Gene signatures distinguish stage-specific prostate cancer stem cells isolated from transgenic adenocarcinoma of the mouse prostate lesions and predict the malignancy of human tumors.

PubMed

Mazzoleni, Stefania; Jachetti, Elena; Morosini, Sara; Grioni, Matteo; Piras, Ignazio Stefano; Pala, Mauro; Bulfone, Alessandro; Freschi, Massimo; Bellone, Matteo; Galli, Rossella

2013-09-01

The relevant social and economic impact of prostate adenocarcinoma, one of the leading causes of death in men, urges critical improvements in knowledge of the pathogenesis and cure of this disease. These can also be achieved by implementing in vitro and in vivo preclinical models by taking advantage of prostate cancer stem cells (PCSCs). The best-characterized mouse model of prostate cancer is the transgenic adenocarcinoma of the mouse prostate (TRAMP) model. TRAMP mice develop a progressive lesion called prostatic intraepithelial neoplasia that evolves into adenocarcinoma (AD) between 24 and 30 weeks of age. ADs often metastasize to lymph nodes, lung, bones, and kidneys. Eventually, approximately 5% of the mice develop an androgen-independent neuroendocrine adenocarcinoma. Here we report the establishment of long-term self-renewing PCSC lines from the different stages of TRAMP progression by application of the neurosphere assay. Stage-specific prostate cell lines were endowed with the critical features expected from malignant bona fide cancer stem cells, namely, self-renewal, multipotency, and tumorigenicity. Notably, transcriptome analysis of stage-specific PCSCs resulted in the generation of well-defined, meaningful gene signatures, which identify distinct stages of human tumor progression. As such, TRAMP-derived PCSCs represent a novel and valuable preclinical model for elucidating the pathogenetic mechanisms leading to prostate adenocarcinoma and for the identification of molecular mediators to be pursued as therapeutic targets.

Therapeutic Roles of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2013-10-01

KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1 regulate self- renewal of normal and malignant human mammary stem cells. Cancer Res 66:6063-71...ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and bmi-1 regulate self-renewal of normal and malignant human mammary stem cells

Loss of miR-100 enhances migration, invasion, epithelial-mesenchymal transition and stemness properties in prostate cancer cells through targeting Argonaute 2.

PubMed

Wang, Min; Ren, Dong; Guo, Wei; Wang, Zeyu; Huang, Shuai; Du, Hong; Song, Libing; Peng, Xinsheng

2014-07-01

Evidence in literature has demonstrated that some microRNAs (miRNAs) play a pivotal role in most solid tumor metastasis. Previous studies have showed that miR-100 is downregulated in human prostate cancer tissue compared to normal prostate and also significantly decreased in bone metastatic prostate cancer samples compared with primary prostate cancer. Argonaute 2 (AGO2) is the core effector protein of the miRNA-induced silencing complex and overexpression of AGO2 might enhance tumor metastasis. However, it is unknown whether and how miR-100 and AGO2 regulates metastasis of prostate cancer. Here, we report that miR-100 negatively regulated migration, invasion, epithelial-mesenchymal transition (EMT), colony formation, spheroid formation and expression of the stemness factors c-Myc, Oct4 and Klf4 in PC-3 and DU145 cells. Furthermore, miR-100 expression was negatively correlated with bone metastasis of prostate cancer patients. Notably, luciferase assay showed that AGO2 was a direct target of miR-100. Downregulation of AGO2 repressed migration, invasion, EMT and stemness of prostate cancer cells, and reversed the effects seen with miR-100 downregulation. Downregulation of AGO2 enhanced expression of miR-34a and miR-125b which can suppress migration, invasion, EMT and stemness of cancer cells. Taken together, our findings indicate that loss of miR-100 promotes the metastatic ability of prostate cancer cells at least partially by upregulating AGO2 expression through modulating migration, invasion, EMT and stemness of cancer cells, and suggest that miR-100/AGO2 may play an important role in regulating the metastasis of prostate cancer and is a potential target of prevention and therapy.

Prostate Stem Cell Antigen: A Prospective Therapeutic and Diagnostic Target

PubMed Central

Raff, Adam B.; Gray, Andrew; Kast, W. Martin

2009-01-01

The development of novel clinical tools to combat cancer is an intense field of research and recent efforts have been directed at the identification of proteins that may provide diagnostic, prognostic and/or therapeutic applications due to their restricted expression. To date, a number of protein candidates have emerged as potential clinical tools in the treatment of prostate cancer. Discovered over ten year ago, prostate stem cell antigen (PSCA) is a cell surface antigen that belongs to the Ly-6/Thy-1 family of glycosylphosphatidylinositol-anchored proteins. PSCA is highly overexpressed in human prostate cancer, with limited expression in normal tissues, making it an ideal target for both diagnosis and therapy. Several studies have now clearly correlated the expression of PSCA with relevant clinical benchmarks, such as Gleason score and metastasis, while others have demonstrated the efficacy of PSCA targeting in treatment through various modalities. The purpose of this review is to present the current body of knowledge about PSCA and its potential role in the treatment of human prostate cancer. PMID:18838214

Androgen deprivation and stem cell markers in prostate cancers

PubMed Central

Tang, Yao; Hamburger, Anne W; Wang, Linbo; Khan, Mohammad Afnan; Hussain, Arif

2010-01-01

In our previous studies using human LNCaP xenografts and TRAMP (transgenic adenocarcinoma of mouse prostate) mice, androgen deprivation therapy (ADT) resulted in a temporary cessation of prostate cancer (PCa) growth, but then tumors grew faster with more malignant behaviour. To understand whether cancer stem cells might play a role in PCa progression in these animal models, we investigated the expressions of stem cell-related markers in tumors at different time points after ADT. In both animal models, enhanced expressions of stem cell markers were observed in tumors of castrated mice, as compared to non-castrated controls. This increased cell population that expressed stem cell markers is designated as stem-like cells (SLC) in this article. We also observed that the SLC peaked at relatively early time points after ADT, before tumors resumed their growth. These results suggest that the SLC population may play a role in tumor re-growth and disease progression, and that targeting the SLC at their peak-expression time point may prevent tumor recurrence following ADT. PMID:20126580

Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

DTIC Science & Technology

2015-12-01

xenograft tumors. The results from these studies will reveal whether targeting PTEN-deficient human tumors with WEE1 inhibitors can induce specific... xenograft tumors formed by PTEN- PSAlo PCSCs in castrated male immunocompromised mice. What was accomplished under these goals? Aim 1. Examine...prostate cancer stem cells. Aim 3. Investigate the cytotoxicity of WEE1 inhibitors against recalcitrant xenograft tumors formed by PTEN- CSCs in

Targeting Tumor Oct4 to Deplete Prostate Tumor and Metastasis Initiating Cells

DTIC Science & Technology

2017-12-01

Nie, POU5F1B, an OCT4 Retrogene, Suppresses Uncontrolled Tumor Growth. Keystone Meeting on Molecular and Cellular Basis of Growth and Regeneration...Daotai Nie. Cancer Stem Cells in Resistance to Cytotoxic Drugs: Implications in Chemotherapy. B. Bonavida (ed.), Molecular Mechanisms of Tumor Cell...retrogene of the master embryonic stem cell gene POU5F1 is associated with prostate cancer susceptibility. American journal of human genetics 94

Prostate Stem Cell Antigen DNA Vaccination Breaks Tolerance to Self-antigen and Inhibits Prostate Cancer Growth

PubMed Central

Ahmad, Sarfraz; Casey, Garrett; Sweeney, Paul; Tangney, Mark; O'Sullivan, Gerald C

2009-01-01

Prostate stem cell antigen (PSCA) is a cell surface antigen expressed in normal human prostate and over expressed in prostate cancer. Elevated levels of PSCA protein in prostate cancer correlate with increased tumor stage/grade, with androgen independence and have higher expression in bone metastases. In this study, the PSCA gene was isolated from the transgenic adenocarcinoma mouse prostate cell line (TRAMPC1), and a vaccine plasmid construct was generated. This plasmid PSCA (pmPSCA) was delivered by intramuscular electroporation (EP) and induced effective antitumor immune responses against subcutaneous TRAMPC1 tumors in male C57 BL/6 mice. The pmPSCA vaccination inhibited tumor growth, resulting in cure or prolongation in survival. Similarly, the vaccine inhibited metastases in PSCA expressing B16 F10 tumors. There was activation of Th-1 type immunity against PSCA, indicating the breaking of tolerance to a self-antigen. This immunity was tumor specific and was transferable by adoptive transfer of splenocytes. The mice remained healthy and there was no evidence of collateral autoimmune responses in normal tissues. EP-assisted delivery of the pmPSCA evoked strong specific responses and could, in neoadjuvant or adjuvant settings, provide a safe and effective immune control of prostate cancer, given that there is significant homology between human and mouse PSCA. PMID:19337234

ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro.

PubMed

Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M; Suo, Zhenhe

2015-12-15

Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2'-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells.

ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro

PubMed Central

Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2015-01-01

Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2′-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells. PMID:26528857

Mitigation of arsenic-induced acquired cancer phenotype in prostate cancer stem cells by miR-143 restoration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngalame, Ntube N.O., E-mail: ngalamenn@niehs.nih.g

Inorganic arsenic, an environmental contaminant and a human carcinogen is associated with prostate cancer. Emerging evidence suggests that cancer stem cells (CSCs) are the driving force of carcinogenesis. Chronic arsenic exposure malignantly transforms the human normal prostate stem/progenitor cell (SC) line, WPE-stem to arsenic-cancer SCs (As-CSCs), through unknown mechanisms. MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the posttranscriptional level. In prior work, miR-143 was markedly downregulated in As-CSCs, suggesting a role in arsenic-induced malignant transformation. In the present study, we investigated whether loss of miR-143 expression is important in arsenic-induced transformation of prostate SCs. Restorationmore » of miR-143 in As-CSCs was achieved by lentivirus-mediated miR-143 overexpression. Cells were assessed bi-weekly for up to 30 weeks to examine mitigation of cancer phenotype. Secreted matrix metalloproteinase (MMP) activity was increased by arsenic-induced malignant transformation, but miR-143 restoration decreased secreted MMP-2 and MMP-9 enzyme activities compared with scramble controls. Increased cell proliferation and apoptotic resistance, two hallmarks of cancer, were decreased upon miR-143 restoration. Increased apoptosis was associated with decreased BCL2 and BCL-XL expression. miR-143 restoration dysregulated the expression of SC/CSC self-renewal genes including NOTCH-1, BMI-1, OCT4 and ABCG2. The anticancer effects of miR-143 overexpression appeared to be mediated by targeting and inhibiting LIMK1 protein, and the phosphorylation of cofilin, a LIMK1 substrate. These findings clearly show that miR-143 restoration mitigated multiple cancer characteristics in the As-CSCs, suggesting a potential role in arsenic-induced transformation of prostate SCs. Thus, miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer. - Highlights: • Chronic arsenic exposure malignantly transforms human prostate stem cells (SCs) to arsenic-cancer SCs via unknown mechanisms. • miR-143 was several fold downregulated in the arsenic-cancer SCs (As-CSCs), suggesting a likely role in transformation. • miR-143 restoration reduced cancer characteristics in the As-CSC, suggesting a role in arsenic-induced SC transformation. • miR-143 appears to exert its anticancer effect by inhibiting expression and activity of LIMK1, its predicted gene target. • These findings suggest miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer.« less

Pyruvate dehydrogenase expression is negatively associated with cell stemness and worse clinical outcome in prostate cancers

PubMed Central

Zhong, Yali; Li, Xiaoli; Ji, Yasai; Li, Xiaoran; Li, Yaqing; Yu, Dandan; Yuan, Yuan; Liu, Jian; Li, Huixiang; Zhang, Mingzhi; Ji, Zhenyu; Fan, Dandan; Wen, Jianguo; Goscinski, Mariusz Adam; Yuan, Long; Hao, Bin; Nesland, Jahn M; Suo, Zhenhe

2017-01-01

Cells generate adenosine-5′-triphosphate (ATP), the major currency for energy-consuming reactions, through mitochondrial oxidative phosphorylation (OXPHOS) and glycolysis. One of the remarkable features of cancer cells is aerobic glycolysis, also known as the “Warburg Effect”, in which cancer cells rely preferentially on glycolysis instead of mitochondrial OXPHOS as the main energy source even in the presence of high oxygen tension. One of the main players in controlling OXPHOS is the mitochondrial gatekeeperpyruvate dehydrogenase complex (PDHc) and its major subunit is E1α (PDHA1). To further analyze the function of PDHA1 in cancer cells, it was knock out (KO) in the human prostate cancer cell line LnCap and a stable KO cell line was established. We demonstrated that PDHA1 gene KO significantly decreased mitochondrial OXPHOS and promoted anaerobic glycolysis, accompanied with higher stemness phenotype including resistance to chemotherapy, enhanced migration ability and increased expression of cancer stem cell markers. We also examined PDHA1 protein expression in prostate cancer tissues by immunohistochemistry and observed that reduced PDHA1 protein expression in clinical prostate carcinomas was significantly correlated with poor prognosis. Collectively, our results show that negative PDHA1 gene expressionis associated with significantly higher cell stemness in prostate cancer cells and reduced protein expression of this gene is associated with shorter clinical outcome in prostate cancers. PMID:28076853

Animal models relevant to human prostate carcinogenesis underlining the critical implication of prostatic stem/progenitor cells

PubMed Central

Mimeault, Murielle; Batra, Surinder K.

2012-01-01

Recent development of animal models relevant to human prostate cancer (PC) etiopathogenesis has provided important information on the specific functions provided by key gene products altered during disease initiation and progression to locally invasive, metastatic and hormone-refractory stages. Especially, the characterization of transgenic mouse models has indicated that the inactivation of distinct tumor suppressor proteins such as phosphatase tensin homolog deleted on chromosome 10 (PTEN), Nkx3.1, p27KIP1 and p53 and retinoblastoma (pRb) may cooperate for the malignant transformation of prostatic stem/progenitor cells into PC stem/progenitor cells and tumor development and metastases. Moreover, the sustained activation of diverse oncogenic signaling elements, including epidermal growth factor receptor (EGFR), sonic hedgehog, Wnt/β-catenin, c-Myc, Akt and nuclear factor-kappaB (NF-κB) also may contribute to the acquisition of more aggressive and hormone-refractory phenotypes by PC stem/progenitor cells and their progenies during disease progression. Importantly, it has also been shown that an enrichment of PC stem/progenitor cells expressing stem cell-like markers may occur after androgen deprivation therapy and docetaxel treatment in the transgenic mouse models of PC suggesting the critical implication of these immature PC cells in treatment resistance, tumor re-growth and disease recurrence. Of clinical interest, the molecular targeting of distinct gene products altered in PC cells by using different dietary compounds has also been shown to counteract PC initiation and progression in animal models supporting their potential use as chemopreventive or chemotherapeutic agents for eradicating the total tumor cell mass, improving current anti-hormonal and chemotherapies and preventing disease relapse. PMID:21396984

Differentiation of Neonatal Human-Induced Pluripotent Stem Cells to Prostate Epithelial Cells: A Model to Study Prostate Cancer Development

DTIC Science & Technology

2013-06-01

38, 40, 41]. Because these “ mela - noma stem cells” (MSC) are sometimes so numerous, some have argued that the CSC model may not apply to melanoma...40]. There are data from two groups indicating that mela - noma lesions contain a CSC subset character- ized by CD271 expression [25, 26]. In a...neuronal proteins and neuron- like differentiation has been long recognized in neoplastic melanocytes [46, 47]. Certain mela - noma cell lines that

Contribution of Caudal Müllerian Duct Mesenchyme to Prostate Development

PubMed Central

Brechka, Hannah; McAuley, Erin M.; Lamperis, Sophia M.; Paner, Gladell P.

2016-01-01

A fundamental understanding of prostate development and tissue homeostasis has the high potential to reveal mechanisms for prostate disease initiation and identify novel therapeutic approaches for disease prevention and treatment. Our current understanding of prostate lineage specification stems from the use of developmental model systems that rely upon the embryonic preprostatic urogenital sinus mesenchyme to induce the formation of mature prostate epithelial cells. It is unclear, however, how the urogenital sinus epithelium can derive both adult urethral glands and prostate epithelia. Furthermore, the vast disparity in disease initiation between these two glands highlights key developmental factors that predispose prostate epithelia to hyperplasia and cancer. In this study we demonstrate that the caudal Müllerian duct mesenchyme (CMDM) drives prostate epithelial differentiation and is a key determinant in cell lineage specification between urethral glands and prostate epithelia. Utilizing both human embryonic stem cells and mouse embryonic tissues, we document that the CMDM is capable of inducing the specification of androgen receptor, prostate-specific antigen, NKX3.1, and Hoxb13-positive prostate epithelial cells. These results help to explain key developmental differences between prostate and urethral gland differentiation, and implicate factors secreted by the caudal Müllerian duct as novel targets for prostate disease prevention and treatment. PMID:27595922

Human Prostate Sphere-Forming Cells Represent a Subset of Basal Epithelial Cells Capable of Glandular Regeneration in Vivo

PubMed Central

Garraway, Isla P; Sun, Wenyi; Tran, Chau P; Perner, Sven; Zhang, Bao; Goldstein, Andrew S; Hahm, Scott A; Haider, Maahum; Head, Christian S; Reiter, Robert E; Rubin, Mark A; Witte, Owen N

2010-01-01

BACKGROUND Prostate stem/progenitor cells function in glandular development and maintenance. They may be targets for tumor initiation, so characterization of these cells may have therapeutic implications. Cells from dissociated tissues that form spheres in vitro often represent stem/progenitor cells. A subset of human prostate cells that form prostaspheres were evaluated for self-renewal and tissue regeneration capability in the present study. METHODS Prostaspheres were generated from 59 prostatectomy specimens. Lineage marker expression and TMPRSS-ERG status was determined via immunohistochemistry and fluorescence in situ hybridization (FISH). Subpopulations of prostate epithelial cells were isolated by cell sorting and interrogated for sphere-forming activity. Tissue regeneration potential was assessed by combining sphere-forming cells with rat urogenital sinus mesenchyme (rUGSM) subcutaneously in immunocompromised mice. RESULTS Prostate tissue specimens were heterogeneous, containing both benign and malignant (Gleason 3–5) glands. TMPRSS-ERG fusion was found in approximately 70% of cancers examined. Prostaspheres developed from single cells at a variable rate (0.5–4%) and could be serially passaged. A basal phenotype (CD44+CD49f+CK5+p63+CK8−AR−PSA−) was observed among sphere-forming cells. Subpopulations of prostate cells expressing tumor-associated calcium signal transducer 2 (Trop2), CD44, and CD49f preferentially formed spheres. In vivo implantation of sphere-forming cells and rUGSM regenerated tubular structures containing discreet basal and luminal layers. The TMPRSS-ERG fusion was absent in prostaspheres derived from fusion-positive tumor tissue, suggesting a survival/growth advantage of benign prostate epithelial cells. CONCLUSION Human prostate sphere-forming cells self-renew, have tissue regeneration capability, and represent a subpopulation of basal cells. Prostate 70: 491–501, 2010. © 2009 Wiley-Liss, Inc. PMID:19938015

Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer

PubMed Central

Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.

2013-01-01

Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489

Prostate cancer stem cells: from theory to practice.

PubMed

Adamowicz, Jan; Pakravan, Katayoon; Bakhshinejad, Babak; Drewa, Tomasz; Babashah, Sadegh

2017-04-01

None of the generally accepted theories on prostate cancer development can fully explain many distinguishing features of the disease, such as intratumoral heterogeneity, metastatic growth, drug resistance and tumor relapse. Prostate stem cells are a heterogeneous and small subpopulation of self-renewing cells which can actively proliferate in response to changes in the androgen level and give rise to all the cell lineages that build the prostate epithelium. According to the cancer stem cell hypothesis, prostate cancer could be a stem cell disease. Prostate cancer stem cells, which represent only a minimal percentage of the tumor mass, are characterized by a markedly increased clonogenicity and therapeutic resistance. These tumor-initiating cells reside in dynamic niches distributed within the prostate but at a higher concentration in proximal regions of the prostatic ducts. Several markers have been used to identify prostate cancer stem cells. Nevertheless, a definitive profile has not yet been established owing to specificity issues. As cancer stem cells play determining roles in the birth and burst of prostate malignancy, strategies that selectively target them have gained huge clinical attention. Unraveling the mechanisms underlying the physiological functions of cancer stem cells and gaining fundamental insights into their putative involvement in the pathogenesis of prostate tumors provide novel opportunities for the development of efficient and sophisticated therapeutic strategies in the future.

Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression.

PubMed

Forno, Irene; Ferrero, Stefano; Russo, Maria Veronica; Gazzano, Giacomo; Giangiobbe, Sara; Montanari, Emanuele; Del Nero, Alberto; Rocco, Bernardo; Albo, Giancarlo; Languino, Lucia R; Altieri, Dario C; Vaira, Valentina; Bosari, Silvano

2015-01-01

Most men diagnosed with prostate cancer will have an indolent and curable disease, whereas approximately 15% of these patients will rapidly progress to a castrate-resistant and metastatic stage with high morbidity and mortality. Therefore, the identification of molecular signature(s) that detect men at risk of progressing disease remains a pressing and still unmet need for these patients. Here, we used an integrated discovery platform combining prostate cancer cell lines, a Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) model and clinically-annotated human tissue samples to identify loss of expression of microRNA-34b as consistently associated with prostate cancer relapse. Mechanistically, this was associated with epigenetics silencing of the MIR34B/C locus and increased DNA copy number loss, selectively in androgen-dependent prostate cancer. In turn, loss of miR-34b resulted in downstream deregulation and overexpression of the "stemness" marker, Sox2. These findings identify loss of miR-34b as a robust biomarker for prostate cancer progression in androgen-sensitive tumors, and anticipate a potential role of progenitor/stem cell signaling in this stage of disease.

Identification of Epigenetic Changes in Prostate Cancer using Induced Pluripotent Stem Cells

DTIC Science & Technology

2013-04-01

0240 TITLE: Identification of Epigenetic Changes in Prostate Cancer using Induced Pluripotent Stem Cells PRINCIPAL INVESTIGATOR: Donna M...TITLE AND SUBTITLE I Identification of Epigenetic Changes in Prostate Cancer using 5a. CONTRACT NUMBER Induced Pluripotent Stem Cells ... stem cells (iPSCs). Comparison of gene and protein expression of these prostatic iPSCs and embryonic stem cells (ESCs) revealed similarities but

Epithelial-to-mesenchymal transition and estrogen receptor α mediated epithelial dedifferentiation mark the development of benign prostatic hyperplasia.

PubMed

Shao, Rui; Shi, Jiandang; Liu, Haitao; Shi, Xiaoyu; Du, Xiaoling; Klocker, Helmut; Lee, Chung; Zhu, Yan; Zhang, Ju

2014-06-01

Epithelial-to-mesenchymal transition (EMT) has been reported involved in the pathogenesis of fibrotic disorders and associated with stemness characteristics. Recent studies demonstrated that human benign prostatic hyperplasia (BPH) development involves accumulation of mesenchymal-like cells derived from the prostatic epithelium. However, the inductive factors of EMT in the adult prostate and the cause-and-effect relationship between EMT and stemness characteristics are not yet resolved. EMT expression patterns were immunohistochemically identified in the human epithelia of normal/BPH prostate tissue and in a rat BPH model induced by estrogen/androgen (E2/T, ratio 1:100) alone or in the presence of the ER antagonist raloxifene. Gene expression profiles were analyzed in micro-dissected prostatic epithelia of rat stimulated by E2/T for 3 days. Two main morphological features both accompanied with EMT were observed in the epithelia of human BPH. Luminal cells undergoing EMT dedifferentiated from a cytokeratin (CK) CK18(+) /CK8(+) /CK19(+) to a CK18(-) /CK8(+) /CK19(-) phenotype and CK14 expression increased in basal epithelial cells. ERα expression was closely related to these dedifferentiated cells and the expression of EMT markers. A similar pattern of EMT events was observed in the E2/T induced rat model of BPH in comparison to the prostates of untreated rats, which could be prevented by raloxifene. Epithelial and mesenchymal phenotype switching is an important mechanism in the etiology of BPH. ERα mediated enhanced estrogenic effect is a crucial inductive factor of epithelial dedifferentiation giving rise to activation of an EMT program in prostate epithelium. © 2014 Wiley Periodicals, Inc.

Enrichment of prostate cancer stem-like cells from human prostate cancer cell lines by culture in serum-free medium and chemoradiotherapy.

PubMed

Wang, Lei; Huang, Xing; Zheng, Xinmin; Wang, Xinghuan; Li, Shiwen; Zhang, Lin; Yang, Zhonghua; Xia, Zhiping

2013-01-01

The discovery of rare subpopulations of cancer stem cells (CSCs) has created a new focus in cancer research. As CSCs demonstrate resistance to chemoradiation therapy relative to other cancer cells, this allows the enrichment of CSC populations by killing apoptosis-susceptible cancer cells. In this study, three commonly used human prostate cancer (PCa) cell lines (DU145, PC-3 and LNCaP) were examined for their expression of the putative stem cell markers CD133 and CD44 via flow cytometric analysis. Under normal culture conditions, CD133(+)/CD44(+) cells were only present in the DU145 cell line, and comprised only a minor percentage (0.1% ± 0.01%) of the total population. However, the proportion of these CD133(+)/CD44(+) prostate CSCs could be increased in these cell lines via culture in serum-free medium (SFM), or through chemotherapy or radiotherapy. Indeed, after culture in SFM, the proportion of CD133(+)/CD44(+) cells in DU145 and PC-3 had increased to 10.3% and 3.0%, respectively. Moreover, the proportion had increased to 9.8% enriched by chemotherapy and 3.5% by radiotherapy in DU145. Colony-formation tests, cell invasion assays, and tumor xenografts in BALB/c nude mice were used to evaluate the stem cell properties of CD133(+)/CD44(+) PCa cells that were isolated via fluorescence-activated cell sorting (FACS). CD133(+)/CD44(+) cells had an enhanced colony-formation capability and invasive ability in vitro, and displayed greater tumorigenic properties in vivo. These results demonstrate the presence of CD133(+)/CD44(+) prostate CSCs in established PCa cell lines and that populations of these cells can be enriched by culture in SFM or chemoradiotherapy. Finding novel therapies to override chemoradiation resistance in the prostate CSCs is the key to improve long-term results in PCa management.

α-blockade, apoptosis, and prostate shrinkage: how are they related?

PubMed

Chłosta, Piotr; Drewa, Tomasz; Kaplan, Steven

2013-01-01

The α1-adrenoreceptor antagonists, such as terazosin and doxazosin, induce prostate programmed cell death (apoptosis) within prostate epithelial and stromal cells in vitro. This treatment should cause prostate volume decrease, However, this has never been observed in clinical conditions. The aim of this paper is to review the disconnect between these two processes. PubMed and DOAJ were searched for papers related to prostate, apoptosis, and stem cell death. The following key words were used: prostate, benign prostate hyperplasia, programmed cell death, apoptosis, cell death, α1-adrenoreceptor antagonist, α-blockade, prostate epithelium, prostate stroma, stem cells, progenitors, and in vitro models. We have shown how discoveries related to stem cells can influence our understanding of α-blockade treatment for BPH patients. Prostate epithelial and mesenchymal compartments have stem (progenitors) and differentiating cells. These compartments are described in relation to experimental in vitro and in vivo settings. Apoptosis is observed within prostate tissue, but this effect has no clinical significance and cannot lead to prostate shrinkage. In part, this is due to stem cells that are responsible for prostate tissue regeneration and are resistant to apoptosis triggered by α1-receptor antagonists.

Proximal location of mouse prostate epithelial stem cells

PubMed Central

Tsujimura, Akira; Koikawa, Yasuhiro; Salm, Sarah; Takao, Tetsuya; Coetzee, Sandra; Moscatelli, David; Shapiro, Ellen; Lepor, Herbert; Sun, Tung-Tien; Wilson, E. Lynette

2002-01-01

Stem cells are believed to regulate normal prostatic homeostasis and to play a role in the etiology of prostate cancer and benign prostatic hyperplasia. We show here that the proximal region of mouse prostatic ducts is enriched in a subpopulation of epithelial cells that exhibit three important attributes of epithelial stem cells: they are slow cycling, possess a high in vitro proliferative potential, and can reconstitute highly branched glandular ductal structures in collagen gels. We propose a model of prostatic homeostasis in which mouse prostatic epithelial stem cells are concentrated in the proximal region of prostatic ducts while the transit-amplifying cells occupy the distal region of the ducts. This model can account for many biological differences between cells of the proximal and distal regions, and has implications for prostatic disease formation. PMID:12082083

Prostate cancer targeting motifs: expression of αν β3, neurotensin receptor 1, prostate specific membrane antigen, and prostate stem cell antigen in human prostate cancer cell lines and xenografts.

PubMed

Taylor, Robert M; Severns, Virginia; Brown, David C; Bisoffi, Marco; Sillerud, Laurel O

2012-04-01

Membrane receptors are frequent targets of cancer therapeutic and imaging agents. However, promising in vitro results often do not translate to in vivo clinical applications. To better understand this obstacle, we measured the expression differences in receptor signatures among several human prostate cancer cell lines and xenografts as a function of tumorigenicity. Messenger RNA and protein expression levels for integrin α(ν) β(3), neurotensin receptor 1 (NTSR1), prostate specific membrane antigen (PSMA), and prostate stem cell antigen (PSCA) were measured in LNCaP, C4-2, and PC-3 human prostate cancer cell lines and in murine xenografts using quantitative reverse transcriptase polymerase chain reaction, flow cytometry, and immunohistochemistry. Stable expression patterns were observed for integrin α(ν) and PSMA in all cells and corresponding xenografts. Integrin β(3) mRNA expression was greatly reduced in C4-2 xenografts and greatly elevated in PC-3 xenografts compared with the corresponding cultured cells. NTSR1 mRNA expression was greatly elevated in LNCaP and PC-3 xenografts. PSCA mRNA expression was elevated in C4-2 xenografts when compared with C4-2 cells cultured in vitro. Furthermore, at the protein level, PSCA was re-expressed in all xenografts compared with cells in culture. The regulation of mRNA and protein expression of the cell-surface target proteins α(ν) β(3), NTSR1, PSMA, and PSCA, in prostate cancer cells with different tumorigenic potential, was influenced by factors of the microenvironment, differing between cell cultures and murine xenotransplants. Integrin α(ν) β(3), NTRS1 and PSCA mRNA expression increased with tumorigenic potential, but mRNA expression levels for these proteins do not translate directly to equivalent expression levels of membrane bound protein. Copyright © 2011 Wiley Periodicals, Inc.

s-SHIP expression identifies a subset of murine basal prostate cells as neonatal stem cells

PubMed Central

Brocqueville, Guillaume; Chmelar, Renee S.; Bauderlique-Le Roy, Hélène; Deruy, Emeric; Tian, Lu; Vessella, Robert L.; Greenberg, Norman M.; Bourette, Roland P.

2016-01-01

Isolation of prostate stem cells (PSCs) is crucial for understanding their biology during normal development and tumorigenesis. In this aim, we used a transgenic mouse model expressing GFP from the stem cell-specific s-SHIP promoter to mark putative stem cells during postnatal prostate development. Here we show that cells identified by GFP expression are present transiently during early prostate development and localize to the basal cell layer of the epithelium. These prostate GFP+ cells are a subpopulation of the Lin− CD24+ Sca-1+ CD49f+ cells and are capable of self-renewal together with enhanced growth potential in sphere-forming assay in vitro, a phenotype consistent with that of a PSC population. Transplantation assays of prostate GFP+ cells demonstrate reconstitution of prostate ducts containing both basal and luminal cells in renal grafts. Altogether, these results demonstrate that s-SHIP promoter expression is a new marker for neonatal basal prostate cells exhibiting stem cell properties that enables PSCs in situ identification and isolation via a single consistent parameter. Transcriptional profiling of these GFP+ neonatal stem cells showed an increased expression of several components of the Wnt signaling pathway. It also identified stem cell regulators with potential applications for further analyses of normal and cancer stem cells. PMID:27081082

Chemical Suppression of the Reactivated Androgen Signaling Pathway in Androgen-Independent Prostate Cancer

DTIC Science & Technology

2011-07-01

when it is ingested during pregnancy [20,21]. Aside from its role in development, Hh signaling also supports stem cells in adult tissues [22-24]. However...For the mo.~t commonly uti - lized human prostate cancer cell lines (LNCaP and derivatives, DUI45, PC3 or CWR22rvl) grown in culture, Shh, Glil/2 and

Keratin 13 expression reprograms bone and brain metastases of human prostate cancer cells.

PubMed

Li, Qinlong; Yin, Lijuan; Jones, Lawrence W; Chu, Gina C-Y; Wu, Jason B-Y; Huang, Jen-Ming; Li, Quanlin; You, Sungyong; Kim, Jayoung; Lu, Yi-Tsung; Mrdenovic, Stefan; Wang, Ruoxiang; Freeman, Michael R; Garraway, Isla; Lewis, Michael S; Chung, Leland W K; Zhau, Haiyen E

2016-12-20

Lethal progression of prostate cancer metastasis can be improved by developing animal models that recapitulate the clinical conditions. We report here that cytokeratin 13 (KRT13), an intermediate filament protein, plays a directive role in prostate cancer bone, brain, and soft tissue metastases. KRT13 expression was elevated in bone, brain, and soft tissue metastatic prostate cancer cell lines and in primary and metastatic clinical prostate, lung, and breast cancer specimens. When KRT13 expression was determined at a single cell level in primary tumor tissues of 44 prostate cancer cases, KRT13 level predicted bone metastasis and the overall survival of prostate cancer patients. Genetically enforced KRT13 expression in human prostate cancer cell lines drove metastases toward mouse bone, brain and soft tissues through a RANKL-independent mechanism, as KRT13 altered the expression of genes associated with EMT, stemness, neuroendocrine/neuromimicry, osteomimicry, development, and extracellular matrices, but not receptor activator NF-κB ligand (RANKL) signaling networks in prostate cancer cells. Our results suggest new inhibitors targeting RANKL-independent pathways should be developed for the treatment of prostate cancer bone and soft tissue metastases.

MiR-141-3p promotes prostate cancer cell proliferation through inhibiting kruppel-like factor-9 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jiu-zhi; Department of Urology, People's Hospital of Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang, 830001; Li, Jia

Evidence has revealed that some microRNAs play a critical role in tumor proliferation. We demonstrated that miR-141-3p appears to be a novel oncogene miRNA, which promotes prostate tumorigenesis and facilitates the stemness of prostate cancer cells via suppressing a key transcription factor kruppel-like factor-9 (KLF9). KLF9 is the core effector protein that might suppress tumor growth. MiR-141-3p is upregulated in prostate cancer cells and tissues compared to non-tumorigenic prostate epithelial cells and prostate tissues. MiR-141-3p positively regulated proliferation, spheroid formation, and expression of the stemness factors OCT-4, Nanog, SOX-9, Bmil, CCND1, and CD44 in PC-3 cells. Restoration of miR-141-3p suppresses themore » expression of the transcription factor KLF9 in PC-3 and accelerates prostate tumorigenesis via targeted binding with its 3′-UTR. Downregulation of KLF9 enhances spheres formation of prostate cancer cells. Our results suggest that miR-141-3p/KLF9 may play an important role in regulating the growth of prostate cancer and is a potential target of prevention and therapy. - Highlights: • MiR-141-3p is upregulated in human prostate cancer. • MiR-141-3p induces cell proliferation and apoptosis resistance. • KLF9 is a direct and functional target of miR-141-3p.« less

Stem cells in prostate cancer initiation and progression

PubMed Central

Lawson, Devon A.; Witte, Owen N.

2007-01-01

Peter Nowell and David Hungerford’s discovery of the Philadelphia chromosome facilitated many critical studies that have led to a paradigm shift in our understanding of cancer as a disease of stem cells. This Review focuses on the application of these concepts to investigation of the role of stem cells in prostate cancer initiation and progression. Major strides in the development of in vitro and in vivo assays have enabled identification and characterization of prostate stem cells as well as functional evaluation of the tumorigenic effects of prostate cancer–related genetic alterations. PMID:17671638

Targeting Tumor Oct4 to Deplete Prostate Tumor- and Metastasis-Initiating Cells

DTIC Science & Technology

2015-10-01

and stem cell To investigate whether POU5F1B overrxpression can induce cancer stem cell -related genes expression, we did cancer stem cell ...future 15. SUBJECT TERMS OCT4, cancer stem cells , prostate cancer, metastasis, tumor formation 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT...described in last report. Here we describe some findings previously not reported. 1.1 POU5F1B expression in prostatic tissue As cancer stem cell marker

Chondroitin sulfatases differentially regulate Wnt signaling in prostate stem cells through effects on SHP2, phospho-ERK1/2, and Dickkopf Wnt signaling pathway inhibitor (DKK3)

PubMed Central

Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

2017-01-01

The chondroitin sulfatases N-acetylgalactosamine-4-sulfatase (ARSB) and galactosamine-N-acetyl-6-sulfatase (GALNS) remove either the 4-sulfate group at the non-reducing end of chondroitin 4-sulfate (C4S) and dermatan sulfate, or the 6-sulfate group of chondroitin 6-sulfate, chondroitin 4,6-disulfate (chondroitin sulfate E), or keratan sulfate. In human prostate cancer tissues, the ARSB activity was reduced and the GALNS activity was increased, compared to normal prostate tissue. In human prostate stem cells, when ARSB was reduced by silencing or GALNS was increased by overexpression, activity of SHP2, the ubiquitous non-receptor tyrosine phosphatase, declined, attributable to increased binding of SHP2 with C4S. This led to increases in phospho-ERK1/2, Myc/Max nuclear DNA binding, DNA methyltransferase (DNMT) activity and expression, and methylation of the Dickkopf Wnt signaling pathway inhibitor (DKK)3 promoter and to reduced DKK3 expression. Since DKK3 negatively regulates Wnt/β-catenin signaling, silencing of ARSB or overexpression of GALNS disinhibited (increased) Wnt/β-catenin signaling. These findings indicate that the chondroitin sulfatases can exert profound effects on Wnt-mediated processes, due to epigenetic effects that modulate Wnt signaling. PMID:29245974

Mesenchymal Stem Cell Based Therapy for Prostate Cancer

DTIC Science & Technology

2015-11-01

Award Number: W81XWH-13-1-0304 TITLE: Mesenchymal Stem Cell-Based Therapy for Prostate Cancer PRINCIPAL INVESTIGATOR: John Isaacs CONTRACTING...TITLE AND SUBTITLE Mesenchymal Stem Cell-Based Therapy for Prostate Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0304 5c. PROGRAM ELEMENT...effective therapy for castrate resistant metastatic prostate cancer (CRPC). Based upon a substantial published literature from multiple groups, as well as

Stem cells in genetically-engineered mouse models of prostate cancer

PubMed Central

Shibata, Maho; Shen, Michael M.

2015-01-01

The cancer stem cell model proposes that tumors have a hierarchical organization in which tumorigenic cells give rise to non-tumorigenic cells, with only a subset of stem-like cells able to propagate the tumor. In the case of prostate cancer, recent analyses of genetically engineered mouse (GEM) models have provided evidence supporting the existence of cancer stem cells in vivo. These studies suggest that cancer stem cells capable of tumor propagation exist at various stages of tumor progression from prostatic intraepithelial neoplasia (PIN) to advanced metastatic and castration-resistant disease. However, studies of stem cells in prostate cancer have been limited by available approaches for evaluating their functional properties in cell culture and transplantation assays. Given the role of the tumor microenvironment and the putative cancer stem cell niche, future studies using GEM models to analyze cancer stem cells in their native tissue microenvironment are likely to be highly informative. PMID:26341780

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2014-10-01

G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human...1, OCT3/4, Hedgehog (Hh), Wnt/β-catenin, Notch signaling, Hox gene family, PTEN/Akt pathway, efflux transporters such as ABCG markers of self...105-111 (2001). 50. Liu, S., et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer

Inhibition of FOXC2 restores epithelial phenotype and drug sensitivity in prostate cancer cells with stem-cell properties

PubMed Central

Paranjape, A N; Soundararajan, R; Werden, S J; Joseph, R; Taube, J H; Liu, H; Rodriguez-Canales, J; Sphyris, N; Wistuba, I; Miura, N; Dhillon, J; Mahajan, N; Mahajan, K; Chang, J T; Ittmann, M; Maity, S N; Logothetis, C; Tang, D G; Mani, S A

2016-01-01

Advanced prostate adenocarcinomas enriched in stem-cell features, as well as variant androgen receptor (AR)-negative neuroendocrine (NE)/small-cell prostate cancers are difficult to treat, and account for up to 30% of prostate cancer-related deaths every year. While existing therapies for prostate cancer such as androgen deprivation therapy (ADT), destroy the bulk of the AR-positive cells within the tumor, eradicating this population eventually leads to castration-resistance, owing to the continued survival of AR-/lo stem-like cells. In this study, we identified a critical nexus between p38MAPK signaling, and the transcription factor Forkhead Box Protein C2 (FOXC2) known to promote cancer stem-cells and metastasis. We demonstrate that prostate cancer cells that are insensitive to ADT, as well as high-grade/NE prostate tumors, are characterized by elevated FOXC2, and that targeting FOXC2 using a well-tolerated p38 inhibitor restores epithelial attributes and ADT-sensitivity, and reduces the shedding of circulating tumor cells in vivo with significant shrinkage in the tumor mass. This study thus specifies a tangible mechanism to target the AR-/lo population of prostate cancer cells with stem-cell properties. PMID:26804168

Comparative characterization of stem cell marker expression, metabolic activity and resistance to doxorubicin in adherent and spheroid cells derived from the canine prostate adenocarcinoma cell line CT1258.

PubMed

Liu, Wen; Moulay, Mohammed; Willenbrock, Saskia; Roolf, Catrin; Junghanss, Christian; Ngenazahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo

2015-04-01

Canine prostate cancer represents a spontaneous animal model for the human counterpart. Cells with stem cell-like character are considered to play a major role in therapeutic resistance and tumor relapse. Thus, the identification of markers allowing for recognition and characterization of these cells is essential. Expression of 12 stem cell marker genes in the canine prostate cancer cell line CT1258 and spheroid cells generated from these was analyzed by quantitative real-time PCR. In CT1258 and the generated spheroid cells, CD44 and CD133 expression was analyzed by flow cytometry, as well as proliferation and doxorubicin resistance. Integrin alpha-6 (ITGA6) expression and metabolic activity were significantly up-regulated in CT1258-derived spheroid cells, while doxorubicin resistance remained comparable. ITGA6 de-regulation and metabolic activity appear to be characteristic of the generated spheres, indicating potential intervention targets. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Enrichment of putative prostate cancer stem cells after androgen deprivation: upregulation of pluripotency transactivators concurs with resistance to androgen deprivation in LNCaP cell lines.

PubMed

Seiler, Daniel; Zheng, Junying; Liu, Gentao; Wang, Shunyou; Yamashiro, Joyce; Reiter, Robert E; Huang, Jiaoti; Zeng, Gang

2013-09-01

Prostate cancer stem cells (PCSC) offer theoretical explanations to many clinical and biological behaviors of the disease in human. In contrast to approaches of using side populations and cell-surface markers to isolate and characterize the putative PCSC, we hypothesize that androgen deprivation leads to functional enrichment of putative PCSC. Human prostate cancer lines LNCaP, LAPC4 and LAPC9 were depleted of androgen in cell cultures and in castrated SCID mice. The resultant androgen deprivation-resistant or castration-resistant populations, in particular in LNCaP and its derivative cell lines, displayed increased expression of pluripotency transactivators and significantly higher tumorigenicity. Individual tumor cell clones were isolated from castration-resistant bulk cultures of LNCaP (CR-LNCaP) and tested for tumorigenicity in male SCID mice under limiting dilution conditions. As few as 200 cells were able to form spheres in vitro, and generate tumors with similar growth kinetics as 10(6) LNCaP or 10(4) CR-LNCaP cells in vivo. These putative PCSC were CD44(+) /CD24(-) and lack the expression of prostate lineage proteins. When transplanted into the prostate of an intact male SCID mouse, these putative PCSC seemed to show limited differentiation into Ck5(+) , Ck8(+) , Ck5(+) /Ck8(+) , and AR(+) cells. On the other hand, stable transduction of LNCaP with retrovirus encoding Sox2 led to androgen-deprivation resistant growth and down-regulation of major prostate lineage gene products in vitro. Concurrence of overexpression of pluripotency transactivators and resistance to androgen deprivation supported the role of putative PCSC in the emergence of prostate cancer resistant to androgen deprivation. © 2013 Wiley Periodicals, Inc.

Quantification of Mesenchymal Stem Cells (MSCs) at sites of human prostate cancer.

PubMed

Brennen, W Nathaniel; Chen, Shuangling; Denmeade, Samuel R; Isaacs, John T

2013-01-01

Circulating bone marrow-derived Mesenchymal Stem Cells (BM-MSCs) have an innate tropism for tumor tissue in response to the inflammatory microenvironment present in malignant lesions. The prostate is bombarded by numerous infectious and inflammatory insults over a lifetime. Chronic inflammation is associated with CXCL12, CCL5, and CCL2, which are highly overexpressed in prostate cancer. Among other cell types, these chemoattractant stimuli recruit BM-MSCs to the tumor. MSCs are minimally defined as plastic-adhering cells characterized by the expression of CD90, CD73, and CD105 in the absence of hematopoietic markers, which can differentiate into osteoblasts, chondrocytes, and adipocytes. MSCs are immunoprivileged and have been implicated in tumorigenesis through multiple mechanisms, including promoting proliferation, angiogenesis, and metastasis, in addition to the generation of an immunosuppressive microenvironment. We have demonstrated that MSCs represent 0.01-1.1% of the total cells present in core biopsies from primary human prostatectomies. Importantly, these analyses were performed on samples prior to expansion in tissue culture. MSCs in these prostatectomy samples are FAP-, CD90-, CD73-, and CD105-positive, and CD14-, CD20-, CD34-, CD45-, and HLA-DR-negative. Additionally, like BM-MSCs, these prostate cancer-derived stromal cells (PrCSCs) were shown to differentiate into osteoblasts, adipocytes and chondrocytes. In contrast to primary prostate cancer-derived epithelial cells, fluorescently-labeled PrCSCs and BM-MSCs were both shown to home to CWR22RH prostate cancer xenografts following IV injection. These studies demonstrate that not only are MSCs present in sites of prostate cancer where they may contribute to carcinogenesis, but these cells may also potentially be used to deliver cytotoxic or imaging agents for therapeutic and/or diagnostic purposes.

Pim-1: A Molecular Target to Modulate Cellular Resistance to Therapy in Prostate Cancer

DTIC Science & Technology

2005-10-01

Reiter RE, Lilly MB: Gene expression profiling in R- flurbiprofen -treated prostate cancer: Identification of prostate stem cell antigen as a... flurbiprofen -regulated gene. (submitted, 2006). 51. Holder SL, Zemskova M, Bremner R, Neidigh J, Lilly MB: Identification of specific, cell-permeable...profiling in R- flurbiprofen - treated prostate cancer: Identification of prostate stem cell antigen as a flurbiprofen - regulated gene. (poster

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

PHF21B overexpression promotes cancer stem cell-like traits in prostate cancer cells by activating the Wnt/β-catenin signaling pathway.

PubMed

Li, Qiji; Ye, Liping; Guo, Wei; Wang, Min; Huang, Shuai; Peng, Xinsheng

2017-06-23

PHF21B is newly identified to be involved in the tumor progression; however, its biological role and molecular mechanism in prostate cancer have not been defined. This study is aimed to study the role of PHF21B in the progression of prostate cancer. Real-time PCR, immunohistochemistry and western blotting analysis were used to determine PHF21B expression in prostate cancer cell lines and clinical specimens. The role of PHF21B in maintaining prostate cancer stem cell-like phenotype was examined by tumor-sphere formation assay and expression levels of stem cell markers. Luciferase reporter assay, western blot analysis, enzyme-linked immunosorbent assay and ChIP assay were used to determine whether PHF21B activates the Wnt/β-catenin signaling by transcriptionally downregulating SFRP1 and SFRP2. Our results revealed that PHF21B was markedly upregulated in prostate cancer cell lines and tissues. High PHF21B levels predicted poorer recurrence-free survival in prostate cancer patients. Gain-of-function and loss-of-function studies showed that overexpression of PHF21B enhanced, while downregulation suppressed, the cancer stem cell-like phenotype in prostate cancer cells. Xenograft tumor model showed that silencing PHF21B decreased the ability of tumorigenicity in vivo. Notably, Wnt/β-catenin signaling was hyperactivated in prostate cancer cells overexpressing PHF21B, and mediated PHF21B-induced cancer stem cell-like phenotype. Furthermore, PHF21B suppressed repressors of the Wnt/β-catenin signaling cascade, including SFRP1 and SFRP2. These results demonstrated that PHF21B constitutively activated wnt/β-catenin signaling by transcriptionally downregulating SFRP1 and SFRP2, which promotes prostate cancer stem cell-like phenotype. Our results revealed that PHF21B functions as an oncogene in prostate cancer, and may represent a promising prognostic biomarker and an attractive candidate for target therapy of prostate cancer.

Low Testosterone Alters the Activity of Mouse Prostate Stem Cells.

PubMed

Zhou, Ye; Copeland, Ben; Otto-Duessel, Maya; He, Miaoling; Markel, Susan; Synold, Tim W; Jones, Jeremy O

2017-04-01

Low serum testosterone (low T) has been repeatedly linked to worse outcomes in men with newly diagnosed prostate cancer (PC). How low T contributes to these outcomes is unknown. Here we demonstrate that exposure to low T causes significant changes in the mouse prostate and prostate stem cells. Mice were castrated and implanted with capsules to achieve castrate, normal, or sub-physiological levels of T. After 6 weeks of treatment, LC-MS/MS was used to quantify the levels of T and dihydrotestosterone (DHT) in serum and prostate tissue. FACS was used to quantify the percentages of purported prostate stem and transit amplifying (TA) cells in mouse prostates. Prostate tissues were also stained for the presence of CD68+ cells and RNA was extracted from prostate tissue or specific cell populations to measure changes in transcript levels with low T treatment. Despite having significantly different levels of T and DHT in the serum, T and DHT concentrations in prostate tissue from different T treatment groups were similar. Low T treatment resulted in significant alterations in the expression of androgen biosynthesis genes, which may be related to maintaining prostate androgen levels. Furthermore, the expression of androgen-regulated genes in the prostate was similar among all T treatment groups, demonstrating that the mouse prostate can maintain functional levels of androgens despite low serum T levels. Low T increased the frequency of prostate stem and TA cells in adult prostate tissue and caused major transcriptional changes in those cells. Gene ontology analysis suggested that low T caused inflammatory responses and immunofluorescent staining indicated that low T treatment led to the increased presence of CD68+ macrophages in prostate tissue. Low T alters the AR signaling axis which likely leads to maintenance of functional levels of prostate androgens. Low T also induces quantitative and qualitative changes in prostate stem cells which appear to lead to inflammatory macrophage infiltration. These changes are proposed to lead to an aggressive phenotype once cancers develop and may contribute to the poor outcomes in men with low T. Prostate 77:530-541, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Zoledronic acid overcomes chemoresistance by sensitizing cancer stem cells to apoptosis.

PubMed

Rouhrazi, H; Turgan, N; Oktem, G

2018-01-01

Unlike low tumorigenic bulk tumor cells (non-CSCs), cancer stem cells (CSCs) are a subset of tumor cells that can self-renew and differentiate into different cancer subtypes. CSCs are considered responsible for tumor recurrence, distant metastasis, angiogenesis, and drug or radiation resistance. CSCs also are resistant to apoptosis. Zoledronic acid (ZA) is a third generation bisphosphonate that reduces cell proliferation and exhibits anti-tumor effects by inducing cell death in some malignancies; however, the effects of ZA on CSCs are unclear. We investigated the anti-cancer effects of ZA on two epithelial cancer cell lines, prostate DU-145 and breast MCF7, focusing primarily on induction and activation of apoptosis. Cluster of differentiation (CD) 133 + /CD44 + prostate CSCs and CD 44 + /CD24 breast CSCs were isolated from the DU-145 human prostate cancer and MCF-7 human breast cancer cell lines, respectively, using FACSAria flow cytometry cell sorting. CSCs and non-CSCs were exposed to increasing concentrations of ZA for 24, 48 and 72 h to determine the IC 50 dose. Annexin-V assay for detecting cell death and cell cycle was performed using the Muse™ Cell Analyzer. Prostate CSCs and non-CSCs were assayed by quantitative reverse transcription PCR (qRT-PCR) array for detecting 84 key apoptosis related genes. Gene regulation at the protein level was investigated by immunofluorescence. ZA caused a dose- and time-dependent decrease in cell viability. Treatment with ZA resulted in a concomitant increase in apoptosis and cell cycle arrest at S-phase in CSCs. Significant over/under-expressions were detected in seven of the genes of ZA-treated DU-145 CSCs cells. Expressions of CASP9, CASP4, BAX and BAD genes increased, while the expressions of BIRC3, BIRC2 and BCL2 genes decreased. In the DU-145 non-CSCs, five genes exhibited changes in gene expression after ZA treatment, two exhibited increased expression (CASP7 and BAD) and three exhibited decreased expression (BIRC3, BIRC2 and BCL2). ZA caused cell death of drug resistant breast MCF-7 and prostate DU-145 cancer stem cells by activating apoptosis. ZA can facilitate the intrinsic pathway of apoptosis in human prostate CSCs by down-regulating anti-apoptotic genes and up-regulating pro-apoptotic genes. ZA may be an effective therapeutic agent for targeting chemoresistance in CSCs.

The Function of Neuroendocrine Cells in Prostate Cancer

DTIC Science & Technology

2015-06-20

Comprehensive Cancer Center and 4Broad Center for Regenerative Medicine and Stem Cell Biology, David Geffen School of Medicine at UCLA, 10833 Le Conte... Regenerative Medicine and Stem Cell Research, UCLA David Geffen School of Medicine , Los Angeles, California. 2Department of Urology, The First...progress in prostate cancer. Soochou University Annual Translational Medicine Meeting, Suzhou, China, November 2013 21. Prostate Cancer Stem Cells

Hyper-expression of PAX2 in human metastatic prostate tumors and its role as a cancer promoter in an in vitro invasion model.

PubMed

Ueda, Takashi; Ito, Saya; Shiraishi, Takumi; Kulkarni, Prakash; Ueno, Akihisa; Nakagawa, Hideo; Kimura, Yasunori; Hongo, Fumiya; Kamoi, Kazumi; Kawauchi, Akihiro; Miki, Tsuneharu

2013-09-01

Metastasis is a consequence of many biological events, during which cancer stem cells are shifted into a malignant state. Among these events, invasion of prostate cancer cells into host tissues is possible to be assessed by means of an in vitro invasion model, and is thought to be coupled to altered expression of membrane proteins. Dysregulated functions of the factors regulating organogenesis during embryogenesis are known to facilitate metastasis of many types of cancers. PAX2 (paired box 2) is a member of the PAX transcription factor family, which regulates prostatic ductal growth and branching in organogenesis of mammalian prostates. However, the role of PAX2 in prostate cancer development remains to be determined. PAX2 expression in human prostate cancers and normal prostate epithelium were examined by quantitative RT-PCR and immunohistochemistry. Matrigel invasion assay and a gene array analysis were performed using prostate cancer cell lines transfected with either control or PAX2 siRNA. In human prostate cancers, PAX2 was hyper-expressed in metastatic cancers, but was expressed at lower levels in non-metastatic cancers. Consistent with this, PAX2 knockdown repressed cell growth and invasion in a Matrigel invasion assay. Gene ontology analysis revealed that many cell membrane proteins were downregulated after PAX2 knockdown. Our data suggested that PAX2 hyper-expression promotes the development of the metastatic state in prostate cancer cells, presumably through upregulating the expression of cell membrane proteins. Copyright © 2013 Wiley Periodicals, Inc.

Mesenchymal stem cells as a vector for the inflammatory prostate microenvironment

PubMed Central

Brennen, W Nathaniel; Denmeade, Samuel R; Isaacs, John T

2014-01-01

Mesenchymal stem cells (MSCs) have an inherent tropism for sites of inflammation, which are frequently present in sites of cancer, including prostatic lesions. MSCs have been defined as CD73/CD90/CD105 triple-positive cells in the absence of hematopoietic lineage markers with the ability to differentiate into multiple mesodermal lineages, including osteoblasts, adipocytes, and chondrocytes. Our group has previously demonstrated that MSCs represent between 0.01 and 1.1% of the total cells present in human prostatectomy tissue. In addition to their multi-lineage differentiation potential, MSCs are immunoprivileged in nature and have a range of immunomodulatory effects on both the innate and adaptive arms of the immune system. MSCs have been detected in an increasing array of tissues, and evidence suggests that they are likely present in perivascular niches throughout the body. These observations suggest that MSCs represent critical mediators of the overall immune response during physiological homeostasis and likely contribute to pathophysiological conditions as well. Chronic inflammation has been suggested as an initiating event and progression factor in prostate carcinogenesis, a process in which the immunosuppressive properties of MSCs may play a role. MSCs have also been shown to influence malignant progression through a variety of other mechanisms, including effects on tumor proliferation, angiogenesis, survival, and metastasis. Additionally, human bone marrow-derived MSCs have been shown to traffic to human prostate cancer xenografts in immunocompromised murine hosts. The trafficking properties and immunoprivileged status of MSCs suggest that they can be exploited as an allogeneic cell-based vector to deliver cytotoxic or diagnostic agents for therapy. PMID:23975882

SHBG Is an Important Factor in Stemness Induction of Cells by DHT In Vitro and Associated with Poor Clinical Features of Prostate Carcinomas

PubMed Central

Ma, Yuanyuan; Liang, Dongming; Liu, Jian; Wen, Jian-Guo; Servoll, Einar; Waaler, Gudmund; Sæter, Thorstein; Axcrona, Karol; Vlatkovic, Ljiljana; Axcrona, Ulrika; Paus, Elisabeth; Yang, Yue; Zhang, Zhiqian; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2013-01-01

Androgen plays a vital role in prostate cancer development. However, it is not clear whether androgens influence stem-like properties of prostate cancer, a feature important for prostate cancer progression. In this study, we show that upon DHT treatment in vitro, prostate cancer cell lines LNCaP and PC-3 were revealed with higher clonogenic potential and higher expression levels of stemness related factors CD44, CD90, Oct3/4 and Nanog. Moreover, sex hormone binding globulin (SHBG) was also simultaneously upregulated in these cells. When the SHBG gene was blocked by SHBG siRNA knock-down, the induction of Oct3/4, Nanog, CD44 and CD90 by DHT was also correspondingly blocked in these cells. Immunohistochemical evaluation of clinical samples disclosed weakly positive, and areas negative for SHBG expression in the benign prostate tissues, while most of the prostate carcinomas were strongly positive for SHBG. In addition, higher levels of SHBG expression were significantly associated with higher Gleason score, more seminal vesicle invasions and lymph node metastases. Collectively, our results show a role of SHBG in upregulating stemness of prostate cancer cells upon DHT exposure in vitro, and SHBG expression in prostate cancer samples is significantly associated with poor clinicopathological features, indicating a role of SHBG in prostate cancer progression. PMID:23936228

Prostate Cancer Stem-Like Cells | Center for Cancer Research

Cancer.gov

Prostate cancer is the third leading cause of cancer-related death among men, killing an estimated 27,000 men each year in the United States. Men with advanced prostate cancer often become resistant to conventional therapies. Many researchers speculate that the emergence of resistance is due to the presence of cancer stem cells, which are believed to be a small subpopulation of tumor cells that can self-renew and give rise to more differentiated tumor cells. It is thought that these stem cells survive initial therapies (such as chemotherapy and hormone therapy) and then generate new tumor cells that are resistant to these standard treatments. If prostate cancer stem cells could be identified and characterized, it might be possible to design treatments that prevent resistance.

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2015-05-01

GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

The many ways to make a luminal cell and a prostate cancer cell.

PubMed

Strand, Douglas W; Goldstein, Andrew S

2015-12-01

Research in the area of stem/progenitor cells has led to the identification of multiple stem-like cell populations implicated in prostate homeostasis and cancer initiation. Given that there are multiple cells that can regenerate prostatic tissue and give rise to prostate cancer, our focus should shift to defining the signaling mechanisms that drive differentiation and progenitor self-renewal. In this article, we will review the literature, present the evidence and raise important unanswered questions that will help guide the field forward in dissecting critical mechanisms regulating stem-cell differentiation and tumor initiation. © 2015 Society for Endocrinology.

Identification of multipotent mesenchymal stromal cells in the reactive stroma of a prostate cancer xenograft by side population analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santamaria-Martinez, Albert; Universitat de Barcelona, Barcelona; Barquinero, Jordi

2009-10-15

Cancer stem cells are a distinct cellular population that is believed to be responsible for tumor initiation and maintenance. Recent data suggest that solid tumors also contain another type of stem cells, the mesenchymal stem cells or multipotent mesenchymal stromal cells (MSCs), which contribute to the formation of tumor-associated stroma. The Hoechst 33342 efflux assay has proved useful to identify a rare cellular fraction, named Side Population (SP), enriched in cells with stem-like properties. Using this assay, we identified SP cells in a prostate cancer xenograft containing human prostate cancer cells and mouse stromal cells. The SP isolation, subculture andmore » sequential sorting allowed the generation of single-cell-derived clones of murine origin that were recognized as MSC by their morphology, plastic adherence, proliferative potential, adipogenic and osteogenic differentiation ability and immunophenotype (CD45{sup -}, CD81{sup +} and Sca-1{sup +}). We also demonstrated that SP clonal cells secrete transforming growth factor {beta}1 (TGF-{beta}1) and that their inhibition reduces proliferation and accelerates differentiation. These results reveal the existence of SP cells in the stroma of a cancer xenograft, and provide evidence supporting their MSC nature and the role of TGF-{beta}1 in maintaining their proliferation and undifferentiated status. Our data also reveal the usefulness of the SP assay to identify and isolate MSC cells from carcinomas.« less

Identification of multipotent mesenchymal stromal cells in the reactive stroma of a prostate cancer xenograft by side population analysis.

PubMed

Santamaria-Martínez, Albert; Barquinero, Jordi; Barbosa-Desongles, Anna; Hurtado, Antoni; Pinós, Tomàs; Seoane, Joan; Poupon, Marie-France; Morote, Joan; Reventós, Jaume; Munell, Francina

2009-10-15

Cancer stem cells are a distinct cellular population that is believed to be responsible for tumor initiation and maintenance. Recent data suggest that solid tumors also contain another type of stem cells, the mesenchymal stem cells or multipotent mesenchymal stromal cells (MSCs), which contribute to the formation of tumor-associated stroma. The Hoechst 33342 efflux assay has proved useful to identify a rare cellular fraction, named Side Population (SP), enriched in cells with stem-like properties. Using this assay, we identified SP cells in a prostate cancer xenograft containing human prostate cancer cells and mouse stromal cells. The SP isolation, subculture and sequential sorting allowed the generation of single-cell-derived clones of murine origin that were recognized as MSC by their morphology, plastic adherence, proliferative potential, adipogenic and osteogenic differentiation ability and immunophenotype (CD45(-), CD81(+) and Sca-1(+)). We also demonstrated that SP clonal cells secrete transforming growth factor beta1 (TGF-beta1) and that their inhibition reduces proliferation and accelerates differentiation. These results reveal the existence of SP cells in the stroma of a cancer xenograft, and provide evidence supporting their MSC nature and the role of TGF-beta1 in maintaining their proliferation and undifferentiated status. Our data also reveal the usefulness of the SP assay to identify and isolate MSC cells from carcinomas.

Bone Marrow-derived Mesenchymal Stem Cells (MSCs) as a Selective Delivery Vehicle for a PSA-Activated Protoxin for Advanced Prostate Cancer

DTIC Science & Technology

2014-04-01

other groups are seeking to develop MSCs as vectors to deliver prostate - specific antigen (PSA)-activated prodrugs (Denmeade et al. 2003) and protoxins...Denmeade SR, Jakobsen CM, Janssen S, Khan SR, Garrett ES, Lilja H, Christensen SB & Isaacs JT 2003 Prostate - specific antigen -activated thapsigargin...cells derived from benign prostatic hyperplasia specimens possess stem cell like property. Prostate 67 1265–1276. (doi:10.1002/ pros .20599) Lin G, Yang R

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2011-08-01

and ability to induce prostate tubule formation in vivo. FISH analysis of prostaspheres derived from patient specimens containing the TMPRSS-ERG...hybridization (FISH)[6]. Analysis of prostate tumor surgical cohorts have found 36-78% of prostate cancers possess the TMPRSS-ERG fusion[6]. We wondered...suggest that cancer stem/early progenitor cells can be expanded in our cultures. 6 To test the feasibility of this approach, FISH analysis was

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2011-02-01

2Departmentof Pathologyand LaboratoryMedicine,DavidGeffen SchoolofMedicine, Universityof Californiaat Los Angeles, Los Angeles,California...Invitrogen, ant-pm-1) and incubated at 378C in humidified air containing 5% CO2. Due to technical issues with cultivating and maintaining rodent uro

Origin and Properties of Prostatic Stem Cells

DTIC Science & Technology

2007-02-01

Brinster RL. beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999;96(10):5504-9. 14. Tsujimura ...G. R., Donjacour, A. A., Cooke, P. S., Mee, S., Bigsby, R. M., Higgins, S. J. & Sugimura, Y. (1987) Endocr. Rev. 8, 338–362. 9. Tsujimura , A...90. 4 Tsujimura A, Koikawa Y, Salm S et al. Proximal location of mouse prostate epithelial stem cells: A model of prostatic homeostasis. J Cell Biol

The role of epithelial plasticity in prostate cancer dissemination and treatment resistance

PubMed Central

Bitting, Rhonda L.; Schaeffer, Daneen; Somarelli, Jason A.; Garcia-Blanco, Mariano A.

2014-01-01

Nearly 30,000 men die annually in the USA of prostate cancer, nearly uniformly from metastatic dissemination. Despite recent advances in hormonal, immunologic, bone-targeted, and cytotoxic chemotherapies, treatment resistance and further dissemination are inevitable in men with metastatic disease. Emerging data suggests that the phenomenon of epithelial plasticity, encompassing both reversible mesenchymal transitions and acquisition of stemness traits, may underlie this lethal biology of dissemination and treatment resistance. Understanding the molecular underpinnings of this cellular plasticity from preclinical models of prostate cancer and from biomarker studies of human metastatic prostate cancer has provided clues to novel therapeutic approaches that may delay or prevent metastatic disease and lethality over time. This review will discuss the preclinical and clinical evidence for epithelial plasticity in this rapidly changing field and relate this to clinical phenotype and resistance in prostate cancer while suggesting novel therapeutic approaches. PMID:24414193

BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

PubMed Central

Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

2016-01-01

Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

Adipose Stem Cell-Based Therapeutic Targeting of Residual Androgens in African Americans With Bone-Metastatic Prostate Cancer

DTIC Science & Technology

2013-09-01

survival rate than CA males [3-7]. Socioeconomic and environmental factors, such as diet , access to care, and screening, have been cited as factors...cDNA clone coding for 3α-hydroxysteroid dehydrogenase (3α-HSD) was obtained from Origene. The 3α-HSD, also known as aldo- keto reductase family 1 member...growth of established human prostate LNCaP tumors in nude mice fed a low-fat diet . J Natl Cancer Inst 87: 1456–1462 17. Aronson WJ et al. (1999

Wnt and Notch Pathways Have Interrelated Opposing Roles on Prostate Progenitor Cell Proliferation and Differentiation

PubMed Central

Shahi, Payam; Seethammagari, Mamatha R.; Valdez, Joseph M.; Xin, Li; Spencer, David M.

2011-01-01

Tissue stem cells are capable of both self-renewal and differentiation to maintain a constant stem cell population and give rise to the plurality of cells within a tissue. Wnt signaling has been previously identified as a key mediator for the maintenance of tissue stem cells; however, possible cross-regulation with other developmentally critical signaling pathways involved in adult tissue homeostasis, such as Notch, is not well understood. By using an in vitro prostate stem cell colony (“prostasphere”) formation assay and in vivo prostate reconstitution experiments, we demonstrate that Wnt pathway induction on Sca-1+ CD49f+ basal/stem cells (B/SCs) promotes expansion of the basal epithelial compartment with noticeable increases in “triple positive” (cytokeratin [CK] 5+, CK8+, p63+) prostate progenitor cells, concomitant with upregulation of known Wnt target genes involved in cell-cycle induction. Moreover, Wnt induction affects expression of epithelial-to-mesenchymal transition signature genes, suggesting a possible mechanism for priming B/SC to act as potential tumor-initiating cells. Interestingly, induction of Wnt signaling in B/SCs results in downregulation of Notch1 transcripts, consistent with its postulated antiproliferative role in prostate cells. In contrast, induction of Notch signaling in prostate progenitors inhibits their proliferation and disrupts prostasphere formation. In vivo prostate reconstitution assays further demonstrate that induction of Notch in B/SCs disrupts proper acini formation in cells expressing the activated Notch1 allele, Notch-1 intracellular domain. These data emphasize the importance of Wnt/Notch cross-regulation in adult stem cell biology and suggest that Wnt signaling controls the proliferation and/or maintenance of epithelial progenitors via modulation of Notch signaling. PMID:21308863

Identification of Epigenetic Changes in Prostate Cancer using Induced Pluripotent Stem Cells

DTIC Science & Technology

2014-04-01

somatic cells in human iPS cells. Nat Cell Bioi, 13: 541, 2011 5. Polo, J. M., Liu, S., Figueroa , M. E. et al.: Cell type of origin influences the...human iPS cells. Nat Cell Bioi 13: 5•1 \\ - 5•19. 18. Poloj:\\ə, Lu S, Figueroa ME, Kulalert W, Eminli S, ct a!. (20 10) Cell type of origin

Prostate Cancer Stem-Like Cells | Center for Cancer Research

Cancer.gov

Prostate cancer is the third leading cause of cancer-related death among men, killing an estimated 27,000 men each year in the United States. Men with advanced prostate cancer often become resistant to conventional therapies. Many researchers speculate that the emergence of resistance is due to the presence of cancer stem cells, which are believed to be a small subpopulation

Differential requirements of androgen receptor in luminal progenitors during prostate regeneration and tumor initiation

PubMed Central

Chua, Chee Wai; Epsi, Nusrat J; Leung, Eva Y; Xuan, Shouhong; Lei, Ming; Li, Bo I; Bergren, Sarah K; Hibshoosh, Hanina; Mitrofanova, Antonina

2018-01-01

Master regulatory genes of tissue specification play key roles in stem/progenitor cells and are often important in cancer. In the prostate, androgen receptor (AR) is a master regulator essential for development and tumorigenesis, but its specific functions in prostate stem/progenitor cells have not been elucidated. We have investigated AR function in CARNs (CAstration-Resistant Nkx3.1-expressing cells), a luminal stem/progenitor cell that functions in prostate regeneration. Using genetically--engineered mouse models and novel prostate epithelial cell lines, we find that progenitor properties of CARNs are largely unaffected by AR deletion, apart from decreased proliferation in vivo. Furthermore, AR loss suppresses tumor formation after deletion of the Pten tumor suppressor in CARNs; however, combined Pten deletion and activation of oncogenic Kras in AR-deleted CARNs result in tumors with focal neuroendocrine differentiation. Our findings show that AR modulates specific progenitor properties of CARNs, including their ability to serve as a cell of origin for prostate cancer. PMID:29334357

Enhancing the Efficacy of Prostate Cancer Immunotherapy by Manipulating T-Cell Receptor Signaling in Order to Alter Peripheral Regulatory T-Cell Activity

DTIC Science & Technology

2009-07-01

27] Ross S, Spencer SD, Holcomb I, Tan C, Hongo J, Devaux B, et al. Prostate stem cell antigen as therapy target: tissue expression and in vivo...Holcomb I, Tan C, Hongo J, Devaux B, et al. Prostate stem cell antigen as therapy target: tissue expression and in vivo efficacy of an immunoconjugate

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2009-08-01

GCGGTGGAAG AGCCATCAT-30 and 50-TCTGTGGCTTCACCACTT TTCTC-30; for b-actin, 50-GCGGGAAATCGTGCGT GACATT-30 and 50-GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was...Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance protein-mediated efflux of androgen

Peptide-targeted, stimuli-responsive polymersomes for delivering a cancer stemness inhibitor to cancer stem cell microtumors.

PubMed

Karandish, Fataneh; Froberg, James; Borowicz, Pawel; Wilkinson, John C; Choi, Yongki; Mallik, Sanku

2018-03-01

Often cancer relapses after an initial response to chemotherapy because of the tumor's heterogeneity and the presence of progenitor stem cells, which can renew. To overcome drug resistance, metastasis, and relapse in cancer, a promising approach is the inhibition of cancer stemness. In this study, the expression of the neuropilin-1 receptor in both pancreatic and prostate cancer stem cells was identified and targeted with a stimuli-responsive, polymeric nanocarrier to deliver a stemness inhibitor (napabucasin) to cancer stem cells. Reduction-sensitive amphiphilic block copolymers PEG 1900 -S-S-PLA 6000 and the N 3 -PEG 1900 -PLA 6000 were synthesized. The tumor penetrating iRGD peptide-hexynoic acid conjugate was linked to the N 3 -PEG 1900 -PLA 6000 polymer via a Cu 2+ catalyzed "Click" reaction. Subsequently, this peptide-polymer conjugate was incorporated into polymersomes for tumor targeting and tissue penetration. We prepared polymersomes containing 85% PEG 1900 -S-S-PLA 6000 , 10% iRGD-polymer conjugate, and 5% DPPE-lissamine rhodamine dye. The iRGD targeted polymersomes encapsulating the cancer stemness inhibitor napabucasin were internalized in both prostate and pancreatic cancer stem cells. The napabucasin encapsulated polymersomes significantly (p < .05) reduced the viability of both prostate and pancreatic cancer stem cells and decreased the stemness protein expression notch-1 and nanog compared to the control and vesicles without any drug. The napabucasin encapsulated polymersome formulations have the potential to lead to a new direction in prostate and pancreatic cancer therapy by penetrating deeply into the tumors, releasing the encapsulated stemness inhibitor, and killing cancer stem cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Novel Therapeutic Approaches Toward Treating Prostate Cancer

DTIC Science & Technology

2013-05-01

Kinases, Prostate Cancer, AKT inhibition, Mouse, Prostate Stem Cells 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES...Bearss 0, Wierda WG, Gandhi V (2009) Pim kinase inhibitor, 5GI-1776, induces apoptosis in CLL lymphocytes. Blood 114:4150--4157. 27. Grey R, et aL...PIM1 expression predict outcome in mantle cell lymphoma treated with high dose therapy, stem eel! transplantation and rituximab: a Cancer and Leukemia

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2009-08-01

The Prostate Manuscript ID: PROS-09-224.R1 Wiley - Manuscript type: Original Article Date Submitted by the Author: 18-Sep-2009 Complete List of ...subpopulation of basal cells has stem cell characteristics raises some interesting questions about the cell of origin for prostate cancer. Can both basal...positively for AMACR and the retention of 7 a p63+ basal layer, the basal-derived lesions fulfill the histologic criteria used

Inhibition of Midkine Suppresses Prostate Cancer CD133+ Stem Cell Growth and Migration.

PubMed

Erdogan, Suat; Doganlar, Zeynep B; Doganlar, Oguzhan; Turkekul, Kader; Serttas, Riza

2017-09-01

Midkine (MDK) is a tumor-promoting factor that is often overexpressed in various human carcinomas, and the role of MDK has not yet been fully investigated in prostate cancer stem cells. Prostate cancer CD133 + stem cells (PCSCs) were isolated from human castration-resistant PC3 cells. PCSCs were treated with different concentrations of MDK inhibitor, iMDK, for 24-72 hours. The IC 50 values were determined by the MTT test. Endogenous MDK messenger RNA expression was knocked down by small interfering RNA. Quantitative reverse transcription polymerase chain reaction, Western blot analyses and image-based cytometry were used to investigate apoptosis and cell cycle progression as well as their underlying molecular mechanisms. Cell migration was evaluated by the wound healing test. iMDK caused dose- and time-dependent inhibition of PCSC survival. Similar growth inhibition was also obtained by small interfering RNA-mediated knockdown of endogenous MDK expression. iMDK was shown to preferentially induce cell cycle arrest at the S and G2/M phases. Suppressed PCSC growth was also accompanied by increases in p53 and the cell cycle inhibitor p21 genes. Combinatorial treatment of iMDK with docetaxel significantly inhibited cell proliferation versus either of the agents used alone. Inhibition of MDK expression strongly suppressed the migration of PCSCs compared to untreated and docetaxel-treated cells. iMDK and the knockdown of MDK decreased p-Akt and significantly upregulated the expression of PI3K/phosphatase/tensin homolog. Our data indicate that MDK plays a crucial role in controlling PCSC proliferation and migration. Therefore, suppression of endogenous expression of MDK would, in combination with traditional chemotherapy drugs, be a potential treatment for PCSCs. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

GE132+Natural: Novel promising dietetic supplement with antiproliferative influence on prostate, colon, and breast cancer cells.

PubMed

Okic-Djordjevic, I; Trivanovic, D; Krstic, J; Jaukovic, A; Mojsilovic, S; Santibanez, J F; Terzic, M; Vesovic, D; Bugarski, D

2013-01-01

Natural products have been investigated for promising new leads in pharmaceutical development. The purpose of this study was to analyze the biological effect of GE132+Natural, a novel supplement consisting of 5 compounds: Resveratrol, Ganoderma lucidum, Sulforaphane, Lycopene and Royal jelly. The antiproliferative activity of GE132+Natural was tested on 3 different human cancer cell lines: MCF7 (breast cancer cells), PC3 (prostate cancer cells), and SW480 (colon cancer cells), as well as on EA.hy 926 (normal human endothelial cell line). In addition, the cytotoxicity of GE132+- Natural on the proliferation of primary human mesenchymal stem cells isolated from dental pulp (DP=MSC), along with its in vitro impact on different peripheral blood parameters, was determined. The results revealed high antiproliferative activity of GE132+Natural on all tested cancer cell lines (PC3, MCF7 and SW480), as well as on the EA.hy 926 endothelial cell line in a dose-dependent manner. However, applied in a wide range of concentrations GE132+Natural did not affect both the proliferation of primary mesenchymal stem cells and the peripheral blood cells counts. The data obtained demonstrated that GE132+Natural is effective in inhibiting cancer cell proliferation, indicating its potential beneficial health effects. In addition, the results pointed that adult mesenchymal stem cells might be valuable as a test system for evaluating the toxicity and efficacy of new medicines or chemicals.

The natural flavonoid apigenin sensitizes human CD44+ prostate cancer stem cells to cisplatin therapy.

PubMed

Erdogan, Suat; Turkekul, Kader; Serttas, Rıza; Erdogan, Zeynep

2017-04-01

Prostate cancer (PCa) is the second most common type of cancer and the fifth leading cause of cancer-related death among men. Development of chemoresistance, tumor relapse and metastasis remain major barriers to effective treatment and all been identified to be associated with cancer stem cells (CSCs). Natural flavonoids such as apigenin have been shown to have the ability to improve the therapeutic efficacy of common chemotherapy agents through CSCs sensitization. Thus, the aim of this study was to evaluate the combination of apigenin with cisplatin on CD44 + PCa stem cell growth and migration. Platinum-based anti-neoplastic drugs have been used to treat a number of malignancies including PCa. However, acquired resistance and side effects unfortunately have limited cisplatin's use. A CD44 + subpopulation was isolated from human androgen-independent PC3 PCa cells by using human CD44-PE antibody. IC 50 values were determined by MTT test. RT-qPCR, Western blot analyses and image-based cytometer were used to investigate apoptosis, cell cycle and their underlying molecular mechanisms. Cell migration was evaluated by wound healing test. The combination of the IC 50 doses of apigenin (15μM) and cisplatin (7.5μM) for 48h significantly enhanced cisplatin's cytotoxic and apoptotic effects through downregulation of Bcl-2, sharpin and survivin; and upregulation of caspase-8, Apaf-1 and p53 mRNA expression. The combined therapy suppressed the phosphorylation of p-PI3K and p-Akt, inhibited the protein expression of NF-κB, and downregulated the cell cycle by upregulating p21, as well as cyclin dependent kinases CDK-2, -4, and -6. Apigenin significantly increased the inhibitory effects of cisplatin on cell migration via downregulation of Snail expression. In conclusion, our study showed the possible therapeutic approach of using apigenin to potentially increase the effects of cisplatin by targeting CSCs subset in prostate cancer. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Associations between RNA splicing regulatory variants of stemness-related genes and racial disparities in susceptibility to prostate cancer.

PubMed

Wang, Yanru; Freedman, Jennifer A; Liu, Hongliang; Moorman, Patricia G; Hyslop, Terry; George, Daniel J; Lee, Norman H; Patierno, Steven R; Wei, Qingyi

2017-08-15

Evidence suggests that cells with a stemness phenotype play a pivotal role in oncogenesis, and prostate cells exhibiting this phenotype have been identified. We used two genome-wide association study (GWAS) datasets of African descendants, from the Multiethnic/Minority Cohort Study of Diet and Cancer (MEC) and the Ghana Prostate Study, and two GWAS datasets of non-Hispanic whites, from the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial and the Breast and Prostate Cancer Cohort Consortium (BPC3), to analyze the associations between genetic variants of stemness-related genes and racial disparities in susceptibility to prostate cancer. We evaluated associations of single-nucleotide polymorphisms (SNPs) in 25 stemness-related genes with prostate cancer risk in 1,609 cases and 2,550 controls of non-Hispanic whites (4,934 SNPs) and 1,144 cases and 1,116 controls of African descendants (5,448 SNPs) with correction by false discovery rate ≤0.2. We identified 32 SNPs in five genes (TP63, ALDH1A1, WNT1, MET and EGFR) that were significantly associated with prostate cancer risk, of which six SNPs in three genes (TP63, ALDH1A1 and WNT1) and eight EGFR SNPs showed heterogeneity in susceptibility between these two racial groups. In addition, 13 SNPs in MET and one in ALDH1A1 were found only in African descendants. The in silico bioinformatics analyses revealed that EGFR rs2072454 and SNPs in linkage with the identified SNPs in MET and ALDH1A1 (r 2  > 0.6) were predicted to regulate RNA splicing. These variants may serve as novel biomarkers for racial disparities in prostate cancer risk. © 2017 UICC.

A Novel Chimeric Antigen Receptor Against Prostate Stem Cell Antigen Mediates Tumor Destruction in a Humanized Mouse Model of Pancreatic Cancer

PubMed Central

Lagisetty, Kiran H.; Tran, Eric; Zheng, Zhili; Gattinoni, Luca; Yu, Zhiya; Burns, William R.; Miermont, Anne M.; Teper, Yaroslav; Rudloff, Udo; Restifo, Nicholas P.; Feldman, Steven A.; Rosenberg, Steven A.; Morgan, Richard A.

2014-01-01

Abstract Despite advances in the understanding of its molecular pathophysiology, pancreatic cancer remains largely incurable, highlighting the need for novel therapies. We developed a chimeric antigen receptor (CAR) specific for prostate stem cell antigen (PSCA), a glycoprotein that is overexpressed in pancreatic cancer starting at early stages of malignant transformation. To optimize the CAR design, we used antigen-recognition domains derived from mouse or human antibodies, and intracellular signaling domains containing one or two T cell costimulatory elements, in addition to CD3zeta. Comparing multiple constructs established that the CAR based on human monoclonal antibody Ha1-4.117 had the greatest reactivity in vitro. To further analyze this CAR, we developed a human pancreatic cancer xenograft model and adoptively transferred CAR-engineered T cells into animals with established tumors. CAR-engineered human lymphocytes induced significant antitumor activity, and unlike what has been described for other CARs, a second-generation CAR (containing CD28 cosignaling domain) induced a more potent antitumor effect than a third-generation CAR (containing CD28 and 41BB cosignaling domains). While our results provide evidence to support PSCA as a target antigen for CAR-based immunotherapy of pancreatic cancer, the expression of PSCA on selected normal tissues could be a source of limiting toxicity. PMID:24694017

Role of interleukins, IGF and stem cells in BPH

PubMed Central

McLaren, Ian D.; Jerde, Travis J.; Bushman, Wade

2013-01-01

The condition known as benign prostatic hyperplasia may be defined as a benign enlargement of the prostate gland resulting from a proliferation of both benign epithelial and stromal elements. It might also be defined clinically as a constellation of lower urinary tract symptoms (LUTSs) in aging men. The purpose of this review is to consider the ways in which inflammatory cytokines belonging to the interleukin family, members of the IFG family, and stem cells may contribute to the development and progression of BPH-LUTS. This might occur in three mechanisms: One, interleukin signaling, IFG signaling and stem cells may contribute to reactivation of developmental growth mechanisms in the adult prostate leading to tissue growth. Two, given that epidemiologic studies indicate an increased incidence of BPH-LUTS in association with obesity and diabetes, IFG signaling may provide the mechanistic basis for the effect of diabetes and obesity on prostate growth. Three, expression of interleukins in association with inflammation in the prostate may induce sensitization of afferent fibers innervating the prostate and result in increased sensitivity to pain and noxious sensations in the prostate and bladder and heightened sensitivity to bladder filling. PMID:21864972

Prostate Cancer Stem Cells: Viewing Signaling Cascades at a Finer Resolution.

PubMed

Lin, Xiukun; Farooqi, Ammad Ahmad; Qureshi, Muhammad Zahid; Romero, Mirna Azalea; Tabassum, Sobia; Ismail, Muhammad

2016-06-01

It is becoming characteristically more understandable that within tumor cells, there lies a sub-population of tumor cells with "stem cell" like properties and remarkable ability of self-renewal. Many features of these self-renewing cells are comparable with normal stem cells and are termed as "cancer stem cells". Accumulating experimentally verified data has started to scratch the surface of spatio-temporally dysregulated intracellular signaling cascades in the biology of prostate cancer stem cells. We partition this multicomponent review into how different signaling cascades operate in cancer stem cells and how bioactive ingredients isolated from natural sources may modulate signaling network.

Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression

PubMed Central

Russo, Maria Veronica; Gazzano, Giacomo; Giangiobbe, Sara; Montanari, Emanuele; Del Nero, Alberto; Rocco, Bernardo; Albo, Giancarlo; Languino, Lucia R.; Altieri, Dario C.; Vaira, Valentina; Bosari, Silvano

2015-01-01

Most men diagnosed with prostate cancer will have an indolent and curable disease, whereas approximately 15% of these patients will rapidly progress to a castrate-resistant and metastatic stage with high morbidity and mortality. Therefore, the identification of molecular signature(s) that detect men at risk of progressing disease remains a pressing and still unmet need for these patients. Here, we used an integrated discovery platform combining prostate cancer cell lines, a Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) model and clinically-annotated human tissue samples to identify loss of expression of microRNA-34b as consistently associated with prostate cancer relapse. Mechanistically, this was associated with epigenetics silencing of the MIR34B/C locus and increased DNA copy number loss, selectively in androgen-dependent prostate cancer. In turn, loss of miR-34b resulted in downstream deregulation and overexpression of the “stemness” marker, Sox2. These findings identify loss of miR-34b as a robust biomarker for prostate cancer progression in androgen-sensitive tumors, and anticipate a potential role of progenitor/stem cell signaling in this stage of disease. PMID:26107383

Propagation of human spermatogonial stem cells in vitro.

PubMed

Sadri-Ardekani, Hooman; Mizrak, Sefika C; van Daalen, Saskia K M; Korver, Cindy M; Roepers-Gajadien, Hermien L; Koruji, Morteza; Hovingh, Suzanne; de Reijke, Theo M; de la Rosette, Jean J M C H; van der Veen, Fulco; de Rooij, Dirk G; Repping, Sjoerd; van Pelt, Ans M M

2009-11-18

Young boys treated with high-dose chemotherapy are often confronted with infertility once they reach adulthood. Cryopreserving testicular tissue before chemotherapy and autotransplantation of spermatogonial stem cells at a later stage could theoretically allow for restoration of fertility. To establish in vitro propagation of human spermatogonial stem cells from small testicular biopsies to obtain an adequate number of cells for successful transplantation. Study performed from April 2007 to July 2009 using testis material donated by 6 adult men who underwent orchidectomy as part of prostate cancer treatment. Testicular cells were isolated and cultured in supplemented StemPro medium; germline stem cell clusters that arose were subcultured on human placental laminin-coated dishes in the same medium. Presence of spermatogonia was determined by reverse transcriptase polymerase chain reaction and immunofluorescence for spermatogonial markers. To test for the presence of functional spermatogonial stem cells in culture, xenotransplantation to testes of immunodeficient mice was performed, and migrated human spermatogonial stem cells after transplantation were detected by COT-1 fluorescence in situ hybridization. The number of colonized spermatogonial stem cells transplanted at early and later points during culture were counted to determine propagation. Propagation of spermatogonial stem cells over time. Testicular cells could be cultured and propagated up to 15 weeks. Germline stem cell clusters arose in the testicular cell cultures from all 6 men and could be subcultured and propagated up to 28 weeks. Expression of spermatogonial markers on both the RNA and protein level was maintained throughout the entire culture period. In 4 of 6 men, xenotransplantation to mice demonstrated the presence of functional spermatogonial stem cells, even after prolonged in vitro culture. Spermatogonial stem cell numbers increased 53-fold within 19 days in the testicular cell culture and increased 18,450-fold within 64 days in the germline stem cell subculture. Long-term culture and propagation of human spermatogonial stem cells in vitro is achievable.

Prostate stem cell antigen is overexpressed in human transitional cell carcinoma.

PubMed

Amara, N; Palapattu, G S; Schrage, M; Gu, Z; Thomas, G V; Dorey, F; Said, J; Reiter, R E

2001-06-15

Prostate stem cell antigen (PSCA), a homologue of the Ly-6/Thy-1 family of cell surface antigens, is expressed by a majority of human prostate cancers and is a promising target for prostate cancer immunotherapy. In addition to its expression in normal and malignant prostate, we recently reported that PSCA is expressed at low levels in the transitional epithelium of normal bladder. In the present study, we compared the expression of PSCA in normal and malignant urothelial tissues to assess its potential as an immunotherapeutic target in transitional cell carcinoma (TCC). Immunohistochemical analysis of PSCA protein expression was performed on tissue sections from 32 normal bladder specimens, as well as 11 cases of low-grade transitional cell dysplasia, 21 cases of carcinoma in situ (CIS), 38 superficial transitional cell tumors (STCC, stages T(a)-T(1)), 65 muscle-invasive TCCs (ITCCs, stages T(2)-T(4)), and 7 bladder cancer metastases. The level of PSCA protein expression was scored semiquantitatively by assessing both the intensity and frequency (i.e., percentage of positive tumor cells) of staining. We also examined PSCA mRNA expression in a representative sample of normal and malignant human transitional cell tissues. In normal bladder, PSCA immunostaining was weak and confined almost exclusively to the superficial umbrella cell layer. Staining in CIS and STCC was more intense and uniform than that seen in normal bladder epithelium (P < 0.001), with staining detected in 21 (100%) of 21 cases of CIS and 37 (97%) of 38 superficial tumors. PSCA protein was also detected in 42 (65%) of 65 of muscle-invasive and 4 (57%) of 7 metastatic cancers, with the highest levels of PSCA expression (i.e., moderate-strong staining in >50% of tumor cells) seen in 32% of invasive and 43% of metastatic samples. Higher levels of PSCA expression correlated with increasing tumor grade for both STCCs and ITCCs (P < 0.001). Northern blot analysis confirmed the immunohistochemical data, showing a dramatic increase in PSCA mRNA expression in two of five muscle-invasive transitional cell tumors when compared with normal samples. Confocal microscopy demonstrated that PSCA expression in TCC is confined to the cell surface. These data demonstrate that PSCA is overexpressed in a majority of human TCCs, particularly CIS and superficial tumors, and may be a useful target for bladder cancer diagnosis and therapy.

The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44.

PubMed

Liu, Can; Kelnar, Kevin; Liu, Bigang; Chen, Xin; Calhoun-Davis, Tammy; Li, Hangwen; Patrawala, Lubna; Yan, Hong; Jeter, Collene; Honorio, Sofia; Wiggins, Jason F; Bader, Andreas G; Fagin, Randy; Brown, David; Tang, Dean G

2011-02-01

Cancer stem cells (CSCs), or tumor-initiating cells, are involved in tumor progression and metastasis. MicroRNAs (miRNAs) regulate both normal stem cells and CSCs, and dysregulation of miRNAs has been implicated in tumorigenesis. CSCs in many tumors--including cancers of the breast, pancreas, head and neck, colon, small intestine, liver, stomach, bladder and ovary--have been identified using the adhesion molecule CD44, either individually or in combination with other marker(s). Prostate CSCs with enhanced clonogenic and tumor-initiating and metastatic capacities are enriched in the CD44(+) cell population, but whether miRNAs regulate CD44(+) prostate cancer cells and prostate cancer metastasis remains unclear. Here we show, through expression analysis, that miR-34a, a p53 target, was underexpressed in CD44(+) prostate cancer cells purified from xenograft and primary tumors. Enforced expression of miR-34a in bulk or purified CD44(+) prostate cancer cells inhibited clonogenic expansion, tumor regeneration, and metastasis. In contrast, expression of miR-34a antagomirs in CD44(-) prostate cancer cells promoted tumor development and metastasis. Systemically delivered miR-34a inhibited prostate cancer metastasis and extended survival of tumor-bearing mice. We identified and validated CD44 as a direct and functional target of miR-34a and found that CD44 knockdown phenocopied miR-34a overexpression in inhibiting prostate cancer regeneration and metastasis. Our study shows that miR-34a is a key negative regulator of CD44(+) prostate cancer cells and establishes a strong rationale for developing miR-34a as a novel therapeutic agent against prostate CSCs.

Targeting Prostate Cancer Stemlike Cells through Cell Surface Expressed GRP78

DTIC Science & Technology

2016-12-01

NOTES 14. ABSTRACT This study investigated a function for cell surface GRP78 in regulating prostate cancer stem -like cells . In year 1, we showed that...enrichment of cell surface GRP78+ cancer stem like cells in sphere culture. We also showed that the signaling axis activated by cell surface GRP78 is...but not the GRP78(-) cells , exhibited cancer stem -like cell behavior. Furthermore an GRP78 monoclonal antibody inhibited sphere forming ability of

Bone Marrow-derived Mesenchymal Stem Cells (MSCs) as a Selective Delivery Vehicle for a PSA-Activated Protoxin for Advanced Prostate Cancer

DTIC Science & Technology

2013-03-01

tissue have been optimized • Optimization of flow cytometry-based analyses to characterize co- incident expression of multiple MSC-related markers on a...CA). Mouse anti-human vimentin (clone LN-6) was purchased from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse Alexa Fluor 488, Roswell Park

Immunostaining of the androgen receptor and sequence analysis of its DNA-binding domain in canine prostate cancer.

PubMed

Lai, Chen-Li; van den Ham, René; Mol, Jan; Teske, Erik

2009-09-01

Prostate cancer in the dog (cPC) has many features in common with hormone refractory human prostate cancer. As cPC is seen more often in castrated dogs, the contribution of the androgen receptor (AR) to the development of prostate cancer remains questionable. The aim of the present study was to evaluate the presence of the AR by immunohistochemistry in cPC. AR staining was observed in most tumors from intact and castrated dogs, but the proportion of positive cells and the staining intensity were much lower than in the prostate of healthy, non-castrated dogs. Most of the positive staining was seen in the cytoplasm rather than in the nuclei of the tumor cells. The predominant cytoplasmic localization was not related to mutations in exon 3 of the DNA-binding domain of the AR, as shown by sequence analysis of microdissected AR positive tumor cells. Other mechanisms that lead to an impaired androgen-AR signaling or a basal/stem cell like origin may explain the low cytoplasmic AR staining in cPC.

Monoacylglycerol lipase exerts dual control over endocannabinoid and fatty acid pathways to support prostate cancer.

PubMed

Nomura, Daniel K; Lombardi, Donald P; Chang, Jae Won; Niessen, Sherry; Ward, Anna M; Long, Jonathan Z; Hoover, Heather H; Cravatt, Benjamin F

2011-07-29

Cancer cells couple heightened lipogenesis with lipolysis to produce fatty acid networks that support malignancy. Monoacylglycerol lipase (MAGL) plays a principal role in this process by converting monoglycerides, including the endocannabinoid 2-arachidonoylglycerol (2-AG), to free fatty acids. Here, we show that MAGL is elevated in androgen-independent versus androgen-dependent human prostate cancer cell lines, and that pharmacological or RNA-interference disruption of this enzyme impairs prostate cancer aggressiveness. These effects were partially reversed by treatment with fatty acids or a cannabinoid receptor-1 (CB1) antagonist, and fully reversed by cotreatment with both agents. We further show that MAGL is part of a gene signature correlated with epithelial-to-mesenchymal transition and the stem-like properties of cancer cells, supporting a role for this enzyme in protumorigenic metabolism that, for prostate cancer, involves the dual control of endocannabinoid and fatty acid pathways. Copyright © 2011 Elsevier Ltd. All rights reserved.

Evaluating the Potential of Adipose Tissue-Derived MSCs as Anticancer Gene Delivery Vehicles to Bone-Metastasized Prostate Cancer

DTIC Science & Technology

2010-04-01

Isolation of  human adipose‐derived stem cells from biopsies and  liposuction  specimens. Methods Mol Biol. 2008;449:69‐79.  PMID: 18370084.  6:   Ricks DM...may already be in circulation in the bone marrow. Human adipose derived MSCs (AT-MSCs) on the other hand are easy to procure from liposuction

Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African American Prostate Cancer

DTIC Science & Technology

2016-10-01

These analyses have led to two submitted manuscripts. The first manuscript, “Variants of stemness -related genes predicted to regulate RNA splicing...and Table 1-3 at the end of this progress report. The second manuscript, “Single nucleotide polymorphisms of stemness pathway genes predicted to...cancer and support a contribution of the stemness pathway to prostate cancer patient outcome. Please see Figure 5-7 and Table 4-6 at the end of this

Increased Expression of ALDH1A1 in Prostate Cancer is Correlated With Tumor Aggressiveness: A Tissue Microarray Study of Iranian Patients.

PubMed

Kalantari, Elham; Saadi, Faezeh H; Asgari, Mojgan; Shariftabrizi, Ahmad; Roudi, Raheleh; Madjd, Zahra

2017-09-01

Subpopulations of prostate cancer (PCa) cells expressing putative stem cell markers possess the ability to promote tumor growth, maintenance, and progression. This study aimed to evaluate the expression patterns and clinical significance of putative stem cell marker aldehyde dehydrogenase 1 A1 (ALDH1A1) in prostate tumor tissues. ALDH1A1 expression was examined in a well-defined series of prostate tissues, including 105 (68%) samples of PCa, 21 (13%) samples of high-grade prostatic intraepithelial neoplasia, and 31 (19%) samples of benign prostate hyperplasia, which were embedded in tissue microarray blocks. The correlation of ALDH1A1 expression with clinicopathologic parameters was also assessed. There was a significant difference between the expression level of ALDH1A1 in PCa compared with the high-grade prostatic intraepithelial neoplasia and benign prostate hyperplasia samples (P<0.001). PCa cells expressing ALDH1A1 were more often seen in samples with advanced Gleason score (P=0.05) and high serum prostate specific antigen level (P=0.02). In addition, a positive correlation was found between ALDH1A1 expression and primary tumor stage and regional lymph node involvement (P=0.04 and 0.03, respectively). The significant association between ALDH1A1 expressions with Gleason score indicates the potential role of this protein in PCa tumorigenesis and aggressive behavior; therefore, this cancer stem cell marker can be used as a promising candidate for targeted therapy of PCa, especially those with high Gleason score.

Enrichment of prostate cancer stem cells from primary prostate cancer cultures of biopsy samples

PubMed Central

Wang, Shunqi; Huang, Shengsong; Zhao, Xin; Zhang, Qimin; Wu, Min; Sun, Feng; Han, Gang; Wu, Denglong

2014-01-01

This study was to enrich prostate cancer stem cells (PrCSC) from primary prostate cancer cultures (PPrCC). Primary prostate cancer cells were amplified in keratinocyte serum-free medium with epidermal growth factor (EGF) and bovine pituitary extract (BPE), supplemented with leukemia inhibitory factor (LIF), stem cell factor (SCF) and cholera toxin. After amplification, cells were transferred into ultra-low attachment dishes with serum-free DMEM/F12 medium, supplemented with EGF, basic fibroblast growth factor (bFGF), bovine serum albumin (BSA), insulin, and N2 nutrition. Expression of cell-type-specific markers was determined by RT-qPCR and immunostaining. Tumorigenicity of enriched PrCSC was determined by soft agar assay and xenograft assay in NOD/SCID mice. Biopsy samples from 19 confirmed prostate cancer patients were used for establishing PPrCC, and 18 cases (95%) succeeded. Both basal marker (CK5) and luminal markers (androgen receptor and CK8) strongly co-expressed in most of PPrCC, indicating their basal epithelial origin. After amplification under adherent culture condition in vitro, transient amplifying cells were the dominant cells. Sphere formation efficiency (SFE) of passaged PPrCC was about 0.5%, which was 27 times lower than SFE of LNCaP (13.67%) in the same condition. Compared with adherent cells from PPrCC, prostasphere from PPrCC showed up regulated stem cell markers and increased tumorigenic potential in soft-agar assay. However, spheroid cells from PPrCC prostasphere failed to initiate tumor in xenograft assay in 6 months. Thus, PPrCC can be established and amplified from prostate cancer biopsy samples. Our modified sphere culture system can enrich PrCSC from PPrCC. PMID:24427338

Expression profile of undifferentiated cell transcription factor 1 in normal and cancerous human epithelia.

PubMed

Mouallif, Mustapha; Albert, Adelin; Zeddou, Mustapha; Ennaji, My Mustapha; Delvenne, Philippe; Guenin, Samuel

2014-08-01

Undifferentiated cell Transcription Factor 1 (UTF1) is a chromatin-bound protein involved in stem cell differentiation. It was initially reported to be restricted to stem cells or germinal tissues. However, recent work suggests that UTF1 is also expressed in somatic cells and that its expression may increase during carcinogenesis. To further clarify the expression profile of UTF1, we evaluated UTF1 expression levels immunohistochemically in eight normal human epithelia (from breast, prostate, endometrium, bladder, colon, oesophagus, lung and kidney) and their corresponding tumours as well as in several epithelial cell lines. We showed UTF1 staining in normal and tumour epithelial tissues, but with varying intensities according to the tissue location. In vitro analyses also revealed that UTF1 is expressed in somatic epithelial cell lines even in the absence of Oct4A and Sox2, its two main known regulators. The comparison of UTF1 levels in normal and tumoral tissues revealed significant overexpression in endometrial and prostatic adenocarcinomas, whereas lower intensity of the staining was observed in renal and colic tumours, suggesting a potential tissue-specific function of UTF1. Altogether, these results highlight a potential dual role for UTF1, acting either as an oncogene or as a tumour suppressor depending on the tissue. These findings also question its role as a specific marker for stem cells. © 2014 The Authors. International Journal of Experimental Pathology © 2014 International Journal of Experimental Pathology.

In Pursuit of Prostate Cancer Stem Cells

DTIC Science & Technology

2007-01-01

cells with different tumorigenicities and primitiveness in human PCa xenografts and cell lines. In this study, we seek to reevaluate the relevancy...us prostatospheres and establish primary xenografts in order to carry out our proposed experiments. Preliminary in vitro experiments indicate that...LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c. THIS PAGE U UU 31

Recent advances in prostate development and links to prostatic diseases

PubMed Central

Powers, Ginny L.

2013-01-01

The prostate is a branched ductal-acinar gland that is part of the male reproductive tract. Prostate development depends upon the integration of steroid hormone signals, paracrine interactions between the stromal and epithelial tissue layers, and the actions of cell autonomous factors. Several genes and signalling pathways are known to be required for one or more steps of prostate development including epithelial budding, duct elongation, branching morphogenesis, and/or cellular differentiation. Recent progress in the field of prostate development has included the application of genome-wide technologies including serial analysis of gene expression (SAGE), expression profiling microarrays, and other large scale approaches to identify new genes and pathways that are essential for prostate development. The aggregation of experimental results into online databases by organized multi-lab projects including the Genitourinary Developmental Molecular Atlas Project (GUDMAP) has also accelerated the understanding of molecular pathways that function during prostate development and identified links between prostate anatomy and molecular signaling. Rapid progress has also recently been made in understanding the nature and role of candidate stem cells in the developing and adult prostate. This has included the identification of putative prostate stem cell markers, lineage tracing, and organ reconstitution studies. However, several issues regarding their origin, precise nature, and possible role(s) in disease remain unresolved. Nevertheless, several links between prostatic developmental mechanisms and the pathogenesis of prostatic diseases including benign prostatic hyperplasia and prostate cancer have led to recent progress on targeting developmental pathways as therapeutic strategies for these diseases. PMID:23335485

Downregulation of microRNA‑574 in cancer stem cells causes recurrence of prostate cancer via targeting REL.

PubMed

Lai, Xiaodong; Guo, Yanchun; Guo, Zhitao; Liu, Ruibao; Wang, Xunguo; Wang, Fang

2016-12-01

miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify the underlying molecular mechanisms. Our literature search found that miR‑574 is regulated in cancer stem cells (CSCs), and next we used the microRNA (miRNA) database (www.mirdb.org) to find REL as a target of miR‑574. Luciferase assay was performed to verify the miRNA/target relationship. Oligo-transfection, real‑time PCR and western blot analysis were used to support the conclusions. We validated REL to be the direct gene via luciferase reporter assay system, and real‑time PCR and western blot analysis were also conducted to study the mRNA and protein expression level of REL between different groups (recurrence and non‑recurrence) or cells treated with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors, indicating the negative regulatory relationship between miR‑574 and REL. We also investigated the relative viability of prostate CSCs when transfected with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors to validate miR‑574 to be positively interfering with the viability of prostate CSCs. We then investigated the relative apoptosis of prostate CSCs when transfected with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors. The results showed miR‑574 inhibited apoptosis. In conclusion, miR‑574 might be a novel prognostic and therapeutic target in the management of PCa recurrence.

Establishment of a dog primary prostate cancer organoid using the urine cancer stem cells.

PubMed

Usui, Tatsuya; Sakurai, Masashi; Nishikawa, Shimpei; Umata, Koji; Nemoto, Yuki; Haraguchi, Tomoya; Itamoto, Kazuhito; Mizuno, Takuya; Noguchi, Shunsuke; Mori, Takashi; Iwai, Satomi; Nakagawa, Takayuki; Yamawaki, Hideyuki; Ohama, Takashi; Sato, Koichi

2017-12-01

Dog spontaneously develop prostate cancer (PC) like humans. Because most dogs with PC have a poor prognosis, they could be used as a translational model for advanced PC in humans. Stem cell-derived 3-D organoid culture could recapitulate organ structures and physiology. Using patient tissues, a human PC organoid culture system was established. Recent study has shown that urine cells also possess the characteristic of stem cells. However, urine cell-derived PC organoids have never been produced. Therefore, we generated PC organoids using the dog urine samples. Urine organoids were successfully generated from each dog with PC. Each organoid showed cystic structures and resembled the epithelial structures of original tissues. Expression of an epithelial cell marker, E-cadherin, and a myofibloblast marker, α-SMA, was observed in the urine organoids. The organoids also expressed a basal cell marker, CK5, and a luminal cell marker, CK8. CD49f-sorted basal cell organoids rapidly grew compared with CD24-sorted luminal cell organoids. The population of CD44-positive cells was the highest in both organoids and the original urine cells. Tumors were successfully formed with the injection of the organoids into immunodeficient mice. Treatment with a microtubule inhibitor, docetaxel, but not a cyclooxygenase inhibitor, piroxicam, and an mTOR inhibitor, rapamycin, decreased the cell viability of organoids. Treatment with a Hedgehog signal inhibitor, GANT61, increased the radiosensitivity in the organoids. These findings revealed that PC organoids using urine might become a useful tool for investigating the mechanisms of the pathogenesis and treatment of PC in dogs. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Targeting IκB kinase β/NF-κB signaling in human prostate cancer by a novel IκB kinase β inhibitor CmpdA

PubMed Central

Zhang, Yanting; Lapidus, Rena G.; Liu, Peiyan; Choi, Eun Yong; Adediran, Samusi; Hussain, Arif; Wang, Xinghuan; Liu, Xuefeng; Dan, Han C.

2016-01-01

NF-κB plays an important role in many types of cancer, including prostate cancer (PCa), but the role of the upstream kinase of NF-κB, IKKβ, in PCa has not been fully documented, nor are there any effective IKKβ inhibitors used in clinical settings. Here, we have shown that IKKβ activity is mediated by multiple kinases including IKKα in human PCa cell lines that express activated IKKβ. Immunohistochemical analysis (IHC) of human PCa tissue microarrays (TMA) demonstrates that phosphorylation of IKKα/β within its activation loop gradually increases in low to higher stage tumors as compared to normal tissue. The expression of cell proliferation and survival markers (Ki67, Survivin), epithelial-to-mesenchymal transition (EMT) markers (Slug, Snail), as well as cancer stem cell (CSC) related transcription factors (Nanog, Sox2, Oct-4), also increase in parallel among the respective TMA samples analyzed. IKKβ, but not NF-κB, is found to regulate Nanog, which, in turn, modulates the levels of Oct4, Sox2, Snail and Slug, indicating an essential role of IKKβ in regulating cancer stem cells and EMT. The novel IKKβ inhibitor CmpdA inhibits constitutively activated IKKβ/NF-κB signaling, leading to induction of apoptosis and inhibition of proliferation, migration and stemness in these cells. CmpdA also significantly inhibits tumor growth in xenografts without causing apparent in vivo toxicity. Furthermore, CmpdA and docetaxel act synergistically to inhibit proliferation of PCa cells. These results indicate that IKKβ plays a pivotal role in PCa, and targeting IKKβ, including in combination with docetaxel, may be a potentially useful strategy for treating advanced PCa. PMID:27196761

Inhibition of human prostate cancer (PC-3) cells and targeting of PC-3-derived prostate cancer stem cells with koenimbin, a natural dietary compound from Murraya koenigii (L) Spreng.

PubMed

Kamalidehghan, Behnam; Ghafouri-Fard, Soudeh; Motevaseli, Elahe; Ahmadipour, Fatemeh

2018-01-01

Inhibition of prostate cancer stem cells (PCSCs) is an efficient curative maintenance protocol for the prevention of prostate cancer. The objectives of this study were to assess the efficiency of koenimbin, a major biologically active component of Murraya koenigii (L) Spreng, in the suppression of PC-3 cells and to target PC-3-derived cancer stem cells (CSCs) through apoptotic and CSC signaling pathways in vitro. The antiproliferative activity of koenimbin was examined using MTT, and the apoptotic detection was carried out by acridine orange/propidium iodide (AO/PI) double-staining and multiparametric high-content screening (HCS) assays. Caspase bioluminescence assay, reverse transcription polymerase chain reaction (RT-PCR), and immunoblotting were conducted to confirm the expression of apoptotic-associated proteins. Cell cycle analysis was investigated using flow cytometry. Involvement of nuclear factor-kappa B (NF-κB) was analyzed using HCS assay. Aldefluor™ and prostasphere formation examinations were used to evaluate the impact of koenimbin on PC-3 CSCs in vitro. Koenimbin remarkably inhibited cell proliferation in a dose-dependent manner. Koenimbin induced nuclear condensation, formation of apoptotic bodies, and G 0 /G 1 phase arrest of PC-3 cells. Koenimbin triggered the activation of caspase-3/7 and caspase-9 and the release of cytochrome c , decreased anti-apoptotic Bcl-2 and HSP70 proteins, increased pro-apoptotic Bax proteins, and inhibited NF-κB translocation from the cytoplasm to the nucleus, leading to the activation of the intrinsic apoptotic pathway. Koenimbin significantly ( P <0.05) reduced the aldehyde dehydrogenase-positive cell population of PC-3 CSCs and the size and number of PC-3 CSCs in primary, secondary, and tertiary prostaspheres in vitro. Koenimbin has chemotherapeutic potential that may be employed for future treatment through decreasing the recurrence of cancer, resulting in the improvement of cancer management strategies and patient survival.

MtDNA depleted PC3 cells exhibit Warburg effect and cancer stem cell features

PubMed Central

Li, Xiaoran; Zhong, Yali; Lu, Jie; Axcrona, Karol; Eide, Lars; Syljuåsen, Randi G.; Peng, Qian; Wang, Junbai; Zhang, Hongquan; Goscinski, Mariusz Adam; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2016-01-01

Reducing mtDNA content was considered as a critical step in the metabolism restructuring for cell stemness restoration and further neoplastic development. However, the connections between mtDNA depletion and metabolism reprograming-based cancer cell stemness in prostate cancers are still lack of studies. Here, we demonstrated that human CRPC cell line PC3 tolerated high concentration of the mtDNA replication inhibitor ethidium bromide (EtBr) and the mtDNA depletion triggered a universal metabolic remodeling process. Failure in completing that process caused lethal consequences. The mtDNA depleted (MtDP) PC3 cells could be steadily maintained in the special medium in slow cycling status. The MtDP PC3 cells contained immature mitochondria and exhibited Warburg effect. Furthermore, the MtDP PC3 cells were resistant to therapeutic treatments and contained greater cancer stem cell-like subpopulations: CD44+, ABCG2+, side-population and ALDHbright. In conclusion, these results highlight the association of mtDNA content, mitochondrial function and cancer cell stemness features. PMID:27248169

Application of mitochondrial pyruvate carrier blocker UK5099 creates metabolic reprogram and greater stem-like properties in LnCap prostate cancer cells in vitro.

PubMed

Zhong, Yali; Li, Xiaoran; Yu, Dandan; Li, Xiaoli; Li, Yaqing; Long, Yuan; Yuan, Yuan; Ji, Zhenyu; Zhang, Mingzhi; Wen, Jian-Guo; Nesland, Jahn M; Suo, Zhenhe

2015-11-10

Aerobic glycolysis is one of the important hallmarks of cancer cells and eukaryotic cells. In this study, we have investigated the relationship between blocking mitochondrial pyruvate carrier (MPC) with UK5099 and the metabolic alteration as well as stemness phenotype of prostatic cancer cells. It was found that blocking pyruvate transportation into mitochondrial attenuated mitochondrial oxidative phosphorylation (OXPHOS) and increased glycolysis. The UK5099 treated cells showed significantly higher proportion of side population (SP) fraction and expressed higher levels of stemness markers Oct3/4 and Nanog. Chemosensitivity examinations revealed that the UK5099 treated cells became more resistant to chemotherapy compared to the non-treated cells. These results demonstrate probably an intimate connection between metabolic reprogram and stem-like phenotype of LnCap cells in vitro. We propose that MPC blocker (UK5099) application may be an ideal model for Warburg effect studies, since it attenuates mitochondrial OXPHOS and increases aerobic glycolysis, a phenomenon typically reflected in the Warburg effect. We conclude that impaired mitochondrial OXPHOS and upregulated glycolysis are related with stem-like phenotype shift in prostatic cancer cells.

Application of mitochondrial pyruvate carrier blocker UK5099 creates metabolic reprogram and greater stem-like properties in LnCap prostate cancer cells in vitro

PubMed Central

Zhong, Yali; Li, Xiaoran; Yu, Dandan; Li, Xiaoli; Li, Yaqing; Long, Yuan; Yuan, Yuan; Ji, Zhenyu; Zhang, Mingzhi; Wen, Jian-Guo; Nesland, Jahn M.; Suo, Zhenhe

2015-01-01

Aerobic glycolysis is one of the important hallmarks of cancer cells and eukaryotic cells. In this study, we have investigated the relationship between blocking mitochondrial pyruvate carrier (MPC) with UK5099 and the metabolic alteration as well as stemness phenotype of prostatic cancer cells. It was found that blocking pyruvate transportation into mitochondrial attenuated mitochondrial oxidative phosphorylation (OXPHOS) and increased glycolysis. The UK5099 treated cells showed significantly higher proportion of side population (SP) fraction and expressed higher levels of stemness markers Oct3/4 and Nanog. Chemosensitivity examinations revealed that the UK5099 treated cells became more resistant to chemotherapy compared to the non-treated cells. These results demonstrate probably an intimate connection between metabolic reprogram and stem-like phenotype of LnCap cells in vitro. We propose that MPC blocker (UK5099) application may be an ideal model for Warburg effect studies, since it attenuates mitochondrial OXPHOS and increases aerobic glycolysis, a phenomenon typically reflected in the Warburg effect. We conclude that impaired mitochondrial OXPHOS and upregulated glycolysis are related with stem-like phenotype shift in prostatic cancer cells. PMID:26413751

Gene Expression in Single Cells Isolated from the CWR-R1 Prostate Cancer Cell Line and Human Prostate Tissue Based on the Side Population Phenotype.

PubMed

Gangavarapu, Kalyan J; Miller, Austin; Huss, Wendy J

2016-09-01

Defining biological signals at the single cell level can identify cancer initiating driver mutations. Techniques to isolate single cells such as microfluidics sorting and magnetic capturing systems have limitations such as: high cost, labor intense, and the requirement of a large number of cells. Therefore, the goal of our current study is to identify a cost and labor effective, reliable, and reproducible technique that allows single cell isolation for analysis to promote regular laboratory use, including standard reverse transcription PCR (RT-PCR). In the current study, we utilized single prostate cells isolated from the CWR-R1 prostate cancer cell line and human prostate clinical specimens, based on the ATP binding cassette (ABC) transporter efflux of dye cycle violet (DCV), side population assay. Expression of four genes: ABCG2; Aldehyde dehydrogenase1A1 (ALDH1A1); androgen receptor (AR); and embryonic stem cell marker, Oct-4, were determined. Results from the current study in the CWR-R1 cell line showed ABCG2 and ALDH1A1 gene expression in 67% of single side population cells and in 17% or 100% of non-side population cells respectively. Studies using single cells isolated from clinical specimens showed that the Oct-4 gene is detected in only 22% of single side population cells and in 78% of single non-side population cells. Whereas, AR gene expression is in 100% single side population and non-side population cells isolated from the same human prostate clinical specimen. These studies show that performing RT-PCR on single cells isolated by FACS can be successfully conducted to determine gene expression in single cells from cell lines and enzymatically digested tissue. While these studies provide a simple yes/no expression readout, the more sensitive quantitative RT-PCR would be able to provide even more information if necessary.

Gene Expression in Single Cells Isolated from the CWR-R1 Prostate Cancer Cell Line and Human Prostate Tissue Based on the Side Population Phenotype

PubMed Central

Gangavarapu, Kalyan J; Miller, Austin; Huss, Wendy J

2016-01-01

Defining biological signals at the single cell level can identify cancer initiating driver mutations. Techniques to isolate single cells such as microfluidics sorting and magnetic capturing systems have limitations such as: high cost, labor intense, and the requirement of a large number of cells. Therefore, the goal of our current study is to identify a cost and labor effective, reliable, and reproducible technique that allows single cell isolation for analysis to promote regular laboratory use, including standard reverse transcription PCR (RT-PCR). In the current study, we utilized single prostate cells isolated from the CWR-R1 prostate cancer cell line and human prostate clinical specimens, based on the ATP binding cassette (ABC) transporter efflux of dye cycle violet (DCV), side population assay. Expression of four genes: ABCG2; Aldehyde dehydrogenase1A1 (ALDH1A1); androgen receptor (AR); and embryonic stem cell marker, Oct-4, were determined. Results from the current study in the CWR-R1 cell line showed ABCG2 and ALDH1A1 gene expression in 67% of single side population cells and in 17% or 100% of non-side population cells respectively. Studies using single cells isolated from clinical specimens showed that the Oct-4 gene is detected in only 22% of single side population cells and in 78% of single non-side population cells. Whereas, AR gene expression is in 100% single side population and non-side population cells isolated from the same human prostate clinical specimen. These studies show that performing RT-PCR on single cells isolated by FACS can be successfully conducted to determine gene expression in single cells from cell lines and enzymatically digested tissue. While these studies provide a simple yes/no expression readout, the more sensitive quantitative RT-PCR would be able to provide even more information if necessary. PMID:27785389

Brachyury as a potential modulator of androgen receptor activity and a key player in therapy resistance in prostate cancer

PubMed Central

Pinto, Filipe; Pértega-Gomes, Nelma; Vizcaíno, José R.; Andrade, Raquel P.; Cárcano, Flavio M.; Reis, Rui Manuel

2016-01-01

Prostate cancer (PCa) is the most commonly diagnosed neoplasm and the second leading cause of cancer-related deaths in men. Acquisition of resistance to conventional therapy is a major problem for PCa patient management. Several mechanisms have been described to promote therapy resistance in PCa, such as androgen receptor (AR) activation, epithelial-to-mesenchymal transition (EMT), acquisition of stem cell properties and neuroendocrine transdifferentiation (NEtD). Recently, we identified Brachyury as a new biomarker of PCa aggressiveness and poor prognosis. In the present study we aimed to assess the role of Brachyury in PCa therapy resistance. We showed that Brachyury overexpression in prostate cancer cells lines increased resistance to docetaxel and cabazitaxel drugs, whereas Brachyury abrogation induced decrease in therapy resistance. Through ChiP-qPCR assays we further demonstrated that Brachyury is a direct regulator of AR expression as well as of the biomarker AMACR and the mesenchymal markers Snail and Fibronectin. Furthermore, in vitro Brachyury was also able to increase EMT and stem properties. By in silico analysis, clinically human Brachyury-positive PCa samples were associated with biomarkers of PCa aggressiveness and therapy resistance, including PTEN loss, and expression of NEtD markers, ERG and Bcl-2. Taken together, our results indicate that Brachyury contributes to tumor chemotherapy resistance, constituting an attractive target for advanced PCa patients. PMID:27049720

Exosomes secreted by placental stem cells selectively inhibit growth of aggressive prostate cancer cells.

PubMed

Peak, Taylor C; Praharaj, Prakash P; Panigrahi, Gati K; Doyle, Michael; Su, Yixin; Schlaepfer, Isabel R; Singh, Ravi; Vander Griend, Donald J; Alickson, Julie; Hemal, Ashok; Atala, Anthony; Deep, Gagan

2018-05-23

The current paradigm in the development of new cancer therapies is the ability to target tumor cells while avoiding harm to noncancerous cells. Furthermore, there is a need to develop novel therapeutic options against drug-resistant cancer cells. Herein, we characterized the placental-derived stem cell (PLSC) exosomes (PLSC Exo ) and evaluated their anti-cancer efficacy in prostate cancer (PCa) cell lines. Nanoparticle tracking analyses revealed the size distribution (average size 131.4 ± 0.9 nm) and concentration of exosomes (5.23 × 10 10 ±1.99 × 10 9 per ml) secreted by PLSC. PLSC Exo treatment strongly inhibited the viability of enzalutamide-sensitive and -resistant PCa cell lines (C4-2B, CWR-R1, and LNCaP cells). Interestingly, PLSC Exo treatment had no effect on the viability of a non-neoplastic human prostate cell line (PREC-1). Mass spectrometry (MS) analyses showed that PLSC Exo are loaded with 241 proteins and mainly with saturated fatty acids. Further, Ingenuity Pathway Analysis analyses of proteins loaded in PLSC Exo suggested the role of retinoic acid receptor/liver x receptor pathways in their biological effects. Together, these results suggest the novel selective anti-cancer effects of PLSC Exo against aggressive PCa cells. Copyright © 2018 Elsevier Inc. All rights reserved.

The flavonoid apigenin reduces prostate cancer CD44(+) stem cell survival and migration through PI3K/Akt/NF-κB signaling.

PubMed

Erdogan, Suat; Doganlar, Oguzhan; Doganlar, Zeynep B; Serttas, Riza; Turkekul, Kader; Dibirdik, Ilker; Bilir, Ayhan

2016-10-01

Cancer stem cells (CSCs) are involved in drug resistance, metastasis and recurrence of cancers. The efficacy of apigenin on cell survival, apoptosis, migration and stemness properties were analyzed in CSCs. Prostate CSCs (CD44(+)) were isolated from human prostate cancer (PCa) PC3 cells using a magnetic-activated cell sorting system. PC3 and CSCs were treated with various concentrations of apigenin, docetaxel and their combinations for 48h. Apigenin dose dependently inhibited CSCs and PC3 cell survival, and this was accompanied with a significant increase of p21 and p27. Apigenin induced apoptosis via an extrinsic caspase-dependent pathway by upregulating the mRNA expressions of caspases-8, -3 and TNF-α, but failed to regulate the intrinsic pathway as determined by the Bax, cytochrome c (Cyt-c) and APAF-1 in CSCs. In contrary to CSCs, apigenin induced intrinsic apoptosis pathway as evidenced by the induction of Bax, Cyt-c and caspase-3 while caspase-8, TNF-α and Bcl-2 levels remained unchanged in PC3 cells. The flavonoid strongly suppressed the migration rate of CSCs compared to untreated cells. Significant downregulation of matrix metallopeptidases-2, -9, Snail and Slug exhibits the ability of apigenin treatment to suppress invasion. The expressions of NF-κB p105/p50, PI3K, Akt and the phosphorylation of pAkt were decreased after apigenin treatment. Moreover, apigenin treatment significantly reduced pluripotency marker Oct3/4 protein expression which might be associated with the down-regulation of PI3K/Akt/NF-κB signaling. Our data indicated that, apigenin could be a useful compound to prevent proliferation and migration of cancer cells as well as CSCs. Copyright © 2016 Elsevier Inc. All rights reserved.

High activity Rhenium-186 HEDP with autologous peripheral blood stem cell rescue: a phase I study in progressive hormone refractory prostate cancer metastatic to bone

PubMed Central

O'Sullivan, J M; McCready, V R; Flux, G; Norman, A R; Buffa, F M; Chittenden, S; Guy, M; Pomeroy, K; Cook, G; Gadd, J; Treleaven, J; Al-Deen, A; Horwich, A; Huddart, R A; Dearnaley, D P

2002-01-01

We tested the feasibility and toxicity of high activities Rhenium-186 hydroxyethylidene diphosphonate, with peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. Twenty-five patients received between 2500 and 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate followed 14 days later by the return of peripheral blood peripheral blood stem cells. Activity limiting toxicity was defined as grade III haematological toxicity, lasting at least 7 days, or grade IV haematological toxicity of any duration or any serious unexpected toxicity. Activity limiting toxicity occurred in two of six who received activities of 5000 MBq and maximum tolerated activity was defined at this activity level. Prostate specific antigen reductions of 50% or more lasting at least 4 weeks were seen in five of the 25 patients (20%) all of whom received more than 3500 MBq of Rhenium-186 hydroxyethylidene diphosphonate. The actuarial survival at 1 year is 54%. Administered activities of 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate are feasible using autologous peripheral blood peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. The main toxicity is thrombocytopaenia, which is short lasting. A statistically significant activity/prostate specific antigen response was seen. We have now commenced a Phase II trial to further evaluate response rates. British Journal of Cancer (2002) 86, 1715–1720. doi:10.1038/sj.bjc.6600348 www.bjcancer.com © 2002 Cancer Research UK PMID:12087455

Chemopreventive Effect of PSP Through Targeting of Prostate Cancer Stem Cell-Like Population

PubMed Central

Liu, Ji; Lee, Davy Tak-Wing; Chiu, Yung-Tuen; Ma, Stephanie; Ng, Irene Oi-Lin; Wong, Yong-Chuan; Chan, Franky Leung; Ling, Ming-Tat

2011-01-01

Recent evidence suggested that prostate cancer stem/progenitor cells (CSC) are responsible for cancer initiation as well as disease progression. Unfortunately, conventional therapies are only effective in targeting the more differentiated cancer cells and spare the CSCs. Here, we report that PSP, an active component extracted from the mushroom Turkey tail (also known as Coriolus versicolor), is effective in targeting prostate CSCs. We found that treatment of the prostate cancer cell line PC-3 with PSP led to the down-regulation of CSC markers (CD133 and CD44) in a time and dose-dependent manner. Meanwhile, PSP treatment not only suppressed the ability of PC-3 cells to form prostaspheres under non-adherent culture conditions, but also inhibited their tumorigenicity in vivo, further proving that PSP can suppress prostate CSC properties. To investigate if the anti-CSC effect of PSP may lead to prostate cancer chemoprevention, transgenic mice (TgMAP) that spontaneously develop prostate tumors were orally fed with PSP for 20 weeks. Whereas 100% of the mice that fed with water only developed prostate tumors at the end of experiment, no tumors could be found in any of the mice fed with PSP, suggesting that PSP treatment can completely inhibit prostate tumor formation. Our results not only demonstrated the intriguing anti-CSC effect of PSP, but also revealed, for the first time, the surprising chemopreventive property of oral PSP consumption against prostate cancer. PMID:21603625

Concepts of epigenetics in prostate cancer development.

PubMed

Cooper, C S; Foster, C S

2009-01-27

Substantial evidence now supports the view that epigenetic changes have a role in the development of human prostate cancer. Analyses of the patterns of epigenetic alteration are providing important insights into the origin of this disease and have identified specific alterations that may serve as useful diagnostic and prognostic biomarkers. Examination of cancer methylation patterns supports a stem cell origin of prostate cancer. It is well established that methylation of GSTpi is a marker of prostate cancer, and global patterns of histone marking appear to be linked to cancer prognosis with levels of acetylated histones H3K9, H3K18, and H4K12, and of dimethylated H4R3 and H3K4, dividing low-grade prostate cancer (Gleason 6 or less) into two prognostically separate groups. Elevated levels of several components of the polycomb group protein complex, EZH2, BMI1, and RING1, can also act as biomarkers of poor clinical outcome. Many components of the epigenetic machinery, including histone deacetylase (whose expression level is linked to the TMPRSS2:ERG translocation) and the histone methylase EZH2, are potential therapeutic targets. The recent discovery of the role of small RNAs in governing the epigenetic status of individual genes offers exciting new possibilities in therapeutics and chemoprevention.

Clonal Evaluation of Prostate Cancer by ERG/SPINK1 Status to Improve Prognosis Prediction

DTIC Science & Technology

2015-10-01

waiting for case numbers to increase. Significant changes in use or care of human subjects, vertebrate animals , biohazards, and/or select agents...IHC at UM is no longer with the University. He has been replaced by Connie Brenke, who is now performing the staining which is ongoing (as shown in...and genomics. Institutional partners include the FHCRC and the UW Institute of Stem Cell Sciences. Core A: Tissues/ Sera /Models The major function

The Anti-cancer Activity of Vernonia divaricata Sw against Leukaemia, Breast and Prostate Cancers In Vitro

PubMed Central

Lowe, HIC; Daley-Beckford, D; Toyang, NJ; Watson, C; Hartley, S; Bryant, J

2014-01-01

Background: Vernonia divaricata is one of five endemic Vernonia species of Jamaica. The ethnomedicinal uses of other species have been established, however, scientific validation of this species has not yet been done and as such this paper is aimed at identifying the anti-cancer activity of V divaricata against leukaemia, breast and prostate cancer cell lines. Methods: Leaves and stems of V divaricata were dried and milled into powder. The crude hexane and methanol extracts of the leaves and stems were obtained and bio-assayed using WST-1 cell proliferation assay against leukaemia, breast and prostate cancer cell lines. Results: The crude hexane and methanol extracts of V divaricata were able to significantly retard the growth of the MCF-7 (breast), HL-60 (leukaemia) and the PC-3 (prostate) cancer cell lines. The crude methanol extract of the stem was the strongest, exhibiting anti-proliferation activity with IC50 values of 10.14, 12.63 and 9.894 μg/ml for the HL-60, MCF-7 and PC-3 cancer cell lines, respectively, with the most potent toward prostate cancer. Conclusion: The medicinal use of V divaricata as an anti-cancer agent was corroborated as the crude hexane and methanol extracts demonstrated potent anti-proliferation activity and as such hold potential for further research and development into a drug to prevent or treat various cancers. PMID:25429469

Sunitinib reduces tumor hypoxia and angiogenesis, and radiosensitizes prostate cancer stem-like cells.

PubMed

Diaz, Roque; Nguewa, Paul A; Redrado, Miriam; Manrique, Irene; Calvo, Alfonso

2015-08-01

The need for new treatments for advanced prostate cancer has fostered the experimental use of targeted therapies. Sunitinib is a multi-tyrosine kinase inhibitor that mainly targets membrane-bound receptors of cells within the tumor microenvironment, such as endothelial cells and pericytes. However, recent studies suggest a direct effect on tumor cells. In the present study, we have evaluated both direct and indirect effects of Sunitinib in prostate cancer and how this drug regulates hypoxia, using in vitro and in vivo models. We have used both in vitro (PC-3, DU145, and LNCaP cells) and in vivo (PC-3 xenografts) models to study the effect of Sunitinib in prostate cancer. Analysis of hypoxia based on HIF-1α expression and FMISO uptake was conducted. ALDH activity was used to analyze cancer stem cells (CSC). Sunitinib strongly reduced proliferation of PC-3 and DU-145 cells in a dose dependent manner, and decreased levels of p-Akt, p-Erk1/2, and Id-1, compared to untreated cells. A 3-fold reduction in tumor growth was also observed (P < 0.001 with respect to controls). Depletion of Hif-1α levels in vitro and a decrease in FMISO uptake in vivo showed that Sunitinib inhibits tumor hypoxia. When combined with radiotherapy, this drug enhanced cell death in vitro and in vivo, and significantly decreased CD-31, PDGFRβ, Hif-1α, Id1, and PCNA protein levels (whereas apoptosis was increased) in tumors as compared to controls or single-therapy treated mice. Moreover, Sunitinib reduced the number of ALDH + cancer stem-like cells and sensitized these cells to radiation-mediated loss of clonogenicity. Our results support the use of Sunitinib in prostate cancer and shows that both hypoxia and cancer stem cells are involved in the effect elicited by this drug. Combination of Sunitinib with radiotherapy warrants further consideration to reduce prostate cancer burden. © 2015 Wiley Periodicals, Inc.

Engineering A11 Minibody-Conjugated, Polypeptide-Based Gold Nanoshells for Prostate Stem Cell Antigen (PSCA)-Targeted Photothermal Therapy.

PubMed

Mayle, Kristine M; Dern, Kathryn R; Wong, Vincent K; Chen, Kevin Y; Sung, Shijun; Ding, Ke; Rodriguez, April R; Knowles, Scott; Taylor, Zachary; Zhou, Z Hong; Grundfest, Warren S; Wu, Anna M; Deming, Timothy J; Kamei, Daniel T

2017-02-01

Currently, there is no curative treatment for advanced metastatic prostate cancer, and options, such as chemotherapy, are often nonspecific, harming healthy cells and resulting in severe side effects. Attaching targeting ligands to agents used in anticancer therapies has been shown to improve efficacy and reduce nonspecific toxicity. Furthermore, the use of triggered therapies can enable spatial and temporal control over the treatment. Here, we combined an engineered prostate cancer-specific targeting ligand, the A11 minibody, with a novel photothermal therapy agent, polypeptide-based gold nanoshells, which generate heat in response to near-infrared light. We show that the A11 minibody strongly binds to the prostate stem cell antigen that is overexpressed on the surface of metastatic prostate cancer cells. Compared to nonconjugated gold nanoshells, our A11 minibody-conjugated gold nanoshell exhibited significant laser-induced, localized killing of prostate cancer cells in vitro. In addition, we improved upon a comprehensive heat transfer mathematical model that was previously developed by our laboratory. By relaxing some of the assumptions of our earlier model, we were able to generate more accurate predictions for this particular study. Our experimental and theoretical results demonstrate the potential of our novel minibody-conjugated gold nanoshells for metastatic prostate cancer therapy.

Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells

DTIC Science & Technology

2015-10-01

LNCaP-CRPC cells expressed AR protein and its 4 targets, i.e., PSA, FKBP5, PAP (prostate alkaline phosphatase), and PSMA (prostate-specific membrane...LNCaP GAPDH FKBP5 PSA 75 - 50 - PAP AR *** 100 - 75 - AR-V7100 -75 - PSMA 100 - 250 - 150 - 37 - 25 - 50 - 36 - A B C CDSS CDSS+Bica Re lat ive m

Zika Virus Selectively Kills Aggressive Human Embryonal CNS Tumor Cells In Vitro and In Vivo.

PubMed

Kaid, Carolini; Goulart, Ernesto; Caires-Júnior, Luiz C; Araujo, Bruno H S; Soares-Schanoski, Alessandra; Bueno, Heloisa M S; Telles-Silva, Kayque A; Astray, Renato M; Assoni, Amanda F; Júnior, Antônio F R; Ventini, Daniella C; Puglia, Ana L P; Gomes, Roselane P; Zatz, Mayana; Okamoto, Oswaldo K

2018-06-15

Zika virus (ZIKV) is largely known for causing brain abnormalities due to its ability to infect neural progenitor stem cells during early development. Here, we show that ZIKV is also capable of infecting and destroying stem-like cancer cells from aggressive human embryonal tumors of the central nervous system (CNS). When evaluating the oncolytic properties of Brazilian Zika virus strain (ZIKV BR ) against human breast, prostate, colorectal, and embryonal CNS tumor cell lines, we verified a selective infection of CNS tumor cells followed by massive tumor cell death. ZIKV BR was more efficient in destroying embryonal CNS tumorspheres than normal stem cell neurospheres. A single intracerebroventricular injection of ZIKV BR in BALB/c nude mice bearing orthotopic human embryonal CNS tumor xenografts resulted in a significantly longer survival, decreased tumor burden, fewer metastasis, and complete remission in some animals. Tumor cells closely resembling neural stem cells at the molecular level with activated Wnt signaling were more susceptible to the oncolytic effects of ZIKV BR Furthermore, modulation of Wnt signaling pathway significantly affected ZIKV BR -induced tumor cell death and viral shedding. Altogether, these preclinical findings indicate that ZIKV BR could be an efficient agent to treat aggressive forms of embryonal CNS tumors and could provide mechanistic insights regarding its oncolytic effects. Significance: Brazilian Zika virus strain kills aggressive metastatic forms of human CNS tumors and could be a potential oncolytic agent for cancer therapy. Cancer Res; 78(12); 3363-74. ©2018 AACR . ©2018 American Association for Cancer Research.

Genetic variant as a marker for bladder cancer therapy

Cancer.gov

Patients who have inherited a specific common genetic variant develop bladder cancer tumors that strongly express a protein known as prostate stem cell antigen (PSCA), which is also expressed in many pancreatic and prostate tumors, according to research a

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2012-08-01

guidelines. Adjacent prostate tissue was snap frozen in liquid Nitrogen or fixed in formalin and paraffin-embedded to evaluate anatomy and glandular...phenotypically normal and fertile [35]. We examined the prostate at 8 and 20 weeks of age and found no difference in gross anatomy and histology among WT...gross anatomy of the prostate of WT and CD1662/2 mice at 8 weeks of age, scale bar: 2 mm. Bottom: HE staining of DLP section from WT and CD1662/2 mice

BMP7 Induces Dormancy of Prostatic Tumor Stem Cell in Bone

DTIC Science & Technology

2012-10-01

the upper back of nude mice. Recombinant human BMP7 was peritumorally injected daily after implantation. Tumor growth was monitored weekly by...of BMP7 was administrated daily through i.v. after intracardiac injection of CSCs from PC3mm or C4-2B cells to the mice. As shown in Figure 5A...mice, and then BMP7 was administrated daily . BLI of representative mice in each group six weeks after implantation (A). Normalized BLI signals

Correlation of mRNA and protein levels: Cell type-specific gene expression of cluster designation antigens in the prostate

PubMed Central

Pascal, Laura E; True, Lawrence D; Campbell, David S; Deutsch, Eric W; Risk, Michael; Coleman, Ilsa M; Eichner, Lillian J; Nelson, Peter S; Liu, Alvin Y

2008-01-01

Background: Expression levels of mRNA and protein by cell types exhibit a range of correlations for different genes. In this study, we compared levels of mRNA abundance for several cluster designation (CD) genes determined by gene arrays using magnetic sorted and laser-capture microdissected human prostate cells with levels of expression of the respective CD proteins determined by immunohistochemical staining in the major cell types of the prostate – basal epithelial, luminal epithelial, stromal fibromuscular, and endothelial – and for prostate precursor/stem cells and prostate carcinoma cells. Immunohistochemical stains of prostate tissues from more than 50 patients were scored for informative CD antigen expression and compared with cell-type specific transcriptomes. Results: Concordance between gene and protein expression findings based on 'present' vs. 'absent' calls ranged from 46 to 68%. Correlation of expression levels was poor to moderate (Pearson correlations ranged from 0 to 0.63). Divergence between the two data types was most frequently seen for genes whose array signals exceeded background (> 50) but lacked immunoreactivity by immunostaining. This could be due to multiple factors, e.g. low levels of protein expression, technological sensitivities, sample processing, probe set definition or anatomical origin of tissue and actual biological differences between transcript and protein abundance. Conclusion: Agreement between these two very different methodologies has great implications for their respective use in both molecular studies and clinical trials employing molecular biomarkers. PMID:18501003

Formulation of the bivalent prostate cancer vaccine with surgifoam elicits antigen-specific effector T cells in PSA-transgenic mice.

PubMed

Karan, Dev

2017-10-13

We previously developed and characterized an adenoviral-based prostate cancer vaccine for simultaneous targeting of prostate-specific antigen (PSA) and prostate stem cell antigen (PSCA). We also demonstrated that immunization of mice with the bivalent vaccine (Ad 5 -PSA+PSCA) inhibited the growth of established prostate tumors. However, there are multiple challenges hindering the success of immunological therapies in the clinic. One of the prime concerns has been to overcome the immunological tolerance and maintenance of long-term effector T cells. In this study, we further characterized the use of the bivalent vaccine (Ad 5 -PSA+PSCA) in a transgenic mouse model expressing human PSA in the mouse prostate. We demonstrated the expression of PSA analyzed at the mRNA level (by RT-PCR) and protein level (by immunohistochemistry) in the prostate lobes harvested from the PSA-transgenic (PSA-Tg) mice. We established that the administration of the bivalent vaccine in surgifoam to the PSA-Tg mice induces strong PSA-specific effector CD8 + T cells as measured by IFN-γ secretion and in vitro cytotoxic T-cell assay. Furthermore, the use of surgifoam with Ad 5 -PSA+PSCA vaccine allows multiple boosting vaccinations with a significant increase in antigen-specific CD8 + T cells. These observations suggest that the formulation of the bivalent prostate cancer vaccine (Ad 5 -PSA+PSCA) with surgifoam bypasses the neutralizing antibody response, thus allowing multiple boosting. This formulation is also helpful for inducing an antigen-specific immune response in the presence of self-antigen, and maintains long-term effector CD8 + T cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Semaphorin 3 C drives epithelial-to-mesenchymal transition, invasiveness, and stem-like characteristics in prostate cells.

PubMed

Tam, Kevin J; Hui, Daniel H F; Lee, Wilson W; Dong, Mingshu; Tombe, Tabitha; Jiao, Ivy Z F; Khosravi, Shahram; Takeuchi, Ario; Peacock, James W; Ivanova, Larissa; Moskalev, Igor; Gleave, Martin E; Buttyan, Ralph; Cox, Michael E; Ong, Christopher J

2017-09-13

Prostate cancer (PCa) is among the most commonly-occurring cancers worldwide and a leader in cancer-related deaths. Local non-invasive PCa is highly treatable but limited treatment options exist for those with locally-advanced and metastatic forms of the disease underscoring the need to identify mechanisms mediating PCa progression. The semaphorins are a large grouping of membrane-associated or secreted signalling proteins whose normal roles reside in embryogenesis and neuronal development. In this context, semaphorins help establish chemotactic gradients and direct cell movement. Various semaphorin family members have been found to be up- and down-regulated in a number of cancers. One family member, Semaphorin 3 C (SEMA3C), has been implicated in prostate, breast, ovarian, gastric, lung, and pancreatic cancer as well as glioblastoma. Given SEMA3C's roles in development and its augmented expression in PCa, we hypothesized that SEMA3C promotes epithelial-to-mesenchymal transition (EMT) and stem-like phenotypes in prostate cells. In the present study we show that ectopic expression of SEMA3C in RWPE-1 promotes the upregulation of EMT and stem markers, heightened sphere-formation, and cell plasticity. In addition, we show that SEMA3C promotes migration and invasion in vitro and cell dissemination in vivo.

Co-Expression of Putative Cancer Stem Cell Markers CD44 and CD133 in Prostate Carcinomas.

PubMed

Kalantari, Elham; Asgari, Mojgan; Nikpanah, Seyedehmoozhan; Salarieh, Naghme; Asadi Lari, Mohammad Hossein; Madjd, Zahra

2017-10-01

Cancer stem cells (CSCs) are the main players of prostate tumorigenesis thus; characterization of CSCs can pave the way for understanding the early detection, drug resistance, metastasis and relapse. The current study was conducted to evaluate the expression level and clinical significance of the potential CSC markers CD44 and CD133 in a series of prostate tissues. One hundred and forty eight prostate tissues composed of prostate cancer (PCa), high-grade prostatic intraepithelial neoplasia (HGPIN), and benign prostate hyperplasia (BPH) were immunostained for the putative CSC markers CD44 and CD133. Subsequently, the correlation between the expression of these markers and the clinicopathological variables was examined. A higher level of CD44 expression was observed in 42% of PCa, 57% of HGPIN, and 42% BPH tissues. In the case of CD133 expression PCa, HGPIN, and BPH samples demonstrated high immunoreactivity in 46%, 43%, and 42% of cells, respectively. Statistical analysis showed an inverse significant correlation between CD44 expression with Gleason score of PCa (P = 0.02), while no significant correlation was observed between CD133 expression and clinicopathological parameters. A significant reciprocal correlation was observed between the expression of two putative CSC markers CD44 and CD133 in PCa specimens while not indicating clinical significance. Further clinical investigation is required to consider these markers as targets of new therapeutic strategies for PCa.

Expression of the gastrin-releasing peptide receptor, the prostate stem cell antigen and the prostate-specific membrane antigen in lymph node and bone metastases of prostate cancer.

PubMed

Ananias, Hildo J K; van den Heuvel, Marius C; Helfrich, Wijnand; de Jong, Igle J

2009-07-01

Cell membrane antigens like the gastrin-releasing peptide receptor (GRPR), the prostate stem cell antigen (PSCA), and the prostate-specific membrane antigen (PSMA), expressed in prostate cancer, are attractive targets for new therapeutic and diagnostic applications. Therefore, we investigated in this study whether these antigens are expressed in metastasized prostate cancer. Formalin-fixed, paraffin-embedded specimens of 15 patients with uni- or bilateral lymph node metastases of prostate cancer (totaling 21 cases) and 17 patient-cases of bone metastases were processed for immunohistochemistry with anti-GRPR, anti-PSCA, and anti-PSMA antibodies. A pathologist blinded to clinical and pathological data scored the immunoreactivity for these antibodies on a four-point scale (0 = no staining; 1+ = weak staining; 2+ = moderate staining; 3+ = strong staining) and documented the distribution pattern. GRPR staining in lymph node metastases was seen in 85.7% of cases (18 of 21 cases), PSCA in 95.2% (20/21), and PSMA in 100% (21/21). GRPR in bone metastases was seen in 52.9% of cases (9/17), PSCA in 94.1% (16/17), and PSMA in 100% (17/17). We have shown for the first time that GRPR is expressed in the vast majority of lymph node metastases and in 52.9% of bone metastases of prostate cancer. PSCA and PSMA are both highly expressed in lymph node and bone metastases. Although PSCA and PSMA are mostly expressed in prostate cancer metastases, GRPR offers an interesting alternative target as it can be targeted relatively easy with peptide-based (radio)pharmaceuticals. (c) 2009 Wiley-Liss, Inc.

Curcumin Suppresses In Vitro Proliferation and Invasion of Human Prostate Cancer Stem Cells by Modulating DLK1-DIO3 Imprinted Gene Cluster MicroRNAs.

PubMed

Zhang, Hu; Zheng, Jiajia; Shen, Hongliang; Huang, Yongyi; Liu, Te; Xi, Hao; Chen, Chuan

2018-01-01

Curcumin can suppress human prostate cancer (HuPCa) cell proliferation and invasion. However, it is not known whether curcumin can inhibit HuPCa stem cell (HuPCaSC) proliferation and invasion. We used methyl thiazolyl tetrazolium and Transwell assays to examine the proliferation and invasion of the HuPCaSC lines DU145 and 22Rv1 following curcumin or dimethyl sulfoxide (control) treatment. The microRNA (miRNA) expression levels in the DLK1-DIO3 imprinted genomic region in the cells and in tumor tissues from patients with PCa were examined using microarray and quantitative PCR. The median inhibitory concentration of curcumin for HuPCa cells significantly inhibited HuPCaSC proliferation and invasion in vitro. The miR-770-5p and miR-1247 expression levels in the DLK1-DIO3 imprinted gene cluster were significantly different between the curcumin-treated and control HuPCaSCs. Overexpression of these positive miRNAs significantly increased the inhibition rates of miR-770-5p- and miR-1247-transfected HuPCaSCs compared to the control miR-Mut-transfected HuPCaSCs. Lastly, low-tumor grade PCa tissues had higher miR-770-5p and miR-1247 expression levels than high-grade tumor tissues. Curcumin can suppress HuPCaSC proliferation and invasion in vitro by modulating specific miRNAs in the DLK1-DIO3 imprinted gene cluster.

SOX2 plays a critical role in EGFR-mediated self-renewal of human prostate cancer stem-like cells.

PubMed

Rybak, Adrian P; Tang, Damu

2013-12-01

SOX2 is an essential transcription factor for stem cells and plays a role in tumorigenesis, however its role in prostate cancer stem cells (PCSCs) remains unclear. We report here a significant upregulation of SOX2 at both mRNA and protein levels in DU145 PCSCs propagated as suspension spheres in vitro. The expression of SOX2 in DU145 PCSCs is positively regulated by epidermal growth factor receptor (EGFR) signaling. Activation of EGFR signaling, following the addition of epidermal growth factor (EGF) or ectopic expression of a constitutively-active EGFR mutant (EGFRvIII), increased SOX2 expression and the self-renewal of DU145 PCSCs. Conversely, a small molecule EGFR inhibitor (AG1478) blocked EGFR activation, reduced SOX2 expression and inhibited PCSC self-renewal activity, implicating SOX2 in mediating EGFR-dependent self-renewal of PCSCs. In line with this notion, ectopic SOX2 expression enhanced EGF-induced self-renewal of DU145 PCSCs, while SOX2 knockdown reduced PCSC self-renewal with EGF treatment no longer capable of enhancing their propagation. Furthermore, SOX2 knockdown reduced the capacity of DU145 PCSCs to grow under anchorage-independent conditions. Finally, DU145 PCSCs generated xenograft tumors more aggressively with elevated levels of SOX2 expression compared to xenograft tumors derived from non-PCSCs. Collectively, we provide evidence that SOX2 plays a critical role in EGFR-mediated self-renewal of DU145 PCSCs. © 2013.

Exosomes Secreted under Hypoxia Enhance Invasiveness and Stemness of Prostate Cancer Cells by Targeting Adherens Junction Molecules

PubMed Central

Ramteke, Anand; Ting, Harold; Agarwal, Chapla; Mateen, Samiha; Somasagara, Ranganathan; Hussain, Anowar; Graner, Michael; Frederick, Barbara; Agarwal, Rajesh; Deep, Gagan

2015-01-01

Hypoxic conditions in prostate cancer (PCA) are associated with poor prognosis; however, precise mechanism/s through which hypoxia promotes malignant phenotype remains unclear. Here, we analyzed the role of exosomes from hypoxic PCA cells in enhancing the invasiveness and stemness of naïve PCA cells, as well as in promoting cancer-associated fibroblast (CAF) phenotype in prostate stromal cells (PrSC). Human PCA LNCaP and PC3 cells were exposed to hypoxic (1% O2) or normoxic (21% O2) conditions, and exosomes secreted under hypoxic (ExoHypoxic) and normoxic (ExoNormoxic) conditions were isolated from conditioned media. Nanoparticle tracking analysis revealed that ExoHypoxic have smaller average size as compared to ExoNormoxic. Immunoblotting results showed a higher level of tetraspanins (CD63 and CD81), heat shock proteins (HSP90 and HSP70) and Annexin II in ExoHypoxic compared to ExoNormoxic. Co-culturing with ExoHypoxic increased the invasiveness and motility of naïve LNCaP and PC3 cells, respectively. ExoHypoxic also promoted prostasphere formation by both LNCaP and PC3 cells, and enhanced α-SMA (a CAF biomarker) expression in PrSC. Compared to ExoNormoxic, ExoHypoxic showed higher metalloproteinases activity and increased level of diverse signaling molecules (TGF-β2, TNF1α, IL6, TSG101, Akt, ILK1, and β-catenin). Furthermore, proteome analysis revealed a higher number of proteins in ExoHypoxic (160 proteins) compared to ExoNormoxic (62 proteins), primarily associated with the remodeling of epithelial adherens junction pathway. Importantly, ExoHypoxic targeted the expression of adherens junction proteins in naïve PC3 cells. These findings suggest that ExoHypoxic are loaded with unique proteins that could enhance invasiveness, stemness and induce microenvironment changes; thereby, promoting PCA aggressiveness. PMID:24347249

Detection and characterization of invasive circulating tumor cells derived from men with metastatic castration-resistant prostate cancer.

PubMed

Friedlander, Terence W; Ngo, Vy T; Dong, Huan; Premasekharan, Gayatri; Weinberg, Vivian; Doty, Shaun; Zhao, Qiang; Gilbert, Elizabeth G; Ryan, Charles J; Chen, Wen-Tien; Paris, Pamela L

2014-05-15

The Vitatex cell-adhesion matrix (CAM) platform allows for isolation of invasive circulating tumor cells (iCTCs). Here we sought to determine the utility of prostate-specific membrane antigen (PSMA) as a metastatic castration-resistant prostate cancer (mCRPC) iCTC biomarker, to identify solitary cells and clusters of iCTCs expressing either epithelial, mesenchymal, or stem cell markers, and to explore the feasibility of iCTC epigenomic analysis. CTCs were isolated and enumerated simultaneously using the Vitatex and CellSearch platforms in 23 men with mCRPC. CAM-avid iCTCs were identified as nucleated cells capable of CAM uptake, but without detectable expression of hematopoietic lineage (HL) markers including CD45. iCTCs were enumerated immunocytochemically (ICC) and by flow cytometry. Whole-genome methylation status was determined for iCTCs using the Illumina HumanMethylation27 BeadChip. Thirty-four samples were collected for iCTC analysis. A median of 27 (range 0-800) and 23 (range 2-390) iCTCs/mL were detected by ICC and flow, respectively. In a subset of 20 samples, a median of seven CTCs/mL (range 0-85) were detected by the CellSearch platform compared to 26 by the CAM platform. iCTC clusters were observed in 17% of samples. iCTCs expressing PSMA as well as markers of EMT and stemness were detectable. The iCTC methylation profile highly resembled mCRPC. More CTCs were recovered using the CAM platform than the CellSearch platform, and the CAM platform allowed for the detection of iCTC clusters, iCTCs expressing EMT and stem-cell markers, and characterization of the iCTC methylome. Correlation with clinical data in future studies may yield further insight into the functional significance of these findings. © 2013 UICC.

Overexpression and knock-down studies highlight that a disintegrin and metalloproteinase 28 controls proliferation and migration in human prostate cancer.

PubMed

Rudnicka, Caroline; Mochizuki, Satsuki; Okada, Yasunori; McLaughlin, Claire; Leedman, Peter J; Stuart, Lisa; Epis, Michael; Hoyne, Gerard; Boulos, Sherif; Johnson, Liam; Schlaich, Markus; Matthews, Vance

2016-10-01

Prostate cancer is one of the most prevalent cancers in men. It is critical to identify and characterize oncogenes that drive the pathogenesis of human prostate cancer. The current study builds upon previous research showing that a disintegrin and metallproteinase (ADAM)28 is involved in the pathogenesis of numerous cancers. Our novel study used overexpression, pharmacological, and molecular approaches to investigate the biological function of ADAM28 in human prostate cancer cells, with a focus on cell proliferation and migration. The results of this study provide important insights into the role of metalloproteinases in human prostate cancer.The expression of ADAM28 protein levels was assessed within human prostate tumors and normal adjacent tissue by immunohistochemistry. Immunocytochemistry and western blotting were used to assess ADAM28 protein expression in human prostate cancer cell lines. Functional assays were conducted to assess proliferation and migration in human prostate cancer cells in which ADAM28 protein expression or activity had been altered by overexpression, pharmacological inhibition, or by siRNA gene knockdown.The membrane bound ADAM28 was increased in human tumor biopsies and prostate cancer cell lines. Pharmacological inhibition of ADAM28 activity and/or knockdown of ADAM28 significantly reduced proliferation and migration of human prostate cancer cells, while overexpression of ADAM28 significantly increased proliferation and migration.ADAM28 is overexpressed in primary human prostate tumor biopsies, and it promotes human prostate cancer cell proliferation and migration. This study supports the notion that inhibition of ADAM28 may be a potential novel therapeutic strategy for human prostate cancer.

Systematic dissection of phenotypic, functional, and tumorigenic heterogeneity of human prostate cancer cells

PubMed Central

Chao, Hsueh-Ping; Deng, Qu; Jeter, Collene; Liu, Can; Honorio, Sofia; Li, Hangwen; Davis, Tammy; Suraneni, Mahipal; Laffin, Brian; Qin, Jichao; Li, Qiuhui; Yang, Tao; Whitney, Pamela; Shen, Jianjun; Huang, Jiaoti; Tang, Dean G.

2015-01-01

Human cancers are heterogeneous containing stem-like cancer cells operationally defined as cancer stem cells (CSCs) that possess great tumor-initiating and long-term tumor-propagating properties. In this study, we systematically dissect the phenotypic, functional and tumorigenic heterogeneity in human prostate cancer (PCa) using xenograft models and >70 patient tumor samples. In the first part, we further investigate the PSA−/lo PCa cell population, which we have recently shown to harbor self-renewing long-term tumor-propagating cells and present several novel findings. We show that discordant AR and PSA expression in both untreated and castration-resistant PCa (CRPC) results in AR+PSA+, AR+PSA−, AR−PSA−, and AR−PSA+ subtypes of PCa cells that manifest differential sensitivities to therapeutics. We further demonstrate that castration leads to a great enrichment of PSA−/lo PCa cells in both xenograft tumors and CRPC samples and systemic androgen levels dynamically regulate the relative abundance of PSA+ versus PSA−/lo PCa cells that impacts the kinetics of tumor growth. We also present evidence that the PSA−/lo PCa cells possess distinct epigenetic profiles. As the PSA−/lo PCa cell population is heterogeneous, in the second part, we employ two PSA− (Du145 and PC3) and two PSA+ (LAPC9 and LAPC4) PCa models as well as patient tumor cells to further dissect the clonogenic and tumorigenic subsets. We report that different PCa models possess distinct tumorigenic subpopulations that both commonly and uniquely express important signaling pathways that could represent therapeutic targets. Our results have important implications in understanding PCa cell heterogeneity, response to clinical therapeutics, and cellular mechanisms underlying CRPC. PMID:26246472

Prostate stem cell antigen (PSCA) mRNA expression in peripheral blood in patients with benign prostatic hyperplasia and/or prostate cancer.

PubMed

Fawzy, Mohamed S; Mohamed, Randa H; Elfayoumi, Abdel-Rahman R

2015-03-01

The aim of this study was to determine whether detection of prostate stem cell antigen (PSCA) expression in BPH might be associated with the subsequent presence of Prostate cancer (PCa) and also to determine whether detection of PSCA expression has potential for prognosis in PCa. This study was comprised of 112 PCa patients, 111 BPH patients and 120 control subjects. We employed reverse-transcriptase polymerase chain reaction (RT-PCR) to detect PSCA mRNA-bearing cells in peripheral blood. PSCA mRNA was detected in the peripheral blood of 71.4% PCa patients and in 13.5% of patients with BPH by RT-PCR. PSCA was positive in 80% of high-grade diseases compared with 20% of low-grade diseases (P = 0.01). Whereas only 38.8% of prostate-confined diseases were PSCA positive, 61.2% of extraprostatic diseases were PSCA positive (P < 0.001). Patients with a lymphovascular invasion of tumor emboli tended to be PSCA positive (P = 0.02). BPH patients with RT-PCR PSCA positive were significantly more likely to develop prostate cancer (OR = 16, 95% CI = 8.1-31.6, P < 0.001). In conclusion, RT-PCR PSCA positivity is significantly associated with the Gleason score, LV tumor emboli and whether or not the tumor was organ confined. In this study, RT-PCR PSCA detection may be a promising tumor marker of diagnostic and metastasis detection for patients with prostate cancer. Also, it may be an important test for predicting BPH patients who are at high risk of subsequent cancer development.

Reducing Toxicity of Radiation Treatment of Advanced Prostate Cancer

DTIC Science & Technology

2015-10-01

steady state hematopoiesis with normalization of the frequency of hematopoietic stem and progenitor cells. Moreover, hematopoietic stem cells from RTA...ongoing. 7 KEY RESEARCH ACCOMPLISHMENTS: • Identified radiation protection of different organ systems (GI tract, skin and hematopoiesis ) by RTA

Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

DTIC Science & Technology

2015-12-01

enter replica- tive senescence or undergo mitotic arrest in the presence of broken chromosomes and shortened telomeres (25–27). However, cancer cells...Cell death during crisis is mediated by mitotic telomere deprotection. Nature, 522, 492–496. 27. Herbig,U., Jobling,W.A., Chen,B.P., Chen,D.J. and...Sedivy,J.M. (2004) Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a).Mol

The Effect of a Histone Deacetylase Inhibitor (AR-42) on Canine Prostate Cancer Growth and Metastasis.

PubMed

Elshafae, Said M; Kohart, Nicole A; Altstadt, Lucas A; Dirksen, Wessel P; Rosol, Thomas J

2017-05-01

Canine prostate cancer (PCa) is an excellent preclinical model for human PCa. AR-42 is a histone deacetylase inhibitor (HDACi) developed at The Ohio State University that inhibits the proliferation of several cancers, including multiple myeloma, lung, and hepatocellular cancer. In this study, we investigated whether AR-42 would prevent or decrease. The growth and metastasis of a canine PCa (Ace-1 cells) to bone in vitro and in vivo. Proliferation, cell viability, invasion, and metastasis of a canine prostate cancer cell line (Ace-1) were measured following treatment with AR-42. Expression of anoikis resistance, epithelial-to-mesenchymal transition (EMT), and stem cell-related markers were also evaluated. To assess the efficacy of AR-42 on prevention of PCa metastasis to bone, Ace-1 cells were injected in the left cardiac ventricle of nude mice, mice were treated with AR-42, and the incidence and growth of bone metastasis were measured. Bioluminescence was performed to monitor the bone metastases in nude mice. AR-42 inhibited the in vitro proliferation of Ace-1 cells in a time- and dose-dependent manner. The IC 50 concentration of AR-42 for Ace-1 cells was 0.42 μM after 24 hr of treatment. AR-42 induced apoptosis, decreased cell migration, and increased the stem cell properties of Ace-1 cells in vitro. AR-42 downregulated E-cadherin, N-cadherin, TWIST, MYOF, anoikis resistance, and osteomimicry genes, while it upregulated SNAIL, PTEN, FAK, and ZEB1 gene expression in Ace-1 cells. Importantly, AR-42 decreased the bioluminescence and incidence of bone metastasis in nude mice. In addition, AR-42 induced apoptosis and altered the tumor cell morphology to an irregular cell phenotype with condensed chromatin in the bone metastases. AR-42 decreased PCa growth and bone metastasis, induced apoptosis, and downregulated osteomimicry genes in PCa cells in the bone microenvironment. Prostate 77:776-793, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

An Embryonic Growth Pathway is Reactivated in Human Prostate Cancer

DTIC Science & Technology

2005-06-01

and 13 weeks in the prostatic urothelium and nascent prostatic buds. Staining was slightly diminished at 16.5, further diminished at 18 to 20 and...in the human fetal prostate is contemporaneous with the fetal testosterone surge and with ductal budding of the prostatic urothelium . SHH expression...expression in the human fetal the fetal mouse.8 There was intense staining of all layers of prostate. the prostatic urothelium at 11.5 weeks

Enhancing Therapeutic Cellular Prostate Cancer Vaccines

DTIC Science & Technology

2012-06-01

oxygen -mediated mobilization of mesenchymal stem cell and progenitors (MSCs)”, Division of Preventive, Occupational, And Aerospace Medicine...postdoctoral fellow Completed: Tittle: Hyperbaric oxygen as mobilizer of stem cells and progenitors in senescent mice (Stanimir Vuk-Pavlovic, P.I.). Co... stem and progenitor cells (HSPCs) and mesenchymal stromal cells (MSCs) from bone marrow into circulation of old mice were explored. Specific Aims:

Roles for the Stem Cell–Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis

PubMed Central

Kleeberger, Wolfram; Bova, G. Steven; Nielsen, Matthew E.; Herawi, Mehsati; Chuang, Ai-Ying; Epstein, Jonathan I.; Berman, David M.

2011-01-01

The intermediate filament protein Nestin identifies stem/progenitor cells in adult tissues, but the function of Nestin is poorly understood. We investigated Nestin expression and function in common lethal cancers. Nestin mRNA was detected in cell lines from small cell lung, and breast cancers, and particularly elevated in cell lines derived from prostate cancer metastases. Whereas the androgen-independent lines PC3, 22RV1, and DU145 all expressed Nestin transcripts under standard culture conditions, the androgen-dependent line LnCaP expressed Nestin only on androgen withdrawal. We confirmed associations of Nestin expression, androgen withdrawal, and metastatic potential by immunohistochemical analysis of samples from 254 prostate cancer patients. Cytoplasmic Nestin protein was readily identifiable in prostate cancer cells from 75% of patients with lethal androgen-independent disease, even in cancer sampled from the prostate itself. However, Nestin expression was undetectable in localized androgen-deprived tumors and in metastases without prior androgen deprivation. To address its function, we reduced Nestin levels with short hairpin RNAs, markedly inhibiting in vitro migration and invasion in prostate cancer cells but leaving cell growth intact. Nestin knockdown also diminished metastases 5-fold compared with controls despite uncompromised tumorigenicity at the site of inoculation. These results specify a function for Nestin in cell motility and identify a novel pathway for prostate cancer metastasis. Activity of this pathway may be selected by the extraprostatic environment or, as supported by our data, may originate within the prostate after androgen deprivation. Further dissection of this novel Nestin migration pathway may lead to strategies to prevent and neutralize metastatic spread. PMID:17909025

The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenes

DTIC Science & Technology

2014-10-01

McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. The Endogenous Cell-Fate Factor Dachshund Restrains Prostate Epithelial Cell Migration via...Loro E, Pestell RG. “Inhibition of Breast Tumor Stem Cells Expansion by the Endogenous Cell Fate Determination Factor Dachshund.” Chapter in Volume

Exosomes from bulk and stem cells from human prostate cancer have a differential microRNA content that contributes cooperatively over local and pre-metastatic niche.

PubMed

Sánchez, Catherine A; Andahur, Eliana I; Valenzuela, Rodrigo; Castellón, Enrique A; Fullá, Juan A; Ramos, Christian G; Triviño, Juan C

2016-01-26

The different prostate cancer (PCa) cell populations (bulk and cancer stem cells, CSCs) release exosomes that contain miRNAs that could modify the local or premetastatic niche. The analysis of the differential expression of miRNAs in exosomes allows evaluating the differential biological effect of both populations on the niche, and the identification of potential biomarkers and therapeutic targets. Five PCa primary cell cultures were established to originate bulk and CSCs cultures. From them, exosomes were purified by precipitation for miRNAs extraction to perform a comparative profile of miRNAs by next generation sequencing in an Illumina platform. 1839 miRNAs were identified in the exosomes. Of these 990 were known miRNAs, from which only 19 were significantly differentially expressed: 6 were overexpressed in CSCs and 13 in bulk cells exosomes. miR-100-5p and miR-21-5p were the most abundant miRNAs. Bioinformatics analysis indicated that differentially expressed miRNAs are highly related with PCa carcinogenesis, fibroblast proliferation, differentiation and migration, and angiogenesis. Besides, miRNAs from bulk cells affects osteoblast differentiation. Later, their effect was evaluated in normal prostate fibroblasts (WPMY-1) where transfection with miR-100-5p, miR-21-5p and miR-139-5p increased the expression of metalloproteinases (MMPs) -2, -9 and -13 and RANKL and fibroblast migration. The higher effect was achieved with miR21 transfection. As conclusion, miRNAs have a differential pattern between PCa bulk and CSCs exosomes that act collaboratively in PCa progression and metastasis. The most abundant miRNAs in PCa exosomes are interesting potential biomarkers and therapeutic targets.

Demonstration of intermediate cells during human prostate epithelial differentiation in situ and in vitro using triple-staining confocal scanning microscopy.

PubMed

van Leenders, G; Dijkman, H; Hulsbergen-van de Kaa, C; Ruiter, D; Schalken, J

2000-08-01

In human prostate epithelium, morphologically basal and luminal cells can be discriminated. The basal cell layer that putatively contains progenitor cells of the secretory epithelium is characterized by the expression of keratins (K) 5 and 14. Luminal cells represent the secretory compartment of the epithelium and express K8 and 18. We developed a technique for the simultaneous analysis of K5, 14, and 18 to identify intermediate cell stages in the prostate epithelium and to study the dynamic aspects of its differentiation in vitro. Nonmalignant prostate tissue and primary epithelial cultures were immunohistochemically characterized using triple staining with antibodies for K5, K14, and K18. Antibodies for K18 and K5 were conjugated directly with fluorochromes Alexa 488 and 546. K14 was visualized indirectly with streptavidin-Cy5. Keratin expression was analyzed by confocal scanning microscopy. The occurrence of exocrine and neuroendocrine differentiation in culture was determined via antibodies to prostate-specific antigen (PSA), chromogranin A, and serotonin. We found that basal cells expressed either K5(++)/14(++)/18+ or K5(++)/18+. The majority of luminal cells expressed K18(++), but colocalization of K5+/18(++) were recognized. Epithelial monolayer cultures predominantly revealed the basal cell phenotype K5(++)/14(++)/18+, whereas intermediate subpopulations expressing K5+/14+/18(++) and K5+/18(++) were also identified. On confluence, differentiation was induced as multicellular gland-like buds, and extensions became evident on top of the monolayer. These structures were composed of K18(++)- and K5+/18(+)-positive cell clusters surrounded by phenotypically basal cells. Few multicellular structures and cells in the monolayer showed exocrine differentiation (PSA+), but expression of chromogranin A and serotonin was absent. We conclude that simultaneous evaluation of keratin expression is useful for analyzing epithelial differentiation in the prostate. During this process, putative stem cells phenotypically resembling K5(++)/14(++)/18+ differentiate toward luminal cells (K18(++)) via intermediate cell stages, as identified by up-regulation of K18 and down-regulation of K5 and 14.

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2013-10-01

et al. Targeting cancer stem cells by inhibiting Wnt, Notch, and Hedgehog pathways. Nat Rev Clin Oncol 2011;8:97–106. 26] Guise T. Examining the...Nitrogen or fixed in formalin and paraffin-embedded to evaluate anatomy and glandular architecture. The remainder of the tissue was mechan- ically and

Resveratrol Improved the Progression of Chronic Prostatitis via the Downregulation of c-kit/SCF by Activating Sirt1.

PubMed

He, Yi; Zeng, Huizhi; Yu, Yang; Zhang, Jiashu; Zeng, Xiaona; Gong, Fengtao; Duan, Xingping; Liu, Qi; Yang, Bo

2017-07-19

The regulation mechanism of inflammation inducing prostate carcinogenesis remains largely unknown. Therefore, we investigated the role of the c-kit/SCF pathway, which has been associated with the control of prostate carcinogenesis, in chronic prostatitis (CP) rats and evaluated the anti-prostatitis effect of resveratrol. We performed hemolysin and eosin staining to evaluate the histopathological changes in prostates. Multiple approaches evaluated the expression levels of c-kit, stem cell factor (SCF), Sirt1, and carcinogenesis-associated proteins. The CP group exhibited severe diffuse chronic inflammation. Meanwhile, the prostate cells appeared atypia; the activity of c-kit/SCF was upregulated, and carcinogenesis-associated proteins are dysregulated significantly in CP rats. Resveratrol treatment significantly improved these factors by Sirt1 activation. In summary, CP could further cause prostate carcinogenesis, which may be associated with activated c-kit/SCF signaling. Resveratrol treatment could improve the progression of CP via the downregulation of c-kit/SCF by activating Sirt1.

Cancer Stem Cells: Cellular Plasticity, Niche, and its Clinical Relevance.

PubMed

Lee, Gina; Hall, Robert R; Ahmed, Atique U

2016-10-01

Cancer handles an estimated 7.6 million deaths worldwide per annum. A recent theory focuses on the role Cancer Stem Cells (CSCs) in driving tumorigenesis and disease progression. This theory hypothesizes that a population of the tumor cell with similar functional and phenotypic characteristics as normal tissue stem cells are responsible for formation and advancement of many human cancers. The CSCs subpopulation can differentiate into non-CSC tumor cells and promote phenotypic and functional heterogeneity within the tumor. The presence of CSCs has been reported in a number of human cancers including blood, breast, brain, colon, lung, pancreas prostate and liver. Although the origin of CSCs remains a mystery, recent reports suggest that the phenotypic characteristics of CSCs may be plastic and are influenced by the microenvironment specific for the individual tumor. Such factors unique to each tumor preserve the dynamic balance between CSCs to non-CSCs cell fate, as well as maintain the proper equilibrium. Alternating such equilibrium via dedifferentiation can result in aggressiveness, as CSCs are considered to be more resistant to the conventional cancer treatments of chemotherapy and radiation. Understanding how the tumoral microenvironment affects the plasticity driven CSC niche will be critical for developing a more effective treatment for cancer by eliminating its aggressive and recurring nature that now is believed to be perpetuated by CSCs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, K

Purpose: Most prostate cancers are slow-growing diseases but normally require much higher doses (80Gy) with conventional fractionation radiotherapy, comparing to other more aggressive cancers. This study is to disclose the radiobiological basis of this discrepancy by proposing the concept of prostate cancer stem cells (CSCs) and examining their specific irradiation responses. Methods: There are overwhelming evidences that CSC may keep their stemness, e.g. the competency of cell differentiation, in hypoxic microenvironments and hence become radiation resistive, though the probability is tiny for aggressiveness cancers. Tumor hypoxia used to be considered as an independent reason for poor treatment outcomes, and recentmore » evidences showed that even prostate cancers were also hypoxic though they are very slow-growing. In addition, to achieve comparable outcomes to other much more aggressive cancers, much higher doses (rather than lower doses) are always needed for prostate cancers, regardless of its non-aggressiveness. All these abnormal facts can only be possibly interpreted by the irradiation responses characteristics of prostate CSCs. Results: Both normal cancer cells (NCCs) and CSCs exiting in tumors, in which NCCs are mainly for symptoms whereas killing all CSCs achieves disease-free. Since prostate cancers are slow-growing, the hypoxia in prostate cancers cannot possibly from NCCs, thus it is caused by hypoxic CSCs. However, single hypoxic cell cannot be imaged due to limitation of imaging techniques, unless a large group of hypoxic cells exist together, thus most of CSCs in prostate cancers are virtually hypoxic, i.e. not in working mode because CSCs in proliferating mode have to be normoxic, and this explains why prostate cancers are unaggressive. Conclusion: The fractional dose in conventional radiotherapy (∼2Gy) could only kill NCCs and CSCs in proliferating modes, whereas most CSCs survived fractional treatments since they were hypoxic, thus to eliminate all CSCs and achieve disease-free, much more fractionations are needed.« less

A novel canine model for prostate cancer.

PubMed

Keller, Jill M; Schade, George R; Ives, Kimberly; Cheng, Xu; Rosol, Thomas J; Piert, Morand; Siddiqui, Javed; Roberts, William W; Keller, Evan T

2013-06-01

No existing animal model fully recapitulates all features of human prostate cancer. The dog is the only large mammal, besides humans, that commonly develops spontaneous prostate cancer. Canine prostate cancer features many similarities with its human counterpart. We sought to develop a canine model of prostate cancer that would more fully represent the features of human prostate cancer than existing models. The Ace-1 canine prostate cancer cell line was injected transabdominally under transrectal ultrasound (TRUS) guidance into the prostates of immunosuppressed, intact, adult male dogs. Tumor progression was monitored by TRUS imaging. Some dogs were subjected to positron emission tomography (PET) for tumor detection. Time of euthanasia was determined based on tumor size, impingement on urethra, and general well-being. Euthanasia was followed by necropsy and histopathology. Ace-1 tumor cells grew robustly in every dog injected. Tumors grew in subcapsular and parenchymal regions of the prostate. Tumor tissue could be identified using PET. Histological findings were similar to those observed in human prostate cancer. Metastases to lungs and lymph nodes were detected, predominantly in dogs with intraprostatic tumors. We have established a minimally invasive dog model of prostate cancer. This model may be valuable for studying prostate cancer progression and distant metastasis. Copyright © 2013 Wiley Periodicals, Inc.

Anatomy and Histology of the Human and Murine Prostate.

PubMed

Ittmann, Michael

2018-05-01

The human and murine prostate glands have similar functional roles in the generation of seminal fluid to assist in reproduction. There are significant differences in the anatomy and histology of murine and human prostate and knowledge of the normal anatomy and histology of the murine prostate is essential to interpreting changes in genetically engineered mouse models. In this review, the normal anatomy and histology of both human and mouse prostate will be described. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Steady advance of stem cell therapies: report from the 2011 World Stem Cell Summit, Pasadena, California, October 3-5.

PubMed

Swan, Melanie

2011-12-01

Stem cell research and related therapies (including regenerative medicine and cellular therapies) could have a significant near-term impact on worldwide public health and aging. One reason is the industry's strong linkage between policy, science, industry, and patient advocacy, as was clear in the attendance and programming at the 7(th) annual World Stem Cell Summit held in Pasadena, California, October 3-5, 2011. A special conference session sponsored by the SENS Foundation discussed how stem cell therapies are being used to extend healthy life span. Stem cells are useful not only in cell-replacement therapies, but also in disease modeling, drug discovery, and drug toxicity screening. Stem cell therapies are currently being applied to over 50 diseases, including heart, lung, neurodegenerative, and eye disease, cancer, and human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS). Dozens of companies are developing therapeutic solutions that are in different stages of clinical use and clinical trials. Some high-profile therapies include Dendreon's Provenge for prostate cancer, Geron's first-ever embryonic stem cell trials for spinal cord injury, Fibrocell's laViv cellular therapy for wrinkles, and well-established commercial skin substitutes (Organogenesis' Apligraf and Advanced BioHealing's Dermagraft). Stem cell policy issues under consideration include medical tourism, standards for large-scale stem cell manufacturing, and lingering ethical debates over the use of embryonic stem cells. Contemporary stem cell science advances include a focus on techniques for the direct reprogramming of cells from one lineage to another without returning to pluripotency as an intermediary step, improved means of generating and characterizing induced pluripotent cells, and progress in approaches to neurodegenerative disease.

Withanolides from the stems and leaves of Physalis pubescens and their cytotoxic activity.

PubMed

Xia, Guiyang; Li, Yang; Sun, Jiawen; Wang, Liqing; Tang, Xiaolong; Lin, Bin; Kang, Ning; Huang, Jian; Chen, Lixia; Qiu, Feng

2016-11-01

A phytochemical study of Physalis pubescens L. afforded twelve compounds, including six new withanolides (1, 4, and 6i-9), four new withanolide glucosides (2, 3, 5, and 6), and two known withanolides (10 and 11). Their structures were established via extensive spectroscopic analysis. The absolute configuration of 3 was assigned using X-ray crystallography, and the absolute configurations of the 1,2-diol moiety in 1 were determined using the in situ dimolybdenum electronic circular dichroism method. Compounds 7, 9, and 10 exhibited significant cytotoxicity against human prostate cancer cells (C4-2B and 22Rvl), human renal carcinoma cells (786-O, A-498, Caki-2, and ACHN), human melanoma cells (A375 and A375-S2), and human normal hepatic cell line (L02) with IC 50 values in the range of 0.17-5.30μM. Copyright © 2016 Elsevier Inc. All rights reserved.

Secreted factors from metastatic prostate cancer cells stimulate mesenchymal stem cell transition to a pro-tumourigenic 'activated' state that enhances prostate cancer cell migration.

PubMed

Ridge, Sarah M; Bhattacharyya, Dibyangana; Dervan, Eoin; Naicker, Serika D; Burke, Amy J; Murphy, J M; O'leary, Karen; Greene, John; Ryan, Aideen E; Sullivan, Francis J; Glynn, Sharon A

2018-05-15

Mesenchymal stem cells (MSCs) are a heterogeneous population of multipotent cells that are capable of differentiating into osteocytes, chondrocytes and adipocytes. Recently, MSCs have been found to home to the tumour site and engraft in the tumour stroma. However, it is not yet known whether they have a tumour promoting or suppressive function. We investigated the interaction between prostate cancer cell lines 22Rv1, DU145 and PC3, and bone marrow-derived MSCs. MSCs were 'educated' for extended periods in prostate cancer cell conditioned media and PC3-educated MSCs were found to be the most responsive with a secretory profile rich in pro-inflammatory cytokines. PC3-educated MSCs secreted increased osteopontin (OPN), interleukin-8 (IL-8) and fibroblast growth factor-2 (FGF-2) and decreased soluble fms-like tyrosine kinase-1 (sFlt-1) compared to untreated MSCs. PC3-educated MSCs showed a reduced migration and proliferation capacity that was dependent on exposure to PC3-conditioned medium. Vimentin and α-smooth muscle actin (αSMA) expression was decreased in PC3-educated MSCs compared to untreated MSCs. PC3 and DU145 education of healthy donor and prostate cancer patient-derived MSCs led to a reduced proportion of FAP+ αSMA+ cells contrary to characteristics commonly associated with cancer associated fibroblasts (CAFs). The migration of PC3 cells was increased toward both PC3-educated and DU145-educated MSCs compared to untreated MSCs, while DU145 migration was only enhanced toward patient-derived MSCs. In summary, MSCs developed an altered phenotype in response to prostate cancer conditioned medium which resulted in increased secretion of pro-inflammatory cytokines, modified functional activity and the chemoattraction of prostate cancer cells. © 2017 UICC.

Prostate Cancer Stem Cell-Targeted Efficacy of a New-Generation Taxoid, SBT-1214 and Novel Polyenolic Zinc-Binding Curcuminoid, CMC2.24

PubMed Central

Botchkina, Galina I.; Zuniga, Edison S.; Rowehl, Rebecca H.; Park, Rosa; Bhalla, Rahuldev; Bialkowska, Agnieszka B.; Johnson, Francis; Golub, Lorne M.; Zhang, Yu; Ojima, Iwao; Shroyer, Kenneth R.

2013-01-01

Background Prostate cancer is the second leading cause of cancer death among men. Multiple evidence suggests that a population of tumor-initiating, or cancer stem cells (CSCs) is responsible for cancer development and exceptional drug resistance, representing a highly important therapeutic target. The present study evaluated CSC-specific alterations induced by new-generation taxoid SBT-1214 and a novel polyenolic zinc-binding curcuminoid, CMC2.24, in prostate CSCs. Principal Findings The CD133high/CD44high phenotype was isolated from spontaneously immortalized patient-derived PPT2 cells and highly metastatic PC3MM2 cells. Weekly treatment of the NOD/SCID mice bearing PPT2- and PC3MM3-induced tumors with the SBT-1214 led to dramatic suppression of tumor growth. Four of six PPT2 and 3 of 6 PC3MM2 tumors have shown the absence of viable cells in residual tumors. In vitro, SBT-1214 (100nM-1µM; for 72 hr) induced about 60% cell death in CD133high/CD44+/high cells cultured on collagen I in stem cell medium (in contrast, the same doses of paclitaxel increased proliferation of these cells). The cytotoxic effects were increased when SBT-1214 was combined with the CMC2.24. A stem cell-specific PCR array assay revealed that this drug combination mediated massive inhibition of multiple constitutively up-regulated stem cell-related genes, including key pluripotency transcription factors. Importantly, this drug combination induced expression of p21 and p53, which were absent in CD133high/CD44high cells. Viable cells that survived this treatment regimen were no longer able to induce secondary spheroids, exhibited significant morphological abnormalities and died in 2-5 days. Conclusions We report here that the SBT-1214 alone, or in combination with CMC2.24, possesses significant activity against prostate CD133high/CD44+/high tumor-initiating cells. This drug combination efficiently inhibits expression of the majority of stem cell-related genes and pluripotency transcription factors. In addition, it induces a previously absent expression of p21 and p53 (“gene wake-up”), which can potentially reverse drug resistance by increasing sensitivity to anti-cancer drugs. PMID:24086245

B lymphoma Moloney murine leukemia virus insertion region 1: An oncogenic mediator in prostate cancer.

PubMed

Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi

2018-06-01

B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.

Targeting the Adipocyte-Tumor Cell Interaction in Prostate Cancer Treatment

DTIC Science & Technology

2014-10-01

cell of origin 5, it would be of great interest to further investigate whether p62 regulates mesenchymal stem cells in PCa. To start addressing this...Signaling Promotes Inflammation and Tumorigenesis. Cancer Cell 26, 121-135 (2014). 5. Uccelli, A., Moretta, L. & Pistoia, V. Mesenchymal stem cells ...chemotherapeutic approaches. Tasks 6.7. (Aim 2.3) Determine the role of adipose- stem cells (ASC). Since fibroblasts and adipocytes have the same

Microenvironment-Programmed Metastatic Prostate Cancer Stem Cells (mPCSCs)

DTIC Science & Technology

2015-10-01

osteoblastic differentiation during aging . Rejuvenation Res 2006;9:10–9. 25] Gao FB, Raff M. Cell size control and a cell-intrinsic maturation program in...self- renewing long-term tumor-propagating cells that resist castration. Cell Stem Cell 10, 556-569 (2012). 8. Rybak, A.P., Bristow, R.G., & Kapoor, A...established clinical tumor is sustained by subpopulations of self- renewing cancer cells operationally called cancer stem cells (CSC) that can generate

Non-coding RNAs in Prostate Cancer: From Discovery to Clinical Applications.

PubMed

Ceder, Yvonne

2016-01-01

Prostate cancer is a heterogeneous disease for which the molecular mechanisms are still not fully elucidated. Prostate cancer research has traditionally focused on genomic and epigenetic alterations affecting the proteome, but over the last decade non-coding RNAs, especially microRNAs, have been recognized to play a key role in prostate cancer progression. A considerable number of individual microRNAs have been found to be deregulated in prostate cancer and their biological significance elucidated in functional studies. This review will delineate the current advances regarding the involvement of microRNAs and their targets in prostate cancer biology as well as their potential usage in the clinical management of the disease. The main focus will be on microRNAs contributing to initiation and progression of prostate cancer, including androgen signalling, cellular plasticity, stem cells biology and metastatic processes. To conclude, implications on potential future microRNA-based therapeutics based on the recent advances regarding the interplay between microRNAs and their targets are discussed.

Rapid Selection of Mesenchymal Stem and Progenitor Cells in Primary Prostate Stromal Cultures

PubMed Central

Brennen, W. Nathaniel; Kisteman, L. Nelleke; Isaacs, John T.

2016-01-01

BACKGROUND Carcinoma-associated fibroblasts (CAFs) are a dominant component of the tumor microenvironment with pro-tumorigenic properties. Despite this knowledge, their physiologic origins remain poorly understood. Mesenchymal stem cells (MSCs) can be recruited from the bone marrow to areas of tissue damage and inflammation, including prostate cancer. MSCs can generate and have many overlapping properties with CAFs in preclinical models. METHODS Multiparameter flow cytometry and multipotent differentiation assays used to define MSCs in primary prostate stromal cultures derived from young (>25 yrs) organ donors and prostate cancer patients compared with bone marrow-derived stromal cultures. Population doubling times, population doublings, cell size, and differentiation potential determined under multiple culture conditions, including normoxia, hypoxia, and a variety of media. TGF-β measured by ELISA. RESULTS MSCs and stromal progenitors are not only present in normal and malignant prostate tissue, but are quickly selected for in primary stromal cultures derived from these tissues; becoming the dominant population within just a few passages. Growth potential inversely associated with TGF-β concentrations. All conditions generated populations with an average cell diameter >15 μm. All cultures tested had the ability to undergo osteogenic and chondrogenic differentiation, but unlike bone marrow-derived MSCs, primary stromal cultures derived from normal prostate tissue lack adipogenic differentiation potential. In contrast, a subset of stromal cultures derived from prostate cancer patients retain the ability to differentiate into adipocytes; a property that is significantly suppressed under hypoxic conditions in both bone marrow- and prostate-derived MSCs. CONCLUSIONS Primary prostate stromal cultures are highly enriched in cells with an MSC or stromal progenitor phenotype. The use of primary cultures such as these to study CAFs raises interesting implications when considering their overlapping properties. The lack of adipogenesis in stromal cultures derived from normal prostates suggests they have a lineage-restricted progenitor phenotype. The retention of adipogenic differentiation in cultures from a subset of prostate cancer patients suggests the active recruitment of less committed progenitors or MSCs from the bone marrow as a function of disease progression. This recruitment can potentially be exploited for prognostic purposes or a cell-based platform for the systemic delivery of cytotoxic agents to sites of prostate cancer. PMID:26732992

Rapid selection of mesenchymal stem and progenitor cells in primary prostate stromal cultures.

PubMed

Brennen, W Nathaniel; Kisteman, L Nelleke; Isaacs, John T

2016-05-01

Carcinoma-associated fibroblasts (CAFs) are a dominant component of the tumor microenvironment with pro-tumorigenic properties. Despite this knowledge, their physiologic origins remain poorly understood. Mesenchymal stem cells (MSCs) can be recruited from the bone marrow to areas of tissue damage and inflammation, including prostate cancer. MSCs can generate and have many overlapping properties with CAFs in preclinical models. Multiparameter flow cytometry and multipotent differentiation assays used to define MSCs in primary prostate stromal cultures derived from young (<25 yrs) organ donors and prostate cancer patients compared with bone marrow-derived stromal cultures. Population doubling times, population doublings, cell size, and differentiation potential determined under multiple culture conditions, including normoxia, hypoxia, and a variety of media. TGF-β measured by ELISA. MSCs and stromal progenitors are not only present in normal and malignant prostate tissue, but are quickly selected for in primary stromal cultures derived from these tissues; becoming the dominant population within just a few passages. Growth potential inversely associated with TGF-β concentrations. All conditions generated populations with an average cell diameter >15 µm. All cultures tested had the ability to undergo osteogenic and chondrogenic differentiation, but unlike bone marrow-derived MSCs, primary stromal cultures derived from normal prostate tissue lack adipogenic differentiation potential. In contrast, a subset of stromal cultures derived from prostate cancer patients retain the ability to differentiate into adipocytes; a property that is significantly suppressed under hypoxic conditions in both bone marrow- and prostate-derived MSCs. Primary prostate stromal cultures are highly enriched in cells with an MSC or stromal progenitor phenotype. The use of primary cultures such as these to study CAFs raises interesting implications when considering their overlapping properties. The lack of adipogenesis in stromal cultures derived from normal prostates suggests they have a lineage-restricted progenitor phenotype. The retention of adipogenic differentiation in cultures from a subset of prostate cancer patients suggests the active recruitment of less committed progenitors or MSCs from the bone marrow as a function of disease progression. This recruitment can potentially be exploited for prognostic purposes or a cell-based platform for the systemic delivery of cytotoxic agents to sites of prostate cancer. © 2016 Wiley Periodicals, Inc.

ZEB1-mediated vasculogenic mimicry formation associates with epithelial-mesenchymal transition and cancer stem cell phenotypes in prostate cancer.

PubMed

Wang, Hua; Huang, Bin; Li, Bai Mou; Cao, Kai Yuan; Mo, Chen Qiang; Jiang, Shuang Jian; Pan, Jin Cheng; Wang, Zong Ren; Lin, Huan Yi; Wang, Dao Hu; Qiu, Shao Peng

2018-05-12

The zinc finger E-box-binding homeobox 1 (ZEB1) induced the epithelial-mesenchymal transition (EMT) and altered ZEB1 expression could lead to aggressive and cancer stem cell (CSC) phenotypes in various cancers. Tissue specimens from 96 prostate cancer patients were collected for immunohistochemistry and CD34/periodic acid-Schiff double staining. Prostate cancer cells were subjected to ZEB1 knockdown or overexpression and assessment of the effects on vasculogenic mimicry formation in vitro and in vivo. The underlying molecular events of ZEB1-induced vasculogenic mimicry formation in prostate cancer were then explored. The data showed that the presence of VM and high ZEB1 expression was associated with higher Gleason score, TNM stage, and lymph node and distant metastases as well as with the expression of vimentin and CD133 in prostate cancer tissues. Furthermore, ZEB1 was required for VM formation and altered expression of EMT-related and CSC-associated proteins in prostate cancer cells in vitro and in vivo. ZEB1 also facilitated tumour cell migration, invasion and clonogenicity. In addition, the effects of ZEB1 in prostate cancer cells were mediated by Src signalling; that is PP2, a specific inhibitor of the Src signalling, dose dependently reduced the p-Src 527 level but not p-Src 416 level, while ZEB1 knockdown also down-regulated the level of p-Src 527 in PC3 and DU-145 cells. PP2 treatment also significantly reduced the expression of VE-cadherin, vimentin and CD133 in these prostate cancer cells. Src signalling mediated the effects of ZEB1 on VM formation and gene expression. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Dietary tomato and lycopene impact androgen signaling- and carcinogenesis-related gene expression during early TRAMP prostate carcinogenesis

PubMed Central

Wan, Lei; Tan, Hsueh-Li; Thomas-Ahner, Jennifer M.; Pearl, Dennis K.; Erdman, John W.; Moran, Nancy E.; Clinton, Steven K.

2014-01-01

Consumption of tomato products containing the carotenoid lycopene is associated with a reduced risk of prostate cancer. To identify gene expression patterns associated with early testosterone-driven prostate carcinogenesis, which are impacted by dietary tomato and lycopene, wild type (WT) and transgenic adenocarcinoma of the mouse prostate (TRAMP) mice were fed control or tomato- or lycopene-containing diets from 4-10 wk-of-age. Eight-week-old mice underwent sham surgery, castration, or castration followed by testosterone-repletion (2.5 mg/kg/d initiated 1 wk after castration). Ten-wk-old intact TRAMP mice exhibit early multifocal prostatic intraepithelial neoplasia (PIN). Of the 200 prostate cancer-related genes measured by quantitative NanoString®, 189 are detectable, 164 significantly differ by genotype, 179 by testosterone status, and 30 by diet type (P<0.05). In TRAMP, expression of Birc5, Mki67, Aurkb, Ccnb2, Foxm1, and Ccne2 is greater compared to WT and is decreased by castration. In parallel, castration reduces Ki67-positive staining (P<0.0001) compared to intact and testosterone-repleted TRAMP mice. Expression of genes involved in androgen metabolism/signaling pathways are reduced by lycopene feeding (Srd5a1) and by tomato-feeding (Srd5a2, Pxn, and Srebf1). Additionally, tomato-feeding significantly reduced expression of genes associated with stem cell features, Aldh1a and Ly6a, while lycopene-feeding significantly reduced expression of neuroendocrine differentiation-related genes, Ngfr and Syp. Collectively, these studies demonstrate a profile of testosterone-regulated genes associated with early stages of prostate carcinogenesis that are potential mechanistic targets of dietary tomato components. Future studies on androgen signaling/metabolism, stem cell features, and neuroendocrine differentiation pathways may elucidate the mechanisms by which dietary tomato and lycopene impact prostate cancer risk. PMID:25315431

Targeting MEK5 Enhances Radiosensitivity of Human Prostate Cancer and Impairs Tumor-Associated Angiogenesis

DTIC Science & Technology

2016-09-01

AWARD NUMBER: W81XWH-15-1-0296 TITLE: Targeting MEK5 Enhances Radiosensitivity of Human Prostate Cancer and Impairs Tumor- Associated...3. DATES COVERED 31 Aug 2015 - 30 Aug 2016 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Targeting MEK5 Enhances Radiosensitivity of Human Prostate...therapeutic modality for the treatment of human prostate cancer. However, tumors often demonstrate resistance to ionizing radiation and continue to

Cancer telomeres and white crows.

PubMed

Meeker, Alan K

2018-01-01

This mini-review article discusses past and present prostate-focused research on telomere and telomerase biology conducted at Johns Hopkins, through the eyes of a Donald S Coffey trainee. Included are past discoveries of abnormalities in telomere biology in the context of prostate cancer and its pre-malignant precursor prostatic intraepithelial neoplasia (PIN); the finding that telomerase activity is androgen-regulated in the prostate, and the potential role of telomerase in prostate epithelial stem cells. Also reviewed are more recent results showing that in situ telomere length measurements in patient tissue specimens may have utility in risk assessment and as a prognostic biomarker. Highlighted throughout the article are some of the training and mentorship approaches employed by the late Dr. Coffey, former Director of Urologic Research at the Brady Urological Research Institute, which inspired new research ideas, team science, and discovery.

Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

PubMed

Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

2016-01-01

Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.

Increased expression of VEGF121/VEGF165-189 ratio results in a significant enhancement of human prostate tumor angiogenesis.

PubMed

Catena, Raul; Muniz-Medina, Vanessa; Moralejo, Beatriz; Javierre, Biola; Best, Carolyn J M; Emmert-Buck, Michael R; Green, Jeffrey E; Baker, Carl C; Calvo, Alfonso

2007-05-15

Vascular endothelial growth factor (VEGF) is a proangiogenic factor upregulated in many tumors. The alternative splicing of VEGF mRNA renders 3 major isoforms of 121, 165 and 189 amino-acids in humans (1 less amino-acid for each mouse VEGF isoform). We have designed isoform specific real time QRT-PCR assays to quantitate VEGF transcripts in mouse and human normal and malignant prostates. In the human normal prostate, VEGF(165) was the predominant isoform (62.8% +/- 5.2%), followed by VEGF(121) (22.5% +/- 6.3%) and VEGF(189) (p < 0.001) (14.6% +/- 2.1%). Prostate tumors showed a significant increase in the percentage of VEGF(121) and decreases in VEGF(165) (p < 0.01) and VEGF(189) (p < 0.05). However, the amount of total VEGF mRNA was similar between normal and malignant prostates. VEGF(164) was the transcript with the highest expression in the mouse normal prostate. Unlike human prostate cancer, tumors from TRAMP mice demonstrated a significant increase in total VEGF mRNA levels and in each of the VEGF isoforms, without changes in the relative isoform ratios. Morpholino phosphorodiamide antisense oligonucleotide technology was used to increase the relative amount of VEGF(121) while proportionally decreasing VEGF(165) and VEGF(189) levels in human prostate cell lines, through the modification of alternative splicing, without changing transcription levels and total amount of VEGF. The increase in the VEGF(121)/VEGF(165-189) ratio in PC3 cells resulted in a dramatic increase in prostate tumor angiogenesis in vivo. Our results underscore the importance of VEGF(121) in human prostate carcinoma and demonstrate that the relative expression of the different VEGF isoforms has an impact on prostate carcinogenesis. (c) 2007 Wiley-Liss, Inc.

A prodrug-doped cellular Trojan Horse for the potential treatment of prostate cancer.

PubMed

Levy, Oren; Brennen, W Nathaniel; Han, Edward; Rosen, David Marc; Musabeyezu, Juliet; Safaee, Helia; Ranganath, Sudhir; Ngai, Jessica; Heinelt, Martina; Milton, Yuka; Wang, Hao; Bhagchandani, Sachin H; Joshi, Nitin; Bhowmick, Neil; Denmeade, Samuel R; Isaacs, John T; Karp, Jeffrey M

2016-06-01

Despite considerable advances in prostate cancer research, there is a major need for a systemic delivery platform that efficiently targets anti-cancer drugs to sites of disseminated prostate cancer while minimizing host toxicity. In this proof-of-principle study, human mesenchymal stem cells (MSCs) were loaded with poly(lactic-co-glycolic acid) (PLGA) microparticles (MPs) that encapsulate the macromolecule G114, a thapsigargin-based prostate specific antigen (PSA)-activated prodrug. G114-particles (∼950 nm in size) were internalized by MSCs, followed by the release of G114 as an intact prodrug from loaded cells. Moreover, G114 released from G114 MP-loaded MSCs selectively induced death of the PSA-secreting PCa cell line, LNCaP. Finally, G114 MP-loaded MSCs inhibited tumor growth when used in proof-of-concept co-inoculation studies with CWR22 PCa xenografts, suggesting that cell-based delivery of G114 did not compromise the potency of this pro-drug in-vitro or in-vivo. This study demonstrates a potentially promising approach to assemble a cell-based drug delivery platform, which inhibits cancer growth in-vivo without the need of genetic engineering. We envision that upon achieving efficient homing of systemically infused MSCs to cancer sites, this MSC-based platform may be developed into an effective, systemic 'Trojan Horse' therapy for targeted delivery of therapeutic agents to sites of metastatic PCa. Copyright © 2016 Elsevier Ltd. All rights reserved.

N-Cadherin in Prostate Cancer: Downstream Pathways and Their Translational Application for Castrate-Resistant Prostate Cancer

DTIC Science & Technology

2012-09-01

with properties of stem cells. Cell 133, 704–715 (2008). 22. Mason , M.J., Fan, G ., Plath, K., Zhou, Q. & Horvath , S. Signed weighted gene co...An J, Horvath S, Gleave M, Rettig MB, Wainberg ZA, Reiter RE. Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis...N at u re A m er ic a, In c. A ll ri g h ts r es er ve d . A r t i c l e s nAture medicine VOLUME 16 | NUMBER 12 | DECEMBER 2010 1415 of in

Smooth muscle cell-specific knockout of androgen receptor: a new model for prostatic disease.

PubMed

Welsh, Michelle; Moffat, Lindsey; McNeilly, Alan; Brownstein, David; Saunders, Philippa T K; Sharpe, Richard M; Smith, Lee B

2011-09-01

Androgen-driven stromal-epithelial interactions play a key role in normal prostate development and function as well as in the progression of common prostatic diseases such as benign prostatic hyperplasia and prostate cancer. However, exactly how, and via which cell type, androgens mediate their effects in the adult prostate remains unclear. This study investigated the role for smooth muscle (SM) androgen signaling in normal adult prostate homeostasis and function using mice in which androgen receptor was selectively ablated from prostatic SM cells. In adulthood the knockout (KO) mice displayed a 44% reduction in prostate weight and exhibited histological abnormalities such as hyperplasia, inflammation, fibrosis, and reduced expression of epithelial, SM, and stem cell identify markers (e.g. p63 reduced by 27% and Pten by 31%). These changes emerged beyond puberty and were not explained by changes in serum hormones. Furthermore, in response to exogenous estradiol, adult KO mice displayed an 8.5-fold greater increase in prostate weight than controls and developed urinary retention. KO mice also demonstrated a reduced response to castration compared with controls. Together these results demonstrate that prostate SM cells are vital in mediating androgen-driven stromal-epithelial interactions in adult mouse prostates, determining cell identity and function and limiting hormone-dependent epithelial cell proliferation. This novel mouse model provides new insight into the possible role for SM androgen action in prostate disease.

A human prostatic bacterial isolate alters the prostatic microenvironment and accelerates prostate cancer progression.

PubMed

Simons, Brian W; Durham, Nicholas M; Bruno, Tullia C; Grosso, Joseph F; Schaeffer, Anthony J; Ross, Ashley E; Hurley, Paula J; Berman, David M; Drake, Charles G; Thumbikat, Praveen; Schaeffer, Edward M

2015-02-01

Inflammation is associated with several diseases of the prostate including benign enlargement and cancer, but a causal relationship has not been established. Our objective was to characterize the prostate inflammatory microenvironment after infection with a human prostate-derived bacterial strain and to determine the effect of inflammation on prostate cancer progression. To this end, we mimicked typical human prostate infection with retrograde urethral instillation of CP1, a human prostatic isolate of Escherichia coli. CP1 bacteria were tropic for the accessory sex glands and induced acute inflammation in the prostate and seminal vesicles, with chronic inflammation lasting at least 1 year. Compared to controls, infection induced both acute and chronic inflammation with epithelial hyperplasia, stromal hyperplasia, and inflammatory cell infiltrates. In areas of inflammation, epithelial proliferation and hyperplasia often persist, despite decreased expression of androgen receptor (AR). Inflammatory cells in the prostates of CP1-infected mice were characterized at 8 weeks post-infection by flow cytometry, which showed an increase in macrophages and lymphocytes, particularly Th17 cells. Inflammation was additionally assessed in the context of carcinogenesis. Multiplex cytokine profiles of inflamed prostates showed that distinct inflammatory cytokines were expressed during prostate inflammation and cancer, with a subset of cytokines synergistically increased during concurrent inflammation and cancer. Furthermore, CP1 infection in the Hi-Myc mouse model of prostate cancer accelerated the development of invasive prostate adenocarcinoma, with 70% more mice developing cancer by 4.5 months of age. This study provides direct evidence that prostate inflammation accelerates prostate cancer progression and gives insight into the microenvironment changes induced by inflammation that may accelerate tumour initiation or progression. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

STEAP: A prostate-specific cell-surface antigen highly expressed in human prostate tumors

PubMed Central

Hubert, Rene S.; Vivanco, Igor; Chen, Emily; Rastegar, Shiva; Leong, Kahan; Mitchell, Steve C.; Madraswala, Rashida; Zhou, Yanhong; Kuo, James; Raitano, Arthur B.; Jakobovits, Aya; Saffran, Douglas C.; Afar, Daniel E. H.

1999-01-01

In search of novel genes expressed in metastatic prostate cancer, we subtracted cDNA isolated from benign prostatic hypertrophic tissue from cDNA isolated from a prostate cancer xenograft model that mimics advanced disease. One novel gene that is highly expressed in advanced prostate cancer encodes a 339-amino acid protein with six potential membrane-spanning regions flanked by hydrophilic amino- and carboxyl-terminal domains. This structure suggests a potential function as a channel or transporter protein. This gene, named STEAP for six-transmembrane epithelial antigen of the prostate, is expressed predominantly in human prostate tissue and is up-regulated in multiple cancer cell lines, including prostate, bladder, colon, ovarian, and Ewing sarcoma. Immunohistochemical analysis of clinical specimens demonstrates significant STEAP expression at the cell–cell junctions of the secretory epithelium of prostate and prostate cancer cells. Little to no staining was detected at the plasma membranes of normal, nonprostate human tissues, except for bladder tissue, which expressed low levels of STEAP at the cell membrane. Protein analysis located STEAP at the cell surface of prostate-cancer cell lines. Our results support STEAP as a cell-surface tumor-antigen target for prostate cancer therapy and diagnostic imaging. PMID:10588738

Sensitization of Radioresistant Prostate Cancer Cells by Resveratrol Isolated from Arachis hypogaea Stems.

PubMed

Chen, Yu-An; Lien, Hsiu-Man; Kao, Min-Chuan; Lo, U-Ging; Lin, Li-Chiung; Lin, Chun-Jung; Chang, Sheau-Jiun; Chen, Chia-Chang; Hsieh, Jer-Tsong; Lin, Ho; Tang, Chih-Hsin; Lai, Chih-Ho

2017-01-01

Resveratrol (RV, 3,4',5-trihydroxystilbene) is naturally produced by a wide variety of plants including grapes and peanuts (Arachis hypogaea). However, the yield of RV from peanut stem and its potential radiosensitizing effects in prostate cancer (PCa) have not been well investigated. In this study, we characterized RV in peanut stem extract (PSE) for the first time and showed that both RV and PSE dose-dependently induced cell death in DOC-2/DAB2 interactive protein (DAB2IP)-deficient PCa cells with the radioresistant phenotype. Furthermore, the combination of radiation with either RV or PSE induced the death of radioresistant PCa cells through delayed repair of radiation-induced DNA double-strand break (DSB) and prolonged G2/M arrest, which induced apoptosis. The administration of RV and PSE effectively enhanced radiation therapy in the shDAB2IP PCa xenograft mouse model. These results demonstrate the promising synergistic effect of RV and PSE combined with radiation in the treatment of radioresistant PCa.

Deregulation of E-cadherin, β-catenin, APC and Caveolin-1 expression occurs in canine prostate cancer and metastatic processes.

PubMed

Kobayashi, Priscila E; Fonseca-Alves, Carlos E; Rivera-Calderón, Luis G; Carvalho, Márcio; Kuasne, Hellen; Rogatto, Silvia R; Laufer-Amorim, Renée

2018-06-01

Prostate cancer is a heterogeneous disease with high levels of clinical and gene heterogeneity, consequently offering several targets for therapy. Dogs with naturally occurring prostate cancer are useful models for molecular investigations and studying new treatment efficacy. Three genes and proteins associated with the WNT pathway (β-catenin, APC and E-cadherin) and Caveolin-1 (CAV-1) were evaluated in canine pre-neoplastic proliferative inflammatory atrophy (PIA), prostate cancer and metastatic disease. The APC gene methylation status was also investigated. As in human prostate cancer, cytoplasmic and nuclear β-catenin, which are fundamental for activating the canonical WNT pathway, were found in canine prostate cancer and metastasis. Membranous E-cadherin was also lost in these lesions, allowing cellular migration to the stroma and nuclear localization of β-catenin. In contrast to human prostate tumours, no APC downregulation or hypermethylation was found in canine prostate cancer. The CAV-1 gene and protein overexpression were found in canine prostate cancer, and as in humans, the highest levels were found in Gleason scores ≥8. In conclusion, as with human prostate cancer, β-catenin and E-cadherin in the WNT pathway, as well as Caveolin-1, are molecular drivers in canine prostate cancer. These findings provide additional evidence that dogs are useful models for studying new therapeutic targets in prostate cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.

The pluripotency factor Nanog is directly upregulated by the androgen receptor in prostate cancer cells.

PubMed

Kregel, Steven; Szmulewitz, Russell Z; Vander Griend, Donald J

2014-11-01

The Androgen Receptor (AR) is a nuclear hormone receptor that functions as a critical oncogene in all stages of prostate cancer progression, including progression to castration-resistance following androgen-deprivation therapy. Thus, identifying and targeting critical AR-regulated genes is one potential method to block castration-resistant cancer proliferation. Of particular importance are transcription factors that regulate stem cell pluripotency; many of these genes are emerging as critical oncogenes in numerous tumor cell types. Of these, Nanog has been previously shown to increase the self-renewal and stem-like properties of prostate cancer cells. Thus, we hypothesized that Nanog is a candidate AR target gene that may impart castration-resistance. We modulated AR signaling in LNCaP prostate cancer cells and assayed for Nanog expression. Direct AR binding to the NANOG promoter was tested using AR Chromatin Immunoprecipation (ChIP) and analyses of publically available AR ChIP-sequencing data-sets. Nanog over-expressing cells were analyzed for cell growth and cytotoxicity in response to the AR antagonist enzalutamide and the microtubule stabilizing agent docetaxel. AR signaling upregulates Nanog mRNA and protein. AR binds directly to the NANOG promoter, and was not identified within 75 kb of the NANOGP8 pseudogene, suggesting the NANOG gene locus was preferentially activated. Nanog overexpression in LNCaP cells increases overall growth, but does not increase resistance to enzalutamide or docetaxel. Nanog is a novel oncogenic AR target gene in prostate cancer cells, and stable expression of Nanog increases proliferation and growth of prostate cancer cells, but not resistance to enzalutamide or docetaxel. © 2014 Wiley Periodicals, Inc.

Simultaneous targeting of prostate stem cell antigen and prostate-specific membrane antigen improves the killing of prostate cancer cells using a novel modular T cell-retargeting system.

PubMed

Arndt, Claudia; Feldmann, Anja; Koristka, Stefanie; Cartellieri, Marc; Dimmel, Maria; Ehninger, Armin; Ehninger, Gerhard; Bachmann, Michael

2014-09-01

Recently, we described a novel modular platform technology in which T cell-recruitment and tumor-targeting domains of conventional bispecific antibodies are split to independent components, a universal effector module (EM) and replaceable monospecific/monovalent target modules (TMs) that form highly efficient T cell-retargeting complexes. Theoretically, our unique strategy should allow us to simultaneously retarget T cells to different tumor antigens by combining the EM with two or more different monovalent/monospecific TMs or even with bivalent/bispecific TMs, thereby overcoming limitations of a monospecific treatment such as the selection of target-negative tumor escape variants. In order to advance our recently introduced prostate stem cell antigen (PSCA)-specific modular system for a dual-targeting of prostate cancer cells, two additional TMs were constructed: a monovalent/monospecific TM directed against the prostate-specific membrane antigen (PSMA) and a bivalent/bispecific TM (bsTM) with specificity for PSMA and PSCA. The functionality of the novel dual-targeting strategies was analyzed by performing T cell activation and chromium release assays. Similar to the PSCA-specific modular system, the novel PSMA-specific modular system mediates an efficient target-dependent and -specific tumor cell lysis at low E:T ratios and picomolar Ab concentrations. Moreover, by combination of the EM with either the bispecific TM directed to PSMA and PSCA or both monospecifc TMs directed to either PSCA or PSMA, dual-specific targeting complexes were formed which allowed us to kill potential escape variants expressing only one or the other target antigen. Overall, the novel modular system represents a promising tool for multiple tumor targeting. © 2014 Wiley Periodicals, Inc.

Engineered T cells for pancreatic cancer treatment

PubMed Central

Katari, Usha L; Keirnan, Jacqueline M; Worth, Anna C; Hodges, Sally E; Leen, Ann M; Fisher, William E; Vera, Juan F

2011-01-01

Objective Conventional chemotherapy and radiotherapy produce marginal survival benefits in pancreatic cancer, underscoring the need for novel therapies. The aim of this study is to develop an adoptive T cell transfer approach to target tumours expressing prostate stem cell antigen (PSCA), a tumour-associated antigen that is frequently expressed by pancreatic cancer cells. Methods Expression of PSCA on cell lines and primary tumour samples was confirmed by immunohistochemistry. Healthy donor- and patient-derived T cells were isolated, activated in vitro using CD3/CD28, and transduced with a retroviral vector encoding a chimeric antigen receptor (CAR) targeting PSCA. The ability of these cells to kill tumour cells was analysed by chromium-51 (Cr51) release. Results Prostate stem cell antigen was expressed on >70% of the primary tumour samples screened. Activated, CAR-modified T cells could be readily generated in clinically relevant numbers and were specifically able to kill PSCA-expressing pancreatic cancer cell lines with no non-specific killing of PSCA-negative target cells, thus indicating the potential efficacy and safety of this approach. Conclusions Prostate stem cell antigen is frequently expressed on pancreatic cancer cells and can be targeted for immune-mediated destruction using CAR-modified, adoptively transferred T cells. The safety and efficacy of this approach indicate that it deserves further study and may represent a promising novel treatment for patients with pancreatic cancer. PMID:21843265

Genetically engineered oncolytic Newcastle disease virus mediates cytolysis of prostate cancer stem like cells.

PubMed

Raghunath, Shobana; Pudupakam, Raghavendra Sumanth; Allen, Adria; Biswas, Moanaro; Sriranganathan, Nammalwar

2017-10-20

Oncolytic virotherapy is a promising novel approach that overcomes the limitations posed by radiation and chemotherapy. In this study, the oncolytic efficacy of a recombinant Newcastle disease virus (rNDV) BC-KLQL-GFP, against prostate cancer stem-like/tumor initiating cells was evaluated. Xenograft derived prostaspheres (XPS) induced tumor more efficiently than monolayer cell derived prostaspheres (MCPS) in nude mice. Primary and secondary XPS show enhanced self-renewal and clonogenic potential compared to MCPS. XPS also expressed embryonic stem cell markers, such as Nanog, CD44 and Nestin. Further, prostate specific antigen (PSA) activated recombinant Newcastle Disease Virus (rNDV) was selectively cytotoxic to tumor derived DU145 prostaspheres. An effective concentration (EC 50 ) of 0.11-0.14 multiplicity of infection was sufficient to cause prostasphere cell death in serum free culture. DU145 tumor xenograft derived prostaspheres were used as tumor surrogates as they were enriched for a putative tumor initiating cell population. PSA activated rNDV was efficient in inducing cell death of cells and prostaspheres derived from primary xenografts ex-vivo, thus signifying a potential in vivo efficacy. The EC 50 (∼0.1 MOI) for cytolysis of tumor initiating cells was slightly higher than that was required for the parental cell line, but within the therapeutic margin for safety and efficacy. Copyright © 2017 Elsevier B.V. All rights reserved.

Induction of murine embryonic stem cell differentiation by medicinal plant extracts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reynertson, Kurt A.; Department of Pharmacology, Weill Cornell Medical College, 1300 York Avenue, New York, NY 10065; Charlson, Mary E.

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extractsmore » for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells.« less

Induction of murine embryonic stem cell differentiation by medicinal plant extracts

PubMed Central

Reynertson, Kurt A.; Charlson, Mary E.; Gudas, Lorraine J.

2010-01-01

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly-cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from twelve species of ethnomedically utilized plants, we found fractions from three species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. PMID:20955699

CRISPR/Cas9-mediated gene knockout of NANOG and NANOGP8 decreases the malignant potential of prostate cancer cells.

PubMed

Kawamura, Norihiko; Nimura, Keisuke; Nagano, Hiromichi; Yamaguchi, Sohei; Nonomura, Norio; Kaneda, Yasufumi

2015-09-08

NANOG expression in prostate cancer is highly correlated with cancer stem cell characteristics and resistance to androgen deprivation. However, it is not clear whether NANOG or its pseudogenes contribute to the malignant potential of cancer. We established NANOG- and NANOGP8-knockout DU145 prostate cancer cell lines using the CRISPR/Cas9 system. Knockouts of NANOG and NANOGP8 significantly attenuated malignant potential, including sphere formation, anchorage-independent growth, migration capability, and drug resistance, compared to parental DU145 cells. NANOG and NANOGP8 knockout did not inhibit in vitro cell proliferation, but in vivo tumorigenic potential decreased significantly. These phenotypes were recovered in NANOG- and NANOGP8-rescued cell lines. These results indicate that NANOG and NANOGP8 proteins are expressed in prostate cancer cell lines, and NANOG and NANOGP8 equally contribute to the high malignant potential of prostate cancer.

Effects of homeopathic preparations on human prostate cancer growth in cellular and animal models.

PubMed

MacLaughlin, Brian W; Gutsmuths, Babett; Pretner, Ewald; Jonas, Wayne B; Ives, John; Kulawardane, Don Victor; Amri, Hakima

2006-12-01

The use of dietary supplements for various ailments enjoys unprecedented popularity. As part of this trend, Sabal serrulata (saw palmetto) constitutes the complementary treatment of choice with regard to prostate health. In homeopathy, Sabal serrulata is commonly prescribed for prostate problems ranging from benign prostatic hyperplasia to prostate cancer. The authors' work assessed the antiproliferative effects of homeopathic preparations of Sabal serrulata, Thuja occidentalis, and Conium maculatum, in vivo, on nude mouse xenografts, and in vitro, on PC-3 and DU-145 human prostate cancer as well as MDA-MB-231 human breast cancer cell lines. Treatment with Sabal serrulata in vitro resulted in a 33% decrease of PC-3 cell proliferation at 72 hours and a 23% reduction of DU-145 cell proliferation at 24 hours (P<.01). The difference in reduction is likely due to the specific doubling time of each cell line. No effect was observed on MDA-MB-231 human breast cancer cells. Thuja occidentalis and Conium maculatum did not have any effect on human prostate cancer cell proliferation. In vivo, prostate tumor xenograft size was significantly reduced in Sabal serrulata-treated mice compared to untreated controls (P=.012). No effect was observed on breast tumor growth. Our study clearly demonstrates a biologic response to homeopathic treatment as manifested by cell proliferation and tumor growth. This biologic effect was (i)significantly stronger to Sabal serrulata than to controls and (ii)specific to human prostate cancer. Sabal serrulata should thus be further investigated as a specific homeopathic remedy for prostate pathology.

Human spermatogonial stem cells display limited proliferation in vitro under mouse spermatogonial stem cell culture conditions.

PubMed

Medrano, Jose V; Rombaut, Charlotte; Simon, Carlos; Pellicer, Antonio; Goossens, Ellen

2016-11-01

To study the ability of human spermatogonial stem cells (hSSCs) to proliferate in vitro under mouse spermatogonial stem cell (mSSC) culture conditions. Experimental basic science study. Reproductive biology laboratory. Cryopreserved testicular tissue with normal spermatogenesis obtained from three donors subjected to orchiectomy due to a prostate cancer treatment. Testicular cells used to create in vitro cell cultures corresponding to the following groups: [1] unsorted human testicular cells, [2] differentially plated human testicular cells, and [3] cells enriched with major histocompatibility complex class 1 (HLA - )/epithelial cell surface antigen (EPCAM + ) in coculture with inactivated testicular feeders from the same patient. Analyses and characterization including immunocytochemistry and quantitative reverse-transcription polymerase chain reaction for somatic and germ cell markers, testosterone and inhibin B quantification, and TUNEL assay. Putative hSSCs appeared in singlets, doublets, or small groups of up to four cells in vitro only when testicular cells were cultured in StemPro-34 medium supplemented with glial cell line-derived neurotrophic factor (GDNF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF). Fluorescence-activated cell sorting with HLA - /EPCAM + resulted in an enrichment of 27% VASA + /UTF1 + hSSCs, compared to 13% in unsorted controls. Coculture of sorted cells with inactivated testicular feeders gave rise to an average density of 112 hSSCs/cm 2 after 2 weeks in vitro compared with unsorted cells (61 hSSCs/cm 2 ) and differentially plated cells (49 hSSCS/cm 2 ). However, putative hSSCs rarely stained positive for the proliferation marker Ki67, and their presence was reduced to the point of almost disappearing after 4 weeks in vitro. We found that hSSCs show limited proliferation in vitro under mSSC culture conditions. Coculture of HLA - /EPCAM + sorted cells with testicular feeders improved the germ cell/somatic cell ratio. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

N-Myc Drives Neuroendocrine Prostate Cancer Initiated from Human Prostate Epithelial Cells.

PubMed

Lee, John K; Phillips, John W; Smith, Bryan A; Park, Jung Wook; Stoyanova, Tanya; McCaffrey, Erin F; Baertsch, Robert; Sokolov, Artem; Meyerowitz, Justin G; Mathis, Colleen; Cheng, Donghui; Stuart, Joshua M; Shokat, Kevan M; Gustafson, W Clay; Huang, Jiaoti; Witte, Owen N

2016-04-11

MYCN amplification and overexpression are common in neuroendocrine prostate cancer (NEPC). However, the impact of aberrant N-Myc expression in prostate tumorigenesis and the cellular origin of NEPC have not been established. We define N-Myc and activated AKT1 as oncogenic components sufficient to transform human prostate epithelial cells to prostate adenocarcinoma and NEPC with phenotypic and molecular features of aggressive, late-stage human disease. We directly show that prostate adenocarcinoma and NEPC can arise from a common epithelial clone. Further, N-Myc is required for tumor maintenance, and destabilization of N-Myc through Aurora A kinase inhibition reduces tumor burden. Our findings establish N-Myc as a driver of NEPC and a target for therapeutic intervention. Copyright © 2016 Elsevier Inc. All rights reserved.

miRNA-regulated cancer stem cells: understanding the property and the role of miRNA in carcinogenesis.

PubMed

Chakraborty, Chiranjib; Chin, Kok-Yong; Das, Srijit

2016-10-01

Over the last few years, microRNAs (miRNA)-controlled cancer stem cells have drawn enormous attention. Cancer stem cells are a small population of tumor cells that possess the stem cell property of self-renewal. Recent data shows that miRNA regulates this small population of stem cells. In the present review, we explained different characteristics of cancer stem cells as well as miRNA regulation of self-renewal and differentiation in cancer stem cells. We also described the migration and tumor formation. Finally, we described the different miRNAs that regulate various types of cancer stem cells, such as prostate cancer stem cells, head and neck cancer stem cells, breast cancer stem cells, colorectal cancer stem cells, lung cancer stem cells, gastric cancer stem cells, pancreatic cancer stem cells, etc. Extensive research is needed in order to employ miRNA-based therapeutics to control cancer stem cell population in various cancers in the future.

Human Prostate Cancer Hallmarks Map

PubMed Central

Datta, Dipamoy; Aftabuddin, Md.; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

2016-01-01

Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

Recruitment of Mesenchymal Stem Cells Into Prostate Tumors Promotes Metastasis

PubMed Central

Jung, Younghun; Kim, Jin Koo; Shiozawa, Yusuke; Wang, Jingcheng; Mishra, Anjali; Joseph, Jeena; Berry, Janice E.; McGee, Samantha; Lee, Eunsohl; Sun, Hongli; Wang, Jianhua; Jin, Taocong; Zhang, Honglai; Dai, Jinlu; Krebsbach, Paul H.; Keller, Evan T.; Pienta, Kenneth J.; Taichman, Russell S.

2013-01-01

Tumors recruit mesenchymal stem cells (MSCs) to facilitate healing, which induces their conversion into cancer-associated fibroblasts that facilitate metastasis. However, this process is poorly understood on the molecular level. Here we show that the CXCR6 ligand CXCL16 facilitates MSC or Very Small Embryonic-Like (VSEL) cells recruitment into prostate tumors. CXCR6 signaling stimulates the conversion of MSCs into cancer-associated fibroblasts, which secrete stromal-derived factor-1, also known as CXCL12. CXCL12 expressed by cancer-associated fibroblasts then binds to CXCR4 on tumor cells and induces an epithelial to mesenchymal transition, which ultimately promotes metastasis to secondary tumor sites. Our results provide the molecular basis for MSC recruitment into tumors and how this process leads to tumor metastasis. PMID:23653207

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2015-10-01

antitumor activity in mouse xenografts did not exert toxic effects on normal tissues. BMI-1 targeted therapy when combined with taxotere resulted in...utilizing zebrafish xenografts (Sabaawy Lab) and prostate cancer cell lines (Bertino Lab), and 3) Confirmation of the antitumor activity of C-209...in mouse xenografts alone and upon combination with taxotere (Bertino Lab). The following tasks from the approved SOW were performed to achieve the

Boosting antitumor responses of T lymphocytes infiltrating human prostate cancers.

PubMed

Bronte, Vincenzo; Kasic, Tihana; Gri, Giorgia; Gallana, Keti; Borsellino, Giovanna; Marigo, Ilaria; Battistini, Luca; Iafrate, Massimo; Prayer-Galetti, Tommaso; Pagano, Francesco; Viola, Antonella

2005-04-18

Immunotherapy may provide valid alternative therapy for patients with hormone-refractory metastatic prostate cancer. However, if the tumor environment exerts a suppressive action on antigen-specific tumor-infiltrating lymphocytes (TIL), immunotherapy will achieve little, if any, success. In this study, we analyzed the modulation of TIL responses by the tumor environment using collagen gel matrix-supported organ cultures of human prostate carcinomas. Our results indicate that human prostatic adenocarcinomas are infiltrated by terminally differentiated cytotoxic T lymphocytes that are, however, in an unresponsive status. We demonstrate the presence of high levels of nitrotyrosines in prostatic TIL, suggesting a local production of peroxynitrites. By inhibiting the activity of arginase and nitric oxide synthase, key enzymes of L-arginine metabolism that are highly expressed in malignant but not in normal prostates, reduced tyrosine nitration and restoration of TIL responsiveness to tumor were achieved. The metabolic control exerted by the tumor on TIL function was confirmed in a transgenic mouse prostate model, which exhibits similarities with human prostate cancer. These results identify a novel and dominant mechanism by which cancers induce immunosuppression in situ and suggest novel strategies for tumor immunotherapy.

Cell-autonomous intracellular androgen receptor signaling drives the growth of human prostate cancer initiating cells.

PubMed

Vander Griend, Donald J; D'Antonio, Jason; Gurel, Bora; Antony, Lizamma; Demarzo, Angelo M; Isaacs, John T

2010-01-01

The lethality of prostate cancer is due to the continuous growth of cancer initiating cells (CICs) which are often stimulated by androgen receptor (AR) signaling. However, the underlying molecular mechanism(s) for such AR-mediated growth stimulation are not fully understood. Such mechanisms may involve cancer cell-dependent induction of tumor stromal cells to produce paracrine growth factors or could involve cancer cell autonomous autocrine and/or intracellular AR signaling pathways. We utilized clinical samples, animal models and a series of AR-positive human prostate cancer cell lines to evaluate AR-mediated growth stimulation of prostate CICs. The present studies document that stromal AR expression is not required for prostate cancer growth, since tumor stroma surrounding AR-positive human prostate cancer metastases (N = 127) are characteristically AR-negative. This lack of a requirement for AR expression in tumor stromal cells is also documented by the fact that human AR-positive prostate cancer cells grow equally well when xenografted in wild-type versus AR-null nude mice. AR-dependent growth stimulation was documented to involve secretion, extracellular binding, and signaling by autocrine growth factors. Orthotopic xenograft animal studies documented that the cellautonomous autocrine growth factors which stimulate prostate CIC growth are not the andromedins secreted by normal prostate stromal cells. Such cell autonomous and extracellular autocrine signaling is necessary but not sufficient for the optimal growth of prostate CICs based upon the response to anti-androgen plus/or minus preconditioned media. AR-induced growth stimulation of human prostate CICs requires AR-dependent intracellular pathways. The identification of such AR-dependent intracellular pathways offers new leads for the development of effective therapies for prostate cancer. (c) 2009 Wiley-Liss, Inc.

Immortalization of human prostate epithelial cells by HPV 16 E6/E7 open reading frames.

PubMed

Choo, C K; Ling, M T; Chan, K W; Tsao, S W; Zheng, Z; Zhang, D; Chan, L C; Wong, Y C

1999-08-01

The exact pathogenesis for prostate cancer is not known. Progress made in prostate cancer research has been slow, largely due to the lack of suitable in vitro models. Here, we report our work on the immortalization of a human prostate epithelial cell line and show that it can be used as a model to study prostate tumorigenesis. Replication-defective retrovirus harboring the human papillomavirus (HPV) type 16 E6 and E7 open reading frames was used to infect primary human prostate epithelial cells. Polymerase chain reaction, followed by Southern hybridization for the HPV 16 E6/E7, Western blot for prostatic acid phosphatase, telomeric repeat amplification protocol assay for telomerase activity, two-dimensional gels for cytokeratins, and cytogenetic analysis were undertaken to characterized the infected cells. The retrovirus-infected cell line, HPr-1, continued to grow in culture for more than 80 successive passages. Normal primary cells failed to proliferate after passage 6. HPr-1 cells bore close resemblance to normal primary prostate epithelial cells, both morphologically and biochemically. However, they possessed telomerase activity and proliferated indefinitely. Cytogenetic analysis of HPr-1 cells revealed a human male karyotype with clonal abnormalities and the appearance of multiple double minutes. The HPr-1 cells expressed prostatic acid phosphatase and cytokeratins K8 and K18, proving that they were prostate epithelial cells. They were benign in nude mice tumor formation and soft agar colony formation assay. The HPr-1 cell line is an in vitro representation of early prostate neoplastic progression. Copyright 1999 Wiley-Liss, Inc.

Exosomal microRNA profiling to identify hypoxia-related biomarkers in prostate cancer

PubMed Central

Panigrahi, Gati K.; Ramteke, Anand; Birks, Diane; Abouzeid Ali, Hamdy E.; Venkataraman, Sujatha; Agarwal, Chapla; Vibhakar, Rajeev; Miller, Lance D.; Agarwal, Rajesh; Abd Elmageed, Zakaria Y.; Deep, Gagan

2018-01-01

Hypoxia and expression of hypoxia-related biomarkers are associated with disease progression and treatment failure in prostate cancer (PCa). We have reported that exosomes (nanovesicles of 30-150 nm in diameter) secreted by human PCa cells under hypoxia promote invasiveness and stemness in naïve PCa cells. Here, we identified the unique microRNAs (miRNAs) loaded in exosomes secreted by PCa cells under hypoxia. Using TaqMan® array microRNA cards, we analyzed the miRNA profile in exosomes secreted by human PCa LNCaP cells under hypoxic (ExoHypoxic) and normoxic (ExoNormoxic) conditions. We identified 292 miRNAs loaded in both ExoHypoxic and ExoNormoxic. The top 11 miRNAs with significantly higher level in ExoHypoxic compared to ExoNormoxic were miR-517a, miR-204, miR-885, miR-143, miR-335, miR-127, miR-542, miR-433, miR-451, miR-92a and miR-181a; and top nine miRNA with significantly lower expression level in ExoHypoxic compared to ExoNormoxic were miR-521, miR-27a, miR-324, miR-579, miR-502, miR-222, miR-135b, miR-146a and miR-491. Importantly, the two differentially expressed miRNAs miR-885 (increased expression) and miR-521 (decreased expression) showed similar expression pattern in exosomes isolated from the serum of PCa patients compared to healthy individuals. Additionally, miR-204 and miR-222 displayed correlated expression patterns in prostate tumors (Pearson R = 0.66, p < 0.0001) by The Cancer Genome Atlas (TCGA) prostate adenocarcinoma (PRAD) genomic dataset analysis. Overall, the present study identified unique miRNAs with differential expression in exosomes secreted from hypoxic PCa cells and suggests their potential usefulness as a biomarker of hypoxia in PCa patients. PMID:29568403

A Prospective Randomized Trial of Two Different Prostate Biopsy Schemes

ClinicalTrials.gov

2016-07-03

Prostate Cancer; Local Anesthesia; Prostate-Specific Antigen/Blood; Biopsy/Methods; Image-guided Biopsy/Methods; Prostatic Neoplasms/Diagnosis; Prostate/Pathology; Prospective Studies; Humans; Male; Ultrasonography, Interventional/Methods

Expression of Pleiotrophin in the Prostate is Androgen Regulated and it Functions as an Autocrine Regulator of Mesenchyme and Cancer Associated Fibroblasts and as a Paracrine Regulator of Epithelia

PubMed Central

Orr, Brigid; Vanpoucke, Griet; Grace, O Cathal; Smith, Lee; Anderson, Richard A; Riddick, Antony CP; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

2011-01-01

BACKGROUND Androgens and paracrine signaling from mesenchyme/stroma regulate development and disease of the prostate, and gene profiling studies of inductive prostate mesenchyme have identified candidate molecules such as pleiotrophin (Ptn). METHODS Ptn transcripts and protein were localized by in situ and immunohistochemistry and Ptn mRNA was quantitated by Northern blot and qRT-PCR. Ptn function was examined by addition of hPTN protein to rat ventral prostate organ cultures, primary human fetal prostate fibroblasts, prostate cancer associated fibroblasts, and BPH1 epithelia. RESULTS During development, Ptn transcripts and protein were expressed in ventral mesenchymal pad (VMP) and prostatic mesenchyme. Ptn was localized to mesenchyme surrounding ductal epithelial tips undergoing branching morphogenesis, and was located on the surface of epithelia. hPTN protein stimulated branching morphogenesis and stromal and epithelial proliferation, when added to rat VP cultures, and also stimulated growth of fetal human prostate fibroblasts, prostate cancer associated fibroblasts, and BPH1 epithelia. PTN mRNA was enriched in patient-matched normal prostate fibroblasts versus prostate cancer associated fibroblasts. PTN also showed male enriched expression in fetal human male urethra versus female, and between wt male and ARKO male mice. Transcripts for PTN were upregulated by testosterone in fetal human prostate fibroblasts and organ cultures of female rat VMP. Ptn protein was increased by testosterone in organ cultures of female rat VMP and in rat male urethra compared to female. CONCLUSIONS Our data suggest that in the prostate Ptn functions as a regulator of both mesenchymal and epithelial proliferation, and that androgens regulate Ptn levels. Prostate 71:305–317, 2011. © 2010 Wiley-Liss, Inc. PMID:20812209

MLF1 interacting protein: a potential gene therapy target for human prostate cancer?

PubMed

Zhang, Lei; Ji, Guoqing; Shao, Yuzhang; Qiao, Shaoyi; Jing, Yuming; Qin, Rongliang; Sun, Huiming; Shao, Chen

2015-02-01

Here, we investigated the role of one gene that has been previously associated with human prostate carcinoma cells-myelodysplasia/myeloid leukemia factor 1 interacting protein (MLF1IP)-in order to better ascertain its role in human prostate carcinogenesis. The prostate cancer cell line PC-3 was lentivirally transfected to silence endogenous MLF1IP gene expression, which was confirmed by real-time quantitative PCR (RT-qPCR). Cellomics ArrayScan VTI imaging and MTT assays were conducted to assess cell proliferation. Cell cycle phase arrest and apoptosis were assayed by flow cytometry. Colony formation was assessed by fluorescence microscopy. MLF1IP gene expression was also analyzed by RT-qPCR in sixteen prostate cancer tissue samples and six healthy control prostate tissue samples from human patients. Cell proliferation was significantly inhibited in MLF1IP-silenced cells relative to control cells. G1 phase, S and G2/M phase cell counts were not significantly changed in MLF1IP-silenced cells relative to control cells. Apoptosis was significantly increased in MLF1IP-silenced cells, while MLF1IP-silenced cells displayed a significantly reduced number of cell colonies, compared to control cells. The 16 human prostate cancer tissue samples revealed no clear upregulation or downregulation in MLF1IP gene expression. MLF1IP significantly promotes prostate cancer cell proliferation and colony formation and significantly inhibits apoptosis without affecting cell cycle phase arrest. Further study is required to conclusively determine whether MLF1IP is upregulated in human prostate cancer tumors and to determine the precise cellular mechanism(s) for MLF1IP in prostate carcinogenesis.

Visualization of prostatic nerves by polarization-sensitive optical coherence tomography

PubMed Central

Yoon, Yeoreum; Jeon, Seung Hwan; Park, Yong Hyun; Jang, Won Hyuk; Lee, Ji Youl; Kim, Ki Hean

2016-01-01

Preservation of prostatic nerves is critical to recovery of a man’s sexual potency after radical prostatectomy. A real-time imaging method of prostatic nerves will be helpful for nerve-sparing radical prostatectomy (NSRP). Polarization-sensitive optical coherence tomography (PS-OCT), which provides both structural and birefringent information of tissue, was applied for detection of prostatic nerves in both rat and human prostate specimens, ex vivo. PS-OCT imaging of rat prostate specimens visualized highly scattering and birefringent fibrous structures superficially, and these birefringent structures were confirmed to be nerves by histology or multiphoton microscopy (MPM). PS-OCT could easily distinguish these birefringent structures from surrounding other tissue compartments such as prostatic glands and fats. PS-OCT imaging of human prostatectomy specimens visualized two different birefringent structures, appearing fibrous and sheet-like. The fibrous ones were confirmed to be nerves by histology, and the sheet-like ones were considered to be fascias surrounding the human prostate. PS-OCT imaging of human prostatectomy specimens along the perimeter showed spatial variation in the amount of birefringent fibrous structures which was consistent with anatomy. These results demonstrate the feasibility of PS-OCT for detection of prostatic nerves, and this study will provide a basis for intraoperative use of PS-OCT. PMID:27699090

Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Yongpeng; Li Hongzhen; Miki, Jun

2006-04-01

In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferativemore » capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.« less

Maturation of the developing human fetal prostate in a rodent xenograft model

PubMed Central

Saffarini, Camelia M.; McDonnell, Elizabeth V.; Amin, Ali; Spade, Daniel J.; Huse, Susan M.; Kostadinov, Stefan; Hall, Susan J.; Boekelheide, Kim

2015-01-01

Background Prostate cancer is the most commonly diagnosed non-skin cancer in men. The etiology of prostate cancer is unknown, although both animal and epidemiologic data suggest that early life exposures to various toxicants, may impact DNA methylation status during development, playing an important role. Methods We have developed a xenograft model to characterize the growth and differentiation of human fetal prostate implants (gestational age 12-24 weeks) that can provide new data on the potential role of early life stressors on prostate cancer. The expression of key immunohistochemical markers responsible for prostate maturation was evaluated, including p63, cytokeratin 18, α-smooth muscle actin, vimentin, caldesmon, Ki-67, prostate specific antigen, estrogen receptor-α, and androgen receptor. Xenografts were separated into epithelial and stromal compartments using laser capture microdissection (LCM), and the DNA methylation status was assessed in >480,000 CpG sites throughout the genome. Results Xenografts demonstrated growth and maturation throughout the 200 days of post-implantation evaluation. DNA methylation profiles of laser capture micro-dissected tissue demonstrated tissue-specific markers clustered by their location in either the epithelium or stroma of human prostate tissue. Differential methylated promoter region CpG-associated gene analysis revealed significantly more stromal than epithelial DNA methylation in the 30 and 90-day xenografts. Functional classification analysis identified CpG-related gene clusters in methylated epithelial and stromal human xenografts. Conclusion This study of human fetal prostate tissue establishes a xenograft model that demonstrates dynamic growth and maturation, allowing for future mechanistic studies of the developmental origins of later life proliferative prostate disease. PMID:24038131

Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune resistance.

PubMed

Martin, A M; Nirschl, T R; Nirschl, C J; Francica, B J; Kochel, C M; van Bokhoven, A; Meeker, A K; Lucia, M S; Anders, R A; DeMarzo, A M; Drake, C G

2015-12-01

Primary prostate cancers are infiltrated with programmed death-1 (PD-1) expressing CD8+ T-cells. However, in early clinical trials, men with metastatic castrate-resistant prostate cancer did not respond to PD-1 blockade as a monotherapy. One explanation for this unresponsiveness could be that prostate tumors generally do not express programmed death ligand-1 (PD-L1), the primary ligand for PD-1. However, lack of PD-L1 expression in prostate cancer would be surprising, given that phosphatase and tensin homolog (PTEN) loss is relatively common in prostate cancer and several studies have shown that PTEN loss correlates with PD-L1 upregulation--constituting a mechanism of innate immune resistance. This study tested whether prostate cancer cells were capable of expressing PD-L1, and whether the rare PD-L1 expression that occurs in human specimens correlates with PTEN loss. Human prostate cancer cell lines were evaluated for PD-L1 expression and loss of PTEN by flow cytometry and western blotting, respectively. Immunohistochemical (IHC) staining for PTEN was correlated with PD-L1 IHC using a series of resected human prostate cancer samples. In vitro, many prostate cancer cell lines upregulated PD-L1 expression in response to inflammatory cytokines, consistent with adaptive immune resistance. In these cell lines, no association between PTEN loss and PD-L1 expression was apparent. In primary prostate tumors, PD-L1 expression was rare, and was not associated with PTEN loss. These studies show that some prostate cancer cell lines are capable of expressing PD-L1. However, in human prostate cancer, PTEN loss is not associated with PD-L1 expression, arguing against innate immune resistance as a mechanism that mitigates antitumor immune responses in this disease.

Smooth muscle contraction and growth of stromal cells in the human prostate are both inhibited by the Src family kinase inhibitors, AZM475271 and PP2.

PubMed

Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Rutz, Beata; Ciotkowska, Anna; Strittmatter, Frank; Herlemann, Annika; Janich, Sophie; Waidelich, Raphaela; Liu, Chunxiao; Stief, Christian G; Hennenberg, Martin

2016-12-01

In benign prostatic hyperplasia, increased prostate smooth muscle tone and prostate volume may contribute alone or together to urethral obstruction and voiding symptoms. Consequently, it is assumed there is a connection between smooth muscle tone and growth in the prostate, but any molecular basis for this is poorly understood. Here, we examined effects of Src family kinase (SFK) inhibitors on prostate contraction and growth of stromal cells. SFK inhibitors, AZM475271 and PP2, were applied to human prostate tissues to assess effects on smooth muscle contraction, and to cultured stromal (WPMY-1) and c-Src-deficient cells to examine effects on proliferation, actin organization and viability. SFKs were detected by real time PCR, western blot and immunofluorescence in human prostate tissues, some being located to smooth muscle cells. AZM475271 (10 μM) and PP2 (10 μM) inhibited SFK in prostate tissues and WPMY-1 cells. Both inhibitors reduced α 1 -adrenoceptor-mediated and neurogenic contraction of prostate strips. This may result from cytoskeletal deorganization, which was observed in response to AZM475271 and PP2 in WPMY-1 cells by staining of actin filaments with phalloidin. This was paralleled by reduced proliferation of wildtype but not of c-Src-deficient cells; cytotoxicity was mainly observed at higher concentrations (>50 μM). In human prostate, smooth muscle tone and growth are both controlled by an SFK-dependent process, which may explain their common role in bladder outlet obstruction. Targeting prostate smooth muscle tone and prostate growth simultaneously by a single compound may, in principal, be possible. © 2016 The British Pharmacological Society.

Smooth muscle contraction and growth of stromal cells in the human prostate are both inhibited by the Src family kinase inhibitors, AZM475271 and PP2

PubMed Central

Wang, Yiming; Tamalunas, Alexander; Rutz, Beata; Ciotkowska, Anna; Strittmatter, Frank; Herlemann, Annika; Janich, Sophie; Waidelich, Raphaela; Liu, Chunxiao; Stief, Christian G; Hennenberg, Martin

2016-01-01

Background and Purpose In benign prostatic hyperplasia, increased prostate smooth muscle tone and prostate volume may contribute alone or together to urethral obstruction and voiding symptoms. Consequently, it is assumed there is a connection between smooth muscle tone and growth in the prostate, but any molecular basis for this is poorly understood. Here, we examined effects of Src family kinase (SFK) inhibitors on prostate contraction and growth of stromal cells. Experimental Approach SFK inhibitors, AZM475271 and PP2, were applied to human prostate tissues to assess effects on smooth muscle contraction, and to cultured stromal (WPMY‐1) and c‐Src‐deficient cells to examine effects on proliferation, actin organization and viability. Key Results SFKs were detected by real time PCR, western blot and immunofluorescence in human prostate tissues, some being located to smooth muscle cells. AZM475271 (10 μM) and PP2 (10 μM) inhibited SFK in prostate tissues and WPMY‐1 cells. Both inhibitors reduced α1‐adrenoceptor‐mediated and neurogenic contraction of prostate strips. This may result from cytoskeletal deorganization, which was observed in response to AZM475271 and PP2 in WPMY‐1 cells by staining of actin filaments with phalloidin. This was paralleled by reduced proliferation of wildtype but not of c‐Src‐deficient cells; cytotoxicity was mainly observed at higher concentrations (>50 μM). Conclusions and Implications In human prostate, smooth muscle tone and growth are both controlled by an SFK‐dependent process, which may explain their common role in bladder outlet obstruction. Targeting prostate smooth muscle tone and prostate growth simultaneously by a single compound may, in principal, be possible. PMID:27638545

Alterations in gene expression profiles during prostate cancer progression: functional correlations to tumorigenicity and down-regulation of selenoprotein-P in mouse and human tumors.

PubMed

Calvo, Alfonso; Xiao, Nianqing; Kang, Jason; Best, Carolyn J M; Leiva, Isabel; Emmert-Buck, Michael R; Jorcyk, Cheryl; Green, Jeffrey E

2002-09-15

To identify molecular changes that occur during prostate tumor progression, we have characterized a series of prostate cancer cell lines isolated at different stages of tumorigenesis from C3(1)/Tag transgenic mice. Cell lines derived from low- and high-grade prostatic intraepithelial neoplasia, invasive carcinoma, and a lung metastasis exhibited significant differences in cell growth, tumorigenicity, invasiveness, and angiogenesis. cDNA microarray analysis of 8700 features revealed correlations between the tumorigenicity of the C3(1)/Tag-Pr cells and changes in the expression levels of genes regulating cell growth, angiogenesis, and invasion. Many changes observed in transcriptional regulation in this in vitro system are similar to those reported for human prostate cancer, as well as other types of human tumors. This analysis of expression patterns has also identified novel genes that may be involved in mechanisms of prostate oncogenesis or serve as potential biomarkers or therapeutic targets for prostate cancer. Examples include the L1-cell adhesion molecule, metastasis-associated gene (MTA-2), Rab-25, tumor-associated signal transducer-2 (Trop-2), and Selenoprotein-P, a gene that binds selenium and prevents oxidative stress. Many genes identified in the Pr-cell line model have been shown to be altered in human prostate cancer. The comprehensive microarray data provides a rational basis for using this model system for studies where alterations of specific genes or pathways are of particular interest. Quantitative real-time reverse transcription-PCR for Selenoprotein-P demonstrated a similar down-regulation of the transcript of this gene in a subset of human prostate tumors, mouse tumors, and prostate carcinoma cell lines. This work demonstrates that expression profiling in animal models may lead to the identification of novel genes involved in human prostate cancer biology.

Boosting antitumor responses of T lymphocytes infiltrating human prostate cancers

PubMed Central

Bronte, Vincenzo; Kasic, Tihana; Gri, Giorgia; Gallana, Keti; Borsellino, Giovanna; Marigo, Ilaria; Battistini, Luca; Iafrate, Massimo; Prayer-Galetti, Tommaso; Pagano, Francesco; Viola, Antonella

2005-01-01

Immunotherapy may provide valid alternative therapy for patients with hormone-refractory metastatic prostate cancer. However, if the tumor environment exerts a suppressive action on antigen-specific tumor-infiltrating lymphocytes (TIL), immunotherapy will achieve little, if any, success. In this study, we analyzed the modulation of TIL responses by the tumor environment using collagen gel matrix–supported organ cultures of human prostate carcinomas. Our results indicate that human prostatic adenocarcinomas are infiltrated by terminally differentiated cytotoxic T lymphocytes that are, however, in an unresponsive status. We demonstrate the presence of high levels of nitrotyrosines in prostatic TIL, suggesting a local production of peroxynitrites. By inhibiting the activity of arginase and nitric oxide synthase, key enzymes of L-arginine metabolism that are highly expressed in malignant but not in normal prostates, reduced tyrosine nitration and restoration of TIL responsiveness to tumor were achieved. The metabolic control exerted by the tumor on TIL function was confirmed in a transgenic mouse prostate model, which exhibits similarities with human prostate cancer. These results identify a novel and dominant mechanism by which cancers induce immunosuppression in situ and suggest novel strategies for tumor immunotherapy. PMID:15824085

Altered Fibroblast Growth Factor Receptor 4 Stability Promotes Prostate Cancer Progression1

PubMed Central

Wang, Jianghua; Yu, Wendong; Cai, Yi; Ren, Chengxi; Ittmann, Michael M

2008-01-01

Fibroblast growth factor receptor 4 (FGFR-4) is expressed at significant levels in almost all human prostate cancers, and expression of its ligands is ubiquitous. A common polymorphism of FGFR-4 in which arginine (Arg388) replaces glycine (Gly388) at amino acid 388 is associated with progression in human prostate cancer. We show that the FGFR-4 Arg388 polymorphism, which is present in most prostate cancer patients, results in increased receptor stability and sustained receptor activation. In patients bearing the FGFR-4 Gly388 variant, expression of Huntingtin-interacting protein 1 (HIP1), which occurs in more than half of human prostate cancers, also results in FGFR-4 stabilization. This is associated with enhanced proliferation and anchorage-independent growth in vitro. Our findings indicate that increased receptor stability and sustained FGFR-4 signaling occur in most human prostate cancers due to either the presence of a common genetic polymorphism or the expression of a protein that stabilizes FGFR-4. Both of these alterations are associated with clinical progression in patients with prostate cancer. Thus, FGFR-4 signaling and receptor turnover are important potential therapeutic targets in prostate cancer. PMID:18670643

HUMAN PROSTATE CANCER RISK FACTORS

EPA Science Inventory

Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

Role of Stromal Paracrine Signals in Proliferative Diseases of the Aging Human Prostate

PubMed Central

Takahashi, Sanai; Sugimura, Yoshiki

2018-01-01

Androgens are essential for the development, differentiation, growth, and function of the prostate through epithelial–stromal interactions. However, androgen concentrations in the hypertrophic human prostate decrease significantly with age, suggesting an inverse correlation between androgen levels and proliferative diseases of the aging prostate. In elderly males, age- and/or androgen-related stromal remodeling is spontaneously induced, i.e., increased fibroblast and myofibroblast numbers, but decreased smooth muscle cell numbers in the prostatic stroma. These fibroblasts produce not only growth factors, cytokines, and extracellular matrix proteins, but also microRNAs as stromal paracrine signals that stimulate prostate epithelial cell proliferation. Surgical or chemical castration is the standard systemic therapy for patients with advanced prostate cancer. Androgen deprivation therapy induces temporary remission, but the majority of patients eventually progress to castration-resistant prostate cancer, which is associated with a high mortality rate. Androgen deprivation therapy-induced stromal remodeling may be involved in the development and progression of castration-resistant prostate cancer. In the tumor microenvironment, activated fibroblasts stimulating prostate cancer cell proliferation are called carcinoma-associated fibroblasts. In this review, we summarize the role of stromal paracrine signals in proliferative diseases of the aging human prostate and discuss the potential clinical applications of carcinoma-associated fibroblast-derived exosomal microRNAs as promising biomarkers. PMID:29614830

Granulocyte colony-stimulating factor off-target effect on nerve outgrowth promotes prostate cancer development.

PubMed

Dobrenis, Kostantin; Gauthier, Laurent R; Barroca, Vilma; Magnon, Claire

2015-02-15

The hematopoietic growth factor granulocyte colony-stimulating factor (G-CSF) has a role in proliferation, differentiation and migration of the myeloid lineage and in mobilizing hematopoietic stem and progenitor cells into the bloodstream. However, G-CSF has been newly characterized as a neurotrophic factor in the brain. We recently uncovered that autonomic nerve development in the tumor microenvironment participates actively in prostate tumorigenesis and metastasis. Here, we found that G-CSF constrains cancer to grow and progress by, respectively, supporting the survival of sympathetic nerve fibers in 6-hydroxydopamine-sympathectomized mice and also, promoting the aberrant outgrowth of parasympathetic nerves in transgenic or xenogeneic prostate tumor models. This provides insight into how neurotrophic growth factors may control tumor neurogenesis and may lead to new antineurogenic therapies for prostate cancer. © 2014 UICC.

Protein profile of basal prostate epithelial progenitor cells--stage-specific embryonal antigen 4 expressing cells have enhanced regenerative potential in vivo.

PubMed

Höfner, Thomas; Klein, Corinna; Eisen, Christian; Rigo-Watermeier, Teresa; Haferkamp, Axel; Sprick, Martin R

2016-04-01

The long-term propagation of basal prostate progenitor cells ex vivo has been very difficult in the past. The development of novel methods to expand prostate progenitor cells in vitro allows determining their cell surface phenotype in greater detail. Mouse (Lin(-)Sca-1(+) CD49f(+) Trop2(high)-phenotype) and human (Lin(-) CD49f(+) TROP2(high)) basal prostate progenitor cells were expanded in vitro. Human and mouse cells were screened using 242 anti-human or 176 antimouse monoclonal antibodies recognizing the cell surface protein profile. Quantitative expression was evaluated at the single-cell level using flow cytometry. Differentially expressed cell surface proteins were evaluated in conjunction with the known CD49f(+)/TROP2(high) phenotype of basal prostate progenitor cells and characterized by in vivo sandwich-transplantation experiments using nude mice. The phenotype of basal prostate progenitor cells was determined as CD9(+)/CD24(+)/CD29(+)/CD44(+)/CD47(+)/CD49f(+)/CD104(+)/CD147(+)/CD326(+)/Trop2(high) of mouse as well as human origin. Our analysis revealed several proteins, such as CD13, Syndecan-1 and stage-specific embryonal antigens (SSEAs), as being differentially expressed on murine and human CD49f(+) TROP2(+) basal prostate progenitor cells. Transplantation experiments suggest that CD49f(+) TROP2(high) SSEA-4(high) human prostate basal progenitor cells to be more potent to regenerate prostate tubules in vivo as compared with CD49f(+) TROP2(high) or CD49f(+) TROP2(high) SSEA-4(low) cells. Determination of the cell surface protein profile of functionally defined murine and human basal prostate progenitor cells reveals differentially expressed proteins that may change the potency and regenerative function of epithelial progenitor cells within the prostate. SSEA-4 is a candidate cell surface marker that putatively enables a more accurate identification of the basal PESC lineage. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Ursolic acid activates the apoptosis of prostate cancer via ROCK/PTEN mediated mitochondrial translocation of cofilin-1

PubMed Central

Mu, Dawei; Zhou, Gaobiao; Li, Jianye; Su, Bin; Guo, Heqing

2018-01-01

Ursolic acid has various pharmacological activities, and can reduce blood fat as well as having antihepatic, antitumoral, anti-inflammatory and antiviral properties. However, the pro-apoptotic mechanism by which ursolic acid influences human prostate cancer requires additional study. The aim of the present study was to assess whether ursolic acid activates the apoptosis of prostate cancer and to investigate the mechanism by which the Rho-associated protein kinase 1 (ROCK1)/phosphatase and tensin homolog (PTEN) signaling pathway performs a role in ursolic acid-mediated cofilin-1 to induce apoptosis in human prostate cancer. Firstly, the present study determined the pro-apoptotic mechanism by which ursolic acid influences the cell proliferation and apoptosis of human prostate LNCaP cancer cells. Caspase-3/9 activities and ROCK1, PTEN, Cofilin-1 and cytochrome c protein expression levels were also analyzed. In the present study, it is reported that the pro-apoptotic mechanism of ursolic acid potently suppressed the cell proliferation of human prostate LNCaP cancer cells. The present study revealed that the mediation of ROCK1/PTEN-cofilin-1/cytochrome c protein expression activates caspase-3/9 activities which subsequently induced the apoptosis of human prostate cancer cells. In conclusion, these findings demonstrated that ursolic acid activates the apoptosis of prostate cancer via ROCK/PTEN mediated cofilin-1/cytochrome c which mediated caspase-3/9 activities. PMID:29435058

Human Prostate Cancer Infiltrating Lymphocytes: Raft Microdomains, Signaling and Activation in Organ Cultures

DTIC Science & Technology

2006-06-01

and cell growth and differentiation (14). Increased ARG activity has long been detected in pa- tients with colon, breast , lung, and prostate cancer ...activity has long been detected in patients with colon, breast , lung and prostate cancer [23] and it was advanced that this enzymatic activity...AD_________________ Award Number: DAMD 17-03-01-0032 TITLE: Human Prostate Cancer Infiltrating

Bioenergetics of Stromal Cells as a Predictor of Aggressive Prostate Cancer

DTIC Science & Technology

2016-11-01

complex tissue preparations (human prostate and prostatic adenoma) and rat ventral prostate cells it was reported to exhibit high aerobic glycolysis [19...pyruvate dehydrogenase kinase), 2DG (inhibitor of hexokinase), or metformin (inhibitor of mitochondrial complex I) [41] as a therapeutic approach to... cyanide 4-(trifluoromethoxy) phenylhydrazone; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; GlyST, Glycolytic stress test; HPV, human papilloma virus

Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

USDA-ARS?s Scientific Manuscript database

With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling.

PubMed

Stoyanova, Tanya; Goldstein, Andrew S; Cai, Houjian; Drake, Justin M; Huang, Jiaoti; Witte, Owen N

2012-10-15

The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer.

Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling

PubMed Central

Stoyanova, Tanya; Goldstein, Andrew S.; Cai, Houjian; Drake, Justin M.; Huang, Jiaoti; Witte, Owen N.

2012-01-01

The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer. PMID:23070813

Selective targeting of bioengineered platelets to prostate cancer vasculature: new paradigm for therapeutic modalities

PubMed Central

Montecinos, Viviana P; Morales, Claudio H; Fischer, Thomas H; Burns, Sarah; San Francisco, Ignacio F; Godoy, Alejandro S; Smith, Gary J

2015-01-01

Androgen deprivation therapy (ADT) provides palliation for most patients with advanced prostate cancer (CaP); however, greater than 80% subsequently fail ADT. ADT has been indicated to induce an acute but transient destabilization of the prostate vasculature in animal models and humans. Human re-hydrated lyophilized platelets (hRL-P) were investigated as a prototype for therapeutic agents designed to target selectively the tumour-associated vasculature in CaP. The ability of hRL-P to bind the perturbed endothelial cells was tested using thrombin- and ADP-activated human umbilical vein endothelial cells (HUVEC), as well as primary xenografts of human prostate tissue undergoing acute vascular involution in response to ADT. hRL-P adhered to activated HUVEC in a dose-responsive manner. Systemically administered hRL-P, and hRL-P loaded with super-paramagnetic iron oxide (SPIO) nanoparticles, selectively targeted the ADT-damaged human microvasculature in primary xenografts of human prostate tissue. This study demonstrated that hRL-P pre-loaded with chemo-therapeutics or nanoparticles could provide a new paradigm for therapeutic modalities to prevent the rebound/increase in prostate vasculature after ADT, inhibiting the transition to castration-recurrent growth. PMID:25736582

Genome-Wide Analysis of Androgen Receptor Targets Reveals COUP-TF1 as a Novel Player in Human Prostate Cancer

PubMed Central

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR – COUP-TF1 – which could possibly play a role in human prostate cancer. PMID:23056316

Genome-wide analysis of androgen receptor targets reveals COUP-TF1 as a novel player in human prostate cancer.

PubMed

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR - COUP-TF1 - which could possibly play a role in human prostate cancer.

Obesity does not promote tumorigenesis of localized patient-derived prostate cancer xenografts

PubMed Central

Ascui, Natasha; Frydenberg, Mark; Risbridger, Gail P.; Taylor, Renea A.; Watt, Matthew J.

2016-01-01

There are established epidemiological links between obesity and the severity of prostate cancer. We directly tested this relationship by assessing tumorigenicity of patient-derived xenografts (PDXs) of moderate-grade localized prostate cancer in lean and obese severe combined immunodeficiency (SCID) mice. Mice were rendered obese and insulin resistant by high-fat feeding for 6 weeks prior to transplantation, and PDXs were assessed 10 weeks thereafter. Histological analysis of PDX grafts showed no differences in tumor pathology, prostate-specific antigen, androgen receptor and homeobox protein Nkx-3.1 expression, or proliferation index in lean versus obese mice. Whilst systemic obesity per se did not promote prostate tumorigenicity, we next asked whether the peri-prostatic adipose tissue (PPAT), which covers the prostate anteriorly, plays a role in prostate tumorigenesis. In vitro studies in a cellularized co-culture model of stromal and epithelial cells demonstrated that factors secreted from human PPAT are pro-tumorigenic. Accordingly, we recapitulated the prostate-PPAT spatial relationship by co-grafting human PPAT with prostate cancer in PDX grafts. PDX tissues were harvested 10 weeks after grafting, and histological analysis revealed no evidence of enhanced tumorigenesis with PPAT compared to prostate cancer grafts alone. Altogether, these data demonstrate that prostate cancer tumorigenicity is not accelerated in the setting of diet-induced obesity or in the presence of human PPAT, prompting the need for further work to define the at-risk populations of obesity-driven tumorigenesis and the biological factors linking obesity, adipose tissue and prostate cancer pathogenesis. PMID:27351281

Pubic Bone Osteomyelitis after Salvage High-Intensity Focused Ultrasound for Prostate Cancer

PubMed Central

Robison, Christopher M.; Gor, Ronak A.; Metro, Michael J.

2014-01-01

High-intensity focused ultrasound can be used for the primary treatment of prostate cancer and biochemical recurrence after radical prostatectomy or radiation. Complications of high-intensity focused ultrasound include urinary retention, urethral stenosis, stress incontinence, urinary tract infections, dysuria, impotence, and rarely, rectourethral or rectovesicular fistula. We describe a patient presenting with urinary retention, urinary tract infections and intermittent stress incontinence, later found to be associated with pubic bone osteomyelitis stemming from a prostatopubic fistula. PMID:24917777

Role of miR-452-5p in the tumorigenesis of prostate cancer: A study based on the Cancer Genome Atl(TCGA), Gene Expression Omnibus (GEO), and bioinformatics analysis.

PubMed

Gao, Li; Zhang, Li-Jie; Li, Sheng-Hua; Wei, Li-Li; Luo, Bin; He, Rong-Quan; Xia, Shuang

2018-03-06

MiR-452-5p has been reported to be down-regulated in prostate cancer, affecting the development of this type of cancer. However, the molecular mechanism of miR-452-5p in prostate cancer remains unclear. Therefore, we investigated the network of target genes of miR-452-5p in prostate cancer using bioinformatics analyses. We first analyzed the expression profiles and prognostic value of miR-452-5p in prostate cancer tissues from a public database. Gene Ontology (GO), the Kyoto Encyclopedia of Genes and Genomes (KEGG), PANTHER pathway analyses, and a disease ontology (DG) analysis were performed to find the molecular functions of the target genes from GSE datasets and miRWalk. Finally, we validated hub genes from the protein-protein interaction (PPI) networks of the target genes in the Human Protein Atlas (HPA) database and Gene Expression Profiling Interactive Analysis (GEPIA). Narrowing down the optimal target genes was conducted by seeking the common parts of up-regulated genes from GEPIA, down-regulated genes from GSE datasets, and predicted genes in miRWalk. Based on mining of GEO and ArrayExpress microarray chips and miRNA-Seq data in the TCGA database, which includes 1007 prostate cancer samples and 387 non-cancer samples, miR-452-5p is shown to be down-regulated in prostate cancer. GO, KEGG, and PANTHER pathway analyses suggested that the target genes might participate in important biological processes, such as transforming growth factor beta signaling and the positive regulation of brown fat cell differentiation and mesenchymal cell differentiation, as well as the Ras signaling pathway and pathways regulating the pluripotency of stem cells and arrhythmogenic right ventricular cardiomyopathy (ARVC). Nine genes-GABBR, PNISR, NTSR1, DOCK1, EREG, SFRP1, PTGS2, LEF1, and BMP2-were defined as hub genes in the PPI network. Three genes-FAM174B, SLC30A4, and SLIT1-were jointly shared by GEPIA, the GSE datasets, and miRWalk. Down-regulated miR-452-5p might play an essential role in the tumorigenesis of prostate cancer. Copyright © 2018. Published by Elsevier GmbH.

Induction of murine embryonic stem cell differentiation by medicinal plant extracts.

PubMed

Reynertson, Kurt A; Charlson, Mary E; Gudas, Lorraine J

2011-01-01

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. Copyright © 2010 Elsevier Inc. All rights reserved.

A new serially transplantable human prostatic cancer (HONDA) in nude mice.

PubMed

Ito, Y Z; Nakazato, Y

1984-08-01

A new serially transplantable human prostatic cancer (HONDA) in nude mice was established from a patient with metastatic prostate carcinoma. The tumor grows well in male nude mice. Doubling time of the tumor weight at passage #13 was 9.5 +/- 0.87 days (mean +/- SD). The tumor retains the original histological features of adenocarcinoma even after 6 years of continuous passage. High levels of human prostatic acid phosphatase were detected by radioimmunoassay in sera from the tumor-bearing mice. The tumor cells contain human prostate specific antigen. Electron microscopy showed particles resembling type A retroviruses in cisterns of endoplasmic reticulum, and particles resembling type C retroviruses in the intercellular space of the tumor cells. The tumor grew well in female mice treated with testosterone, but not in untreated female mice or castrated male mice.

Stepwise immortalization and transformation of adult human prostate epithelial cells by a combination of HPV-18 and v-Ki-ras.

PubMed Central

Rhim, J S; Webber, M M; Bello, D; Lee, M S; Arnstein, P; Chen, L S; Jay, G

1994-01-01

Recent investigations have shown the presence of ras gene mutations and human papillomavirus (HPV) DNA in prostate carcinomas. In the present study, secondary adult human prostatic epithelial cells, upon transfection with a plasmid containing the entire HPV-18 genome, acquired an indefinite life-span in culture but did not undergo malignant conversion. Subsequent infection of these immortalized cells with the Kirsten murine sarcoma virus, which contains an activated Ki-ras oncogene, induced morphological transformation that led to the acquisition of neoplastic properties. These findings demonstrate the malignant transformation of adult human prostate epithelial cells in culture by a combination of viral oncogenes and the successive roles of HPV infection and Ki-ras activation in a multistep process responsible for prostate carcinogenesis. Images PMID:7991549

Sca-1 Identifies a Distinct Androgen-Independent Murine Prostatic Luminal Cell Lineage with Bipotent Potential

PubMed Central

Kwon, Oh-Joon; Zhang, Li; Xin, Li

2016-01-01

Recent lineage tracing studies support the existence of prostate luminal progenitors that possess extensive regenerative capacity, but their identity remains unknown. We show that Sca-1 (Stem Cell Antigen-1) identifies a small population of murine prostate luminal cells that reside in the proximal prostatic ducts adjacent to the urethra. Sca-1+ luminal cells do not express Nkx3.1. They do not carry the secretory function, although they express the androgen receptor. These cells are enriched in the prostates of castrated mice. In the in vitro prostate organoid assay, a small fraction of the Sca-1+ luminal cells are capable of generating budding organoids that are morphologically distinct from those derived from other cell lineages. Histologically, this type of organoid is composed of multiple inner layers of luminal cells surrounded by multiple outer layers of basal cells. When passaged, these organoids retain their morphological and histological features. Finally, the Sca-1+ luminal cells are capable of forming small prostate glands containing both basal and luminal cells in an in vivo prostate regeneration assay. Collectively, our study establishes the androgen-independent and bipotent organoid-forming Sca-1+ luminal cells as a functionally distinct cellular entity. These cells may represent a putative luminal progenitor population and serve as a cellular origin for castration resistant prostate cancer. PMID:26418304

Gene expression profile of mouse prostate tumors reveals dysregulations in major biological processes and identifies potential murine targets for preclinical development of human prostate cancer therapy.

PubMed

Haram, Kerstyn M; Peltier, Heidi J; Lu, Bin; Bhasin, Manoj; Otu, Hasan H; Choy, Bob; Regan, Meredith; Libermann, Towia A; Latham, Gary J; Sanda, Martin G; Arredouani, Mohamed S

2008-10-01

Translation of preclinical studies into effective human cancer therapy is hampered by the lack of defined molecular expression patterns in mouse models that correspond to the human counterpart. We sought to generate an open source TRAMP mouse microarray dataset and to use this array to identify differentially expressed genes from human prostate cancer (PCa) that have concordant expression in TRAMP tumors, and thereby represent lead targets for preclinical therapy development. We performed microarrays on total RNA extracted and amplified from eight TRAMP tumors and nine normal prostates. A subset of differentially expressed genes was validated by QRT-PCR. Differentially expressed TRAMP genes were analyzed for concordant expression in publicly available human prostate array datasets and a subset of resulting genes was analyzed by QRT-PCR. Cross-referencing differentially expressed TRAMP genes to public human prostate array datasets revealed 66 genes with concordant expression in mouse and human PCa; 56 between metastases and normal and 10 between primary tumor and normal tissues. Of these 10 genes, two, Sox4 and Tubb2a, were validated by QRT-PCR. Our analysis also revealed various dysregulations in major biologic pathways in the TRAMP prostates. We report a TRAMP microarray dataset of which a gene subset was validated by QRT-PCR with expression patterns consistent with previous gene-specific TRAMP studies. Concordance analysis between TRAMP and human PCa associated genes supports the utility of the model and suggests several novel molecular targets for preclinical therapy.

EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells.

PubMed

Chen, Peijie; Huang, Yan; Zhang, Bo; Wang, Qiuquan; Bai, Peiming

2014-07-01

EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro . Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer.

Role of the ARF Tumor Suppressor in Prostate Cancer

DTIC Science & Technology

2005-10-01

found that ARF expression is absence from highly proliferative prostate adenocarcinomas and this correlates with the increased expression of the p53...prostate is unknown. The preliminary data for my orginal proposal indicated that prostate adenocarcinomas typically maintain wild type p53 (97%), but...independent mechanisms to regulate prostate cell proliferation. Table 1. Protein Expression in Prostate Adenocarcinomas Human prostate tissue samples

[Bone marrow mesenchymal stem cells suppress E coli-induced bacterial prostatitis in rats].

PubMed

Han, Guang-wei; Liu, Cheng-cheng; Gao, Wen-hong; Cui, Dong; Yi, Shan-hong

2015-04-01

To investigate the inhibitory effect of bone marrow mesenchymal stem cells (BMSCs) on E coliinduced prostatitis in rats. BMSCs were isolated, cultured and amplified by the attached choice method. Fifty SD rats were randomized into five groups of equal number: normal control, acute bacterial prostatitis (ABP) , chronic bacterial prostatitis (CBP), ABP + BMSCs, and CBP + BMSCs, and the animals in the latter four groups were injected with E. coli into both sides of the prostate under ultrasound guidance for 1 - 14 days to induce ABP and for 4 - 12 weeks to induce CBP. The control rats were injected with the same amount of PBS. Two weeks after injection of BMSCs into the prostates, pathomorphological changes in the prostate were observed under the light microscope and the mRNA and protein levels of IL-1β and TNF-α determined by RT-PCR and ELISA, respectively, followed by statistical analysis with SPSS 18.0. Histopathological evaluation showed typical pathological inflammatory changes in the prostates of the rats in the ABP and CBP groups, including glandular structural changes, interstitial edema, inflammatory cell infiltration, and fibrous hyperplasia, which were all remarkably relieved after treated with BMSCs. The mRNA and protein levels of IL-β ([0.829 ± 0.121] and [271.75 ± 90.59] pg/ml) and TNF-α ([0.913 ± 0. 094] and [105.78 ± 19. 05] pg/ml) in the ABP and those of IL-1β ([0. 975 ± 0. 114] and [265. 31 ± 71. 34] pg/ml) and TNF-α ([0. 886 ± 0. 084] and [107. 45 ± 26. 11 ] pg/ml) in the CBP groups were significantly higher than those in the control rats ([0. 342 ± 0.087] and [45.76 17. 99] pg/ml, P <0. 05); ([0.247 ± 0.054] and ([19.42 ± 7. 75] pg/ml, P <0. 01) as well as than those in the ABP + BMSCs ([0. 433 ± 0. 072] and [51. 34 ± 22. 13] pg/ml, P < 0. 05 ) ; ( [0. 313 ± 0. 076] and [28. 38 ± 8. 78] pg/ml, P < 0. 01) and the CBP + BMSCs group ([0.396 ± 0.064] and [56.37 ± 21.22] pg/ml, P <0.05); ([0.417 ± 0.068] and [29.21 ± 10.22] pg/ml, P <0.01). Injection of BMSCs can reduce E coli-induced prostatic inflammation reaction, which.may be associated with its reduction of inflammatory cell infiltration and the expressions of IL-1β and TNF-α in the prostate tissue.

Primary Xenografts of Human Prostate Tissue as a Model to Study Angiogenesis Induced by Reactive Stroma

PubMed Central

Montecinos, Viviana P.; Godoy, Alejandro; Hinklin, Jennifer; Vethanayagam, R. Robert; Smith, Gary J.

2012-01-01

Characterization of the mechanism(s) of androgen-driven human angiogenesis could have significant implications for modeling new forms of anti-angiogenic therapies for CaP and for developing targeted adjuvant therapies to improve efficacy of androgen-deprivation therapy. However, models of angiogenesis by human endothelial cells localized within an intact human prostate tissue architecture are until now extremely limited. This report characterizes the burst of angiogenesis by endogenous human blood vessels in primary xenografts of fresh surgical specimens of benign prostate or prostate cancer (CaP) tissue that occurs between Days 6–14 after transplantation into SCID mice pre-implanted with testosterone pellets. The wave of human angiogenesis was preceded by androgen-mediated up-regulation of VEGF-A expression in the stromal compartment. The neo-vessel network anastomosed to the host mouse vascular system between Days 6–10 post-transplantation, the angiogenic response ceased by Day 15, and by Day 30 the vasculature had matured and stabilized, as indicated by a lack of leakage of serum components into the interstitial tissue space and by association of nascent endothelial cells with mural cells/pericytes. The angiogenic wave was concurrent with the appearance of a reactive stroma phenotype, as determined by staining for α-SMA, Vimentin, Tenascin, Calponin, Desmin and Masson's trichrome, but the reactive stroma phenotype appeared to be largely independent of androgen availability. Transplantation-induced angiogenesis by endogenous human endothelial cells present in primary xenografts of benign and malignant human prostate tissue was preceded by induction of androgen-driven expression of VEGF by the prostate stroma, and was concurrent with and the appearance of a reactive stroma phenotype. Androgen-modulated expression of VEGF-A appeared to be a causal regulator of angiogenesis, and possibly of stromal activation, in human prostate xenografts. PMID:22303438

Molecular effects of soy phytoalexin glyceollins in human prostate cancer cells LNCaP

USDA-ARS?s Scientific Manuscript database

Glyceollins are soy–derived phytoalexins that have been proposed to be candidate cancer preventive compounds. The effect of the glyceollins on prostate cancer is unknown. The present study examined the molecular effects of soy phytoalexins, glyceollins, on the human prostate cancer cell line LNCaP t...

Hypoexpression and epigenetic regulation of candidate tumor suppressor gene CADM-2 in human prostate cancer.

PubMed

Chang, Guimin; Xu, Shuping; Dhir, Rajiv; Chandran, Uma; O'Keefe, Denise S; Greenberg, Norman M; Gingrich, Jeffrey R

2010-11-15

Cell adhesion molecules (CADM) comprise a newly identified protein family whose functions include cell polarity maintenance and tumor suppression. CADM-1, CADM-3, and CADM-4 have been shown to act as tumor suppressor genes in multiple cancers including prostate cancer. However, CADM-2 expression has not been determined in prostate cancer. The CADM-2 gene was cloned and characterized and its expression in human prostatic cell lines and cancer specimens was analyzed by reverse transcription-PCR and an immunohistochemical tissue array, respectively. The effects of adenovirus-mediated CADM-2 expression on prostate cancer cells were also investigated. CADM-2 promoter methylation was evaluated by bisulfite sequencing and methylation-specific PCR. We report the initial characterization of CADM-2 isoforms: CADM-2a and CADM-2b, each with separate promoters, in human chromosome 3p12.1. Prostate cancer cell lines, LNCaP and DU145, expressed negligible CADM-2a relative to primary prostate tissue and cell lines, RWPE-1 and PPC-1, whereas expression of CADM-2b was maintained. Using immunohistochemistry, tissue array results from clinical specimens showed statistically significant decreased expression in prostate carcinoma compared with normal donor prostate, benign prostatic hyperplasia, prostatic intraepithelial neoplasia, and normal tissue adjacent to tumor (P < 0.001). Adenovirus-mediated CADM-2a expression suppressed DU145 cell proliferation in vitro and colony formation in soft agar. The decrease in CADM-2a mRNA in cancer cell lines correlated with promoter region hypermethylation as determined by bisulfite sequencing and methylation-specific PCR. Accordingly, treatment of cells with the demethylating agent 5-aza-2'-deoxycytidine alone or in combination with the histone deacetylase inhibitor trichostatin A resulted in the reactivation of CADM-2a expression. CADM-2a protein expression is significantly reduced in prostate cancer. Its expression is regulated in part by promoter methylation and implicates CADM-2 as a previously unrecognized tumor suppressor gene in a proportion of human prostate cancers. ©2010 AACR.

Inhibitory Ah Receptor-Androgen Receptor Crosstalk in Prostate Cancer

DTIC Science & Technology

2006-02-01

Development of a hammerhead ribozyme against bcl-2. I. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate...therapeutic implications, N. Engl. J. Med. 285 (1971) 1182–1186. [14] T. Dorai, C.A. Olsson, A.E. Katz, R. Buttyan, Development of a hammerhead ... ribozyme against bcl-2. I. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate cancer, Prostate 32 (1997) 246

Tumorigenic Potential of Transit Amplifying Prostate Cells

DTIC Science & Technology

2012-06-01

by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

COX-2 and Prostate Cancer Angiogenesis

DTIC Science & Technology

2001-03-01

the optimal dosing and timing of a COX-2 inhibitor (NS398) in an animal model of human prostate cancer, (2)and (3) the mechanisms underlying the...cancer tissues (14) and that a COX-2 inhibitor selectively induces apoptosis in a prostate cancer cell line (15). We also demonstrated that treatment of...human prostate tumor-bearing mice with a selective COX-2 inhibitor (NS-398) significantly reduces tumor size, microvessel density and levels of a

Polyprenylated polycyclic acylphloroglucinol: Angiogenesis inhibitor from Garcinia multiflora.

PubMed

Cheng, Lin-Yang; Chen, Chun-Lin; Kuo, Yueh-Hsiung; Chang, Tsung-Hsien; Lin, I-Wei; Wang, Shih-Wei; Chung, Mei-Ing; Chen, Jih-Jung

2018-06-01

A new polyprenylated polycyclic acylphloroglucinol, garcimultiflorone K (1), has been isolated from the stems of Garcinia multiflora, together with two known compounds, garcimultiflorone A (2) and garcimultiflorone B (3). The structure of new compound 1 was determined through spectroscopic methods including 1D and 2D NMR and MS analyses. The anti-angiogenic and anti-cancer effects of compounds 1-3 were evaluated in human endothelial progenitor cells (EPCs) and cancer cells. Of these, garcimultiflorone K (1) displayed the most potent anti-angiogenic property by suppressing cell growth and tube formation of EPCs. Compound 1 also exhibited growth-inhibitory activities against human hepatocellular carcinoma cell line SK-Hep-1 and hormone refractory prostate cancer cell line PC-3 with GI 50 values of 4.3 ± 1.6 and 6.6 ± 0.4 μM, respectively. Copyright © 2018 Elsevier Ltd. All rights reserved.

Histologic evaluation of human benign prostatic hyperplasia treated by dutasteride: a study by xenograft model with improved severe combined immunodeficient mice.

PubMed

Tsujimura, Akira; Fukuhara, Shinichiro; Soda, Tetsuji; Takezawa, Kentaro; Kiuchi, Hiroshi; Takao, Tetsuya; Miyagawa, Yasushi; Nonomura, Norio; Adachi, Shigeki; Tokita, Yoriko; Nomura, Taisei

2015-01-01

To evaluate histologic change in human prostate samples treated with dutasteride and to elucidate direct effects of dutasteride on human prostate tissue, the present study was conducted by using a xenograft model with improved severe combined immunodeficient (super-SCID) mice, although it is well known that dutasteride reduces prostate volume. After establishment of a xenograft model of human benign prostatic hyperplasia in morphology and function, samples implanted into super-SCID mice with and without dutasteride were evaluated pathohistologically at 2 and 6 months after initiation of dutasteride administration. The proliferative index evaluated by Ki-67 staining was significantly lower in the dutasteride group than the control at 2 and 6 months after administration. Apoptotic index evaluated by the terminal transferase TdT-mediated dUTP-biotin nick end labeling staining was higher in the dutasteride group than the control at 2 and 6 months after administration. Quick scores in the dutasteride group for staining of both cyclooxygenase-2 (Cox-2) and Ras homolog gene family, member A (RhoA) were significantly lower than those in the control group at 2 and 6 months after administration. Dutasteride inhibits cell proliferation and induces apoptosis of prostatic cells, causing a reduced prostate volume. Furthermore, decreased expression of Cox-2 and RhoA within benign prostatic hyperplasia tissue by dutasteride may induce an early effect on improvement of lower urinary tract symptoms, probably by attenuating inflammation reaction of the prostate and decreasing intraurethral pressure, other than the mechanism of reduced prostate volume. Copyright © 2015 Elsevier Inc. All rights reserved.

The HDL receptor SR-BI is associated with human prostate cancer progression and plays a possible role in establishing androgen independence.

PubMed

Schörghofer, David; Kinslechner, Katharina; Preitschopf, Andrea; Schütz, Birgit; Röhrl, Clemens; Hengstschläger, Markus; Stangl, Herbert; Mikula, Mario

2015-08-07

Human prostate cancer represents one of the most frequently diagnosed cancers in men worldwide. Currently, diagnostic methods are insufficient to identify patients at risk for aggressive prostate cancer, which is essential for early treatment. Recent data indicate that elevated cholesterol levels in the plasma are a prerequisite for the progression of prostate cancer. Here, we analyzed clinical prostate cancer samples for the expression of receptors involved in cellular cholesterol uptake. We screened mRNA microarray files of prostate cancer samples for alterations in the expression levels of cholesterol transporters. Furthermore, we performed immunohistochemistry analysis on human primary prostate cancer tissue sections derived from patients to investigate the correlation of SR-BI with clinicopathological parameters and the mTOR target pS6. In contrast to LDLR, we identified SR-BI mRNA and protein expression to be induced in high Gleason grade primary prostate cancers. Histologic analysis of prostate biopsies revealed that 53.6 % of all cancer samples and none of the non-cancer samples showed high SR-BI staining intensity. The disease-free survival time was reduced (P = 0.02) in patients expressing high intra-tumor levels of SR-BI. SR-BI mRNA correlated with HSD17B1 and HSD3B1 and SR-BI protein staining showed correlation with active ribosomal protein S6 (RS = 0.828, P < 0.00001). We identified SR-BI to indicate human prostate cancer formation, suggesting that increased levels of SR-BI may be involved in the generation of a castration-resistant phenotype.

Antiproliferative and Anti-inflammatory Withanolides from Physalis angulata.

PubMed

Sun, Cheng-Peng; Qiu, Chong-Yue; Yuan, Ting; Nie, Xiu-Fang; Sun, Hong-Xin; Zhang, Qian; Li, Hui-Xiang; Ding, Li-Qin; Zhao, Feng; Chen, Li-Xia; Qiu, Feng

2016-06-24

Sixteen new withanolides, physangulatins A-N (1-14) and withaphysalins Y and Z (15 and 16), as well as 12 known analogues, were isolated from the stems and leaves of Physalis angulata L. Their structures were established using extensive spectroscopic data analyses. The absolute configurations of 1 and 9 were assigned via X-ray crystallography. The isolated compounds were tested for their antiproliferative effects against human prostate cancer cells (C4-2B and 22Rvl), human renal carcinoma cells (786-O, A-498, and ACHN), and human melanoma cells (A375-S2), as well as inhibitory effects on NO production induced by LPS in macrophages. Compounds 9, 17, 20, 21, 25, and 27 showed antiproliferative effects against all tested cancer cells, with IC50 values of 0.18-7.43 μM. Compounds 3-5, 9-11, 17, 20-22, 24, 25, and 27 displayed inhibitory effects against NO production, with IC50 values of 1.36-11.59 μM.

Identification of Novel Prognostic Genetic Markers in Prostate Cancer

DTIC Science & Technology

2000-02-01

alterations in two normal- and three malignant-derived prostate epithelial cell lines immortalized with the E6 and E7 transforming genes of human papilloma virus (HPV...malignant-derived prostate epithelial cell lines immortalized with the E6 and E7 transforming genes of human papilloma virus (HPV) 16. These studies...transforming genes of human papilloma virus (HPV) 16 (13). The cell lines demonstrated several numerical and structural chromosomal alterations

Expression and localization of GLUT1 and GLUT12 in prostate carcinoma.

PubMed

Chandler, Jenalle D; Williams, Elizabeth D; Slavin, John L; Best, James D; Rogers, Suzanne

2003-04-15

Increased glucose consumption is a characteristic of malignant cells and in prostate carcinoma is associated with the proliferation of both androgen-dependent and independent cells. Transport of polar glucose across the nonpolar membrane relies on glucose transporter proteins, known as GLUTs. Increased expression of GLUT1 is a characteristic of many malignant cells. The authors characterized and cloned the cDNA for a novel glucose transporter, GLUT12, which was identified initially in malignant breast epithelial cells. To the authors' knowledge, there have been no reports on the expression of glucose transporters in the human prostate or human prostate carcinoma cells. The authors evaluated GLUT1 and GLUT12 expression in human prostate carcinoma cells. Reverse transcription-polymerase chain reaction was performed on total RNA extracted from cultured prostate carcinoma cells LNCaP, C4, C4-2, and C4-2B using primers to amplify GLUT1, GLUT12, or the housekeeping gene, 36B4. Total protein extracted from prostate carcinoma cell lines was assessed for GLUT12 protein by Western blot analysis. Cultured cell monolayers were incubated with antibodies to GLUT1 or GLUT12 and a peripheral Golgi protein, Golgi 58K, for detection by immunofluorescent confocal microscopy. Sections of benign prostatic hyperplasia and human prostate carcinoma were stained for immunohistochemical detection of GLUT1 and GLUT12. GLUT1 and GLUT12 mRNA and protein were detected in all cell lines evaluated. Immunofluorescence staining demonstrated both GLUT1 and GLUT12 on the plasma membrane and in the cytoplasm in all cultured prostate carcinoma cell lines, with GLUT1 but not GLUT12 appearing to colocalize with the Golgi. Immunohistochemical staining of benign prostatic hyperplasia indicated expression of GLUT1 but not GLUT12. Malignant tissue stained for GLUT12 but was negative for GLUT1. GLUT1 and GLUT12 are expressed in human prostate carcinoma cells. One possible rationale for the GLUT1 Golgi association is that it may supply glucose to the Golgi for byproduct incorporation into the prostatic secretory fluid. Further work will investigate the importance of glucose transport and GLUT1 and GLUT12 in prostate carcinoma cell growth. Copyright 2003 American Cancer Society.

Characterization of adenoviral transduction profile in prostate cancer cells and normal prostate tissue.

PubMed

Ai, Jianzhong; Tai, Phillip W L; Lu, Yi; Li, Jia; Ma, Hong; Su, Qin; Wei, Qiang; Li, Hong; Gao, Guangping

2017-09-01

Prostate diseases are common in males worldwide with high morbidity. Gene therapy is an attractive therapeutic strategy for prostate diseases, however, it is currently underdeveloped. As well known, adeno virus (Ad) is the most widely used gene therapy vector. The aims of this study are to explore transduction efficiency of Ad in prostate cancer cells and normal prostate tissue, thus further providing guidance for future prostate pathophysiological studies and therapeutic development of prostate diseases. We produced Ad expressing enhanced green fluorescence protein (EGFP), and characterized the transduction efficiency of Ad in both human and mouse prostate cancer cell lines in vitro, as well as prostate tumor xenograft, and wild-type mouse prostate tissue in vivo. Ad transduction efficiency was determined by EGFP fluorescence using microscopy and flow cytometry. Cell type-specific transduction was examined by immunofluorescence staining of cell markers. Our data showed that Ad efficiently transduced human and mouse prostate cancer cells in vitro in a dose dependent manner. Following intratumoral and intraprostate injection, Ad could efficiently transduce prostate tumor xenograft and the major prostatic cell types in vivo, respectively. Our findings suggest that Ad can efficiently transduce prostate tumor cells in vitro as well as xenograft and normal prostate tissue in vivo, and further indicate that Ad could be a potentially powerful toolbox for future gene therapy of prostate diseases. © 2017 Wiley Periodicals, Inc.

Conditionally reprogrammed normal and primary tumor prostate epithelial cells: a novel patient-derived cell model for studies of human prostate cancer

PubMed Central

Timofeeva, Olga A.; Palechor-Ceron, Nancy; Li, Guanglei; Yuan, Hang; Krawczyk, Ewa; Zhong, Xiaogang; Liu, Geng; Upadhyay, Geeta; Dakic, Aleksandra; Yu, Songtao; Fang, Shuang; Choudhury, Sujata; Zhang, Xueping; Ju, Andrew; Lee, Myeong-Seon; Dan, Han C.; Ji, Youngmi; Hou, Yong; Zheng, Yun-Ling; Albanese, Chris; Rhim, Johng; Schlegel, Richard; Dritschilo, Anatoly; Liu, Xuefeng

2017-01-01

Our previous study demonstrated that conditional reprogramming (CR) allows the establishment of patient-derived normal and tumor epithelial cell cultures from a variety of tissue types including breast, lung, colon and prostate. Using CR, we have established matched normal and tumor cultures, GUMC-29 and GUMC-30 respectively, from a patient's prostatectomy specimen. These CR cells proliferate indefinitely in vitro and retain stable karyotypes. Most importantly, only tumor-derived CR cells (GUMC-30) produced tumors in xenografted SCID mice, demonstrating maintenance of the critical tumor phenotype. Characterization of cells with DNA fingerprinting demonstrated identical patterns in normal and tumor CR cells as well as in xenografted tumors. By flow cytometry, both normal and tumor CR cells expressed basal, luminal, and stem cell markers, with the majority of the normal and tumor CR cells expressing prostate basal cell markers, CD44 and Trop2, as well as luminal marker, CD13, suggesting a transit-amplifying phenotype. Consistent with this phenotype, real time RT-PCR analyses demonstrated that CR cells predominantly expressed high levels of basal cell markers (KRT5, KRT14 and p63), and low levels of luminal markers. When the CR tumor cells were injected into SCID mice, the expression of luminal markers (AR, NKX3.1) increased significantly, while basal cell markers dramatically decreased. These data suggest that CR cells maintain high levels of proliferation and low levels of differentiation in the presence of feeder cells and ROCK inhibitor, but undergo differentiation once injected into SCID mice. Genomic analyses, including SNP and INDEL, identified genes mutated in tumor cells, including components of apoptosis, cell attachment, and hypoxia pathways. The use of matched patient-derived cells provides a unique in vitro model for studies of early prostate cancer. PMID:28009986

O-Glycosylation-mediated signaling circuit drives metastatic castration-resistant prostate cancer.

PubMed

Tzeng, Sheue-Fen; Tsai, Chin-Hsien; Chao, Tai-Kuang; Chou, Yu-Ching; Yang, Yu-Chih; Tsai, Mong-Hsun; Cha, Tai-Lung; Hsiao, Pei-Wen

2018-06-15

Disseminated castration-resistant prostate cancer (CRPC) is a common disease in men that is characterized by limited survival and resistance to androgen-deprivation therapy. The increase in human epidermal growth factor receptor 2 (HER2) signaling contributes to androgen receptor activity in a subset of patients with CRPC; however, enigmatically, HER2-targeted therapies have demonstrated a lack of efficacy in patients with CRPC. Aberrant glycosylation is a hallmark of cancer and involves key processes that support cancer progression. Using transcriptomic analysis of prostate cancer data sets, histopathologic examination of clinical specimens, and in vivo experiments of xenograft models, we reveal in this study a coordinated increase in glycan-binding protein, galectin-4, specific glycosyltransferases of core 1 synthase, glycoprotein- N-acetylgalactosamine 3-β-galactosyltransferase 1 (C1GALT1) and ST3 beta-galactoside α-2,3-sialyltransferase 1 (ST3GAL1), and resulting mucin-type O-glycans during the progression of CRPC. Furthermore, galectin-4 engaged with C1GALT1-dependent O-glycans to promote castration resistance and metastasis by activating receptor tyrosine kinase signaling and cancer cell stemness properties mediated by SRY-box 9 (SOX9). This galectin-glycan interaction up-regulated the MYC-dependent expression of C1GALT1 and ST3GAL1, which altered cellular mucin-type O-glycosylation to allow for galectin-4 binding. In clinical prostate cancer, high-level expression of C1GALT1 and galectin-4 together predict poor overall survival compared with low-level expression of C1GALT1 and galectin-4. In summary, MYC regulates abnormal O-glycosylation, thus priming cells for binding to galectin-4 and downstream signaling, which promotes castration resistance and metastasis.-Tzeng, S.-F., Tsai, C.-H., Chao, T.-K., Chou, Y.-C., Yang, Y.-C., Tsai, M.-H., Cha, T.-L., Hsiao, P.-W. O-Glycosylation-mediated signaling circuit drives metastatic castration-resistant prostate cancer.

Engineering a humanized bone organ model in mice to study bone metastases.

PubMed

Martine, Laure C; Holzapfel, Boris M; McGovern, Jacqui A; Wagner, Ferdinand; Quent, Verena M; Hesami, Parisa; Wunner, Felix M; Vaquette, Cedryck; De-Juan-Pardo, Elena M; Brown, Toby D; Nowlan, Bianca; Wu, Dan Jing; Hutmacher, Cosmo Orlando; Moi, Davide; Oussenko, Tatiana; Piccinini, Elia; Zandstra, Peter W; Mazzieri, Roberta; Lévesque, Jean-Pierre; Dalton, Paul D; Taubenberger, Anna V; Hutmacher, Dietmar W

2017-04-01

Current in vivo models for investigating human primary bone tumors and cancer metastasis to the bone rely on the injection of human cancer cells into the mouse skeleton. This approach does not mimic species-specific mechanisms occurring in human diseases and may preclude successful clinical translation. We have developed a protocol to engineer humanized bone within immunodeficient hosts, which can be adapted to study the interactions between human cancer cells and a humanized bone microenvironment in vivo. A researcher trained in the principles of tissue engineering will be able to execute the protocol and yield study results within 4-6 months. Additive biomanufactured scaffolds seeded and cultured with human bone-forming cells are implanted ectopically in combination with osteogenic factors into mice to generate a physiological bone 'organ', which is partially humanized. The model comprises human bone cells and secreted extracellular matrix (ECM); however, other components of the engineered tissue, such as the vasculature, are of murine origin. The model can be further humanized through the engraftment of human hematopoietic stem cells (HSCs) that can lead to human hematopoiesis within the murine host. The humanized organ bone model has been well characterized and validated and allows dissection of some of the mechanisms of the bone metastatic processes in prostate and breast cancer.

Implications of pleiotrophin in human PC3 prostate cancer cell growth in vivo.

PubMed

Tsirmoula, Sotiria; Dimas, Kostas; Hatziapostolou, Maria; Lamprou, Margarita; Ravazoula, Panagiota; Papadimitriou, Evangelia

2012-10-01

Pleiotrophin (PTN) is a heparin-binding growth factor with diverse functions related to tumor growth, angiogenesis, and metastasis. Pleiotrophin seems to have a significant role in prostate cancer cell growth and to mediate the stimulatory actions of other factors that affect prostate cancer cell functions. However, all studies carried out up to date are in vitro, using different types of human prostate cancer cell lines. The aim of the present work was to study the role of endogenous PTN in human prostate cancer growth in vivo. For this purpose, human prostate cancer PC3 cells were stably transfected with a plasmid vector, bearing the antisense PTN sequence, in order to inhibit PTN expression (AS-PC3). Migration, apoptosis, and adhesion on osteoblastic cells were measured in vitro. In vivo, PC3 cells were s.c. injected into male NOD/SCID mice, and tumor growth, survival rates, angiogenesis, apoptosis, and the number of metastasis were estimated. Pleiotrophin depletion resulted in a decreased migration capability of AS-PC3 cells compared with the corresponding mock-transfected or the non-transfected PC3 cells, as well as increased apoptosis and decreased adhesiveness to osteoblastic cells in vitro. In prostate cancer NOD/SCID mouse xenografts, PTN depletion significantly suppressed tumor growth and angiogenesis and induced apoptosis of cancer cells. In addition, PTN depletion decreased the number of metastases, providing a survival benefit for the animals bearing AS-PC3 xenografts. Our data suggest that PTN is implicated in human prostate cancer growth in vivo and could be considered a potential target for the development of new therapeutic approaches for prostate cancer. © 2012 Japanese Cancer Association.

Human osteocalcin and bone sialoprotein mediating osteomimicry of prostate cancer cells: role of cAMP-dependent protein kinase A signaling pathway.

PubMed

Huang, Wen-Chin; Xie, Zhihui; Konaka, Hiroyuki; Sodek, Jaro; Zhau, Haiyen E; Chung, Leland W K

2005-03-15

Osteocalcin and bone sialoprotein are the most abundant noncollagenous bone matrix proteins expressed by osteoblasts. Surprisingly, osteocalcin and bone sialoprotein are also expressed by malignant but not normal prostate epithelial cells. The purpose of this study is to investigate how osteocalcin and bone sialoprotein expression is regulated in prostate cancer cells. Our investigation revealed that (a) human osteocalcin and bone sialoprotein promoter activities in an androgen-independent prostate cancer cell line of LNCaP lineage, C4-2B, were markedly enhanced 7- to 12-fold in a concentration-dependent manner by conditioned medium collected from prostate cancer and bone stromal cells. (b) Deletion analysis of human osteocalcin and bone sialoprotein promoter regions identified cyclic AMP (cAMP)-responsive elements (CRE) as the critical determinants for conditioned medium-mediated osteocalcin and bone sialoprotein gene expression in prostate cancer cells. Consistent with these results, the protein kinase A (PKA) pathway activators forskolin and dibutyryl cAMP and the PKA pathway inhibitor H-89, respectively, increased or repressed human osteocalcin and bone sialoprotein promoter activities. (c) Electrophoretic mobility shift assay showed that conditioned medium-mediated stimulation of human osteocalcin and bone sialoprotein promoter activities occurs through increased interaction between CRE and CRE-binding protein. (d) Conditioned medium was found to induce human osteocalcin and bone sialoprotein promoter activities via increased CRE/CRE-binding protein interaction in a cell background-dependent manner, with marked stimulation in selected prostate cancer but not bone stromal cells. Collectively, these results suggest that osteocalcin and bone sialoprotein expression is coordinated and regulated through cAMP-dependent PKA signaling, which may define the molecular basis of the osteomimicry exhibited by prostate cancer cells.

Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

2008-05-15

Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygenmore » species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.« less

Sulforaphane and TRAIL induce a synergistic elimination of advanced prostate cancer stem-like cells.

PubMed

Labsch, Sabrina; Liu, Li; Bauer, Nathalie; Zhang, Yiyao; Aleksandrowicz, Ewa; Gladkich, Jury; Schönsiegel, Frank; Herr, Ingrid

2014-05-01

Advanced androgen-independent prostate cancer (AIPC) is an aggressive malignancy with a poor prognosis. Apoptosis-resistant cancer stem cells (CSCs) have been identified in AIPC and are not eliminated by current therapeutics. Novel therapeutic options, which are currently being evaluated in patient studies, include TRAIL and the broccoli-derived isothiocyanate sulforaphane. Although neither agent targets normal cells, TRAIL induces apoptosis in most cancer cells, and sulforaphane eliminates CSCs. In this study, the established AIPC cell lines DU145 and PC3, with enriched CSC features, and primary patient-derived prostate CSCs were treated with sulforaphane and recombinant soluble TRAIL. We examined the effects of these drugs on NF-κB activity, self-renewal and differentiation potential, and stem cell signaling via spheroid- and colony-forming assays, FACS and western blot analyses, immunohistochemistry, and an antibody protein array in vitro and after xenotransplantation. We largely found a stronger effect of sulforaphane on CSC properties compared to TRAIL, though the agents acted synergistically when applied in combination. This was associated with the inhibition of TRAIL-induced NF-κB binding; CXCR4, Jagged1, Notch 1, SOX 2, and Nanog expression; ALDH1 activity inhibition; and the elimination of differentiation and self-renewal potential. In vivo, tumor engraftment and tumor growth were strongly inhibited, without the induction of liver necrosis or other obvious side effects. These findings suggest that sulforaphane shifts the balance from TRAIL-induced survival signals to apoptosis and thus explains the observed synergistic effect. A nutritional strategy for high sulforaphane intake may target the cancer-specific activity of TRAIL in CSCs.

Sulforaphane and TRAIL induce a synergistic elimination of advanced prostate cancer stem-like cells

PubMed Central

LABSCH, SABRINA; LIU, LI; BAUER, NATHALIE; ZHANG, YIYAO; ALEKSANDROWICZ, EWA; GLADKICH, JURY; SCHÖNSIEGEL, FRANK; HERR, INGRID

2014-01-01

Advanced androgen-independent prostate cancer (AIPC) is an aggressive malignancy with a poor prognosis. Apoptosis-resistant cancer stem cells (CSCs) have been identified in AIPC and are not eliminated by current therapeutics. Novel therapeutic options, which are currently being evaluated in patient studies, include TRAIL and the broccoli-derived isothiocyanate sulforaphane. Although neither agent targets normal cells, TRAIL induces apoptosis in most cancer cells, and sulforaphane eliminates CSCs. In this study, the established AIPC cell lines DU145 and PC3, with enriched CSC features, and primary patient-derived prostate CSCs were treated with sulforaphane and recombinant soluble TRAIL. We examined the effects of these drugs on NF-κB activity, self-renewal and differentiation potential, and stem cell signaling via spheroid- and colony-forming assays, FACS and western blot analyses, immunohistochemistry, and an antibody protein array in vitro and after xenotransplantation. We largely found a stronger effect of sulforaphane on CSC properties compared to TRAIL, though the agents acted synergistically when applied in combination. This was associated with the inhibition of TRAIL-induced NF-κB binding; CXCR4, Jagged1, Notch 1, SOX 2, and Nanog expression; ALDH1 activity inhibition; and the elimination of differentiation and self-renewal potential. In vivo, tumor engraftment and tumor growth were strongly inhibited, without the induction of liver necrosis or other obvious side effects. These findings suggest that sulforaphane shifts the balance from TRAIL-induced survival signals to apoptosis and thus explains the observed synergistic effect. A nutritional strategy for high sulforaphane intake may target the cancer-specific activity of TRAIL in CSCs. PMID:24626333

Enrichment of the Cancer Stem Phenotype in Sphere Cultures of Prostate Cancer Cell Lines Occurs through Activation of Developmental Pathways Mediated by the Transcriptional Regulator ΔNp63α

PubMed Central

Portillo-Lara, Roberto; Alvarez, Mario Moisés

2015-01-01

Background Cancer stem cells (CSC) drive prostate cancer tumor survival and metastasis. Nevertheless, the development of specific therapies against CSCs is hindered by the scarcity of these cells in prostate tissues. Suspension culture systems have been reported to enrich CSCs in primary cultures and cell lines. However, the molecular mechanisms underlying this phenomenon have not been fully explored. Methodology/Principal Findings We describe a prostasphere assay for the enrichment of CD133+ CSCs in four commercial PCa cell lines: 22Rv1, DU145, LNCaP, and PC3. Overexpression of CD133, as determined by flow cytometric analysis, correlated with an increased clonogenic, chemoresistant, and invasive potential in vitro. This phenotype is concordant to that of CSCs in vivo. Gene expression profiling was then carried out using the Cancer Reference panel and the nCounter system from NanoString Technologies. This analysis revealed several upregulated transcripts that can be further explored as potential diagnostic markers or therapeutic targets. Furthermore, functional annotation analysis suggests that ΔNp63α modulates the activation of developmental pathways responsible for the increased stem identity of cells growing in suspension cultures. Conclusions/Significance We conclude that profiling the genetic mechanisms involved in CSC enrichment will help us to better understand the molecular pathways that underlie CSC pathophysiology. This platform can be readily adapted to enrich and assay actual patient samples, in order to design patient-specific therapies that are aimed particularly against CSCs. PMID:26110651

Influence of the neural microenvironment on prostate cancer.

PubMed

Coarfa, Christian; Florentin, Diego; Putluri, NagiReddy; Ding, Yi; Au, Jason; He, Dandan; Ragheb, Ahmed; Frolov, Anna; Michailidis, George; Lee, MinJae; Kadmon, Dov; Miles, Brian; Smith, Christopher; Ittmann, Michael; Rowley, David; Sreekumar, Arun; Creighton, Chad J; Ayala, Gustavo

2018-02-01

Nerves are key factors in prostate cancer (PCa), but the functional role of innervation in prostate cancer is poorly understood. PCa induced neurogenesis and perineural invasion (PNI), are associated with aggressive disease. We denervated rodent prostates chemically and physically, before orthotopically implanting cancer cells. We also performed a human neoadjuvant clinical trial using botulinum toxin type A (Botox) and saline in the same patient, before prostatectomy. Bilateral denervation resulted in reduced tumor incidence and size in mice. Botox treatment in humans resulted in increased apoptosis of cancer cells in the Botox treated side. A similar denervation gene array profile was identified in tumors arising in denervated rodent prostates, in spinal cord injury patients and in the Botox treated side of patients. Denervation induced exhibited a signature gene profile, indicating translation and bioenergetic shutdown. Nerves also regulate basic cellular functions of non-neoplastic epithelial cells. Nerves play a role in the homeostasis of normal epithelial tissues and are involved in prostate cancer tumor survival. This study confirms that interactions between human cancer and nerves are essential to disease progression. This work may make a major impact in general cancer treatment strategies, as nerve/cancer interactions are likely important in other cancers as well. Targeting the neural microenvironment may represent a therapeutic approach for the treatment of human prostate cancer. © 2017 The Authors. The Prostate Published by Wiley Periodicals, Inc.

EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells

PubMed Central

CHEN, PEIJIE; HUANG, YAN; ZHANG, BO; WANG, QIUQUAN; BAI, PEIMING

2014-01-01

EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro. Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer. PMID:24959216

Inflammatory response of a prostate stromal cell line induced by Trichomonas vaginalis.

PubMed

Im, S J; Han, I H; Kim, J H; Gu, N Y; Seo, M Y; Chung, Y H; Ryu, J S

2016-04-01

While Trichomonas vaginalis, a cause of sexually transmitted infection, is known as a surface-dwelling protozoa, trichomonads have been detected in prostatic tissue from benign prostatic hyperplasia and prostatitis by immunoperoxidase assay or PCR. However, the immune response of prostate stromal cells infected with T. vaginalis has not been investigated. Our objective was to investigate whether T. vaginalis could induce an inflammatory response in prostate stromal cells. Incubation of a human prostate stromal myofibroblast cells (WPMY-1) with live T. vaginalis T016 increased expression of the inflammatory chemokines CXCL8 and CCL2. In addition, TLR4, ROS, MAPK and NF-κB expression increased, while inhibitors of TLR4, ROS, MAPKs and NF-κB reduced CXCL8 and CCL2 production. Medium conditioned by incubation of WPMY-1 cells with T. vaginalis stimulated the migration of human neutrophils and monocytes (THP-1 cells). We conclude that T. vaginalis increases CXCL8 and CCL2 production by human prostate stromal cells by activating TLR4, ROS, MAPKs and NF-κB, and this in turn attracts neutrophils and monocytes and leads to an inflammatory response. This study is the first attempt to demonstrate an inflammatory reaction in prostate stromal cells caused by T. vaginalis. © 2016 John Wiley & Sons Ltd.

PTK6 activation at the membrane regulates epithelial-mesenchymal transition in prostate cancer.

PubMed

Zheng, Yu; Wang, Zebin; Bie, Wenjun; Brauer, Patrick M; Perez White, Bethany E; Li, Jing; Nogueira, Veronique; Raychaudhuri, Pradip; Hay, Nissim; Tonetti, Debra A; Macias, Virgilia; Kajdacsy-Balla, André; Tyner, Angela L

2013-09-01

The intracellular tyrosine kinase protein tyrosine kinase 6 (PTK6) lacks a membrane-targeting SH4 domain and localizes to the nuclei of normal prostate epithelial cells. However, PTK6 translocates from the nucleus to the cytoplasm in human prostate tumor cells. Here, we show that while PTK6 is located primarily within the cytoplasm, the pool of active PTK6 in prostate cancer cells localizes to membranes. Ectopic expression of membrane-targeted active PTK6 promoted epithelial-mesenchymal transition in part by enhancing activation of AKT, thereby stimulating cancer cell migration and metastases in xenograft models of prostate cancer. Conversely, siRNA-mediated silencing of endogenous PTK6 promoted an epithelial phenotype and impaired tumor xenograft growth. In mice, PTEN deficiency caused endogenous active PTK6 to localize at membranes in association with decreased E-cadherin expression. Active PTK6 was detected at membranes in some high-grade human prostate tumors, and PTK6 and E-cadherin expression levels were inversely correlated in human prostate cancers. In addition, high levels of PTK6 expression predicted poor prognosis in patients with prostate cancer. Our findings reveal novel functions for PTK6 in the pathophysiology of prostate cancer, and they define this kinase as a candidate therapeutic target. Cancer Res; 73(17); 5426-37. ©2013 AACR.

Serum antibodies to huntingtin interacting protein-1: a new blood test for prostate cancer.

PubMed

Bradley, Sarah V; Oravecz-Wilson, Katherine I; Bougeard, Gaelle; Mizukami, Ikuko; Li, Lina; Munaco, Anthony J; Sreekumar, Arun; Corradetti, Michael N; Chinnaiyan, Arul M; Sanda, Martin G; Ross, Theodora S

2005-05-15

Huntingtin-interacting protein 1 (HIP1) is frequently overexpressed in prostate cancer. HIP1 is a clathrin-binding protein involved in growth factor receptor trafficking that transforms fibroblasts by prolonging the half-life of growth factor receptors. In addition to human cancers, HIP1 is also overexpressed in prostate tumors from the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse model. Here we provide evidence that HIP1 plays an important role in mouse tumor development, as tumor formation in the TRAMP mice was impaired in the Hip1null/null background. In addition, we report that autoantibodies to HIP1 developed in the sera of TRAMP mice with prostate cancer as well as in the sera from human prostate cancer patients. This led to the development of an anti-HIP1 serum test in humans that had a similar sensitivity and specificity to the anti-alpha-methylacyl CoA racemase (AMACR) and prostate-specific antigen tests for prostate cancer and when combined with the anti-AMACR test yielded a specificity of 97%. These data suggest that HIP1 plays a functional role in tumorigenesis and that a positive HIP1 autoantibody test may be an important serum marker of prostate cancer.

Progesterone receptor expression during prostate cancer progression suggests a role of this receptor in stromal cell differentiation.

PubMed

Yu, Yue; Yang, Ou; Fazli, Ladan; Rennie, Paul S; Gleave, Martin E; Dong, Xuesen

2015-07-01

The progesterone receptor, like the androgen receptor, belongs to the steroid receptor superfamily. Our previous studies have reported that the PR is expressed specifically in prostate stroma. PR inhibits proliferation of, and regulates cytokine secretion by stromal cells. However, PR protein expression in cancer-associated stroma during prostate cancer progression has not been profiled. Since the phenotypes of prostate stromal cells change dynamically as tumors progress, whether the PR plays a role in regulating stromal cell differentiation needs to be investigated. Immunohistochemistry assays measured PR protein levels on human prostate tissue microarrays containing 367 tissue cores from benign prostate, prostate tumors with different Gleason scores, tumors under various durations of castration therapy, and tumors at the castration-resistant stage. Immunoblotting assays determined whether PR regulated the expression of alpha smooth muscle actin (α-SMA), vimentin, and fibroblast specific protein (FSP) in human prostate stromal cells. PR protein levels decreased in cancer-associated stroma when compared with that in benign prostate stroma. This reduction in PR expression was not correlated with Gleason scores. PR protein levels were elevated by castration therapy, but reduced to pre-castration levels when tumors progressed to the castration-resistant stage. Enhanced PR expression in human prostate stromal cells increased α-SMA, but decreased vimentin and FSP protein levels ligand-independently. These results suggest that PR plays an active role in regulating stromal cell phenotypes during prostate cancer progression. © 2015 Wiley Periodicals, Inc.

Interaction between tumor cell surface receptor RAGE and proteinase 3 mediates prostate cancer metastasis to bone

PubMed Central

Kolonin, Mikhail G.; Sergeeva, Anna; Staquicini, Daniela I.; Smith, Tracey L.; Tarleton, Christy A.; Molldrem, Jeffrey J.; Sidman, Richard L.; Marchiò, Serena; Pasqualini, Renata; Arap, Wadih

2017-01-01

Human prostate cancer often metastasizes to bone, but the biological basis for such site-specific tropism remains largely unresolved. Recent work led us to hypothesize that this tropism may reflect pathogenic interactions between RAGE, a cell surface receptor expressed on malignant cells in advanced prostate cancer, and proteinase 3 (PR3), a serine protease present in inflammatory neutrophils and hematopoietic cells within the bone marrow microenvironment. In this study, we establish that RAGE-PR3 interaction mediates homing of prostate cancer cells to the bone marrow. PR3 bound to RAGE on the surface of prostate cancer cells in vitro, inducing tumor cell motility through a non-proteolytic signal transduction cascade involving activation and phosphorylation of ERK1/2 and JNK1. In preclinical models of experimental metastasis, ectopic expression of RAGE on human prostate cancer cells was sufficient to promote bone marrow homing within a short time frame. Our findings demonstrate how RAGE-PR3 interactions between human prostate cancer cells and the bone marrow microenvironment mediate bone metastasis during prostate cancer progression, with potential implications for prognosis and therapeutic intervention. PMID:28428279

Expression and role of the angiotensin II AT2 receptor in human prostate tissue: in search of a new therapeutic option for prostate cancer.

PubMed

Guimond, Marie-Odile; Battista, Marie-Claude; Nikjouitavabi, Fatemeh; Carmel, Maude; Barres, Véronique; Doueik, Alexandre A; Fazli, Ladan; Gleave, Martin; Sabbagh, Robert; Gallo-Payet, Nicole

2013-07-01

Evidence shows that angiotensin II type 1 receptor (AT1R) blockers may be associated with improved outcome in prostate cancer patients. It has been proposed that part of this effect could be due to angiotensin II type 2 receptor (AT2R) activation, the only active angiotensin II receptor in this situation. This study aimed to characterize the localization and expression of AT2R in prostate tissues and to assess its role on cell morphology and number in prostatic epithelial cells in primary culture. AT2R and its AT2R-interacting protein (ATIP) expression were assessed on non-tumoral and tumoral human prostate using tissue microarray immunohistochemistry, binding assay, and Western blotting. AT2R effect on cell number was measured in primary cultures of epithelial cells from non-tumoral human prostate. AT2R was localized at the level of the acinar epithelial layer and its expression decreased in cancers with a Gleason score 6 or higher. In contrast, ATIP expression increased with cancer progression. Treatment of primary cell cultures from non-tumoral prostate tissues with C21/M024, a selective AT2R agonist, alone or in co-incubation with losartan, an AT1R antagonist, significantly decreased cell number compared to untreated cells. AT2R and ATIP are present in non-tumoral human prostate tissues and differentially regulated according to Gleason score. The decrease in non-tumoral prostate cell number upon selective AT2R stimulation suggests that AT2R may have a protective role against prostate cancer development. Treatment with a selective AT2R agonist could represent a new approach for prostate cancer prevention or for patients on active surveillance. Copyright © 2013 Wiley Periodicals, Inc.

Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor

PubMed Central

Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

2014-01-01

Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a ‘wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model. PMID:25188519

Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor.

PubMed

Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

2014-09-04

Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a 'wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model.

Alpha-adrenergic blocker mediated osteoblastic stem cell differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Yoon Jung; Lee, Jue Yeon; Research Center, Nano Intelligent Biomedical Engineering Corporation

Highlights: Black-Right-Pointing-Pointer Doxazocin directly up-regulated bone metabolism at a low dose. Black-Right-Pointing-Pointer Doxazocin induced osteoblastic stem cell differentiation without affecting cell proliferation. Black-Right-Pointing-Pointer This osteogenic stem cell differentiation is mediated by ERK-signal dependent pathway. -- Abstract: Recent researches have indicated a role for antihypertensive drugs including alpha- or beta-blockers in the prevention of bone loss. Some epidemiological studies reported the protective effects of those agents on fracture risk. However, there is limited information on the association with those agents especially at the mechanism of action. In the present study, we investigated the effects of doxazosin, an alpha-blocker that is clinicallymore » used for the treatment of benign prostatic hyperplasia (BPH) along with antihypertensive medication, on the osteogenic stem cell differentiation. We found that doxazosin increased osteogenic differentiation of human mesenchymal stem cells, detected by Alizarin red S staining and calcein. Doxazosin not only induced expression of alkaline phosphatase, type I collagen, osteopontin, and osteocalcin, it also resulted in increased phosphorylation of extracellular signal-regulated kinase (ERK1/2), a MAP kinase involved in osteoblastic differentiation. Treatment with U0126, a MAP kinase inhibitor, significantly blocked doxazosin-induced osteoblastic differentiation. Unrelated to activation of osteogenic differentiation by doxazosin, we found that there were no significant changes in adipogenic differentiation or in the expression of adipose-specific genes, including peroxisome proliferator-activated receptor {gamma}, aP2, or LPL. In this report, we suggest that doxazosin has the ability to increase osteogenic cell differentiation via ERK1/2 activation in osteogenic differentiation of adult stem cells, which supports the protective effects of antihypertensive drug on fracture risk and according to our data doxazosin might be useful for application in the field of bone metabolism.« less

The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy.

PubMed

Pasquali, Daniela; Rossi, Valentina; Staibano, Stefania; De Rosa, Gaetano; Chieffi, Paolo; Prezioso, Domenico; Mirone, Vincenzo; Mascolo, Massimo; Tramontano, Donatella; Bellastella, Antonio; Sinisi, Antonio Agostino

2006-09-01

A new family of angiogenic factors named endocrine-gland-derived vascular endothelial growth factors (EG-VEGF)/prokineticins (PK) have been recently described as predominantly expressed in steroidogenic tissues. Whether the normal and malignant epithelial prostate cells and tissues express EG-VEGF/PK1 and PK2 and their receptors is still unknown. We studied the expression of EG-VEGF/PK1 and PK2 and their receptors (PK-R1 and PK-R2) in human prostate and their involvement in cancer. Using immunohistochemistry, Western blot, and RT-PCR, we determined the expression of EG-VEGF/PK1 in normal prostate (NP) and malignant prostate tissues (PCa), in epithelial cell primary cultures from normal prostate (NPEC) and malignant prostate (CPEC) and in a panel of prostate cell lines. In NPEC, CPEC, and in EPN, a nontransformed human prostate epithelial cell line, EG-VEGF/PK1, PK2, PK-R1, and PK-R2 mRNA levels were evaluated by quantitative RT-PCR. EG-VEGF/PK1 transcript was found in PCa, in CPEC, in EPN, and in LNCaP, whereas it was detected at low level in NP and in NPEC. EG-VEGF/PK1 was absent in androgen-independent PC3 and DU-145 cell lines. Immunochemistry confirmed that EG-VEGF/PK1 protein expression was restricted to hyperplastic and malignant prostate tissues, localized in the glandular epithelial cells, and progressively increased with the prostate cancer Gleason score advancement. EG-VEGF/PK1 and PK2 were weakly expressed in NPEC and EPN. On the other hand, their transcripts were highly detected in CPEC. PK-R1 and PK-R2 were found in NPEC, EPN, and CPEC. Interestingly, CPEC showed a significantly (P < 0.05) higher expression of EG-VEGF/PK1, PK2, PK-R1, and PK-R2 compared with NPEC and EPN. We demonstrated that PKs and their receptors are expressed in human prostate and that their levels increased with prostate malignancy. It may imply that EG-VEGF/PK1 could be involved in prostate carcinogenesis, probably regulating angiogenesis. Thus, the level of EG-VEGF/PK1 could be useful for prostate cancer outcome evaluation and as a target for prostate cancer treatment in the future.

miR-888 is an expressed prostatic secretions-derived microRNA that promotes prostate cell growth and migration

PubMed Central

Lewis, Holly; Lance, Raymond; Troyer, Dean; Beydoun, Hind; Hadley, Melissa; Orians, Joseph; Benzine, Tiffany; Madric, Kenya; Semmes, O John; Drake, Richard; Esquela-Kerscher, Aurora

2014-01-01

microRNAs (miRNAs) are a growing class of small non-coding RNAs that exhibit widespread dysregulation in prostate cancer. We profiled miRNA expression in syngeneic human prostate cancer cell lines that differed in their metastatic potential in order to determine their role in aggressive prostate cancer. miR-888 was the most differentially expressed miRNA observed in human metastatic PC3-ML cells relative to non-invasive PC3-N cells, and its levels were higher in primary prostate tumors from cancer patients, particularly those with seminal vesicle invasion. We also examined a novel miRNA-based biomarker source called expressed prostatic secretions in urine (EPS urine) for miR-888 expression and found that its levels were preferentially elevated in prostate cancer patients with high-grade disease. These expression studies indicated a correlation for miR-888 in disease progression. We next tested how miR-888 regulated cancer-related pathways in vitro using human prostate cancer cell lines. Overexpression of miR-888 increased proliferation and migration, and conversely inhibition of miR-888 activity blocked these processes. miR-888 also increased colony formation in PC3-N and LNCaP cells, supporting an oncogenic role for this miRNA in the prostate. Our data indicates that miR-888 functions to promote prostate cancer progression and can suppress protein levels of the tumor suppressor genes RBL1 and SMAD4. This miRNA holds promise as a diagnostic tool using an innovative prostatic fluid source as well as a therapeutic target for aggressive prostate cancer. PMID:24200968

Molecular imaging of prostate cancer: translating molecular biology approaches into the clinical realm.

PubMed

Vargas, Hebert Alberto; Grimm, Jan; F Donati, Olivio; Sala, Evis; Hricak, Hedvig

2015-05-01

The epidemiology of prostate cancer has dramatically changed since the introduction of prostate-specific antigen (PSA) screening in the 1980's. Most prostate cancers today are detected at early stages of the disease and are considered 'indolent'; however, some patients' prostate cancers demonstrate a more aggressive behaviour which leads to rapid progression and death. Increasing understanding of the biology underlying the heterogeneity that characterises this disease has led to a continuously evolving role of imaging in the management of prostate cancer. Functional and metabolic imaging techniques are gaining importance as the impact on the therapeutic paradigm has shifted from structural tumour detection alone to distinguishing patients with indolent tumours that can be managed conservatively (e.g., by active surveillance) from patients with more aggressive tumours that may require definitive treatment with surgery or radiation. In this review, we discuss advanced imaging techniques that allow direct visualisation of molecular interactions relevant to prostate cancer and their potential for translation to the clinical setting in the near future. The potential use of imaging to follow molecular events during drug therapy as well as the use of imaging agents for therapeutic purposes will also be discussed. • Advanced imaging techniques allow direct visualisation of molecular interactions in prostate cancer. • MRI/PET, optical and Cerenkov imaging facilitate the translation of molecular biology. • Multiple compounds targeting PSMA expression are currently undergoing clinical translation. • Other targets (e.g., PSA, prostate-stem cell antigen, GRPR) are in development.

Perinatal exposure to mixtures of anti-androgenic chemicals causes proliferative lesions in rat prostate.

PubMed

Boberg, Julie; Johansson, Hanna K L; Hadrup, Niels; Dreisig, Karin; Berthelsen, Line; Almstrup, Kristian; Vinggaard, Anne Marie; Hass, Ulla

2015-02-01

Elevated levels of endogenous or exogenous estrogens during fetal life can induce permanent disturbances in prostate growth and predispose to precancerous lesions. Recent studies have indicated that also early anti-androgen exposure may affect prostate cancer risk. We examined the influence of perinatal exposure to mixtures of anti-androgenic and estrogenic chemicals on prostate development. Wistar rats were exposed from gestation day 7 to postnatal day 22 to a mixture of 8 anti-androgenic compounds (AAMix), a mixture of four estrogenic compounds (EMix), or paracetamol or a mixture of all 13 compounds (TotalMix) in mixture ratios reflecting human exposure levels. Ventral prostate weights were reduced by the TotalMix and AAMix in pre-pubertal rats. Histological changes in prostate appeared with increasing age and indicated a shift from the normal age-dependent epithelial atrophy towards hyperplasia. These lesions showed similarities to pre-cancerous lesions in humans. Increased proliferation was observed already in pre-puberty and it was hypothesized that this could be associated with reduced ERβ signaling, but no clear conclusions could be made from gene expression studies on ERβ-related pathways. The influences of the estrogenic chemicals and paracetamol on prostate morphology were minor, but in young adulthood the estrogen mixture reduced ventral prostate mRNA levels of Igf1 and paracetamol reduced the mRNA level ofPbpc3. Mixtures of endocrine disrupters relevant for human exposure was found to elicit persistent effects on the rat prostate following perinatal exposure, suggesting that human perinatal exposure to environmental chemicals may increase the risk of prostate cancer later in life. © 2014 Wiley Periodicals, Inc.

Canine REIC/Dkk-3 interacts with SGTA and restores androgen receptor signalling in androgen-independent prostate cancer cell lines.

PubMed

Kato, Yuiko; Ochiai, Kazuhiko; Kawakami, Shota; Nakao, Nobuhiro; Azakami, Daigo; Bonkobara, Makoto; Michishita, Masaki; Morimatsu, Masami; Watanabe, Masami; Omi, Toshinori

2017-06-09

The pathological condition of canine prostate cancer resembles that of human androgen-independent prostate cancer. Both canine and human androgen receptor (AR) signalling are inhibited by overexpression of the dimerized co-chaperone small glutamine-rich tetratricopeptide repeat-containing protein α (SGTA), which is considered to cause the development of androgen-independency. Reduced expression in immortalised cells (REIC/Dkk-3) interferes with SGTA dimerization and rescues AR signalling. This study aimed to assess the effects of REIC/Dkk-3 and SGTA interactions on AR signalling in the canine androgen-independent prostate cancer cell line CHP-1. Mammalian two-hybrid and Halo-tagged pull-down assays showed that canine REIC/Dkk-3 interacted with SGTA and interfered with SGTA dimerization. Additionally, reporter assays revealed that canine REIC/Dkk-3 restored AR signalling in both human and canine androgen-independent prostate cancer cells. Therefore, we confirmed the interaction between canine SGTA and REIC/Dkk-3, as well as their role in AR signalling. Our results suggest that this interaction might contribute to the development of a novel strategy for androgen-independent prostate cancer treatment. Moreover, we established the canine androgen-independent prostate cancer model as a suitable animal model for the study of this type of treatment-refractory human cancer.

Targeting the Human Complement Membrane Attack Complex to Selectively Kill Prostate Cancer Cells

DTIC Science & Technology

2013-10-01

prostate cancer cells in vitro . Evaluate CD59 expression in human prostate cancer microarrays. Aim 4: Evaluate toxicity and efficacy of the lead PAC5...fragment in vitro . Since PSA is the major chymotrypsin-like serine protease in the seminal plasma and prostatic fluid, we hypothesized that PSA was...that the evolution -related complement protein C5, but not C4, is a substrate of PSA as well. *Department of Pharmacology and Molecular Sciences, The

Targeting the Human Complement Membrane Attack Complex to Selectively Kill Prostate Cancer Cells

DTIC Science & Technology

2012-10-01

prostate cancer cells in vitro . Evaluate CD59 expression in human prostate cancer microarrays. Aim 4: Evaluate toxicity and efficacy of the lead...findings suggest PSA may also have immunoregulatory activity in the seminal plasma to aid in normal fertility that may have been co-opted by prostate...cleavage fragments have not been described. PSA can cleave C3 and generate the 37 kDa fragment in vitro . PSA is the major chymotrypsin-like serine

Cytotoxic Compounds from Brucea mollis

PubMed Central

Tung, Mai Hung Thanh; Đuc, Ho Viet; Huong, Tran Thu; Duong, Nguyen Thanh; Phuong, Do Thi; Thao, Do Thi; Tai, Bui Huu; Kim, Young Ho; Bach, Tran The; Cuong, Nguyen Manh

2013-01-01

Ten compounds, including soulameanone (1), isobruceine B (2), 9-methoxy-canthin-6-one (3), bruceolline F (4), niloticine (5), octatriacontan-1-ol (6), bombiprenone (7), α-tocopherol (8), inosine (9), and apigenin 7-O-β-D-glucopyranoside (10), were isolated from the leaves, stems, and roots of Brucea mollis Wall. ex Kurz. Their structures were determined using one-and two-dimensional NMR spectroscopy and mass spectrometry. All compounds were evaluated for their cytotoxic activity against KB (human carcinoma of the mouth), LU-1 (human lung adenocarcinoma), LNCaP (human prostate adeno-carcinoma), and HL-60 (human promyelocytic leukemia) cancer cell lines. Compound 2 showed significant cytotoxic activity against KB, LU-1, LNCaP, and HL-60 cancer cells with IC50 values of 0.39, 0.40, 0.34, and 0.23 μg/mL, respectively. In addition, compounds 3 and 5 showed significant cytotoxic activity against KB, LU-1, LNCaP, and HL-60 cancer cells with IC50 values around 1–4 μg/mL. Compounds 9-methoxycanthin-6-one (3) and niloticine (5) have been discovered for the first time from the Brucea genus. PMID:24106661

The microbiome in prostate inflammation and prostate cancer.

PubMed

Porter, Corey M; Shrestha, Eva; Peiffer, Lauren B; Sfanos, Karen S

2018-05-23

The human microbiome may influence prostate cancer initiation and/or progression through both direct and indirect interactions. To date, the majority of studies have focused on direct interactions including the influence of prostate infections on prostate cancer risk and, more recently, on the composition of the urinary microbiome in relation to prostate cancer. Less well understood are indirect interactions of the microbiome with prostate cancer, such as the influence of the gastrointestinal or oral microbiota on pro- or anti-carcinogenic xenobiotic metabolism, and treatment response. We review the literature to date on direct and indirect interactions of the microbiome with prostate inflammation and prostate cancer. Emerging studies indicate that the microbiome can influence prostate inflammation in relation to benign prostate conditions such as prostatitis/chronic pelvic pain syndrome and benign prostatic hyperplasia, as well as in prostate cancer. We provide evidence that the human microbiome present at multiple anatomic sites (urinary tract, gastrointestinal tract, oral cavity, etc.) may play an important role in prostate health and disease. In health, the microbiome encourages homeostasis and helps educate the immune system. In dysbiosis, a systemic inflammatory state may be induced, predisposing remote anatomical sites to disease, including cancer. The microbiome's ability to affect systemic hormone levels may also be important, particularly in a disease such as prostate cancer that is dually affected by estrogen and androgen levels. Due to the complexity of the potential interconnectedness between prostate cancer and the microbiome, it is vital to further explore and understand the relationships that are involved.

Prostate cancer and inflammation: the evidence

PubMed Central

Sfanos, Karen S; De Marzo, Angelo M

2014-01-01

Chronic inflammation is now known to contribute to several forms of human cancer, with an estimated 20% of adult cancers attributable to chronic inflammatory conditions caused by infectious agents, chronic noninfectious inflammatory diseases and / or other environmental factors. Indeed, chronic inflammation is now regarded as an ‘enabling characteristic’ of human cancer. The aim of this review is to summarize the current literature on the evidence for a role for chronic inflammation in prostate cancer aetiology, with a specific focus on recent advances regarding the following: (i) potential stimuli for prostatic inflammation; (ii) prostate cancer immunobiology; (iii) inflammatory pathways and cytokines in prostate cancer risk and development; (iv) proliferative inflammatory atrophy (PIA) as a risk factor lesion to prostate cancer development; and (v) the role of nutritional or other antiinflammatory compounds in reducing prostate cancer risk. PMID:22212087

Photodynamic therapy in prostate cancer: optical dosimetry and response of normal tissue

NASA Astrophysics Data System (ADS)

Chen, Qun; Shetty, Sugandh D.; Heads, Larry; Bolin, Frank; Wilson, Brian C.; Patterson, Michael S.; Sirls, Larry T., II; Schultz, Daniel; Cerny, Joseph C.; Hetzel, Fred W.

1993-06-01

The present study explores the possibility of utilizing photodynamic therapy (PDT) in treating localized prostate carcinoma. Optical properties of ex vivo human prostatectomy specimens, and in vivo and ex vivo dog prostate glands were studied. The size of the PDT induced lesion in dog prostate was pathologically evaluated as a biological endpoint. The data indicate that the human normal and carcinoma prostate tissues have similar optical properties. The average effective attenuation depth is less in vivo than that of ex vivo. The PDT treatment generated a lesion size of up to 16 mm in diameter. The data suggest that PDT is a promising modality in prostate cancer treatment. Multiple fiber system may be required for clinical treatment.

Analysis of the Human Prostate-Specific Proteome Defined by Transcriptomics and Antibody-Based Profiling Identifies TMEM79 and ACOXL as Two Putative, Diagnostic Markers in Prostate Cancer

PubMed Central

O'Hurley, Gillian; Busch, Christer; Fagerberg, Linn; Hallström, Björn M.; Stadler, Charlotte; Tolf, Anna; Lundberg, Emma; Schwenk, Jochen M.; Jirström, Karin; Bjartell, Anders; Gallagher, William M.; Uhlén, Mathias; Pontén, Fredrik

2015-01-01

To better understand prostate function and disease, it is important to define and explore the molecular constituents that signify the prostate gland. The aim of this study was to define the prostate specific transcriptome and proteome, in comparison to 26 other human tissues. Deep sequencing of mRNA (RNA-seq) and immunohistochemistry-based protein profiling were combined to identify prostate specific gene expression patterns and to explore tissue biomarkers for potential clinical use in prostate cancer diagnostics. We identified 203 genes with elevated expression in the prostate, 22 of which showed more than five-fold higher expression levels compared to all other tissue types. In addition to previously well-known proteins we identified two poorly characterized proteins, TMEM79 and ACOXL, with potential to differentiate between benign and cancerous prostatic glands in tissue biopsies. In conclusion, we have applied a genome-wide analysis to identify the prostate specific proteome using transcriptomics and antibody-based protein profiling to identify genes with elevated expression in the prostate. Our data provides a starting point for further functional studies to explore the molecular repertoire of normal and diseased prostate including potential prostate cancer markers such as TMEM79 and ACOXL. PMID:26237329

Identification of HLA-DRB1*1501-restricted T-cell epitopes from human prostatic acid phosphatase.

PubMed

Klyushnenkova, Elena N; Kouiavskaia, Diana V; Kodak, James A; Vandenbark, Arthur A; Alexander, Richard B

2007-07-01

The crucial role of CD4 T-cells in anti-tumor immune response is widely recognized, yet the identification of HLA class II-restricted epitopes derived from tumor antigens has lagged behind compared to class I epitopes. This is particularly true for prostate cancer. Based on the hypothesis that successful cancer immunotherapy will likely resemble autoimmunity, we searched for the CD4 T-cell epitopes derived from prostatic proteins that are restricted by human leukocyte antigen (HLA)-DRB1*1501, an allele associated with granulomatous prostatitis (GP), a disease that may have an autoimmune etiology. One of the antigens implicated in the development of autoimmunity in the prostate is prostatic acid phosphatase (PAP), which is also considered a promising target for prostate cancer immunotherapy. We immunized transgenic (tg) mice engineered to express HLA-DRB1*1501 with human PAP. A library of overlapping 20-mer peptides spanning the entire human PAP sequence was screened in vitro for T-cell recognition by proliferative and interferon (IFN)-gamma enzyme-linked immunosorbent spot (ELISPOT) assays. We identified two 20-mer peptides, PAP (133-152), and PAP (173-192), that were immunogenic and naturally processed from whole PAP in HLA-DRB1*1501 tg mice. These peptides were also capable of stimulating CD4 T lymphocytes from HLA-DRB1*1501-positive patients with GP and normal donors. These peptides can be used for the design of a new generation of peptide-based vaccines against prostate cancer. The study can also be helpful in understanding the role of autoimmunity in the development of some forms of chronic prostatitis.

Expression of Voltage-Gated Sodium Channel Nav1.8 in Human Prostate Cancer is Associated with High Histological Grade

PubMed Central

Suy, Simeng; Hansen, Todd P.; Auto, Heather D.; Kallakury, Bhaskar V.S.; Dailey, Vernon; Danner, Malika; MacArthur, Linda; Zhang, Ying; Miessau, Matthew J.; Collins, Sean P.; Brown, Milton L.

2013-01-01

Voltage-gated sodium (Nav) channels are required for impulse conductance in excitable tissues. Navs have been linked to human cancers, including prostate. The expression and distribution of Nav isoforms (Nav1.1-Nav1.9) in human prostate cancer are not well established. Here, we evaluated the expression of these isoforms and investigated the expression of Nav1.8 in human prostate cancer tissues. Nav1.8 was highly expressed in all examined cells. Expression of Nav1.1, Nav1.2, and Nav1.9 were high in DU-145, PC-3 and PC-3M cells compared to LNCaP (hormone-dependent), C4-2, C4-2B, and CWR22Rv-1 cells. Nav1.5 and Nav1.6 were expressed in all cells examined. Nav1.7 expression was absent in PC-3M and CWR22Rv-1, but expressed in the other cells examined. Immunohistochemistry revealed intensive Nav1.8 staining correlated with more advanced pathologic stage of disease. Increased intensity of nuclear Nav1.8 correlated with increased Gleason grade. Our results revealed that Nav1.8 is universally expressed in human prostate cancer cells. Nav1.8 expression statistically correlated with pathologic stage (P=0.04) and Gleason score (P=0.01) of human prostate tissue specimens. The aberrant nuclear localization of Nav1.8 with advanced prostate cancer tissues warrant further investigation into use of Nav1.8 as a potential biomarker to differentiate between early and advanced disease. PMID:24163825

Dual-frequency ultrasound focal therapy for MRI-guided transurethral treatment of the prostate: Study in gel phantom

NASA Astrophysics Data System (ADS)

N'Djin, W. Apoutou; Mougenot, Charles; Kobelevskiy, Ilya; Ramsay, Elizabeth; Bronskill, Michael; Chopra, Rajiv

2012-11-01

Ultrasound thermal therapy of localized prostate cancer offers a minimally-invasive non-ionizing alternative [1-3] to surgery and radiotherapy. MRI-controlled transurethral ultrasound prostate therapy [4-6] has previously been investigated in a pilot human feasibility study [7], by treating a small sub-volume of prostate tissue. In this study, the feasibility of transurethral dual-frequency ultrasound focal therapy has been investigated in gel phantom. A database of pelvic anatomical models of human prostate cancer patients have been created using MR clinical images. The largest prostate boundary (47 cm3) was used to fabricate an anatomical gel phantom which included various MR characteristics to mimic prostate tissues, 4 localized tumors and surrounding prostate tissues. A 9-element transurethral ultrasound applicator working in dual-frequency mode (f = 4.6/14.5 MHz) was evaluated to heat: (i) the entire prostate volume (Full prostate treatment strategy), (ii) a prostate region restricted to tumors (Focal therapy). Acoustic power of each element and rotation rate of the device were adjusted in realtime based on MR-thermometry feedback control (nine thermal slices updated every 6.2s). Experiments have been performed using dual-frequency ultrasound exposures (surface Pmax: 20W.cm-2). (i) For full prostate heating, 7 elements of the device were used to cover the entire prostate length. The heating process was completed within 35 min. Ultrasound exposures at the fundamental frequency allowed full heating of the largest prostate radii (>18 mm), while exposures at the 3rd harmonic ensured homogeneous treatment of the smallest radii. Undertreated and overtreated regions represented respectively 2% and 17% of the prostate volume. (ii) For focal therapy, the target region was optimized to maintain safe regions in the prostate and to cover all tumor-mimics. Only 5 ultrasound elements were used to treat successfully all tumor-mimics within 26 min. Undertreated and overtreated regions each represented 7% of the prostate volume. MRI-guided transurethral ultrasound procedure enables full treatment and focal therapy in human prostate geometry. Prostate volume heating was fast compared to standard HIFU prostate treatments. Dual-frequency ultrasound exposures allowed optimal heat deposition in all prostate regions. The focal therapy strategy is promising as regard to safety and could contribute to enhance the post-treatment autonomy of the patient.

Concurrent Hepsin overexpression and adenomatous polyposis coli deletion causes invasive prostate carcinoma in mice.

PubMed

Valkenburg, Kenneth C; Hostetter, Galen; Williams, Bart O

2015-10-01

A clinical need to better categorize patients with prostate cancer exists. The Wnt/β-catenin signaling pathway plays important roles in human prostate cancer progression. Deletion of the endogenous Wnt antagonist adenomatous polyposis coli (Apc) in mice causes high grade prostate intraepithelial neoplasia, widely thought to be the precursor to prostate cancer. However, no metastasis occurrs in this model. New mouse models are needed to determine molecular causes of tumorigenesis, progression, and metastasis. To determine whether the overexpression of the prostate oncogene Hepsin could cause prostate cancer progression, we crossed a prostate-specific Hepsin overexpression model to a prostate-specific Apc-deletion model and classified the observed phenotype. When Apc was deleted and Hepsin overexpressed concurrently, mice displayed invasive carcinoma, with loss of membrane characteristics and increase of fibrosis. These tumors had both luminal and basaloid characteristics. Though no metastasis was observed, there was evidence of adenomas and lung necrosis, inflammation, and chronic hemorrhage. This work indicates that the Wnt/β-catenin pathway and the Hepsin pathway act in concert to promote prostate cancer progression. Both of these pathways are up-regulated in human prostate cancer and could represent chemotherapeutic targets. © 2015 Wiley Periodicals, Inc.

Differential expression of androgen, estrogen, and progesterone receptors in benign prostatic hyperplasia

PubMed Central

Song, Lingmin; Shen, Wenhao; Zhang, Heng; Wang, Qiwu; Wang, Yongquan; Zhou, Zhansong

2016-01-01

This study aimed to identify the differential expression levels of androgen receptor (AR), estrogen receptors (ERα, ERβ), and progesterone receptor (PGR) between normal prostate and benign prostatic hyperplasia (BPH). The combination of immunohistochemistry, quantitative real-time reverse transcription polymerase chain reaction, and Western blotting assay was used to identify the distribution and differential expression of these receptors at the immunoactive biomarker, transcriptional, and protein levels between 5 normal human prostate tissues and 40 BPH tissues. The results were then validated in a rat model of BPH induced by testosterone propionate and estradiol benzoate. In both human and rat prostate tissues, AR was localized mainly to epithelial and stromal cell nuclei; ERα was distributed mainly to stromal cells, but not exclusively; ERβ was interspersed in the basal layer of epithelium, but sporadically in epithelial and stromal cells; PGR was expressed abundantly in cytoplasm of epithelial and stromal cells. There were decreased expression of ERα and increased expression of PGR, but no difference in the expression of ERβ in the BPH compared to the normal prostate of both human and rat. Increased expression of AR in the BPH compared to the normal prostate of human was observed, however, the expression of AR in the rat prostate tissue was decreased. This study identified the activation of AR and PGR and repression of ERα in BPH, which indicate a promoting role of AR and PGR and an inhibitory role of ERα in the pathogenesis of BPH. PMID:27294569

Inhibition of adrenergic human prostate smooth muscle contraction by the inhibitors of c-Jun N-terminal kinase, SP600125 and BI-78D3.

PubMed

Strittmatter, F; Walther, S; Gratzke, C; Göttinger, J; Beckmann, C; Roosen, A; Schlenker, B; Hedlund, P; Andersson, K E; Stief, C G; Hennenberg, M

2012-07-01

BACKGROUND AND PURPOSE α(1) -Adrenoceptor-induced contraction of prostate smooth muscle is mediated by calcium- and Rho kinase-dependent mechanisms. In addition, other mechanisms, such as activation of c-jun N-terminal kinase (JNK) may be involved. Here, we investigated whether JNK participates in α(1)-adrenoceptor-induced contraction of human prostate smooth muscle. EXPERIMENTAL APPROACH Prostate tissue was obtained from patients undergoing radical prostatectomy. Effects of the JNK inhibitors SP600125 (50 µM) and BI-78D3 (30 µM) on contractions induced by phenylephrine, noradrenaline and electric field stimulation (EFS) were studied in myographic measurements. JNK activation by noradrenaline (30 µM) and phenylephrine (10 µM), and the effects of JNK inhibitors of c-Jun phosphorylation were assessed by Western blot analyses with phospho-specific antibodies. Expression of JNK was studied by immunohistochemistry and fluorescence double staining. KEY RESULTS The JNK inhibitors SP600125 and BI-78D3 reduced phenylephrine- and noradrenaline-induced contractions of human prostate strips. In addition, SP600125 reduced EFS-induced contraction of prostate strips. Stimulation of prostate tissue with noradrenaline or phenylephrine in vitro resulted in activation of JNK. Incubation of prostate tissue with SP600125 or BI-78D3 reduced the phosphorylation state of c-Jun. Immunohistochemical staining demonstrated the expression of JNK in smooth muscle cells of human prostate tissue. Fluorescence staining showed that α(1A)-adrenoceptors and JNK are expressed in the same cells. CONCLUSIONS AND IMPLICATIONS Activation of JNK is involved in α(1)-adrenoceptor-induced prostate smooth muscle contraction. Models of α(1)-adrenoceptor-mediated prostate smooth muscle contraction should include this JNK-dependent mechanism. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

TGFβ1 alters androgenic metabolites and hydroxysteroid dehydrogenase enzyme expression in human prostate reactive stromal primary cells: Is steroid metabolism altered by prostate reactive stromal microenvironment?

PubMed Central

Piao, Yun-shang; Wiesenfeld, Paddy; Sprando, Robert; Arnold, Julia T.

2013-01-01

The inflammatory tissue microenvironment can be an active promoter in preneoplastic cancer lesions. Altered steroid hormone metabolism as induced by the inflammatory microenvironment may contribute to epithelial cancer progression. Dehydroepiandrosterone sulfate (DHEAS) is the most abundant endogenous steroid hormone present in human serum and can be metabolized to DHEA, androgens and/or estrogens in peripheral tissues. We have previously reported that TGFβ1-induced reactive prostate stromal cells increase DHEA metabolism to active androgens and alter prostate cancer cell gene expression. While much of the focus on mechanisms of prostate cancer and steroid metabolism is in the epithelial cancer cells, this study focuses on TGFβ1-induced effects on DHEA metabolic pathways and enzymes in human prostate stromal cells. In DHEA-treated primary prostate stromal cells, TGFβ1 produced time- and dose-dependent increases in metabolism of DHEA to androstenedione and testosterone. Also TGFβ1-treated prostate stromal cells exhibited changes in the gene expression of enzymes involved in steroid metabolism including up-regulation of 3β hydroxysteroid dehydrogenase (HSD), and down-regulation of 17βHSD5, and 17βHSD2. These studies suggest that reactive prostate stroma and the inflammatory microenvironment may contribute to altered steroid metabolism and increased intratumoral androgens. PMID:23770322

TGFβ1 alters androgenic metabolites and hydroxysteroid dehydrogenase enzyme expression in human prostate reactive stromal primary cells: Is steroid metabolism altered by prostate reactive stromal microenvironment?

PubMed

Piao, Yun-shang; Wiesenfeld, Paddy; Sprando, Robert; Arnold, Julia T

2013-11-01

The inflammatory tissue microenvironment can be an active promoter in preneoplastic cancer lesions. Altered steroid hormone metabolism as induced by the inflammatory microenvironment may contribute to epithelial cancer progression. Dehydroepiandrosterone sulfate (DHEAS) is the most abundant endogenous steroid hormone present in human serum and can be metabolized to DHEA, androgens and/or estrogens in peripheral tissues. We have previously reported that TGFβ1-induced reactive prostate stromal cells increase DHEA metabolism to active androgens and alter prostate cancer cell gene expression. While much of the focus on mechanisms of prostate cancer and steroid metabolism is in the epithelial cancer cells, this study focuses on TGFβ1-induced effects on DHEA metabolic pathways and enzymes in human prostate stromal cells. In DHEA-treated primary prostate stromal cells, TGFβ1 produced time- and dose-dependent increases in metabolism of DHEA to androstenedione and testosterone. Also TGFβ1-treated prostate stromal cells exhibited changes in the gene expression of enzymes involved in steroid metabolism including up-regulation of 3β hydroxysteroid dehydrogenase (HSD), and down-regulation of 17βHSD5, and 17βHSD2. These studies suggest that reactive prostate stroma and the inflammatory microenvironment may contribute to altered steroid metabolism and increased intratumoral androgens. Published by Elsevier Ltd.

Androgen receptor-negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms.

PubMed

Li, Zhi Gang; Mathew, Paul; Yang, Jun; Starbuck, Michael W; Zurita, Amado J; Liu, Jie; Sikes, Charles; Multani, Asha S; Efstathiou, Eleni; Lopez, Adriana; Wang, Jing; Fanning, Tina V; Prieto, Victor G; Kundra, Vikas; Vazquez, Elba S; Troncoso, Patricia; Raymond, Austin K; Logothetis, Christopher J; Lin, Sue-Hwa; Maity, Sankar; Navone, Nora M

2008-08-01

In prostate cancer, androgen blockade strategies are commonly used to treat osteoblastic bone metastases. However, responses to these therapies are typically brief, and the mechanism underlying androgen-independent progression is not clear. Here, we established what we believe to be the first human androgen receptor-negative prostate cancer xenografts whose cells induced an osteoblastic reaction in bone and in the subcutis of immunodeficient mice. Accordingly, these cells grew in castrated as well as intact male mice. We identified FGF9 as being overexpressed in the xenografts relative to other bone-derived prostate cancer cells and discovered that FGF9 induced osteoblast proliferation and new bone formation in a bone organ assay. Mice treated with FGF9-neutralizing antibody developed smaller bone tumors and reduced bone formation. Finally, we found positive FGF9 immunostaining in prostate cancer cells in 24 of 56 primary tumors derived from human organ-confined prostate cancer and in 25 of 25 bone metastasis cases studied. Collectively, these results suggest that FGF9 contributes to prostate cancer-induced new bone formation and may participate in the osteoblastic progression of prostate cancer in bone. Androgen receptor-null cells may contribute to the castration-resistant osteoblastic progression of prostate cancer cells in bone and provide a preclinical model for studying therapies that target these cells.

Androgen receptor–negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms

PubMed Central

Li, Zhi Gang; Mathew, Paul; Yang, Jun; Starbuck, Michael W.; Zurita, Amado J.; Liu, Jie; Sikes, Charles; Multani, Asha S.; Efstathiou, Eleni; Lopez, Adriana; Wang, Jing; Fanning, Tina V.; Prieto, Victor G.; Kundra, Vikas; Vazquez, Elba S.; Troncoso, Patricia; Raymond, Austin K.; Logothetis, Christopher J.; Lin, Sue-Hwa; Maity, Sankar; Navone, Nora M.

2008-01-01

In prostate cancer, androgen blockade strategies are commonly used to treat osteoblastic bone metastases. However, responses to these therapies are typically brief, and the mechanism underlying androgen-independent progression is not clear. Here, we established what we believe to be the first human androgen receptor–negative prostate cancer xenografts whose cells induced an osteoblastic reaction in bone and in the subcutis of immunodeficient mice. Accordingly, these cells grew in castrated as well as intact male mice. We identified FGF9 as being overexpressed in the xenografts relative to other bone-derived prostate cancer cells and discovered that FGF9 induced osteoblast proliferation and new bone formation in a bone organ assay. Mice treated with FGF9-neutralizing antibody developed smaller bone tumors and reduced bone formation. Finally, we found positive FGF9 immunostaining in prostate cancer cells in 24 of 56 primary tumors derived from human organ-confined prostate cancer and in 25 of 25 bone metastasis cases studied. Collectively, these results suggest that FGF9 contributes to prostate cancer–induced new bone formation and may participate in the osteoblastic progression of prostate cancer in bone. Androgen receptor–null cells may contribute to the castration-resistant osteoblastic progression of prostate cancer cells in bone and provide a preclinical model for studying therapies that target these cells. PMID:18618013

Significance of common variants on human chromosome 8q24 in relation to the risk of prostate cancer in native Japanese men

PubMed Central

Liu, Miao; Kurosaki, Takayuki; Suzuki, Motofumi; Enomoto, Yutaka; Nishimatsu, Hiroaki; Arai, Tomio; Sawabe, Motoji; Hosoi, Takayuki; Homma, Yukio; Kitamura, Tadaichi

2009-01-01

Background Common variants on human chromosome 8q24, rs1447295 (C/A) and rs6983267 (T/G), have been recently linked to the prevalence of prostate cancer in European and American populations. Here, we evaluated whether the single-nucleotide polymorphisms rs1447295 and rs6983267 were associated with the risk of sporadic prostate cancer as well as latent prostate cancer in a native Japanese population. Results We analyzed genomic DNA samples from 391 sporadic prostate cancer patients, 323 controls who had died from causes unrelated to cancer and 112 Japanese men who were diagnosed as having latent prostate cancer based on autopsy results. The polymorphisms were determined by allelic discrimination using a fluorescent-based TaqMan assay. The A allele of rs1447295 was significantly associated with the risk of sporadic prostate cancer (p = 0.04; age-adjusted OR, 1.34), while the G allele of rs6983267 showed a trend towards being a high-risk allele (p = 0.06; age-adjusted OR, 1.27). No significant difference between these two polymorphisms and the risk of latent prostate cancer was observed in the present Japanese population. Conclusion Known variants on human chromosome 8q24 may be risk factors for sporadic prostate cancer in native Japanese men. PMID:19602258

Role of Human Polyomavirus Bkv in Prostate Cancer

DTIC Science & Technology

2007-12-01

D. L. Walker. 1976 . New human papovaviruses. Prog Med Virol. 22:1-35. 59. Palapattu, G. S., S. Sutcliffe, P. J. Bastian, E. A. Platz, A. M. De Marzo ...J. Imperiale. 2004. Detection and expression of human BK virus sequences in neoplastic prostate tissues. Oncogene 23:7031-7046. 4. De Marzo , A. M...virus sequences in neoplastic prostate tissues. Oncogene 23:7031-7046. 41 18. De Marzo , A. M., T. L. DeWeese, E. A. Platz, A. K. Meeker, M. Nakayama

The expression of β3-adrenoceptors and their function in the human prostate.

PubMed

Suzuki, Takahisa; Otsuka, Atsushi; Matsumoto, Rikiya; Furuse, Hiroshi; Ozono, Seiichiro

2016-02-01

Little is known about β3-adrenoceptor (AR) expression and function in human prostate. We examined the expression and distribution of β-AR subtypes in normal prostate and benign prostatic hyperplasia (BPH) tissues, and investigated which selective β-AR subtype agonist was most involved in the relaxation of isolated human prostate strips. Messenger RNA (mRNA) expression for β1-, β2-, and β3 -ARs was investigated using reverse transcriptase-polymerase chain reactions (RT-PCR). Quantitative analysis of mRNA expression of β-AR subtypes between normal prostate and BPH tissues was performed using quantitative RT-PCR (qPCR). Distributions were examined by immunohistochemistry (IHC). Strips of human normal prostate or BPH were suspended in organ baths and exposed to isoproterenol, dobutamine, procaterol, and TRK-380 to investigate their relaxant effects on KCl-induced contractions, and their inhibitory effects on electrical field stimulation (EFS)-induced contractions. We confirmed the presence of mRNA for β1-, β2-, and β3-ARs both in normal prostate and in BPH tissues. For β3-AR, mRNA expression in BPH tissues was significantly higher than in normal prostate tissues, but there was no significant difference in β1- and β2-AR expression between normal and BPH tissues. IHC revealed differences in staining intensity between smooth muscle cells and glandular cells, with different proportions for different β-AR subtypes. Staining of β3-AR was particularly intense in smooth muscle cells as opposed to glandular cells. Isoproterenol and TRK-380 significantly decreased the tone of KCl-induced contractions of the normal prostate strips. The rank order of relaxant effects was isoproterenol > TRK-380 > procaterol > dobutamine. All selective β-AR agonists significantly decreased the amplitude of EFS-induced contractions of the normal prostate strips. The rank order of inhibitory effects was isoproterenol > dobutamine >TRK-380 > procaterol. In BPH strips, all selective β-AR agonists showed no significant relaxant or inhibitory effects on KCl- or EFS-induced contractions. β3 -AR is abundant in human prostate smooth muscle, whose relaxation is mediated by β1- and β3-AR stimulation. β3-AR agonists may have clinical use in the treatment of male non-BPH patients or neurogenic bladder patients with voiding dysfunction. © 2015 Wiley Periodicals, Inc.

Clinical Usefulness of the Histoculture Drug Response Assay for Prostate Cancer and Benign Prostate Hypertrophy (BPH).

PubMed

Hoffman, Robert M

2018-01-01

The histoculture drug response assay (HDRA) has been adapted to determine androgen sensitivity in Gelfoam histoculture of human benign prostatic tissue as well as prostate cancer. Gelfoam histoculture was used to measure androgen-independent and androgen-dependent growth of benign and malignant prostate tissue. The androgen-sensitivity index was significantly higher in 23 paired specimens of prostate cancer compared to benign prostate hypertrophy (BPH). Genistein decreased the androgen-sensitivity index of BPH and prostate cancer in Gelfoam ® histoculture in a dose-dependent manner.

Targeting Ligand Dependent and Ligand Independent Androgen Receptor Signaling in Prostate Cancer

DTIC Science & Technology

2014-10-01

3962–76. 27. Lin SP, Lee YT, Wang JY, Miller SA, Chiou SH, Hung MC, et al. Survival of cancer stem cells under hypoxia and serum depletion via...the SRC-3 coactivator in suppression of cytokine mRNA translation and inflammatory response. Mol Cell 2007;25:765–78. 26. SahuB, LaaksoM,OvaskaK...al. Targeting cancer stem cells expressing an embryonic signature with anti-proteases to decrease their tumor potential. Cell Death Dis 2013;4:e706. 29

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2014-10-01

Res 62:4736-45, (2002). PMC: 12183433. 14. Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1...Among these interacting pathways are BMI-1, OCT3/4, Hedgehog (Hh), Wnt/β-catenin, Notch signaling, Hox gene family, PTEN/Akt pathway, efflux...cancer, and cancer stem cells. Nature 414, 105-111 (2001). 50. Liu, S., et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and

Everyman's prostate phantom: kiwi-fruit substitute for human prostates at magnetic resonance imaging, diffusion-weighted imaging and magnetic resonance spectroscopy.

PubMed

Mueller-Lisse, Ullrich G; Murer, Sophie; Mueller-Lisse, Ulrike L; Kuhn, Marissa; Scheidler, Juergen; Scherr, Michael

2017-08-01

To apply an easy-to-assemble phantom substitute for human prostates in T2-weighted magnetic resonance imaging (T2WI), diffusion-weighted imaging (DWI) and 3D magnetic resonance spectroscopy (MRS). Kiwi fruit were fixed with gel hot and cold compress packs on two plastic nursery pots, separated by a plastic plate, and submerged in tap water inside a 1-L open-spout plastic watering can for T2WI (TR/TE 7500/101 ms), DWI (5500/61 ms, ADC b50-800 s/mm 2 map) and MRS (940/145 ms) at 3.0 T, with phased array surface coils. One green kiwi fruit was additionally examined with an endorectal coil. Retrospective comparison with benign peripheral zone (PZ) and transitional zone (TZ) of prostate (n = 5), Gleason 6-7a prostate cancer (n = 8) and Gleason 7b-9 prostate cancer (n = 7) validated the phantom. Mean contrast between central placenta (CP) and outer pericarp (OP, 0.346-0.349) or peripheral placenta (PP, 0.364-0.393) of kiwi fruit was similar to Gleason 7b-9 prostate cancer and PZ (0.308) in T2WI. ADC values of OP and PP (1.27 ± 0.07-1.37 ± 0.08 mm 2 /s × 10 -3 ) resembled PZ and TZ (1.39 ± 0.17-1.60 ± 0.24 mm 2 /s × 10 -3 ), while CP (0.91 ± 0.14-0.99 ± 0.10 mm 2 /s × 10 -3 ) resembled Gleason 7b-9 prostate cancer (1.00 ± 0.25 mm 2 /s × 10 -3 ). MR spectra showed peaks of citrate and myo-inositol in kiwi fruit, and citrate and "choline+creatine" in prostates. The phantom worked with an endorectal coil, too. The kiwi fruit phantom reproducibly showed zones similar to PZ, TZ and cancer in human prostates in T2WI and DWI and two metabolite peaks in MRS and appears suitable to compare different MR protocols, coil systems and scanners. • Kiwi fruit appear suitable as phantoms for human prostate in MR examinations. • Kiwi fruit show zonal anatomy like human prostates in T2-weighted MRI and DWI. • MR spectroscopy reliably shows peaks in kiwi fruit (citrate/inositol) and human prostates (citrate/choline+creatine). • The kiwi fruit phantom works both with and without an endorectal coil. • EU regulation No. 543/2011 specifies physical and biochemical properties of kiwi fruit.

Evaluation of the adequacy of published studies of low-dose effects of bisphenol A on the rodent prostate for use in human risk assessment.

PubMed

Milman, Harry A; Bosland, Maarten C; Walden, Paul D; Heinze, John E

2002-06-01

Studies conducted in our laboratories and by others found no consistent correlation between prostate size, prostate pathology, or the development of prostate cancer under a variety of experimental conditions. Furthermore, an evaluation of eight published studies that were conducted in mice and rats following in utero exposure by oral treatment of dams with low levels of bisphenol A (BPA) and that focused on the prostate identified several discrepancies that affect their adequacy for use in human risk assessment. For example, there was inadequate reporting of the purity of BPA and the animal supplier used, and housing of offspring was not the same among the studies. In addition, there were differences between studies with mice and rats in exposure regimen, route of exposure, and numbers of dams or pups used per BPA dose group. Poor inter- and intraspecies correlation (i.e., mouse to rat or between mouse or rat strains) further complicates the ability to use results from these studies to predict potential prostate effects in humans. Thus, we conclude that a finding of increased prostate weight in rodent studies with perinatal exposure in the absence of associated pathologic and/or functional changes is meaningless and not indicative of a potential adverse effect in humans. Copyright 2002 Elsevier Science (USA)

Expression of lnterleukin-8 Correlates with Angiogenesis, Tumorigenicity, and Metastasis of Human Prostate Cancer Cells Implanted Orthotopically in Nude Mice1

PubMed Central

Sun, Jin Kim; Uehara, Hisanori; Karashima, Takashi; Mccarty, Marya; Shih, Nancy; Fidler, Isaiah J

2001-01-01

Abstract We determined whether the expression of interleukin-8 (IL-8) by human prostate cancer cells correlates with induction of angiogenesis, tumorigenicity, and production of metastasis. Low and high IL-8-producing clones were isolated from the heterogeneous PC-3 human prostate cancer cell line. The secretion of IL-8 protein correlated with transcriptional activity and levels of IL-8 mRNA. All PC-3 cells expressed both IL-8 receptors, CXCR1 and CXCR2. The low and high IL-8-producing clones were injected into the prostate of nude mice. Titration studies indicated that PC-3 cells expressing high levels of IL-8 were highly tumorigenic, producing rapidly growing, highly vascularized prostate tumors with and a 100% incidence of lymph node metastasis. Low IL-8-expressing PC-3 cells were less tumorigenic, producing slower growing and less vascularized primary tumors and a significantly lower incidence of metastasis. In situ hybridization (ISH) analysis of the tumors for expression of genes that regulate angiogenesis and metastasis showed that the expression level of IL-8, matrix metalloproteinases, vascular endothelial growth factor (VEGF), and E-cadherin corresponded with microvascular density and biological behavior of the prostate cancers in nude mice. Collectively, the data show that the expression level of IL-8 in human prostate cancer cells is associated with angiogenesis, tumorigenicity, and metastasis. PMID:11326314

Influence of the neural microenvironment on prostate cancer

PubMed Central

Coarfa, Christian; Florentin, Diego; Putluri, NagiReddy; Ding, Yi; Au, Jason; He, Dandan; Ragheb, Ahmed; Frolov, Anna; Michailidis, George; Lee, MinJae; Kadmon, Dov; Miles, Brian; Smith, Christopher; Ittmann, Michael; Rowley, David; Sreekumar, Arun; Creighton, Chad J.

2017-01-01

Background Nerves are key factors in prostate cancer (PCa), but the functional role of innervation in prostate cancer is poorly understood. PCa induced neurogenesis and perineural invasion (PNI), are associated with aggressive disease. Method We denervated rodent prostates chemically and physically, before orthotopically implanting cancer cells. We also performed a human neoadjuvant clinical trial using botulinum toxin type A (Botox) and saline in the same patient, before prostatectomy. Result Bilateral denervation resulted in reduced tumor incidence and size in mice. Botox treatment in humans resulted in increased apoptosis of cancer cells in the Botox treated side. A similar denervation gene array profile was identified in tumors arising in denervated rodent prostates, in spinal cord injury patients and in the Botox treated side of patients. Denervation induced exhibited a signature gene profile, indicating translation and bioenergetic shutdown. Nerves also regulate basic cellular functions of non‐neoplastic epithelial cells. Conclusion Nerves play a role in the homeostasis of normal epithelial tissues and are involved in prostate cancer tumor survival. This study confirms that interactions between human cancer and nerves are essential to disease progression. This work may make a major impact in general cancer treatment strategies, as nerve/cancer interactions are likely important in other cancers as well. Targeting the neural microenvironment may represent a therapeutic approach for the treatment of human prostate cancer. PMID:29131367

Developmental Exposure to Estrogen Alters Differentiation and Epigenetic Programming in a Human Fetal Prostate Xenograft Model

PubMed Central

Saffarini, Camelia M.; McDonnell-Clark, Elizabeth V.; Amin, Ali; Huse, Susan M.; Boekelheide, Kim

2015-01-01

Prostate cancer is the most frequent non-cutaneous malignancy in men. There is strong evidence in rodents that neonatal estrogen exposure plays a role in the development of this disease. However, there is little information regarding the effects of estrogen in human fetal prostate tissue. This study explored early life estrogen exposure, with and without a secondary estrogen and testosterone treatment in a human fetal prostate xenograft model. Histopathological lesions, proliferation, and serum hormone levels were evaluated at 7, 30, 90, and 200-day time-points after xenografting. The expression of 40 key genes involved in prostatic glandular and stromal growth, cell-cycle progression, apoptosis, hormone receptors and tumor suppressors was evaluated using a custom PCR array. Epigenome-wide analysis of DNA methylation was performed on whole tissue, and laser capture-microdissection (LCM) isolated epithelial and stromal compartments of 200-day prostate xenografts. Combined initial plus secondary estrogenic exposures had the most severe tissue changes as revealed by the presence of hyperplastic glands at day 200. Gene expression changes corresponded with the cellular events in the KEGG prostate cancer pathway, indicating that initial plus secondary exposure to estrogen altered the PI3K-Akt signaling pathway, ultimately resulting in apoptosis inhibition and an increase in cell cycle progression. DNA methylation revealed that differentially methylated CpG sites significantly predominate in the stromal compartment as a result of estrogen-treatment, thereby providing new targets for future investigation. By using human fetal prostate tissue and eliminating the need for species extrapolation, this study provides novel insights into the gene expression and epigenetic effects related to prostate carcinogenesis following early life estrogen exposure. PMID:25799167

Increased choline uptake in macrophages and prostate cancer cells does not allow for differentiation between benign and malignant prostate pathologies.

PubMed

Schwarz, Timo; Seidl, Christof; Schiemann, Matthias; Senekowitsch-Schmidtke, Reingard; Krause, Bernd Joachim

2016-06-01

Inflammatory cells may contribute to the choline uptake in different prostate pathologies. The aim of this study was (i) to assess if inflammatory cells incorporate choline and (ii) to potentially detect differences compared to FDG uptake. Therefore we investigated the uptake of [(3)H]choline and [(18)F]FDG in human prostate carcinoma cells and human inflammatory cells. Macrophages were cultured from isolated mononuclear cells, gained by density gradient centrifugation of human buffy coats. T-lymphocytes, B-lymphocytes and granulocytes were enriched by density gradient centrifugation before cell sorting by means of flow cytometry was performed. [(3)H]choline and [(18)F]FDG uptake of isolated inflammatory cells as well as of LNCaP and PC-3 human prostate carcinoma cells was assessed simultaneously in dual tracer uptake experiments. Macrophages showed highest [(3)H]choline and [(18)F]FDG uptake compared to the tracer uptake rates of leukocytes. [(3)H]choline uptake of macrophages was in the same range as in prostate cancer cells. Lipopolysaccharide stimulation of macrophages resulted in an increase of [(18)F]FDG uptake in macrophages, but not in an increased [(3)H]choline uptake. The high [(3)H]choline uptake in macrophages may be a source of false-positive PET results in diagnosis of prostate cancer by choline-PET/CT. As already known from FDG-PET, discrimination between tumor and inflammation in prostate cancer patients is not possible via choline-PET. The application of choline-PET for reliable primary prostate cancer detection and delineation has to be queried. Copyright © 2016 Elsevier Inc. All rights reserved.

Expression of single-chain Fv gene specific for gamma-seminoprotein by RTS and its biological activity identification.

PubMed

Han, Yuedong; Haun, Yi; Deng, Jinlan; Gao, Feng; Pan, Bifeng; Cui, Daxiang

2006-01-01

Fabricating a single-chain variable fragment specific for human seminoprotein is very important in antibody-directed enzyme prodrug therapy and NMR imaging for prostate cancer. Here a single-chain Fv specific for gamma-seminoprotein was expressed by RTS. Its activity and the efficiency of entry into prostate cancer cells are investigated by immunoprecipitation and Western blotting and immunofluorescent staining, as well as entry of conjugated magnetic beads into cells. Results showed that ScFv peptides specific for gamma-seminoprotein were successfully prepared, which can bind with the prostate cells specifically and can bring magnetic beads into prostate cancer cells within 15 min, the amount of magnetic beads inside prostate cancer cells increased as the culture time prolonged. ScFv-conjugated magnetic beads did not enter into control cells. In conclusion, the ScFv peptide against human gamma-seminoprotein with biological activity was successfully fabricated, which can take magnetic beads to prostate cancer cells specifically and not to the control cells. This ScFv peptide against human gamma-seminoprotein should be useful in improving the detection and therapy of prostate cancer at early stages and NMR imaging.

Pharmacologic basis for the enhanced efficacy of dutasteride against prostatic cancers.

PubMed

Xu, Yi; Dalrymple, Susan L; Becker, Robyn E; Denmeade, Samuel R; Isaacs, John T

2006-07-01

Prostatic dihydrotestosterone (DHT) concentration is regulated by precursors from systemic circulation and prostatic enzymes of androgen metabolism, particularly 5alpha-reductases (i.e., SRD5A1 and SRD5A2). Therefore, the levels of expression SRD5A1 and SRD5A2 and the antiprostatic cancer growth response to finasteride, a selective SRD5A2 inhibitor, versus the dual SRD5A1 and SRD5A2 inhibitor, dutasteride, were compared. Real-time PCR and enzymatic assays were used to determine the levels of SRD5A1 and SRD5A2 in normal versus malignant rat and human prostatic tissues. Rats bearing the Dunning R-3327H rat prostate cancer and nude mice bearing LNCaP or PC-3 human prostate cancer xenografts were used as model systems. Tissue levels of testosterone and DHT were determined using liquid chromatography-mass spectrometry. Prostate cancer cells express undetectable to low levels of SRD5A2 but elevated levels of SRD5A1 activity compared with nonmalignant prostatic tissue. Daily oral treatment of rats with the SRD5A2 selective inhibitor, finasteride, reduces prostate weight and DHT content but did not inhibit R-3327H rat prostate cancer growth or DHT content in intact (i.e., noncastrated) male rats. In contrast, daily oral treatment with even a low 1 mg/kg/d dose of the dual SRD5A1 and SRD5A2 inhibitor, dutasteride, reduces both normal prostate and H tumor DHT content and weight in intact rats while elevating tissue testosterone. Daily oral treatment with finasteride significantly (P < 0.05) inhibits growth of LNCaP human prostate cancer xenografts in intact male nude mice, but this inhibition is not as great as that by equimolar oral dosing with dutasteride. This anticancer efficacy is not equivalent, however, to that produced by castration. Only combination of dutasteride and castration produces a greater tumor inhibition (P < 0.05) than castration monotherapy against androgen-responsive LNCaP cancers. In contrast, no response was induced by dutasteride in nude mice bearing androgen-independent PC-3 human prostatic cancer xenografts. These results document that testosterone is not as potent as DHT but does stimulate prostate cancer growth, thus combining castration with dutasteride enhances therapeutic efficacy.

Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

PubMed

Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

2011-10-01

Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

Epidermal Growth Factor Increases LRF/Pokemon Expression in Human Prostate Cancer Cells

PubMed Central

Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K.

2011-01-01

Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

Neurotensin is an autocrine trophic factor stimulated by androgen withdrawal in human prostate cancer.

PubMed Central

Sehgal, I; Powers, S; Huntley, B; Powis, G; Pittelkow, M; Maihle, N J

1994-01-01

After therapeutic hormone deprivation, prostate cancer cells often develop androgen-insensitive growth through mechanisms thus far undefined. Neuropeptides have been previously implicated as growth factors in some prostate cancers. Here, we demonstrate that androgen-sensitive LNCaP human prostate cancer cells produce and secrete neurotensin following androgen withdrawal. We show that while LNCaP cells express the neurotensin receptor, only androgen-deprived cells exhibit a growth response to exogenous neurotensin. We further demonstrate that androgen-stimulated cells may be refractory to exogenous neurotensin due to androgen induction of a metalloprotease active toward neurotensin. Thus, prostate cancer cells deprived of androgen develop an alternative autocrine growth mechanism involving neurotensin. Images PMID:8197117

Tracking and Functional Characterization of Epithelial-Mesenchymal Transition and Mesenchymal Tumor Cells During Prostate Cancer Metastasis

PubMed Central

Ruscetti, Marcus; Quach, Bill; Dadashian, Eman L.; Mulholland, David J.; Wu, Hong

2015-01-01

The epithelial-mesenchymal transition (EMT) has been postulated as a mechanism by which cancer cells acquire the invasive and stem-like traits necessary for distant metastasis. However, direct in vivo evidence for the role of EMT in the formation of cancer stem-like cells (CSC) and the metastatic cascade remains lacking. Here we report the first isolation and characterization of mesenchymal and EMT tumor cells, which harbor both epithelial and mesenchymal characteristics, in an autochthonous murine model of prostate cancer. By crossing the established Pb-Cre+/−;PtenL/L;KrasG12D/+ prostate cancer model with a vimentin-GFP reporter strain, generating CPKV mice, we were able to isolate epithelial, EMT and mesenchymal cancer cells based on expression of vimentin and EpCAM. CPKV mice (but not mice with Pten deletion alone) exhibited expansion of cells with EMT (EpCAM+/Vim-GFP+) and mesenchymal (EpCAM−/Vim-GFP+) characteristics at the primary tumor site and in circulation. These EMT and mesenchymal tumor cells displayed enhanced stemness and invasive character compared to epithelial tumor cells. Moreover, they displayed an enriched tumor-initiating capacity and could regenerate epithelial glandular structures in vivo, indicative of epithelia-mesenchyme plasticity. Interestingly, while mesenchymal tumor cells could persist in circulation and survive in the lung following intravenous injection, only epithelial and EMT tumor cells could form macrometastases. Our work extends the evidence that mesenchymal and epithelial states in cancer cells contribute differentially to their capacities for tumor initiation and metastatic seeding, respectively, and that EMT tumor cells exist with plasticity that can contribute to multiple stages of the metastatic cascade. PMID:25948589

Chronic bacterial prostatitis in men with spinal cord injury.

PubMed

Krebs, Jörg; Bartel, Peter; Pannek, Jürgen

2014-12-01

Recurrent urinary tract infections (UTI) are a major problem affecting spinal cord injury (SCI) patients and may stem from chronic bacterial prostatitis. We have therefore investigated the presence of chronic bacterial prostatitis and its role in the development of recurrent symptomatic UTI in SCI men. This study is a prospective cross-sectional investigation of bacterial prostatitis in SCI men in a single SCI rehabilitation center. In 50 men with chronic SCI presenting for a routine urologic examination, urine samples before and after prostate massage were taken for microbiologic investigation and white blood cell counting. Furthermore, patient characteristics, bladder diary details, and the annual rate of symptomatic UTI were collected retrospectively. No participant reported current symptoms of UTI or prostatitis. In most men (39/50, 78 %), the microbiologic analysis of the post-massage urine sample revealed growth of pathogenic bacteria. The majority of these men (32/39, 82 %) also presented with mostly (27/39, 69 %) the same pathogenic bacteria in the pre-massage sample. There was no significant (p = 0.48) difference in the number of symptomatic UTI in men with a positive post-massage culture compared with those with a negative culture. No significant (p = 0.67) difference in the frequency distribution of positive versus negative post-massage cultures was detected between men with recurrent and sporadic UTI. Most SCI men are affected by asymptomatic bacterial prostatitis; however, bacterial prostatitis does not play a major role in the development of recurrent UTI. The indication for antibiotic treatment of chronic bacterial prostatitis in asymptomatic SCI men with recurrent UTI is questionable.

Identification of Novel Prostate Cancer-Causitive Gene Mutations by Representational Difference Analysis of Microdissected Prostate Cancer

DTIC Science & Technology

2001-03-01

paired samples of microdissected benign and malignant prostate epithelium. The resulting subtraction products were cloned and screened in Southern blots... benign and malignant human prostate cancer. Data is given to show that microdissected tissue samples retain RNA of sufficient quality to perform gene

Orphan nuclear receptor TLX contributes to androgen insensitivity in castration-resistant prostate cancer via its repression of androgen receptor transcription.

PubMed

Jia, Lin; Wu, Dinglan; Wang, Yuliang; You, Wenxing; Wang, Zhu; Xiao, Lijia; Cai, Ganhui; Xu, Zhenyu; Zou, Chang; Wang, Fei; Teoh, Jeremy Yuen-Chun; Ng, Chi-Fai; Yu, Shan; Chan, Franky L

2018-03-20

The metastatic castration-resistant prostate cancer (CRPC) is a lethal form of prostate cancer, in which the expression of androgen receptor (AR) is highly heterogeneous. Indeed, lower AR expression and attenuated AR signature activity is shown in CRPC tissues, especially in the subset of neuroendocrine prostate cancer (NEPC) and prostate cancer stem-like cells (PCSCs). However, the significance of AR downregulation in androgen insensitivity and de-differentiation of tumor cells in CRPC is poorly understood and much neglected. Our previous study shows that the orphan nuclear receptor TLX (NR2E1), which is upregulated in prostate cancer, plays an oncogenic role in prostate carcinogenesis by suppressing oncogene-induced senescence. In the present study, we further established that TLX exhibited an increased expression in metastatic CRPC. Further analyses showed that overexpression of TLX could confer resistance to androgen deprivation and anti-androgen in androgen-dependent prostate cancer cells in vitro and in vivo, whereas knockdown of endogenous TLX could potentiate the sensitivity to androgen deprivation and anti-androgen in prostate cancer cells. Our study revealed that the TLX-induced resistance to androgen deprivation and anti-androgen was mediated through its direct suppression of AR gene transcription and signaling in both androgen-stimulated and -unstimulated prostate cancer cells. We also characterized that TLX could bind directly to AR promoter and repress AR transcription by recruitment of histone modifiers, including HDAC1, HDAC3, and LSD1. Together, our present study shows, for the first time, that TLX can contribute to androgen insensitivity in CRPC via repression of AR gene transcription and signaling, and also implicates that targeting the druggable TLX may have a potential therapeutic significance in CRPC management, particularly in NEPC and PCSCs.

Identification of the G protein-coupled estrogen receptor (GPER) in human prostate: expression site of the estrogen receptor in the benign and neoplastic gland.

PubMed

Rago, V; Romeo, F; Giordano, F; Ferraro, A; Carpino, A

2016-01-01

Estrogens are involved in growth, differentiation and pathogenesis of human prostate through the mediation of the classical estrogen receptors ERα and ERβ. The G protein-coupled estrogen receptor (GPER) is a 'novel' mediator of estrogen signaling which has been recently recognized in some human reproductive tissues, but its expression in the prostate gland is still unknown. Here, we investigated GPER in benign (from 5 patients) and neoplastic prostatic tissues (from 50 patients) by immunohistochemical analysis and Western blotting. Normal areas of benign prostates revealed a strong GPER immunoreactivity in the basal epithelial cells while luminal epithelial cells were unreactive and stromal cells were weakly immunostained. GPER was also immunolocalized in adenocarcinoma samples but the immunoreactivity of tumoral areas decreased from Gleason pattern 2 to Gleason pattern 4. Furthermore, a strong GPER immunostaining was also revealed in cells of pre-neoplastic lesions (high-grade prostatic intra-epithelial neoplasia). Western blot analysis of benign and tumor protein extracts showed the presence of a ~42 kDa band, consistent with the GPER molecular weight. An increase in both pAkt and p cAMP-response-binding protein (pCREB) levels was also observed in poorly differentiated PCa samples. Finally, this work identified GPER in the epithelial basal cells of benign human prostate, with a different localization with respect to the classical estrogen receptors. Furthermore, the expression of GPER in prostatic adenocarcinoma cells was also observed but with a modulation of the immunoreactivity according to tumor cell arrangements. © 2015 American Society of Andrology and European Academy of Andrology.

Formononetin promotes cell cycle arrest via downregulation of Akt/Cyclin D1/CDK4 in human prostate cancer cells.

PubMed

Li, Tianyu; Zhao, Xinge; Mo, Zengnan; Huang, Weihua; Yan, Haibiao; Ling, Zhian; Ye, Yu

2014-01-01

Formononetin is an O-methylated isoflavone isolated from the root of Astragalus membranaceus. It has already been reported that formononetin could inhibit cell proliferation and induce cell apoptosis in several cancers, including prostate cancer. This study aimed to further investigate whether cell cycle arrest is involved in formononetin-mediated antitumor effect in human prostate cancer cells, along with the underlying molecular mechanism. Human prostate cancer cells PC-3 and DU145 were respectively treated with various concentrations of formononetin. The inhibitory effect of formononetin on proliferation of prostate cancer cells was determined using MTT assays and flow cytometry. Next, formononetin-induced alterations in cyclin D1, CDK4 and Akt expression in PC-3 cells were detected by real-time PCR and western blot. Formononetin dose-dependently inhibited prostate cancer cell proliferation via the induction of cell cycle arrest at G0/G1 phase in vitro, which was more evident in PC-3 cells. Meanwhile, concomitant with reduced phosphorylation of Akt in PC-3 cells, formononetin remarkably downregulated expression levels of cyclin D1 and CDK4 in a dose-dependent manner. More interestingly, in the in vivo studies, formononetin showed a noticeable inhibition of tumor growth in recipient mice. Formononetin could exhibit inhibitory activity against human prostate cancer cells in vivo and in vitro, which is associated with G1 cell cycle arrest by inactivation of Akt/cyclin D1/CDK4. Therefore, formononetin may be used as a candidate agent for clinical treatment of prostate cancer in the future.

Epigenetic Regulation of Vitamin D 24-Hydroxylase/CYP24A1 in Human Prostate Cancer

PubMed Central

Luo, Wei; Karpf, Adam R.; Deeb, Kristin K.; Muindi, Josephia R.; Morrison, Carl D.; Johnson, Candace S.; Trump, Donald L.

2010-01-01

Calcitriol, a regulator of calcium homeostasis with antitumor properties, is degraded by the product of the CYP24A1 gene which is downregulated in human prostate cancer by unknown mechanisms. We found that CYP24A1 expression is inversely correlated with promoter DNA methylation in prostate cancer cell lines. Treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CYP24A1 expression in prostate cancer cells. In vitro methylation of the CYP24A1 promoter represses its promoter activity. Furthermore, inhibition of histone deacetylases by trichostatin A (TSA) enhances the expression of CYP24A1 in prostate cancer cells. ChIP-qPCR reveals that specific histone modifications are associated with the CYP24A1 promoter region. Treatment with TSA increases H3K9ac and H3K4me2 and simultaneously decreases H3K9me2 at the CYP24A1 promoter. ChIP-qPCR assay reveals that treatment with DAC and TSA increases the recruitment of VDR to the CYP24A1 promoter. RT-PCR analysis of paired human prostate samples reveals that CYP24A1 expression is down-regulated in prostate malignant lesions compared to adjacent histologically benign lesions. Bisulfite pyrosequencing shows that CYP24A1 gene is hypermethylated in malignant lesions compared to matched benign lesions. Our findings indicate that repression of CYP24A1 gene expression in human prostate cancer cells is mediated in part by promoter DNA methylation and repressive histone modifications. PMID:20587525

The association between local atherosclerosis of the prostatic artery and benign prostatic enlargement in humans: Putative mechanism of chronic ischemia for prostatic enlargement.

PubMed

Haga, Nobuhiro; Akaihata, Hidenori; Hata, Junya; Aikawa, Ken; Yanagida, Tomohiko; Matsuoka, Kanako; Koguchi, Tomoyuki; Hoshi, Seiji; Ogawa, Soichiro; Kataoka, Masao; Sato, Yuichi; Ishibashi, Kei; Suzuki, Osamu; Hashimoto, Yuko; Kojima, Yoshiyuki

2018-05-21

To investigate the possible pathogenesis of the benign prostatic enlargement (BPE) induced by local atherosclerosis, the association between local atherosclerosis and prostatic enlargement was investigated, and molecular biological analyses were performed using human prostatectomy specimens. A total of 69 consecutive patients who underwent robot-assisted radical prostatectomy (RARP) participated in this prospective study. To evaluate actual local atherosclerosis, prostatic arteries were removed during RARP. Microscopic assessment of local atherosclerosis was classified as one of three degrees of narrowing (minimal, moderate, and severe) according to the degree of obstruction of the inner cavity of the prostatic artery. The expressions of several mediators related to chronic ischemia and cell proliferation of the prostate were investigated by immunohistochemistry. The median age of the present cohort was 68 (range: 55-75) years. Although there was no relationship between local atherosclerosis and lower urinary symptoms evaluated by questionnaires, local atherosclerosis was significantly more severe in patients who had a history of treatment for benign prostatic hyperplasia (P = 0.02). Prostate size was significantly larger in the severe local atherosclerosis group than in the minimal and moderate local atherosclerosis groups (P < 0.001 and P = 0.03, respectively). Thepositive expression rates of hypoxia-inducible factor (HIF)-1α, malondialdehyde (MDA), transforming growth factor (TGF)-β 1 , and basic fibroblast growth factor (bFGF) in the prostate were significantly higher in patients with local atherosclerosis than in patients without local atherosclerosis (all P < 0.01, respectively). In human surgical specimens, there is evidence that local atherosclerosis of the prostatic artery is significantly associated with prostate size. Given the molecular evidence provided in this study, the putative mechanism for this relationship is that chronic ischemia induced upregulation of oxidative stress pathways, leading to BPE. © 2018 Wiley Periodicals, Inc.

Establishment of prostate cancer spheres from a prostate cancer cell line after phenethyl isothiocyanate treatment and discovery of androgen-dependent reversible differentiation between sphere and neuroendocrine cells.

PubMed

Chen, Yamei; Cang, Shundong; Han, Liying; Liu, Christina; Yang, Patrick; Solangi, Zeeshan; Lu, Quanyi; Liu, Delong; Chiao, J W

2016-05-03

Prostate cancer can transform from androgen-responsive to an androgen-independent phenotype. The mechanism responsible for the transformation remains unclear. We studied the effects of an epigenetic modulator, phenethyl isothiocyanate (PEITC), on the androgen-responsive LNCaP cells. After treatment with PEITC, floating spheres were formed with characteristics of prostate cancer stem cells (PCSC). These spheres were capable of self-renewal in media with and without androgen. They have been maintained in both types of media as long term cultures. Upon androgen deprivation, the adherent spheres differentiated to neuroendocrine cells (NEC) with decreased proliferation, expression of androgen receptor, and PSA. NEC reverse differentiated to spheres when androgen was replenished. The sphere cells expressed surface marker CD44 and had enhanced histone H3K4 acetylation, DNMT1 down-regulation and GSTP1 activation. We hypothesize that PEITC-mediated alteration in epigenomics of LNCaP cells may give rise to sphere cells, whereas reversible androgenomic alterations govern the shuttling between sphere PCSC and progeny NEC. Our findings identify unrecognized properties of prostate cancer sphere cells with multi-potential plasticity. This system will facilitate development of novel therapeutic agents and allow further exploration into epigenomics and androgenomics governing the transformation to hormone refractory prostate cancer.

XMRV Discovery and Prostate Cancer-Related Research.

PubMed

Kang, David E; Lee, Michael C; Das Gupta, Jaydip; Klein, Eric A; Silverman, Robert H

2011-01-01

Xenotropic murine leukemia virus-related virus (XMRV) was first reported in 2006 in a study of human prostate cancer patients with genetic variants of the antiviral enzyme, RNase L. Subsequent investigations in North America, Europe, Asia, and Africa have either observed or failed to detect XMRV in patients (prostate cancer, chronic fatigue syndrome-myalgic encephalomyelitis (CFS-ME), and immunosuppressed with respiratory tract infections) or normal, healthy, control individuals. The principal confounding factors are the near ubiquitous presence of mouse-derived reagents, antibodies and cells, and often XMRV itself, in laboratories. XMRV infects and replicates well in many human cell lines, but especially in certain prostate cancer cell lines. XMRV also traffics to prostate in a nonhuman primate model of infection. Here, we will review the discovery of XMRV and then focus on prostate cancer-related research involving this intriguing virus.

Regressive changes in finasteride-treated human hyperplastic prostates correlate with an upregulation of TGF-beta receptor expression.

PubMed

Sáez, C; González-Baena, A C; Japón, M A; Giráldez, J; Segura, D I; Miranda, G; Rodríguez-Vallejo, J M; González-Esteban, J; Torrubia, F

1998-10-01

Prostatic atrophy has been documented histologically as a consequence of finasteride action on human hyperplastic prostates. An increase in apoptotic rates has also been reported in androgen-deprived hyperplastic prostates. Transforming growth factor beta (TGF-beta) signaling is implicated in apoptotic cell death. TGF-betas have been detected in normal and diseased human prostate. In the normal prostate, TGF-beta acts as a predominantly negative growth regulator. TGF-beta signaling receptors TbetaRI and TbetaRII have been shown to be negatively regulated by androgens. We studied the histological changes in 9 selected finasteride-treated patients with benign prostatic hyperplasia (BPH), and analyzed the levels of expression and localization of TGF-beta receptor types TbetaRI and TbetaRII in these patients as compared to selected BPH controls. The prostatic epithelial compartment seemed to be a primary target site for finasteride action, since we observed moderate to severe glandular atrophy after 4-6 months of treatment. TGF-beta receptors were upregulated in treated cases. We assessed a twofold increase in TbetaRII mRNA levels in treated cases as compared to controls. An increase in both TbetaRI and TbetaRII at the protein level by immunostaining was observed, which also provided a helpful means for detecting glands undergoing regression. We conclude that finasteride may modulate the TGF-beta signaling system to promote changes leading to apoptosis of epithelial cells and prostatic glandular atrophy.

Evaluation of NKX3.1 and C-MYC expression in canine prostatic cancer.

PubMed

Fonseca-Alves, Carlos Eduardo; Kobayashi, Priscila Emiko; Laufer-Amorim, Renée

2018-06-01

NKX3.1/C-MYC cross-regulation has been reported in the normal human prostate, and loss of NKX3.1 and gain of C-MYC seem to be important events in prostate cancer development and progression. The dog can be an interesting model for human prostatic disease, and yet only one previous research study has shown deregulation of NKX3.1 and MYC in the canine prostate. To address the expression of NKX3.1 and C-MYC in different canine prostatic lesions, this study verified the gene and protein expression of NKX3.1 and C-MYC in normal canine prostatic tissues. We identified a 26 kDa band that corresponded to the NKX3.1 protein, while C-MYC showed a 50 kDa band on Western blotting analysis of all prostatic tissues. We observed that NKX3.1 protein and transcript were down-regulated in prostate cancer (PC) samples compared with non-neoplastic samples. We also observed that C-MYC protein was overexpressed in PC samples compared with normal (P = .001) and proliferative inflammatory atrophy (PIA) samples (P = .003). We found a positive correlation between NKX3.1 and C-MYC protein expression in normal and PIA samples. Interestingly, a negative correlation (NKX3.1 downregulation and MYC overexpression) was observed between NKX3.1 and MYC transcripts in PC. Thus, samples with higher C-MYC expression also exhibited higher NKX3.1 expression, which indicates the regulation of C-MYC by NKX3.1 protein. As in humans, these two genes and proteins were found to be related to canine prostate cancer. However, in contrast from what is observed in humans, in canine PC samples, the downregulation of NKX3.1 cannot be explained by DNA hypermethylation. Copyright © 2018 Elsevier Ltd. All rights reserved.

The therapeutic effects of docosahexaenoic acid on oestrogen/androgen-induced benign prostatic hyperplasia in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chao; Luo, Fei; Zhou, Ying

Benign prostatic hyperplasia (BPH) is one of the major disorders of the urinary system in elderly men. Docosahexaenoic acid (DHA) is the main component of n-3 polyunsaturated fatty acids (n-3 PUFAs) and has nerve protective, anti-inflammatory and tumour-growth inhibitory effects. Here, the therapeutic potential of DHA in treating BPH was investigated. Seal oil effectively prevented the development of prostatic hyperplasia induced by oestradiol/testosterone in a rat model by suppressing the increase of the prostatic index (PI), reducing the thickness of the peri-glandular smooth muscle layer, inhibiting the proliferation of both prostate epithelial and stromal cells, and downregulating the expression ofmore » androgen receptor (AR) and oestrogen receptor α (ERα). An in vitro study showed that DHA inhibited the growth of the human prostate stromal cell line WPMY-1 and the epithelial cell line RWPE-1 in a dose- and time-dependent manner. In both cell lines, the DHA arrested the cell cycle in the G2/M phase. In addition, DHA also reduced the expression of ERα and AR in the WPMY-1 and RWPE-1 cells. These results indicate that DHA inhibits the multiplication of prostate stromal and epithelial cells through a mechanism that may involve cell cycle arrest and the downregulation of ERα and AR expression. - Highlights: • Seal oil prevents oestradiol/testosterone (E2/T)-induced BPH in castrated rats. • Seal oil downregulates the expression of oestrogen receptor α(ERα) and androgen receptor (AR) in rat BPH tissues. • DHA inhibits the growth of human prostate stromal and epithelial cells in vitro. • DHA arrests human prostate stromal and epithelial cells in the G2/M phase and downregulates the expression of cyclin B1. • DHA inhibits the expression of ERα and AR in human prostate stromal and epithelial cells.« less

Losartan sensitizes selectively prostate cancer cell to ionizing radiation.

PubMed

Yazdannejat, H; Hosseinimehr, S J; Ghasemi, A; Pourfallah, T A; Rafiei, A

2016-01-11

Losartan is an angiotensin II receptor (AT-II-R) blocker that is widely used by human for blood pressure regulation. Also, it has antitumor property. In this study, we investigated the radiosensitizing effect of losartan on cellular toxicity induced by ionizing radiation on prostate cancer and non-malignant fibroblast cells. Human prostate cancer (DU-145) and human non-malignant fibroblast cells (HFFF2) were treated with losartan at different concentrations (0.5, 1, 10, 50 and 100 µM) and then these cells were exposed to ionizing radiation. The cell proliferation was determined using MTT assay. Our results showed that losartan exhibited antitumor effect on prostate cancer cells; it was reduced cell survival to 66% at concentration 1 µM. Losartan showed an additive killing effect in combination with ionizing radiation on prostate cancer cell. The cell proliferation was reduced to 54% in the prostate cancer cells treated with losartan at concentration 1 µM in combination with ionizing radiation. Losartan did not exhibit any toxicity on HFFF2 cell. This result shows a promising effect of losartan on enhancement of therapeutic effect of ionizing radiation in patients during therapy.

Carcinogenic effects of cadmium in the noble (NBL/Cr) rat: induction of pituitary, testicular, and injection site tumors and intraepithelial proliferative lesions of the dorsolateral prostate.

PubMed

Waalkes, M P; Anver, M; Diwan, B A

1999-12-01

Cadmium is a known human carcinogen based on findings of lung cancer in exposed populations. A more controversial target site for cadmium is the human prostate gland, for which some studies indicate a link between cadmium exposure and cancer. Our work in various strains of Wistar rats has shown that cadmium can induce tumors in the ventral lobe of the prostate. The relevance of this type of lesion to human prostate cancer has been questioned because the ventral lobe of the rat prostate, unlike the dorsolateral lobe, has no embryological homolog in the human gland. In this study we investigated the chronic toxic and carcinogenic effects of cadmium in the Noble (NBL/Cr) rat, with particular attention to lesions of the prostate. Cadmium chloride (CdCl2) was given as a single sc injection (0, 1, 2, 4, 8, 16, or 32 micromol/kg) to groups (initially n = 30) of 10-week-old rats. Rats were observed for up to 72 weeks following exposure. In rats that were injected with the lower doses of cadmium (< or =4 micromol/kg), a clear dose-related increase in proliferative lesions of the dorsolateral prostate occurred (0 micromol/kg = 36% incidence, 1 micromol/kg = 62%, 2 micromol/kg = 65%; 4 micromol/kg = 79%; trend p < 0.003). Lesions were described as intraepithelial hyperplasia with occasional areas of atypical epithelial cells, without stromal invasion. At higher doses (> or =8 micromol/kg) the proliferative-lesion response in the dorsolateral prostate gradually declined to near control levels (8 micromol/kg = 63%; 16 micromol/kg = 60%; 32 micromol/kg = 52%). The loss of prostatic response at the higher doses of cadmium was probably due to loss of testicular function secondary to cadmium treatment. This was reflected in a very high incidence (>90%) of lesions, indicative of testicular hypofunction, including tubular degeneration, mineralization, and interstitial (Leydig) cell tumors, at doses in excess of 16 micromol/kg. Malignant injection-site sarcomas occurred at the two highest doses of cadmium, while pituitary adenomas were elevated by cadmium exposure at the highest dose. These results show that cadmium induces proliferative lesions in the dorsolateral prostate of the Noble rat, a model having a presumed relevance to human prostate cancers.

Mapping MRI/MRS Parameters with Genetic Over-expression Profiles In Human Prostate Cancer: Demonstrating the Potential

PubMed Central

Lenkinski, Robert E.; Bloch, B. Nicholas; Liu, Fangbing; Frangioni, John V.; Perner, Sven; Rubin, Mark A.; Genega, Elizabeth; Rofsky, Neil M.; Gaston, Sandra M.

2009-01-01

Magnetic resonance imaging (MRI) and MR spectroscopy can probe a variety of physiological (e.g. blood vessel permeability) and metabolic characteristics of prostate cancer. However, little is known about the changes in gene expression that underlie the spectral and imaging features observed in prostate cancer. Tumor induced changes in vascular permeability and angiogenesis are thought to contribute to patterns of dynamic contrast enhanced (DCE) MRI images of prostate cancer even though the genetic basis of tumor vasculogenesis is complex and the specific mechanisms underlying these DCEMRI features have not yet been determined. In order to identify the changes in gene expression that correspond to MRS and DCEMRI patterns in human prostate cancers, we have utilized tissue print micropeel techniques to generate “whole mount” molecular maps of radical prostatectomy specimens that correspond to pre-surgical MRI/MRS studies. These molecular maps include RNA expression profiles from both Affymetrix GeneChip microarrays and quantitative reverse transcriptase PCR (qrt-PCR) analysis, as well as immunohistochemical studies. Using these methods on patients with prostate cancer, we found robust over-expression of choline kinase a in the majority of primary tumors. We also observed overexpression of neuropeptide Y (NPY), a newly identified angiogenic factor, in a subset of DCEMRI positive prostate cancers. These studies set the stage for establishing MRI/MRS parameters as validated biomarkers for human prostate cancer. PMID:18752015

Active Sonic Hedgehog Signaling between Androgen Independent Human Prostate Cancer Cells and Normal/Benign but Not Cancer-Associated Prostate Stromal Cells

PubMed Central

Shigemura, Katsumi; Huang, Wen-Chin; Li, Xiangyan; Zhau, Haiyen E.; Zhu, Guodong; Gotoh, Akinobu; Fujisawa, Masato; Xie, Jingwu; Marshall, Fray F.; Chung, Leland W. K.

2012-01-01

BACKGROUND Sonic hedgehog (Shh) signaling plays a pivotal role in stromal-epithelial interaction during normal development but its role in tumor-stromal interaction during carcinogenic progression is less well defined. Since hormone refractory prostate cancer with bone metastasis is difficult to treat, it is crucial to investigate how androgen independent (AI) human prostate cancer cells communicate with their associated stroma. METHODS Shh and its target transcription factor, Gli1 mRNA, were assessed by RT-PCR and/or quantitative RT-PCR in co-cultured cell recombinants comprised of AI C4-2 either with NPF (prostate fibroblasts from normal/benign prostate gland) or CPF cancer-associated stromal fibroblasts) under Shh/cyclopamine (a hedgehog signaling inhibitor) treatment. Human bone marrow stromal (HS27A) cells were used as controls. In vivo investigation was performed by checking serum PSA and immunohistochemical staining for the apoptosis-associated M30 gene in mice bearing chimeric C4-2/NPF tumors. RESULTS CONCLUSIONS Based on co-culture and chimeric tumor models, active Shh-mediated signaling was demonstrated between AI prostate cancer and NPF in a paracrine- and tumor progression-dependent manner. Our study suggests that drugs like cyclopamine that interfere with Shh signaling could be beneficial in preventing AI progression in prostate cancer cells. PMID:21520153

A Small Molecule Polyamine Oxidase Inhibitor Blocks Androgen-Induced Oxidative Stress and Delays Prostate Cancer Progression in the TRAMP Mouse Model

PubMed Central

Basu, Hirak S.; Thompson, Todd A.; Church, Dawn R.; Clower, Cynthia C.; Mehraein-Ghomi, Farideh; Amlong, Corey A.; Martin, Christopher T.; Woster, Patrick M.; Lindstrom, Mary J.; Wilding, George

2009-01-01

High levels of reactive oxygen species (ROS) present in human prostate epithelia are an important etiological factor in prostate cancer (CaP) occurrence, recurrence and progression. Androgen induces ROS production in the prostate by a yet unknown mechanism. Here, to the best of our knowledge, we report for the first time that androgen induces an overexpression of spermidine/spermine N1-acetyltransferase (SSAT), the rate-limiting enzyme in the polyamine oxidation pathway. As prostatic epithelia produce a large excess of polyamines, the androgen-induced polyamine oxidation that produces H2O2 could be a major reason for the high ROS levels in the prostate epithelia. A small molecule polyamine oxidase inhibitor N,N'-butanedienyl butanediamine (MDL 72,527 or CPC-200) effectively blocks androgen-induced ROS production in human CaP cells as well as significantly delays CaP progression and death in animals developing spontaneous CaP. These data demonstrate that polyamine oxidation is not only a major pathway for ROS production in prostate, but inhibiting this pathway also successfully delays prostate cancer progression. PMID:19773450

Highly Disordered Proteins in Prostate Cancer.

PubMed

Uversky, Vladimir N; Na, Insung; Landau, Kevin S; Schenck, Ryan O

2017-01-01

Prostate cancer is one of the major threats to the man's health. There are several mechanisms of the prostate cancer development characterized by the involvement of various androgen-related and androgen-unrelated factors in prostate cancer pathogenesis and in the metastatic carcinogenesis of prostate. In all these processes, proteins play various important roles, and the KEGG database has information on 88 human proteins experimentally shown to be involved in prostate cancer. It is known that many proteins associated with different human maladies are intrinsically disordered (i.e., they do not have stable secondary and/or tertiary structure in their unbound states). The goal of this review is to consider several highly disordered proteins known to be associated with the prostate cancer pathogenesis in order to better understand the roles of disordered proteins in this disease. We also hope that consideration of the pathology-related proteins from the perspective of intrinsic disorder can potentially lead to future experimental studies of these proteins to find novel pathways associated with prostate cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The hedgehog/Gli signaling paradigm in prostate cancer

PubMed Central

Chen, Mengqian; Carkner, Richard; Buttyan, Ralph

2011-01-01

Hedgehog is a ligand-activated signaling pathway that regulates Gli-mediated transcription. Although most noted for its role as an embryonic morphogen, hyperactive hedgehog also causes human skin and brain malignancies. The hedgehog-related gene anomalies found in these tumors are rarely found in prostate cancer. Yet surveys of human prostate tumors show concordance of high expression of hedgehog ligands and Gli2 that correlate with the potential for metastasis and therapy-resistant behavior. Likewise, prostate cancer cell lines express hedgehog target genes, and their growth and survival is affected by hedgehog/Gli inhibitors. To date, the preponderance of data supports the idea that prostate tumors benefit from a paracrine hedgehog microenvironment similar to the developing prostate. Uncertainty remains as to whether hedgehog’s influence in prostate cancer also includes aspects of tumor cell autocrine-like signaling. The recent findings that Gli proteins interact with the androgen receptor and affect its transcriptional output have helped to identify a novel pathway through which hedgehog/Gli might affect prostate tumor behavior and raises questions as to whether hedgehog signaling in prostate cancer cells is suitably measured by the expression of Gli target genes alone. PMID:21776292

De novo steroid biosynthesis in human prostate cell lines and biopsies.

PubMed

Sakai, Monica; Martinez-Arguelles, Daniel B; Aprikian, Armen G; Magliocco, Anthony M; Papadopoulos, Vassilios

2016-05-01

Intratumoral androgen formation may be a factor in the development of prostate cancer (PCa), particularly castration-resistant prostate cancer (CRPC). To evaluate the ability of the human prostate to synthesize de novo steroids, we examined the expression of key enzymes and proteins involved in steroid biosynthesis and metabolism. Using TissueScan™ Cancer qPCR Arrays and quantitative RT-PCR, we performed comparative gene expression analyses between various prostate cell lines and biopsies, including normal, hyperplastic, cancerous, and androgen-deprived prostate cells lines, as well as normal, benign prostate hyperplasia (BPH), PCa, and CRPC human specimens. These studies were complemented with steroid biosynthesis studies in normal and BPH cells. Normal human prostate WPMY-1 and WPE1-NA22, benign prostate hyperplasia BPH-1, and cancer PC-3, LNCaP, and VCaP cell lines, as well as normal, BPH, PCa, and CRPC specimens, were used. Although all cell lines express mRNA encoding for hydroxymethylglutaryl-CoA reductase (HMGCR), the mitochondrial translocator protein TSPO and cholesterol side chain cleavage enzyme CYP11A1 were only observed in WPMY-1, BPH-1, and LNCaP cells. HSD3B1, HSD3B2, and CYP17A1 are involved in androgen formation and were not found in most cell lines. WPE1-NA22 and BPH-1 cells were unable to synthesize de novo steroids from mevalonate. Moreover, androgen-deprived cells did not have alterations in the expression of enzymes that could lead to de novo steroid formation. All prostate specimens expressed TSPO and CYP11A1. HSD3B1/2, CYP17A1, HSD17B5, and CYP19A1 mRNA expression was distinct to the profile observed in cells lines. The majority of BPH (90.9%) and PCa (83.1%) specimens contained CYP17A1, compared to control (normal) specimens (46.7%). BPH (82%), PCa (59%), normal (40%), and CRPC (34%) specimens expressed the four key enzymes that metabolize cholesterol to androgens. These studies question the use of prostate cell lines to study steroid biosynthesis and demonstrate that human prostate samples contain transcripts encoding for key steroidogenic enzymes and proteins indicating that they have the potential to synthesize de novo steroids. We propose CYP17A1 as a candidate enzyme that can be used for patient stratification and treatment in BPH and PCa. © 2016 Wiley Periodicals, Inc.

Prostatic specific antigen. From its early days until becoming a prostate cancer biomarker.

PubMed

Dellavedova, T

2016-01-01

Prostate-specific antigen (PSA) has been since the mid 80's the most commonly used biomarker for measuring current and future risk of prostate cancer, for its early detection and to measure response to treatments and detecting recurrence in all stages of the disease. PSA's early development came along with progress in the field of immunology, which allowed detection and study of antigens from different tissues and fluids when injecting them into rabbits to promote immune response. Rubin Flocks in 1960 was the first to investigate and discover prostate-specific antigens in benign and malignant tissue. Some years later, Hara, a Japanese forensic investigator, found 'gamma seminoprotein', that he used to detect human semen in rape cases. However, his work published in Japanese did not reach the Englishspeaking scientific community. In 1970 Ablin discovered both in prostatic fluid and tissue what he called "prostate-specific antigen", but he didn't characterize or describe it. Investigators Li and Beling, and Sensabaugh, approached the current PSA, but they were limited by available technology at that time. Dr T Ming Chu led a research team on prostate cancer in New York, USA and published their results in 1979. He finally received the patent for the discovery of "human purified prostate antigen" in 1984. Due to this work, the Food and Drug Administration (FDA), in USA, approved the use of PSA for monitoring recurrence after treatment. It was later known that PSA was not prostate-specific since it was produced in other tissues and fluids, but it was recognized that it was human species-specific. Works by Papsidero and Stamey showed new indications and utilities for PSA, but it was Catalona who first used it as a marker for prostate cancer in 1991. Thanks to these advances FDA authorized in 1994 the clinical use of PSA for early detection of prostate cancer.

Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing

PubMed Central

Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising

2011-01-01

Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633

Studies of rhodamine-123: effect on rat prostate cancer and human prostate cancer cells in vitro.

PubMed

Arcadi, J A; Narayan, K S; Techy, G; Ng, C P; Saroufeem, R M; Jones, L W

1995-06-01

The effect of the lipophilic, cationic dye, Rhodamine-123 (Rh-123), on prostate cancer in rats, and on three tumor cell lines in vitro is reported here. The general toxicity of Rh-123 in mice has been found to be minimal. Lobund-Wistar (L-W) rats with the autochthonous prostate cancer of Pollard were treated for six doses with Rh-123 at a dose of 15 mg/kg subcutaneously every other day. Microscopic examination of the tumors revealed cellular and acinar destruction. The effectiveness of Rh-123 as a cytotoxic agent was tested by clonogenic and viability assays in vitro with three human prostate cancer cell lines. Severe (60-95%) growth inhibition was observed following Rh-123 exposure for 2-5 days at doses as low as 1.6 micrograms/ml in all three prostate cancer cell lines.

Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

PubMed

Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

2014-12-01

Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.

Inhibition of Adrenergic and Non-Adrenergic Smooth Muscle Contraction in the Human Prostate by the Phosphodiesterase 10-Selective Inhibitor TC-E 5005.

PubMed

Hennenberg, Martin; Schott, Melanie; Kan, Aysenur; Keller, Patrick; Tamalunas, Alexander; Ciotkowska, Anna; Rutz, Beata; Wang, Yiming; Strittmatter, Frank; Herlemann, Annika; Yu, Qingfeng; Stief, Christian G; Gratzke, Christian

2016-11-01

The phosphodiesterase (PDE) 5 inhibitor tadalafil is available for treatment of male lower urinary tract symptoms (LUTS), while the role of other PDE isoforms for prostate smooth muscle tone is still unknown. Here, we examined effects of the PDE10-selective inhibitor TC-E 5005 on smooth muscle contraction in human prostate tissue. Prostate samples were obtained from patients undergoing radical prostatectomy. Expression of PDE10 was addressed by RT-PCR, Western blot, and fluorescence staining with different markers. Effects of TC-E 5005 and tadalafil on contraction, and relaxation of prostate strips were studied via organ bath. PDE10A was detectable by RT-PCR, Western blot, and fluorescence staining in prostate tissues. Colocalization with markers suggested expression of PDE10A in smooth muscle cells and catecholaminergic nerves. Norepinephrine, the α1 -adrenergic agonist phenylephrine, the thromboxane A2 analogue U46619, and endothelins 1-3 induced concentration-dependent contractions of prostate strips, while electric field stimulation (EFS) induced frequence-dependent contractions. Application of TC-E 5005 (500 nM) caused significant inhibition of norepinephrine-, phenylephrine-, and endothelin-3-induced contractions. Inhibition of EFS-induced contractions by TC-E 5005 ranged around 50%, resembling inhibition of EFS-induced contractions by tadalafil (10 μM). The prostacyclin analog treprostinil and the nitric oxide donor DEA NONOate induced relaxations of precontracted prostate strips, which were significantly amplified by TCE 5005. The PDE10-selective inhibitor TC-E 5005 inhibits adrenergic and neurogenic smooth muscle contractions in the human prostate. TC-E 5005 inhibits neurogenic contractions with similar efficacy than tadalafil, so that urodynamic effects in vivo appear possible. Prostate 76:1364-1374, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The Oncogenic Palmitoyi-Protein Network in Prostate Cancer

DTIC Science & Technology

2015-06-01

obesity drug, Ortistat, which inhibits the enzyme fatty acid synthase (FASN), has been shown to slow the growth of human prostate tumors in mice...Orlistat, an FDA-approved anti- obesity drug, suppresses the growth of human prostate tumors in nude mice.5 Despite these advances, the role of lipid...We also tested in vivo whether this network is vulnerable to an intervention that employs a dietary strategy in combination with an FDA-approved

The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer.

PubMed

Cardoso, Henrique J; Figueira, Marília I; Socorro, Sílvia

2017-12-01

The stem cell factor (SCF) is a cytokine that specifically binds the tyrosine kinase receptor c-KIT. The SCF/c-KIT interaction leads to receptor dimerization, activation of kinase activity and initiation of several signal transduction pathways that control cell proliferation, apoptosis, differentiation and migration in several tissues. The activity of SCF/c-KIT system is linked with the phosphatidylinositol 3-kinase (PI3-K), the Src, the Janus kinase/signal transducers and activators of transcription (JAK/STAT), the phospholipase-C (PLC-γ) and the mitogen-activated protein kinase (MAPK) pathways. Moreover, it has been reported that cancer cases display an overactivation of c-KIT due to the presence of gain-of-function mutations or receptor overexpression, which renders c-KIT a tempting target for cancer treatment. In the case of male cancers the most documented activated pathways are the PI3-K and Src, both enhancing abnormal cell proliferation. It is also known that the Src activity in prostate cancer cases depends on the presence of tr-KIT, the cytoplasmic truncated variant of c-KIT that is specifically expressed in tumour tissues and, thus, a very interesting target for drug development. The present review provides an overview of the signalling pathways activated by SCF/c-KIT and discusses the potential application of c-KIT inhibitors for treatment of testicular and prostatic cancers.

Clinical implications of hedgehog signaling pathway inhibitors

PubMed Central

Liu, Hailan; Gu, Dongsheng; Xie, Jingwu

2011-01-01

Hedgehog was first described in Drosophila melanogaster by the Nobel laureates Eric Wieschaus and Christiane Nüsslein-Volhard. The hedgehog (Hh) pathway is a major regulator of cell differentiation, proliferation, tissue polarity, stem cell maintenance, and Carcinogenesis. The first link of Hh signaling to cancer was established through studies of a rare familial disease, Gorlin syndrome, in 1996. Follow-up studies revealed activation of this pathway in basal cell carcinoma, medulloblastoma and, leukemia as well as in gastrointestinal, lung, ovarian, breast, and prostate cancer. Targeted inhibition of Hh signaling is now believed to be effective in the treatment and prevention of human cancer. The discovery and synthesis of specific inhibitors for this pathway are even more exciting. In this review, we summarize major advances in the understanding of Hh signaling pathway activation in human cancer, mouse models for studying Hh-mediated Carcinogenesis, the roles of Hh signaling in tumor development and metastasis, antagonists for Hh signaling and their clinical implications. PMID:21192841

Drug discovery in prostate cancer mouse models.

PubMed

Valkenburg, Kenneth C; Pienta, Kenneth J

2015-01-01

The mouse is an important, though imperfect, organism with which to model human disease and to discover and test novel drugs in a preclinical setting. Many experimental strategies have been used to discover new biological and molecular targets in the mouse, with the hopes of translating these discoveries into novel drugs to treat prostate cancer in humans. Modeling prostate cancer in the mouse, however, has been challenging, and often drugs that work in mice have failed in human trials. The authors discuss the similarities and differences between mice and men; the types of mouse models that exist to model prostate cancer; practical questions one must ask when using a mouse as a model; and potential reasons that drugs do not often translate to humans. They also discuss the current value in using mouse models for drug discovery to treat prostate cancer and what needs are still unmet in field. With proper planning and following practical guidelines by the researcher, the mouse is a powerful experimental tool. The field lacks genetically engineered metastatic models, and xenograft models do not allow for the study of the immune system during the metastatic process. There remain several important limitations to discovering and testing novel drugs in mice for eventual human use, but these can often be overcome. Overall, mouse modeling is an essential part of prostate cancer research and drug discovery. Emerging technologies and better and ever-increasing forms of communication are moving the field in a hopeful direction.

Effects of transplantation of adipose tissue-derived stem cells on prostate tumor.

PubMed

Lin, Guiting; Yang, Rong; Banie, Lia; Wang, Guifang; Ning, Hongxiu; Li, Long-Cheng; Lue, Tom F; Lin, Ching-Shwun

2010-07-01

Obesity is a risk factor for prostate cancer development, but the underlying mechanism is unknown. The present study tested the hypothesis that stromal cells of the adipose tissue might be recruited by cancer cells to help tumor growth. PC3 prostate cancer cells were transplanted into the subcutaneous space of the right flank of athymic mice. One week later, adipose tissue-derived stromal or stem cells (ADSC) or phosphate-buffered saline (PBS, as control) was transplanted similarly to the left flank. Tumor size was monitored for the next 34 days; afterwards, the mice were sacrificed and their tumors harvested for histological examination. The ability of PC3 cells to attract ADSC was tested by migration assay. The involvement of the CXCL12/CXCR4 axis was tested by migration assay in the presence of a specific inhibitor AMD3100. Throughout the entire course, the average size of PC3 tumors in ADSC-treated mice was larger than in PBS-treated mice. ADSC were identified inside the tumors of ADSC-treated mice; CXCR4 expression was also detected. Migration assay indicated the involvement of the CXCL12/CXCR4 axis in the migration of ADSC toward PC3 cells. Capillary density was twice as high in the tumors of ADSC-treated mice than in the tumors of PBS-treated mice. VEGF expression was similar but FGF2 expression was significantly higher in tumors of ADSC-treated mice than in the tumors of PBS-tread mice. Prostate cancer cells recruited ADSC by the CXCL12/CXCR4 axis. ADSC helps tumor growth by increasing tumor vascularity, and which was mediated by FGF2.

Detection of human papillomavirus (HPV) DNA in human prostatic tissues by polymerase chain reaction (PCR).

PubMed

Sarkar, F H; Sakr, W A; Li, Y W; Sreepathi, P; Crissman, J D

1993-01-01

Human papillomavirus (HPV) infections are strongly linked to the pathogenesis of uterine cervical neoplasms, and have been implicated in other cancers of the female genital tract. In contrast, the association of HPV with the cancers of the male urogenital tract is less evident, except in anal and penile cancers. However, recent studies reporting the prevalence of HPV infections in human prostate cancers (60-100% HPV 16 positive vs. no infection of HPV) have raised controversies regarding the prevalence of HPV in benign and neoplastic human prostate. We investigated the prevalence of HPV infections in prostatic intraepithelial neoplasia (PIN) and prostatic adenocarcinomas in 23 surgically resected prostates. Polymerase chain reaction (PCR) was used to amplify HPV 6b/11, 16, and 18 specific DNA sequences, using type specific HPV primers selected from the transforming gene E6-E7. The areas of PIN and cancer in 6 microns H&E stained tissue sections were identified, and respective areas of PIN and cancer were isolated from the adjacent serial sections and used for DNA amplification and HPV detection (Fig. 1). Our results demonstrated the presence of HPV 16 in three carcinomas (13%), using type specific primers in PCR amplified samples. We were not able to demonstrate the presence of other HPV types (HPV 6b/11 or HPV 18) in any of the samples using specific primers. Two of these prostates showed relatively strong positive signals by dot blot analysis, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. One more sample showed weak positivity, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. Subsequently, we have confirmed these results by Southern hybridization of the samples transferred to nylon membrane after agarose gel electrophoresis and detected by HPV 16 type specific oligonucleotide probe, using chemiluminescent assay. We, therefore, conclude that HPV infections of the prostate in general are not as common as has been previously claimed by other investigators.

PSA-selective activation of cytotoxic human serine proteases within the tumor microenvironment as a therapeutic strategy to target prostate cancer.

PubMed

Rogers, Oliver C; Anthony, Lizamma; Rosen, D Marc; Brennen, W Nathaniel; Denmeade, Samuel R

2018-04-27

Prostate cancer is the most diagnosed malignancy and the second leading cause of cancer-related death in American men. While localized therapy is highly curative, treatments for metastatic prostate cancer are largely palliative. Thus, new innovative therapies are needed to target metastatic tumors. Prostate-Specific Antigen (PSA) is a chymotrypsin-like protease with a unique substrate specificity that is secreted by both normal and malignant prostate epithelial cells. Previous studies demonstrated the presence of high levels (μM-mM) of enzymatically active PSA is present in the extracellular fluid of the prostate cancer microenvironment. Because of this, PSA is an attractive target for a protease activated pro-toxin therapeutic strategy. Because prostate cancers typically grow very slowly, a strategy employing a proliferation-independent cytotoxic payload is preferred. Recently, it was shown that the human protease Granzyme B (GZMB), at low micromolar concentrations in the extracellular space, can cleave an array of extracellular matrix (ECM) proteins thus perturbing cell growth, signaling, motility, and integrity. It is also well established that other human proteases such as trypsin can induce similar effects. Because both enzymes require N-terminal proteolytic activation, we propose to convert these proteins into PSA-activated cytotoxins. In this study, we examine the enzymatic and cell targeting parameters of these PSA-activated cytotoxic serine proteases. These pro-enzymes were activated robustly by PSA and induced ECM damage that led to the death of prostate cancer cells in vitro thus supporting the potential use of this strategy as means to target metastatic prostate cancers.

PSA-selective activation of cytotoxic human serine proteases within the tumor microenvironment as a therapeutic strategy to target prostate cancer

PubMed Central

Rogers, Oliver C.; Anthony, Lizamma; Rosen, D. Marc; Brennen, W. Nathaniel; Denmeade, Samuel R.

2018-01-01

Prostate cancer is the most diagnosed malignancy and the second leading cause of cancer-related death in American men. While localized therapy is highly curative, treatments for metastatic prostate cancer are largely palliative. Thus, new innovative therapies are needed to target metastatic tumors. Prostate-Specific Antigen (PSA) is a chymotrypsin-like protease with a unique substrate specificity that is secreted by both normal and malignant prostate epithelial cells. Previous studies demonstrated the presence of high levels (μM-mM) of enzymatically active PSA is present in the extracellular fluid of the prostate cancer microenvironment. Because of this, PSA is an attractive target for a protease activated pro-toxin therapeutic strategy. Because prostate cancers typically grow very slowly, a strategy employing a proliferation-independent cytotoxic payload is preferred. Recently, it was shown that the human protease Granzyme B (GZMB), at low micromolar concentrations in the extracellular space, can cleave an array of extracellular matrix (ECM) proteins thus perturbing cell growth, signaling, motility, and integrity. It is also well established that other human proteases such as trypsin can induce similar effects. Because both enzymes require N-terminal proteolytic activation, we propose to convert these proteins into PSA-activated cytotoxins. In this study, we examine the enzymatic and cell targeting parameters of these PSA-activated cytotoxic serine proteases. These pro-enzymes were activated robustly by PSA and induced ECM damage that led to the death of prostate cancer cells in vitro thus supporting the potential use of this strategy as means to target metastatic prostate cancers. PMID:29854290

Adipose-derived stromal cells inhibit prostate cancer cell proliferation inducing apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahara, Kiyoshi; Ii, Masaaki, E-mail: masaii@art.osaka-med.ac.jp; Inamoto, Teruo

2014-04-18

Highlights: • AdSC transplantation exhibits inhibitory effect on tumor progressions of PCa cells. • AdSC-induced PCa cell apoptosis may occur via the TGF-β signaling pathway. • High expression of the TGF-β1 gene in AdSCs. - Abstract: Mesenchymal stem cells (MSCs) have generated a great deal of interest in the field of regenerative medicine. Adipose-derived stromal cells (AdSCs) are known to exhibit extensive proliferation potential and can undergo multilineage differentiation, sharing similar characteristics to bone marrow-derived MSCs. However, as the effect of AdSCs on tumor growth has not been studied sufficiently, we assessed the degree to which AdSCs affect the proliferationmore » of prostate cancer (PCa) cell. Human AdSCs exerted an inhibitory effect on the proliferation of androgen-responsive (LNCaP) and androgen-nonresponsive (PC3) human PCa cells, while normal human dermal fibroblasts (NHDFs) did not, and in fact promoted PCa cell proliferation to a degree. Moreover, AdSCs induced apoptosis of LNCaP cells and PC3 cells, activating the caspase3/7 signaling pathway. cDNA microarray analysis suggested that AdSC-induced apoptosis in both LNCaP and PC3 cells was related to the TGF-β signaling pathway. Consistent with our in vitro observations, local transplantation of AdSCs delayed the growth of tumors derived from both LNCaP- and PC3-xenografts in immunodeficient mice. This is the first preclinical study to have directly demonstrated that AdSC-induced PCa cell apoptosis may occur via the TGF-β signaling pathway, irrespective of androgen-responsiveness. Since autologous AdSCs can be easily isolated from adipose tissue without any ethical concerns, we suggest that therapy with these cells could be a novel approach for patients with PCa.« less

NF-κB and androgen receptor variant expression correlate with human BPH progression.

PubMed

Austin, David C; Strand, Douglas W; Love, Harold L; Franco, Omar E; Jang, Alex; Grabowska, Magdalena M; Miller, Nicole L; Hameed, Omar; Clark, Peter E; Fowke, Jay H; Matusik, Robert J; Jin, Ren J; Hayward, Simon W

2016-04-01

Benign prostatic hyperplasia (BPH) is a common, chronic progressive disease. Inflammation is associated with prostatic enlargement and resistance to 5α-reductase inhibitor (5ARI) therapy. Activation of the nuclear factor-kappa B (NF-κB) pathway is linked to both inflammation and ligand-independent prostate cancer progression. NF-κB activation and androgen receptor variant (AR-V) expression were quantified in transition zone tissue samples from patients with a wide range of AUASS from incidental BPH in patients treated for low grade, localized peripheral zone prostate cancer to advanced disease requiring surgical intervention. To further investigate these pathways, human prostatic stromal and epithelial cell lines were transduced with constitutively active or kinase dead forms of IKK2 to regulate canonical NF-κB activity. The effects on AR full length (AR-FL) and androgen-independent AR-V expression as well as cellular growth and differentiation were assessed. Canonical NF-κB signaling was found to be upregulated in late versus early stage BPH, and to be strongly associated with non-insulin dependent diabetes mellitus. Elevated expression of AR-variant 7 (AR-V7), but not other AR variants, was found in advanced BPH samples. Expression of AR-V7 significantly correlated with the patient AUASS and TRUS volume. Forced activation of canonical NF-κB in human prostatic epithelial and stromal cells resulted in elevated expression of both AR-FL and AR-V7, with concomitant ligand-independent activation of AR reporters. Activation of NF-κB and over expression of AR-V7 in human prostatic epithelial cells maintained cell viability in the face of 5ARI treatment. Activation of NF-κB and AR-V7 in the prostate is associated with increased disease severity. AR-V7 expression is inducible in human prostate cells by forced activation of NF-κB resulting in resistance to 5ARI treatment, suggesting a potential mechanism by which patients may become resistant to 5ARI therapy. © 2015 Wiley Periodicals, Inc.

Differences in prostate and adipose tissue basic fibroblast growth factor: analysis of preliminary results.

PubMed

Mydlo, J H; Kral, J G; Macchia, R J

1997-09-01

Basic fibroblast growth factor (bFGF or FGF-2) is mitogenic to human prostate epithelial and stromal cells, and it is reported to be elevated in the serum and urine of patients with various cancers, including prostate cancer. Obesity, with increased body fat, is a risk factor for prostate cancer through unknown mechanisms. Because adipose tissue is a source of FGF-2, we determined the quantity and quality of activity of FGF-2 in omental adipose tissue and compared it with normal and cancerous prostate tissues. Using heparin-Sepharose chromatography, we extracted proteins from human omental adipose tissue, adenocarcinoma of the prostate, and benign prostatic hypertrophic (BPH) tissues. Each of the mitogenic proteins eluted with NaCl concentrations between 1.4 M and 1.8 M, similar to control FGF-2. Using FGF-2 antisera (which inhibited the mitogenic activity of the proteins), we performed Western blot analysis to confirm their homology to FGF-2. We also assessed recovery, mitogenicity, and angiogenicity of each of the proteins using thymidine incorporation into human umbilical vein endothelial cells and the chorioallantoic membrane assay. There was greater recovery of FGF-2 from omental adipose tissue compared with cancerous or BPH homogenates (40 micrograms [2.0 micrograms/g] versus 25 micrograms [1.25 micrograms/g] and 20 micrograms [1.0 microgram/g], respectively). Moreover. FGF-2 from adipose tissue had greater mitogenic activity (96.2% versus 74.8% and 54%; P < 0.05) and a greater angiogenic activity (5.1 vessels versus 2.9 and 1.8 vessels; P < 0.05) on the chorioallantoic assay. We suggest that human omental adipose tissue FGF-2 may demonstrate greater mitogenic and angiogenic activity than either BPH or prostate cancer tissue FGF-2. It is not known whether FGF-2 from adipose tissue qualitatively or quantitatively may underlie the relationship between obesity and prostate cancer.

The beta-3 adrenoceptor agonist, mirabegron relaxes isolated prostate from human and rabbit: new therapeutic indication?

PubMed

Calmasini, Fabiano B; Candido, Tuany Z; Alexandre, Eduardo C; D'Ancona, Carlos A; Silva, Daniel; de Oliveira, Marco Antonio; De Nucci, Gilberto; Antunes, Edson; Mónica, Fabíola Z

2015-03-01

Alpha1 (α1)-blockers, 5-alpha reductase and phosphodiesterase type-5 inhibitors are pharmacological classes currently available for benign prostatic hyperplasia (BPH) treatment. Mirabegron, a beta-3 adrenoceptor (β3-AR) agonist has been approved for the therapy of overactive bladder and may constitute a new therapeutic option for BPH treatment. This study is aimed to evaluate the in vitro effects of mirabegron in human and rabbit prostatic smooth muscle. In rabbit prostate, electrical field stimulation (EFS)-induced contraction and concentration-response curve (CRC) to mirabegron in phenylephrine pre-contracted tissues were carried out. The potency (pEC50 ) and maximal response (Emax ) values were determined. In human prostate, CRC to phenylephrine was carried out in the absence and presence of mirabegron. Immunohistochemistry analysis for β3-AR was also carried out. In human prostate, immunohistochemistry analysis revealed the presence of β3-AR on the transition zone and mirabegron reduced by 42% the phenylephrine-induced contractions. In rabbit prostate, mirabegron produced concentration-dependent relaxations (pEC50 : 6.01 ± 0.12; Emax : 106 ± 3%), which were fully resistant to the blockade of β1-AR and β2-AR. The β3-AR blocker L748,337 caused a six-fold rightward shift in mirabegron-induced relaxations. Mirabegron (10 μM) reduced by 63% the EFS-induced contractions. Inhibitors of nitric oxide (L-NAME) and of soluble guanylate cyclase (ODQ) along with a cocktail of K+ channel blockers (apamin, charybdotoxin, glibenclamide, tetraethylammonium) all failed to significantly affect the mirabegron-induced rabbit relaxations. Mirabegron relaxes prostatic smooth muscle, providing an experimental support for the clinical investigation of its combination with an α1-blockers or PDE5 inhibitors in the treatment of BPH. Prostate 75:440-447, 2015. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.

Lectin-Like Oxidized LDL Receptor-1 Is an Enhancer of Tumor Angiogenesis in Human Prostate Cancer Cells

PubMed Central

González-Chavarría, Iván; Cerro, Rita P.; Parra, Natalie P.; Sandoval, Felipe A.; Zuñiga, Felipe A.; Omazábal, Valeska A.; Lamperti, Liliana I.; Jiménez, Silvana P.; Fernandez, Edelmira A.; Gutiérrez, Nicolas A.; Rodriguez, Federico S.; Onate, Sergio A.; Sánchez, Oliberto; Vera, Juan C.; Toledo, Jorge R.

2014-01-01

Altered expression and function of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) has been associated with several diseases such as endothelial dysfunction, atherosclerosis and obesity. In these pathologies, oxLDL/LOX-1 activates signaling pathways that promote cell proliferation, cell motility and angiogenesis. Recent studies have indicated that olr1 mRNA is over-expressed in stage III and IV of human prostatic adenocarcinomas. However, the function of LOX-1 in prostate cancer angiogenesis remains to be determined. Our aim was to analyze the contribution of oxLDL and LOX-1 to tumor angiogenesis using C4-2 prostate cancer cells. We analyzed the expression of pro-angiogenic molecules and angiogenesis on prostate cancer tumor xenografts, using prostate cancer cell models with overexpression or knockdown of LOX-1 receptor. Our results demonstrate that the activation of LOX-1 using oxLDL increases cell proliferation, and the expression of the pro-angiogenic molecules VEGF, MMP-2, and MMP-9 in a dose-dependent manner. Noticeably, these effects were prevented in the C4-2 prostate cancer model when LOX-1 expression was knocked down. The angiogenic effect of LOX-1 activated with oxLDL was further demonstrated using the aortic ring assay and the xenograft model of tumor growth on chorioallantoic membrane of chicken embryos. Consequently, we propose that LOX-1 activation by oxLDL is an important event that enhances tumor angiogenesis in human prostate cancer cells. PMID:25170920

The Role of the Caspase-8 Inhibitor FLIP in Androgen-Withdrawal Induced Death of Prostate Epithelium

DTIC Science & Technology

2007-01-01

cells. Cancer Res 2000;60:2384-9. 20. Voelkel-Johnson C, King DL, Norris JS. Resistance of prostate cancer cells to soluble TNF-related apoptosis...Mukhopadhyay A, Bueso-Ramos C, Chatterjee D, Pantazis P, Aggarwal BB. Curcumin downregulates cell survival mechanisms in human prostate cancer cell...ethanol. LY294002 (Cayman) was dissolved in Androgens and FOXO3a regulate FLIP page 7 dimethylsulfoxide (DMSO). Soluble recombinant human TRAIL (Biomol

In Vivo Imaging of Branched Chain Amino Acid Metabolism in Prostate Cancer

DTIC Science & Technology

2013-08-01

model more closely mimicking human metabolism by assessing four prostate cancer cell lines: PC-3, DU-145, LNCaP and LAPC-4. The PC-3 cells had...Although the xenograph BCAT activity was 2.5 fold higher than cells alone (approaching human levels), the tumors grew very poorly (volumes ≤ 0.2 cc...assessment of prostate cancer (see Appendix 1: Revised Statement of Work). Specifically, as part of these cell - culture and xenograph experiments we

2-Methoxyestradiol as a Chemotherapeutic for Prostate Cancer

DTIC Science & Technology

2006-04-01

PC.Acknowledgements We thank Alicia De Las Pozas and Adriana Gomez for excellent technical assistance, Ron Hamelik for help with flow cytometry, and Drs Bernard...linked inhibitor of apoptosis and AKT proteins and stimulates apoptosis in human LNCaP prostate cancer cells Adriana Gomez,3 Alicia de las Pozas,1 and...changes during the progression of human prostatic cancer. Clin. Cancer Res 1995;1:473-480. 40. Chan DC, Earle KA , Zhao TL, Helfrich B, Zeng C, Baron A

Human PIRH2 Enhances Androgen Receptor Signaling through Inhibition of Histone Deacetylase 1 and Is Overexpressed in Prostate Cancer

PubMed Central

Logan, Ian R.; Gaughan, Luke; McCracken, Stuart R. C.; Sapountzi, Vasileia; Leung, Hing Y.; Robson, Craig N.

2006-01-01

The androgen receptor (AR) is a hormone-dependent transcription factor critically involved in human prostate carcinogenesis. Optimal transcriptional control of androgen-responsive genes by AR may require complex interaction among multiple coregulatory proteins. We have previously shown that the AR coregulator TIP60 can interact with human PIRH2 (hPIRH2). In this study, we uncover important new functional role(s) for hPIRH2 in AR signaling: (i) hPIRH2 interacts with AR and enhances AR-mediated transcription with a dynamic pattern of recruitment to androgen response elements in the prostate-specific antigen (PSA) gene; (ii) hPIRH2 interacts with the AR corepressor HDAC1, leading to reduced HDAC1 protein levels and inhibition of transcriptional repression; (iii) hPIRH2 is required for optimal PSA expression; and (iv) hPIRH2 is involved in prostate cancer cell proliferation. In addition, overexpression of hPIRH2 protein was detected in 73 of 82 (89%) resected prostate cancers, with a strong correlation between increased hPIRH2 expression and aggressive disease, as signified by high Gleason sum scores and the presence of metastatic disease (P = <0.0001 and 0.0004, respectively). Collectively, our data establish hPIRH2 as a key modulator of AR function, opening a new direction for targeted therapy in aggressive human prostate cancer. PMID:16914734

Human PIRH2 enhances androgen receptor signaling through inhibition of histone deacetylase 1 and is overexpressed in prostate cancer.

PubMed

Logan, Ian R; Gaughan, Luke; McCracken, Stuart R C; Sapountzi, Vasileia; Leung, Hing Y; Robson, Craig N

2006-09-01

The androgen receptor (AR) is a hormone-dependent transcription factor critically involved in human prostate carcinogenesis. Optimal transcriptional control of androgen-responsive genes by AR may require complex interaction among multiple coregulatory proteins. We have previously shown that the AR coregulator TIP60 can interact with human PIRH2 (hPIRH2). In this study, we uncover important new functional role(s) for hPIRH2 in AR signaling: (i) hPIRH2 interacts with AR and enhances AR-mediated transcription with a dynamic pattern of recruitment to androgen response elements in the prostate-specific antigen (PSA) gene; (ii) hPIRH2 interacts with the AR corepressor HDAC1, leading to reduced HDAC1 protein levels and inhibition of transcriptional repression; (iii) hPIRH2 is required for optimal PSA expression; and (iv) hPIRH2 is involved in prostate cancer cell proliferation. In addition, overexpression of hPIRH2 protein was detected in 73 of 82 (89%) resected prostate cancers, with a strong correlation between increased hPIRH2 expression and aggressive disease, as signified by high Gleason sum scores and the presence of metastatic disease (P = <0.0001 and 0.0004, respectively). Collectively, our data establish hPIRH2 as a key modulator of AR function, opening a new direction for targeted therapy in aggressive human prostate cancer.

Expression of matrix metalloproteinase-9 and bombesin/gastrin-releasing peptide in human prostate cancers and their lymph node metastases.

PubMed

Ishimaru, Hisashi; Kageyama, Yukio; Hayashi, Tetsuo; Nemoto, Tetsuo; Eishi, Yoshinobu; Kihara, Kazunori

2002-01-01

Neuroendocrine differentiation and subsequent excretion of neuropeptides have been demonstrated to be associated with progression of human prostate cancer. Among neuropeptides found to exist in the prostate, bombesin/gastrin-releasing peptide has been shown to upregulate matrix metalloproteinase-9 (MMP-9) in human prostate cancer cell lines. Expression levels of bombesin, MMP-9, and neuron-specific enolase were examined by immunohistochemistry in 41 cases of clinically organ-confined prostate cancers including 9 with microscopic lymph node metastases. Twenty-seven (64%) of the 41 radical prostatectomy specimens were positive for both MMP-9 and bombesin. Expression of these molecules was observed in almost the same population of the cancer cells. The remaining 14 cases were negative for both MMP-9 and bombesin. High-grade tumors (Gleason sum > or = 7) were more likely to express MMP-9 and bombesin (21/24:88%) than low-grade tumors (Gleason sum > or = 6) (7/17:41%). In eight of the nine cases with pathological lymph node metastases, expression of MMP-9 and bombesin was also noted in metastatic sites. Neuron-specific enolase was positive in 16 cases (39%) and not always associated with the expression of bombesin. Expression of bombesin and expression of MMP-9 are common in human prostate cancers and may be related to an aggressive phenotype.

Redox mechanism of levobupivacaine cytostatic effect on human prostate cancer cells.

PubMed

Jose, Caroline; Hebert-Chatelain, Etienne; Dias Amoedo, Nivea; Roche, Emmanuel; Obre, Emilie; Lacombe, Didier; Rezvani, Hamid Reza; Pourquier, Philippe; Nouette-Gaulain, Karine; Rossignol, Rodrigue

2018-05-31

Anti-cancer effects of local anesthetics have been reported but the mode of action remains elusive. Here, we examined the bioenergetic and REDOX impact of levobupivacaine on human prostate cancer cells (DU145) and corresponding non-cancer primary human prostate cells (BHP). Levobupivacaine induced a combined inhibition of glycolysis and oxidative phosphorylation in cancer cells, resulting in a reduced cellular ATP production and consecutive bioenergetic crisis, along with reactive oxygen species generation. The dose-dependent inhibition of respiratory chain complex I activity by levobupivacaine explained the alteration of mitochondrial energy fluxes. Furthermore, the potency of levobupivacaine varied with glucose and oxygen availability as well as the cellular energy demand, in accordance with a bioenergetic anti-cancer mechanism. The levobupivacaine-induced bioenergetic crisis triggered cytostasis in prostate cancer cells as evidenced by a S-phase cell cycle arrest, without apoptosis induction. In DU145 cells, levobupivacaine also triggered the induction of autophagy and blockade of this process potentialized the anti-cancer effect of the local anesthetic. Therefore, our findings provide a better characterization of the REDOX mechanisms underpinning the anti-effect of levobupivacaine against human prostate cancer cells. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Role of monocyte-lineage cells in prostate cancer cell invasion and tissue factor expression.

PubMed

Lindholm, Paul F; Lu, Yi; Adley, Brian P; Vladislav, Tudor; Jovanovic, Borko; Sivapurapu, Neela; Yang, Ximing J; Kajdacsy-Balla, André

2010-11-01

Tissue factor (TF) is a cell surface glycoprotein intricately related to blood coagulation and inflammation. This study was performed to investigate the role of monocyte-lineage cells in prostate cancer cell TF expression and cell invasion. Prostate cancer cell invasion was tested with and without added peripheral blood monocytes or human monocyte-lineage cell lines. TF neutralizing antibodies were used to determine the TF requirement for prostate cancer cell invasion activity. Immunohistochemistry was performed to identify prostate tissue CD68 positive monocyte-derived cells and prostate epithelial TF expression. Co-culture of PC-3, DU145, and LNCaP cells with isolated human monocytes significantly stimulated prostate cancer cell invasion activity. TF expression was greater in highly invasive prostate cancer cells and was induced in PC-3, DU145, and LNCaP cells by co-culture with U-937 cells, but not with THP-1 cells. TF neutralizing antibodies inhibited PC-3 cell invasion in co-cultures with monocyte-lineage U-937 or THP-1 cells. Prostate cancer tissues contained more CD68 positive cells in the stroma and epithelium (145 ± 53/mm(2)) than benign prostate (108 ± 31/mm(2)). Samples from advanced stage prostate cancer tended to contain more CD68 positive cells when compared with lower stage lesions. Prostatic adenocarcinoma demonstrated significantly increased TF expression compared with benign prostatic epithelium. This study shows that co-culture with monocyte-lineage cells induced prostate cancer cell invasion activity. PC-3 invasion and TF expression was induced in co-culture with U-937 cells and partially inhibited with TF neutralizing antibodies.

Nanodiamond-DGEA peptide conjugates for enhanced delivery of doxorubicin to prostate cancer

PubMed Central

Hwang, Patrick; McIntosh, Roberus; Green, Hadiyah N; Jun, Ho-Wook; Dean, Derrick

2014-01-01

Summary The field of nanomedicine has emerged as an approach to enhance the specificity and efficacy of cancer treatments as stand-alone therapies and in combination with standard chemotherapeutic treatment regimens. The current standard of care for metastatic cancer, doxorubicin (DOX), is presented with challenges, namely toxicity due to a lack of specificity and targeted delivery. Nano-enabled targeted drug delivery systems can provide an avenue to overcome these issues. Nanodiamonds (ND), in particular, have been researched over the past five years for use in various drug delivery systems but minimal work has been done that incorporates targeting capability. In this study, a novel targeted drug delivery system for bone metastatic prostate cancer was developed, characterized, and evaluated in vitro. NDs were conjugated with the Asp–Gly–Glu–Ala (DGEA) peptide to target α2β1 integrins over-expressed in prostate cancers during metastasis. To facilitate drug delivery, DOX was adsorbed to the surface of the ND-DGEA conjugates. Successful preparation of the ND-DGEA conjugates and the ND-DGEA+DOX system was confirmed with transmission electron microscopy, hydrodynamic size, and zeta potential measurements. Since traditional DOX treatment regimens lack specificity and increased toxicity to normal tissues, the ND-DGEA conjugates were designed to distinguish between cells that overexpress α2β1 integrin, bone metastatic prostate cancers cells (PC3), and cells that do not, human mesenchymal stem cells (hMSC). Utilizing the ND-DGEA+DOX system, the efficacy of 1 µg/mL and 2 µg/mL DOX doses increased from 2.5% to 12% cell death and 11% to 34% cell death, respectively. These studies confirmed that the delivery and efficacy of DOX were enhanced by ND-DGEA conjugates. Thus, the targeted ND-DGEA+DOX system provides a novel approach for decreasing toxicity and drug doses. PMID:25161829

DNA methylome changes by estradiol benzoate and bisphenol A links early-life environmental exposures to prostate cancer risk

PubMed Central

Cheong, Ana; Zhang, Xiang; Cheung, Yuk-Yin; Tang, Wan-yee; Chen, Jing; Ye, Shu-Hua; Medvedovic, Mario; Leung, Yuet-Kin; Prins, Gail S.; Ho, Shuk-Mei

2016-01-01

ABSTRACT Developmental exposure to endocrine-disrupting chemicals (EDCs), 17β-estradiol-3-benzoate (EB) and bisphenol A (BPA), increases susceptibility to prostate cancer (PCa) in rodent models. Here, we used the methylated-CpG island recovery assay (MIRA)-assisted genomic tiling and CpG island arrays to identify treatment-associated methylome changes in the postnatal day (PND)90 dorsal prostate tissues of Sprague-Dawley rats neonatally (PND1, 3, and 5) treated with 25 µg/pup or 2,500 µg EB/kg body weight (BW) or 0.1 µg BPA/pup or 10 µg BPA/kg BW. We identified 111 EB-associated and 86 BPA-associated genes, with 20 in common, that have significant differentially methylated regions. Pathway analysis revealed cancer as the top common disease pathway. Bisulfite sequencing validated the differential methylation patterns observed by array analysis in 15 identified candidate genes. The methylation status of 7 (Pitx3, Wnt10b, Paqr4, Sox2, Chst14, Tpd52, Creb3l4) of these 15 genes exhibited an inverse correlation with gene expression in tissue samples. Cell-based assays, using 5-aza-cytidine-treated normal (NbE-1) and cancerous (AIT) rat prostate cells, added evidence of DNA methylation-mediated gene expression of 6 genes (exception: Paqr4). Functional connectivity of these genes was linked to embryonic stem cell pluripotency. Furthermore, clustering analyses using the dataset from The Cancer Genome Atlas revealed that expression of this set of 7 genes was associated with recurrence-free survival of PCa patients. In conclusion, our study reveals that gene-specific promoter methylation changes, resulting from early-life EDC exposure in the rat, may serve as predictive epigenetic biomarkers of PCa recurrence, and raises the possibility that such exposure may impact human disease. PMID:27415467

DNA methylome changes by estradiol benzoate and bisphenol A links early-life environmental exposures to prostate cancer risk.

PubMed

Cheong, Ana; Zhang, Xiang; Cheung, Yuk-Yin; Tang, Wan-Yee; Chen, Jing; Ye, Shu-Hua; Medvedovic, Mario; Leung, Yuet-Kin; Prins, Gail S; Ho, Shuk-Mei

2016-09-01

Developmental exposure to endocrine-disrupting chemicals (EDCs), 17β-estradiol-3-benzoate (EB) and bisphenol A (BPA), increases susceptibility to prostate cancer (PCa) in rodent models. Here, we used the methylated-CpG island recovery assay (MIRA)-assisted genomic tiling and CpG island arrays to identify treatment-associated methylome changes in the postnatal day (PND)90 dorsal prostate tissues of Sprague-Dawley rats neonatally (PND1, 3, and 5) treated with 25 µg/pup or 2,500 µg EB/kg body weight (BW) or 0.1 µg BPA/pup or 10 µg BPA/kg BW. We identified 111 EB-associated and 86 BPA-associated genes, with 20 in common, that have significant differentially methylated regions. Pathway analysis revealed cancer as the top common disease pathway. Bisulfite sequencing validated the differential methylation patterns observed by array analysis in 15 identified candidate genes. The methylation status of 7 (Pitx3, Wnt10b, Paqr4, Sox2, Chst14, Tpd52, Creb3l4) of these 15 genes exhibited an inverse correlation with gene expression in tissue samples. Cell-based assays, using 5-aza-cytidine-treated normal (NbE-1) and cancerous (AIT) rat prostate cells, added evidence of DNA methylation-mediated gene expression of 6 genes (exception: Paqr4). Functional connectivity of these genes was linked to embryonic stem cell pluripotency. Furthermore, clustering analyses using the dataset from The Cancer Genome Atlas revealed that expression of this set of 7 genes was associated with recurrence-free survival of PCa patients. In conclusion, our study reveals that gene-specific promoter methylation changes, resulting from early-life EDC exposure in the rat, may serve as predictive epigenetic biomarkers of PCa recurrence, and raises the possibility that such exposure may impact human disease.

Disrupting Androgen Receptor Signaling Induces Snail-Mediated Epithelial-Mesenchymal Plasticity in Prostate Cancer.

PubMed

Miao, Lu; Yang, Lin; Li, Rui; Rodrigues, Daniel N; Crespo, Mateus; Hsieh, Jer-Tsong; Tilley, Wayne D; de Bono, Johann; Selth, Luke A; Raj, Ganesh V

2017-06-01

Epithelial-to-mesenchymal plasticity (EMP) has been linked to metastasis, stemness, and drug resistance. In prostate cancer, EMP has been associated with both suppression and activation of the androgen receptor (AR) signaling. Here we investigated the effect of the potent AR antagonist enzalutamide on EMP in multiple preclinical models of prostate cancer and patient tissues. Enzalutamide treatment significantly enhanced the expression of EMP drivers (ZEB1, ZEB2, Snail, Twist, and FOXC2) and mesenchymal markers (N-cadherin, fibronectin, and vimentin) in prostate cancer cells, enhanced prostate cancer cell migration, and induced prostate cancer transformation to a spindle, fibroblast-like morphology. Enzalutamide-induced EMP required concomitant suppression of AR signaling and activation of the EMP-promoting transcription factor Snail, as evidenced by both knockdown and overexpression studies. Supporting these findings, AR signaling and Snail expression were inversely correlated in C4-2 xenografts, patient-derived castration-resistant metastases, and clinical samples. For the first time, we elucidate a mechanism explaining the inverse relationship between AR and Snail. Specifically, we found that AR directly repressed SNAI1 gene expression by binding to specific AR-responsive elements within the SNAI1 promoter. Collectively, our findings demonstrate that de-repression of Snail and induction of EMP is an adaptive response to enzalutamide with implications for therapy resistance. Cancer Res; 77(11); 3101-12. ©2017 AACR . ©2017 American Association for Cancer Research.

PSCA expression is associated with favorable tumor features and reduced PSA recurrence in operated prostate cancer.

PubMed

Heinrich, Marie-Christine; Göbel, Cosima; Kluth, Martina; Bernreuther, Christian; Sauer, Charlotte; Schroeder, Cornelia; Möller-Koop, Christina; Hube-Magg, Claudia; Lebok, Patrick; Burandt, Eike; Sauter, Guido; Simon, Ronald; Huland, Hartwig; Graefen, Markus; Heinzer, Hans; Schlomm, Thorsten; Heumann, Asmus

2018-05-31

Prostate Stem Cell Antigen (PSCA) is frequently expressed in prostate cancer but its exact function is unclear. To clarify contradictory findings on the prognostic role of PSCA expression, a tissue microarray containing 13,665 prostate cancers was analyzed by immunohistochemistry. PSCA staining was absent in normal epithelial and stromal cells of the prostate. Membranous and cytoplasmic PSCA staining was seen in 53.7% of 9642 interpretable tumors. Staining was weak in 22.4%, moderate in 24.5% and strong in 6.8% of tumors. PSCA expression was associated with favorable pathological and clinical tumor features: Early pathological tumor stage (p < 0.0001), low Gleason grade (p < 0.0001), absence of lymph node metastasis (p < 0.0001), low pre-operative PSA level (p = 0.0118), negative surgical margin (p < 0.0001) and reduced PSA recurrence (p < 0.0001). PSCA expression was an independent predictor of prognosis in multivariate analysis (hazard ratio 0.84, p < 0.0001). The absence of statistical relationship to TMPRSS2:ERG fusion status, chromosomal deletion or high tumor cell proliferation argues against a major role of PSCA for regulation of cell cycle or genomic integrity. PSCA expression is linked to favorable prognosis. PSCA measurement is a candidate for inclusion in multi-parametric prognostic prostate cancer tests.

CIP2A is a candidate therapeutic target in clinically challenging prostate cancer cell populations.

PubMed

Khanna, Anchit; Rane, Jayant K; Kivinummi, Kati K; Urbanucci, Alfonso; Helenius, Merja A; Tolonen, Teemu T; Saramäki, Outi R; Latonen, Leena; Manni, Visa; Pimanda, John E; Maitland, Norman J; Westermarck, Jukka; Visakorpi, Tapio

2015-08-14

Residual androgen receptor (AR)-signaling and presence of cancer stem-like cells (SCs) are the two emerging paradigms for clinically challenging castration-resistant prostate cancer (CRPC). Therefore, identification of AR-target proteins that are also overexpressed in the cancer SC population would be an attractive therapeutic approach.Our analysis of over three hundred clinical samples and patient-derived prostate epithelial cultures (PPECs), revealed Cancerous inhibitor of protein phosphatase 2A (CIP2A) as one such target. CIP2A is significantly overexpressed in both hormone-naïve prostate cancer (HN-PC) and CRPC patients . CIP2A is also overexpressed, by 3- and 30-fold, in HN-PC and CRPC SCs respectively. In vivo binding of the AR to the intronic region of CIP2A and its functionality in the AR-moderate and AR-high expressing LNCaP cell-model systems is also demonstrated. Further, we show that AR positively regulates CIP2A expression, both at the mRNA and protein level. Finally, CIP2A depletion reduced cell viability and colony forming efficiency of AR-independent PPECs as well as AR-responsive LNCaP cells, in which anchorage-independent growth is also impaired.These findings identify CIP2A as a common denominator for AR-signaling and cancer SC functionality, highlighting its potential therapeutic significance in the most clinically challenging prostate pathology: castration-resistant prostate cancer.

A novel minimally invasive dual-modality fiber optic probe for prostate cancer detection

NASA Astrophysics Data System (ADS)

Sharma, Vikrant

Prostate cancer is the most common form of cancer in males, and is the second leading cause of cancer related deaths in United States. In prostate cancer diagnostics and therapy, there is a critical need for a minimally invasive tool for in vivo evaluation of prostate tissue. Such a tool finds its niche in improving TRUS (trans-rectal ultrasound) guided biopsy procedure, surgical margin assessment during radical prostatectomy, and active surveillance of patients with a certain risk levels. This work is focused on development of a fiber-based dual-modality optical device (dMOD), to differentiate prostate cancer from benign tissue, in vivo. dMOD utilizes two independent optical techniques, LRS (light reflectance spectroscopy) and AFLS (auto-fluorescence lifetime spectroscopy). LRS quantifies scattering coefficient of the tissue, as well as concentrations of major tissue chromophores like hemoglobin derivatives, β-carotene and melanin. AFLS was designed to target lifetime signatures of multiple endogenous fluorophores like flavins, porphyrins and lipo-pigments. Each of these methods was independently developed, and the two modalities were integrated using a thin (1-mm outer diameter) fiber-optic probe. Resulting dMOD probe was implemented and evaluated on animal models of prostate cancer, as well as on human prostate tissue. Application of dMOD to human breast cancer (invasive ductal carcinoma) identification was also evaluated. The results obtained reveal that both LRS and AFLS are excellent techniques to discriminate prostate cancer tissue from surrounding benign tissue in animal models. Each technique independently is capable of providing near absolute (100%) accuracy for cancer detection, indicating that either of them could be used independently without the need of implementing them together. Also, in case of human breast cancer, LRS and AFLS provided comparable accuracies to dMOD, LRS accuracy (96%) being the highest for the studied population. However, the dual-modality integration proved to be ideal for human prostate cancer detection, as dMOD provided much better accuracy i.e., 82.7% for cancer detection in intra-capsular prostatic tissues (ICT), and 92.4% for cancer detection in extra-capsular prostatic tissues (ECT), when compared with either LRS (74.7% ICT, 86.6% ECT) or AFLS(67.1% ICT, 82.1% ECT) alone. A classification algorithm was also developed to identify different grades of prostate cancers based on Gleason scores (GS). When stratified by grade, each high grade prostate cancer (GS 7, 8 and 9) was successfully identified using dMOD with excellent accuracy in ICT (88%, 90%, 85%), as well as ECT (91%, 92%, 94%).

DESNT: A Poor Prognosis Category of Human Prostate Cancer.

PubMed

Luca, Bogdan-Alexandru; Brewer, Daniel S; Edwards, Dylan R; Edwards, Sandra; Whitaker, Hayley C; Merson, Sue; Dennis, Nening; Cooper, Rosalin A; Hazell, Steven; Warren, Anne Y; Eeles, Rosalind; Lynch, Andy G; Ross-Adams, Helen; Lamb, Alastair D; Neal, David E; Sethia, Krishna; Mills, Robert D; Ball, Richard Y; Curley, Helen; Clark, Jeremy; Moulton, Vincent; Cooper, Colin S

2017-03-06

A critical problem in the clinical management of prostate cancer is that it is highly heterogeneous. Accurate prediction of individual cancer behaviour is therefore not achievable at the time of diagnosis leading to substantial overtreatment. It remains an enigma that, in contrast to breast cancer, unsupervised analyses of global expression profiles have not currently defined robust categories of prostate cancer with distinct clinical outcomes. To devise a novel classification framework for human prostate cancer based on unsupervised mathematical approaches. Our analyses are based on the hypothesis that previous attempts to classify prostate cancer have been unsuccessful because individual samples of prostate cancer frequently have heterogeneous compositions. To address this issue, we applied an unsupervised Bayesian procedure called Latent Process Decomposition to four independent prostate cancer transcriptome datasets obtained using samples from prostatectomy patients and containing between 78 and 182 participants. Biochemical failure was assessed using log-rank analysis and Cox regression analysis. Application of Latent Process Decomposition identified a common process in all four independent datasets examined. Cancers assigned to this process (designated DESNT cancers) are characterized by low expression of a core set of 45 genes, many encoding proteins involved in the cytoskeleton machinery, ion transport, and cell adhesion. For the three datasets with linked prostate-specific antigen failure data following prostatectomy, patients with DESNT cancer exhibited poor outcome relative to other patients (p=2.65×10 -5 , p=4.28×10 -5 , and p=2.98×10 -8 ). When these three datasets were combined the independent predictive value of DESNT membership was p=1.61×10 -7 compared with p=1.00×10 -5 for Gleason sum. A limitation of the study is that only prediction of prostate-specific antigen failure was examined. Our results demonstrate the existence of a novel poor prognosis category of human prostate cancer and will assist in the targeting of therapy, helping avoid treatment-associated morbidity in men with indolent disease. Prostate cancer, unlike breast cancer, does not have a robust classification framework. We propose that this failure has occurred because prostate cancer samples selected for analysis frequently have heterozygous compositions (individual samples are made up of many different parts that each have different characteristics). Applying a mathematical approach that can overcome this problem we identify a novel poor prognosis category of human prostate cancer called DESNT. Copyright © 2017 European Association of Urology. Published by Elsevier B.V. All rights reserved.

A rare presentation of disseminated tuberculosis: Prostatic abscess.

PubMed

Verma, Ajay; Singh, Anubhuti; Kishore, Kislay; Kant, Surya

2017-10-01

Involvement of the prostate by tuberculosis (TB) occurs rarely and tuberculosis prostate abscess is an even rarer occurrence. It has been reported in immunocompromised patients, mainly human immunodeficiency virus seropositive individuals. We are reporting a case of tuberculosis prostatic abscess in an immunocompetent patient with relapse of TB. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

A small molecule polyamine oxidase inhibitor blocks androgen-induced oxidative stress and delays prostate cancer progression in the transgenic adenocarcinoma of the mouse prostate model.

PubMed

Basu, Hirak S; Thompson, Todd A; Church, Dawn R; Clower, Cynthia C; Mehraein-Ghomi, Farideh; Amlong, Corey A; Martin, Christopher T; Woster, Patrick M; Lindstrom, Mary J; Wilding, George

2009-10-01

High levels of reactive oxygen species (ROS) present in human prostate epithelia are an important etiologic factor in prostate cancer (CaP) occurrence, recurrence, and progression. Androgen induces ROS production in the prostate by a yet unknown mechanism. Here, to the best of our knowledge, we report for the first time that androgen induces an overexpression of spermidine/spermine N1-acetyltransferase, the rate-limiting enzyme in the polyamine oxidation pathway. As prostatic epithelia produce a large excess of polyamines, the androgen-induced polyamine oxidation that produces H2O2 could be a major reason for the high ROS levels in the prostate epithelia. A small molecule polyamine oxidase inhibitor N,N'-butanedienyl butanediamine (MDL 72,527 or CPC-200) effectively blocks androgen-induced ROS production in human CaP cells, as well as significantly delays CaP progression and death in animals developing spontaneous CaP. These data show that polyamine oxidation is not only a major pathway for ROS production in prostate, but inhibiting this pathway also successfully delays CaP progression.

SSeCKS/AKAP12 induces repulsion between human prostate cancer and microvessel endothelial cells through the activation of Semaphorin 3F.

PubMed

Xie, Wen; Su, Wei; Zhang, Lijuan; Shang, Qingkun; Su, Bing

2017-09-02

Metastasis remains the primary cause of prostate cancer related death. Cancer cells need to contact endothelial cells and disrupt endothelial junctions to cross the endothelium for invasion and metastasis. The suppression of heterotypic repulsion between cancer and endothelial cells allows cancer cells to invade into the surrounding tissue. Here, we demonstrate that SSeCKS/AKAP12 induced repulsion between human prostate cancer and microvessel endothelial cells, which was mediated by an angiogenesis inhibitor Semaphorin 3F. Moreover, we examined AKAP12 and Semaphorin 3F mRNA expression in 42 prostate cancer and 30 benign prostatic hyperplasia tissue samples, and found that the expression of AKAP12 and Semaphorin 3F mRNA was inversely associated with the degree of aggressiveness of prostate cancer cells and tissues. An ordinal logistic regression analysis indicates that there is a positive association between the expression of AKAP12 and Semaphorin 3F in prostate cancer, suggesting that the activation of Semaphorin 3F by SSeCKS/AKAP12 may be involved in prostate cancer progression and metastasis. Copyright © 2017 Elsevier Inc. All rights reserved.

Intraprostatic injection of botulinum toxin type- A relieves bladder outlet obstruction in human and induces prostate apoptosis in dogs

PubMed Central

Chuang, Yao-Chi; Tu, Chieh-Hsien; Huang, Chao-Cheng; Lin, Hsin-Ju; Chiang, Po-Hui; Yoshimura, Naoki; Chancellor, Michael B

2006-01-01

Background With the increasing interest with botulinum toxin – A (BTX-A) application in the lower urinary tract, we investigated the BTX-A effects on the canine prostate and also in men with bladder outlet obstruction (BOO) due to benign prostatic hyperplasia (BPH). Methods Transperineal injection into the prostate using transrectal ultrasound (TRUS) was performed throughout the study. Saline with or without 100 U of BTX-A was injected into mongrel dogs prostate. One or 3 months later, the prostate was harvested for morphologic and apoptotic study. In addition, eight BPH patients refractory to α-blockers were treated with ultrasound guided intraprostatic injection of 200 U of BTX-A. Results In the BTX-A treated dogs, atrophy and diffuse apoptosis was observed with H&E stain and TUNEL stain at 1 and 3 months. Clinically, the mean prostate volume, symptom score, and quality of life index were significantly reduced by 18.8%, 73.1%, and 61.5% respectively. Maximal flow rate significantly increased by 72.0%. Conclusion Intraprostatic BTX-A injection induces prostate apotosis in dogs and relieves BOO in humans. It is therefore a promising alternative treatment for refractory BOO due to BPH. PMID:16620393

SOX4 is essential for prostate tumorigenesis initiated by PTEN ablation | Office of Cancer Genomics

Cancer.gov

Understanding remains incomplete of the mechanisms underlying initiation and progression of prostate cancer, the most commonly diagnosed cancer in American men. The transcription factor SOX4 is overexpressed in many human cancers, including prostate cancer, suggesting it may participate in prostate tumorigenesis. In this study, we investigated this possibility by genetically deleting Sox4 in a mouse model of prostate cancer initiated by loss of the tumor suppressor Pten.

Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model

PubMed Central

Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

2016-01-01

Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model.

PubMed

Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

2016-03-01

Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer.

Human Collagen Injections to Reduce Rectal Dose During Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noyes, William R., E-mail: noyes@cancercenternd.com; Hosford, Charles C.; Schultz, Steven E.

Objectives: The continuing search for interventions, which address the incidence and grade of rectal toxicities associated with radiation treatment of prostate cancer, is a major concern. We are reporting an investigational trial using human collagen to increase the distance between the prostate and anterior rectal wall, thereby decreasing the radiation dose to the rectum. Methods: This is a pilot study evaluating the use of human collagen as a displacing agent for the rectal wall injected before starting a course of intensity-modulated radiotherapy (IMRT) for prostate cancer. Using a transperineal approach, 20 mL of human collagen was injected into the perirectalmore » space in an outpatient setting. Computerized IMRT plans were performed pre- and postcollagen injection, and after a patient completed their radiotherapy, to determine radiation dose reduction to the rectum associated with the collagen injection. Computed tomography scans were performed 6 months and 12 months after completing their radiotherapy to evaluate absorption rate of the collagen. All patients were treated with IMRT to a dose of 75.6 Gy to the prostate. Results: Eleven patients were enrolled into the study. The injection of human collagen in the outpatient setting was well tolerated. The mean separation between the prostate and anterior rectum was 12.7 mm. The mean reduction in dose to the anterior rectal wall was 50%. All men denied any rectal symptoms during the study. Conclusions: The transperineal injection of human collagen for the purpose of tissue displacement is well tolerated in the outpatient setting. The increased separation between the prostate and rectum resulted in a significant decrease in radiation dose to the rectum while receiving IMRT and was associated with no rectal toxicities.« less

Glutathione S-transferase Pi mediates proliferation of androgen-independent prostate cancer cells

PubMed Central

Hokaiwado, Naomi; Takeshita, Fumitaka; Naiki-Ito, Aya; Asamoto, Makoto; Ochiya, Takahiro; Shirai, Tomoyuki

2008-01-01

Prostate cancers generally acquire an androgen-independent growth capacity with progression, resulting in resistance to antiandrogen therapy. Therefore, identification of the genes regulated through this process may be important for understanding the mechanisms of prostate carcinogenesis. We here utilized androgen-dependent/independent transplantable tumors, newly established with the ‘transgenic rat adenocarcinoma in prostate’ (TRAP) model, to analyze their gene expression using microarrays. Among the overexpressed genes in androgen-independent prostate cancers compared with the androgen-dependent tumors, glutathione S-transferase pi (GST-pi) was included. In line with this, human prostate cancer cell lines PC3 and DU145 (androgen independent) had higher expression of GST-pi compared with LNCaP (androgen dependent) as determined by semiquantitative reverse transcription–polymerase chain reaction analysis. To investigate the roles of GST-pi expression in androgen-independent human prostate cancers, GST-pi was knocked down by a small interfering RNA (siRNA), resulting in significant decrease of the proliferation rate in the androgen-independent PC3 cell line. In vivo, administration of GST-pi siRNA–atelocollagen complex decreased GST-pi protein expression, resulting in enhanced numbers of TdT mediated dUTP-biotin nick-end labering (TUNEL)-positive apoptotic cells. These findings suggest that GST-pi might play important roles in proliferation of androgen-independent human prostate cancer cells. PMID:18413363

Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

PubMed Central

Kong, Hoon Young; Byun, Jonghoe

2015-01-01

Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

Estrogen action and prostate cancer

PubMed Central

Nelles, Jason L; Hu, Wen-Yang; Prins, Gail S

2011-01-01

Early work on the hormonal basis of prostate cancer focused on the role of androgens, but more recently estrogens have been implicated as potential agents in the development and progression of prostate cancer. In this article, we review the epidemiological, laboratory and clinical evidence that estrogen may play a causative role in human prostate cancer, as well as rodent and grafted in vivo models. We then review recent literature highlighting potential mechanisms by which estrogen may contribute to prostate cancer, including estrogenic imprinting and epigenetic modifications, direct genotoxicity, hyperprolactinemia, inflammation and immunologic changes, and receptor-mediated actions. We discuss the work performed so far separating the actions of the different known estrogen receptors (ERs), ERα and ERβ, as well as G-protein-coupled receptor 30 and their specific roles in prostate disease. Finally, we predict that future work in this field will involve more investigations into epigenetic changes, experiments using new models of hormonal dysregulation in developing human prostate tissue, and continued delineation of the roles of the different ER subtypes, as well as their downstream signaling pathways that may serve as therapeutic targets. PMID:21765856

Chronic toxic and carcinogenic effects of oral cadmium in the Noble (NBL/Cr) rat: induction of neoplastic and proliferative lesions of the adrenal, kidney, prostate, and testes.

PubMed

Waalkes, M P; Anver, M R; Diwan, B A

1999-10-29

Based on the occurrence of pulmonary cancers in exposed populations, cadmium is classified as a human carcinogen. More controversial target sites for cadmium in humans include the prostate and kidney, where some studies have shown a link between cadmium and cancer. In Wistar rats cadmium induces tumors in the ventral prostate. The relevance of such lesions to humans is debated since the rat ventral lobe, unlike the dorsolateral lobe, has no embryological homolog in the human prostate. Cadmium has not been linked with renal tumors in rodents but is a potent nephrotoxin. In this work we studied the effects of oral cadmium in the Noble (NBL/Cr) rat with particular attention to proliferative lesions of the prostate and kidneys. Cadmium (as CdCl2) was given ad libitum throughout the study in the drinking water at doses of 0, 25, 50, 100, and 200 ppm Cd to groups (initial n = 30) of male rats, which were observed for up to 102 wk. At the lower doses of cadmium (< or =50 ppm) a clear dose-related increase in total proliferative lesions of the prostate (ventral and dorsolateral lesions combined) occurred (0 ppm = 21% incidence, 25 ppm = 46%, 50 ppm = 50%; trend p < .03). These lesions were described as intraepithelial hyperplasia with occasional areas of atypical epithelial cells without stromal invasion. The lesions occurred primarily in the dorsolateral prostate with cadmium exposure and most frequently showed three or more foci within each specimen. At higher doses, prostatic proliferative lesions declined to control levels. The loss of prostatic response at the higher doses was likely due to diminished testicular function secondary to cadmium treatment. This was reflected in lesions indicative of testicular hypofunction at the highest cadmium dose, namely, interstitial cell hyperplasia, and a strong correlation between cadmium dose and total proliferative lesions of the testes (hyperplasias and tumors combined). Renal tumors (mainly mesenchymal and pelvic transitional cell), although few in number, showed a positive correlation with cadmium dose, as did pelvic transitional epithelial hyperplasia. Renal lesions were not associated with any cadmium-induced changes in age-related chronic nephropathy. The incidence of pheochromocytomas of the adrenal was increased by cadmium but only at the 50 ppm dose. Inflammatory lesions of the liver and spleen were common at higher doses and showed strong trends based on dose. These results indicate that oral cadmium can induce proliferative lesions in the prostate and kidney of the Noble rat. The finding of proliferative lesions of dorsolateral prostate in rats has presumed relevance to human prostate cancers.

PTEN expression and function in adult cancer stem cells and prospects for therapeutic targeting.

PubMed

Ciuffreda, Ludovica; Falcone, Italia; Incani, Ursula Cesta; Del Curatolo, Anais; Conciatori, Fabiana; Matteoni, Silvia; Vari, Sabrina; Vaccaro, Vanja; Cognetti, Francesco; Milella, Michele

2014-09-01

Phosphatase and tensin homolog deleted on chromosome ten (PTEN) is a non-redundant lipid phosphatase that restrains and fine tunes the phosphatidylinositol-3-kinase (PI3K) signaling pathway. PTEN is involved in inherited syndromes, which predispose to different types of cancers and is among the most frequently inactivated tumor suppressor genes in sporadic cancers. Indeed, loss of PTEN function occurs in a wide spectrum of human cancers through a variety of mechanisms, including mutations, deletions, transcriptional silencing, or protein instability. PTEN prevents tumorigenesis through multiple mechanisms and regulates a plethora of cellular processes, including survival, proliferation, energy metabolism and cellular architecture. Moreover, recent studies have demonstrated that PTEN is able to exit, exist, and function outside the cell, allowing for inhibition of the PI3K pathway in neighboring cells in a paracrine fashion. Most recently, studies have shown that PTEN is also critical for stem cell maintenance and that PTEN loss can lead to the emergence and proliferation of cancer stem cell (CSC) clones. Depending on the cellular and tissue context of origin, PTEN deletion may result in increased self-renewal capacity or normal stem cell exhaustion and PTEN-defìcient stem and progenitor cells have been reported in prostate, lung, intestinal, and pancreatic tissues before tumor formation; moreover, reversible or irreversible PTEN loss is frequently observed in CSC from a variety of solid and hematologic malignancies, where it may contribute to the functional phenotype of CSC. In this review, we will focus on the role of PTEN expression and function and downstream pathway activation in cancer stem cell biology and regulation of the tumorigenic potential; the emerging role of PTEN in mediating the crosstalk between the PI3K and MAPK pathways will also be discussed, together with prospects for the therapeutic targeting of tumors lacking PTEN expression. Copyright © 2014 Elsevier Ltd. All rights reserved.

Investigation of scattering coefficients and anisotropy factors of human cancerous and normal prostate tissues using Mie theory

NASA Astrophysics Data System (ADS)

Pu, Yang; Chen, Jun; Wang, Wubao

2014-02-01

The scattering coefficient, μs, the anisotropy factor, g, the scattering phase function, p(θ), and the angular dependence of scattering intensity distributions of human cancerous and normal prostate tissues were systematically investigated as a function of wavelength, scattering angle and scattering particle size using Mie theory and experimental parameters. The Matlab-based codes using Mie theory for both spherical and cylindrical models were developed and applied for studying the light propagation and the key scattering properties of the prostate tissues. The optical and structural parameters of tissue such as the index of refraction of cytoplasm, size of nuclei, and the diameter of the nucleoli for cancerous and normal human prostate tissues obtained from the previous biological, biomedical and bio-optic studies were used for Mie theory simulation and calculation. The wavelength dependence of scattering coefficient and anisotropy factor were investigated in the wide spectral range from 300 nm to 1200 nm. The scattering particle size dependence of μs, g, and scattering angular distributions were studied for cancerous and normal prostate tissues. The results show that cancerous prostate tissue containing larger size scattering particles has more contribution to the forward scattering in comparison with the normal prostate tissue. In addition to the conventional simulation model that approximately considers the scattering particle as sphere, the cylinder model which is more suitable for fiber-like tissue frame components such as collagen and elastin was used for developing a computation code to study angular dependence of scattering in prostate tissues. To the best of our knowledge, this is the first study to deal with both spherical and cylindrical scattering particles in prostate tissues.

Pomegranate Polyphenols Downregulate Expression of Androgen Synthesizing Genes in Human Prostate Cancer Cells Overexpressing the Androgen Receptor

PubMed Central

Hong, Mee Young; Seeram, Navindra P.; Heber, David

2008-01-01

Prostate cancer is dependent on circulating testosterone in its early stages and is treatable with radiation and surgery. However, recurrent prostate tumors advance to an androgen-independent state where they progress in the absence of circulating testosterone leading to metastasis and death. During the development of androgen independence, prostate cancer cells are known to increase intracellular testosterone synthesis which maintains cancer cell growth in the absence of significant amounts of circulating testosterone. Overexpression of the androgen receptor (AR) occurs in androgen-independent prostate cancer and has been proposed as another mechanism promoting the development of androgen independence. The LNCaP-AR cell line is engineered to overexpress AR but is otherwise similar to the widely studied LNCaP cell line. We have previously shown that pomegranate extracts inhibit both androgen-dependent and androgen-independent prostate cancer cell growth. In the present study, we examined the effects of pomegranate polyphenols, ellagitannin-rich extract and whole juice extract on the expression of genes for key androgen synthesizing enzymes and the AR. We measured expression of the HSD3B2, AKR1C3 and SRD5A1 genes for the respective androgen synthesizing enzymes in LNCaP, LNCaP-AR, and DU-145 human prostate cancer cells. A two-fold suppression of gene expression was considered statistically significant. Pomegranate polyphenols inhibited gene expression and AR most consistently in the LNCaP-AR cell line (P =.05). Therefore, inhibition by pomegranate polyphenols of gene expression involved in androgen synthesis enzymes and the AR may be of particular importance in androgen-independent prostate cancer cells and the subset of human prostate cancers where AR is upregulated. PMID:18479901

Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate

PubMed Central

Karpf, Adam R; Omilian, Angela R; Bshara, Wiam; Tian, Lili; Tangrea, Michael A; Morrison, Carl D; Johnson, Candace S

2011-01-01

Epigenetic alterations occur in tumor-associated vessels in the tumor microenvironment. Methylation of the CYP24A1 gene promoter differs in endothelial cells isolated from tumors and non-tumor microenvironments in mice. The epigenetic makeup of endothelial cells of human tumor-associated vasculature is unknown due to difficulty of isolating endothelial cells populations from a heterogeneous tissue microenvironment. To ascertain CYP24A1 promoter methylation in tumor-associated endothelium, we utilized laser microdissection guided by CD31 immunohistochemistry to procure endothelial cells from human prostate tumor specimens. Prostate tissues were obtained following robotic radical prostatectomy from men with clinically localized prostate cancer. Adjacent histologically benign prostate tissues were used to compare endothelium from benign versus tumor microenvironments. Sodium bisulfite sequencing of CYP24A1 promoter region showed that the average CYP24A1 promoter methylation in the endothelium was 20% from the tumor microenvironment compared with 8.2% in the benign microenvironment (p < 0.05). A 2-fold to 17-fold increase in CYP24A1 promoter methylation was observed in the prostate tumor endothelium compared with the matched benign prostate endothelium in four patient samples, while CYP24A1 promoter methylation remained unchanged in two patient samples. In addition, there is no correlation of the level of CYP24A1 promoter methylation in prostate tumor-associated endothelium with that of epithelium/stroma. This study demonstrates that the CYP24A1 promoter is methylated in tumor-associated endothelium, indicating that epigenetic alterations in CYP24A1 may play a role in determining the phenotype of tumor-associated vasculature in the prostate tumor microenvironment. PMID:21725204

Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

PubMed

Yu, Yue; Lee, Jennifer Suehyun; Xie, Ning; Li, Estelle; Hurtado-Coll, Antonio; Fazli, Ladan; Cox, Michael; Plymate, Stephen; Gleave, Martin; Dong, Xuesen

2014-01-01

Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR) was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1) and interlukin-6 (IL-6) by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

PubMed

Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

2008-06-01

Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

The role of PIM1/PIM2 kinases in tumors of the male reproductive system.

PubMed

Jiménez-García, Manuel Pedro; Lucena-Cacace, Antonio; Robles-Frías, María José; Narlik-Grassow, Maja; Blanco-Aparicio, Carmen; Carnero, Amancio

2016-11-30

The PIM family of serine/threonine kinases has three highly conserved isoforms (PIM1, PIM2 and PIM3). PIM proteins are regulated through transcription and stability by JAK/STAT pathways and are overexpressed in hematological malignancies and solid tumors. The PIM kinases possess weak oncogenic abilities, but enhance other genes or chemical carcinogens to induce tumors. We generated conditional transgenic mice that overexpress PIM1 or PIM2 in male reproductive organs and analyzed their contribution to tumorigenesis. We found an increase in alterations of sexual organs and hyperplasia in the transgenic mice correlating with inflammation. We also found that PIM1/2 are overexpressed in a subset of human male germ cells and prostate tumors correlating with inflammatory features and stem cell markers. Our data suggest that PIM1/2 kinase overexpression is a common feature of male reproductive organs tumors, which provoke tissue alterations and a large inflammatory response that may act synergistically during the process of tumorigenesis. There is also a correlation with markers of cancer stem cells, which may contribute to the therapy resistance found in tumors overexpressing PIM kinases.

Synthetic Lethality as a Targeted Approach to Advanced Prostate Cancer

DTIC Science & Technology

2013-03-01

cell line was derived from primary human prostate epithelial cells by transformation with human papilloma virus. While not tumorigenic, they do...normal cells and tissues has no significant adverse effects. Inhibition of PKCδ in human and murine cells containing an activated Ras protein, however...initiates rapid and profound apoptosis. In this work, we are testing the hypothesis that inhibition or down-regulation of PKCδ in human and murine

NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer Risk

DTIC Science & Technology

2009-05-01

Steadman DJ, Giuffrida D, Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28...Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28:2389–95. 20. Wu X, Senechal K...3212836 /UG=Hs.21765 fatty acid desaturase 3 204733_at 5.74 gb:NM_002774.1 /DEF=Homo sapiens kallikrein 6 (neurosin, zyme) (KLK6), mRNA. /FEA=mRNA /GEN

Molecularly Targeted Dose-Enhancement Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model

DTIC Science & Technology

2013-10-01

cell lines, such as cervix cancer cell line (HeLa) and breast cancer cell line (MDA-MB-231), were also employed. The experiments with other cell lines...breast cancer cell line (MDA-MB- 231), and cervix cancer cell line (HeLa). Different from our hypothesis, prostate cancer cell lines did not present...Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model PRINCIPAL INVESTIGATOR: Kwang Song

Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN-deficient prostate cancer.

PubMed

Carver, Brett S; Chapinski, Caren; Wongvipat, John; Hieronymus, Haley; Chen, Yu; Chandarlapaty, Sarat; Arora, Vivek K; Le, Carl; Koutcher, Jason; Scher, Howard; Scardino, Peter T; Rosen, Neal; Sawyers, Charles L

2011-05-17

Prostate cancer is characterized by its dependence on androgen receptor (AR) and frequent activation of PI3K signaling. We find that AR transcriptional output is decreased in human and murine tumors with PTEN deletion and that PI3K pathway inhibition activates AR signaling by relieving feedback inhibition of HER kinases. Similarly, AR inhibition activates AKT signaling by reducing levels of the AKT phosphatase PHLPP. Thus, these two oncogenic pathways cross-regulate each other by reciprocal feedback. Inhibition of one activates the other, thereby maintaining tumor cell survival. However, combined pharmacologic inhibition of PI3K and AR signaling caused near-complete prostate cancer regressions in a Pten-deficient murine prostate cancer model and in human prostate cancer xenografts, indicating that both pathways coordinately support survival. Copyright © 2011 Elsevier Inc. All rights reserved.

Over-expression of lipocalin 2 promotes cell migration and invasion through activating ERK signaling to increase SLUG expression in prostate cancer.

PubMed

Ding, Guanxiong; Fang, Jie; Tong, Shijun; Qu, Lianxi; Jiang, Haowen; Ding, Qiang; Liu, Jun

2015-06-15

Metastasis is the primary cause of prostate cancer (PCa) lethality and poses a huge clinical obstacle. Lipocalin 2 (LCN2), a member of the lipocalin family, is aberrantly expressed in some human cancers and has been implicated in the progression of some tumors. However, the role of LCN2 in the metastatic capacity of prostate cancer (PCa) is poorly understood. LCN2 expression was examined by RT-qPCR and/or immunoblotting in human prostate tissue specimens and prostate cancer cell lines LNCaP, C4-2, 22RV1, PC3, DU-145, and PC3MM2. LCN2 protein level in human serum samples was determined by ELISA. Lentiviruses-mediated over-expression of LCN2 and knockdown of LCN2 was conducted to evaluate the role of LCN2 in cell migratory and invasive capacities of prostate cancer cells. Cell migration and invasion was examined by transwell chamber assay. Knockdown of SLUG by lentivirus was performed to investigate its role in LCN2-promoted cell migration and invasion in vitro (22RV1 cell line) and metastasis in vivo (tail vein metastasis assay in nude mice). Role of ERK signaling in LCN2-mediated up-regulation of SLUG was assayed by using ERK inhibitor U0126. We confirmed that LCN2 levels were correlated positively with invasive prostate cancer in human tissue and serum samples, and were also consistently associated with the invasive capacity of prostate cancer cell lines. The over-expression of LCN2 in 22RV1 cells (not highly invasive) promoted the epithelial-mesenchymal transition (EMT), increasing cell motility and invasiveness, while the knockdown of LCN2 in PC3 cells (highly invasive) inhibited EMT, decreasing cell motility and invasiveness. Among the multiple EMT transcription factors, LCN2 specifically induces the expression of SLUG, which was shown here to be required for the LCN2-induced increase in the invasive capacity of prostate cancer cells both in vitro and in vivo. Mechanistically, LCN2 promoted SLUG expression via activating ERK signaling pathway. LCN2 plays an important role in promoting cell migration and invasion of prostate cancer by inducing EMT through the ERK/SLUG axis. Therefore, targeted inhibition of LCN2 may represent a therapeutic strategy to prevent the metastasis of prostate cancer. © 2015 Wiley Periodicals, Inc.

Optical coherence elastography (OCE) as a method for identifying benign and malignant prostate biopsies

NASA Astrophysics Data System (ADS)

Li, Chunhui; Guan, Guangying; Ling, Yuting; Lang, Stephen; Wang, Ruikang K.; Huang, Zhihong; Nabi, Ghulam

2015-03-01

Objectives. Prostate cancer is the most frequently diagnosed malignancy in men. Digital rectal examination (DRE) - a known clinical tool based on alteration in the mechanical properties of tissues due to cancer has traditionally been used for screening prostate cancer. Essentially, DRE estimates relative stiffness of cancerous and normal prostate tissue. Optical coherence elastography (OCE) are new optical imaging techniques capable of providing cross-sectional imaging of tissue microstructure as well as elastogram in vivo and in real time. In this preliminary study, OCE was used in the setting of the human prostate biopsies ex vivo, and the images acquired were compared with those obtained using standard histopathologic methods. Methods. 120 prostate biopsies were obtained by TRUS guided needle biopsy procedures from 9 patients with clinically suspected cancer of the prostate. The biopsies were approximately 0.8mm in diameter and 12mm in length, and prepared in Formalin solution. Quantitative assessment of biopsy samples using OCE was obtained in kilopascals (kPa) before histopathologic evaluation. The results obtained from OCE and standard histopathologic evaluation were compared provided the cross-validation. Sensitivity, specificity, and positive and negative predictive values were calculated for OCE (histopathology was a reference standard). Results. OCE could provide quantitative elasticity properties of prostate biopsies within benign prostate tissue, prostatic intraepithelial neoplasia, atypical hyperplasia and malignant prostate cancer. Data analysed showed that the sensitivity and specificity of OCE for PCa detection were 1 and 0.91, respectively. PCa had significantly higher stiffness values compared to benign tissues, with a trend of increasing in stiffness with increasing of malignancy. Conclusions. Using OCE, microscopic resolution elastogram is promising in diagnosis of human prostatic diseases. Further studies using this technique to improve the detection and staging of malignant cancer of the prostate are ongoing.

AR Signaling in Human Malignancies: Prostate Cancer and Beyond.

PubMed

Antonarakis, Emmanuel S

2018-01-18

The notion that androgens and androgen receptor (AR) signaling are the hallmarks of prostate cancer oncogenesis and disease progression is generally well accepted. What is more poorly understood is the role of AR signaling in other human malignancies. This special issue of Cancers initially reviews the role of AR in advanced prostate cancer, and then explores the potential importance of AR signaling in other epithelial malignancies. The first few articles focus on the use of novel AR-targeting therapies in castration-resistant prostate cancer and the mechanisms of resistance to novel antiandrogens, and they also outline the interaction between AR and other cellular pathways, including PI3 kinase signaling, transcriptional regulation, angiogenesis, stromal factors, Wnt signaling, and epigenetic regulation in prostate cancer. The next several articles review the possible role of androgens and AR signaling in breast cancer, bladder cancer, salivary gland cancer, and hepatocellular carcinoma, as well as the potential treatment implications of using antiandrogen therapies in these non-prostatic malignancies.

Orphan nuclear receptor TLX functions as a potent suppressor of oncogene-induced senescence in prostate cancer via its transcriptional co-regulation of the CDKN1A (p21(WAF1) (/) (CIP1) ) and SIRT1 genes.

PubMed

Wu, Dinglan; Yu, Shan; Jia, Lin; Zou, Chang; Xu, Zhenyu; Xiao, Lijia; Wong, Kam-Bo; Ng, Chi-Fai; Chan, Franky L

2015-05-01

Oncogene-induced senescence is an important tumour-suppressing mechanism to prevent both premalignant transformation and cancer progression. Overcoming this process is a critical step in early cancer development. The druggable orphan nuclear receptor TLX (NR2E1) is characterized as an important regulator of neural stem cells and is also implicated in the development of some brain tumours. However, its exact functional roles in cancer growth regulation still remain unclear. Here we report that TLX can act as a promoter of tumourigenesis in prostate cancer by suppressing oncogene-induced senescence. We determined that TLX exhibited an increased expression in high-grade prostate cancer tissues and many prostate cancer cell lines. Functional studies revealed that TLX could perform an oncogenic function in prostate cancer cells, as its knockdown triggered cellular senescence and cell growth arrest in vitro and in vivo, whereas its over-expression promoted the malignant growth of prostate cancer cells. Furthermore, enhancement of TLX activity, by either ectopic expression or ligand stimulation, could potently prevent doxorubicin-induced senescence in prostate cancer cells and also allow prostatic epithelial cells to escape oncogene-induced senescence induced either by activated oncogene H-Ras(G12V) or knockdown of tumour suppressor PTEN, via a mechanism of direct but differential transcriptional regulation of two senescence-associated genes, repression of CDKN1A and transactivation of SIRT1. Together, our present study shows, for the first time, that TLX may play an important role in prostate carcinogenesis through its suppression of oncogene-induced senescence, and also suggests that targeting the senescence-regulatory TLX is of potential therapeutic significance in prostate cancer. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Forced LIGHT expression in prostate tumors overcomes Treg mediated immunosuppression and synergizes with a prostate tumor therapeutic vaccine by recruiting effector T lymphocytes.

PubMed

Yan, Lisa; Da Silva, Diane M; Verma, Bhavna; Gray, Andrew; Brand, Heike E; Skeate, Joseph G; Porras, Tania B; Kanodia, Shreya; Kast, W Martin

2015-02-15

LIGHT, a ligand for lymphotoxin-β receptor (LTβR) and herpes virus entry mediator, is predominantly expressed on activated immune cells and LTβR signaling leads to the recruitment of lymphocytes. The interaction between LIGHT and LTβR has been previously shown to activate immune cells and result in tumor regression in a virally-induced tumor model, but the role of LIGHT in tumor immunosuppression or in a prostate cancer setting, where self antigens exist, has not been explored. We hypothesized that forced expression of LIGHT in prostate tumors would shift the pattern of immune cell infiltration toward an anti-tumoral milieu, would inhibit T regulatory cells (Tregs) and would induce prostate cancer tumor associated antigen (TAA) specific T cells that would eradicate tumors. Real Time PCR was used to evaluate expression of forced LIGHT and other immunoregulatory genes in prostate tumors samples. For in vivo studies, adenovirus encoding murine LIGHT was injected intratumorally into TRAMP-C2 prostate cancer cell tumor bearing mice. Chemokine and cytokine concentrations were determined by multiplex ELISA. Flow cytometry was used to phenotype tumor infiltrating lymphocytes and expression of LIGHT on the tumor cell surface. Tumor-specific lymphocytes were quantified via ELISpot assay. Treg induction and Treg suppression assays determined Treg functionality after LIGHT treatment. LIGHT in combination with a therapeutic vaccine, PSCA TriVax, reduced tumor burden. LIGHT expression peaked within 48 hr of infection, recruited effector T cells that recognized mouse prostate stem cell antigen (PSCA) into the tumor microenvironment, and inhibited infiltration of Tregs. Tregs isolated from tumor draining lymph nodes had impaired suppressive capability after LIGHT treatment. Forced LIGHT treatment combined with PSCA TriVax therapeutic vaccination delays prostate cancer progression in mice by recruiting effector T lymphocytes to the tumor and inhibiting Treg mediated immunosuppression. Prostate 75:280-291, 2015. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.

Some Ethical Concerns About Human Induced Pluripotent Stem Cells.

PubMed

Zheng, Yue Liang

2016-10-01

Human induced pluripotent stem cells can be obtained from somatic cells, and their derivation does not require destruction of embryos, thus avoiding ethical problems arising from the destruction of human embryos. This type of stem cell may provide an important tool for stem cell therapy, but it also results in some ethical concerns. It is likely that abnormal reprogramming occurs in the induction of human induced pluripotent stem cells, and that the stem cells generate tumors in the process of stem cell therapy. Human induced pluripotent stem cells should not be used to clone human beings, to produce human germ cells, nor to make human embryos. Informed consent should be obtained from patients in stem cell therapy.

Decursin suppresses human androgen-independent PC3 prostate cancer cell proliferation by promoting the degradation of beta-catenin.

PubMed

Song, Gyu-Yong; Lee, Jee-Hyun; Cho, Munju; Park, Byeoung-Soo; Kim, Dong-Eun; Oh, Sangtaek

2007-12-01

Alterations in the Wnt/beta-catenin pathway are associated with the development and progression of human prostate cancer. Decursin, a pyranocoumarin isolated from the Korean Angelica gigas root, inhibits the growth of androgen-independent human prostate cancer cells, but little is known about its mechanism of action. Using a cell-based screen, we found that decursin attenuates the Wnt/beta-catenin pathway. Decursin antagonized beta-catenin response transcription (CRT), which was induced with Wnt3a-conditioned medium and LiCl, by promoting the degradation of beta-catenin. Furthermore, decursin suppressed the expression of cyclin D1 and c-myc, which are downstream target genes of beta-catenin and thus inhibited the growth of PC3 prostate cancer cells. In contrast, decursinol, in which the (CH3)2-C=CH-COO- side chain of decursin is replaced with -OH, had no effect on CRT, the level of intracellular beta-catenin, or PC3 cell proliferation. Our findings suggest that decursin exerts its anticancer activity in prostate cancer cells via inhibition of the Wnt/beta-catenin pathway.

Expression profile of human tissue kallikrein 15 provides preliminary insights into its roles in the prostate and testis.

PubMed

Filippou, Panagiota S; Ren, Annie H; Soosaipillai, Antoninus; Papaioannou, Michail-Dimitrios; Korbakis, Dimitrios; Safar, Roaa; Diamandis, Eleftherios P; Conner, James

2018-06-26

Human tissue kallikrein 15 (KLK15) is the latest member of the kallikrein-related peptidase family. Little is known about the pathophysiological roles of KLK15. Previous studies implied a role of KLK15 in prostate cancer. In the present study, we examined KLK15 protein expression using a new immunoassay (ELISA) and immunohistochemistry (IHC). Highest KLK15 levels were detected in the testis and seminal fluid, whereas lower levels were observed in prostate and other tissues. Immunohistochemical analysis of testis suggests that KLK15 is strongly expressed in mature spermatids, but not in immature germ cells. KLK15 displayed predominantly nuclear localization in the basal cell layer of the prostatic epithelium. We also measured KLK15 in supernatants of various cell lines. Highest KLK15 levels were primarily detected in prostate cancer cell lines and KLK15 expression was hormone-independent, in contrast to KLK3. Collectively, our data provide insights into the localization and possible role of KLK15 in human physiology. Copyright © 2018. Published by Elsevier Inc.

Modeling prostate cancer in mice: something old, something new, something premalignant, something metastatic.

PubMed

Irshad, Shazia; Abate-Shen, Cory

2013-06-01

More than 15 years ago, the first generation of genetically engineered mouse (GEM) models of prostate cancer was introduced. These transgenic models utilized prostate-specific promoters to express SV40 oncogenes specifically in prostate epithelium. Since the description of these initial models, there have been a plethora of GEM models of prostate cancer representing various perturbations of oncogenes or tumor suppressors, either alone or in combination. This review describes these GEM models, focusing on their relevance for human prostate cancer and highlighting their strengths and limitations, as well as opportunities for the future.

Locus-specific gene repositioning in prostate cancer

PubMed Central

Leshner, Marc; Devine, Michelle; Roloff, Gregory W.; True, Lawrence D.; Misteli, Tom; Meaburn, Karen J.

2016-01-01

Genes occupy preferred spatial positions within interphase cell nuclei. However, positioning patterns are not an innate feature of a locus, and genes can alter their localization in response to physiological and pathological changes. Here we screen the radial positioning patterns of 40 genes in normal, hyperplasic, and malignant human prostate tissues. We find that the overall spatial organization of the genome in prostate tissue is largely conserved among individuals. We identify three genes whose nuclear positions are robustly altered in neoplastic prostate tissues. FLI1 and MMP9 position differently in prostate cancer than in normal tissue and prostate hyperplasia, whereas MMP2 is repositioned in both prostate cancer and hyperplasia. Our data point to locus-specific reorganization of the genome during prostate disease. PMID:26564800

Resveratrol Improves Cell Cycle Arrest in Chronic Prostatitis Rats, by C-kit/SCF Suppression.

PubMed

He, Yi; Zeng, Huizhi; Yu, Yang; Zhang, Jiashu; Zeng, Xiaona; Gong, Fengtao; Liu, Qi; Yang, Bo

2017-08-01

Chronic prostatitis (CP) with complex pathogenesis is difficult for treatment. c-kit has been associated with the control of cell proliferation of prostate cells. This study aims to evaluate the role of resveratrol, an activator of Sirt1, in regulating the expression of c-kit in CP and investigate the consequent effects on cell cycle. Rat model of CP was established through subcutaneous injections of diphtheria-pertussis-tetanus vaccine and subsequently treated with resveratrol. Hematoxylin and eosin staining was performed to identify the histopathological changes in prostates. Western blotting and immunohistochemical staining examined the expression level of c-kit, stem cell factor (SCF), Sirt1, and cell cycle-associated proteins. The model group exhibited severe diffuse chronic inflammation, characterized by leukocyte infiltration and papillary frond protrusion into the gland cavities, and a notable increase in prostatic epithelial height. Gland lumen diameter was also significantly smaller; the activity of c-kit/SCF in the CP rats was increased significantly compared to the control group. Meanwhile, the cell cycle proteins are dysregulated significantly in CP rats. Resveratrol treatment significantly improved these factors by Sirt1 activation. Dysregulation of cell cycle was involved in the pathological processes of CP, which was improved after resveratrol treatment by the downregulation of c-kit/SCF by activating Sirt1.

Prevalence of Prostate Cancer Metastases after Intravenous Inoculation Provides Clues into the Molecular Basis of Dormancy in the Bone Marrow Microenvironment1

PubMed Central

Jung, Younghun; Shiozawa, Yusuke; Wang, Jingcheng; McGregor, Natalie; Dai, Jinlu; Park, Serk In; Berry, Janice E; Havens, Aaron M; Joseph, Jeena; Kim, Jin Koo; Patel, Lalit; Carmeliet, Peter; Daignault, Stephanie; Keller, Evan T; McCauley, Laurie K; Pienta, Kenneth J; Taichman, Russell S

2012-01-01

Bone is the preferred metastasis site of advanced prostate cancer (PCa). Using an in vivo murine model of human PCa cell metastasis to bone, we noted that the majority of animals that develop skeletal metastasis have either spinal lesions or lesions in the bones of the hindlimb. Much less frequently, lesions develop in the bones of the forelimb. We therefore speculated whether the environment of the forelimb bones is not permissive for the growth of PCa. Consequently, data on tumor prevalence were normalized to account for the number of PCa cells arriving after intravascular injection, marrow cellularity, and number of hematopoietic stem cell niches. None of these factors were able to account for the observed differences in tumor prevalence. An analysis of differential gene and protein levels identified that growth arrest specific-6 (GAS6) levels were significantly greater in the forelimb versus hindlimb bone marrow. When murine RM1 cells were implanted into subcutaneous spaces in immune competent animals, tumor growth in the GAS6-/- animals was greater than in GAS6+/+ wild-type animals. In an osseous environment, the human PC3 cell line grew significantly better in vertebral body transplants (vossicles) derived from GAS6-/- animals than in vossicles derived from GAS6+/+ animals. Together, these data suggest that the differences in tumor prevalence after intravascular inoculation are a useful model to study the molecular basis of tumor dormancy. Importantly, these data suggest that therapeutic manipulation of GAS6 levels may prove useful as a therapy for metastatic disease. PMID:22745589

Estradiol causes the rapid accumulation of cAMP in human prostate.

PubMed Central

Nakhla, A M; Khan, M S; Romas, N P; Rosner, W

1994-01-01

Androgens are widely acknowledged to be central to the pathogenesis of benign prostatic hypertrophy (BPH). However, BPH increases in prevalence as men age, at precisely the stage of life when plasma androgens are decreasing. The decrease in total plasma androgens is amplified by an age-related increase in plasma sex hormone-binding globulin (SHBG) that results in a relatively greater decrease in free androgens than in total androgens. In addition, estrogens have long been suspected to be important in BPH, but a direct effect on the human prostate has never been demonstrated. We present data that are consistent with a role for estradiol, and for a decrease in androgens and an increase in SHBG, in the pathogenesis of BPH. We show that estradiol, but not dihydrotestosterone, acts in concert with SHBG to produce an 8-fold increase in intracellular cAMP in human BPH tissue. This increase is not blocked by an antiestrogen and is not provoked by an estrogen (diethylstilbestrol) that does not bind to SHBG, thus excluding the classic estrogen receptor as being operative in these events. Conversely, dihydrotestosterone, which blocks the binding of estradiol to SHBG, completely negates the effect of estradiol. Finally, we demonstrate that the SHBG-steroid-responsive second-messenger system is primarily localized to the prostatic stromal cells and not to the prostatic epithelial cells. Thus, we have shown a cell-specific, powerful, nontranscriptional effect of estradiol on the human prostate. PMID:7515502

Heparin-binding growth factor isolated from human prostatic extracts.

PubMed

Mydlo, J H; Bulbul, M A; Richon, V M; Heston, W D; Fair, W R

1988-01-01

Prostatic tissue extracts from patients with benign prostatic hyperplasia (BPH) and prostatic carcinoma were fractionated using heparin-Sepharose chromatography. The mitogenic activity of eluted fractions on quiescent subconfluent Swiss Albino 3T3 fibroblasts was tested employing a tritiated-thymidine-incorporation assay. Two peaks of activity were consistently noted--one in the void volume and a second fraction which eluted with 1.3-1.6 M NaCl and contained the majority of the mitogenic activity. Both non-heparin- and heparin-binding fractions increased tritiated incorporation into a mouse osteoblast cell line (MC3T3), while only the heparin-binding fractions stimulated a human umbilical vein endothelial cell line (HUV). No increased uptake of thymidine was seen using a human prostatic carcinoma cell line (PC-3). Sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) of lyophilized active fractions showed a persistent band at 17,500 daltons. The purified protein demonstrated angiogenic properties using the chick embryo chorioallantoic membrane (CAM) assay. Western blot analysis using antibodies specific to basic fibroblast growth factor (bFGF) or acidic FGF (aFGF) demonstrated that the former, but not the latter, bound to prostatic growth factor (PrGF), and inhibited its mitogenic activity as well. It appears that PrGF shares homology with basic fibroblast growth factors.

ERBB2 Increases Metastatic Potentials Specifically in Androgen-Insensitive Prostate Cancer Cells

PubMed Central

Tome-Garcia, Jessica; Li, Dan; Ghazaryan, Seda; Shu, Limin; Wu, Lizhao

2014-01-01

Despite all the blood-based biomarkers used to monitor prostate cancer patients, prostate cancer remains as the second common cause of cancer mortality in men in the United States. This is largely due to a lack of understanding of the molecular pathways that are responsible for the aggressive forms of prostate cancers, the castrate-resistant prostate cancer and the metastatic prostate cancer. Cell signaling pathways activated by the ERBB2 oncogene or the RAS oncogene are frequently found to be altered in metastatic prostate cancers. To evaluate and define the role of the ERBB2/RAS pathway in prostate cancer metastasis, we have evaluated the impact of ERBB2- or RAS-overexpression on the metastatic potentials for four prostate cancer cell lines derived from tumors with different androgen sensitivities. To do so, we transfected the human DU145, LnCaP, and PC3 prostate cancer cells and the murine Myc-CaP prostate cancer cells with the activated form of ERBB2 or H-RAS and assessed their metastatic potentials by three complementary assays, a wound healing assay, a transwell motility assay, and a transwell invasion assay. We showed that while overexpression of ERBB2 increased the metastatic potential of the androgen-insensitive prostate cancer cells (i.e. PC3 and DU145), it did not affect metastatic potentials of the androgen-sensitive prostate cancer cells (i.e. LnCaP and Myc-CaP). In contrast, overexpression of H-RAS only increased the cell motility of Myc-CaP cells, which overexpress the human c-MYC oncogene. Our data suggest that ERBB2 collaborates with androgen signaling to promote prostate cancer metastasis, and that although RAS is one of the critical downstream effectors of ERBB2, it does not phenocopy ERBB2 for its impact on the metastatic potentials of prostate cancer cell lines. PMID:24937171

Inhibition of microRNA-500 has anti-cancer effect through its conditional downstream target of TFPI in human prostate cancer.

PubMed

Cai, Bing; Chen, Wei; Pan, Yue; Chen, Hongde; Zhang, Yirong; Weng, Zhiliang; Li, Yeping

2017-07-01

We investigated the prognostic potential and regulatory mechanism of microRNA-500 (miR-500), and human gene of tissue factor pathway inhibitor (TFPI) in prostate cancer. MiR-500 expression was assessed by qRT-PCR in prostate cancer cell lines and primary tumors. Cancer patients' clinicopathological factors and overall survival were analyzed according to endogenous miR-500 level. MiR-500 was downregulated in DU145 and VCaP cells. Its effect on prostate cancer proliferation, invasion in vitro, and tumorigenicity in vivo, were probed. Possible downstream target of miR-500, TFPI was assessed by luciferase assay and qRT-PCR in prostate cancer cells. In miR-500-downregulated DU145 and VCaP cells, TFPI was silenced to see whether it was directly involved in the regulation of miR-500 in prostate cancer. TFPI alone was either upregulated or downregulated in DU145 and VCaP cells. Their effect on prostate cancer development was further evaluated. MiR-500 is upregulated in both prostate cancer cells and primary tumors. In prostate cancer patients, high miR-500 expression is associated with poor prognosis and overall survival. In DU145 and VCaP cells, miR-500 downregulation inhibited cancer proliferation, invasion in vitro, and explant growth in vivo. TFPI was verified to be associated with miR-500 in prostate cancer. Downregulation of TFPI reversed anti-cancer effects of miR-500 downregulation in prostate cancer cells. However, neither TFPI upregulation nor downregulation alone had any functional impact on prostate cancer development. MiR-500 may be a potential biomarker and molecular target in prostate cancer. TFPI may conditionally regulate prostate cancer in miR-500-downregualted prostate cancer cells. © 2017 Wiley Periodicals, Inc.

Tocotrienol-rich fraction of palm oil induces cell cycle arrest and apoptosis selectively in human prostate cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Janmejai K.; Department of Urology, University Hospitals of Cleveland, Cleveland, OH 44106; Gupta, Sanjay

2006-07-28

One of the requisite of cancer chemopreventive agent is elimination of damaged or malignant cells through cell cycle inhibition or induction of apoptosis without affecting normal cells. In this study, employing normal human prostate epithelial cells (PrEC), virally transformed normal human prostate epithelial cells (PZ-HPV-7), and human prostate cancer cells (LNCaP, DU145, and PC-3), we evaluated the growth-inhibitory and apoptotic effects of tocotrienol-rich fraction (TRF) extracted from palm oil. TRF treatment to PrEC and PZ-HPV-7 resulted in almost identical growth-inhibitory responses of low magnitude. In sharp contrast, TRF treatment resulted in significant decreases in cell viability and colony formation inmore » all three prostate cancer cell lines. The IC{sub 5} values after 24 h TRF treatment in LNCaP, PC-3, and DU145 cells were in the order 16.5, 17.5, and 22.0 {mu}g/ml. TRF treatment resulted in significant apoptosis in all the cell lines as evident from (i) DNA fragmentation (ii) fluorescence microscopy, and (iii) cell death detection ELISA, whereas the PrEC and PZ-HPV-7 cells did not undergo apoptosis, but showed modestly decreased cell viability only at a high dose of 80 {mu}g/ml. In cell cycle analysis, TRF (10-40 {mu}g/ml) resulted in a dose-dependent G0/G1 phase arrest and sub G1 accumulation in all three cancer cell lines but not in PZ-HPV-7 cells. These results suggest that the palm oil derivative TRF is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. TRF offers significant promise as a chemopreventive and/or therapeutic agent against prostate cancer.« less

P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

PubMed Central

Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

2016-01-01

Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under experimental conditions. PMID:27071060

P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate.

PubMed

Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G; Hennenberg, Martin

2016-01-01

Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients' adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1-10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under experimental conditions.

The Role of XMRV, a Novel Xenotropic Murine Retrovirus, in Human Prostate Cancers

DTIC Science & Technology

2011-05-01

ultimately determine the true prevalence of these viruses in humans and then to determine whether there is a link to any pathology. BODY...characterization of the novel XMRV virus , documenting its tissue tropism and interferon-sensitivity. We also documented the prevalence of the virus in human ...correlation of XMRV with prostate cancer prognosis. The recog- nition that human papilloma viruses most often initiate cervical carcinomas has focused

Bad seeds produce bad crops: a single stage-process of prostate tumor invasion

PubMed Central

Man, Yan-gao; Gardner, William A.

2008-01-01

It is a commonly held belief that prostate carcinogenesis is a multi-stage process and that tumor invasion is triggered by the overproduction of proteolytic enzymes. This belief is consistent with data from cell cultures and animal models, whereas is hard to interpret several critical facts, including the presence of cancer in “healthy” young men and cancer DNA phenotype in morphologically normal prostate tissues. These facts argue that alternative pathways may exist for prostate tumor invasion in some cases. Since degradation of the basal cell layer is the most distinct sign of invasion, our recent studies have attempted to identify pre-invasive lesions with focal basal cell layer alterations. Our studies revealed that about 30% of prostate cancer patients harbored normal appearing duct or acinar clusters with a high frequency of focal basal cell layer disruptions. These focally disrupted basal cell layers had significantly reduced cell proliferation and tumor suppressor expression, whereas significantly elevated degeneration, apoptosis, and infiltration of immunoreactive cells. In sharp contrast, associated epithelial cell had significantly elevated proliferation, expression of malignancy-signature markers, and physical continuity with invasive lesions. Based on these and other findings, we have proposed that these normal appearing duct or acinar clusters are derived from monoclonal proliferation of genetically damaged stem cells and could progress directly to invasion through two pathways: 1) clonal in situ transformation (CIST) and 2) multi-potential progenitor mediated “budding” (MPMB). These pathways may contribute to early onset of prostate cancer at young ages, and to clinically more aggressive prostate tumors. PMID:18725981

The adaptive immune system promotes initiation of prostate carcinogenesis in a human c-Myc transgenic mouse model.

PubMed

Melis, Monique H M; Nevedomskaya, Ekaterina; van Burgsteden, Johan; Cioni, Bianca; van Zeeburg, Hester J T; Song, Ji-Ying; Zevenhoven, John; Hawinkels, Lukas J A C; de Visser, Karin E; Bergman, Andries M

2017-11-07

Increasing evidence from epidemiological and pathological studies suggests a role of the immune system in the initiation and progression of multiple cancers, including prostate cancer. Reports on the contribution of the adaptive immune system are contradictive, since both suppression and acceleration of disease development have been reported. This study addresses the functional role of lymphocytes in prostate cancer development using a genetically engineered mouse model (GEMM) of human c-Myc driven prostate cancer (Hi-Myc mice) combined with B and T cell deficiency (RAG1 -/- mice). From a pre-cancerous stage on, Hi-Myc mice showed higher accumulation of immune cells in their prostates then wild-type mice, of which macrophages were the most abundant. The onset of invasive adenocarcinoma was delayed in Hi-MycRAG1 -/- compared to Hi-Myc mice and associated with decreased infiltration of leukocytes into the prostate. In addition, lower levels of the cytokines CXCL2, CCL5 and TGF-β1 were detected in Hi-MycRAG1 -/- compared to Hi-Myc mouse prostates. These results from a GEMM of prostate cancer provide new insights into the promoting role of the adaptive immune system in prostate cancer development. Our findings indicate that the endogenous adaptive immune system does not protect against de novo prostate carcinogenesis in Hi-Myc transgenic mice, but rather accelerates the formation of invasive adenocarcinomas. This may have implications for the development of novel treatment strategies.

Inflammation and Atrophy Precede Prostate Neoplasia in PhIP Induced Rat Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borowsky, A D; Dingley, K; Ubick, E

2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine (PhIP) has been implicated as a major mutagenic heterocyclic amine in the human diet and is carcinogenic in the rat prostate. In order to validate PhIP induced rat prostate neoplasia as a model of human prostate cancer progression, we sought to study the earliest histologic and morphologic changes in the prostate and to follow the progressive changes over time. We fed 67 male Fischer F344 5 week old rats with PhIP (400 PPM) or control diets for 20 weeks, and then sacrificed animals for histomorphologic examination at age 25 weeks, 45 weeks, and 65 weeks. Animals treated with PhIPmore » showed significantly more inflammation (P=.002 (25wk), >.001(45wk), .016(65wk)) and atrophy (P=.003(25wk), >.001(45wk), .006 (65wk)) in their prostate glands relative to controls. Prostatic intraepithelial neoplasia (PIN) occurred only in PhIP treated rats. PIN lesions arose in areas of glandular atrophy, most often in the ventral prostate. Atypical cells in areas of atrophy show loss of glutathione S-transferase pi immunostaining preceding development of PIN. None of the animals in this study developed invasive carcinomas differing from previous reports. Overall, these findings suggest that the pathogenesis of prostatic neoplasia in the PhIP treated rat prostate proceeds from inflammation to post-inflammatory proliferative atrophy to PIN.« less

Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor

NASA Technical Reports Server (NTRS)

Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W. M.; Duray, P. H.

1999-01-01

PURPOSE: To maintain ex vivo integral prostatic tissue including intact stromal and ductal elements using the NASA-designed Rotating Wall Vessel (RWV) which maintains colocalized cells in an environment that promotes both three-dimensional cellular interactions together with the uniform mass transfer of nutrients and metabolic wastes. MATERIALS AND METHODS: Samples of normal prostate were obtained as a byproduct of transurethral prostatectomy or needle biopsy. Prostatic tissue dissected into small 1 x 1 mm. blocks was cultured in the Rotating Wall Vessel (RWV) Bioreactor for various time periods and analyzed using histological, immunochemical, and total cell RNA assays. RESULTS: We report the long term maintenance of benign explanted human prostate tissue grown in simple culture medium, under the simulated microgravity conditions afforded by the RWV bioreactor. Mesenchymal stromal elements including blood vessels and architecturally preserved tubuloglandular acini were maintained for a minimum of 28 days. Cytokeratins, vimentin and TGF-beta2 receptor and ligand were preserved through the entire culture period as revealed by immunocytochemistry. Prostatic acid phosphatase (PAP) was continuously expressed during the culture period, although somewhat decreased. Prostatic specific antigen (PSA) and its transcript were down regulated over time of culture. Prostatic carcinoma cells from the TSU cell line were able to invade RWV-cultured benign prostate tissue explants. CONCLUSIONS: The RWV bioreactor represents an additional new technology for culturing prostate tissue for further investigations concerning the basic physiology and pathobiology of this clinically important tissue.

Expression and Function of the Progesterone Receptor in Human Prostate Stroma Provide Novel Insights to Cell Proliferation Control

PubMed Central

Yu, Yue; Liu, Liangliang; Xie, Ning; Xue, Hui; Fazli, Ladan; Buttyan, Ralph; Wang, Yuzhuo; Gleave, Martin

2013-01-01

Context: Like other tissues, the prostate is an admixture of many different cell types that can be segregated into components of the epithelium or stroma. Reciprocal interactions between these 2 types of cells are critical for maintaining prostate homeostasis, whereas aberrant stromal cell proliferation can disrupt this balance and result in diseases such as benign prostatic hyperplasia. Although the androgen and estrogen receptors are relatively well studied for their functions in controlling stromal cell proliferation and differentiation, the role of the progesterone receptor (PR) remains unclear. Objective: The aim of the study was to investigate the expression and function of the PR in the prostate. Design and Setting: Human prostate biopsies, renal capsule xenografts, and prostate stromal cells were used. Immunohistochemistry, Western blotting, real-time quantitative PCR, cell proliferation, flow cytometry, and gene microarray analyses were performed. Results: Two PR isoforms, PRA and PRB, are expressed in prostate stromal fibroblasts and smooth muscle cells, but not in epithelial cells. Both PR isoforms suppress prostate stromal cell proliferation through inhibition of the expression of cyclinA, cyclinB, and cdc25c, thus delaying cell cycling through S and M phases. Gene microarray analyses further demonstrated that PRA and PRB regulated different transcriptomes. However, one of the major gene groups commonly regulated by both PR isoforms was the one associated with regulation of cell proliferation. Conclusion: PR plays an inhibitory role in prostate stromal cell proliferation. PMID:23666965

Optimization and comprehensive characterization of a faithful tissue culture model of the benign and malignant human prostate.

PubMed

Maund, Sophia Lisette; Nolley, Rosalie; Peehl, Donna Mae

2014-02-01

Few preclinical models accurately depict normal human prostate tissue or primary prostate cancer (PCa). In vitro systems typically lack complex cellular interactions among structured prostatic epithelia and a stromal microenvironment, and genetic and molecular fidelity are concerns in both in vitro and in vivo models. 'Tissue slice cultures' (TSCs) provide realistic preclinical models of diverse tissues and organs, but have not been fully developed or widely utilized for prostate studies. Problems encountered include degeneration of differentiated secretory cells, basal cell hyperplasia, and poor survival of PCa. Here, we optimized, characterized, and applied a TSC model of primary human PCa and benign prostate tissue that overcomes many deficiencies of current in vitro models. Tissue cores from fresh prostatectomy specimens were precision-cut at 300 μm and incubated in a rotary culture apparatus. The ability of varied culture conditions to faithfully maintain benign and cancer cell and tissue structure and function over time was evaluated by immunohistological and biochemical assays. After optimization of the culture system, molecular and cellular responses to androgen ablation and to piperlongumine (PL), purported to specifically reduce androgen signaling in PCa, were investigated. Optimized culture conditions successfully maintained the structural and functional fidelity of both benign and PCa TSCs for 5 days. TSCs exhibited androgen dependence, appropriately undergoing ductal degeneration, reduced proliferation, and decreased prostate-specific antigen expression upon androgen ablation. Further, TSCs revealed cancer-specific reduction of androgen receptor and increased apoptosis upon treatment with PL, validating data from cell lines. We demonstrate a TSC model that authentically recapitulates the structural, cellular, and genetic characteristics of the benign and malignant human prostate, androgen dependence of the native tissue, and cancer-specific response to a potentially new therapeutic for PCa. The work described herein provides a basis for advancing the experimental utility of the TSC model.

Protection against oxidative DNA damage and stress in human prostate by glutathione S-transferase P1

PubMed Central

Kanwal, Rajnee; Pandey, Mitali; Bhaskaran, Natarajan; MacLennan, Gregory T; Fu, Pingfu; Ponsky, Lee E; Gupta, Sanjay

2014-01-01

The pi-class glutathione S-transferase (GSTP1) actively protect cells from carcinogens and electrophilic compounds. Loss of GSTP1 expression via promoter hypermethylation is the most common epigenetic alteration observed in human prostate cancer. Silencing of GSTP1 can increase generation of reactive oxygen species (ROS) and DNA damage in cells. In this study we investigated whether loss of GSTP1 contributes to increased DNA damage that may predispose men to a higher risk of prostate cancer. We found significantly elevated (103%; P<0.0001) levels of 8-oxo-2′-deoxogunosine (8-OHdG), an oxidative DNA damage marker, in adenocarcinomas, compared to benign counterparts, which positively correlated (r=0.2) with loss of GSTP1 activity (34%; P<0.0001). Silencing of GSTP1 using siRNA approach in normal human prostate epithelial RWPE1 cells caused increased intracellular production of ROS and higher susceptibility of cells to H2O2-mediated oxidative stress. Additionally, human prostate carcinoma LNCaP cells, which contain a silenced GSTP1 gene, were genetically modified to constitutively express high levels of GSTP1. Induction of GSTP1 activity lowered endogenous ROS levels in LNCaP-pLPCX-GSTP1 cells, and when exposed to H2O2, these cells exhibited significantly reduced production of ROS and 8-OHdG levels, compared to vector control LNCaP-pLPCX cells. Furthermore, exposure of LNCaP cells to green tea polyphenols caused re-expression of GSTP1, which protected the cells from H2O2-mediated DNA damage through decreased ROS production compared to non-exposed cells. These results suggest that loss of GSTP1 expression in human prostate cells, a process that increases their susceptibility to oxidative stress-induced DNA damage, may be an important target for primary prevention of prostate cancer. PMID:22833520

Organoid culture systems for prostate epithelial tissue and prostate cancer tissue

PubMed Central

Drost, Jarno; Karthaus, Wouter R.; Gao, Dong; Driehuis, Else; Sawyers, Charles L.; Chen, Yu; Clevers, Hans

2016-01-01

Summary This protocol describes a recently developed strategy to generate 3D prostate organoid cultures from healthy mouse and human prostate (either bulk or FAC-sorted single luminal and basal cells), metastatic prostate cancer lesions and circulating tumour cells. Organoids derived from healthy material contain the differentiated luminal and basal cell types, whereas organoids derived from prostate cancer tissue mimic the histology of the tumour. The stepwise establishment of these cultures and the fully defined serum-free conditioned medium that is required to sustain organoid growth are outlined. Organoids established using this protocol can be used to study many different aspects of prostate biology, including homeostasis, tumorigenesis and drug discovery. PMID:26797458

Growth inhibitory effects of the dual ErbB1/ErbB2 tyrosine kinase inhibitor PKI-166 on human prostate cancer xenografts.

PubMed

Mellinghoff, Ingo K; Tran, Chris; Sawyers, Charles L

2002-09-15

Experiments with human prostate cancer cell lines have shown that forced overexpression of the ErbB2-receptor tyrosine kinase (RTK) promotes androgen-independent growth and increases androgen receptor-transcriptional activity in a ligand-independent fashion. To investigate the relationship between ErbB-RTK signaling and androgen in genetically unmanipulated human prostate cancer, we performed biochemical and biological studies with the dual ErbB1/ErbB2 RTK inhibitor PKI-166 using human prostate cancer xenograft models with isogenic sublines reflecting the transition from androgen-dependent to androgen-independent growth. In the presence of low androgen concentrations, PKI-166 showed profound growth-inhibitory effects on tumor growth, which could be partially reversed by androgen add-back. At physiological androgen concentrations, androgen withdrawal greatly enhanced the ability of PKI-166 to retard tumor growth. The level of extracellular signal-regulated kinase activation correlated with the response to PKI-166 treatment, whereas the expression levels of ErbB1 and ErbB2 did not. These results suggest that ErbB1/ErbB2 RTKs play an important role in the biology of androgen-independent prostate cancer and provide a rationale for clinical evaluation of inhibitors targeted to this pathway.

Hypoxia-Induced Signaling Promotes Prostate Cancer Progression: Exosomes Role as Messenger of Hypoxic Response in Tumor Microenvironment

PubMed Central

Deep, Gagan; Panigrahi, Gati K.

2017-01-01

Prostate cancer (PCA) is the leading malignancy in men and the second leading cause of cancer-related deaths. Hypoxia (low O2 condition) is considered an early event in prostate carcinogenesis associated with an aggressive phenotype. In fact, clinically, hypoxia and hypoxia-related biomarkers are associated with treatment failure and disease progression. Hypoxia-inducible factor 1 (HIF-1) is the key factor that is activated under hypoxia, and mediates adaptation of cells to hypoxic conditions through regulating the expression of genes associated with angiogenesis, epithelial-to-mesenchymal transition (EMT), metastasis, survival, proliferation, metabolism, stemness, hormone-refractory progression, and therapeutic resistance. Besides HIF-1, several other signaling pathways including PI3K/Akt/mTOR, NADPH oxidase (NOX), Wnt/β-catenin, and Hedgehog are activated in cancer cells under hypoxic conditions, and also contribute in hypoxia-induced biological effects in HIF-1-dependent and -independent manners. Hypoxic cancer cells cause extensive changes in the tumor microenvironment both local and distant, and recent studies have provided ample evidence supporting the crucial role of nanosized vesicles “exosomes” in mediating hypoxia-induced tumor microenvironment remodeling. Exosomes’ role has been reported in hypoxia-induced angiogenesis, stemness, activation of cancer-associated fibroblasts (CAFs), and EMT. Together, existing literature suggests that hypoxia plays a predominant role in PCA growth and progression, and PCA could be effectively prevented and treated via targeting hypoxia/hypoxia-related signaling pathways. PMID:27279239

Emerging Roles of Human Prostatic Acid Phosphatase

PubMed Central

Kong, Hoon Young; Byun, Jonghoe

2013-01-01

Prostate cancer is one of the most prevalent non-skin related cancers. It is the second leading cause of cancer deaths among males in most Western countries. If prostate cancer is diagnosed in its early stages, there is a higher probability that it will be completely cured. Prostatic acid phosphatase (PAP) is a non-specific phosphomonoesterase synthesized in prostate epithelial cells and its level proportionally increases with prostate cancer progression. PAP was the biochemical diagnostic mainstay for prostate cancer until the introduction of prostate-specific antigen (PSA) which improved the detection of early-stage prostate cancer and largely displaced PAP. Recently, however, there is a renewed interest in PAP because of its usefulness in prognosticating intermediate to high-risk prostate cancers and its success in the immunotherapy of prostate cancer. Although PAP is believed to be a key regulator of prostate cell growth, its exact role in normal prostate as well as detailed molecular mechanism of PAP regulation is still unclear. Here, many different aspects of PAP in prostate cancer are revisited and its emerging roles in other environment are discussed. PMID:24009853

Development of a Hybrid Optical Biopsy Probe to Improve Prostate Cancer Diagnosis

DTIC Science & Technology

2011-06-01

integrated needle probe can be developed for guiding needle biopsy for prostate cancer diagnosis. Multi-modal optical measurements to be utilized for... needle probe can be developed for guiding needle biopsy for prostate cancer diagnosis. Multi-modal optical measurements to be utilized for the study...tissue, into a transrectal- ultrasound , needle - biopsy probe. In the development phase, documentation to obtain IRB approval for ex vivo human prostate

Role of the TGF-Beta 1 in the Prevention of Prostate Cancer

DTIC Science & Technology

2001-04-01

the prostate or seminal vesicles delayed tumor development in the TRAMP mice through autocrine and paracrine pathways. 14. SUBJECT TERMS 15. NUMBER OF...it imperative to develop prevention strategies against this disease. Modifications in environmental, dietary, endocrine, or genetic factors may play a...This hypothesis is being tested in TRAMP transgenic mice, which develop spontaneous prostate cancer with features similar to that of human prostate

Glycophenotype of breast and prostate cancer stem cells treated with thieno[2,3-b]pyridine anticancer compound.

PubMed

Mastelić, Angela; Čikeš Čulić, Vedrana; Režić Mužinić, Nikolina; Vuica-Ross, Milena; Barker, David; Leung, Euphemia Y; Reynisson, Jóhannes; Markotić, Anita

2017-01-01

Tumor progression may be driven by a small subpopulation of cancer stem cells (CSCs characterized by CD44 + /CD24 - phenotype). We investigated the influence of a newly developed thienopyridine anticancer compound (3-amino-5-oxo- N -naphthyl-5,6,7, 8-tetrahydrothieno[2,3- b ]quinoline-2-carboxamide, 1 ) on the growth, survival and glycophenotype (CD15s and GM3 containing neuraminic acid substituted with acetyl residue, NeuAc) of breast and prostate cancer stem/progenitor-like cell population. MDA-MB-231 and Du-145 cells were incubated with compound 1 alone or in combination with paclitaxel. The cellular metabolic activity was determined by the 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay. The type of cell death induced by 48-h treatment was assessed using a combination of Annexin-V-FITC and propidium iodide staining. Flow cytometric analysis was performed to detect the percentage of CD44 + /CD24 - cells, and GM3 and CD15s positive CSCs, as well as the expression of GM3 and CD15s per one CSC, in both cell lines. Compound 1 produces a dose- and time-dependent cytotoxicity, mediated mainly by apoptosis in breast cancer cells, and slightly (2.3%) but statistically significant lowering breast CSC subpopulation. GM3 expression per one breast CSC was increased, and the percentage of prostate GM3 + CSC subpopulation was decreased in cells treated with compound 1 compared with non-treated cells. The percentage of CD15s + CSCs was lower in both cell lines after treatment with compound 1 . Considering that triple-negative breast cancers are characterized by an increased percentage of breast CSCs and knowing their association with an increased risk of metastasis and mortality, compound 1 is a potentially effective drug for triple-negative breast cancer treatment.

A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

PubMed

Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

1999-01-01

We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

Overexpression of HepaCAM inhibits cell viability and motility through suppressing nucleus translocation of androgen receptor and ERK signaling in prostate cancer.

PubMed

Song, Xuedong; Wang, Yin; Du, Hongfei; Fan, Yanru; Yang, Xue; Wang, Xiaorong; Wu, Xiaohou; Luo, Chunli

2014-07-01

HepaCAM is suppressed in a variety of human cancers, and involved in cell adhesion, growth, migration, invasion, and survival. However, the expression and function of HepaCAM in prostate cancer are still unknown. HepaCAM expression has been detected by RT-PCR, Western blotting and immunohistochemistry staining in prostate cell lines RWPE-1, LNCap, DU145, PC3, and in 75 human prostate tissue specimens, respectively. Meanwhile, the cell proliferation ability was detected by WST-8 assay. The role of HepaCAM in prostate cancer cell migration and invasion was examined by wound healing and transwell assay. And flow cytometry was used to observe the apoptosis of prostate cancer cells. Then we detected changes of Androgen Receptor translocation and ERK signaling using immunofluorescence staining and western blot after overexpression of HepaCAM. The HepaCAM expression was significantly down-regulated in prostate cancer tissues and undetected in prostate cancer cells. However, the low HepaCAM expression was not statistically associated with clinicopathological characteristics of prostate cancer. Overexpression of HepaCAM in prostate cancer cells decreased the cell proliferation, migration and invasion, and induced the cell apoptosis. Meanwhile, HepaCAM prevented the androgen receptor translocation from the cytoplasm to the nucleus and down-regulated the MAPK/ERK signaling. Our results suggested that HepaCAM acted as a tumor suppressor in prostate cancer. HepaCAM inhibited cell viability and motility which might be through suppressing the nuclear translocation of Androgen Receptor and down-regulating the ERK signaling. Therefore, it was indicated that HepaCAM may be a potential therapeutic target for prostate cancer. © 2014 Wiley Periodicals, Inc.

Virus Delivery of CRISPR Guides to the Murine Prostate for Gene Alteration.

PubMed

Riedel, Maria; Berthelsen, Martin F; Bakiri, Latifa; Wagner, Erwin F; Thomsen, Martin K

2018-04-27

With an increasing incidence of prostate cancer, identification of new tumor drivers or modulators is crucial. Genetically engineered mouse models (GEMM) for prostate cancer are hampered by tumor heterogeneity and its complex microevolution dynamics. Traditional prostate cancer mouse models include, amongst others, germline and conditional knockouts, transgenic expression of oncogenes, and xenograft models. Generation of de novo mutations in these models is complex, time-consuming, and costly. In addition, most of traditional models target the majority of the prostate epithelium, whereas human prostate cancer is well known to evolve as an isolated event in only a small subset of cells. Valuable models need to simulate not only prostate cancer initiation, but also progression to advanced disease. Here we describe a method to target a few cells in the prostate epithelium by transducing cells by viral particles. The delivery of an engineered virus to the murine prostate allows alteration of gene expression in the prostate epithelia. Virus type and quantity will hereby define the number of targeted cells for gene alteration by transducing a few cells for cancer initiation and many cells for gene therapy. Through surgery-based injection in the anterior lobe, distal from the urinary track, the tumor in this model can expand without impairing the urinary function of the animal. Furthermore, by targeting only a subset of prostate epithelial cells the technique enables clonal expansion of the tumor, and therefore mimics human tumor initiation, progression, as well as invasion through the basal membrane. This novel technique provides a powerful prostate cancer model with improved physiological relevance. Animal suffering is limited, and since no additional breeding is required, overall animal count is reduced. At the same time, analysis of new candidate genes and pathways is accelerated, which in turn is more cost efficient.

Prostate Cancer, Nutrition, and Dietary Supplements (PDQ®)—Health Professional Version

Cancer.gov

Nutrition methods and dietary supplements have been studied for prostate cancer prevention or treatment. Read about the history of research, laboratory, and human studies on various prostate supplements, such as calcium, green tea, lycopene, pomegranate, selenium, soy, and vitamin E in this expert-reviewed summary.

Enoxacin penetration into human prostatic tissue.

PubMed Central

Bergeron, M G; Roy, R; Lessard, C; Foucault, P

1988-01-01

Concurrent enoxacin concentrations in serum and prostatic tissue were determined in 14 patients. The mean ratios of enoxacin concentration in tissue over concentration in serum were 1.4 +/- 0.2 (standard error of the mean). The levels in serum and prostatic tissue were above the MICs for most urinary pathogens. PMID:3196004

Inhibitory mechanisms of Agaricus blazei Murill on the growth of prostate cancer in vitro and in vivo.

PubMed

Yu, Ching-Han; Kan, Shu-Fen; Shu, Chin-Hang; Lu, Ting-Jang; Sun-Hwang, Lucy; Wang, Paulus S

2009-10-01

Agaricus blazei Murill (A. blazei) has been conventionally used as a health food for the prevention of cancer. However, little is known about the direct effects and action mechanisms of A. blazei on human prostate cancer. In the present study, the effects of A. blazei on the growth of human prostate cancer were examined in vitro and in vivo. A. blazei, especially the broth fraction, inhibited cell proliferation in both androgen-dependent and androgen-independent prostate cancer cell lines. The broth of A. blazei induced lactate dehydrogenase leakage in three cancer cell lines, whereas the activities of caspase 3 and the DNA fragmentation were enhanced the most in androgen-independent PC3 cells. The protein expressions of apoptosis-related molecules were elevated by the broth of A. blazei in PC3 cells. Oral supplementation with the broth of A. blazei (with the higher ratio of beta-glucan) significantly suppressed tumor growth without inducing adverse effects in severe combined immunodeficient mice with PC3 tumor xenograft. Tumor xenografts from A. blazei-fed mice showed decreased proliferating cell nuclear antigen-positive cells and reduced tumor microvessel density. Based on these results, we found that the broth of A. blazei may directly inhibit the growth of prostate cancer cell via an apoptotic pathway and suppress prostate tumor growth via antiproliferative and antiangiogenic mechanisms. We therefore suggest that A. blazei might have potential therapeutic use in the prevention and treatment of human prostate cancer.

Mitochondrial redox signaling by p66Shc is involved in regulating androgenic growth stimulation of human prostate cancer cells

PubMed Central

Veeramani, S; Yuan, T-C; Lin, F-F; Lin, M-F

2009-01-01

p66Shc is shown to negatively regulate the life span in mice through reactive oxygen species (ROS) production. Recent reports, however, revealed that p66Shc protein level is significantly elevated in several human cancer tissues and growth-stimulated carcinoma cells, suggesting a mitogenic and carcinogenic role for p66Shc. In this communication, we demonstrate for the first time that p66Shc mediates androgenic growth signals in androgen-sensitive human prostate cancer cells through mitochondrial ROS production. Growth stimulation of prostate cancer cells with 5α-dihydrotestosterone (DHT) is accompanied by increased p66Shc level and ROS production, which is abolished by antioxidant treatments. However, antioxidant treatments do not affect the transcriptional activity of androgen receptor (AR) as observed by its inability to block DHT-induced prostate-specific antigen expression, an AR-dependent correlate of prostate cancer progression. Elevated expression of p66Shc by cDNA transfection increases the basal cell proliferation and, thus, reduces additional DHT-induced cell proliferation. Furthermore, DHT increases the translocation of p66Shc into mitochondria and its interaction with cytochrome c. Conversely, both redox-negative p66Shc mutant (W134F), which is deficient in cytochrome c interaction, and p66Shc small interfering RNA decrease DHT-induced cell proliferation. These results collectively reveal a novel role for p66Shc–ROS pathway in androgen-induced prostate cancer cell proliferation and, thus, may play a role in early prostate carcinogenesis. PMID:18504439

The expression of xenobiotic-metabolizing enzymes in human prostate and in prostate epithelial cells (PECs) derived from primary cultures.

PubMed

Al-Buheissi, S Z; Cole, K J; Hewer, A; Kumar, V; Bryan, R L; Hudson, D L; Patel, H R; Nathan, S; Miller, R A; Phillips, D H

2006-06-01

Dietary heterocyclic amines (HCAs) are carcinogenic in rodent prostate requiring activation by enzymes such as cytochrome P450 (CYP) and N-acetyltransferase (NAT). We investigated by Western blotting and immunohistochemistry the expression of CYP1A1, CYP1A2, and NAT1 in human prostate and in prostate epithelial cells (PECs) derived from primary cultures and tested their ability to activate the dietary carcinogen 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) and its N-hydroxy metabolite (N-OH-IQ) to DNA-damaging moieties. Western blotting identified CYP1A1, CYP1A2, and NAT1. Immunohistochemistry localized NAT1 to the cytoplasm of PECs. Inter-individual variation was observed in the expression levels of CYP1A1, 1A2, and NAT1 (11, 75, and 35-fold, respectively). PECs expressed CYP1A1 and NAT1 but not CYP1A2. When incubated with IQ or N-OH-IQ, PECs formed DNA adducts indicating their ability to metabolically activate these compounds. Prostate cells possess the capacity to activate dietary carcinogens. PECs may provide a useful model system to study their role in prostate carcinogenesis.

Resveratrol in prostate diseases – a short review

PubMed Central

Jasińska, Lidia; Ogrodowczyk, Marcin

2013-01-01

Introduction Resveratrol is a plant–derived polyphenol suggested to have many beneficial health effects, including antioxidant, anti–inflammatory, anti–proliferative, proapoptotic, and anti–angiogenic. It is even specu- lated that uptake of resveratrol by red wine consumption could be behind the so–called French paradox the lower incidence of cardiovascular diseases in the French population. These properties, together with good absorption and tolerance, would make it an attractive agent in prostatic diseases, especially in cancer prevention and treatment. Material and methods MEDLINE search (keywords “prostate res- veratrol”) resulted in 39 research papers published since 2007. It has been shown that resveratol down–regulate androgen receptor expression, inhibit proliferation, and promote apop- tosis in prostate cancer cell lines and enhance their sensitivity to ionizing radiation. Several studies on animal prostate cancer development also suggest that resveratrol is able do delay or prevent carcino- genesis in prostate. Despite these promising results, there is no proof of any therapeutic properties of resveratrol in prostate diseases from human clinical trials nor any information about ongoing trials in this field. Conclusions Resveratrol is produced and sold as a nutritional supplement, there is not enough clinical evidence to justify a recommendation for the administration of resveratrol in humans at present. PMID:24579014

Androgen-independent proliferation of LNCaP prostate cancer cells infected by xenotropic murine leukemia virus-related virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakoki, Katsura; Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523; Department of Urology, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523

Highlights: • XMRV infection induces androgen-independent growth in LNCaP cells. • XMRV infection reduces expression of androgen receptor. • XMRV promotes appearance of androgen blocker-resistant prostate cancer cells. - Abstract: Xenotropic murine leukemia virus-related virus (XMRV) is a novel gammaretrovirus that was originally isolated from human prostate cancer. It is now believed that XMRV is not the etiologic agent of prostate cancer. An analysis of murine leukemia virus (MLV) infection in various human cell lines revealed that prostate cancer cell lines are preferentially infected by XMRV, and this suggested that XMRV infection may confer some sort of growth advantage tomore » prostate cancer cell lines. To examine this hypothesis, androgen-dependent LNCaP cells were infected with XMRV and tested for changes in certain cell growth properties. We found that XMRV-infected LNCaP cells can proliferate in the absence of the androgen dihydrotestosterone. Moreover, androgen receptor expression is significantly reduced in XMRV-infected LNCaP cells. Such alterations were not observed in uninfected and amphotropic MLV-infected LNCaP cells. This finding explains why prostate cancer cell lines are preferentially infected with XMRV.« less

Recombination Origin of Retrovirus XMRV | Center for Cancer Research

Cancer.gov

Xenotropic murine leukemia virus–related virus (XMRV) was first reported in samples from a human prostate tumor in 2006, and, at that time, claims were made that XMRV infection rates ranged from 6 to 27 percent of human prostate cancers.  Later research reported XMRV in the blood of 67 percent of people with chronic fatigue syndrome (CFS). When follow-up studies failed to detect XMRV in multiple sets of specimens from people with prostate cancer or CFS and healthy controls, the original reports came under closer scrutiny.

Using Functional Signatures to Identify Repositioned Drugs for Breast, Myelogenous Leukemia and Prostate Cancer

PubMed Central

Shigemizu, Daichi; Hu, Zhenjun; Hung, Jui-Hung; Huang, Chia-Ling; Wang, Yajie; DeLisi, Charles

2012-01-01

The cost and time to develop a drug continues to be a major barrier to widespread distribution of medication. Although the genomic revolution appears to have had little impact on this problem, and might even have exacerbated it because of the flood of additional and usually ineffective leads, the emergence of high throughput resources promises the possibility of rapid, reliable and systematic identification of approved drugs for originally unintended uses. In this paper we develop and apply a method for identifying such repositioned drug candidates against breast cancer, myelogenous leukemia and prostate cancer by looking for inverse correlations between the most perturbed gene expression levels in human cancer tissue and the most perturbed expression levels induced by bioactive compounds. The method uses variable gene signatures to identify bioactive compounds that modulate a given disease. This is in contrast to previous methods that use small and fixed signatures. This strategy is based on the observation that diseases stem from failed/modified cellular functions, irrespective of the particular genes that contribute to the function, i.e., this strategy targets the functional signatures for a given cancer. This function-based strategy broadens the search space for the effective drugs with an impressive hit rate. Among the 79, 94 and 88 candidate drugs for breast cancer, myelogenous leukemia and prostate cancer, 32%, 13% and 17% respectively are either FDA-approved/in-clinical-trial drugs, or drugs with suggestive literature evidences, with an FDR of 0.01. These findings indicate that the method presented here could lead to a substantial increase in efficiency in drug discovery and development, and has potential application for the personalized medicine. PMID:22346740

Chronic prostatic infection and inflammation by Propionibacterium acnes in a rat prostate infection model.

PubMed

Olsson, Jan; Drott, Johanna Bergh; Laurantzon, Lovisa; Laurantzon, Oscar; Bergh, Anders; Elgh, Fredrik

2012-01-01

Chronic inflammation in the prostate, seen as infiltration of inflammatory cells into the prostate gland in histological samples, affects approximately half the male population without indication of prostate disease, and is almost ubiquitous in patients diagnosed with benign prostate hyperplasia and cancer. Several studies have demonstrated the gram-positive bacterium Propionibacterium acnes to be frequently present in prostate tissue from men suffering from prostate disease. P. acnes has been shown to be associated with histological inflammation in human prostatectomy specimens, and also to induce strong inflammatory response in prostate-derived tissue culture models. The present paper describes a rat model for assessment of the pathogenic potential of P. acnes in prostate. Prostate glands of Sprague Dawley rats (n = 98) were exposed via an abdominal incision and live P. acnes or, in control rats, saline were injected into the ventral and dorso-lateral lobes. Rats were sacrificed 5 days, 3 weeks, 3 months and 6 months post infection, and prostate tissue was analyzed for bacterial content and histological inflammation. Rat sera were assessed for levels of CRP and anti-P. acnes IgG. Live P. acnes could be recovered from the dorso-lateral lobes up to 3 months post infection, while the ventral lobes were cleared from bacteria at that time. In samples up to 3 months post infection, the dorso-lateral lobes exhibited intense focal inflammation. CRP and IgG levels were elevated throughout the span of the experiment, and reached maximum levels 3 weeks and 3 months post infection, respectively. We show that P. acnes have the potential to cause chronic infection in previously healthy prostate, and that the infection has potential to cause chronic histological inflammation in the infected tissue. The high prevalence of P. acnes in human prostate tissue calls for resolution of pathogenic details. The present rat model suggests that complications such as chronic inflammation may be induced by P. acnes infection.

Chronic Prostatic Infection and Inflammation by Propionibacterium acnes in a Rat Prostate Infection Model

PubMed Central

Olsson, Jan; Drott, Johanna Bergh; Laurantzon, Lovisa; Laurantzon, Oscar; Bergh, Anders; Elgh, Fredrik

2012-01-01

Chronic inflammation in the prostate, seen as infiltration of inflammatory cells into the prostate gland in histological samples, affects approximately half the male population without indication of prostate disease, and is almost ubiquitous in patients diagnosed with benign prostate hyperplasia and cancer. Several studies have demonstrated the Gram-positive bacterium Propionibacterium acnes to be frequently present in prostate tissue from men suffering from prostate disease. P. acnes has been shown to be associated with histological inflammation in human prostatectomy specimens, and also to induce strong inflammatory response in prostate-derived tissue culture models. The present paper describes a rat model for assessment of the pathogenic potential of P. acnes in prostate. Prostate glands of Sprague Dawley rats (n = 98) were exposed via an abdominal incision and live P. acnes or, in control rats, saline were injected into the ventral and dorso-lateral lobes. Rats were sacrificed 5 days, 3 weeks, 3 months and 6 months post infection, and prostate tissue was analyzed for bacterial content and histological inflammation. Rat sera were assessed for levels of CRP and anti-P. acnes IgG. Live P. acnes could be recovered from the dorso-lateral lobes up to 3 months post infection, while the ventral lobes were cleared from bacteria at that time. In samples up to 3 months post infection, the dorso-lateral lobes exhibited intense focal inflammation. CRP and IgG levels were elevated throughout the span of the experiment, and reached maximum levels 3 weeks and 3 months post infection, respectively. We show that P. acnes have the potential to cause chronic infection in previously healthy prostate, and that the infection has potential to cause chronic histological inflammation in the infected tissue. The high prevalence of P. acnes in human prostate tissue calls for resolution of pathogenic details. The present rat model suggests that complications such as chronic inflammation may be induced by P. acnes infection. PMID:23240022

Activation of β-catenin signaling in androgen receptor-negative prostate cancer cells.

PubMed

Wan, Xinhai; Liu, Jie; Lu, Jing-Fang; Tzelepi, Vassiliki; Yang, Jun; Starbuck, Michael W; Diao, Lixia; Wang, Jing; Efstathiou, Eleni; Vazquez, Elba S; Troncoso, Patricia; Maity, Sankar N; Navone, Nora M

2012-02-01

To study Wnt/β-catenin in castrate-resistant prostate cancer (CRPC) and understand its function independently of the β-catenin-androgen receptor (AR) interaction. We carried out β-catenin immunocytochemical analysis, evaluated TOP-flash reporter activity (a reporter of β-catenin-mediated transcription), and sequenced the β-catenin gene in MDA prostate cancer 118a, MDA prostate cancer 118b, MDA prostate cancer 2b, and PC-3 prostate cancer cells. We knocked down β-catenin in AR-negative MDA prostate cancer 118b cells and carried out comparative gene-array analysis. We also immunohistochemically analyzed β-catenin and AR in 27 bone metastases of human CRPCs. β-Catenin nuclear accumulation and TOP-flash reporter activity were high in MDA prostate cancer 118b but not in MDA prostate cancer 2b or PC-3 cells. MDA prostate cancer 118a and MDA prostate cancer 118b cells carry a mutated β-catenin at codon 32 (D32G). Ten genes were expressed differently (false discovery rate, 0.05) in MDA prostate cancer 118b cells with downregulated β-catenin. One such gene, hyaluronan synthase 2 (HAS2), synthesizes hyaluronan, a core component of the extracellular matrix. We confirmed HAS2 upregulation in PC-3 cells transfected with D32G-mutant β-catenin. Finally, we found nuclear localization of β-catenin in 10 of 27 human tissue specimens; this localization was inversely associated with AR expression (P = 0.056, Fisher's exact test), suggesting that reduced AR expression enables Wnt/β-catenin signaling. We identified a previously unknown downstream target of β-catenin, HAS2, in prostate cancer, and found that high β-catenin nuclear localization and low or no AR expression may define a subpopulation of men with bone metastatic prostate cancer. These findings may guide physicians in managing these patients.

No Evidence for Infection of UK Prostate Cancer Patients with XMRV, BK Virus, Trichomonas vaginalis or Human Papilloma Viruses

PubMed Central

Groom, Harriet C. T.; Warren, Anne Y.; Neal, David E.; Bishop, Kate N.

2012-01-01

The prevalence of specific infections in UK prostate cancer patients was investigated. Serum from 84 patients and 62 controls was tested for neutralisation of xenotropic murine leukaemia virus-related virus (XMRV) Envelope. No reactivity was found in the patient samples. In addition, a further 100 prostate DNA samples were tested for XMRV, BK virus, Trichomonas vaginalis and human papilloma viruses by nucleic acid detection techniques. Despite demonstrating DNA integrity and assay sensitivity, we failed to detect the presence of any of these agents in DNA samples, bar one sample that was weakly positive for HPV16. Therefore we conclude that these infections are absent in this typical cohort of men with prostate cancer. PMID:22470540

No evidence for infection of UK prostate cancer patients with XMRV, BK virus, Trichomonas vaginalis or human papilloma viruses.

PubMed

Groom, Harriet C T; Warren, Anne Y; Neal, David E; Bishop, Kate N

2012-01-01

The prevalence of specific infections in UK prostate cancer patients was investigated. Serum from 84 patients and 62 controls was tested for neutralisation of xenotropic murine leukaemia virus-related virus (XMRV) Envelope. No reactivity was found in the patient samples. In addition, a further 100 prostate DNA samples were tested for XMRV, BK virus, Trichomonas vaginalis and human papilloma viruses by nucleic acid detection techniques. Despite demonstrating DNA integrity and assay sensitivity, we failed to detect the presence of any of these agents in DNA samples, bar one sample that was weakly positive for HPV16. Therefore we conclude that these infections are absent in this typical cohort of men with prostate cancer.

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells.

PubMed

Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E

2014-05-01

Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1)  mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50  = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly, the findings demonstrate that the potential of the inhibitors for use in diagnosis and therapy can be evaluated in an immunocompetent animal model that naturally develops prostate cancer before use in humans. © 2014 Wiley Periodicals, Inc.

Prostate-Specific G-Protein Coupled Receptor, an Emerging Biomarker Regulating Inflammation and Prostate Cancer Invasion.

PubMed

Rodriguez, M; Siwko, S; Liu, M

2016-01-01

Prostate cancer is highly prevalent among men in developed countries, but a significant proportion of detected cancers remain indolent, never progressing into aggressive carcinomas. This highlights the need to develop refined biomarkers that can distinguish between indolent and potentially dangerous cases. The prostate-specific G-protein coupled receptor (PSGR, or OR51E2) is an olfactory receptor family member with highly specific expression in human prostate epithelium that is highly overexpressed in PIN and prostate cancer. PSGR has been functionally implicated in prostate cancer cell invasiveness, suggesting a potential role in the transition to metastatic PCa. Recently, transgenic mice overexpressing PSGR in the prostate were reported to develop an acute inflammatory response followed by emergence of low grade PIN, whereas mice with compound PSGR overexpression and loss of PTEN exhibited accelerated formation of invasive prostate adenocarcinoma. This article will review recent PSGR findings with a focus on its role as a potential prostate cancer biomarker and regulator of prostate cancer invasion and inflammation.

Effect of obese and lean Zucker rat sera on human and rat prostate cancer cells: implications in obesity-related prostate tumor biology.

PubMed

Lamarre, Neil S; Ruggieri, Michael R; Braverman, Alan S; Gerstein, Matthew I; Mydlo, Jack H

2007-01-01

Several reports have demonstrated the effects of obesity on prostate cancer. Also several reports have linked expression of vascular endothelial cell growth factor (VEGF) and basic fibroblast growth factor (FGF-2) to prostate cancer aggressiveness. The objective of this study was to determine whether a difference exists between lean and obese Zucker rat sera on proliferation prostate cancer cell lines, as well as to examine the differences in FGF-2 and VEGF concentrations. Ten-week-old female obese and lean Zucker rat sera were subjected to charcoal stripping and tested for the proliferation of human LNCaP and rat AT3B-1 prostate cancer cells. An acetonitrile extract of the charcoal used to strip the sera was also tested for mitogenicity. VEGF and FGF-2 concentrations were determined by enzyme-linked immunosorbent assay. Both unstripped and charcoal-stripped obese rat sera had a greater mitogenic effect than did the lean sera on the LNCaP cell line. Charcoal stripping of both obese and lean sera reduced the mitogenic effect on the AT3B-1 cell line. The acetonitrile extract of the charcoal used to strip the sera was unable to recover this proliferative effect. The concentration of VEGF was greater in the obese serum than in the lean serum, and charcoal stripping reduced the concentrations of both FGF-2 and VEGF. The finding of greater VEGF in obese rat sera, as well as greater mitogenic responses on human prostate cancer cells in vitro, suggests this as one of the many possible mechanisms involved in obesity-related prostate cancer biology.

Development of a Novel, Non-Invasive Diagnostic Test for Prostate Cancer

DTIC Science & Technology

2006-01-01

Chang JJ, Bhargava V , Shinohara K. The optimal systematic prostate biopsy scheme should include 8 rather than 6 biopsies: results of a prospective...sextant and laterally directed biopsies for the detection of prostate cancer. J Urol, 2001, 165:1554-9. 19. Djavan B, Ravery V , Zlotta A, Dobronski P...Smith-Jones PM, Navarro V , Goldsmith SJ, Bander NH. Radioimmunotherapy of prostate cancer in human xenografts using monoclonal antibodies specific to

Comprehensive Molecular Profiling of African-American Prostate Cancer to Inform on Prognosis and Disease Biology

DTIC Science & Technology

2017-10-01

development and patterning, and to become more knowledgeable in molecular genetics and the pathology of human prostatic diseases. Specific Aims: 1...AWARD NUMBER: W81XWH-15-1-0661 TITLE: Comprehensive Molecular Profiling of African-American Prostate Cancer to Inform on Prognosis and...COVERED 30 Sept 2016 – 29 Sept 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Comprehensive Molecular Profiling of African-American Prostate Cancer to

Soy Consumption of Prostate Cancer Risk in Men: A Meta-Analysis

USDA-ARS?s Scientific Manuscript database

Soy is a major plant source of dietary protein to humans. Epidemiologic studies show that consumption of soy foods may be related to a reduction in cancer risk in humans. The purpose of the present study was to conduct a meta-analysis on the association between soy consumption and prostate cancer r...

Inverse association between gluthathione peroxidase activity and both selenium-binding protein 1 levels and gleason score in human prostate tissue

USDA-ARS?s Scientific Manuscript database

BACKGROUND. Data from human epidemiological studies, cultured mammalian cells, and animal models have supported a potentially beneficial role of selenium (Se) in prostate cancer prevention. In addition, Se-containing proteins including members of the gutathione peroxidase (GPx) family and Selenium-B...

3 CFR - Guidelines for Human Stem Cell Research

Code of Federal Regulations, 2010 CFR

2010-01-01

... 3 The President 1 2010-01-01 2010-01-01 false Guidelines for Human Stem Cell Research Presidential Documents Other Presidential Documents Memorandum of July 30, 2009 Guidelines for Human Stem Cell Research..., scientifically worthy human stem cell research, including human embryonic stem cell research, to the extent...

Forced LIGHT expression in prostate tumors overcomes Treg mediated immunosuppression and synergizes with a prostate tumor therapeutic vaccine by recruiting effector T lymphocytes

PubMed Central

Yan, Lisa; Da Silva, Diane M.; Verma, Bhavna; Gray, Andrew; Brand, Heike E.; Skeate, Joseph G.; Porras, Tania B.; Kanodia, Shreya; Kast, W. Martin

2014-01-01

Background LIGHT, a ligand for lymphotoxin-β receptor (LTβR) and herpes virus entry mediator, is predominantly expressed on activated immune cells and LTβR signaling leads to the recruitment of lymphocytes. The interaction between LIGHT and LTβR has been previously shown in a virus induced tumor model to activate immune cells and result in tumor regression, but the role of LIGHT in tumor immunosuppression or in a prostate cancer setting, where self antigens exist, has not been explored. We hypothesized that forced expression of LIGHT in prostate tumors would shift the pattern of immune cell infiltration, would inhibit T regulatory cells (Tregs) and would induce prostate cancer tumor associated antigen (TAA) specific T cells that would eradicate tumors. Methods Real Time PCR was used to evaluate expression of forced LIGHT and various other genes in prostate tumors samples. Adenovirus encoding murine LIGHT was injected intratumorally into TRAMP C2 prostate cancer cell tumor bearing mice for in vivo studies. Chemokine and cytokine concentrations were determined by multiplex ELISA. Flow cytometry was used to phenotype tumor infiltrating lymphocytes and expression of LIGHT on the tumor cell surface. Tumor specific lymphocytes were quantified via an ELISpot assay. Treg induction and Treg suppression assays determined Treg functionality after LIGHT treatment. Results LIGHT expression peaked within 48 hours of infection, recruited effector T cells into the tumor microenvironment that recognized mouse prostate stem cell antigen (PSCA) and inhibited the infiltration of Tregs. Tregs isolated from tumor draining lymph nodes had impaired suppressive capability after LIGHT treatment. LIGHT in combination with a therapeutic vaccine, PSCA TriVax, reduced tumor burden. Conclusion Forced LIGHT treatment combined with PSCA TriVax therapeutic vaccination delays prostate cancer progression in mice by recruiting effector T lymphocytes to the tumor and inhibiting Treg mediated immunosuppression. PMID:25399517

Withanolides from Aeroponically Grown Physalis peruviana and Their Selective Cytotoxicity to Prostate Cancer and Renal Carcinoma Cells.

PubMed

Xu, Ya-Ming; Wijeratne, E M Kithsiri; Babyak, Ashley L; Marks, Hanna R; Brooks, Alan D; Tewary, Poonam; Xuan, Li-Jiang; Wang, Wen-Qiong; Sayers, Thomas J; Gunatilaka, A A Leslie

2017-07-28

Investigation of aeroponically grown Physalis peruviana resulted in the isolation of 11 new withanolides, including perulactones I-L (1-4), 17-deoxy-23β-hydroxywithanolide E (5), 23β-hydroxywithanolide E (6), 4-deoxyphyperunolide A (7), 7β-hydroxywithanolide F (8), 7β-hydroxy-17-epi-withanolide K (9), 24,25-dihydro-23β,28-dihydroxywithanolide G (10), and 24,25-dihydrowithanolide E (11), together with 14 known withanolides (12-25). The structures of 1-11 were elucidated by the analysis of their spectroscopic data, and 12-25 were identified by comparison of their spectroscopic data with those reported. All withanolides were evaluated for their cytotoxic activity against a panel of tumor cell lines including LNCaP (androgen-sensitive human prostate adenocarcinoma), 22Rv1 (androgen-resistant human prostate adenocarcinoma), ACHN (human renal adenocarcinoma), M14 (human melanoma), SK-MEL-28 (human melanoma), and normal human foreskin fibroblast cells. Of these, the 17β-hydroxywithanolides (17-BHWs) 6, 8, 9, 11-13, 15, and 19-22 showed selective cytotoxic activity against the two prostate cancer cell lines LNCaP and 22Rv1, whereas 13 and 20 exhibited selective toxicity for the ACHN renal carcinoma cell line. These cytotoxicity data provide additional structure-activity relationship information for the 17-BHWs.

The Role of the Capase-8 Inhibitor FLIP in Androgen-Withdrawal Induced Death of Prostate Epithelium

DTIC Science & Technology

2006-01-01

DL, Norris JS. Resistance of prostate cancer cells to soluble TNF- related apoptosis- inducing ligand (TRAIL/Apo2L) can be overcome by doxorubicin or...Bueso-Ramos C, Chatterjee D, Pantazis P, Aggarwal BB. Curcumin downregulates cell survival mechanisms in human prostate cancer cell lines. Oncogene

The Role of the Caspase-8 Inhibitor FLIP in Androgen-Withdrawal Induced Death of Prostate Epithelium

DTIC Science & Technology

2006-01-01

DL, Norris JS. Resistance of prostate cancer cells to soluble TNF- related apoptosis- inducing ligand (TRAIL/Apo2L) can be overcome by doxorubicin or...Bueso-Ramos C, Chatterjee D, Pantazis P, Aggarwal BB. Curcumin downregulates cell survival mechanisms in human prostate cancer cell lines. Oncogene

Norfloxacin penetration into human renal and prostatic tissues.

PubMed Central

Bergeron, M G; Thabet, M; Roy, R; Lessard, C; Foucault, P

1985-01-01

Concurrent norfloxacin concentrations in serum, kidney, and prostatic tissue were determined in 14 patients. Mean ratios of norfloxacin concentration in tissue over concentration in serum were 6.6 +/- 2.8 for the kidney and 1.7 +/- 0.2 for the prostate samples. The levels were above the MICs of most urinary pathogens. PMID:3834837

Dietary phenethyl isothiocyanate inhibition of androgen-responsive LNCaP prostate cancer cell tumor growth correlates with decreased angiogenesis

USDA-ARS?s Scientific Manuscript database

Phenethyl isothiocyanate (PEITC), found in certain cruciferous vegetables, has antitumor activity in several cancer models, including prostate cancer. In our xenograft model, dietary administration of PEITC (100-150 mg/kg/d) inhibited androgen-responsive LNCaP human prostate cancer cell tumor growth...

Development of an orally-administrative MELK-targeting inhibitor that suppresses the growth of various types of human cancer.

PubMed

Chung, Suyoun; Suzuki, Hanae; Miyamoto, Takashi; Takamatsu, Naofumi; Tatsuguchi, Ayako; Ueda, Koji; Kijima, Kyoko; Nakamura, Yusuke; Matsuo, Yo

2012-12-01

We previously reported MELK (maternal embryonic leucine zipper kinase) as a novel therapeutic target for breast cancer. MELK was also reported to be highly upregulated in multiple types of human cancer. It was implied to play indispensable roles in cancer cell survival and indicated its involvement in the maintenance of tumor-initiating cells. We conducted a high-throughput screening of a compound library followed by structure-activity relationship studies, and successfully obtained a highly potent MELK inhibitor OTSSP167 with IC₅₀ of 0.41 nM. OTSSP167 inhibited the phosphorylation of PSMA1 (proteasome subunit alpha type 1) and DBNL (drebrin-like), which we identified as novel MELK substrates and are important for stem-cell characteristics and invasiveness. The compound suppressed mammosphere formation of breast cancer cells and exhibited significant tumor growth suppression in xenograft studies using breast, lung, prostate, and pancreas cancer cell lines in mice by both intravenous and oral administration. This MELK inhibitor should be a promising compound possibly to suppress the growth of tumor-initiating cells and be applied for treatment of a wide range of human cancer.

Mangiferin inhibition of proliferation and induction of apoptosis in human prostate cancer cells is correlated with downregulation of B-cell lymphoma-2 and upregulation of microRNA-182.

PubMed

Li, Minglin; Ma, Huili; Yang, Lixin; Li, Peng

2016-01-01

Mangiferin, a flavonoid extracted from the mango tree, possesses anti-inflammatory, antibacterial, anti-herpes simplex and antitumor activity, and is able to affect immune function. The present study investigated the anticancer effects of mangiferin treatment on PC3 human prostate cancer cells, and the potential underlying mechanisms. In the present study, an MTT assay was used to analyze the proliferation of PC3 cells. Subsequently, flow cytometry and colorimetric assay kits were utilized to measure the PC3 cell apoptotic rate. The expression levels of B-cell lymphoma-2 (Bcl-2) and microRNA-182 (miR-182) were detected using western blot analysis and quantitative reverse transcription-polymerase chain reaction, respectively. Finally, miR-182 and anti-miR-182 were transfected into PC3 cells, which were used to investigate the effects of mangiferin. Mangiferin treatment reduced the proliferation of PC3 human prostate cancer cells in a concentration- and time-dependent manner. In addition, mangiferin was able to promote apoptosis and induce the caspase-3 activity of PC3 human prostate cancer cells. Mangiferin treatment was also able to significantly reduce Bcl-2 expression levels and enhance miR-182 expression in PC3 cells. Finally, it was observed that mangiferin inhibited proliferation and induced apoptosis in PC3 human prostate cancer cells, and this effect was correlated with downregulation of Bcl-2 and upregulation of miR-182.

Relaxin receptor antagonist AT-001 synergizes with docetaxel in androgen-independent prostate xenografts.

PubMed

Neschadim, Anton; Pritzker, Laura B; Pritzker, Kenneth P H; Branch, Donald R; Summerlee, Alastair J S; Trachtenberg, John; Silvertown, Joshua D

2014-06-01

Androgen hormones and the androgen receptor (AR) pathway are the main targets of anti-hormonal therapies for prostate cancer. However, resistance inevitably develops to treatments aimed at the AR pathway resulting in androgen-independent or hormone-refractory prostate cancer (HRPC). Therefore, there is a significant unmet need for new, non-androgen anti-hormonal strategies for the management of prostate cancer. We demonstrate that a relaxin hormone receptor antagonist, AT-001, an analog of human H2 relaxin, represents a first-in-class anti-hormonal candidate treatment designed to significantly curtail the growth of androgen-independent human prostate tumor xenografts. Chemically synthesized AT-001, administered subcutaneously, suppressed PC3 xenograft growth by up to 60%. AT-001 also synergized with docetaxel, standard first-line chemotherapy for HRPC, to suppress tumor growth by more than 98% in PC3 xenografts via a mechanism involving the downregulation of hypoxia-inducible factor 1 alpha and the hypoxia-induced response. Our data support developing AT-001 for clinical use as an anti-relaxin hormonal therapy for advanced prostate cancer.

Cytokeratin characterization of human prostatic carcinoma and its derived cell lines.

PubMed

Nagle, R B; Ahmann, F R; McDaniel, K M; Paquin, M L; Clark, V A; Celniker, A

1987-01-01

Two murine monoclonal anti-cytokeratin antibodies with defined specificity were shown to distinguish between basal cells and luminal cells in human prostate tissue. Forty-one biopsies or transurethral resection specimens were characterized using these two antibodies. In cases of benign prostatic hyperplasia, focal loss of the basal cell layer was noted in areas of glandular proliferation. Ten cases of adenocarcinoma of the prostate, varying in Gleason's histological grade from 2 to 4, were also studied. In each case the carcinoma was shown to represent the luminal cell phenotype with no evidence of involvement of the basal cell phenotype. An analysis of three established metastatic prostatic carcinoma cell lines (DU-145, PC-3, and LNCaP) using two-dimensional electrophoresis showed that the cytokeratin complement of each cell line was slightly different but retained the phenotype of the luminal cell. It was concluded that during both hyperplasia and neoplastic transformation of the prostate, the luminal cell phenotype is primarily involved and that the basal cell phenotype does not appear to contribute to either intraluminal proliferation or invasive cell populations.

BMP7 Induces Dormancy of Prostatic Tumor Stem Cell in Bone

DTIC Science & Technology

2013-07-01

Watabe, Shigeru Hirota, Sudha K. Pai, Wen Liu, Koji Fukuda, Christopher Chambers, Andrew Wilber and Kounosuke Watabe “Bone Figure 7. Expression of BMP7...Hiroshi Okuda,1 Fei Xing,1 Puspa R. Pandey,1 Misako Watabe,1 Shigeru Hirota,2 Sudha K. Pai,1 Wen Liu,1 Koji Fukuda,1 Christopher Chambers,1 Andrew

Gastrin-releasing peptide receptor (GRPr) promotes EMT, growth, and invasion in canine prostate cancer.

PubMed

Elshafae, Said M; Hassan, Bardes B; Supsavhad, Wachiraphan; Dirksen, Wessel P; Camiener, Rachael Y; Ding, Haiming; Tweedle, Michael F; Rosol, Thomas J

2016-06-01

The gastrin-releasing peptide receptor (GRPr) is upregulated in early and late-stage human prostate cancer (PCa) and other solid tumors of the mammary gland, lung, head and neck, colon, uterus, ovary, and kidney. However, little is known about its role in prostate cancer. This study examined the effects of a heterologous GRPr agonist, bombesin (BBN), on growth, motility, morphology, gene expression, and tumor phenotype of an osteoblastic canine prostate cancer cell line (Ace-1) in vitro and in vivo. The Ace-1 cells were stably transfected with the human GRPr and tumor cells were grown in vitro and as subcutaneous and intratibial tumors in nude mice. The effect of BBN was measured on cell proliferation, cell migration, tumor growth (using bioluminescence), tumor cell morphology, bone tumor phenotype, and epithelial-mesenchymal transition (EMT) and metastasis gene expression (quantitative RT-PCR). GRPr mRNA expression was measured in primary canine prostate cancers and normal prostate glands. Bombesin (BBN) increased tumor cell proliferation and migration in vitro and tumor growth and invasion in vivo. BBN upregulated epithelial-to-mesenchymal transition (EMT) markers (TWIST, SNAIL, and SLUG mRNA) and downregulated epithelial markers (E-cadherin and β-catenin mRNA), and modified tumor cell morphology to a spindle cell phenotype. Blockade of GRPr upregulated E-cadherin and downregulated VIMENTIN and SNAIL mRNA. BBN altered the in vivo tumor phenotype in bone from an osteoblastic to osteolytic phenotype. Primary canine prostate cancers had increased GRPr mRNA expression compared to normal prostates. These data demonstrated that the GRPr is important in prostate cancer growth and progression and targeting GRPr may be a promising strategy for treatment of prostate cancer. Prostate 76:796-809, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Inhibition of prostate smooth muscle contraction and prostate stromal cell growth by the inhibitors of Rac, NSC23766 and EHT1864.

PubMed

Wang, Y; Kunit, T; Ciotkowska, A; Rutz, B; Schreiber, A; Strittmatter, F; Waidelich, R; Liu, C; Stief, C G; Gratzke, C; Hennenberg, M

2015-06-01

Medical therapy of lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH) targets smooth muscle contraction in the prostate, or prostate growth. However, current therapeutic options are insufficient. Here, we investigated the role of Rac in the control of smooth muscle tone in human prostates and growth of prostate stromal cells. Experiments were performed using human prostate tissues from radical prostatectomy and cultured stromal cells (WPMY-1). Expression of Rac was examined by Western blot and fluorescence staining. Effects of Rac inhibitors (NSC23766 and EHT1864) on contractility were assessed in the organ bath. The effects of Rac inhibitors were assessed by pull-down, cytotoxicity using a cell counting kit, cytoskeletal organization by phalloidin staining and cell growth using an 5-ethynyl-2'-deoxyuridine assay. Expression of Rac1-3 was observed in prostate samples from each patient. Immunoreactivity for Rac1-3 was observed in the stroma, where it colocalized with the smooth muscle marker, calponin. NSC23766 and EHT1864 significantly reduced contractions of prostate strips induced by noradrenaline, phenylephrine or electrical field stimulation. NSC23766 and EHT1864 inhibited Rac activity in WPMY-1 cells. Survival of WPMY-1 cells ranged between 64 and 81% after incubation with NSC23766 (50 or 100 μM) or EHT1864 (25 μM) for 24 h. NSC23766 and EHT1864 induced cytoskeletal disorganization in WPMY-1 cells. Both inhibitors impaired the growth of WPMY-1 cells. Rac may be a link connecting the control of prostate smooth muscle tone with proliferation of smooth muscle cells. Improvements in LUTS suggestive of BPH by Rac inhibitors appears possible. © 2015 The British Pharmacological Society.

Effect of Pulsed Electromagnetic Field Therapy on Prostate Volume and Vascularity in the Treatment of Benign Prostatic Hyperplasia: A Pilot Study in a Canine Model

PubMed Central

Leoci, Raffaella; Aiudi, Giulio; Silvestre, Fabio; Lissner, Elaine; Lacalandra, Giovanni Michele

2014-01-01

BACKGROUND Benign prostatic hyperplasia (BPH) is a result of urogenital aging. Recent studies suggest that an age-related impairment of the blood supply to the lower urinary tract plays a role in the development of BPH and thus may be a contributing factor in the pathogenesis of BPH. The canine prostate is a model for understanding abnormal growth of the human prostate gland. We studied the efficacy of pulsed electromagnetic field therapy (PEMF) in dogs to modify prostate blood flow and evaluated its effect on BPH. METHODS PEMF (5 min, twice a day for 3 weeks) was performed on 20 dogs affected by BPH. Prostatic volume, Doppler assessment by ultrasonography, libido, semen quality, testosterone levels, and seminal plasma volume, composition and pH were evaluated before and after treatment. RESULTS The 3 weeks of PEMF produced a significant reduction in prostatic volume (average 57%) without any interference with semen quality, testosterone levels or libido. Doppler parameters showed a reduction of peripheral resistances and a progressive reduction throughout the trial of the systolic peak velocity, end-diastolic velocity, mean velocity, mean, and peak gradient of the blood flow in the dorsal branch of the prostatic artery. The pulsatility index and the resistance index did not vary significantly over time. CONCLUSIONS The efficacy of PEMF on BPH in dogs, with no side effects, suggests the suitability of this treatment in humans and supports the hypothesis that impairment of blood supply to the lower urinary tract may be a causative factor in the development of BPH. Prostate 74:1132–1141, 2014. © 2014 The Authors. The Prostate published by Wiley Periodicals, Inc. PMID:24913937

Conditional Expression of the Androgen Receptor Induces Oncogenic Transformation of the Mouse Prostate*

PubMed Central

Zhu, Chunfang; Luong, Richard; Zhuo, Ming; Johnson, Daniel T.; McKenney, Jesse K.; Cunha, Gerald R.; Sun, Zijie

2011-01-01

The androgen signaling pathway, mediated through the androgen receptor (AR), is critical in prostate tumorigenesis. However, the precise role of AR in prostate cancer development and progression still remains largely unknown. Specifically, it is unclear whether overexpression of AR is sufficient to induce prostate tumor formation in vivo. Here, we inserted the human AR transgene with a LoxP-stop-loxP (LSL) cassette into the mouse ROSA26 locus, permitting “conditionally” activated AR transgene expression through Cre recombinase-mediated removal of the LSL cassette. By crossing this AR floxed strain with Osr1-Cre (odd skipped related) mice, in which the Osr1 promoter activates at embryonic day 11.5 in urogenital sinus epithelium, we generated a conditional transgenic line, R26hARloxP:Osr1-Cre+. Expression of transgenic AR was detected in both prostatic luminal and basal epithelial cells and is resistant to castration. Approximately one-half of the transgenic mice displayed mouse prostatic intraepithelial neoplasia (mPIN) lesions. Intriguingly, four mice (10%) developed prostatic adenocarcinomas, with two demonstrating invasive diseases. Positive immunostaining of transgenic AR protein was observed in the majority of atypical and tumor cells in the mPIN and prostatic adenocarcinomas, providing a link between transgenic AR expression and oncogenic transformation. An increase in Ki67-positive cells appeared in all mPIN and prostatic adenocarcinoma lesions of the mice. Thus, we demonstrated for the first time that conditional activation of transgenic AR expression by Osr1 promoter induces prostate tumor formation in mice. This new AR transgenic mouse line mimics the human disease and can be used for study of prostate tumorigenesis and drug development. PMID:21795710

Cancer stem cell-related gene expression as a potential biomarker of response for first-in-class imipridone ONC201 in solid tumors.

PubMed

Prabhu, Varun V; Lulla, Amriti R; Madhukar, Neel S; Ralff, Marie D; Zhao, Dan; Kline, Christina Leah B; Van den Heuvel, A Pieter J; Lev, Avital; Garnett, Mathew J; McDermott, Ultan; Benes, Cyril H; Batchelor, Tracy T; Chi, Andrew S; Elemento, Olivier; Allen, Joshua E; El-Deiry, Wafik S

2017-01-01

Cancer stem cells (CSCs) correlate with recurrence, metastasis and poor survival in clinical studies. Encouraging results from clinical trials of CSC inhibitors have further validated CSCs as therapeutic targets. ONC201 is a first-in-class small molecule imipridone in Phase I/II clinical trials for advanced cancer. We have previously shown that ONC201 targets self-renewing, chemotherapy-resistant colorectal CSCs via Akt/ERK inhibition and DR5/TRAIL induction. In this study, we demonstrate that the anti-CSC effects of ONC201 involve early changes in stem cell-related gene expression prior to tumor cell death induction. A targeted network analysis of gene expression profiles in colorectal cancer cells revealed that ONC201 downregulates stem cell pathways such as Wnt signaling and modulates genes (ID1, ID2, ID3 and ALDH7A1) known to regulate self-renewal in colorectal, prostate cancer and glioblastoma. ONC201-mediated changes in CSC-related gene expression were validated at the RNA and protein level for each tumor type. Accordingly, we observed inhibition of self-renewal and CSC markers in prostate cancer cell lines and patient-derived glioblastoma cells upon ONC201 treatment. Interestingly, ONC201-mediated CSC depletion does not occur in colorectal cancer cells with acquired resistance to ONC201. Finally, we observed that basal expression of CSC-related genes (ID1, CD44, HES7 and TCF3) significantly correlate with ONC201 efficacy in >1000 cancer cell lines and combining the expression of multiple genes leads to a stronger overall prediction. These proof-of-concept studies provide a rationale for testing CSC expression at the RNA and protein level as a predictive and pharmacodynamic biomarker of ONC201 response in ongoing clinical studies.

Cancer stem cell-related gene expression as a potential biomarker of response for first-in-class imipridone ONC201 in solid tumors

PubMed Central

Zhao, Dan; Kline, Christina Leah B.; Van den Heuvel, A. Pieter J.; Lev, Avital; Garnett, Mathew J.; McDermott, Ultan; Benes, Cyril H.; Batchelor, Tracy T.; Chi, Andrew S.; Elemento, Olivier; Allen, Joshua E.

2017-01-01

Cancer stem cells (CSCs) correlate with recurrence, metastasis and poor survival in clinical studies. Encouraging results from clinical trials of CSC inhibitors have further validated CSCs as therapeutic targets. ONC201 is a first-in-class small molecule imipridone in Phase I/II clinical trials for advanced cancer. We have previously shown that ONC201 targets self-renewing, chemotherapy-resistant colorectal CSCs via Akt/ERK inhibition and DR5/TRAIL induction. In this study, we demonstrate that the anti-CSC effects of ONC201 involve early changes in stem cell-related gene expression prior to tumor cell death induction. A targeted network analysis of gene expression profiles in colorectal cancer cells revealed that ONC201 downregulates stem cell pathways such as Wnt signaling and modulates genes (ID1, ID2, ID3 and ALDH7A1) known to regulate self-renewal in colorectal, prostate cancer and glioblastoma. ONC201-mediated changes in CSC-related gene expression were validated at the RNA and protein level for each tumor type. Accordingly, we observed inhibition of self-renewal and CSC markers in prostate cancer cell lines and patient-derived glioblastoma cells upon ONC201 treatment. Interestingly, ONC201-mediated CSC depletion does not occur in colorectal cancer cells with acquired resistance to ONC201. Finally, we observed that basal expression of CSC-related genes (ID1, CD44, HES7 and TCF3) significantly correlate with ONC201 efficacy in >1000 cancer cell lines and combining the expression of multiple genes leads to a stronger overall prediction. These proof-of-concept studies provide a rationale for testing CSC expression at the RNA and protein level as a predictive and pharmacodynamic biomarker of ONC201 response in ongoing clinical studies. PMID:28767654

The human retrovirus XMRV in prostate cancer and chronic fatigue syndrome.

PubMed

Silverman, Robert H; Nguyen, Carvell; Weight, Christopher J; Klein, Eric A

2010-07-01

Xenotropic murine leukemia virus-related virus (XMRV) is an authentic, newly recognized human retrovirus first identified in prostate cancer tissues from men with a deficiency in the innate immunity gene RNASEL. At present, studies have detected XMRV at widely different rates in prostate cancer cases (0-27%) and in patients with chronic fatigue syndrome (CFS; 0-67%). Indirect or direct modes of carcinogenesis by XMRV have been suggested depending on whether the virus was found in stroma or malignant epithelium. Viral replication in the prostate might be affected by androgens, which stimulate XMRV through a transcriptional enhancer site in viral DNA. By contrast, host restriction factors, such as APOBEC3 and tetherin, inhibit virus replication. Immune dysfunction mediated by XMRV has been suggested as a possible factor in CFS. Recent studies show that some existing antiretroviral drugs suppress XMRV infections and diagnostic assays are under development. Although other retroviruses of the same genus as XMRV (gammaretroviruses) cause cancer and neurological disease in animals, whether XMRV is a cause of either prostate cancer or CFS remains unknown. Emerging science surrounding XMRV is contributing to our knowledge of retroviral infections while focusing intense interest on two major human diseases.

Two sides of the same coin? Unraveling subtle differences between human embryonic and induced pluripotent stem cells by Raman spectroscopy.

PubMed

Parrotta, Elvira; De Angelis, Maria Teresa; Scalise, Stefania; Candeloro, Patrizio; Santamaria, Gianluca; Paonessa, Mariagrazia; Coluccio, Maria Laura; Perozziello, Gerardo; De Vitis, Stefania; Sgura, Antonella; Coluzzi, Elisa; Mollace, Vincenzo; Di Fabrizio, Enzo Mario; Cuda, Giovanni

2017-11-28

Human pluripotent stem cells, including embryonic stem cells and induced pluripotent stem cells, hold enormous promise for many biomedical applications, such as regenerative medicine, drug testing, and disease modeling. Although induced pluripotent stem cells resemble embryonic stem cells both morphologically and functionally, the extent to which these cell lines are truly equivalent, from a molecular point of view, remains controversial. Principal component analysis and K-means cluster analysis of collected Raman spectroscopy data were used for a comparative study of the biochemical fingerprint of human induced pluripotent stem cells and human embryonic stem cells. The Raman spectra analysis results were further validated by conventional biological assays. Raman spectra analysis revealed that the major difference between human embryonic stem cells and induced pluripotent stem cells is due to the nucleic acid content, as shown by the strong positive peaks at 785, 1098, 1334, 1371, 1484, and 1575 cm -1 , which is enriched in human induced pluripotent stem cells. Here, we report a nonbiological approach to discriminate human induced pluripotent stem cells from their native embryonic stem cell counterparts.

FOXA1 and SOX9 Expression in the Developing Urogenital Sinus of the Tammar Wallaby (Macropus eugenii).

PubMed

Gamat, Melissa; Chew, Keng Yih; Shaw, Geoffrey; Renfree, Marilyn B

2015-01-01

The mammalian prostate is a compact structure in humans but multi-lobed in mice. In humans and mice, FOXA1 and SOX9 play pivotal roles in prostate morphogenesis, but few other species have been examined. We examined FOXA1 and SOX9 in the marsupial tammar wallaby, Macropus eugenii, which has a segmented prostate more similar to human than to mouse. In males, prostatic budding in the urogenital epithelium (UGE) was initiated by day 24 postpartum (pp), but in the female the UGE remained smooth and had begun forming the marsupial vaginal structures. FOXA1 was upregulated in the male urogenital sinus (UGS) by day 51 pp, whilst in the female UGS FOXA1 remained basal. FOXA1 was localised in the UGE in both sexes between day 20 and 80 pp. SOX9 was upregulated in the male UGS at day 21-30 pp and remained high until day 51-60 pp. SOX9 protein was localised in the distal tips of prostatic buds which were highly proliferative. The persistent upregulation of the transcription factors SOX9 and FOXA1 after the initial peak and fall of androgen levels suggest that in the tammar, as in other mammals, these factors are required to sustain prostate differentiation, development and proliferation as androgen levels return to basal levels. © 2015 S. Karger AG, Basel.

In-depth investigation of archival and prospectively collected samples reveals no evidence for XMRV infection in prostate cancer.

PubMed

Lee, Deanna; Das Gupta, Jaydip; Gaughan, Christina; Steffen, Imke; Tang, Ning; Luk, Ka-Cheung; Qiu, Xiaoxing; Urisman, Anatoly; Fischer, Nicole; Molinaro, Ross; Broz, Miranda; Schochetman, Gerald; Klein, Eric A; Ganem, Don; Derisi, Joseph L; Simmons, Graham; Hackett, John; Silverman, Robert H; Chiu, Charles Y

2012-01-01

XMRV, or xenotropic murine leukemia virus (MLV)-related virus, is a novel gammaretrovirus originally identified in studies that analyzed tissue from prostate cancer patients in 2006 and blood from patients with chronic fatigue syndrome (CFS) in 2009. However, a large number of subsequent studies failed to confirm a link between XMRV infection and CFS or prostate cancer. On the contrary, recent evidence indicates that XMRV is a contaminant originating from the recombination of two mouse endogenous retroviruses during passaging of a prostate tumor xenograft (CWR22) in mice, generating laboratory-derived cell lines that are XMRV-infected. To confirm or refute an association between XMRV and prostate cancer, we analyzed prostate cancer tissues and plasma from a prospectively collected cohort of 39 patients as well as archival RNA and prostate tissue from the original 2006 study. Despite comprehensive microarray, PCR, FISH, and serological testing, XMRV was not detected in any of the newly collected samples or in archival tissue, although archival RNA remained XMRV-positive. Notably, archival VP62 prostate tissue, from which the prototype XMRV strain was derived, tested negative for XMRV on re-analysis. Analysis of viral genomic and human mitochondrial sequences revealed that all previously characterized XMRV strains are identical and that the archival RNA had been contaminated by an XMRV-infected laboratory cell line. These findings reveal no association between XMRV and prostate cancer, and underscore the conclusion that XMRV is not a naturally acquired human infection.

Inhibition of prostatic smooth muscle contraction by the inhibitor of G protein-coupled receptor kinase 2/3, CMPD101.

PubMed

Yu, Qingfeng; Gratzke, Christian; Wang, Yiming; Herlemann, Annika; Strittmatter, Frank; Rutz, Beata; Stief, Christian G; Hennenberg, Martin

2018-07-15

Alpha1-adrenoceptors induce prostate smooth muscle contraction, and hold a prominent role for pathophysiology and therapy of lower urinary tract symptoms in benign prostatic hyperplasia. G protein-coupled receptors are regulated by posttranslational regulation, including phosphorylation by G protein-coupled receptor kinases 2 and 3 (GRK2/3). Although posttranslational adrenoceptor regulation has been recently suggested to occur in the prostate, this is still marginally understood. With the newly developed CMPD101, a small molecule inhibitor with assumed specificity for GRK2/3 is now available. Here, we studied effects of CMPD101 on smooth muscle contraction of human prostate tissue. Electric field stimulation caused frequency-dependent contractions, which were inhibited concentration-dependently by CMPD101 (5 µM, 50 µM). 50 µM of CMPD101 did not affect myosin light chain (MCL) phosphorylation or Rho kinase activity, and did not alter contractions induced by highmolar KCl. Noradrenaline, the α 1 -adrenoceptor agonist phenylephrine, endothelin-1, and the thromboxane A 2 analogue U46619 induced concentration-dependent contractions, which were inhibited by CMPD101 (50 µM). CMPD101 (50 µM) did not change phosphorylation of β 2 -adrenoceptors or β 2 -adrenergic relaxation of prostate strips. Molecular detection by Western blot and peroxidase staining suggested expression of GRK2 and GRK3 in human prostates. Double labeling in fluorescence staining confirmed that immunoreactivity for GRK2 and GRK3 was located to smooth muscle cells in the prostate stroma. In conclusion, CMPD101 inhibits adrenergic, neurogenic, and non-adrenergic smooth muscle contractions in the human prostate. Underlying mechanisms may be independent from GRK inhibition, and from inhibition of MLC kinase and Rho kinase. This may point to unknown properties of CMPD101. Copyright © 2018 Elsevier B.V. All rights reserved.

Ultra-high performance liquid chromatographic determination of levofloxacin in human plasma and prostate tissue with use of experimental design optimization procedures.

PubMed

Szerkus, O; Jacyna, J; Wiczling, P; Gibas, A; Sieczkowski, M; Siluk, D; Matuszewski, M; Kaliszan, R; Markuszewski, M J

2016-09-01

Fluoroquinolones are considered as gold standard for the prevention of bacterial infections after transrectal ultrasound guided prostate biopsy. However, recent studies reported that fluoroquinolone- resistant bacterial strains are responsible for gradually increasing number of infections after transrectal prostate biopsy. In daily clinical practice, antibacterial efficacy is evaluated only in vitro, by measuring the reaction of bacteria with an antimicrobial agent in culture media (i.e. calculation of minimal inhibitory concentration). Such approach, however, has no relation to the treated tissue characteristics and might be highly misleading. Thus, the objective of this study was to develop, with the use of Design of Experiments approach, a reliable, specific and sensitive ultra-high performance liquid chromatography- diode array detection method for the quantitative analysis of levofloxacin in plasma and prostate tissue samples obtained from patients undergoing prostate biopsy. Moreover, correlation study between concentrations observed in plasma samples vs prostatic tissue samples was performed, resulting in better understanding, evaluation and optimization of the fluoroquinolone-based antimicrobial prophylaxis during transrectal ultrasound guided prostate biopsy. Box-Behnken design was employed to optimize chromatographic conditions of the isocratic elution program in order to obtain desirable retention time, peak symmetry and resolution of levofloxacine and ciprofloxacine (internal standard) peaks. Fractional Factorial design 2(4-1) with four center points was used for screening of significant factors affecting levofloxacin extraction from the prostatic tissue. Due to the limited number of tissue samples the prostatic sample preparation procedure was further optimized using Central Composite design. Design of Experiments approach was also utilized for evaluation of parameter robustness. The method was found linear over the range of 0.030-10μg/mL for human plasma and 0.300-30μg/g for human prostate tissue samples. The intra-day and inter-day variability for levofloxacine from both plasma and prostate samples were less than 10%, with accuracies between 93 and 108% of the nominal values. The limit of detection and the limit of quantification for human plasma were 0.01μg/mL and 0.03μg/mL, respectively. For the prostate tissue, the limit of detection and the limit of quantification were 0.1μg/g and 0.3μg/g, respectively. The average recoveries of levofloxacin were in the range from 99 to 106%. Also, the method fulfills requirements of robustness what was determined and proved by Design of Experiments. The developed method was successfully applied to examine prostate tissue and plasma samples from 140 hospitalized patients enrolled into the clinical study, 12h after oral administration of LVF at a dose of 500mg. The mean (±SD) LVF concentration in prostate was 6.22±3.52μg/g and in plasma 2.54±1.14μg/mL. Due to simplicity of the method and relative small amount of sample needed for the assay, the method can be applied in clinical practice for monitoring of LVF concentrations in plasma and prostate gland. Copyright © 2016 Elsevier B.V. All rights reserved.

Potential Prognostic Markers for Human Prostate Cancer

DTIC Science & Technology

2001-03-01

thymosin 0315 gene. The gene appears to exist as a single copy in the rat genome and is comprised of 3 exons distributed over 3 kilobases. The...metastatic prostate cancer cells. Autocrine motility factor ( AMF ), a prostate tumor G low low cell secreted factor [13], also affects motility of...prostate H low low carcinoma cells. Tumor cell migration in response to HIF low low ATI low low AMF has been associated with metastatic potential. AT2 low

Heterobivalent Imaging Agents for Simultaneous Targeting Prostate-Specific Membrane Antigen (PSMA) and Hepsin

DTIC Science & Technology

2011-04-01

specific membrane antigen (PSMA), showed promise in the clinic for identifying candidates for salvage radiotherapy. (4, 5) Because of the important...removed benzyl group to afford the Lys- Urea-Glu 14 in 85% yield. Compound 14 was conjugated with the suberic acid bis-(N- hydroxysuccinimide ( DSS ) in...directed against human and mouse prostate-specific membrane antigen. Prostate 2004; 61: 1-11. 4. Chang SS, Heston WD. The clinical role of prostate

Response to luteinizing releasing hormone, thyrotrophic releasing hormone, and human chorionic gonadotropin administration in healthy men at different risks for prostatic cancer and in prostatic cancer patients.

PubMed

Hill, P; Wynder, E L; Garbaczewski, L; Garnes, H; Walker, A R

1982-05-01

A comparative study of the pituitary and testicular response to luteinizing releasing hormone (LHRH), thyrotrophic releasing hormone (TRH), and human chorionic gonadotrophin (HCG) administration was carried out in (a) low-risk young South African black men and high-risk North American black men for prostatic cancer and (b) healthy elderly South African men and South African black men with prostatic cancer. A comparable HCG response occurred in young South African and North American black men, while a greater release of prolactin, but a lesser release of luteinizing hormone in response to LHRH:TRH occurred in South African black men. The response to HCG was comparable in elderly and young South African black men, although the prolactin release in response to TRH was greater in elderly men. A more prolonged release of luteinizing hormone was evident in men with prostatic cancer. Higher estradiol and estrone but lower androstenedione levels occurred in men with prostatic cancer. Data suggest that, in the elderly South African black men with prostatic cancer, estrogen metabolism is modified and that either the estrogen level or the higher estrogen:androgen levels modify the pituitary response to LHRH:TRH. A Western diet enhanced the changes in hormone profiles evident in black South African men with prostatic cancer.

Trichomonas vaginalis homolog of macrophage migration inhibitory factor induces prostate cell growth, invasiveness, and inflammatory responses.

PubMed

Twu, Olivia; Dessí, Daniele; Vu, Anh; Mercer, Frances; Stevens, Grant C; de Miguel, Natalia; Rappelli, Paola; Cocco, Anna Rita; Clubb, Robert T; Fiori, Pier Luigi; Johnson, Patricia J

2014-06-03

The human-infective parasite Trichomonas vaginalis causes the most prevalent nonviral sexually transmitted infection worldwide. Infections in men may result in colonization of the prostate and are correlated with increased risk of aggressive prostate cancer. We have found that T. vaginalis secretes a protein, T. vaginalis macrophage migration inhibitory factor (TvMIF), that is 47% similar to human macrophage migration inhibitory factor (HuMIF), a proinflammatory cytokine. Because HuMIF is reported to be elevated in prostate cancer and inflammation plays an important role in the initiation and progression of cancers, we have explored a role for TvMIF in prostate cancer. Here, we show that TvMIF has tautomerase activity, inhibits macrophage migration, and is proinflammatory. We also demonstrate that TvMIF binds the human CD74 MIF receptor with high affinity, comparable to that of HuMIF, which triggers activation of ERK, Akt, and Bcl-2-associated death promoter phosphorylation at a physiologically relevant concentration (1 ng/mL, 80 pM). TvMIF increases the in vitro growth and invasion through Matrigel of benign and prostate cancer cells. Sera from patients infected with T. vaginalis are reactive to TvMIF, especially in males. The presence of anti-TvMIF antibodies indicates that TvMIF is released by the parasite and elicits host immune responses during infection. Together, these data indicate that chronic T. vaginalis infections may result in TvMIF-driven inflammation and cell proliferation, thus triggering pathways that contribute to the promotion and progression of prostate cancer.

Diploid, but not haploid, human embryonic stem cells can be derived from microsurgically repaired tripronuclear human zygotes

PubMed Central

Fan, Yong; Li, Rong; Huang, Jin; Yu, Yang; Qiao, Jie

2013-01-01

Human embryonic stem cells have shown tremendous potential in regenerative medicine, and the recent progress in haploid embryonic stem cells provides new insights for future applications of embryonic stem cells. Disruption of normal fertilized embryos remains controversial; thus, the development of a new source for human embryonic stem cells is important for their usefulness. Here, we investigated the feasibility of haploid and diploid embryo reconstruction and embryonic stem cell derivation using microsurgically repaired tripronuclear human zygotes. Diploid and haploid zygotes were successfully reconstructed, but a large proportion of them still had a tripolar spindle assembly. The reconstructed embryos developed to the blastocyst stage, although the loss of chromosomes was observed in these zygotes. Finally, triploid and diploid human embryonic stem cells were derived from tripronuclear and reconstructed zygotes (from which only one pronucleus was removed), but haploid human embryonic stem cells were not successfully derived from the reconstructed zygotes when two pronuclei were removed. Both triploid and diploid human embryonic stem cells showed the general characteristics of human embryonic stem cells. These results indicate that the lower embryo quality resulting from abnormal spindle assembly contributed to the failure of the haploid embryonic stem cell derivation. However, the successful derivation of diploid embryonic stem cells demonstrated that microsurgical tripronuclear zygotes are an alternative source of human embryonic stem cells. In the future, improving spindle assembly will facilitate the application of triploid zygotes to the field of haploid embryonic stem cells. PMID:23255130

Prostate cancer stem-like cells proliferate slowly and resist etoposide-induced cytotoxicity via enhancing DNA damage response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Judy; Father Sean O'Sullivan Research Institute, Hamilton, Ontario, Canada L8N 4A6; The Hamilton Centre for Kidney Research

Despite the development of chemoresistance as a major concern in prostate cancer therapy, the underlying mechanisms remain elusive. In this report, we demonstrate that DU145-derived prostate cancer stem cells (PCSCs) progress slowly with more cells accumulating in the G1 phase in comparison to DU145 non-PCSCs. Consistent with the important role of the AKT pathway in promoting G1 progression, DU145 PCSCs were less sensitive to growth factor-induced activation of AKT in comparison to non-PCSCs. In response to etoposide (one of the most commonly used chemotherapeutic drugs), DU145 PCSCs survived significantly better than non-PCSCs. In addition to etoposide, PCSCs demonstrated increased resistancemore » to docetaxel, a taxane drug that is commonly used to treat castration-resistant prostate cancer. Etoposide produced elevated levels of γH2AX and triggered a robust G2/M arrest along with a coordinated reduction of the G1 population in PCSCs compared to non-PCSCs, suggesting that elevated γH2AX plays a role in the resistance of PCSCs to etoposide-induced cytotoxicity. We have generated xenograft tumors from DU145 PCSCs and non-PCSCs. Consistent with the knowledge that PCSCs produce xenograft tumors with more advanced features, we were able to demonstrate that PCSC-derived xenograft tumors displayed higher levels of γH2AX and p-CHK1 compared to non-PCSC-produced xenograft tumors. Collectively, our research suggests that the elevation of DNA damage response contributes to PCSC-associated resistance to genotoxic reagents. - Highlights: • Increased survival in DU145 PCSCs following etoposide-induced cytotoxicity. • PCSCs exhibit increased sensitivity to etoposide-induced DDR. • Resistance to cytotoxicity may be due to slower proliferation in PCSCs. • Reduced kinetics to growth factor induced activation of AKT in PCSCs.« less

Label-Free Relative Quantitation of Isobaric and Isomeric Human Histone H2A and H2B Variants by Fourier Transform Ion Cyclotron Resonance Top-Down MS/MS.

PubMed

Dang, Xibei; Singh, Amar; Spetman, Brian D; Nolan, Krystal D; Isaacs, Jennifer S; Dennis, Jonathan H; Dalton, Stephen; Marshall, Alan G; Young, Nicolas L

2016-09-02

Histone variants are known to play a central role in genome regulation and maintenance. However, many variants are inaccessible by antibody-based methods or bottom-up tandem mass spectrometry due to their highly similar sequences. For many, the only tractable approach is with intact protein top-down tandem mass spectrometry. Here, ultra-high-resolution FT-ICR MS and MS/MS yield quantitative relative abundances of all detected HeLa H2A and H2B isobaric and isomeric variants with a label-free approach. We extend the analysis to identify and relatively quantitate 16 proteoforms from 12 sequence variants of histone H2A and 10 proteoforms of histone H2B from three other cell lines: human embryonic stem cells (WA09), U937, and a prostate cancer cell line LaZ. The top-down MS/MS approach provides a path forward for more extensive elucidation of the biological role of many previously unstudied histone variants and post-translational modifications.

Soy, Isoflavones, and Prostate Cancer Risk in Men: A Revisit of Meta-Analysis

USDA-ARS?s Scientific Manuscript database

Soy is a major plant source of dietary protein to humans. Epidemiologic studies show that soy consumption may be associated with a reduction in cancer risk in humans. The purpose of this study was to conduct a meta-analysis on the association between soy and prostate cancer in men. We systematicall...

A method to measure cellular adhesion utilizing a polymer micro-cantilever

NASA Astrophysics Data System (ADS)

Gaitas, Angelo; Malhotra, Ricky; Pienta, Kenneth

2013-09-01

In the present study we engineered a micro-machined polyimide cantilever with an embedded sensing element to investigate cellular adhesion, in terms of its relative ability to stick to a cross-linker, 3,3'-dithiobis[sulfosuccinimidylpropionate], coated on the cantilever surface. To achieve this objective, we investigated adhesive properties of three human prostate cancer cell lines, namely, a bone metastasis derived human prostate cancer cell line (PC3), a brain metastasis derived human prostate cancer cell line (DU145), and a subclone of PC3 (PC3-EMT14). We found that PC3-EMT14, which displays a mesenchymal phenotype, has the least adhesion compared to PC3 and DU145, which exhibit an epithelial phenotype.

The effect of a combination of prostatic massage and antibiotic plus anticongestive drugs on human semen quality and fertility.

PubMed

Homonnai, Z T; Fainman, N; Paz, G; Kraicer, P F

1979-01-01

A total of 123 patients suffering from chronic prostatitis and infertility were included in this study. No significant improvement in sperm quality was found following prostatic massage with (90 patients) or without (33) antiobiotic plus anticongestive therapy. There was no apparent change in the relative contribution on the prostate and seminal vesicle of the ejaculate, as judged by the concentration of calcium and fructose. Nor was the pregnancy rate increased. It is concluded that prostatic massage is of little or no therapeutic value in treatment of infertility.

ANX7 as a Bio-Marker in Prostate and Breast Cancer Progression

PubMed Central

Srivastava, Meera; Bubendorf, Lukas; Nolan, Lisa; Glasman, Mirta; Leighton, Ximena; Miller, Georgina; Fehrle, Wilfred; Raffeld, Mark; Eidelman, Ofer; Kallioniemi, Olli P.; Srivastava, Shiv; Pollard, Harvey B.

2001-01-01

The ANX7 gene codes for a Ca2+-activated GTPase, which has been implicated in both exocytotic secretion in cells and control of growth. In this review, we summarize information regarding increased tumor frequency in the Anx7 knockout mice, ANX7 growth suppression of human cancer cell lines, and ANX7 expression in human tumor tissue micro-arrays. The loss of ANX7 is significant in metastatic and hormone refractory prostate cancer compared to benign prostatic hyperplasia. In addition, ANX7 expression has prognostic value for predicting survival of breast cancer patients. PMID:11673658

A Novel Anti-Beta2-Microglobulin Antibody Inhibition of Androgen Receptor Expression, Survival, and Progression in Prostate Cancer Cells

DTIC Science & Technology

2009-05-31

Konaka H, Sodek J, Zhau HE, Chung LW. Human Osteocalcin and Bone Sialoprotein Mediating Osteomimicry of Prostate Cancer Cells: Role of cAMP... sialoprotein mediating osteomimicry of prostate cancer cells: role of cAMP-dependent protein kinase A signaling path- way. Cancer Res 2005;65:2303^13

Cyproterone acetate enhances TRAIL-induced androgen-independent prostate cancer cell apoptosis via up-regulation of death receptor 5.

PubMed

Chen, Linjie; Wolff, Dennis W; Xie, Yan; Lin, Ming-Fong; Tu, Yaping

2017-03-07

Virtually all prostate cancer deaths occur due to obtaining the castration-resistant phenotype after prostate cancer cells escaped from apoptosis and/or growth suppression initially induced by androgen receptor blockade. TNF-related apoptosis-inducing ligand (TRAIL) was an attractive cancer therapeutic agent due to its minimal toxicity to normal cells and remarkable apoptotic activity in tumor cells. However, most localized cancers including prostate cancer are resistant to TRAIL-induced apoptosis, thereby creating a therapeutic challenge of inducing TRAIL sensitivity in cancer cells. Herein the effects of cyproterone acetate, an antiandrogen steroid, on the TRAIL-induced apoptosis of androgen receptor-negative prostate cancer cells are reported. Cell apoptosis was assessed by both annexin V/propidium iodide labeling and poly (ADP-ribose) polymerase cleavage assays. Gene and protein expression changes were determined by quantitative real-time PCR and western blot assays. The effect of cyproterone acetate on gene promoter activity was determined by luciferase reporter assay. Cyproterone acetate but not AR antagonist bicalutamide dramatically increased the susceptibility of androgen receptor-negative human prostate cancer PC-3 and DU145 cells to TRAIL-induced apoptosis but no effects on immortalized human prostate stromal PS30 cells and human embryonic kidney HEK293 cells. Further investigation of the TRAIL-induced apoptosis pathway revealed that cyproterone acetate exerted its effect by selectively increasing death receptor 5 (DR5) mRNA and protein expression. Cyproterone acetate treatment also increased DR5 gene promoter activity, which could be abolished by mutation of a consensus binding domain of transcription factor CCAAT-enhancer-binding protein homologous protein (CHOP) in the DR5 gene promoter. Cyproterone acetate increases CHOP expression in a concentration and time-dependent manner and endoplasmic reticulum stress reducer 4-phenylbutyrate could block cyproterone acetate-induced CHOP and DR5 up-regulation. More importantly, siRNA silencing of CHOP significantly reduced cyproterone acetate-induced DR5 up-regulation and TRAIL sensitivity in prostate cancer cells. Our study shows a novel effect of cyproterone acetate on apoptosis pathways in prostate cancer cells and raises the possibility that a combination of TRAIL with cyproterone acetate could be a promising strategy for treating castration-resistant prostate cancer.

I.V. infusion of brain-derived neurotrophic factor gene-modified human mesenchymal stem cells protects against injury in a cerebral ischemia model in adult rat.

PubMed

Nomura, T; Honmou, O; Harada, K; Houkin, K; Hamada, H; Kocsis, J D

2005-01-01

I.V. delivery of mesenchymal stem cells prepared from adult bone marrow reduces infarction size and ameliorates functional deficits in rat cerebral ischemia models. Administration of the brain-derived neurotrophic factor to the infarction site has also been demonstrated to be neuroprotective. To test the hypothesis that brain-derived neurotrophic factor contributes to the therapeutic benefits of mesenchymal stem cell delivery, we compared the efficacy of systemic delivery of human mesenchymal stem cells and human mesenchymal stem cells transfected with a fiber-mutant F/RGD adenovirus vector with a brain-derived neurotrophic factor gene (brain-derived neurotrophic factor-human mesenchymal stem cells). A permanent middle cerebral artery occlusion was induced by intraluminal vascular occlusion with a microfilament. Human mesenchymal stem cells and brain-derived neurotrophic factor-human mesenchymal stem cells were i.v. injected into the rats 6 h after middle cerebral artery occlusion. Lesion size was assessed at 6 h, 1, 3 and 7 days using MR imaging, and histological methods. Functional outcome was assessed using the treadmill stress test. Both human mesenchymal stem cells and brain-derived neurotrophic factor-human mesenchymal stem cells reduced lesion volume and elicited functional improvement compared with the control sham group, but the effect was greater in the brain-derived neurotrophic factor-human mesenchymal stem cell group. ELISA analysis of the infarcted hemisphere revealed an increase in brain-derived neurotrophic factor in the human mesenchymal stem cell groups, but a greater increase in the brain-derived neurotrophic factor-human mesenchymal stem cell group. These data support the hypothesis that brain-derived neurotrophic factor contributes to neuroprotection in cerebral ischemia and cellular delivery of brain-derived neurotrophic factor can be achieved by i.v. delivery of human mesenchymal stem cells.

Unfoldomics of prostate cancer: on the abundance and roles of intrinsically disordered proteins in prostate cancer

PubMed Central

Landau, Kevin S; Na, Insung; Schenck, Ryan O; Uversky, Vladimir N

2016-01-01

Prostatic diseases such as prostate cancer and benign prostatic hyperplasia are highly prevalent among men. The number of studies focused on the abundance and roles of intrinsically disordered proteins in prostate cancer is rather limited. The goal of this study is to analyze the prevalence and degree of disorder in proteins that were previously associated with the prostate cancer pathogenesis and to compare these proteins to the entire human proteome. The analysis of these datasets provides means for drawing conclusions on the roles of disordered proteins in this common male disease. We also hope that the results of our analysis can potentially lead to future experimental studies of these proteins to find novel pathways associated with this disease. PMID:27453073

Prostate-specific membrane antigen-targeted liposomes specifically deliver the Zn(2+) chelator TPEN inducing oxidative stress in prostate cancer cells.

PubMed

Stuart, Christopher H; Singh, Ravi; Smith, Thomas L; D'Agostino, Ralph; Caudell, David; Balaji, K C; Gmeiner, William H

2016-05-01

To evaluate the potential use of zinc chelation for prostate cancer therapy using a new liposomal formulation of the zinc chelator, N,N,N',N'-tetrakis(2-pyridylmethyl)-ethylenediamine (TPEN). TPEN was encapsulated in nontargeted liposomes or liposomes displaying an aptamer to target prostate cancer cells overexpression prostate-specific membrane antigen. The prostate cancer selectivity and therapeutic efficacy of liposomal (targeted and nontargeted) and free TPEN were evaluated in vitro and in tumor-bearing mice. TPEN chelates zinc and results in reactive oxygen species imbalance leading to cell death. Delivery of TPEN using aptamer-targeted liposomes results in specific delivery to targeted cells. In vivo experiments show that TPEN-loaded, aptamer-targeted liposomes reduce tumor growth in a human prostate cancer xenograft model.

Senescence-Induced Alterations of Laminin Chain Expression Modulate Tumorigenicity of Prostate Cancer Cells1

PubMed Central

Sprenger, Cynthia C T; Drivdahl, Rolf H; Woodke, Lillie B; Eyman, Daniel; Reed, May J; Carter, William G; Plymate, Stephen R

2008-01-01

Prostate cancer is an age-associated epithelial cancer, and as such, it contributes significantly to the mortality of the elderly. Senescence is one possible mechanism by which the body defends itself against various epithelial cancers. Senescent cells alter the microenvironment, in part, through changes to the extracellular matrix. Laminins (LMs) are extracellular proteins important to both the structure and function of the microenvironment. Overexpression of the senescence-associated gene mac25 in human prostate cancer cells resulted in increased mRNA levels of the LM α4 and β2 chains compared to empty vector control cells. The purpose of this study was to examine the effects of these senescence-induced LM chains on tumorigenicity of prostate cancer cells. We created stable M12 human prostate cancer lines overexpressing either the LM α4 or β2 chain or both chains. Increased expression of either the LM α4 or β2 chain resulted in increased in vitro migration and in vivo tumorigenicity of those cells, whereas high expression of both chains led to decreased in vitro proliferation and in vivo tumorigenicity compared to M12 control cells. This study demonstrates that senescent prostate epithelial cells can alter the microenvironment and that these changes modulate progression of prostate cancer. PMID:19048114

Multiphoton gradient index endoscopy for evaluation of diseased human prostatic tissue ex vivo

NASA Astrophysics Data System (ADS)

Huland, David M.; Jain, Manu; Ouzounov, Dimitre G.; Robinson, Brian D.; Harya, Diana S.; Shevchuk, Maria M.; Singhal, Paras; Xu, Chris; Tewari, Ashutosh K.

2014-11-01

Multiphoton microscopy can instantly visualize cellular details in unstained tissues. Multiphoton probes with clinical potential have been developed. This study evaluates the suitability of multiphoton gradient index (GRIN) endoscopy as a diagnostic tool for prostatic tissue. A portable and compact multiphoton endoscope based on a 1-mm diameter, 8-cm length GRIN lens system probe was used. Fresh ex vivo samples were obtained from 14 radical prostatectomy patients and benign and malignant areas were imaged and correlated with subsequent H&E sections. Multiphoton GRIN endoscopy images of unfixed and unprocessed prostate tissue at a subcellular resolution are presented. We note several differences and identifying features of benign versus low-grade versus high-grade tumors and are able to identify periprostatic tissues such as adipocytes, periprostatic nerves, and blood vessels. Multiphoton GRIN endoscopy can be used to identify both benign and malignant lesions in ex vivo human prostate tissue and may be a valuable diagnostic tool for real-time visualization of suspicious areas of the prostate.

CWR22: the first human prostate cancer xenograft with strongly androgen-dependent and relapsed strains both in vivo and in soft agar.

PubMed

Nagabhushan, M; Miller, C M; Pretlow, T P; Giaconia, J M; Edgehouse, N L; Schwartz, S; Kung, H J; de Vere White, R W; Gumerlock, P H; Resnick, M I; Amini, S B; Pretlow, T G

1996-07-01

Most patients' prostate cancers respond to androgen deprivation but relapse after periods of several months to years. Only two prostate cancer xenografts, LNCaP and PC-346, have been reported to be responsive to androgen deprivation and to relapse subsequently. Both of these tumors shrink slightly, if at all, and relapse less than 5 weeks after androgen withdrawal. After androgen withdrawal, the human primary prostate cancer xenograft CWR22 regresses markedly, and prostate-specific antigen (PSA) falls up to 3000-fold in the blood of mice. PSA usually returns to normal. In some animals, the tumor relapses and is then designated CWR22R. In these animals, PSA starts to rise approximately 2-7 months, and tumor begins to grow 3-10 months after castration. Animals with CWR22 need to be euthanized because of large tumors 6-12 weeks after the transplantation of CWR22. Androgen withdrawal prolongs life approximately 3-4-fold.

Quantitative volumetric imaging of normal, neoplastic and hyperplastic mouse prostate using ultrasound.

PubMed

Singh, Shalini; Pan, Chunliu; Wood, Ronald; Yeh, Chiuan-Ren; Yeh, Shuyuan; Sha, Kai; Krolewski, John J; Nastiuk, Kent L

2015-09-21

Genetically engineered mouse models are essential to the investigation of the molecular mechanisms underlying human prostate pathology and the effects of therapy on the diseased prostate. Serial in vivo volumetric imaging expands the scope and accuracy of experimental investigations of models of normal prostate physiology, benign prostatic hyperplasia and prostate cancer, which are otherwise limited by the anatomy of the mouse prostate. Moreover, accurate imaging of hyperplastic and tumorigenic prostates is now recognized as essential to rigorous pre-clinical trials of new therapies. Bioluminescent imaging has been widely used to determine prostate tumor size, but is semi-quantitative at best. Magnetic resonance imaging can determine prostate volume very accurately, but is expensive and has low throughput. We therefore sought to develop and implement a high throughput, low cost, and accurate serial imaging protocol for the mouse prostate. We developed a high frequency ultrasound imaging technique employing 3D reconstruction that allows rapid and precise assessment of mouse prostate volume. Wild-type mouse prostates were examined (n = 4) for reproducible baseline imaging, and treatment effects on volume were compared, and blinded data analyzed for intra- and inter-operator assessments of reproducibility by correlation and for Bland-Altman analysis. Examples of benign prostatic hyperplasia mouse model prostate (n = 2) and mouse prostate implantation of orthotopic human prostate cancer tumor and its growth (n =  ) are also demonstrated. Serial measurement volume of the mouse prostate revealed that high frequency ultrasound was very precise. Following endocrine manipulation, regression and regrowth of the prostate could be monitored with very low intra- and interobserver variability. This technique was also valuable to monitor the development of prostate growth in a model of benign prostatic hyperplasia. Additionally, we demonstrate accurate ultrasound image-guided implantation of orthotopic tumor xenografts and monitoring of subsequent tumor growth from ~10 to ~750 mm(3) volume. High frequency ultrasound imaging allows precise determination of normal, neoplastic and hyperplastic mouse prostate. Low cost and small image size allows incorporation of this imaging modality inside clean animal facilities, and thereby imaging of immunocompromised models. 3D reconstruction for volume determination is easily mastered, and both small and large relative changes in volume are accurately visualized. Ultrasound imaging does not rely on penetration of exogenous imaging agents, and so may therefore better measure poorly vascularized or necrotic diseased tissue, relative to bioluminescent imaging (IVIS). Our method is precise and reproducible with very low inter- and intra-observer variability. Because it is non-invasive, mouse models of prostatic disease states can be imaged serially, reducing inter-animal variability, and enhancing the power to detect small volume changes following therapeutic intervention.

Embryonic Stem Cell Patents and Human Dignity

PubMed Central

Resnik, David B.

2009-01-01

This article examines the assertion that human embryonic stem cells patents are immoral because they violate human dignity. After analyzing the concept of human dignity and its role in bioethics debates, this article argues that patents on human embryos or totipotent embryonic stem cells violate human dignity, but that patents on pluripotent or multipotent stem cells do not. Since patents on pluripotent or multipotent stem cells may still threaten human dignity by encouraging people to treat embryos as property, patent agencies should carefully monitor and control these patents to ensure that patents are not inadvertently awarded on embryos or totipotent stem cells. PMID:17922198

Orthotopic tumorgrafts in nude mice: A new method to study human prostate cancer.

PubMed

Saar, Matthias; Körbel, Christina; Linxweiler, Johannes; Jung, Volker; Kamradt, Jörn; Hasenfus, Andrea; Stöckle, Michael; Unteregger, Gerhard; Menger, Michael D

2015-10-01

In vivo model systems in prostate cancer research that authentically reproduce tumor growth are still sparse. While orthotopic implantation is technically difficult, particularly in the mouse, most models favor subcutaneous tumor growth. This however provides little information about natural tumor growth behavior and tumor stroma interaction. Furthermore, established prostate cancer cell lines grown as in vivo xenografts are not able to reflect the variety of tumor specific growth patterns and growth behavior in men. Primary cell cultures are difficult to handle and an induction of orthotopic tumors has not been successful yet. Therefore, a tumorgraft model using tumor tissue from prostatectomy specimens was developed. Balb/c nude mice were used to graft fresh prostate tumor tissue by renal subcapsular and orthotopic implantation. Testosterone propionate was supplemented. Animals were tracked by means of 30 MHz ultrasound to monitor tumor engraftment and growth. Autopsy, histology, PSA measurements as well as immunostaining and PCR for human tissue were performed to confirm orthotopic tumor growth. Renal subcapsular engraftment was seen in 2 of 3 mice. Orthotopic engraftment was observed in 7 of 11 animals (63.6%) with an overall engraftment of 5 out of 9 patient specimens (55.6%). Ultrasound confirmed the tumor growth over time. Of interest, the tumorgrafts not only retained essential features of the parental tumors, but also stained positive for tumor specific markers such as AR, PSA, and AMACR. Tumor positive animals showed highly elevated serum PSA levels with confirmation of a human specific PCR sequence and a human endothelial cell lining in the tumor vessels. Standardized implantation of fresh tumor tissue in nude mice prostates generates tumorgrafts with histological properties of organ-confined prostate cancer. These tumorgrafts display a new approach for an optimized in vivo model of prostate cancer and will allow further investigations on specific pathways of tumor initiation and progression as well as therapeutic response. © 2015 Wiley Periodicals, Inc.

Laser Illumination Modality of Photoacoustic Imaging Technique for Prostate Cancer

NASA Astrophysics Data System (ADS)

Peng, Dong-qing; Peng, Yuan-yuan; Guo, Jian; Li, Hui

2016-02-01

Photoacoustic imaging (PAI) has recently emerged as a promising imaging technique for prostate cancer. But there was still a lot of challenge in the PAI for prostate cancer detection, such as laser illumination modality. Knowledge of absorbed light distribution in prostate tissue was essential since the distribution characteristic of absorbed light energy would influence the imaging depth and range of PAI. In order to make a comparison of different laser illumination modality of photoacoustic imaging technique for prostate cancer, optical model of human prostate was established and combined with Monte Carlo simulation method to calculate the light absorption distribution in the prostate tissue. Characteristic of light absorption distribution of transurethral and trans-rectal illumination case, and of tumor at different location was compared with each other.The relevant conclusions would be significant for optimizing the light illumination in a PAI system for prostate cancer detection.

A Multiscale, Mechanism-Driven, Dynamic Model for the Effects of 5α-Reductase Inhibition on Prostate Maintenance

PubMed Central

Zager, Michael G.; Barton, Hugh A.

2012-01-01

A systems-level mathematical model is presented that describes the effects of inhibiting the enzyme 5α-reductase (5aR) on the ventral prostate of the adult male rat under chronic administration of the 5aR inhibitor, finasteride. 5aR is essential for androgen regulation in males, both in normal conditions and disease states. The hormone kinetics and downstream effects on reproductive organs associated with perturbing androgen regulation are complex and not necessarily intuitive. Inhibition of 5aR decreases the metabolism of testosterone (T) to the potent androgen 5α-dihydrotestosterone (DHT). This results in decreased cell proliferation, fluid production and 5aR expression as well as increased apoptosis in the ventral prostate. These regulatory changes collectively result in decreased prostate size and function, which can be beneficial to men suffering from benign prostatic hyperplasia (BPH) and could play a role in prostate cancer. There are two distinct isoforms of 5aR in male humans and rats, and thus developing a 5aR inhibitor is a challenging pursuit. Several inhibitors are on the market for treatment of BPH, including finasteride and dutasteride. In this effort, comparisons of simulated vs. experimental T and DHT levels and prostate size are depicted, demonstrating the model accurately described an approximate 77% decrease in prostate size and nearly complete depletion of prostatic DHT following 21 days of daily finasteride dosing in rats. This implies T alone is not capable of maintaining a normal prostate size. Further model analysis suggests the possibility of alternative dosing strategies resulting in similar or greater effects on prostate size, due to complex kinetics between T, DHT and gene occupancy. With appropriate scaling and parameterization for humans, this model provides a multiscale modeling platform for drug discovery teams to test and generate hypotheses about drugging strategies for indications like BPH and prostate cancer, such as compound binding properties, dosing regimens, and target validation. PMID:22970204

Hyaluronan in aged collagen matrix increases prostate epithelial cell proliferation

PubMed Central

Damodarasamy, Mamatha; Vernon, Robert B.; Chan, Christina K.; Plymate, Stephen R.; Wight, Thomas N.

2015-01-01

The extracellular matrix (ECM) of the prostate, which is comprised primarily of collagen, becomes increasingly disorganized with age, a property that may influence the development of hyperplasia and cancer. Collageous ECM extracted from the tails of aged mice exhibits many characteristics of collagen in aged tissues, including the prostate. When polymerized into a 3-dimensional (3D) gel, these collagen extracts can serve as models for the study of specific cell-ECM interactions. In the present study, we examined the behaviors of human prostatic epithelial cell lines representing normal prostate epithelial cells (PEC), benign prostatic hyperplasia (BPH-1), and adenocarcinoma (LNCaP) cultured in contact with 3D gels made from collagen extracts of young and aged mice. We found that proliferation of PEC, BPH-1, and LNCaP cells were all increased by culture on aged collagen gels relative to young collagen gels. In examining age-associated differences in the composition of the collagen extracts, we found that aged and young collagen had a similar amount of several collagen-associated ECM components, but aged collagen had a much greater content of the glycosaminoglycan hyaluronan (HA) than young collagen. The addition of HA (of similar size and concentration to that found in aged collagen extracts) to cells placed in young collagen elicited significantly increased proliferation in BPH-1 cells, but not in PEC or LNCaP cells, relative to controls not exposed to HA. Of note, histochemical analyses of human prostatic tissues showed significantly higher expression of HA in BPH and prostate cancer stroma relative to stroma of normal prostate. Collectively, these results suggest that changes in ECM involving increased levels of HA contribute to the growth of prostatic epithelium with aging. PMID:25124870

Identification of viral infections in the prostate and evaluation of their association with cancer

PubMed Central

2010-01-01

Background Several viruses with known oncogenic potential infect prostate tissue, among these are the polyomaviruses BKV, JCV, and SV40; human papillomaviruses (HPVs), and human cytomegalovirus (HCMV) infections. Recently, the Xenotropic Murine Leukemia Virus-related gammaretrovirus (XMRV) was identified in prostate tissue with a high prevalence observed in prostate cancer (PC) patients homozygous for the glutamine variant of the RNASEL protein (462Q/Q). Association studies with the R462Q allele and non-XMRV viruses have not been reported. We assessed associations between prostate cancer, prostate viral infections, and the RNASEL 462Q allele in Mexican cancer patients and controls. Methods 130 subjects (55 prostate cancer cases and 75 controls) were enrolled in the study. DNA and RNA isolated from prostate tissues were screened for the presence of viral genomes. Genotyping of the RNASEL R462Q variant was performed by Taqman method. Results R/R, R/Q, and Q/Q frequencies for R462Q were 0.62, 0.38, and 0.0 for PC cases and 0.69, 0.24, and 0.07 for controls, respectively. HPV sequences were detected in 11 (20.0%) cases and 4 (5.3%) controls. XMRV and HCMV infections were detected in one and six control samples, respectively. The risk of PC was significantly increased (Odds Ratio = 3.98; 95% CI: 1.17-13.56, p = 0.027) by infection of the prostatic tissue with HPV. BKV, JCV, and SV40 sequences were not detected in any of the tissue samples examined. Conclusions We report a positive association between PC and HPV infection. The 462Q/Q RNASEL genotype was not represented in our PC cases; thus, its interaction with prostate viral infections and cancer could not be evaluated. PMID:20576103

Characterization of neuroendocrine differentiation in human benign prostate and prostatic adenocarcinoma.

PubMed

Aprikian, A G; Cordon-Cardo, C; Fair, W R; Reuter, V E

1993-06-15

This report describes an immunohistopathologic analysis characterizing the incidence, pattern of distribution, and hormonal content of neuroendocrine (NE) cells in human benign prostate and prostatic adenocarcinoma. Formaldehyde-fixed, paraffin-embedded material from 15 benign prostates, 31 primary prostatic adenocarcinomas, 16 metastatic lesions, 21 primary tumors treated with short-course diethylstilbestrol (DES), and 10 specimens from hormone-refractory patients were examined. NE cells were identified using silver histochemistry and a panel of immunohistochemical NE markers (chromogranin-A, serotonin, neuron-specific enolase), and specific peptide hormone antibodies. NE cells were identified in all benign prostates. NE cells were identified in 77% of primary untreated adenocarcinomas with no significant differences with respect to pathologic stage. NE cells were found isolated and dispersed in the tumor, composing the minority of malignant cells. Double-labeling and serial section immunohistochemistry demonstrated the coexpression of prostate-specific antigen (PSA) in NE cells. In addition to serotonin, some tumors expressed multiple hormone immunoreactivities. NE cells were identified in 56% of metastatic deposits, with a similar pattern of distribution. In DES-treated cases, NE cells were found consistently in the adjacent benign epithelium, whereas 52% of tumors contained NE cells. Hormone-refractory tumors contained NE cells in 60% of cases. This analysis demonstrates that a significant proportion of primary and metastatic prostatic adenocarcinomas contain a subpopulation of NE cells, the expression of which does not appear to be suppressed with androgen ablation and does not correlate with pathologic stage. Furthermore, NE cells coexpress PSA, suggesting a common precursor cell of origin. The elaboration of biogenic amines and neuropeptides suggests that NE cells dispersed in prostatic carcinoma may play a paracrine growth-regulatory role.

The human stem cell hierarchy is defined by a functional dependence on Mcl-1 for self-renewal capacity.

PubMed

Campbell, Clinton J V; Lee, Jung Bok; Levadoux-Martin, Marilyne; Wynder, Tracy; Xenocostas, Anargyros; Leber, Brian; Bhatia, Mickie

2010-09-02

The molecular basis for the unique proliferative and self-renewal properties that hierarchically distinguish human stem cells from progenitors and terminally differentiated cells remains largely unknown. We report a role for the Bcl-2 family member myeloid cell leukemia-1 (Mcl-1) as an indispensable regulator of self-renewal in human stem cells and show that a functional dependence on Mcl-1 defines the human stem cell hierarchy. In vivo pharmacologic targeting of the Bcl-2 family members in human hematopoietic stem cells (HSCs) and human leukemic stem cells reduced stem cell regenerative and self-renewal function. Subsequent protein expression studies showed that, among the Bcl-2 family members, only Mcl-1 was up-regulated exclusively in the human HSC fraction on in vivo regeneration of hematopoiesis. Short hairpin RNA-knockdown of Mcl-1 in human cord blood cells did not affect survival in the HSC or hematopoietic progenitor cell fractions in vitro but specifically reduced the in vivo self-renewal function of human HSCs. Moreover, knockdown of Mcl-1 in ontogenetically primitive human pluripotent stem cells resulted in almost complete ablation of stem cell self-renewal function. Our findings show that Mcl-1 is an essential regulator of stem cell self-renewal in humans and therefore represents an axis for therapeutic interventions.

Multifunctional iron platinum stealth immunomicelles: targeted detection of human prostate cancer cells using both fluorescence and magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Taylor, Robert M.; Huber, Dale L.; Monson, Todd C.; Ali, Abdul-Mehdi S.; Bisoffi, Marco; Sillerud, Laurel O.

2011-10-01

Superparamagnetic iron oxide nanoparticles (SPIONs) are the most common type of contrast agents used in contrast agent-enhanced magnetic resonance imaging (MRI). Still, there is a great deal of room for improvement, and nanoparticles with increased MRI relaxivities are needed to increase the contrast enhancement in MRI applied to various medical conditions including cancer. We report the synthesis of superparamagnetic iron platinum nanoparticles (SIPPs) and subsequent encapsulation using PEGylated phospholipids to create stealth immunomicelles (DSPE-SIPPs) that can be specifically targeted to human prostate cancer cell lines and detected using both MRI and fluorescence imaging. SIPP cores and DSPE-SIPPs were 8.5 ± 1.6 nm and 42.9 ± 8.2 nm in diameter, respectively, and the SIPPs had a magnetic moment of 120 A m2/kg iron. J591, a monoclonal antibody against prostate specific membrane antigen (PSMA), was conjugated to the DSPE-SIPPs (J591-DSPE-SIPPs), and specific targeting of J591-DSPE-SIPPs to PSMA-expressing human prostate cancer cell lines was demonstrated using fluorescence confocal microscopy. The transverse relaxivity of the DSPE-SIPPs, measured at 4.7 Tesla, was 300.6 ± 8.5 s-1 mM-1, which is 13-fold better than commercially available SPIONs (23.8 ± 6.9 s-1 mM-1) and 3-fold better than reported relaxivities for Feridex® and Resovist®. Our data suggest that J591-DSPE-SIPPs specifically target human prostate cancer cells in vitro, are superior contrast agents in T 2-weighted MRI, and can be detected using fluorescence imaging. To our knowledge, this is the first report on the synthesis of multifunctional SIPP micelles and using SIPPs for the specific detection of prostate cancer.