, although gustatory stimulation mobilizes Ca(2+) in taste Receptor (Type II) cells from DKO mice, as from wild-type (WT) mice, taste cells from DKO mice fail to release ATP when stimulated with tastants. ATP release could be elicited by depolarizing DKO Receptor cells with KCl, suggesting that ATP-release machinery remains functional in DKO taste buds. To explore the difference in ATP release across genotypes, we used reverse transcriptase (RT)-PCR, immunostaining, and histochemistry for key proteins underlying ATP secretion and degradation: Pannexin1, TRPM5, and NTPDase2 (ecto-ATPase) are indistinguishable between WT and DKO mice. The ultrastructure of contacts between taste cells and nerve fibers is also normal in the DKO mice. Finally, quantitative RT-PCR show that P2X4 and P2X7, potential modulators of ATP secretion, are similarly expressed in taste buds in WT and DKO taste buds. Importantly, we find that P2X2 is expressed in WT taste buds and appears to function as an autocrine, positive feedback signal to amplify taste-evoked ATP secretion.
Knocking out P2X receptors reduces transmitter secretion in taste buds
Huang, Yijen A.; Stone, Leslie M.; Pereira, Elizabeth; Yang, Ruibiao; Kinnamon, John C.; Dvoryanchikov, Gennady; Chaudhari, Nirupa; Finger, Thomas E.; Kinnamon, Sue C.; Roper, Stephen D.
2011-01-01
In response to gustatory stimulation, taste bud cells release a transmitter, ATP, that activates P2X2 and P2X3 receptors on gustatory afferent fibers. Taste behavior and gustatory neural responses are largely abolished in mice lacking P2X2 and P2X3 receptors (P2X2 and P2X3 double knockout, or “DKO” mice). The assumption has been that eliminating P2X2 and P2X3 receptors only removes postsynaptic targets but that transmitter secretion in mice is normal. Using functional imaging, ATP biosensor cells, and a cell-free assay for ATP, we tested this assumption. Surprisingly, although gustatory stimulation mobilizes Ca2+ in taste Receptor (Type II) cells from DKO mice, as from wild type (WT) mice, taste cells from DKO mice fail to release ATP when stimulated with tastants. ATP release could be elicited by depolarizing DKO Receptor cells with KCl, suggesting that ATP-release machinery remains functional in DKO taste buds. To explore the difference in ATP release across genotypes, we employed reverse transcriptase (RT)-PCR, immunostaining, and histochemistry for key proteins underlying ATP secretion and degradation: Pannexin1, TRPM5, and NTPDase2 (ecto-ATPase) are indistinguishable between WT and DKO mice. The ultrastructure of contacts between taste cells and nerve fibers is also normal in the DKO mice. Finally, quantitative RT-PCR show that P2X4 and P2X7, potential modulators of ATP secretion, are similarly expressed in taste buds in WT and DKO taste buds. Importantly, we find that P2X2 is expressed in WT taste buds and appears to function as an autocrine, positive feedback signal to amplify taste-evoked ATP secretion. PMID:21940456
Rjasanow, Alexandra; Leitner, Michael G.; Thallmair, Veronika; Halaszovich, Christian R.; Oliver, Dominik
2015-01-01
The activity of many proteins depends on the phosphoinositide (PI) content of the membrane. E.g., dynamic changes of the concentration of PI(4,5)P2 are cellular signals that regulate ion channels. The susceptibility of a channel to such dynamics depends on its affinity for PI(4,5)P2. Yet, measuring affinities for endogenous PIs has not been possible directly, but has relied largely on the response to soluble analogs, which may not quantitatively reflect binding to native lipids. Voltage-sensitive phosphatases (VSPs) turn over PI(4,5)P2 to PI(4)P when activated by depolarization. In combination with voltage-clamp electrophysiology VSPs are useful tools for rapid and reversible depletion of PI(4,5)P2. Because cellular PI(4,5)P2 is resynthesized rapidly, steady state PI(4,5)P2 changes with the degree of VSP activation and thus depends on membrane potential. Here we show that titration of endogenous PI(4,5)P2 with Ci-VSP allows for the quantification of relative PI(4,5)P2 affinities of ion channels. The sensitivity of inward rectifier and voltage-gated K+ channels to Ci-VSP allowed for comparison of PI(4,5)P2 affinities within and across channel subfamilies and detected changes of affinity in mutant channels. The results also reveal that VSPs are useful only for PI effectors with high binding specificity among PI isoforms, because PI(4,5)P2 depletion occurs at constant overall PI level. Thus, Kir6.2, a channel activated by PI(4,5)P2 and PI(4)P was insensitive to VSP. Surprisingly, despite comparable PI(4,5)P2 affinity as determined by Ci-VSP, the Kv7 and Kir channel families strongly differed in their sensitivity to receptor-mediated depletion of PI(4,5)P2. While Kv7 members were highly sensitive to activation of PLC by Gq-coupled receptors, Kir channels were insensitive even when PI(4,5)P2 affinity was lowered by mutation. We hypothesize that different channels may be associated with distinct pools of PI(4,5)P2 that differ in their accessibility to PLC and VSPs. PMID
Michelson, David; Hargreaves, Richard; Alexander, Robert; Ceesay, Paulette; Hietala, Jarmo; Lines, Christopher; Reines, Scott
2013-02-01
Preclinical studies suggest that substance P acting at neurokinin 1 (NK1) receptors may be involved in stress responses and NK1 receptor antagonists show activity in tests of anxiety. These data raise the possibility that NK1 receptor antagonists could be potential anxiolytic treatments in humans. We evaluated this hypothesis clinically using the NK1 antagonist L-759274. This is a randomized, double-blind, placebo- and active-controlled, multicentre, proof-of-concept trial. Patients with generalized anxiety disorder were randomized 1:1:1 to 6 wk of treatment with 40 mg L-759274 (n = 73), 1-6 mg lorazepam (n = 69) or placebo (n = 71). Efficacy was assessed using the Hamilton Anxiety Scale (HAMA). A positron emission tomography (PET) study was also performed in 16 healthy subjects to determine the relationship between NK1 receptor occupancy and plasma levels of L-759274 to verify adequate target engagement by the doses tested during the clinical trial. No statistically significant difference in mean change from baseline HAMA score at 6 wk was seen for L-759274 vs. placebo [difference = 1.0 (95% confidence intervals (CI) -1.2 to 3.2), p = 0.359] whereas the lorazepam group did show a significant improvement vs. placebo (difference = -2.7, 95% CI -5.0 to -0.4, p = 0.020) and L-759274 (difference = 3.7, 95% CI 1.5-6.0, p = 0.001]. Results from the PET study indicated that the L-759274 dosing regimen used in the clinical trial likely provided high levels of NK1 receptor occupancy (>90%), supporting the view that it was an adequate proof-of-concept trial. The NK1 receptor antagonist L-759274 does not appear to be efficacious for the treatment of generalized anxiety disorder.
Gross, Kara; Karagiannides, Iordanes; Thomou, Thomas; Koon, Hon Wai; Bowe, Collin; Kim, Ho; Giorgadze, Nino; Tchkonia, Tamara; Pirtskhalava, Tamara; Kirkland, James L; Pothoulakis, Charalabos
2009-05-01
White adipose tissue is intimately involved in the regulation of immunity and inflammation. We reported that human mesenteric preadipocytes express the substance P (SP)-mediated neurokinin-1 receptor (NK-1R), which signals proinflammatory responses. Here we tested the hypothesis that SP promotes proliferation and survival of human mesenteric preadipocytes and investigated responsible mechanism(s). Preadipocytes were isolated from mesenteric fat biopsies during gastric bypass surgery. Proliferative and antiapoptotic responses were delineated in 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS), bromodeoxyuridine (BrdU), caspase-3, and TUNEL assays, as well as Western immunoanalysis. SP (10(-7) M) increased MTS and proliferation (BrdU) and time dependently (15-30 min) induced Akt, EGF receptor, IGF receptor, integrin alphaVbeta3, phosphatidylinositol 3-kinase, and PKC-theta phosphorylation. Furthermore, pharmacological antagonism of Akt and PKC-theta activation significantly attenuated SP-induced preadipocyte proliferation. Exposure of preadipocytes to the proapoptotic Fas ligand (FasL, 100 microM) resulted in nuclear DNA fragmentation (TUNEL assay), as well as increased cleaved poly (ADP-ribose) polymerase, cleaved caspase-7, and caspase-3 expression. Cotreatment with SP almost completely abolished these responses in a NK-1R-dependent fashion. SP (10(-7) M) also time dependently stimulated expression 4E binding protein 1 and phosphorylation of p70 S6 kinase, which increased protein translation efficiency. SP increases preadipocyte viability, reduces apoptosis, and stimulates proliferation, possibly via cell cycle upregulation and increased protein translation efficiency. SP-induced proliferative and antiapoptotic pathways in fat depots may contribute to development of the creeping fat and inflammation characteristic of Crohn's disease.
Sharma, Ashutosh; Kirkpatrick, Gordon; Chen, Virginia; Skolnik, Kate; Hollander, Zsuzsanna; Wilcox, Pearce; Quon, Bradley S
2017-01-01
C-reactive protein (CRP) is a systemic marker of inflammation that correlates with disease status in cystic fibrosis (CF). The clinical utility of CRP measurement to guide pulmonary exacerbation (PEx) treatment decisions remains uncertain. To determine whether monitoring CRP during PEx treatment can be used to predict treatment response. We hypothesized that early changes in CRP can be used to predict treatment response. We reviewed all PEx events requiring hospitalization for intravenous (IV) antibiotics over 2 years at our institution. 83 PEx events met our eligibility criteria. CRP levels from admission to day 5 were evaluated to predict treatment non-response, using a modified version of a prior published composite definition. CRP was also evaluated to predict time until next exacerbation (TUNE). 53% of 83 PEx events were classified as treatment non-response. Paradoxically, 24% of PEx events were characterized by a ≥ 50% increase in CRP levels within the first five days of treatment. Absolute change in CRP from admission to day 5 was not associated with treatment non-response (p = 0.58). Adjusted for FEV1% predicted, admission log10 CRP was associated with treatment non-response (OR: 2.39; 95% CI: 1.14 to 5.91; p = 0.03) and shorter TUNE (HR: 1.60; 95% CI: 1.13 to 2.27; p = 0.008). The area under the receiver operating characteristics (ROC) curve of admission CRP to predict treatment non-response was 0.72 (95% CI 0.61-0.83; p<0.001). 23% of PEx events were characterized by an admission CRP of > 75 mg/L with a specificity of 90% for treatment non-response. Admission CRP predicts treatment non-response and time until next exacerbation. A very elevated admission CRP (>75mg/L) is highly specific for treatment non-response and might be used to target high-risk patients for future interventional studies aimed at improving exacerbation outcomes.
Ohlmann, Philippe; Lecchi, Anna; El-Tayeb, Ali; Müller, Christa E; Cattaneo, Marco; Gachet, Christian
2013-03-01
Various radioligands have been used to characterize and quantify the platelet P2Y(12) receptor, which share several weaknesses: (a) they are metabolically unstable and substrates for ectoenzymes, (b) they are agonists, and (c) they do not discriminate between P2Y(1) and P2Y(12). We used the [(3)H]PSB-0413 selective P2Y(12) receptor antagonist radioligand to reevaluate the number of P2Y(12) receptors in intact platelets and in membrane preparations. Studies in humans showed that: (1) [(3)H]PSB-0413 bound to 425 ± 50 sites/platelet (K (D) = 3.3 ± 0.6 nM), (2) 0.5 ± 0.2 pmol [(3)H]PSB-0413 bound to 1 mg protein of platelet membranes (K (D) = 6.5 ± 3.6 nM), and (3) competition studies confirmed the known features of P2Y(12), with the expected rank order of potency: AR-C69931MX > 2MeSADP ≫ ADPβS > ADP, while the P2Y(1) ligand MRS2179 and the P2X(1) ligand α,β-Met-ATP did not displace [(3)H]PSB-0413 binding. Patients with severe P2Y(12) deficiency displayed virtually no binding of [(3)H]PSB-0413 to intact platelets, while a patient with a dysfunctional P2Y(12) receptor had normal binding. Studies in mice showed that: (1) [(3)H]PSB-0413 bound to 634 ± 87 sites/platelet (K (D) = 14 ± 4.5 nM) and (2) 0.7 pmol ± 0.3 [(3)H]PSB-0413 bound to 1 mg protein of platelet membranes (K (D) = 9.1 ± 5.3 nM). Clopidogrel and other thiol reagents like pCMBS or DTT abolished the binding both to intact platelets and membrane preparations. Therefore, [(3)H]PSB-0413 is an accurate and selective tool for radioligand binding studies aimed at quantifying P2Y(12) receptors, to identify patients with P2Y(12) deficiencies or quantify the effect of P2Y(12) targeting drugs.
Suhara, W; Koide, H; Okuzawa, T; Hayashi, D; Hashimoto, T; Kojo, H
2009-09-01
The nuclear peroxisome proliferator-activated receptors (PPAR) have been shown to play crucial roles in regulating energy homeostasis including lipid and carbohydrate metabolism, inflammatory responses, and cell proliferation, differentiation, and survival. Because PPAR agonists have the potential to prevent or ameliorate diseases such as hyperlipidemia, diabetes, atherosclerosis, and obesity, we have explored new natural agonists for PPAR. For this purpose, cow's milk was tested for agonistic activity toward human PPAR subtypes using a reporter gene assay. Milk increased human PPARalpha activity in a dose-dependent manner with a 3.2-fold increase at 0.5% (vol/vol). It also enhanced human PPARdelta activity in a dose-dependent manner with an 11.5-fold increase at 0.5%. However, it only slightly affected human PPARgamma activity. Ice cream, butter, and yogurt also increased the activities of PPARalpha and PPARdelta, whereas vegetable cream affected activity of PPARdelta but not PPARalpha. Skim milk enhanced the activity of PPAR to a lesser degree than regular milk. Milk and fresh cream increased the activity of human retinoid X receptor (RXR)alpha as well as PPARalpha and PPARdelta, whereas neither affected vitamin D3 receptor, estrogen receptors alpha and beta, or thyroid receptors alpha and beta. Both milk and fresh cream were shown by quantitative real-time PCR to increase the quantity of mRNA for uncoupling protein 2 (UCP2), an energy expenditure gene, in a dose-dependent manner. The increase in UCP2 mRNA was found to be reduced by treatment with PPARdelta-short interfering (si)RNA. This study unambiguously clarified at the cellular level that cow's milk increased the activities of human PPARalpha, PPARdelta, and RXRalpha. The possible role in enhancing the activities of PPARalpha, PPARdelta, and RXRalpha, and the health benefits of cow's milk were discussed.
Structure and signalling functions of C3 receptors on human B cells.
Frade, R
1990-03-01
CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.
Shah, Arpeet; Farooq, Asim V; Tiwari, Vaibhav; Kim, Min-Jung; Shukla, Deepak
2010-11-20
The human cornea is a primary target for herpes simplex virus-1 (HSV-1) infection. The goals of the study were to determine the cellular modalities of HSV-1 entry into human corneal epithelial (HCE) cells. Specific features of the study included identifying major entry receptors, assessing pH dependency, and determining trends of re-infection. A recombinant HSV-1 virus expressing beta-galactosidase was used to ascertain HSV-1 entry into HCE cells. Viral replication within cells was confirmed using a time point plaque assay. Lysosomotropic agents were used to test for pH dependency of entry. Flow cytometry and immunocytochemistry were used to determine expression of three cellular receptors--nectin-1, herpesvirus entry mediator (HVEM), and paired immunoglobulin-like 2 receptor alpha (PILR-a). The necessity of these receptors for viral entry was tested using antibody-blocking. Finally, trends of re-infection were investigated using viral entry assay and flow cytometry post-primary infection. Cultured HCE cells showed high susceptibility to HSV-1 entry and replication. Entry was demonstrated to be pH dependent as blocking vesicular acidification decreased entry. Entry receptors expressed on the cell membrane include nectin-1, HVEM, and PILR-α. Receptor-specific antibodies blocked entry receptors, reduced viral entry and indicated nectin-1 as the primary receptor used for entry. Cells re-infected with HSV-1 showed a decrease in entry, which was correlated to decreased levels of nectin-1 as demonstrated by flow cytometry. HSV-1 is capable of developing an infection in HCE cells using a pH dependent entry process that involves primarily nectin-1 but also the HVEM and PILR-α receptors. Re-infected cells show decreased levels of entry, correlated with a decreased level of nectin-1 receptor expression.
Electrophysiological characterization of recombinant and native P2X receptors.
Niforatos, Wende; Jarvis, Michael F
2004-10-01
ATP acts as a fast neurotransmitter by activating a family of ligand-gated ion channels, the P2X receptors. Functional homomeric P2X(3) and heteromeric P2X(2/3) receptors are highly localized on primary sensory afferent neurons that transmit nociceptive sensory information. Activation of these P2X(3)-containing channels may provide a specific mechanism whereby ATP, released via synaptic transmission or by cellular injury, elicits pain. The experimental procedures described in this unit are useful for the electorphysiological characterization of P2X receptors. In addition, these protocols provide methods for the evaluation of ligands that interact with P2X receptors that are either natively expressed on excitable cells or cloned and expressed in heterologous cell systems. These methods are derived from standard electrophysiological principles and procedures that are applicable to a wide variety of ligand-gated ion channels. Specific attention is given here to the reliable electrophysiological measurement of both quickly (P2X(3)) and more slowly (P2X(2) and P2X(2/3)) desensitizing receptors.
Substance P inhibits natural killer cell cytotoxicity through the neurokinin-1 receptor.
Monaco-Shawver, Linda; Schwartz, Lynnae; Tuluc, Florin; Guo, Chang-Jiang; Lai, Jian Ping; Gunnam, Satya M; Kilpatrick, Laurie E; Banerjee, Pinaki P; Douglas, Steven D; Orange, Jordan S
2011-01-01
SP is a potent neuroimmunomodulator that functions through ligating members of the neurokinin receptor family, one of which, NK1R, is widely expressed in immune cells. As in humans, circulating SP levels are increased in pathologic states associated with impairment of NK cell functions, such as depression and HIV infection, we hypothesized that SP has a direct, inhibitory effect upon NK cells. We have studied a clonal human NK cell line (YTS) as well as ex vivo human NK cells and have determined that truncated and full-length NK1R isoforms are expressed in and SP bound by ex vivo NK cells and the YTS NK cell line. Incubation of YTS cells with 10⁻⁶ M SP and ex vivo NK cells with 10⁻⁵ M SP inhibited cytotoxic ability by ∼20% and reduced degranulation. This inhibitory effect upon cytotoxicity was partially prevented by the NK1R antagonist CP96,345. The treatment of YTS or ex vivo NK cells with SP neither down-modulated NCR expression nor affected triggering receptor-induced NF-κB activation. Preincubation of YTS cells with SP, however, did abbreviate the typically prolonged intracellular calcium increase induced by target cell engagement and reduced triggering receptor-induced pERK. Thus, SP has the potential to regulate NK cell functions and acts downstream from neurokinin receptors to modulate NK cell activation signaling. This mechanism may contribute to impairment of NK cell function in certain disease states associated with increased circulating SP. Antagonism of this system may present an opportunity to augment NK cell function therapeutically in selected human diseases.
Peroxisomal abnormalities in the immortalized human hepatocyte (IHH) cell line.
Klouwer, Femke C C; Koster, Janet; Ferdinandusse, Sacha; Waterham, Hans R
2017-04-01
The immortalized human hepatocyte (IHH) cell line is increasingly used for studies related to liver metabolism, including hepatic glucose, lipid, lipoprotein and triglyceride metabolism, and the effect of therapeutic interventions. To determine whether the IHH cell line is a good model to investigate hepatic peroxisomal metabolism, we measured several peroxisomal parameters in IHH cells and, for comparison, HepG2 cells and primary skin fibroblasts. This revealed a marked plasmalogen deficiency and a deficient fatty acid α-oxidation in the IHH cells, due to a defect of PEX7, a cytosolic receptor protein required for peroxisomal import of a subset of peroxisomal proteins. These abnormalities have consequences for the lipid homeostasis of these cells and thus should be taken into account for the interpretation of data previously generated by using this cell line and when considering using this cell line for future research.
P2X1 Receptor Antagonists Inhibit HIV-1 Fusion by Blocking Virus-Coreceptor Interactions
Giroud, Charline; Marin, Mariana; Hammonds, Jason; Spearman, Paul
2015-01-01
ABSTRACT HIV-1 Env glycoprotein-mediated fusion is initiated upon sequential binding of Env to CD4 and the coreceptor CXCR4 or CCR5. Whereas these interactions are thought to be necessary and sufficient to promote HIV-1 fusion, other host factors can modulate this process. Previous studies reported potent inhibition of HIV-1 fusion by selective P2X1 receptor antagonists, including NF279, and suggested that these receptors play a role in HIV-1 entry. Here we investigated the mechanism of antiviral activity of NF279 and found that this compound does not inhibit HIV-1 fusion by preventing the activation of P2X1 channels but effectively blocks the binding of the virus to CXCR4 or CCR5. The notion of an off-target effect of NF279 on HIV-1 fusion is supported by the lack of detectable expression of P2X1 receptors in cells used in fusion experiments and by the fact that the addition of ATP or the enzymatic depletion of ATP in culture medium does not modulate viral fusion. Importantly, NF279 fails to inhibit HIV-1 fusion with cell lines and primary macrophages when added at an intermediate stage downstream of Env-CD4-coreceptor engagement. Conversely, in the presence of NF279, HIV-1 fusion is arrested downstream of CD4 binding but prior to coreceptor engagement. NF279 also antagonizes the signaling function of CCR5, CXCR4, and another chemokine receptor, as evidenced by the suppression of calcium responses elicited by specific ligands and by recombinant gp120. Collectively, our results demonstrate that NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env. IMPORTANCE Inhibition of P2X receptor activity suppresses HIV-1 fusion and replication, suggesting that P2X signaling is involved in HIV-1 entry. However, mechanistic experiments conducted in this study imply that P2X1 receptor is not expressed in target cells or involved in viral fusion. Instead, we found that inhibition of HIV-1 fusion by a specific P2X1
P2X1 Receptor Antagonists Inhibit HIV-1 Fusion by Blocking Virus-Coreceptor Interactions.
Giroud, Charline; Marin, Mariana; Hammonds, Jason; Spearman, Paul; Melikyan, Gregory B
2015-09-01
HIV-1 Env glycoprotein-mediated fusion is initiated upon sequential binding of Env to CD4 and the coreceptor CXCR4 or CCR5. Whereas these interactions are thought to be necessary and sufficient to promote HIV-1 fusion, other host factors can modulate this process. Previous studies reported potent inhibition of HIV-1 fusion by selective P2X1 receptor antagonists, including NF279, and suggested that these receptors play a role in HIV-1 entry. Here we investigated the mechanism of antiviral activity of NF279 and found that this compound does not inhibit HIV-1 fusion by preventing the activation of P2X1 channels but effectively blocks the binding of the virus to CXCR4 or CCR5. The notion of an off-target effect of NF279 on HIV-1 fusion is supported by the lack of detectable expression of P2X1 receptors in cells used in fusion experiments and by the fact that the addition of ATP or the enzymatic depletion of ATP in culture medium does not modulate viral fusion. Importantly, NF279 fails to inhibit HIV-1 fusion with cell lines and primary macrophages when added at an intermediate stage downstream of Env-CD4-coreceptor engagement. Conversely, in the presence of NF279, HIV-1 fusion is arrested downstream of CD4 binding but prior to coreceptor engagement. NF279 also antagonizes the signaling function of CCR5, CXCR4, and another chemokine receptor, as evidenced by the suppression of calcium responses elicited by specific ligands and by recombinant gp120. Collectively, our results demonstrate that NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env. Inhibition of P2X receptor activity suppresses HIV-1 fusion and replication, suggesting that P2X signaling is involved in HIV-1 entry. However, mechanistic experiments conducted in this study imply that P2X1 receptor is not expressed in target cells or involved in viral fusion. Instead, we found that inhibition of HIV-1 fusion by a specific P2X1 receptor antagonist, NF
Yang, Lina; Su, Ling; Cao, Congmei; Xu, Linyan; Zhong, Diansheng; Xu, Lijia; Liu, Xiangguo
2013-06-01
Natural chalcones have been proved to inhibit cancer cells with therapeutic potential, but the underlying molecular mechanism is still largely unexplored. Here, we identified a novel chalcone, 2'-hydroxy-4',5'-dimethoxychalcone (HDMC) and demonstrated that HDMC induced apoptosis in various nonsmall cell lung cancer cells. Further study showed that HDMC elevated cellular reactive oxygen species (ROS) levels, thus inducing expressions of ATF4 and C/EBP homologous protein (CHOP). Then, death receptor 5 (DR5) was upregulated through ATF4-CHOP axis and eventually resulted in apoptosis. We also found that downregulation of c-FLIPL contributed to HDMC-induced apoptosis. In conclusion, HDMC induces apoptosis in human nonsmall cell lung cancer cells via activation of DR5 signaling pathway, and ROS-mediated ATF4-CHOP axis is involved in the process. Our results further supported the potential for HDMC to be developed as a new antitumor agent for cancer therapy or chemoprevention. Copyright © 2013 International Union of Biochemistry and Molecular Biology, Inc.
Wilcox, R A; Fauq, A; Kozikowski, A P; Nahorski, S R
1997-02-03
The novel synthetic analogues D-3-fluoro-myo-inositol 1,5-bisphosphate-4-phosphorothioate, [3F-Ins(1,5)P2-4PS], D-3-fluoro-myo-inositol 1,4-bisphosphate-5-phosphorothioate [3F-Ins(1,4)P2-5PS], and D-3-fluoro-myo-inositol 1-phosphate-4,5-bisphosphorothioate [3F-Ins(1)P-(4,5)PS2] were utilised to define the structure-activity relationships which could produce partial agonism at the Ca2+ mobilising myo-inositol 1,4,5-trisphosphate [Ins(1,4,5)P3] receptor. Based on prior structure-activity data we hypothesised that the minimal structural requirements for lns(1,4,5)P3 receptor partial agonism, were phosphorothioate substitution of the crucial vicinal 4,5-bisphosphate pair accompanied by another structural perturbation, such fluorination of 3-position of the myo-inositol ring. All the analogues fully displaced [3H]Ins(1,4,5)P3 from a single Ins(1,4,5)P3 binding site in pig cerebellar membranes [3F-Ins(1,5)P2-4PS (1C50 = 26 nM), 3F-Ins(1,4)P2-5PS (IC50 = 80 nM) and 3F-Ins(1)P-(4,5)PS2 (IC50 = 109 nM) cf. Ins(1,4,5)P3 (IC50 = 11 nM)]. In contrast, 3F-Ins(1,5)P2-4PS (IC50 = 424 nM) and 3F-Ins(1,4)P2-5PS (IC50 = 3579 nM) were weak full agonists at the Ca2+ mobilising Ins(1,4,5)P3 receptor of permeabilised SH-SY5Y neuroblastoma cells, being respectively 4- and 36-fold less potent than Ins(1,4,5)P3 (EC50 = 99 nM). While 3F-Ins(1)P-(4,5)PS2 (EC50 = 11345 nM) was a partial agonist releasing only 64.3 +/- 1.9% of the Ins(1,4,5)P3-sensitive intracellular Ca2+ pools. 3F-Ins(1)P-(4,5)PS2 was unique among the Ins(1,4,5)P3 receptor partial agonists so far identified in having a relatively high affinity for the Ins(1,4,5)P3 binding site, accompanied by a significant loss of intrinsic activity for Ca2+ mobilisation. This improved affinity was probably due to the retention of the 1-position phosphate, which enhances interaction with the Ins-(1,4,5)P3 receptor. 3F-Ins(1)P-(4,5)PS2 may be an important lead compound for the development of efficient Ins(1,4,5)P3 receptor antagonists.
Hua, Wen-Bin; Wu, Xing-Huo; Zhang, Yu-Kun; Song, Yu; Tu, Ji; Kang, Liang; Zhao, Kang-Cheng; Li, Shuai; Wang, Kun; Liu, Wei; Shao, Zeng-Wu; Yang, Shu-Hua; Yang, Cao
2017-08-01
Intervertebral disc degeneration (IDD) is a chronic disease associated with the degradation of extracellular matrix (ECM). Matrix metalloproteinase (MMP)-13 is a major enzyme that mediates the degradation of ECM components. MMP-13 has been predicted to be a potential target of miR-127-5p. However, the exact function of miR-127-5p in IDD is still unclear. We designed this study to evaluate the correlation between miR-127-5p level and the degeneration of human intervertebral discs and explore the potential mechanisms. miR-127-5p levels and MMP-13 mRNA levels were detected by quantitative real-time polymerase chain reaction (qPCR). To determine whether MMP-13 is a target of miR-127-5p, dual luciferase reporter assays were performed. miR-127-5p mimic and miR-127-5p inhibitor were used to overexpress or downregulate miR-127-5p expression in human NP cells, respectively. Small interfering RNA (siRNA) was used to knock down MMP-13 expression in human NP cells. Type II collagen expression in human NP cells was detected by qPCR, western blotting, and immunofluorescence staining. We confirmed that miR-127-5p was significantly downregulated in nucleus pulposus (NP) tissue of degenerative discs and its expression was inversely correlated with MMP-13 mRNA levels. We reveal that MMP-13 may act as a target of miR-127-5p. Expression of miR-127-5p was inversely correlated with type II collagen expression in human NP cells. Moreover, suppression of MMP-13 expression by siRNA blocked downstream signaling and increased type II collagen expression. Dysregulated miR-127-5p contributed to the degradation of type II collagen by targeting MMP-13 in human IDD. Our findings highlight that miR-127-5p may serve as a new therapeutic target in IDD. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Naturally occurring glucagon-like peptide-2 (GLP-2) receptors in human intestinal cell lines.
Sams, Anette; Hastrup, Sven; Andersen, Marie; Thim, Lars
2006-02-17
Although clinical trials with GLP-2 receptor agonists are currently ongoing, the mechanisms behind GLP-2-induced intestinal epithelial growth remain to be understood. To approach the GLP-2 mechanism of action this study aimed to identify intestinal cell lines endogenously expressing the GLP-2 receptor. Here we report the first identification of a cell line endogenously expressing functional GLP-2 receptors. The human intestinal epithelial cell line, FHC, expressed GLP-2 receptor encoding mRNA (RT-PCR) and GLP-2 receptor protein (Western blot). In cultured FHC cells, GLP-2 induced concentration dependent cAMP accumulation (pEC(50)=9.7+/-0.04 (mean+/-S.E.M., n=4)). In addition, a naturally occurring human intestinal fibroblast cell line, 18Co, endogenously expressing GLP-2 receptor encoding mRNA (RT-PCR) and protein (Western blot) was identified. No receptor functionality (binding or G-protein signalling) could be demonstrated in 18Co cells. The identified gut-relevant cell lines provide tools for future clarification of the mechanisms underlying GLP-2-induced epithelial growth.
Lee, Won-Kyu; Han, Jason J; Jin, Bong-Suk; Boo, Doo Wan; Yu, Yeon Gyu
2009-12-18
Seven transmembrane (7TM) synthetic peptides mimicking the alpha-helical TM domains of the human serotonin receptor subtype-6 (5-HT(6)) were autonomously reconstituted in detergent micelle and liposome environments. The degree of assembly of the 7TM peptides was characterized by monitoring the fluorescence resonance energy transfer (FRET) between donor and acceptor probes labeled at the amino termini of the second and fourth TM-peptides, respectively. The FRET efficiency of these peptides significantly increased when the 7TM peptides were reconstituted in liposome compare to detergent micelles. Furthermore, the 7TM peptides reconstituted in liposomes selectively bound to free serotonin and serotonin-conjugated magnetic beads, yielding a dissociation constant of 0.84 microM. These results show that the seven individual TM domains of 5-HT(6) can spontaneously assemble into liposomes in a conformation that mimics a native structure, and further demonstrate that specific interactions between TM helices play a critical role in the folding and stabilizing of GPCRs. The autonomous assembly of 7TM-peptides can be applied to the screening of agonists for GPCRs that are difficult to manipulate.
Atkinson, Peter J; Bromidge, Steven M; Duxon, Mark S; Gaster, Laramie M; Hadley, Michael S; Hammond, Beverley; Johnson, Christopher N; Middlemiss, Derek N; North, Stephanie E; Price, Gary W; Rami, Harshad K; Riley, Graham J; Scott, Claire M; Shaw, Tracey E; Starr, Kathryn R; Stemp, Geoffrey; Thewlis, Kevin M; Thomas, David R; Thompson, Mervyn; Vong, Antonio K K; Watson, Jeannette M
2005-02-01
Starting from a high throughput screening hit, a series of 3,4-dihydro-2H-benzoxazinones has been identified with both high affinity for the 5-HT(1A) receptor and potent 5-HT reuptake inhibitory activity. The 5-(2-methyl)quinolinyloxy derivative combined high 5-HT(1A/1B/1D) receptor affinities with low intrinsic activity and potent inhibition of the 5-HT reuptake site (pK(i)8.2). This compound also had good oral bioavailability and brain penetration in the rat.
Therapeutic Potential of 5-HT2C Receptor Agonists for Addictive Disorders.
Higgins, Guy A; Fletcher, Paul J
2015-07-15
The neurotransmitter 5-hydroxytryptamine (5-HT; serotonin) has long been associated with the control of a variety of motivated behaviors, including feeding. Much of the evidence linking 5-HT and feeding behavior was obtained from studies of the effects of the 5-HT releaser (dex)fenfluramine in laboratory animals and humans. Recently, the selective 5-HT2C receptor agonist lorcaserin received FDA approval for the treatment of obesity. This review examines evidence to support the use of selective 5-HT2C receptor agonists as treatments for conditions beyond obesity, including substance abuse (particularly nicotine, psychostimulant, and alcohol dependence), obsessive compulsive, and excessive gambling disorder. Following a brief survey of the early literature supporting a role for 5-HT in modulating food and drug reinforcement, we propose that intrinsic differences between SSRI and serotonin releasers may have underestimated the value of serotonin-based pharmacotherapeutics to treat clinical forms of addictive behavior beyond obesity. We then highlight the critical involvement of the 5-HT2C receptor in mediating the effect of (dex)fenfluramine on feeding and body weight gain and the evidence that 5-HT2C receptor agonists reduce measures of drug reward and impulsivity. A recent report of lorcaserin efficacy in a smoking cessation trial further strengthens the idea that 5-HT2C receptor agonists may have potential as a treatment for addiction. This review was prepared as a contribution to the proceedings of the 11th International Society for Serotonin Research Meeting held in Hermanus, South Africa, July 9-12, 2014.
T Cell Calcium Signaling Regulation by the Co-Receptor CD5
Freitas, Claudia M. Tellez
2018-01-01
Calcium influx is critical for T cell effector function and fate. T cells are activated when T cell receptors (TCRs) engage peptides presented by antigen-presenting cells (APC), causing an increase of intracellular calcium (Ca2+) concentration. Co-receptors stabilize interactions between the TCR and its ligand, the peptide-major histocompatibility complex (pMHC), and enhance Ca2+ signaling and T cell activation. Conversely, some co-receptors can dampen Ca2+ signaling and inhibit T cell activation. Immune checkpoint therapies block inhibitory co-receptors, such as cytotoxic T-lymphocyte associated antigen 4 (CTLA-4) and programmed death 1 (PD-1), to increase T cell Ca2+ signaling and promote T cell survival. Similar to CTLA-4 and PD-1, the co-receptor CD5 has been known to act as a negative regulator of T cell activation and to alter Ca2+ signaling and T cell function. Though much is known about the role of CD5 in B cells, recent research has expanded our understanding of CD5 function in T cells. Here we review these recent findings and discuss how our improved understanding of CD5 Ca2+ signaling regulation could be useful for basic and clinical research. PMID:29701673
Permeability and single channel conductance of human homomeric ρ1 GABAC receptors
Wotring, Virginia E; Chang, Yongchang; Weiss, David S
1999-01-01
Homomeric human ρ1 GABAC receptors were expressed in Xenopus oocytes and in human embryonic kidney cells (HEK293) in order to examine their conductance and permeability. Reversal potentials of currents elicited by γ-aminobutyric acid (GABA) were measured in extracellular solutions of various ionic composition to determine relative permeability of homomeric ρ1 receptors. The rank order of anionic permeability was: SCN− > I− > NO3− > Br− > Cl− > formate (For−) > HCO3− > acetate (Ac−) ≈ proprionate (Prop−) ≈ isethionate (Ise−) ≈ F−≈ PO4−. In the oocyte expression system, relative permeabilities to SCN−, I−, NO3−, Br− and HCO3− were higher for ρ1 GABAC receptors than α1β2γ2L GABAA receptors. Expression of ρ1 GABAC receptors in Xenopus oocytes and in HEK293 cells gave similar relative permeabilities for selected anions, suggesting that the expression system does not significantly alter permeation properties. The pore diameter of the homomeric ρ1 GABAC receptor expressed in oocytes was estimated to be 0.61 nm, which is somewhat larger than the 0.56 nm pore diameter estimated for α1β2γ2L GABAA receptors. Homomeric ρ1 GABA receptors expressed in oocytes had a single channel chord conductance of 0.65 ± 0.04 pS (mean ±s.e.m.s) when the internal chloride concentration ([Cl−]i) was 20 mm. With a [Cl−]i of 100 mm, the single channel chord conductance was 1.59 ± 0.24 pS. The mean open time directly measured from 43 GABA-induced channel openings in six patches was 3.2 ± 0.8 s. The mean open time in the presence of 100 μm picrotoxin was 0.07 ± 0.01 s (77 openings from 3 patches). The differences observed in ionic permeabilities, pore size, single channel conductance and mean open time suggest that the ρ1 homomeric receptor may not be the native retinal GABAC receptor reported previously. PMID:10581305
Milutinovic, Snezana; Kashyap, Arun K; Yanagi, Teruki; Wimer, Carina; Zhou, Sihong; O'Neil, Ryann; Kurtzman, Aaron L; Faynboym, Alexsandr; Xu, Li; Hannum, Charles H; Diaz, Paul W; Matsuzawa, Shu-ichi; Horowitz, Michael; Horowitz, Lawrence; Bhatt, Ramesh R; Reed, John C
2016-01-01
Death receptors of the TNF family are found on the surface of most cancer cells and their activation typically kills cancer cells through the stimulation of the extrinsic apoptotic pathway. The endogenous ligand for death receptors 4 and 5 (DR4 and DR5) is TNF-related apoptosis-inducing ligand, TRAIL (Apo2L). As most untransformed cells are not susceptible to TRAIL-induced apoptosis, death receptor activators have emerged as promising cancer therapeutic agents. One strategy to stimulate death receptors in cancer patients is to use soluble human recombinant TRAIL protein, but this agent has limitations of a short half-life and decoy receptor sequestration. Another strategy that attempted to evade decoy receptor sequestration and to provide improved pharmacokinetic properties was to generate DR4 or DR5 agonist antibodies. The resulting monoclonal agonist antibodies overcame the limitations of short half-life and avoided decoy receptor sequestration, but are limited by activating only one of the two death receptors. Here, we describe a DR4 and DR5 dual agonist produced using Surrobody technology that activates both DR4 and DR5 to induce apoptotic death of cancer cells in vitro and in vivo and also avoids decoy receptor sequestration. This fully human anti-DR4/DR5 Surrobody displays superior potency to DR4- and DR5-specific antibodies, even when combined with TRAIL-sensitizing proapoptotic agents. Moreover, cancer cells were less likely to acquire resistance to Surrobody than either anti-DR4 or anti-DR5 monospecific antibodies. Taken together, Surrobody shows promising preclinical proapoptotic activity against cancer cells, meriting further exploration of its potential as a novel cancer therapeutic agent. ©2015 American Association for Cancer Research.
Milutinovic, Snezana; Kashyap, Arun K.; Yanagi, Teruki; Wimer, Carina; Zhou, Sihong; O' Neil, Ryann; Kurtzman, Aaron L.; Faynboym, Alexsandr; Xu, Li; Hannum, Charles H.; Diaz, Paul W.; Matsuzawa, Shu-ichi; Horowitz, Michael; Horowitz, Lawrence; Bhatt, Ramesh R.; Reed, John C.
2015-01-01
Death receptors of the Tumor Necrosis Factor (TNF) family are found on surface of most cancer cells and their activation typically kills cancer cells through the stimulation of the extrinsic apoptotic pathway. The endogenous ligand for death receptors-4 and -5 (DR4 and DR5) is Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand, TRAIL (Apo2L). Since most untransformed cells are not susceptible to TRAIL-induced apoptosis, death receptor activators have emerged as promising cancer therapeutic agents. One strategy to stimulate death receptors in cancer patients is to use soluble human recombinant TRAIL protein, but this agent has limitations of a short half-life and decoy receptor sequestration. Another strategy that attempted to evade decoy receptor sequestration and to provide improved pharmacokinetic properties was to generate DR4 or DR5 agonist antibodies. The resulting monoclonal agonist antibodies overcame the limitations of short half-life and avoided decoy receptor sequestration, but are limited by activating only one of the two death receptors. Here, we describe a DR4 and DR5 dual agonist produced using Surrobody™ technology that activates both DR4 and DR5 to induce apoptotic death of cancer cells in vitro and in vivo and also avoids decoy receptor sequestration. This fully human anti-DR4/DR5 Surrobody displays superior potency to DR4- and DR5-specific antibodies, even when combined with TRAIL-sensitizing pro-apoptotic agents. Moreover, cancer cells were less likely to acquire resistance to Surrobody than either anti-DR4 or anti-DR5 mono-specific antibodies. Taken together, Surrobody shows promising preclinical pro-apoptotic activity against cancer cells, meriting further exploration of its potential as a novel cancer therapeutic agent. PMID:26516157