Identification and verification of differentially expressed genes in the caprine hypothalamic-pituitary-gonadal axis that are associated with litter size.

PubMed

Feng, Tao; Cao, Gui-Ling; Chu, Ming-Xing; Di, Ran; Huang, Dong-Wei; Liu, Qiu-Yue; Pan, Zhang-Yuan; Jin, Mei; Zhang, Ying-Jie; Li, Ning

2015-02-01

Litter size is a favorable economic trait for the goat industry, but remains a complex trait controlled by multiple genes in multiple organs. Several genes have been identified that may affect embryo survival, follicular development, and the health of fetuses during pregnancy. Jining Grey goats demonstrate the largest litter size among goat breeds indigenous to China. In order to better understand the genetic basis of this trait, six suppression subtractive hybridization (SSH) cDNA libraries were constructed using pooled mRNAs from hypothalamuses, pituitaries, and ovaries of sexually mature and adult polytocous Jining Grey goats, as testers, versus the pooled corresponding mRNAs of monotocous Liaoning Cashmere goats, as drivers. A total of 1,458 true-positive clones--including 955 known genes and 481 known and 22 unknown expressed sequence tags--were obtained from the SSH libraries by sequencing and alignment. The known genes were categorized into cellular processes and signaling information storage and processing, and metabolism. Three genes (FTH1, GH, and SAA) were selected to validate the SSH results by quantitative real-time PCR; all three were up-regulated in the corresponding tissues in the tester group indicating that these are candidate genes associated with the large litter size of Jining Grey goats. Several other identified genes may affect embryo survival, follicular development, and health during pregnancy. This study provides insights into the mechanistic basis by which the caprine hypothalamic-pituitary-gonadal axis affects reproductive traits and provides a theoretical basis for goat production and breeding. © 2015 Wiley Periodicals, Inc.

Identification of genes differentially expressed in grapevine associated with resistance to Elsinoe ampelina through suppressive subtraction hybridization.

PubMed

Gao, Min; Wang, Qian; Wan, Ran; Fei, Zhangjun; Wang, Xiping

2012-09-01

Anthracnose, caused by the biotrophic fungus Elsinoe ampelina, is an economically devastating disease of grapevine (Vitis vinifera L.) prevalent in warm and humid regions of the world. In order to investigate the molecular resistance mechanisms and identify genes related to anthracnose resistance in grapevine, a Suppression Subtractive Hybridization (SSH) library was constructed using mixed cDNAs prepared from leaves of Chinese wild Vitis quinquangularis clone 'Shang-24', cDNA prepared from leaves infected with the pathogen E. ampelina served as tester and cDNA from mock-inoculated leaves as driver. A total of 670 high-quality ESTs were clustered and assembled into a collection of 461 unique genes comprising 85 contigs and 376 singletons. By Gene ontology (GO) analysis 310 unigenes were assigned to 22 GO slims within the molecular function category, while 317 unigenes could be sorted into 43 GO slims within the biological process category. The expression profiles of 20 selected genes, monitored by quantitative RT-PCR, indicated that expression of these genes in the E. ampelina-resistant 'Shang-24' was quicker and more intense, than in the susceptible 'Red Globe' where the reaction was delayed and limited. The results imply that these up-regulated genes could be involved in grapevine responses against E. ampelina infection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Identification of genes differentially expressed by calorie restriction in the rotifer (Brachionus plicatilis).

PubMed

Oo, Aung Kyaw Swar; Kaneko, Gen; Hirayama, Makoto; Kinoshita, Shigeharu; Watabe, Shugo

2010-01-01

A monogonont rotifer Brachionus plicatilis has been widely used as a model organism for physiological, ecological studies and for ecotoxicology. Because of the availability of parthenogenetic mode of reproduction as well as its versatility to be used as live food in aquaculture, the population dynamic studies using the rotifer have become more important and acquired the priority over those using other species. Although many studies have been conducted to identify environmental factors that influence rotifer populations, the molecular mechanisms involved still remain to be elucidated. In this study, gene(s) differentially expressed by calorie restriction in the rotifer was analyzed, where a calorie-restricted group was fed 3 h day(-1) and a well-fed group fed ad libitum. A subtracted cDNA library from the calorie-restricted rotifer was constructed using suppression subtractive hybridization (SSH). One hundred sixty-three expressed sequence tags (ESTs) were identified, which included 109 putative genes with a high identity to known genes in the publicly available database as well as 54 unknown ESTs. After assembling, a total of 38 different genes were obtained among 109 ESTs. Further validation of expression by semi-quantitative reverse transcription-PCR showed that 29 out of the 38 genes obtained by SSH were up regulated by calorie restriction.

Genes up-regulated during red coloration in UV-B irradiated lettuce leaves.

PubMed

Park, Jong-Sug; Choung, Myoung-Gun; Kim, Jung-Bong; Hahn, Bum-Soo; Kim, Jong-Bum; Bae, Shin-Chul; Roh, Kyung-Hee; Kim, Yong-Hwan; Cheon, Choong-Ill; Sung, Mi-Kyung; Cho, Kang-Jin

2007-04-01

Molecular analysis of gene expression differences between green and red lettuce leaves was performed using the SSH method. BlastX comparisons of subtractive expressed sequence tags (ESTs) indicated that 7.6% of clones encoded enzymes involved in secondary metabolism. Such clones had a particularly high abundance of flavonoid-metabolism proteins (6.5%). Following SSH, 566 clones were rescreened for differential gene expression using dot-blot hybridization. Of these, 53 were found to overexpressed during red coloration. The up-regulated expression of six genes was confirmed by Northern blot analyses. The expression of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes showed a positive correlation with anthocyanin accumulation in UV-B-irradiated lettuce leaves; flavonoid 3',5'-hydroxylase (F3',5'H) and anthocyanidin synthase (ANS) were expressed continuously in both samples. These results indicated that the genes CHS, F3H, and DFR coincided with increases in anthocyanin accumulation during the red coloration of lettuce leaves. This study show a relationship between red coloration and the expression of up-regulated genes in lettuce. The subtractive cDNA library and EST database described in this study represent a valuable resource for further research for secondary metabolism in the vegetable crops.

Pathogen-regulated genes in wheat isogenic lines differing in resistance to brown rust Puccinia triticina.

PubMed

Dmochowska-Boguta, Marta; Alaba, Sylwia; Yanushevska, Yuliya; Piechota, Urszula; Lasota, Elzbieta; Nadolska-Orczyk, Anna; Karlowski, Wojciech M; Orczyk, Waclaw

2015-10-05

Inoculation of wheat plants with Puccinia triticina (Pt) spores activates a wide range of host responses. Compatible Pt interaction with susceptible Thatcher plants supports all stages of the pathogen life cycle. Incompatible interaction with TcLr9 activates defense responses including oxidative burst and micronecrotic reactions associated with the pathogen's infection structures and leads to complete termination of pathogen development. These two contrasting host-pathogen interactions were a foundation for transcriptome analysis of incompatible wheat-Pt interaction. A suppression subtractive hybridization (SSH) library was constructed using cDNA from pathogen-inoculated susceptible Thatcher and resistant TcLr9 isogenic lines. cDNA represented steps of wheat-brown rust interactions: spore germination, haustorium mother cell (HMC) formation and micronecrotic reactions. All ESTs were clustered and validated by similarity search to wheat genome using BLASTn and sim4db tools. qRT-PCR was used to determine transcript levels of selected ESTs after inoculation in both lines. Out of 793 isolated cDNA clones, 183 were classified into 152 contigs. 89 cDNA clones and encoded proteins were functionally annotated and assigned to 5 Gene Ontology categories: catalytic activity 48 clones (54 %), binding 32 clones (36 %), transporter activity 6 clones (7 %), structural molecule activity 2 clones (2 %) and molecular transducer activity 1 clone (1 %). Detailed expression profiles of 8 selected clones were analyzed using the same plant-pathogen system. The strongest induction after pathogen infection and the biggest differences between resistant and susceptible interactions were detected for clones encoding wall-associated kinase (GenBank accession number JG969003), receptor with leucine-rich repeat domain (JG968955), putative serine/threonine protein kinase (JG968944), calcium-mediated signaling protein (JG968925) and 14-3-3 protein (JG968969). The SSH library represents transcripts regulated by pathogen infection during compatible and incompatible interactions of wheat with P. triticina. Annotation of selected clones confirms their putative roles in successive steps of plant-pathogen interactions. The transcripts can be categorized as defense-related due to their involvement in either basal defense or resistance through an R-gene mediated reaction. The possible involvement of selected clones in pathogen recognition and pathogen-induced signaling as well as resistance mechanisms such as cell wall enforcement, oxidative burst and micronecrotic reactions is discussed.

Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

PubMed

Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

2008-05-01

SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Transcriptome responses in the rectal gland of fed and fasted spiny dogfish shark (Squalus acanthias) determined by suppression subtractive hybridization.

PubMed

Deck, Courtney A; McKay, Sheldon J; Fiedler, Tristan J; LeMoine, Christophe M R; Kajimura, Makiko; Nawata, C Michele; Wood, Chris M; Walsh, Patrick J

2013-12-01

Prior studies of the elasmobranch rectal gland have demonstrated that feeding induces profound and rapid up regulation of the gland's ability to secrete concentrated NaCl solutions and the metabolic capacity to support this highly ATP consuming process. We undertook the current study to attempt to determine the degree to which up regulation of mRNA transcription was involved in the gland's activation. cDNA libraries were created from mRNA isolated from rectal glands of fasted (7days post-feeding) and fed (6h and 22h post-feeding) spiny dogfish sharks (Squalus acanthias), and the libraries were subjected to suppression subtractive hybridization (SSH) analysis. Quantitative real time PCR (qPCR) was also used to ascertain the mRNA expression of several genes revealed by the SSH analysis. In total the treatments changed the abundance of 170 transcripts, with 103 up regulated by feeding, and 67 up regulated by fasting. While many of the changes took place in 'expected' Gene Ontology (GO) categories (e.g., metabolism, transport, structural proteins, DNA and RNA turnover, etc.), KEGG analysis revealed a number of categories which identify oxidative stress as a topic of interest for the gland. GO analysis also revealed that branched chain essential amino acids (e.g., valine, leucine, isoleucine) are potential metabolic fuels for the rectal gland. In addition, up regulation of transcripts for many genes in the anticipated GO categories did not agree (i.e., fasting down regulated in feeding treatments) with previously observed increases in their respective proteins/enzyme activities. These results suggest an 'anticipatory' storage of selected mRNAs which presumably supports the rapid translation of proteins upon feeding activation of the gland. © 2013 Elsevier Inc. All rights reserved.

SSH reveals a linkage between a senescence-associated protease and Verticillium wilt symptom development in lettuce (Lactuca sativa)

USDA-ARS?s Scientific Manuscript database

Suppression subtractive hybridization (SSH) was employed to identify lettuce (Lactuca sativa) genes that are differentially expressed in symptomatic leaves infected with Verticillium dahliae. Genes expressed only in symptomatic leaves included those with homology to pathogenesis-related (PR) protei...

Expressed sequence tags (ESTs) and phylogenetic analysis of floral genes from a paleoherb species, Asarum caudigerum.

PubMed

Zhao, Yinhe; Wang, Guoying; Zhang, Jinpeng; Yang, Junbo; Peng, Shang; Gao, Lianming; Li, Chengyun; Hu, Jinyong; Li, Dezhu; Gao, Lizhi

2006-07-01

Asarum caudigerum (Aristolochiaceae) is an important species of paleoherb in relation to understanding the origin and evolution of angiosperm flowers, due to its basal position in the angiosperms. The aim of this study was to isolate floral-related genes from A. caudigerum, and to infer evolutionary relationships among florally expression-related genes, to further illustrate the origin and diversification of flowers in angiosperms. A subtracted floral cDNA library was constructed from floral buds using suppression subtractive hybridization (SSH). The cDNA of floral buds and leaves at the seedling stage were used as a tester and a driver, respectively. To further identify the function of putative MADS-box transcription factors, phylogenetic trees were reconstructed in order to infer evolutionary relationships within the MADS-box gene family. In the forward-subtracted floral cDNA library, 1920 clones were randomly sequenced, from which 567 unique expressed sequence tags (ESTs) were obtained. Among them, 127 genes failed to show significant similarity to any published sequences in GenBank and thus are putatively novel genes. Phylogenetic analysis indicated that a total of 29 MADS-box transcription factors were members of the APETALA3(AP3) subfamily, while nine others were putative MADS-box transcription factors that formed a cluster with MADS-box genes isolated from Amborella, the basal-most angiosperm, and those from the gymnosperms. This suggests that the origin of A. caudigerum is intermediate between the angiosperms and gymnosperms.

Cloning, expression, and purification of a new antimicrobial peptide gene from Musca domestica larva.

PubMed

Pei, Zhihua; Sun, Xiaoning; Tang, Yan; Wang, Kai; Gao, Yunhang; Ma, Hongxia

2014-10-01

Musca domestica (Diptera: Muscidae), the housefly, exhibits unique immune defences and can produce antimicrobial peptides upon stimulation with bacteria. Based on the cDNA library constructed using the suppression subtractive hybridization (SSH) method, a 198-bp antimicrobial peptide gene, which we named MDAP-2, was amplified by rapid amplification of cDNA ends (RACE) from M. domestica larvae stimulated with Salmonella pullorum (Enterobacteriaceae: Salmonella). In the present study, the full-length MDAP-2 gene was cloned and inserted into a His-tagged Escherichia coli prokaryotic expression system to enable production of the recombinant peptide. The recombinant MDAP-2 peptide was purified using Ni-NTA HisTrap FF crude column chromatography. The bacteriostatic activity of the recombinant purified MDAP-2 protein was assessed. The results indicated that MDAP-2 had in vitro antibacterial activity against all of the tested Gram- bacteria from clinical isolates, including E. coli (Enterobacteriaceae: Escherichia), one strain of S. pullorum (Enterobacteriaceae: Salmonella), and one strain of Pasteurella multocida. DNA sequencing and BLAST analysis showed that the MDAP-2 antimicrobial peptide gene was not homologous to any other antimicrobial peptide genes in GenBank. The antibacterial mechanisms of the newly discovered MDAP-2 peptide warrant further study. Copyright © 2014 Elsevier B.V. All rights reserved.

Construction and analysis of the cDNA subtraction library of yeast and mycelial phases of Sporothrix globosa isolated in China: identification of differentially expressed genes*

PubMed Central

Hu, Qing-bi; He, Yu; Zhou, Xun

2015-01-01

Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182

Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni

PubMed Central

Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

2008-01-01

Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004

Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni.

PubMed

Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

2008-12-29

Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1alpha and EF-2. Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination.

Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus.

PubMed

Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

2016-10-27

Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5' UTR and 3' UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress.

Pattern Triggered Immunity (PTI) in Tobacco: Isolation of Activated Genes Suggests Role of the Phenylpropanoid Pathway in Inhibition of Bacterial Pathogens

PubMed Central

Szatmári, Ágnes; Zvara, Ágnes; Móricz, Ágnes M.; Besenyei, Eszter; Szabó, Erika; Ott, Péter G.; Puskás, László G.; Bozsó, Zoltán

2014-01-01

Background Pattern Triggered Immunity (PTI) or Basal Resistance (BR) is a potent, symptomless form of plant resistance. Upon inoculation of a plant with non-pathogens or pathogenicity-mutant bacteria, the induced PTI will prevent bacterial proliferation. Developed PTI is also able to protect the plant from disease or HR (Hypersensitive Response) after a challenging infection with pathogenic bacteria. Our aim was to reveal those PTI-related genes of tobacco (Nicotiana tabacum) that could possibly play a role in the protection of the plant from disease. Methodology/Principal Findings Leaves were infiltrated with Pseudomonas syringae pv. syringae hrcC- mutant bacteria to induce PTI, and samples were taken 6 and 48 hours later. Subtraction Suppressive Hybridization (SSH) resulted in 156 PTI-activated genes. A cDNA microarray was generated from the SSH clone library. Analysis of hybridization data showed that in the early (6 hpi) phase of PTI, among others, genes of peroxidases, signalling elements, heat shock proteins and secondary metabolites were upregulated, while at the late phase (48 hpi) the group of proteolysis genes was newly activated. Microarray data were verified by real time RT-PCR analysis. Almost all members of the phenyl-propanoid pathway (PPP) possibly leading to lignin biosynthesis were activated. Specific inhibition of cinnamic-acid-4-hydroxylase (C4H), rate limiting enzyme of the PPP, decreased the strength of PTI - as shown by the HR-inhibition and electrolyte leakage tests. Quantification of cinnamate and p-coumarate by thin-layer chromatography (TLC)-densitometry supported specific changes in the levels of these metabolites upon elicitation of PTI. Conclusions/Significance We believe to provide first report on PTI-related changes in the levels of these PPP metabolites. Results implicated an actual role of the upregulation of the phenylpropanoid pathway in the inhibition of bacterial pathogenic activity during PTI. PMID:25101956

Upregulated Genes In Sporadic, Idiopathic Pulmonary Arterial Hypertension

PubMed Central

Edgar, Alasdair J; Chacón, Matilde R; Bishop, Anne E; Yacoub, Magdi H; Polak, Julia M

2006-01-01

Background To elucidate further the pathogenesis of sporadic, idiopathic pulmonary arterial hypertension (IPAH) and identify potential therapeutic avenues, differential gene expression in IPAH was examined by suppression subtractive hybridisation (SSH). Methods Peripheral lung samples were obtained immediately after removal from patients undergoing lung transplant for IPAH without familial disease, and control tissues consisted of similarly sampled pieces of donor lungs not utilised during transplantation. Pools of lung mRNA from IPAH cases containing plexiform lesions and normal donor lungs were used to generate the tester and driver cDNA libraries, respectively. A subtracted IPAH cDNA library was made by SSH. Clones isolated from this subtracted library were examined for up regulated expression in IPAH using dot blot arrays of positive colony PCR products using both pooled cDNA libraries as probes. Clones verified as being upregulated were sequenced. For two genes the increase in expression was verified by northern blotting and data analysed using Student's unpaired two-tailed t-test. Results We present preliminary findings concerning candidate genes upregulated in IPAH. Twenty-seven upregulated genes were identified out of 192 clones examined. Upregulation in individual cases of IPAH was shown by northern blot for tissue inhibitor of metalloproteinase-3 and decorin (P < 0.01) compared with the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase. Conclusion Four of the up regulated genes, magic roundabout, hevin, thrombomodulin and sucrose non-fermenting protein-related kinase-1 are expressed specifically by endothelial cells and one, muscleblind-1, by muscle cells, suggesting that they may be associated with plexiform lesions and hypertrophic arterial wall remodelling, respectively. PMID:16390543

Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

PubMed

Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

2013-09-01

Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sugarcane genes differentially expressed in response to Puccinia melanocephala infection: identification and transcript profiling.

PubMed

Oloriz, María I; Gil, Víctor; Rojas, Luis; Portal, Orelvis; Izquierdo, Yovanny; Jiménez, Elio; Höfte, Monica

2012-05-01

Brown rust caused by the fungus Puccinia melanocephala is a major disease of sugarcane (Saccharum spp.). A sugarcane mutant, obtained by chemical mutagenesis of the susceptible variety B4362, showed a post-haustorial hypersensitive response (HR)-mediated resistance to the pathogen and was used to identify genes differentially expressed in response to P. melanocephala via suppression subtractive hybridization (SSH). Tester cDNA was derived from the brown rust-resistant mutant after inoculation with P. melanocephala, while driver cDNAs were obtained from the non-inoculated resistant mutant and the inoculated susceptible donor variety B4362. Database comparisons of the sequences of the SSH recombinant clones revealed that, of a subset of 89 non-redundant sequences, 88% had similarity to known functional genes, while 12% were of unknown function. Thirteen genes were selected for transcript profiling in the resistant mutant and the susceptible donor variety. Genes involved in glycolysis and C4 carbon fixation were up-regulated in both interactions probably due to disturbance of sugarcane carbon metabolism by the pathogen. Genes related with the nascent polypeptide associated complex, post-translational proteome modulation and autophagy were transcribed at higher levels in the compatible interaction. Up-regulation of a putative L-isoaspartyl O-methyltransferase S-adenosylmethionine gene in the compatible interaction may point to fungal manipulation of the cytoplasmatic methionine cycle. Genes coding for a putative no apical meristem protein, S-adenosylmethionine decarboxylase, non-specific lipid transfer protein, and GDP-L-galactose phosphorylase involved in ascorbic acid biosynthesis were up-regulated in the incompatible interaction at the onset of haustorium formation, and may contribute to the HR-mediated defense response in the rust-resistant mutant.

Construction and analysis of an SSH cDNA library of early heat-induced genes of Vigna aconitifolia variety RMO-40.

PubMed

Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar

2012-11-01

Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (<1 × 10(-6)) in the NCBI non-redundant database. Gene ontology functional classification terms were retrieved for 479 (65%) sequences, and 339 sequences were annotated with 165 EC codes and mapped to 68 different KEGG pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.

Suppressive subtractive hybridization approach revealed differential expression of hypersensitive response and reactive oxygen species production genes in tea (Camellia sinensis (L.) O. Kuntze) leaves during Pestalotiopsis thea infection.

PubMed

Senthilkumar, Palanisamy; Thirugnanasambantham, Krishnaraj; Mandal, Abul Kalam Azad

2012-12-01

Tea (Camellia sinensis (L.) O. Kuntze) is an economically important plant cultivated for its leaves. Infection of Pestalotiopsis theae in leaves causes gray blight disease and enormous loss to the tea industry. We used suppressive subtractive hybridization (SSH) technique to unravel the differential gene expression pattern during gray blight disease development in tea. Complementary DNA from P. theae-infected and uninfected leaves of disease tolerant cultivar UPASI-10 was used as tester and driver populations respectively. Subtraction efficiency was confirmed by comparing abundance of β-actin gene. A total of 377 and 720 clones with insert size >250 bp from forward and reverse library respectively were sequenced and analyzed. Basic Local Alignment Search Tool analysis revealed 17 sequences in forward SSH library have high degree of similarity with disease and hypersensitive response related genes and 20 sequences with hypothetical proteins while in reverse SSH library, 23 sequences have high degree of similarity with disease and stress response-related genes and 15 sequences with hypothetical proteins. Functional analysis indicated unknown (61 and 59 %) or hypothetical functions (23 and 18 %) for most of the differentially regulated genes in forward and reverse SSH library, respectively, while others have important role in different cellular activities. Majority of the upregulated genes are related to hypersensitive response and reactive oxygen species production. Based on these expressed sequence tag data, putative role of differentially expressed genes were discussed in relation to disease. We also demonstrated the efficiency of SSH as a tool in enriching gray blight disease related up- and downregulated genes in tea. The present study revealed that many genes related to disease resistance were suppressed during P. theae infection and enhancing these genes by the application of inducers may impart better disease tolerance to the plants.

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat

PubMed Central

Zhang, Zijin; Chen, Jieming; Su, Yongying; Liu, Hanmei; Chen, Yanger; Luo, Peigao; Du, Xiaogang; Wang, Dan; Zhang, Huaiyu

2015-01-01

LHY (late elongated hypocotyl) is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization) cDNA library-induced stripe rust pathogen (CYR32) in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like). Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing) technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection. PMID:26010918

Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

PubMed

Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

2015-11-01

MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. © 2015 Scandinavian Plant Physiology Society.

Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra.

PubMed

Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

2016-01-01

The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis.

Characterization of a novel plantain Asr gene, MpAsr, that is regulated in response to infection of Fusarium oxysporum f. sp. cubense and abiotic stresses.

PubMed

Liu, Hai-Yan; Dai, Jin-Ran; Feng, Dong-Ru; Liu, Bing; Wang, Hong-Bin; Wang, Jin-Fa

2010-03-01

Asr (abscisic acid, stress, ripening induced) genes are typically upregulated by a wide range of factors, including drought, cold, salt, abscisic acid (ABA) and injury; in addition to plant responses to developmental and environmental signals. We isolated an Asr gene, MpAsr, from a suppression subtractive hybridization (SSH) cDNA library of cold induced plantain (Musa paradisiaca) leaves. MpAsr expression was upregulated in Fusarium oxysporum f. sp. cubense infected plantain leaves, peels and roots, suggesting that MpAsr plays a role in plantain pathogen response. In addition, a 581-bp putative promoter region of MpAsr was isolated via genome walking and cis-elements involved in abiotic stress and pathogen-related responses were detected in this same region. Furthermore, the MpAsr promoter demonstrated positive activity and inducibility in tobacco under F. oxysporum f. sp. cubense infection and ABA, cold, dehydration and high salt concentration treatments. Interestingly, transgenic Arabidopsis plants overexpressing MpAsr exhibited higher drought tolerance, but showed no significant decreased sensitivity to F. oxysporum f. sp. cubense. These results suggest that MpAsr might be involved in plant responses to both abiotic stress and pathogen attack.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

NASA Astrophysics Data System (ADS)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

PubMed Central

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-01-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato. PMID:27929131

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Subtractive transcriptome analysis of leaf and rhizome reveals differentially expressed transcripts in Panax sokpayensis.

PubMed

Gurung, Bhusan; Bhardwaj, Pardeep K; Talukdar, Narayan C

2016-11-01

In the present study, suppression subtractive hybridization (SSH) strategy was used to identify rare and differentially expressed transcripts in leaf and rhizome tissues of Panax sokpayensis. Out of 1102 randomly picked clones, 513 and 374 high quality expressed sequenced tags (ESTs) were generated from leaf and rhizome subtractive libraries, respectively. Out of them, 64.92 % ESTs from leaf and 69.26 % ESTs from rhizome SSH libraries were assembled into different functional categories, while others were of unknown function. In particular, ESTs encoding galactinol synthase 2, ribosomal RNA processing Brix domain protein, and cell division cycle protein 20.1, which are involved in plant growth and development, were most abundant in the leaf SSH library. Other ESTs encoding protein KIAA0664 homologue, ubiquitin-activating enzyme e11, and major latex protein, which are involved in plant immunity and defense response, were most abundant in the rhizome SSH library. Subtractive ESTs also showed similarity with genes involved in ginsenoside biosynthetic pathway, namely farnesyl pyrophosphate synthase, squalene synthase, and dammarenediol synthase. Expression profiles of selected ESTs validated the quality of libraries and confirmed their differential expression in the leaf, stem, and rhizome tissues. In silico comparative analyses revealed that around 13.75 % of unigenes from the leaf SSH library were not represented in the available leaf transcriptome of Panax ginseng. Similarly, around 18.12, 23.75, 25, and 6.25 % of unigenes from the rhizome SSH library were not represented in available root/rhizome transcriptomes of P. ginseng, Panax notoginseng, Panax quinquefolius, and Panax vietnamensis, respectively, indicating a major fraction of novel ESTs. Therefore, these subtractive transcriptomes provide valuable resources for gene discovery in P. sokpayensis and would complement the available transcriptomes from other Panax species.

The effect of column purification on cDNA indirect labelling for microarrays

PubMed Central

Molas, M Lia; Kiss, John Z

2007-01-01

Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

The effect of column purification on cDNA indirect labelling for microarrays.

PubMed

Molas, M Lia; Kiss, John Z

2007-06-27

The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

PubMed

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

Exogenous application of methyl jasmonate induces a defense response and resistance against Sclerotinia sclerotiorum in dry bean plants.

PubMed

Oliveira, Marília Barros; Junior, Murillo Lobo; Grossi-de-Sá, Maria Fátima; Petrofeza, Silvana

2015-06-15

Sclerotinia sclerotiorum (Lib.) de Bary is a necrotrophic fungal pathogen that causes a disease known as white mold, which is a major problem for dry bean (Phaseolus vulgaris L.) and other crops in many growing areas in Brazil. To investigate the role of methyl jasmonate (MeJA) in defending dry bean plants against S. sclerotiorum, we used suppression subtractive hybridization (SSH) of cDNA and identified genes that are differentially expressed during plant-pathogen interactions after treatment. Exogenous MeJA application enhanced resistance to the pathogen, and SSH analyses led to the identification of 94 unigenes, presumably involved in a variety of functions, which were classified into several functional categories, including metabolism, signal transduction, protein biogenesis and degradation, and cell defense and rescue. Using RT-qPCR, some unigenes were found to be differentially expressed in a time-dependent manner in dry bean plants during the interaction with S. sclerotiorum after MeJA treatment, including the pathogenesis-related protein PR3 (chitinase), PvCallose (callose synthase), PvNBS-LRR (NBS-LRR resistance-like protein), PvF-box (F-box family protein-like), and a polygalacturonase inhibitor protein (PGIP). Based on these expression data, the putative roles of differentially expressed genes were discussed in relation to the disease and MeJA resistance induction. Changes in the activity of the pathogenesis-related proteins β-1,3-glucanase, chitinase, phenylalanine ammonia-lyase, and peroxidase in plants after MeJA treatment and following inoculation of the pathogen were also investigated as molecular markers of induced resistance. Foliar application of MeJA induced partial resistance against S. sclerotiorum in plants as well as a consistent increase in pathogenesis-related protein activities. Our findings provide new insights into the physiological and molecular mechanisms of resistance induced by MeJA in the P. vulgaris-S. sclerotiorum pathosystem. Copyright © 2015 Elsevier GmbH. All rights reserved.

Identification of up-regulated genes from the metal-hyperaccumulator aquatic fern Salvinia minima Baker, in response to lead exposure.

PubMed

Leal-Alvarado, Daniel A; Martínez-Hernández, A; Calderón-Vázquez, C L; Uh-Ramos, D; Fuentes, G; Ramírez-Prado, J H; Sáenz-Carbonell, L; Santamaría, J M

2017-12-01

Lead (Pb) is one of the most serious environmental pollutants. The aquatic fern Salvinia minima Baker is capable to hyper-accumulate Pb in their tissues. However, the molecular mechanisms involved in its Pb accumulation and tolerance capacity are not fully understood. In order to investigate the molecular mechanisms that are activated by S. minima in response to Pb, we constructed a suppression subtractive hybridization library (SSH) in response to an exposure to 40μM of Pb(NO 3 ) 2 for 12h. 365 lead-related differentially expressed sequences tags (ESTs) were isolated and sequenced. Among these ESTs, 143 unique cDNA (97 were registered at the GenBank and 46 ESTs were not registered, because they did not meet the GenBank conditions). Those ESTs were identified and classified into 3 groups according to Blast2GO. In terms of metabolic pathways, they were grouped into 29 KEGG pathways. Among the ESTs, we identified some that might be part of the mechanism that this fern may have to deal with this metal, including abiotic-stress-related transcription factors, some that might be involved in tolerance mechanisms such as ROS scavenging, membrane protection, and those of cell homeostasis recovery. To validate the SSH library, 4 genes were randomly selected from the library and analyzed by qRT-PCR. These 4 genes were transcriptionally up-regulated in response to lead in at least one of the two tested tissues (roots and leaves). The present library is one of the few genomics approaches to study the response to metal stress in an aquatic fern, representing novel molecular information and tools to understand the molecular physiology of its Pb tolerance and hyperaccumulation capacity. Further research is required to elucidate the functions of the lead-induced genes that remain classified as unknown, to perhaps reveal novel molecular mechanisms of Pb tolerance and accumulation capacity in aquatic plants. Copyright © 2017 Elsevier B.V. All rights reserved.

Suppression subtractive hybridization as a tool to identify anthocyanin metabolism-related genes in apple skin.

PubMed

Ban, Yusuke; Moriguchi, Takaya

2010-01-01

The pigmentation of anthocyanins is one of the important determinants for consumer preference and marketability in horticultural crops such as fruits and flowers. To elucidate the mechanisms underlying the physiological process leading to the pigmentation of anthocyanins, identification of the genes differentially expressed in response to anthocyanin accumulation is a useful strategy. Currently, microarrays have been widely used to isolate differentially expressed genes. However, the use of microarrays is limited by its high cost of special apparatus and materials. Therefore, availability of microarrays is limited and does not come into common use at present. Suppression subtractive hybridization (SSH) is an alternative tool that has been widely used to identify differentially expressed genes due to its easy handling and relatively low cost. This chapter describes the procedures for SSH, including RNA extraction from polysaccharides and polyphenol-rich samples, poly(A)+ RNA purification, evaluation of subtraction efficiency, and differential screening using reverse northern in apple skin.

Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra

PubMed Central

Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

2016-01-01

The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis. PMID:27043211

Frequency content of sea surface height variability from internal gravity waves to mesoscale eddies

NASA Astrophysics Data System (ADS)

Savage, Anna C.; Arbic, Brian K.; Richman, James G.; Shriver, Jay F.; Alford, Matthew H.; Buijsman, Maarten C.; Thomas Farrar, J.; Sharma, Hari; Voet, Gunnar; Wallcraft, Alan J.; Zamudio, Luis

2017-03-01

High horizontal-resolution (1/12.5° and 1/25°) 41-layer global simulations of the HYbrid Coordinate Ocean Model (HYCOM), forced by both atmospheric fields and the astronomical tidal potential, are used to construct global maps of sea surface height (SSH) variability. The HYCOM output is separated into steric and nonsteric and into subtidal, diurnal, semidiurnal, and supertidal frequency bands. The model SSH output is compared to two data sets that offer some geographical coverage and that also cover a wide range of frequencies—a set of 351 tide gauges that measure full SSH and a set of 14 in situ vertical profilers from which steric SSH can be calculated. Three of the global maps are of interest in planning for the upcoming Surface Water and Ocean Topography (SWOT) two-dimensional swath altimeter mission: (1) maps of the total and (2) nonstationary internal tidal signal (the latter calculated after removing the stationary internal tidal signal via harmonic analysis), with an average variance of 1.05 and 0.43 cm2, respectively, for the semidiurnal band, and (3) a map of the steric supertidal contributions, which are dominated by the internal gravity wave continuum, with an average variance of 0.15 cm2. Stationary internal tides (which are predictable), nonstationary internal tides (which will be harder to predict), and nontidal internal gravity waves (which will be very difficult to predict) may all be important sources of high-frequency "noise" that could mask lower frequency phenomena in SSH measurements made by the SWOT mission.

Hypoxia-activated genes from early placenta are elevated in Preeclampsia, but not in Intra-Uterine Growth Retardation

PubMed Central

Vaiman, Daniel; Mondon, Françoise; Garcès-Duran, Alexandra; Mignot, Thérèse-Marie; Robert, Brigitte; Rebourcet, Régis; Jammes, Hélène; Chelbi, Sonia T; Quetin, Frédérique; Marceau, Geoffrey; Sapin, Vincent; Piumi, François; Danan, Jean-Louis; Rigourd, Virginie; Carbonne, Bruno; Ferré, Françoise

2005-01-01

Background As a first step to explore the possible relationships existing between the effects of low oxygen pressure in the first trimester placenta and placental pathologies developing from mid-gestation, two subtracted libraries totaling 2304 cDNA clones were constructed. For achieving this, two reciprocal suppressive/subtractive hybridization procedures (SSH) were applied to early (11 weeks) human placental villi after incubation either in normoxic or in hypoxic conditions. The clones from both libraries (1440 hypoxia-specific and 864 normoxia-specific) were spotted on nylon macroarrays. Complex cDNAs probes prepared from placental villi (either from early pregnancy, after hypoxic or normoxic culture conditions, or near term for controls or pathological placentas) were hybridized to the membranes. Results Three hundred and fifty nine clones presenting a hybridization signal above the background were sequenced and shown to correspond to 276 different genes. Nine of these genes are mitochondrial, while 267 are nuclear. Specific expression profiles characteristic of preeclampsia (PE) could be identified, as well as profiles specific of intra-uterine growth retardation (IUGR). Focusing on the chromosomal distribution of the fraction of genes that responded in at least one hybridization experiment, we could observe a highly significant chromosomal clustering of 54 genes into 8 chromosomal regions, four of which containing imprinted genes. Comparative mapping data indicate that these imprinted clusters are maintained in synteny in mice, and apparently in cattle and pigs, suggesting that the maintenance of such syntenies is requested for achieving a normal placental physiology in eutherian mammals. Conclusion We could demonstrate that genes induced in PE were also genes highly expressed under hypoxic conditions (P = 5.10-5), which was not the case for isolated IUGR. Highly expressed placental genes may be in syntenies conserved interspecifically, suggesting that the maintenance of such clusters is requested for achieving a normal placental physiology in eutherian mammals. PMID:16129025

Comparative analysis of differential gene expression in kidney tissues of moribund and surviving crucian carp (Carassius auratus gibelio) in response to cyprinid herpesvirus 2 infection.

PubMed

Xu, Lijuan; Podok, Patarida; Xie, Jun; Lu, Liqun

2014-08-01

Cyprinid herpesvirus 2 (CyHV-2) has recently been associated with high mortality of cultured crucian carp (Carassius auratus gibelio) in eastern China. In this study, we established a real-time PCR method to confirm viral infection of crucian carp and to quantify CyHV-2 particles obtained by sucrose gradient centrifugation from diseased fish. Virus-free crucian carp were artificially infected with CyHV-2 using an injection method, which resulted in a dose-dependent death rate. In situ hybridization analysis indicated that there was extensive viral replication and lysis in the kidneys of moribund fish, in contrast to very limited replication in surviving fish. To probe the host immune response to viral infection at the level of gene expression, we identified virus-responsive genes using suppression subtractive hybridization (SSH) in head kidney tissues, the principal immune organ of fish, from moribund and surviving crucian carps after viral challenge. From the moribund SSH library, 363 expressed sequence tags (ESTs) were clustered to 234 unigenes (including 15 singletons and 45 contigs). From the survivor SSH library, 599 ESTs was clustered to 549 unigenes (including 107 singletons and 105 contigs). We further analyzed the transcriptional levels of all immune-related genes by quantitative real-time RT-PCR, which confirmed the upregulation of 90.48 % of these genes. The significantly upregulated immune-related genes identified in this study can serve as candidate marker genes for acute CyHV-2 infection.

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

Transcriptomic analysis of Ruditapes philippinarum hemocytes reveals cytoskeleton disruption after in vitro Vibrio tapetis challenge.

PubMed

Brulle, Franck; Jeffroy, Fanny; Madec, Stéphanie; Nicolas, Jean-Louis; Paillard, Christine

2012-10-01

The Manila clam, Ruditapes philippinarum, is an economically-important, commercial shellfish; harvests are diminished in some European waters by a pathogenic bacterium, Vibrio tapetis, that causes Brown Ring disease. To identify molecular characteristics associated with susceptibility or resistance to Brown Ring disease, Suppression Subtractive Hybridization (SSH) analyzes were performed to construct cDNA libraries enriched in up- or down-regulated transcripts from clam immune cells, hemocytes, after a 3-h in vitro challenge with cultured V. tapetis. Nine hundred and ninety eight sequences from the two libraries were sequenced, and an in silico analysis identified 235 unique genes. BLAST and "Gene ontology" classification analyzes revealed that 60.4% of the Expressed Sequence Tags (ESTs) have high similarities with genes involved in various physiological functions, such as immunity, apoptosis and cytoskeleton organization; whereas, 39.6% remain unidentified. From the 235 unique genes, we selected 22 candidates based upon physiological function and redundancy in the libraries. Then, Real-Time PCR analysis identified 3 genes related to cytoskeleton organization showing significant variation in expression attributable to V. tapetis exposure. Disruption in regulation of these genes is consistent with the etiologic agent of Brown Ring disease in Manila clams. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

PubMed

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Genes differentially expressed in Theobroma cacao associated with resistance to witches' broom disease caused by Crinipellis perniciosa.

PubMed

Leal, Gildemberg Amorim; Albuquerque, Paulo S B; Figueira, Antonio

2007-05-01

SUMMARY The basidiomycete Crinipellis perniciosa is the causal agent of witches' broom disease of Theobroma cacao (cocoa). Hypertrophic growth of infected buds ('brooms') is the most dramatic symptom, but the main economic losses derive from pod infection. To identify cocoa genes differentially expressed during the early stages of infection, two cDNA libraries were constructed using the suppression subtractive hybridization (SSH) approach. Subtraction hybridization was conducted between cDNAs from infected shoot-tips of the susceptible genotype 'ICS 39' and the resistant 'CAB 214', in both directions. A total of 187 unique sequences were obtained, with 83 from the library enriched for the susceptible 'ICS 39' sequences, and 104 for the resistant 'CAB 214'. By homology search and ontology analyses, the identified sequences were mainly putatively categorized as belonging to 'signal transduction', 'response to biotic and abiotic stress', 'metabolism', 'RNA and DNA metabolism', 'protein metabolism' and 'cellular maintenance' classes. Quantitative reverse transcription amplification (RT-qPCR) of 23 transcripts identified as differentially expressed between genotypes revealed distinct kinetics of gene up-regulation at the asymptomatic stage of the disease. Expression induction in the susceptible 'ICS 39' in response to C. perniciosa was delayed and limited, while in 'CAB 214' there was a quicker and more intense reaction, with two peaks of gene induction at 48 and 120 h after inoculation, corresponding to morphological and biochemical changes previously described during colonization. Similar differences in gene induction were validated for another resistant genotype ('CAB 208') in an independent experiment. Validation of these genes corroborated similar hypothetical mechanisms of resistance described in other pathosystems.

Spectral decomposition of internal gravity wave sea surface height in global models

NASA Astrophysics Data System (ADS)

Savage, Anna C.; Arbic, Brian K.; Alford, Matthew H.; Ansong, Joseph K.; Farrar, J. Thomas; Menemenlis, Dimitris; O'Rourke, Amanda K.; Richman, James G.; Shriver, Jay F.; Voet, Gunnar; Wallcraft, Alan J.; Zamudio, Luis

2017-10-01

Two global ocean models ranging in horizontal resolution from 1/12° to 1/48° are used to study the space and time scales of sea surface height (SSH) signals associated with internal gravity waves (IGWs). Frequency-horizontal wavenumber SSH spectral densities are computed over seven regions of the world ocean from two simulations of the HYbrid Coordinate Ocean Model (HYCOM) and three simulations of the Massachusetts Institute of Technology general circulation model (MITgcm). High wavenumber, high-frequency SSH variance follows the predicted IGW linear dispersion curves. The realism of high-frequency motions (>0.87 cpd) in the models is tested through comparison of the frequency spectral density of dynamic height variance computed from the highest-resolution runs of each model (1/25° HYCOM and 1/48° MITgcm) with dynamic height variance frequency spectral density computed from nine in situ profiling instruments. These high-frequency motions are of particular interest because of their contributions to the small-scale SSH variability that will be observed on a global scale in the upcoming Surface Water and Ocean Topography (SWOT) satellite altimetry mission. The variance at supertidal frequencies can be comparable to the tidal and low-frequency variance for high wavenumbers (length scales smaller than ˜50 km), especially in the higher-resolution simulations. In the highest-resolution simulations, the high-frequency variance can be greater than the low-frequency variance at these scales.

Gene Expression Profiling in the Thiamethoxam Resistant and Susceptible B-biotype Sweetpotato Whitefly, Bemisia tabaci

PubMed Central

Xie, Wen; Yang, Xin; Wang, Shao-Ii; Wu, Qing-jun; Yang, Ni-na; Li, Ru-mei; Jiao, Xiaoguo; Pan, Hui-peng; Liu, Bai-ming; Feng, Yun-tao; Xu, Bao-yun; Zhou, Xu-guo; Zhang, You-jun

2012-01-01

Thiamethoxam has been used as a major insecticide to control the B-biotype sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Due to its excessive use, a high level of resistance to thiamethoxam has developed worldwide over the past several years. To better understand the molecular mechanisms underlying this resistance in B. tabaci, gene profiles between the thiamethoxam-resistant and thiamethoxam-susceptible strains were investigated using the suppression subtractive hybridization (SSH) library approach. A total of 72 and 52 upand down-regulated genes were obtained from the forward and reverse SSH libraries, respectively. These expressed sequence tags (ESTs) belong to several functional categories based on their gene ontology annotation. Some categories such as cell communication, response to abiotic stimulus, lipid particle, and nuclear envelope were identified only in the forward library of thiamethoxam-resistant strains. In contrast, categories such as behavior, cell proliferation, nutrient reservoir activity, sequence-specific DNA binding transcription factor activity, and signal transducer activity were identified solely in the reverse library. To study the validity of the SSH method, 16 differentially expressed genes from both forward and reverse SSH libraries were selected randomly for further analyses using quantitative realtime PCR (qRT-PCR). The qRT-PCR results were fairly consistent with the SSH results; however, only 50% of the genes showed significantly different expression profiles between the thiamethoxam-resistant and thiamethoxam-susceptible whiteflies. Among these genes, a putative NAD-dependent methanol dehydrogenase was substantially over-expressed in the thiamethoxamresistant adults compared to their susceptible counterparts. The distributed profiles show that it was highly expressed during the egg stage, and was most abundant in the abdomen of adult females. PMID:22957505

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays

PubMed Central

2011-01-01

Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Characterization and expression analysis of two cDNAs encoding Xa1 and oxysterol binding proteins in sorghum (Sorghum bicolor)

USDA-ARS?s Scientific Manuscript database

Using suppression subtractive hybridization (SSH) and subsequent microarray analysis, expression profiles of sorghum genes responsive to greenbug phloem-feeding were obtained and identified. Among the profiles, two cDNAs designated to MM73 and MM95 were identified to encode Xa1 (Xa1) and oxysterol ...

[Comparisons of different methods for virus-elimination of edible fungi].

PubMed

Zhang, Chao-hui; Liu, Ying-miao; Qi, Yuan-cheng; Gao, Yu-qian; Shen, Jin-wen; Qiu, Li-you

2010-05-01

Four dsRNA bands were extracted from Pleurotus ostreatus TD300 by the dsRNA isolation technique with sizes of 8.2 kb, 2.5 kb, 2.1 kb, and 1.1 kb, respectively. Four virus-eliminated methods, i. e. hyphal tips cut (HTC), protoplast regeneration (PR), single spore hybridization (SSH), and frozen and lyophilized (FL), were applied to prepare virus-eliminated strains, and one virus-eliminated strain was selected for each virus-elimination method. The virus-eliminated strains were named as HTC8, PR15, FL01, and SSH11, respectively. There were low concentration of 8.2 kb dsRNA remained in HTC8, as well as low concentration of 8.2 kb and 2.5 kb dsRNA remained in FL01. However, no dsRNA remained in PR15 and SSH11. The hyphal growth rate and laccase activity of the virus-eliminated strains increased, especially HTC8 and PR15, whose hyphal growth rate was higher by 22.73% and 18.18%, and laccase activities higher by 145.83% and 134.38% than that of the original strain, respectively. The conclusion is that hyphal tips cut and protoplast regeneration are suitable to prepare virus-eliminated strains of edible fungi.

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Identification of transcripts involved in meiosis and follicle formation during ovine ovary development.

PubMed

Baillet, Adrienne; Mandon-Pépin, Béatrice; Cabau, Cédric; Poumerol, Elodie; Pailhoux, Eric; Cotinot, Corinne

2008-09-23

The key steps in germ cell survival during ovarian development are the entry into meiosis of oogonies and the formation of primordial follicles, which then determine the reproductive lifespan of the ovary. In sheep, these steps occur during fetal life, between 55 and 80 days of gestation, respectively. The aim of this study was to identify differentially expressed ovarian genes during prophase I meiosis and early folliculogenesis in sheep. In order to elucidate the molecular events associated with early ovarian differentiation, we generated two ovary stage-specific subtracted cDNA libraries using SSH. Large-scale sequencing of these SSH libraries identified 6,080 ESTs representing 2,535 contigs. Clustering and assembly of these ESTs resulted in a total of 2,101 unique sequences depicted in 1,305 singleton (62.11%) and 796 contigs (37.9%) ESTs (clusters). BLASTX evaluation indicated that 99% of the ESTs were homologous to various known genes/proteins in a broad range of organisms, especially ovine, bovine and human species. The remaining 1% which exhibited any homology to known gene sequences was considered as novel. Detailed study of the expression patterns of some of these genes using RT-PCR revealed new promising candidates for ovary differentiation genes in sheep. We showed that the SSH approach was relevant to determining new mammalian genes which might be involved in oogenesis and early follicle development, and enabled the discovery of new potential oocyte and granulosa cell markers for future studies. These genes may have significant implications regarding our understanding of ovarian function in molecular terms, and for the development of innovative strategies to both promote and control fertility.

Integrated miRNA-mRNA analysis reveals regulatory pathways underlying the curly fleece trait in Chinese tan sheep.

PubMed

Liu, Yufang; Zhang, Jibin; Xu, Qiao; Kang, Xiaolong; Wang, Kejun; Wu, Keliang; Fang, Meiying

2018-05-11

Tan sheep is an indigenous Chinese breed well known for its beautiful curly fleece. One prominent breed characteristic of this sheep breed is that the degree of curliness differs markedly between lambs and adults, but the molecular mechanisms regulating the shift are still not well understood. In this study, we identified 49 differentially expressed (DE) microRNAs (miRNAs) between Tan sheep at the two stages through miRNA-seq, and combined the data with that in our earlier Suppression Subtractive Hybridization cDNA (SSH) library study to elucidate the mechanisms underlying curly fleece formation. Thirty-six potential miRNA-mRNA target pairs were identified using computational methods, including 25 DE miRNAs and 10 DE genes involved in the MAPK signaling pathway, steroid biosynthesis and metabolic pathways. With the differential expressions between lambs and adults confirmed by qRT-PCR, some miRNAs were already annotated in the genome, but some were novel miRNAs. Inhibition of KRT83 expression by miR-432 was confirmed by both gene knockdown with siRNA and overexpression, which was consistent with the miRNAs and targets prediction results. Our study represents the comprehensive analysis of mRNA and miRNA in Tan sheep and offers detailed insight into the development of curly fleece as well as the potential mechanisms controlling curly hair formation in humans.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Differentiation of respiratory syncytial virus subgroups with cDNA probes in a nucleic acid hybridization assay.

PubMed Central

Sullender, W M; Anderson, L J; Anderson, K; Wertz, G W

1990-01-01

A new approach to respiratory syncytial (RS) virus subgroup determination was developed by using a simple nucleic acid filter hybridization technique. By this method, virus-infected cells are bound and fixed in a single step, and the viral RNA in the fixed-cell preparation is characterized directly by its ability to hybridize to cDNA probes specific for either the A or B subgroups of RS virus. The subgroup-specific probes were constructed from cDNA clones that corresponded to a portion of the extracellular domain of the RS virus G protein of either a subgroup B RS virus (8/60) or a subgroup A RS virus (A2). The cDNA probes were labeled with 32P and used to analyze RS virus isolates collected over a period of three decades. Replicate templates of infected cell preparations were hybridized with either the subgroup A or B probe. The subgroup assignments of 40 viruses tested by nucleic acid hybridization were in agreement with the results of subgroup determinations based on their reactivities with monoclonal antibodies, which previously has been the only method available for determining the subgroup classification of RS virus isolates. The nucleic acid hybridization assay has the advantage of providing broad-based discrimination of the two subgroups on the basis of nucleic acid homology, irrespective of minor antigenic differences that are detected in assays in which monoclonal antibodies are used. The nucleic acid hybridization technique provides a reliable method for RS virus subgroup characterization. Images PMID:2118548

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

Microarray slide hybridization using fluorescently labeled cDNA.

PubMed

Ares, Manuel

2014-01-01

Microarray hybridization is used to determine the amount and genomic origins of RNA molecules in an experimental sample. Unlabeled probe sequences for each gene or gene region are printed in an array on the surface of a slide, and fluorescently labeled cDNA derived from the RNA target is hybridized to it. This protocol describes a blocking and hybridization protocol for microarray slides. The blocking step is particular to the chemistry of "CodeLink" slides, but it serves to remind us that almost every kind of microarray has a treatment step that occurs after printing but before hybridization. We recommend making sure of the precise treatment necessary for the particular chemistry used in the slides to be hybridized because the attachment chemistries differ significantly. Hybridization is similar to northern or Southern blots, but on a much smaller scale.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

PubMed

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Identification and computational annotation of genes differentially expressed in pulp development of Cocos nucifera L. by suppression subtractive hybridization

PubMed Central

2014-01-01

Background Coconut (Cocos nucifera L.) is one of the world’s most versatile, economically important tropical crops. Little is known about the physiological and molecular basis of coconut pulp (endosperm) development and only a few coconut genes and gene product sequences are available in public databases. This study identified genes that were differentially expressed during development of coconut pulp and functionally annotated these identified genes using bioinformatics analysis. Results Pulp from three different coconut developmental stages was collected. Four suppression subtractive hybridization (SSH) libraries were constructed (forward and reverse libraries A and B between stages 1 and 2, and C and D between stages 2 and 3), and identified sequences were computationally annotated using Blast2GO software. A total of 1272 clones were obtained for analysis from four SSH libraries with 63% showing similarity to known proteins. Pairwise comparing of stage-specific gene ontology ids from libraries B-D, A-C, B-C and A-D showed that 32 genes were continuously upregulated and seven downregulated; 28 were transiently upregulated and 23 downregulated. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis showed that 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT), phospholipase D, acetyl-CoA carboxylase carboxyltransferase beta subunit, 3-hydroxyisobutyryl-CoA hydrolase-like and pyruvate dehydrogenase E1 β subunit were associated with fatty acid biosynthesis or metabolism. Triose phosphate isomerase, cellulose synthase and glucan 1,3-β-glucosidase were related to carbohydrate metabolism, and phosphoenolpyruvate carboxylase was related to both fatty acid and carbohydrate metabolism. Of 737 unigenes, 103 encoded enzymes were involved in fatty acid and carbohydrate biosynthesis and metabolism, and a number of transcription factors and other interesting genes with stage-specific expression were confirmed by real-time PCR, with validation of the SSH results as high as 66.6%. Based on determination of coconut endosperm fatty acids content by gas chromatography–mass spectrometry, a number of candidate genes in fatty acid anabolism were selected for further study. Conclusion Functional annotation of genes differentially expressed in coconut pulp development helped determine the molecular basis of coconut endosperm development. The SSH method identified genes related to fatty acids, carbohydrate and secondary metabolites. The results will be important for understanding gene functions and regulatory networks in coconut fruit. PMID:25084812

Identification and computational annotation of genes differentially expressed in pulp development of Cocos nucifera L. by suppression subtractive hybridization.

PubMed

Liang, Yuanxue; Yuan, Yijun; Liu, Tao; Mao, Wei; Zheng, Yusheng; Li, Dongdong

2014-08-02

Coconut (Cocos nucifera L.) is one of the world's most versatile, economically important tropical crops. Little is known about the physiological and molecular basis of coconut pulp (endosperm) development and only a few coconut genes and gene product sequences are available in public databases. This study identified genes that were differentially expressed during development of coconut pulp and functionally annotated these identified genes using bioinformatics analysis. Pulp from three different coconut developmental stages was collected. Four suppression subtractive hybridization (SSH) libraries were constructed (forward and reverse libraries A and B between stages 1 and 2, and C and D between stages 2 and 3), and identified sequences were computationally annotated using Blast2GO software. A total of 1272 clones were obtained for analysis from four SSH libraries with 63% showing similarity to known proteins. Pairwise comparing of stage-specific gene ontology ids from libraries B-D, A-C, B-C and A-D showed that 32 genes were continuously upregulated and seven downregulated; 28 were transiently upregulated and 23 downregulated. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis showed that 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT), phospholipase D, acetyl-CoA carboxylase carboxyltransferase beta subunit, 3-hydroxyisobutyryl-CoA hydrolase-like and pyruvate dehydrogenase E1 β subunit were associated with fatty acid biosynthesis or metabolism. Triose phosphate isomerase, cellulose synthase and glucan 1,3-β-glucosidase were related to carbohydrate metabolism, and phosphoenolpyruvate carboxylase was related to both fatty acid and carbohydrate metabolism. Of 737 unigenes, 103 encoded enzymes were involved in fatty acid and carbohydrate biosynthesis and metabolism, and a number of transcription factors and other interesting genes with stage-specific expression were confirmed by real-time PCR, with validation of the SSH results as high as 66.6%. Based on determination of coconut endosperm fatty acids content by gas chromatography-mass spectrometry, a number of candidate genes in fatty acid anabolism were selected for further study. Functional annotation of genes differentially expressed in coconut pulp development helped determine the molecular basis of coconut endosperm development. The SSH method identified genes related to fatty acids, carbohydrate and secondary metabolites. The results will be important for understanding gene functions and regulatory networks in coconut fruit.

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

PubMed Central

van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

2002-01-01

Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

Expression responses of five cold tolerant related genes to two temperature dropping treatments in sea cucumber Apostichopus japonicus

NASA Astrophysics Data System (ADS)

Li, Chengze; Chang, Yaqing; Pang, Zhenguo; Ding, Jun; Ji, Nanjing

2015-03-01

Environmental conditions, including ambient temperature, play important roles in survival, growth development, and reproduction of the Japanese sea cucumber, Apostichopus japonicus. Low temperatures result in slowed growth and skin ulceration disease. In a previous study, we investigated the effect of low temperature on gene expression profiles in A. japonicus by suppression subtractive hybridization (SSH). Genes encoding Ferritin, Lysozyme, Hsp70, gp96, and AjToll were selected from a subtracted cDNA library of A. japonicus under acute cold stress. The transcriptional expression profiles of these genes were investigated in different tissues (coelomocyte, respiratory tree, intestine, longitudinal muscle) after exposure to acute and mild temperature dropping treatments. The results show that (1) the five cold-tolerance-related genes were found in all four tissues and the highest mRNA levels were observed in coelomocyte and respiratory tree; (2) under the temperature dropping treatments, three types of transcriptional regulation patterns were observed: primary suppression followed by up-regulation at -2°C, suppressed expression throughout the two treatments, and more rarely an initial stimulation followed by suppression; and (3) gene expression suppression was more severe under acute temperature dropping than under mild temperature dropping treatment. The five cold-tolerance-related genes that were distributed mainly in coelomocyte and respiratory tissues were generally down-regulated by low temperature stress but an inverse up-regulation event was found at the extreme temperature (-2°C).

Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

PubMed Central

Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

2004-01-01

We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, C.K.; Li, X.; Luna, J.

1994-09-15

Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

Structure and chromosomal localization of the human PD-1 gene (PDCD1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinohara, T.; Ishida, Y.; Kawaichi, M.

1994-10-01

A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

Detection of Helicobacter Pylori Genome with an Optical Biosensor Based on Hybridization of Urease Gene with a Gold Nanoparticles-Labeled Probe

NASA Astrophysics Data System (ADS)

Shahrashoob, M.; Mohsenifar, A.; Tabatabaei, M.; Rahmani-Cherati, T.; Mobaraki, M.; Mota, A.; Shojaei, T. R.

2016-05-01

A novel optics-based nanobiosensor for sensitive determination of the Helicobacter pylori genome using a gold nanoparticles (AuNPs)-labeled probe is reported. Two specific thiol-modified capture and signal probes were designed based on a single-stranded complementary DNA (cDNA) region of the urease gene. The capture probe was immobilized on AuNPs, which were previously immobilized on an APTES-activated glass, and the signal probe was conjugated to different AuNPs as well. The presence of the cDNA in the reaction mixture led to the hybridization of the AuNPs-labeled capture probe and the signal probe with the cDNA, and consequently the optical density of the reaction mixture (AuNPs) was reduced proportionally to the cDNA concentration. The limit of detection was measured at 0.5 nM.

Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

PubMed Central

McWilliams, D; Callahan, R C; Boime, I

1977-01-01

A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

Is social sciences and humanities (SSH) premedical education marginalized in the medical school admission process? A review and contextualization of the literature.

PubMed

Hall, Justin N; Woods, Nicole; Hanson, Mark D

2014-07-01

To investigate the performance outcomes of medical students with social sciences and humanities (SSH) premedical education during and beyond medical school by reviewing the literature, and to contextualize this review within today's admission milieu. From May to July 2012, the lead author searched the PubMed, MEDLINE, and PsycINFO databases, and reference lists of relevant articles, for research that compared premedical SSH education with premedical sciences education and its influence on performance during and/or after medical school. The authors extracted representative themes and relevant empirical findings. They contextualized their findings within today's admission milieu. A total of 1,548 citations were identified with 20 papers included in the review. SSH premedical education is predominately an American experience. For medical students with SSH background, equivalent academic, clinical, and research performance compared with medical students with a premedical science background is reported, yet different patterns of competencies exist. Post-medical-school equivalent or improved clinical performance is associated with an SSH background. Medical students with SSH backgrounds were more likely to select primary care or psychiatry careers. SSH major/course concentration, not SSH course counts, is important for admission decision making. The impact of today's admission milieu decreases the value of an SSH premedical education. Medical students with SSH premedical education perform on par with peers yet may possess different patterns of competencies, research, and career interests. However, SSH premedical education likely will not attain a significant role in medical school admission processes.

Right- and left-loop short shRNAs have distinct and unusual mechanisms of gene silencing

PubMed Central

Dallas, Anne; Ilves, Heini; Ge, Qing; Kumar, Pavan; Shorenstein, Joshua; Kazakov, Sergei A.; Cuellar, Trinna L.; McManus, Michael T.; Behlke, Mark A.; Johnston, Brian H.

2012-01-01

Small hairpin RNAs (shRNAs) having duplex lengths of 25–29 bp are normally processed by Dicer into short interfering RNAs (siRNAs) before incorporation into the RNA-induced silencing complex (RISC). However, shRNAs of ≤19 bp [short shRNAs (sshRNAs)] are too short for Dicer to excise their loops, raising questions about their mechanism of action. sshRNAs are designated as L-type or R-type according to whether the loop is positioned 3′ or 5′ to the guide sequence, respectively. Using nucleotide modifications that inhibit RNA cleavage, we show that R- but not L-sshRNAs require loop cleavage for optimum activity. Passenger-arm slicing was found to be important for optimal functioning of L-sshRNAs but much less important for R-sshRNAs that have a cleavable loop. R-sshRNAs could be immunoprecipitated by antibodies to Argonaute-1 (Ago1); complexes with Ago1 contained both intact and loop-cleaved sshRNAs. In contrast, L-sshRNAs were immunoprecipitated with either Ago1 or Ago2 and were predominantly sliced in the passenger arm of the hairpin. However, ‘pre-sliced’ L-sshRNAs were inactive. We conclude that active L-sshRNAs depend on slicing of the passenger arm to facilitate opening of the duplex, whereas R-sshRNAs primarily act via loop cleavage to generate a 5′-phosphate at the 5′-end of the guide strand. PMID:22810205

Detection of Rossby Waves in Multi-Parameters in Multi-Mission Satellite Observations and HYCOM Simulations in the Indian Ocean

NASA Technical Reports Server (NTRS)

Subrahmanyam, Bulusu; Heffner, David M.; Cromwell, David; Shriver, Jay F.

2009-01-01

Rossby waves are difficult to detect with in situ methods. However, as we show in this paper, they can be clearly identified in multi-parameters in multi-mission satellite observations of sea surface height (SSH), sea surface temperature (SST) and ocean color observations of chlorophyll-a (chl-a), as well as 1/12-deg global HYbrid Coordinate Ocean Model (HYCOM) simulations of SSH, SST and sea surface salinity (SSS) in the Indian Ocean. While the surface structure of Rossby waves can be elucidated from comparisons of the signal in different sea surface parameters, models are needed to gain direct information about how these waves affect the ocean at depth. The first three baroclinic modes of the Rossby waves are inferred from the Fast Fourier Transform (FFT), and two-dimensional Radon Transform (2D RT). At many latitudes the first and second baroclinic mode Rossby wave phase speeds from satellite observations and model parameters are identified.

A novel white spot syndrome virus protein WSSV164 controls prophenoloxidases, PmproPOs in shrimp melanization cascade.

PubMed

Sangsuriya, Pakkakul; Charoensapsri, Walaiporn; Sutthangkul, Jantiwan; Senapin, Saengchan; Hirono, Ikuo; Tassanakajon, Anchalee; Amparyup, Piti

2018-09-01

Melanization, mediated by the prophenoloxidase (proPO)-activating system, is an important innate immune response in invertebrates. The implication of the proPO system in antiviral response and the suppression of host proPO activation by the viral protein have previously been demonstrated in shrimp. However, the molecular mechanism of viral-host interactions in the proPO cascade remains largely unexplored. Here, we characterized the viral protein, namely, WSSV164, which was initially identified from the forward suppression subtractive hybridization (SSH) cDNA library of the PmproPO1/2 co-silenced black tiger shrimp Penaeus monodon that was challenged with white spot syndrome virus (WSSV). Using the yeast two-hybrid system, WSSV164 was found to interact with the PmproPO2 protein. The subsequent validation assay by co-immunoprecipitation revealed that WSSV164 directly bound to both PmproPO1 and PmproPO2. The gene silencing experiment was carried out to explore the role of WSSV164 in the control of the proPO pathway in shrimp, and the results showed that suppression of WSSV164 can restore PO activity in WSSV-infected shrimp hemolymph. The recombinant proteins of PmproPO1 and PmproPO2 were produced in Sf-9 cells and were shown to be successfully activated by exogenous trypsin and endogenous serine proteinases from shrimp hemocyte lysate supernatant (HLS), yielding PO activity in vitro. Moreover, the activated PO activity in shrimp HLS was dose-dependently reduced by the recombinant WSSV164 protein, suggesting that WSSV164 may interfere with the activation of the proPO system in shrimp. Taken together, these results suggest an alternative infection route of WSSV through the encoded viral protein WSSV164 that binds to the PmproPO1 and PmproPO2 proteins, interfering with the activation of the melanization cascade in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

Estimating the efficiency of fish cross-species cDNA microarray hybridization.

PubMed

Cohen, Raphael; Chalifa-Caspi, Vered; Williams, Timothy D; Auslander, Meirav; George, Stephen G; Chipman, James K; Tom, Moshe

2007-01-01

Using an available cross-species cDNA microarray is advantageous for examining multigene expression patterns in non-model organisms, saving the need for construction of species-specific arrays. The aim of the present study was to estimate relative efficiency of cross-species hybridizations across bony fishes, using bioinformatics tools. The methodology may serve also as a model for similar evaluations in other taxa. The theoretical evaluation was done by substituting comparative whole-transcriptome sequence similarity information into the thermodynamic hybridization equation. Complementary DNA sequence assemblages of nine fish species belonging to common families or suborders and distributed across the bony fish taxonomic branch were selected for transcriptome-wise comparisons. Actual cross-species hybridizations among fish of different taxonomic distances were used to validate and eventually to calibrate the theoretically computed relative efficiencies.

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Preferential Targeting of a Signal Recognition Particle-dependent Precursor to the Ssh1p Translocon in Yeast♦

PubMed Central

Spiller, Michael P.; Stirling, Colin J.

2011-01-01

Protein translocation across the endoplasmic reticulum membrane occurs via a “translocon” channel formed by the Sec61p complex. In yeast, two channels exist: the canonical Sec61p channel and a homolog called Ssh1p. Here, we used trapped translocation intermediates to demonstrate that a specific signal recognition particle-dependent substrate, Sec71p, is targeted exclusively to Ssh1p. Strikingly, we found that, in the absence of Ssh1p, precursor could be successfully redirected to canonical Sec61p, demonstrating that the normal targeting reaction must involve preferential sorting to Ssh1p. Our data therefore demonstrate that Ssh1p is the primary translocon for Sec71p and reveal a novel sorting mechanism at the level of the endoplasmic reticulum membrane enabling precursors to be directed to distinct translocons. Interestingly, the Ssh1p-dependent translocation of Sec71p was found to be dependent upon Sec63p, demonstrating a previously unappreciated functional interaction between Sec63p and the Ssh1p translocon. PMID:21454595

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

PubMed

Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

1997-01-17

Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum.

PubMed

Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo

2015-11-01

The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell.

Expression of Selected Ginkgo biloba Heat Shock Protein Genes After Cold Treatment Could Be Induced by Other Abiotic Stress

PubMed Central

Cao, Fuliang; Cheng, Hua; Cheng, Shuiyuan; Li, Linling; Xu, Feng; Yu, Wanwen; Yuan, Honghui

2012-01-01

Heat shock proteins (HSPs) play various stress-protective roles in plants. In this study, three HSP genes were isolated from a suppression subtractive hybridization (SSH) cDNA library of Ginkgo biloba leaves treated with cold stress. Based on the molecular weight, the three genes were designated GbHSP16.8, GbHSP17 and GbHSP70. The full length of the three genes were predicted to encode three polypeptide chains containing 149 amino acids (Aa), 152 Aa, and 657 Aa, and their corresponding molecular weights were predicted as follows: 16.67 kDa, 17.39 kDa, and 71.81 kDa respectively. The three genes exhibited distinctive expression patterns in different organs or development stages. GbHSP16.8 and GbHSP70 showed high expression levels in leaves and a low level in gynoecia, GbHSP17 showed a higher transcription in stamens and lower level in fruit. This result indicates that GbHSP16.8 and GbHSP70 may play important roles in Ginkgo leaf development and photosynthesis, and GbHSP17 may play a positive role in pollen maturation. All three GbHSPs were up-regulated under cold stress, whereas extreme heat stress only caused up-regulation of GbHSP70, UV-B treatment resulted in up-regulation of GbHSP16.8 and GbHSP17, wounding treatment resulted in up-regulation of GbHSP16.8 and GbHSP70, and abscisic acid (ABA) treatment caused up-regulation of GbHSP70 primarily. PMID:22754330

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

Human brain factor 1, a new member of the fork head gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, D.B.; Wiese, S.; Burfeind, P.

1994-06-01

Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

Characterization of transformation related genes in oral cancer cells.

PubMed

Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

1998-04-16

A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

Instrumented SSH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, Scott; Campbell, Scott

NERSC recently undertook a project to access and analyze Secure Shell (SSH) related data. This includes authentication data such as user names and key fingerprints, interactive session data such as keystrokes and responses, and information about noninteractive sessions such as commands executed and files transferred. Historically, this data has been inaccessible with traditional network monitoring techniques, but with a modification to the SSH daemon, this data can be passed directly to intrusion detection systems for analysis. The instrumented version of SSH is now running on all NERSC production systems. This paper describes the project, details about how SSH was instrumented,more » and the initial results of putting this in production.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Genomic comparison of the endophyte Herbaspirillum seropedicae SmR1 and the phytopathogen Herbaspirillum rubrisubalbicans M1 by suppressive subtractive hybridization and partial genome sequencing.

PubMed

Monteiro, Rose A; Balsanelli, Eduardo; Tuleski, Thalita; Faoro, Helison; Cruz, Leonardo M; Wassem, Roseli; de Baura, Valter A; Tadra-Sfeir, Michelle Z; Weiss, Vinícius; DaRocha, Wanderson D; Muller-Santos, Marcelo; Chubatsu, Leda S; Huergo, Luciano F; Pedrosa, Fábio O; de Souza, Emanuel M

2012-05-01

Herbaspirillum rubrisubalbicans M1 causes the mottled stripe disease in sugarcane cv. B-4362. Inoculation of this cultivar with Herbaspirillum seropedicae SmR1 does not produce disease symptoms. A comparison of the genomic sequences of these closely related species may permit a better understanding of contrasting phenotype such as endophytic association and pathogenic life style. To achieve this goal, we constructed suppressive subtractive hybridization (SSH) libraries to identify DNA fragments present in one species and absent in the other. In a parallel approach, partial genomic sequence from H. rubrisubalbicans M1 was directly compared in silico with the H. seropedicae SmR1 genome. The genomic differences between the two organisms revealed by SSH suggested that lipopolysaccharide and adhesins are potential molecular factors involved in the different phenotypic behavior. The cluster wss probably involved in cellulose biosynthesis was found in H. rubrisubalbicans M1. Expression of this gene cluster was increased in H. rubrisubalbicans M1 cells attached to the surface of maize root, and knockout of wssD gene led to decrease in maize root surface attachment and endophytic colonization. The production of cellulose could be responsible for the maize attachment pattern of H. rubrisubalbicans M1 that is capable of outcompeting H. seropedicae SmR1. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

An SSH library responsive to azadirachtin A constructed in Spodoptera litura Fabricius cell lines.

PubMed

Yan, Chao; Zhang, Zhi-Xiang; Xu, Han-Hong

2012-05-31

The present study revealed differentially expressed genes responsive to azadirachtin A (Aza) in Spodoptera litura cell line through suppression subtractive hybridization. In the Aza-responsive SSH library, approximately 270 sequences represent 53 different identified genes encoding proteins with various predicted functions, and the percentages of the gene clusters were 26.09% (genetic information processing), 11.41% (cell growth and death), 7.07% (metabolism), 6.52% (signal transduction/transport) and 2.72% (immunity), respectively. Eleven clones homologous to identified genes were selected to be confirmed through quantitative real time polymerase chain reaction. Among the eleven clones validated, all but one transcript of lipase showed an increase in SL cell line collected from ETA, whereas the transcripts of other genes were lower in the SL cell line collected from ETA compared with that of UETA. These genes were considered to be related to the response of SL cell line to Aza. These will provide a new clue to uncover the molecular mechanisms of Aza acting on SL cell line. Copyright © 2012 Elsevier B.V. All rights reserved.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Proposal and Implementation of SSH Client System Using Ajax

NASA Astrophysics Data System (ADS)

Kosuda, Yusuke; Sasaki, Ryoichi

Technology called Ajax gives web applications the functionality and operability of desktop applications. In this study, we propose and implement a Secure Shell (SSH) client system using Ajax, independent of the OS or Java execution environment. In this system, SSH packets are generated on a web browser by using JavaScript and a web server works as a proxy in communication with an SSH server to realize end-to-end SSH communication. We implemented a prototype program and confirmed by experiment that it runs on several web browsers and mobile phones. This system has enabled secure SSH communication from a PC at an Internet cafe or any mobile phone. By measuring the processing performance, we verified satisfactory performance for emergency use, although the speed was unsatisfactory in some cases with mobile phone. The system proposed in this study will be effective in various fields of E-Business.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Differential gene expression in whitefly Bemisia tabaci-infested tomato (Solanum lycopersicum) plants at progressing developmental stages of the insect's life cycle.

PubMed

Estrada-Hernández, María Gloria; Valenzuela-Soto, José Humberto; Ibarra-Laclette, Enrique; Délano-Frier, John Paul

2009-09-01

A suppression-subtractive-hybridization (SSH) strategy was used to identify genes whose expression was modified in response to virus-free whitefly Bemisia tabaci (Bt, biotype A) infestation in tomato (Solanum lycopersicum) plants. Thus, forward and reverse SSH gene libraries were generated at four points in the whitefly's life cycle, namely at (1) 2 days (adult feeding and oviposition: phase I); (2) 7 days (mobile crawler stage: phase II); (3) 12 days (second to third instar nymphal transition: phase III) and (4) 18 days (fourth instar nymphal stage: phase IV). The 169 genes with altered expression (up and downregulated) that were identified in the eight generated SSH libraries, together with 75 additional genes that were selected on the basis of their involvement in resistance responses against phytofagous insects and pathogens, were printed on a Nexterion(®) Slide MPX 16 to monitor their pattern of expression at the above phases. The results indicated that Bt infestation in tomato led to distinctive phase-specific expression/repression patterns of several genes associated predominantly with photosynthesis, senescence, secondary metabolism and (a)biotic stress. Most of the gene expression modifications were detected in phase III, coinciding with intense larval feeding, whereas fewer changes were detected in phases I and IV. These results complement previously reported gene expression profiles in Bt-infested tomato and Arabidopisis, and support and expand the opinion that Bt infestation leads to the downregulation of specific defense responses in addition to those controlled by jasmonic acid. Copyright © Physiologia Plantarum 2009.

Direct SSH Gateway Access to Peregrine | High Performance Computing |

Science.gov Websites

can access peregrine-ssh.nrel.gov, you must have: An active NREL HPC user account (see User Accounts ) An OTP Token (see One Time Password Tokens) Logging into peregrine-ssh.nrel.gov With your HPC account

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Sentaurus® based modeling and simulation for GFET's characteristic for ssDNA immobilization and hybridization

NASA Astrophysics Data System (ADS)

Yunfang, Jia; Cheng, Ju

2016-01-01

The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).

Impact of Assimilating Surface Velocity Observations on the Model Sea Surface Height Using the NCOM-4DVAR

DTIC Science & Technology

2016-09-26

statistical analysis is done by not only examining the SSH forecast error across the entire do- main, but also by concentrating on the areamost densely covered...over (b) entire GoM domain and (d) GLAD region only. Statistics shown for FR (thin black), SSH1 (thick black), and VEL (gray) experiment 96-h SSH...coefficient. To statistically FIG. 9. Sea surface height (m) for AVISO (a) 1 Aug, (b) 20 Aug, (c) 10 Sep, and (d) 30 Sep; for SSH1 experiment (e) 1

Minimal-length Synthetic shRNAs Formulated with Lipid Nanoparticles are Potent Inhibitors of Hepatitis C Virus IRES-linked Gene Expression in Mice

PubMed Central

Dallas, Anne; Ilves, Heini; Shorenstein, Joshua; Judge, Adam; Spitler, Ryan; Contag, Christopher; Wong, Suet Ping; Harbottle, Richard P; MacLachlan, Ian; Johnston, Brian H

2013-01-01

We previously identified short synthetic shRNAs (sshRNAs) that target a conserved hepatitis C virus (HCV) sequence within the internal ribosome entry site (IRES) of HCV and potently inhibit HCV IRES-linked gene expression. To assess in vivo liver delivery and activity, the HCV-directed sshRNA SG220 was formulated into lipid nanoparticles (LNP) and injected i.v. into mice whose livers supported stable HCV IRES-luciferase expression from a liver-specific promoter. After a single injection, RNase protection assays for the sshRNA and 3H labeling of a lipid component of the nanoparticles showed efficient liver uptake of both components and long-lasting survival of a significant fraction of the sshRNA in the liver. In vivo imaging showed a dose-dependent inhibition of luciferase expression (>90% 1 day after injection of 2.5 mg/kg sshRNA) with t1/2 for recovery of about 3 weeks. These results demonstrate the ability of moderate levels of i.v.-injected, LNP-formulated sshRNAs to be taken up by liver hepatocytes at a level sufficient to substantially suppress gene expression. Suppression is rapid and durable, suggesting that sshRNAs may have promise as therapeutic agents for liver indications. PMID:24045712

Attenuation of CCl4-Induced Oxidative Stress and Hepatonephrotoxicity by Saudi Sidr Honey in Rats.

PubMed

Al-Yahya, Mohammed; Mothana, Ramzi; Al-Said, Mansour; Al-Dosari, Mohammed; Al-Musayeib, Nawal; Al-Sohaibani, Mohammed; Parvez, Mohammad Khalid; Rafatullah, Syed

2013-01-01

The present study was undertaken to investigate the possible protective effect of Saudi Sidr honey (SSH) on carbon tetrachloride (CCl4) induced oxidative stress and liver and kidney damage in rat. Moreover, the antioxidant activity and the phenolic and flavonoidal contents were determined. The hepatorenal protective activity of the SSH was determined by assessing biochemical, hematological, and histological parameters. Serum transaminases, ALP, GGT, creatinine, bilirubin urea, uric acid, and MDA level in liver and kidney tissues were significantly elevated, and the antioxidant status of nonprotein sulfhydryls, albumin, and total protein levels in liver and kidney were declined significantly in CCl4 alone treated animals. Pretreatment with SSH and silymarin prior to the administration of CCl4 significantly prevented the increase of the serum levels of enzyme markers and reduced oxidative stress. SSH also exhibited a significant lipid-lowering effect and caused an HDL-C enhanced level in serum. The histopathological evaluation of the liver and kidney also revealed that honey protected incidence of both liver and kidney lesions. Moreover, SSH showed a strong antioxidant activity in DPPH and β -carotene-linoleic acid assays. SSH was found to contain phenolic compounds. Additionally, the SSH supplementation restored the hepatocytes viability against 2',7'-dichlorofluorescein (DCF) toxicity in ex vivo test.

Attenuation of CCl4-Induced Oxidative Stress and Hepatonephrotoxicity by Saudi Sidr Honey in Rats

PubMed Central

Al-Yahya, Mohammed; Mothana, Ramzi; Al-Said, Mansour; Al-Dosari, Mohammed; Al-Musayeib, Nawal; Al-Sohaibani, Mohammed; Parvez, Mohammad Khalid; Rafatullah, Syed

2013-01-01

The present study was undertaken to investigate the possible protective effect of Saudi Sidr honey (SSH) on carbon tetrachloride (CCl4) induced oxidative stress and liver and kidney damage in rat. Moreover, the antioxidant activity and the phenolic and flavonoidal contents were determined. The hepatorenal protective activity of the SSH was determined by assessing biochemical, hematological, and histological parameters. Serum transaminases, ALP, GGT, creatinine, bilirubin urea, uric acid, and MDA level in liver and kidney tissues were significantly elevated, and the antioxidant status of nonprotein sulfhydryls, albumin, and total protein levels in liver and kidney were declined significantly in CCl4 alone treated animals. Pretreatment with SSH and silymarin prior to the administration of CCl4 significantly prevented the increase of the serum levels of enzyme markers and reduced oxidative stress. SSH also exhibited a significant lipid-lowering effect and caused an HDL-C enhanced level in serum. The histopathological evaluation of the liver and kidney also revealed that honey protected incidence of both liver and kidney lesions. Moreover, SSH showed a strong antioxidant activity in DPPH and β-carotene-linoleic acid assays. SSH was found to contain phenolic compounds. Additionally, the SSH supplementation restored the hepatocytes viability against 2′,7′-dichlorofluorescein (DCF) toxicity in ex vivo test. PMID:23533498

Nested high resolution models for the coastal areas of the North Indian Ocean

NASA Astrophysics Data System (ADS)

Wobus, Fred; Shapiro, Georgy

2017-04-01

Oceanographic processes at coastal scales require much higher horizontal resolution from both ocean models and observations as compared to deep water oceanography. Aside from a few exceptions such as land-locked seas, the hydrodynamics of coastal shallow waters is strongly influenced by the tides, which in turn control the mixing, formation of temperature fronts and other phenomena. The numerical modelling of the coastal domains requires good knowledge of the lateral boundary conditions. The application of lateral boundary conditions to ocean models is a notoriously tricky task, but can only be avoided with global ocean models. Smaller scale regional ocean models are typically nested within global models, and even smaller-scale coastal models may be nested within regional models, creating a nesting chain. However a direct nesting of a very high resolution coastal model into a coarse resolution global model results in degrading of the accuracy of the outputs due to the large difference between the model resolutions. This is why a nesting chain has to be applied, so that every increase in resolution is kept within a reasonable minimum (typically by a factor of 3 to 5 at each step). Global models are traditionally non-tidal, so at some stage of the nesting chain the tides need to be introduced. This is typically done by calculating the tidal constituents from a dedicated tidal model (e.g. TPXO) for all boundary points of a nested model. The tidal elevation at each boundary location can then be calculated from the harmonics at every model time step and the added to the parent model non-tidal SSH. This combination of harmonics-derived tidal SSH and non-tidal parent model SSH is typically applied to the nested domain using the Flather condition, together with the baroclinic velocities from the parent model. The harmonics-derived SSH cannot be added to an SSH signal that is already tidal, so the parent model SSH has to be either detided or taken from a non-tidal model. Due to the lack of effective detiding methods and the prevailing view that harmonics-derived SSH provide a cleaner tidal signal over the SSH taken from a tidal parent model it has traditionally only been the last model in a nesting chain that is tidal. But to our knowledge these assumptions haven't been sufficiently tested and need to be re-visited. Furthermore, the lack of tides in the larger-scale regional models limits their capability and we would like to push for a nesting chain where all regional models (including the intermediate ones) are tidal. In this study we have conducted a number of numerical experiments where we have tested whether a tidal regional model can effectively force a tidal nested model without resorting to detiding techniques and the use of a dedicated tidal model such as TPXO. We have tested whether it's possible to use a tidal parent model and use the total SSH (combined geostrophic SSH and tidal component) to force the child model at the boundary. We call this strategy "tidal nesting" as opposed to TPXO tidal forcing which is used in "traditional nesting". For our experiments we have developed 2 models based on the same NEMO 3.6 codebase. The medium resolution AS20 model covers the Arabian Sea at 1/20 ̊ with 50 layers using a hybrid s-on-top-of-z vertical discretisation scheme (Shapiro et al., 2013); and the high resolution AG60 model covers the Arabian/Persian Gulf at 1/60 ̊ with 50 layers. The AS20 model is "traditionally" nested within the UK Met Office non-tidal large-scale Indian Ocean model at 1/12 ̊ resolution and tidal constituents at the boundary are taken from the TPXO7.2 Global Tidal Solution. Our "tidal nesting" experiments use different forcing frequencies at which the tidal SSH is fed from the larger-scale AS20 into the smaller-scale AG60 model. These strategies are compared with "traditional nesting" where the inner AG60 uses boundary conditions from a non-tidal AS20 parent model and tides are computed from TPXO harmonics. The results reveal an optimal tidal nesting strategy which forces tidal SSH from the parent model at 1-hourly intervals whilst non-tidal parameters are forced at 24-hourly intervals. The analysis includes comparisons with tidal gauges in the Gulf of Oman and inside the Arabian Gulf. The accuracy of tides inside the Gulf is inhibited by the narrow Straits of Hormuz, and tidal nesting doesn't achieve the same level of agreement with observation as traditional nesting. We also found that a further increase in the SSH forcing frequency to 30 minutes does not further improve the results. The forcing at intervals of 1h/24h for tidal/non-tidal parameters shows that a 2-step tidal nesting chain is viable and thus tides can be represented in more than just the last model of a nesting chain. References: Shapiro, G., Luneva, M., Pickering, J., and Storkey, D.: The effect of various vertical discretization schemes and horizontal diffusion parameterization on the performance of a 3-D ocean model: the Black Sea case study, Ocean Sci., 9, 377-390, doi:10.5194/os-9-377-2013, 2013.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proudnikov, D.; Kirillov, E.; Chumakov, K.

2000-01-01

This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

The biocontrol endophytic bacterium Pseudomonas fluorescens PICF7 induces systemic defense responses in aerial tissues upon colonization of olive roots.

PubMed

Gómez-Lama Cabanás, Carmen; Schilirò, Elisabetta; Valverde-Corredor, Antonio; Mercado-Blanco, Jesús

2014-01-01

Pseudomonas fluorescens PICF7, a native olive root endophyte and effective biocontrol agent (BCA) against Verticillium wilt of olive, is able to trigger a broad range of defense responses in root tissues of this woody plant. In order to elucidate whether strain PICF7 also induces systemic defense responses in above-ground organs, aerial tissues of olive plants grown under non-gnotobiotic conditions were collected at different time points after root bacterization with this endophytic BCA. A suppression subtractive hybridization (SSH) cDNA library, enriched in up-regulated genes, was generated. This strategy enabled the identification of 376 ESTs (99 contigs and 277 singlets), many of them related to response to different stresses. Five ESTs, involved in defense responses, were selected to carry out time-course quantitative real-time PCR (qRT-PCR) experiments aiming to: (1) validate the induction of these genes, and (2) shed light on their expression pattern along time (from 1 to 15 days). Induction of olive genes potentially coding for lipoxygenase 2, catalase, 1-aminocyclopropane-1-carboxylate oxidase, and phenylananine ammonia-lyase was thus confirmed at some time points. Computational analysis also revealed that different transcription factors were up-regulated in olive aerial tissues (i.e., JERF, bHLH, WRKY), as previously reported for roots. Results confirmed that root colonization by this endophytic bacterium does not only trigger defense responses in this organ but also mounts a wide array of systemic defense responses in distant tissues (stems, leaves). This sheds light on how olive plants respond to the "non-hostile" colonization by a bacterial endophyte and how induced defense response can contribute to the biocontrol activity of strain PICF7.

The biocontrol endophytic bacterium Pseudomonas fluorescens PICF7 induces systemic defense responses in aerial tissues upon colonization of olive roots

PubMed Central

Gómez-Lama Cabanás, Carmen; Schilirò, Elisabetta; Valverde-Corredor, Antonio; Mercado-Blanco, Jesús

2014-01-01

Pseudomonas fluorescens PICF7, a native olive root endophyte and effective biocontrol agent (BCA) against Verticillium wilt of olive, is able to trigger a broad range of defense responses in root tissues of this woody plant. In order to elucidate whether strain PICF7 also induces systemic defense responses in above-ground organs, aerial tissues of olive plants grown under non-gnotobiotic conditions were collected at different time points after root bacterization with this endophytic BCA. A suppression subtractive hybridization (SSH) cDNA library, enriched in up-regulated genes, was generated. This strategy enabled the identification of 376 ESTs (99 contigs and 277 singlets), many of them related to response to different stresses. Five ESTs, involved in defense responses, were selected to carry out time-course quantitative real-time PCR (qRT-PCR) experiments aiming to: (1) validate the induction of these genes, and (2) shed light on their expression pattern along time (from 1 to 15 days). Induction of olive genes potentially coding for lipoxygenase 2, catalase, 1-aminocyclopropane-1-carboxylate oxidase, and phenylananine ammonia-lyase was thus confirmed at some time points. Computational analysis also revealed that different transcription factors were up-regulated in olive aerial tissues (i.e., JERF, bHLH, WRKY), as previously reported for roots. Results confirmed that root colonization by this endophytic bacterium does not only trigger defense responses in this organ but also mounts a wide array of systemic defense responses in distant tissues (stems, leaves). This sheds light on how olive plants respond to the “non-hostile” colonization by a bacterial endophyte and how induced defense response can contribute to the biocontrol activity of strain PICF7. PMID:25250017

ESTs Analysis Reveals Putative Genes Involved in Symbiotic Seed Germination in Dendrobium officinale

PubMed Central

Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing

2013-01-01

Dendrobium officinale (Orchidaceae) is one of the world’s most endangered plants with great medicinal value. In nature, D . officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D . officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e-5). Based on sequence similarity with known proteins, 579 differentially expressed genes in D . officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D . officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D . officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids. PMID:23967335

ESTs analysis reveals putative genes involved in symbiotic seed germination in Dendrobium officinale.

PubMed

Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing

2013-01-01

Dendrobiumofficinale (Orchidaceae) is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e(-5)). Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Identification of an Na(+)-dependent transporter associated with saxitoxin-producing strains of the cyanobacterium Anabaena circinalis.

PubMed

Pomati, Francesco; Burns, Brendan P; Neilan, Brett A

2004-08-01

Blooms of the freshwater cyanobacterium Anabaena circinalis are recognized as an important health risk worldwide due to the production of a range of toxins such as saxitoxin (STX) and its derivatives. In this study we used HIP1 octameric-palindrome repeated-sequence PCR to compare the genomic structure of phylogenetically similar Australian isolates of A. circinalis. STX-producing and nontoxic cyanobacterial strains showed different HIP1 (highly iterated octameric palindrome 1) DNA patterns, and characteristic interrepeat amplicons for each group were identified. Suppression subtractive hybridization (SSH) was performed using HIP1 PCR-generated libraries to further identify toxic-strain-specific genes. An STX-producing strain and a nontoxic strain of A. circinalis were chosen as testers in two distinct experiments. The two categories of SSH putative tester-specific sequences were characterized by different families of encoded proteins that may be representative of the differences in metabolism between STX-producing and nontoxic A. circinalis strains. DNA-microarray hybridization and genomic screening revealed a toxic-strain-specific HIP1 fragment coding for a putative Na(+)-dependent transporter. Analysis of this gene demonstrated analogy to the mrpF gene of Bacillus subtilis, whose encoded protein is involved in Na(+)-specific pH homeostasis. The application of this gene as a molecular probe in laboratory and environmental screening for STX-producing A. circinalis strains was demonstrated. The possible role of this putative Na(+)-dependent transporter in the toxic cyanobacterial phenotype is also discussed, in light of recent physiological studies of STX-producing cyanobacteria.

Variability in Sea Surface Height: A Qualitative Measure for the Meridional Overturning in the North Atlantic

NASA Technical Reports Server (NTRS)

Hakkinen, Sirpa

1999-01-01

Sea surface height (SSH) from altimeter observations from 1992 on and from modeling results is investigated to determine the modes of variability and the linkages to the state of oceanic circulation in the North Atlantic. First the altimeter and model simulated SSH are analyzed using the empirical orthogonal function (EOF) analysis. They are found to share a similar leading mode where the center of action is along the Gulf Stream and North Atlantic Current with opposite sign anomalies in the subpolar gyre and in the slope waters along the Eastern Seaboard. The time series of the leading EOF mode from the altimeter data shows that between winters of 1995 and 1996, SSH over the Gulf Stream decreased by about 12cm which change is reproduced by the model simulation. Based on the relationship from the model simulations between the time series of the SSH EOF1 and meridional heat transport, it is suggested that associated with this SSH change in 1995-96, the overturning has slowed down from its heights in the early 90's. Furthermore, it is shown that decadal variability in the leading SSH mode originates from the thermal forcing component. This adds confidence to the qualitative relationship between the state of overturning/meridional heat transport and SSH in the limited area described by the EOF1. SSH variability in the eastern side of the North Atlantic basin, outside the western boundary current region, is determined by local and remote (Rossby waves) wind stress curl forcing.

From population connectivity to the art of striping Russian dolls: the lessons from Pocillopora corals.

PubMed

Gélin, Pauline; Fauvelot, Cécile; Bigot, Lionel; Baly, Joseph; Magalon, Hélène

2018-01-01

Here, we examined the genetic variability in the coral genus Pocillopora , in particular within the Primary Species Hypothesis PSH09, identified by Gélin, Postaire, Fauvelot and Magalon (2017) using species delimitation methods [also named Pocillopora eydouxi/meandrina complex sensu , Schmidt-Roach, Miller, Lundgren, & Andreakis (2014)] and which was found to split into three secondary species hypotheses (SSH09a, SSH09b, and SSH09c) according to assignment tests using multi-locus genotypes (13 microsatellites). From a large sampling (2,507 colonies) achieved in three marine provinces [Western Indian Ocean (WIO), Tropical Southwestern Pacific (TSP), and Southeast Polynesia (SEP)], genetic structuring analysis conducted with two clustering analyses (structure and DAPC) using 13 microsatellites revealed that SSH09a was restricted to the WIO while SSH09b and SSH09c were almost exclusively in the TSP and SEP. More surprisingly, each SSH split into two to three genetically differentiated clusters, found in sympatry at the reef scale, leading to a pattern of nested hierarchical levels (PSH > SSH > cluster), each level hiding highly differentiated genetic groups. Thus, rather than structured populations within a single species, these three SSHs, and even the eight clusters, likely represent distinct genetic lineages engaged in a speciation process or real species. The issue is now to understand which hierarchical level (SSH, cluster, or even below) corresponds to the species one. Several hypotheses are discussed on the processes leading to this pattern of mixed clusters in sympatry, evoking formation of reproductive barriers, either by allopatric speciation or habitat selection.

Free and Forced Rossby Waves in the Western South China Sea Inferred from Jason-1 Satellite Altimetry Data

PubMed Central

Wu, Xiangyu; Xie, Qiang; He, Zhigang; Wang, Dongxiao

2008-01-01

Data from a subsurface mooring deployed in the western South China Sea shows clear intra-seasonal oscillations (ISO) at the period of 40∼70 days. Analysis of remotely-sensed sea surface height (SSH) anomalies in the same area indicates that these ISO signals propagate both eastward and westward. Time-longitude diagrams of ISO signals in SSH anomalies and wind-stress curl indicate that the eastward propagating SSH anomalies is forced by wind-stress curl. This is also confirmed by lag correlation between SSH anomalies and the wind-stress-curl index (wind stress curl averaged over 109.5°E -115°E and 12°N -13.5°N). Lag correlation of SSH anomaly suggests that the westward propagating signals are free Rossby waves. PMID:27879897

Can We Infer Ocean Dynamics from Altimeter Wavenumber Spectra?

NASA Technical Reports Server (NTRS)

Richman, James; Shriver, Jay; Arbic, Brian

2012-01-01

The wavenumber spectra of sea surface height (SSH) and kinetic energy (KE) have been used to infer the dynamics of the ocean. When quasi-geostrophic dynamics (QG) or surface quasi-geostrophic (SQG) turbulence dominate and an inertial subrange exists, a steep SSH wavenumber spectrum is expected with k-5 for QG turbulence and a flatter k-11/3 for SQG turbulence. However, inspection of the spectral slopes in the mesoscale band of 70 to 250 km shows that the altimeter wavenumber slopes typically are much flatter than the QG or SQG predictions over most of the ocean. Comparison of the altimeter wavenumber spectra with the spectra estimated from the output of an eddy resolving global ocean circulation model (the Hybrid Coordinate Ocean Model, HYCOM, at 1/25 resolution), which is forced by high frequency winds and includes the astronomical forcing of the sun and the moon, suggests that the flatter slopes of the altimeter may arise from three possible sources, the presence of internal waves, the lack of an inertial subrange in the 70 to 250 km band and noise or submesoscales at small scales. When the wavenumber spectra of SSH and KE are estimated near the internal tide generating regions, the resulting spectra are much flatter than the expectations of QG or SQG theory. If the height and velocity variability are separated into low frequency (periods greater than 2 days) and high frequency (periods less than a day), then a different pattern emerges with a relatively flat wavenumber spectrum at high frequency and a steeper wavenumber spectrum at low frequency. The stationary internal tides can be removed from the altimeter spectrum, which steepens the spectral slopes in the energetic internal wave regions. Away from generating regions where the internal waves

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Response of the North Atlantic dynamic sea level and circulation to Greenland meltwater and climate change in an eddy-permitting ocean model

NASA Astrophysics Data System (ADS)

Saenko, Oleg A.; Yang, Duo; Myers, Paul G.

2017-10-01

The response of the North Atlantic dynamic sea surface height (SSH) and ocean circulation to Greenland Ice Sheet (GrIS) meltwater fluxes is investigated using a high-resolution model. The model is forced with either present-day-like or projected warmer climate conditions. In general, the impact of meltwater on the North Atlantic SSH and ocean circulation depends on the surface climate. In the two major regions of deep water formation, the Labrador Sea and the Nordic Seas, the basin-mean SSH increases with the increase of the GrIS meltwater flux. This SSH increase correlates with the decline of the Atlantic meridional overturning circulation (AMOC). However, while in the Labrador Sea the warming forcing and GrIS meltwater input lead to sea level rise, in the Nordic Seas these two forcings have an opposite influence on the convective mixing and basin-mean SSH (relative to the global mean). The warming leads to less sea-ice cover in the Nordic Seas, which favours stronger surface heat loss and deep mixing, lowering the SSH and generally increasing the transport of the East Greenland Current. In the Labrador Sea, the increased SSH and weaker deep convection are reflected in the decreased transport of the Labrador Current (LC), which closes the subpolar gyre in the west. Among the two major components of the LC transport, the thermohaline and bottom transports, the former is less sensitive to the GrIS meltwater fluxes under the warmer climate. The SSH difference across the LC, which is a component of the bottom velocity, correlates with the long-term mean AMOC rate.

Heavy-tailed distribution of the SSH Brute-force attack duration in a multi-user environment

NASA Astrophysics Data System (ADS)

Lee, Jae-Kook; Kim, Sung-Jun; Park, Chan Yeol; Hong, Taeyoung; Chae, Huiseung

2016-07-01

Quite a number of cyber-attacks to be place against supercomputers that provide highperformance computing (HPC) services to public researcher. Particularly, although the secure shell protocol (SSH) brute-force attack is one of the traditional attack methods, it is still being used. Because stealth attacks that feign regular access may occur, they are even harder to detect. In this paper, we introduce methods to detect SSH brute-force attacks by analyzing the server's unsuccessful access logs and the firewall's drop events in a multi-user environment. Then, we analyze the durations of the SSH brute-force attacks that are detected by applying these methods. The results of an analysis of about 10 thousands attack source IP addresses show that the behaviors of abnormal users using SSH brute-force attacks are based on human dynamic characteristics of a typical heavy-tailed distribution.

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

PubMed Central

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-01-01

Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

PubMed

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-04-10

Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

The Occurrence of Tidal Hybrid Kelvin-Edge Waves in the Global Ocean

NASA Astrophysics Data System (ADS)

Kaur, H.; Buijsman, M. C.; Yankovsky, A. E.; Zhang, T.; Jeon, C. H.

2017-12-01

This study presents the analysis of hybrid Kelvin-edge waves on the continental shelves in a global ocean model. Our objective is to find areas where the transition occurs from Kelvin waves to hybrid Kelvin-edge waves. The change in continental shelf width may convert a Kelvin wave into a hybrid Kelvin-edge wave. In this process the group velocity reaches a minimum and tidal energy is radiated on and/or offshore [Zhang 2016]. We extract M2 SSH (Sea Surface Height) and velocity from the Hybrid Coordinate Ocean Model (HYCOM) and calculate barotropic energy fluxes. We analyze these three areas: the Bay of Biscay, the Amazon Shelf and North West Africa. In these three regions, the continental shelf widens in the propagation direction and the alongshore flux changes its direction towards the coast. A transect is taken at different points in these areas to compute the dispersion relations of the waves on the continental shelf. In model simulations, we change the bathymetry of the Bay of Biscay to study the behavior of the hybrid Kelvin-edge waves. BibliographyZhang, T., and A. E Yankovsky. (2016), On the nature of cross-isobath energy fluxes in topographically modified barotropic semidiurnal Kelvin waves, J. Geophys. Res. Oceans, 121, 3058-3074, doi:10.1002/2015JC011617.

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

Direct Access to Peregrine for External Users | High-Performance Computing

Science.gov Websites

| NREL Direct Access to Peregrine for External Users Direct Access to Peregrine for External : ssh yourHPCuserid@peregrine-ssh.nrel.gov For more information, please read this page. About direct ssh allow access to VPNs. Our current jump-node (hpcsh.nrel.gov) does not provide direct-to-peregrine access

Expression profiling suggests a regulatory role of gallbladder in lipid homeostasis

PubMed Central

Yuan, Zuo-Biao; Han, Tian-Quan; Jiang, Zhao-Yan; Fei, Jian; Zhang, Yi; Qin, Jian; Tian, Zhi-Jie; Shang, Jun; Jiang, Zhi-Hong; Cai, Xing-Xing; Jiang, Yu; Zhang, Sheng-Dao; Jin, Gang

2005-01-01

AIM: To examine expression profile of gallbladder using microarray and to investigate the role of gallbladder in lipid homeostasis. METHODS: 33P-labelled cDNA derived from total RNA of gallbladder tissue was hybridized to a cDNA array representing 17000 cDNA clusters. Genes with intensities ≥2 and variation <0.33 between two samples were considered as positive signals with subtraction of background chosen from an area where no cDNA was spotted. The average gray level of two gallbladders was adopted to analyze its bioinformatics. Identified target genes were confirmed by touch-down polymerase chain reaction and sequencing. RESULTS: A total of 11 047 genes expressed in normal gallbladder, which was more than that predicted by another author, and the first 10 genes highly expressed (high gray level in hybridization image), e.g., ARPC5 (2225.88±90.46), LOC55972 (2220.32±446.51) and SLC20A2 (1865.21±98.02), were related to the function of smooth muscle contraction and material transport. Meanwhile, 149 lipid-related genes were expressed in the gallbladder, 89 of which were first identified (with gray level in hybridization image), e.g., FASN (11.42±2.62), APOD (92.61±8.90) and CYP21A2 (246.11±42.36), and they were involved in each step of lipid metabolism pathway. In addition, 19 of those 149 genes were gallstone candidate susceptibility genes (with gray level in hybridization image), e.g., HMGCR (10.98±0.31), NPC1 (34.88±12.12) and NR1H4 (16.8±0.65), which were previously thought to be expressed in the liver and/or intestine tissue only. CONCLUSION: Gallbladder expresses 11 047 genes and takes part in lipid homeostasis. PMID:15810076

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

Mapping the evidence of prevention and intervention studies for suicidal and self-harming behaviors in young people.

PubMed

De Silva, Stefanie; Parker, Alexandra; Purcell, Rosemary; Callahan, Patrick; Liu, Ping; Hetrick, Sarah

2013-01-01

Suicide and self-harm (SSH) in young people is a major cause of disability-adjusted life years. Effective interventions are of critical importance to reducing the mortality and morbidity associated with SSH. To investigate the extent and nature of research on interventions to prevent and treat SSH in young people using evidence mapping. A systematic search for SSH intervention studies was conducted (participant mean age between 6-25 years). The studies were restricted to high-quality evidence in the form of systematic reviews, meta-analyses, and controlled trials. Thirty-eight controlled studies and six systematic reviews met the study inclusion criteria. The majority (n = 32) involved psychological interventions. Few studies (n = 9) involved treating young people with recognized mental disorders or substance abuse (n = 1) which also addressed SSH. The map was restricted to RCTs, CCTs, systematic reviews, and meta-analyses, and thus might have neglected important information from other study designs. The effectiveness of interventions within the trials was not evaluated. The evidence base for SSH interventions in young people is not well established, which hampers best-practice efforts in this area. Promising interventions that need further research include school-based prevention programs with a skills training component, individual CBT interventions, interpersonal psychotherapy, and attachment-based family therapy. Gaps in the research exist in evaluations of interventions for SSH in young people with identifiable psychopathology, particularly substance use disorder, and research that classifies participants on the basis of their suicidal intent.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

PubMed

Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

2015-06-01

Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

PubMed

Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

2011-06-01

The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.

Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

PubMed Central

Suard, Y M; Tosi, M; Kraehenbuhl, J P

1982-01-01

Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

PubMed

Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

2016-03-15

A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

Generation of Mesoscale Eddies in the Lee of the Hawaiian Islands

DTIC Science & Technology

2011-11-08

temperature (SST) as observed by the Geostationary Operational Environmental Satellites (GOES, Figure lb, data available at http://oceanwatch.pifsc...hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and...The SSH is composed of the SSH anomaly from satellite JASON-1 by the AVISO group and the mean SSH of Niiler et al. [2003] (hereafter referred to

Patterns of internationalization and criteria for research assessment in the social sciences and humanities.

PubMed

Sivertsen, Gunnar

This article investigates the developments during the last decades in the use of languages, publication types and publication channels in the social sciences and humanities (SSH). The purpose is to develop an understanding of the processes of internationalization and to apply this understanding in a critical examination of two often used general criteria in research evaluations in the SSH. One of them is that the coverage of a publication in Scopus or Web of Science is seen in itself as an expression of research quality and of internationalization. The other is that a specific international language, English, and a specific type of publication, journal articles, are perceived as supreme in a general hierarchy of languages and publication types. Simple distinctions based on these criteria are contrary to the heterogeneous publication patterns needed in the SSH to organize their research adequately, present their results properly, reach their audiences efficiently, and thereby fulfil their missions. Research quality, internationalization, and societal relevance can be promoted in research assessment in the SSH without categorical hierarchies of publications. I will demonstrate this by using data from scholarly publishing in the SSH that go beyond the coverage in the commercial data sources in order to give a more comprehensive representation of scholarly publishing in the SSH.

Growth, optical, thermal, mechanical and dielectric studies of sodium succinate hexahydrate (β phase) single crystal: A promising third order NLO material

NASA Astrophysics Data System (ADS)

Mageshwari, P. S. Latha; Priya, R.; Krishnan, S.; Joseph, V.; Das, S. Jerome

2016-11-01

A third order nonlinear optical (NLO)single crystals of sodium succinate hexahydrate (SSH) (β phase) has been grown by a slow evaporation growth technique using aqueous solution at ambient temperature. The lattice parameters and morphology of SSH were determined by single crystal X-ray diffraction analysis. SSH crystallizes in centrosymmetric monoclinic system with space group P 21 / c and the crystalline purity was analyzed by powder X-ray diffraction analysis. The UV-vis-NIR spectrum reveals that the crystal is transparent in the entire visible region. The recorded FT-IR spectrum verified the presence of various functional groups in the material. NMR analysis of the grown crystal confirms the structural elucidation and detects the major and minor functional groups present in the title compound. ICP-OES analysis proved the presence of sodium in SSH. TG-DTA/DSCanalysis was used to investigate the thermal stability of the material. The dielectric permittivity and dielectric loss of SSH were carried out as a function of frequency for different temperatures and the results were discussed. The mechanical stability was evaluated from Vicker's microhardness test. The third order nonlinear optical properties of SSH has been investigated employing Z-scan technique with He-Ne laser operating at 632.8 nm wavelength.

Why are social sciences and humanities needed in the works of IPBES? A systematic review of the literature

PubMed Central

Rankovic, Aleksandar; Lapeyre, Renaud

2018-01-01

Despite the increased attention, which has been given to the issue of involving knowledge and experts from the social sciences and humanities (SSH) into the products and works of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES), little is known on what the expectations towards the involvement of SSH in IPBES actually are. The aim of this paper is to close this gap by identifying the range of possible SSH contributions to IPBES that are expected in the literature, and discuss the inherent challenges of and concrete ways to realize these contributions in the particular institutional setting of IPBES. We address these two points by: firstly, assessing the literature dealing with IPBES and building a typology describing the main ways in which contributions from SSH to IPBES have been conceived between 2006 and 2017. We discuss these expected contributions in light of broader debates on the role of SSH in nature conservation and analyse some of the blind spots and selectivities in the perception of how SSH could substantially contribute to the works of IPBES. Then, secondly, by looking at one particular example, economics and its use in the first thematic assessment on pollinators, pollination and food production, we will concretely illustrate how works in a given discipline could contribute in many different and unprecedented ways to the works of IPBES and help identify paths for enhancing the conservation of biodiversity. Finally, we propose a range of practical recommendations as to how to increase the contribution of SSH in the works of IPBES. PMID:29706803

Acute Effects of Static Stretching of Hamstring on Performance and Anterior Cruciate Ligament Injury Risk During Stop-Jump and Cutting Tasks in Female Athletes.

PubMed

Ruan, Mianfang; Zhang, Qiang; Wu, Xie

2017-05-01

Ruan, M, Zhang, Q, and Wu, X. Acute effects of static stretching of hamstring on performance and anterior cruciate ligament injury risk during stop-jump and cutting tasks in female athletes. J Strength Cond Res 31(5): 1241-1250, 2017-There is limited research investigating antagonist stretch. The purpose of this study was to evaluate the influence of static stretching of hamstrings (SSH) on performance and anterior cruciate ligament (ACL) injury risk during stop-jump and 180° cutting tasks. Twelve female college athletes (age 20.8 ± 0.7 years; height 1.61 ± 0.05 m; mass 54.25 ± 4.22 kg) participated in this study. Subjects performed stop-jump and 180° cutting tasks under 2 conditions: after warm-up with 4 × 30 seconds SSH or after warm-up without SSH. Three-dimensional kinematic and kinetic data as well as electromyography of biceps femoris, rectus femoris, vastus medialis, and gastrocnemius medialis were collected during testing. Static stretching of hamstrings significantly enhanced jump height by 5.1% (p = 0.009) but did not change the takeoff speed of cutting. No significant changes in peak knee adduction moment or peak anterior tibia shear force were observed with SSH regardless of the task. The peak lateral tibia shear force during cutting was significantly (p = 0.036) reduced with SSH. The co-contraction of hamstring and quadriceps during the preactivation (stop-jump: p = 0.04; cutting: p = 0.05) and downward phases (stop-jump: p = 0.04; cutting: p = 0.05) was significantly reduced after SSH regardless of the task. The results suggest that SSH enhanced the performance of stop-jump because of decreased co-contraction of hamstring and quadriceps but did not change the performance of cutting. In addition, SSH did not increase ACL injury risk during stop-jump and cutting tasks and even reduced medial-lateral knee loading during cutting.

Acute Effects of Static Stretching of Hamstring on Performance and Anterior Cruciate Ligament Injury Risk During Stop-Jump and Cutting Tasks in Female Athletes

PubMed Central

Ruan, Mianfang; Zhang, Qiang

2017-01-01

Abstract Ruan, M, Zhang, Q, and Wu, X. Acute effects of static stretching of hamstring on performance and anterior cruciate ligament injury risk during stop-jump and cutting tasks in female athletes. J Strength Cond Res 31(5): 1241–1250, 2017—There is limited research investigating antagonist stretch. The purpose of this study was to evaluate the influence of static stretching of hamstrings (SSH) on performance and anterior cruciate ligament (ACL) injury risk during stop-jump and 180° cutting tasks. Twelve female college athletes (age 20.8 ± 0.7 years; height 1.61 ± 0.05 m; mass 54.25 ± 4.22 kg) participated in this study. Subjects performed stop-jump and 180° cutting tasks under 2 conditions: after warm-up with 4 × 30 seconds SSH or after warm-up without SSH. Three-dimensional kinematic and kinetic data as well as electromyography of biceps femoris, rectus femoris, vastus medialis, and gastrocnemius medialis were collected during testing. Static stretching of hamstrings significantly enhanced jump height by 5.1% (p = 0.009) but did not change the takeoff speed of cutting. No significant changes in peak knee adduction moment or peak anterior tibia shear force were observed with SSH regardless of the task. The peak lateral tibia shear force during cutting was significantly (p = 0.036) reduced with SSH. The co-contraction of hamstring and quadriceps during the preactivation (stop-jump: p = 0.04; cutting: p = 0.05) and downward phases (stop-jump: p = 0.04; cutting: p = 0.05) was significantly reduced after SSH regardless of the task. The results suggest that SSH enhanced the performance of stop-jump because of decreased co-contraction of hamstring and quadriceps but did not change the performance of cutting. In addition, SSH did not increase ACL injury risk during stop-jump and cutting tasks and even reduced medial-lateral knee loading during cutting. PMID:28118311

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

Transport variability of the Brazil Current from observations and a data assimilation model

NASA Astrophysics Data System (ADS)

Schmid, Claudia; Majumder, Sudip

2018-06-01

The Brazil Current transports from observations and the Hybrid Coordinate Model (HYCOM) model are analyzed to improve our understanding of the current's structure and variability. A time series of the observed transport is derived from a three-dimensional field of the velocity in the South Atlantic covering the years 1993 to 2015 (hereinafter called Argo & SSH). The mean transports of the Brazil Current increases from 3.8 ± 2.2 Sv (1 Sv is 106 m3 s-1) at 25° S to 13.9 ± 2.6 Sv at 32° S, which corresponds to a mean slope of 1.4 ± 0.4 Sv per degree. Transport estimates derived from HYCOM fields are somewhat higher (5.2 ± 2.7 and 18.7 ± 7.1 Sv at 25 and 32° S, respectively) than those from Argo & SSH, but these differences are small when compared with the standard deviations. Overall, the observed latitude dependence of the transport of the Brazil Current is in agreement with the wind-driven circulation in the super gyre of the subtropical South Atlantic. A mean annual cycle with highest (lowest) transports in austral summer (winter) is found to exist at selected latitudes (24, 35, and 38° S). The significance of this signal shrinks with increasing latitude (both in Argo & SSH and HYCOM), mainly due to mesoscale and interannual variability. Both Argo & SSH, as well as HYCOM, reveal interannual variability at 24 and 35° S that results in relatively large power at periods of 2 years or more in wavelet spectra. It is found that the interannual variability at 24° S is correlated with the South Atlantic Subtropical Dipole Mode (SASD), the Southern Annular Mode (SAM), and the Niño 3.4 index. Similarly, correlations between SAM and the Brazil Current transport are also found at 35° S. Further investigation of the variability reveals that the first and second mode of a coupled empirical orthogonal function of the meridional transport and the sea level pressure explain 36 and 15 % of the covariance, respectively. Overall, the results indicate that SAM, SASD, and El Niño-Southern Oscillation have an influence on the transport of the Brazil Current.

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Two-leg Su-Schrieffer-Heeger chain with glide reflection symmetry

NASA Astrophysics Data System (ADS)

Zhang, Shao-Liang; Zhou, Qi

2017-06-01

The Su-Schrieffer-Heeger (SSH) model lays the foundation of many important concepts in quantum topological matters. Here, we show that a spin-dependent double-well optical lattice allows one to couple two topologically distinct SSH chains in the bulk and realize a glided-two-leg SSH model that respects the glide reflection symmetry. Such a model gives rise to intriguing quantum phenomena beyond the paradigm of a traditional SSH model. It is characterized by Wilson lines that require non-Abelian Berry connections, and the interplay between the glide symmetry and interaction automatically leads to charge fractionalization without jointing two lattice potentials at an interface. Our work demonstrates the versatility of ultracold atoms to create new theoretical models for studying topological matters.

Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

1991-05-01

The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

Spatial-temporal patterns and driving mechanisms of semiannual variations in the Philippine Sea

NASA Astrophysics Data System (ADS)

Zhao, Jun; Li, Yuanlong; Wang, Fan; Zhai, Fangguo; Yu, Xiaolin

2012-10-01

Satellite altimetric sea surface height (SSH) measurements from 1992 through 2010 are used to explore the oceanic semiannual variations in the Philippine Sea (PS). Pronounced semiannual SSH variations are detected within two zonal bands. One lies east of Luzon Strait (19°-22°N) in the northern PS, while the other is southeast of Mindanao coast (4°-7°N) in the southern PS. In the two near-coast boxes where semiannual harmonic amplitude exceeds 4 cm, the northern box (127°-133°E, 19°-22°N) and the southern box (127°-133°E, 4°-7°N), semiannual changes contribute considerably to the total annual SSH variance by 12% and 17%, respectively. Despite prominent SSH variability, the bifurcation latitude of the North Equatorial Current (NBL) exhibits weak fluctuations with a peak-to-peak difference of only 0.3° on semiannual time scale. While the in-phase annual SSH variations between the two boxes work together to enhance annual NBL changes, their out-of-phase semiannual SSH variations offset each other in driving the NBL displacements. Further analysis with a 11/2-layer reduced-gravity model forced by ECMWF wind stress reveals that the observed semiannual SSH variations are primarily driven by local wind forcing in the far western Pacific. Rossby wave signals propagating from the eastern/central Pacific contribute much less due to along-path dispersion and cancellation. Semiannual signals of wind field in the northern PS reflect mainly the semiannual changes of the Asian Monsoon system, while those in the southern PS arise from the combined effects of Monsoon transition and the annual migration of the intertropical convergence zone (ITCZ).

Thrombin selectively engages LIM kinase 1 and slingshot-1L phosphatase to regulate NF-κB activation and endothelial cell inflammation

PubMed Central

Leonard, Antony; Marando, Catherine; Rahman, Arshad

2013-01-01

Endothelial cell (EC) inflammation is a central event in the pathogenesis of many pulmonary diseases such as acute lung injury and its more severe form acute respiratory distress syndrome. Alterations in actin cytoskeleton are shown to be crucial for NF-κB regulation and EC inflammation. Previously, we have described a role of actin binding protein cofilin in mediating cytoskeletal alterations essential for NF-κB activation and EC inflammation. The present study describes a dynamic mechanism in which LIM kinase 1 (LIMK1), a cofilin kinase, and slingshot-1Long (SSH-1L), a cofilin phosphatase, are engaged by procoagulant and proinflammatory mediator thrombin to regulate these responses. Our data show that knockdown of LIMK1 destabilizes whereas knockdown of SSH-1L stabilizes the actin filaments through modulation of cofilin phosphorylation; however, in either case thrombin-induced NF-κB activity and expression of its target genes (ICAM-1 and VCAM-1) is inhibited. Further mechanistic analyses reveal that knockdown of LIMK1 or SSH-1L each attenuates nuclear translocation and thereby DNA binding of RelA/p65. In addition, LIMK1 or SSH-1L depletion inhibited RelA/p65 phosphorylation at Ser536, a critical event conferring transcriptional competency to the bound NF-κB. However, unlike SSH-1L, LIMK1 knockdown also impairs the release of RelA/p65 by blocking IKKβ-dependent phosphorylation/degradation of IκBα. Interestingly, LIMK1 or SSH-1L depletion failed to inhibit TNF-α-induced RelA/p65 nuclear translocation and proinflammatory gene expression. Thus this study provides evidence for a novel role of LIMK1 and SSH-1L in selectively regulating EC inflammation associated with intravascular coagulation. PMID:24039253

Thrombin selectively engages LIM kinase 1 and slingshot-1L phosphatase to regulate NF-κB activation and endothelial cell inflammation.

PubMed

Leonard, Antony; Marando, Catherine; Rahman, Arshad; Fazal, Fabeha

2013-11-01

Endothelial cell (EC) inflammation is a central event in the pathogenesis of many pulmonary diseases such as acute lung injury and its more severe form acute respiratory distress syndrome. Alterations in actin cytoskeleton are shown to be crucial for NF-κB regulation and EC inflammation. Previously, we have described a role of actin binding protein cofilin in mediating cytoskeletal alterations essential for NF-κB activation and EC inflammation. The present study describes a dynamic mechanism in which LIM kinase 1 (LIMK1), a cofilin kinase, and slingshot-1Long (SSH-1L), a cofilin phosphatase, are engaged by procoagulant and proinflammatory mediator thrombin to regulate these responses. Our data show that knockdown of LIMK1 destabilizes whereas knockdown of SSH-1L stabilizes the actin filaments through modulation of cofilin phosphorylation; however, in either case thrombin-induced NF-κB activity and expression of its target genes (ICAM-1 and VCAM-1) is inhibited. Further mechanistic analyses reveal that knockdown of LIMK1 or SSH-1L each attenuates nuclear translocation and thereby DNA binding of RelA/p65. In addition, LIMK1 or SSH-1L depletion inhibited RelA/p65 phosphorylation at Ser(536), a critical event conferring transcriptional competency to the bound NF-κB. However, unlike SSH-1L, LIMK1 knockdown also impairs the release of RelA/p65 by blocking IKKβ-dependent phosphorylation/degradation of IκBα. Interestingly, LIMK1 or SSH-1L depletion failed to inhibit TNF-α-induced RelA/p65 nuclear translocation and proinflammatory gene expression. Thus this study provides evidence for a novel role of LIMK1 and SSH-1L in selectively regulating EC inflammation associated with intravascular coagulation.

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Amplification of chromosomal DNA in situ

DOEpatents

Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.

2002-01-01

Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

NASA Technical Reports Server (NTRS)

Biermann, B.; Johnson, E. M.; Feldman, L. J.

1990-01-01

Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

Lessons Learned from Assimilating Altimeter Data into a Coupled General Circulation Model with the GMAO Augmented Ensemble Kalman Filter

NASA Technical Reports Server (NTRS)

Keppenne, Christian; Vernieres, Guillaume; Rienecker, Michele; Jacob, Jossy; Kovach, Robin

2011-01-01

Satellite altimetry measurements have provided global, evenly distributed observations of the ocean surface since 1993. However, the difficulties introduced by the presence of model biases and the requirement that data assimilation systems extrapolate the sea surface height (SSH) information to the subsurface in order to estimate the temperature, salinity and currents make it difficult to optimally exploit these measurements. This talk investigates the potential of the altimetry data assimilation once the biases are accounted for with an ad hoc bias estimation scheme. Either steady-state or state-dependent multivariate background-error covariances from an ensemble of model integrations are used to address the problem of extrapolating the information to the sub-surface. The GMAO ocean data assimilation system applied to an ensemble of coupled model instances using the GEOS-5 AGCM coupled to MOM4 is used in the investigation. To model the background error covariances, the system relies on a hybrid ensemble approach in which a small number of dynamically evolved model trajectories is augmented on the one hand with past instances of the state vector along each trajectory and, on the other, with a steady state ensemble of error estimates from a time series of short-term model forecasts. A state-dependent adaptive error-covariance localization and inflation algorithm controls how the SSH information is extrapolated to the sub-surface. A two-step predictor corrector approach is used to assimilate future information. Independent (not-assimilated) temperature and salinity observations from Argo floats are used to validate the assimilation. A two-step projection method in which the system first calculates a SSH increment and then projects this increment vertically onto the temperature, salt and current fields is found to be most effective in reconstructing the sub-surface information. The performance of the system in reconstructing the sub-surface fields is particularly impressive for temperature, but not as satisfactory for salt.

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

1995-04-10

The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

Potential of space-borne GNSS reflectometry to constrain simulations of the ocean circulation. A case study for the South African current system

NASA Astrophysics Data System (ADS)

Saynisch, Jan; Semmling, Maximilian; Wickert, Jens; Thomas, Maik

2015-11-01

The Agulhas current system transports warm and salty water masses from the Indian Ocean into the Southern Ocean and into the Atlantic. The transports impact past, present, and future climate on local and global scales. The size and variability, however, of the respective transports are still much debated. In this study, an idealized model based twin experiment is used to study whether sea surface height (SSH) anomalies estimated from reflected signals of the Global Navigation Satellite System reflectometry (GNSS-R) can be used to determine the internal water mass properties and transports of the Agulhas region. A space-borne GNSS-R detector on the International Space Station (ISS) is assumed and simulated. The detector is able to observe daily SSH fields with a spatial resolution of 1-5∘. Depending on reflection geometry, the precision of a single SSH observation is estimated to reach 3 cm (20 cm) when the carrier phase (code delay) information of the reflected GNSS signal is used. The average precision over the Agulhas region is 7 cm (42 cm). The proposed GNSS-R measurements surpass the radar-based satellite altimetry missions in temporal and spatial resolution but are less precise. Using the estimated GNSS-R characteristics, measurements of SSH are generated by sampling a regional nested general circulation model of the South African oceans. The artificial observations are subsequently assimilated with a 4DVAR adjoint data assimilation method into the same ocean model but with a different initial state and forcing. The assimilated and the original, i.e., the sampled model state, are compared to systematically identify improvements and degradations in the model variables that arise due to the assimilation of GNSS-R based SSH observations. We show that SSH and the independent, i.e., not assimilated model variables velocity, temperature, and salinity improve by the assimilation of GNSS-R based SSH observations. After the assimilation of 90 days of SSH observations, improvements in the independent variables cover the whole water column. Locally, up to 39 % of the original model state are recovered. Shorter assimilation windows result in enhanced reproduction of the observed and assimilated SSH but are accompanied by an insufficient or wrong recovery of sub-surface water properties. The assimilation of real GNSS-R observations, when available, and consequently the estimation of Agulhas water mass properties and the leakage of heat and salt into the Atlantic will benefit from this model-based study.

Overexpression of EAR1 and SSH4 that encode PPxY proteins in the multivesicular body provides stability to tryptophan permease Tat2, allowing yeast cells to grow under high hydrostatic pressure

NASA Astrophysics Data System (ADS)

Hiraki, Toshiki; Usui, Keiko; Abe, Fumiyoshi

2010-12-01

Tryptophan uptake in yeast Saccharomyces cerevisiae is susceptible to high hydrostatic pressure and it limits the growth of tryptophan auxotrophic (Trp-) strains under pressures of 15-25 MPa. The susceptibility of tryptophan uptake is accounted for by the pressure-induced degradation of tryptophan permease Tat2 occurring in a Rsp5 ubiquitin ligase-dependent manner. Ear1 and Ssh4 are multivesicular body proteins that physically interact with Rsp5. We found that overexpression of either of the EAR1 or SSH4 genes enabled the Trp- cells to grow at 15-25 MPa. EAR1 and SSH4 appeared to provide stability to the Tat2 protein when overexpressed. The result suggests that Ear1 and Ssh4 negatively regulate Rsp5 on ubiquitination of Tat2. Currently, high hydrostatic pressure is widely used in bioscience and biotechnology for structurally perturbing macromolecules such as proteins and lipids or in food processing and sterilizing microbes. We suggest that hydrostatic pressure is an operative experimental parameter to screen yeast genes specifically for regulation of Tat2 through the function of Rsp5 ubiquitin ligase.

Research ethics in the dynamic of scientific field: challenges in the building of guidelines for social sciences and humanities.

PubMed

Guerriero, Iara Coelho Zito; Bosi, Maria Lúcia Magalhães

2015-09-01

The development of guidelines on research ethics for social science and humanities (SSH) takes place in the scientific field, marked by disputes aimed at the establishment of hegemonic scientific standard. In Brazil, the National Health Council is responsible for approving these guidelines, which involve certain specificities. Based on the authors' experience in the SSH Working Group of the National Commission on Research Ethics (GT CHS / CONEP), this article presents the process of development of guidelines for SSH, and some its challenges: the distance between the statutory guarantee and the effective execution of guidelines; the biomedical hegemony and the marginal position of the SSH in the CEP / CONEP system; the inadequacy of the current resolution facing the research features in CHS; the use of the concept of risk in guidelines aimed at SSH in the health area. Some interfaces and tensions in the debate between scientific merit and ethical evaluation are also discussed. The analysis highlights important impasses and difficulties regarding inter-paradigmatic dialogue in health research, considered the characteristics of the different traditions, the CONEP's heavily relying on the positivist perspective and the defense of that paradigm hegemony.

Redox Signaling Regulated by Cysteine Persulfide and Protein Polysulfidation.

PubMed

Kasamatsu, Shingo; Nishimura, Akira; Morita, Masanobu; Matsunaga, Tetsuro; Abdul Hamid, Hisyam; Akaike, Takaaki

2016-12-15

For decades, reactive persulfide species including cysteine persulfide (CysSSH) have been known to exist endogenously in organisms. However, the physiological significance of endogenous persulfides remains poorly understood. That cystathionine β-synthase and cystathionine γ-lyase produced CysSSH from cystine was recently demonstrated. An endogenous sulfur transfer system involving CysSSH evidently generates glutathione persulfide (GSSH) that exists at concentrations greater than 100 μM in vivo. Because reactive persulfide species such as CysSSH and GSSH have higher nucleophilicity than parental cysteine (Cys) and glutathione do, these reactive species exhibit strong scavenging activities against oxidants, e.g., hydrogen peroxide, and electrophiles, which contributes to redox signaling regulation. Also, several papers indicated that various proteins and enzymes have Cys polysulfides including CysSSH at their specific Cys residues, which is called protein polysulfidation. Apart from the redox signaling regulatory mechanism, another plausible function of protein polysulfidation is providing protection for protein thiol residues against irreversible chemical modification caused by oxidants and electrophiles. Elucidation of the redox signaling regulatory mechanism of reactive persulfide species including small thiol molecules and thiol-containing proteins should lead to the development of new therapeutic strategies and drug discoveries for oxidative and electrophilic stress-related diseases.

Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

PubMed

Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

2008-03-01

By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

Molecular genetic analysis of the V kappa Ser group associated with two mouse light chain genetic markers. Complementary DNA cloning and southern hybridization analysis

PubMed Central

1985-01-01

Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938

Relationship between the Bering Strait Throughflow and Salinity in the Bering Sea in an Atmosphere-Ocean-Ice Coupled Model

NASA Astrophysics Data System (ADS)

Kawai, Y.; Osafune, S.; Masuda, S.; Komuro, Y.

2016-12-01

The relationship between the volumetric transport of the Bering Strait throughflow (BTF) and sea surface salinity (SSS) in the Bering Sea was investigated using an atmosphere-ocean-ice coupled model, MIROC4h, which includes an eddy-permitting ocean model. The MIROC4h simulated well the seasonal cycle of BTF transport, although it overestimated the transport compared with previous studies. The interannual variations of SSS in the Bering Sea were correlated with those of BTF transport: SSS in the northwestern Bering Sea was high when BTF transport was large. The SSS anomaly associated with the BTF anomaly became evident from late autumn to spring, and SSS lagged behind the BTF by a few months. The BTF transport was strongly correlated with the SSH in the eastern Bering Sea, the southwestern Chukchi Sea, and the East Siberian Sea. The low SSH along the Russian coast in the Arctic Ocean was uncorrelated with the high SSH in the Bering Sea. The Arctic SSH affected BTF transport and the SSS in the northwestern Bering Sea independently of the SSH in the Bering Sea. We evaluated the salt budget in the northwestern Bering Sea, including Anadyr Bay. When the BTF transport in October-March was large, the horizontal convergence of salt increased and sea-ice melting decreased; both changes contributed to the increase of salinity. In contrast, evaporation-minus-precipitation and the residual component had the opposite effect. The sea-ice retreat was closely related to meridional wind anomalies that also raised the SSH in the eastern Bering Sea. Changes in upper-layer currents caused by the southerly wind anomalies in the Bering Sea contributed to the increase of the horizontal convergence of salt. In addition, the SSH anomalies in the Arctic Ocean independently affected the currents in the Bering Strait and the northwestern Bering Sea, perhaps through the propagation of shelf waves, which also led to salinization.

Screening of eye-position related genes with DD-RT-PCR and RDA in the hybrids between Japanese flounder Paralichthys olivaceus and stone flounder Kareius bicoloratus

NASA Astrophysics Data System (ADS)

Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Sun, Yeying; Zhong, Qiwang; Wang, Xubo; Wang, Zhigang; Li, Shuo; Li, Chunmei

2009-02-01

Flatfish or flounder moves one eye to change body proportion into vertebral asymmetry during metamorphosis, during which some become sinistral while others dextral. However, the mechanism behinds the eye-position has not been well understood. In this research, hybrids between Japanese flounder(♀) and stone flounder (♂) show mixed eye-location in both dextral type and sinistral type, and thus become good samples for studying the eye-migration. mRNAs from pro-metamorphosis sinistral and dextral hybrids larvae were screened with classical differential display RT-PCR (DD-RT-PCR) and representational difference analysis of cDNA (cDNA-RDA); 30 and 47 putative fragments were isolated, respectively. The cDNA fragments of creatine kinase and trypsinogen 2 precursor genes isolated by cDNA-RDA exhibited eye-position expression patterns during metamorphosis. However, none of the fragments was proved to be related to flatfishes’ eye-position specifically. Therefore, further studies and more sensitive gene isolated methods are needed to solve the problems.

Simplified Microarray Technique for Identifying mRNA in Rare Samples

NASA Technical Reports Server (NTRS)

Almeida, Eduardo; Kadambi, Geeta

2007-01-01

Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.

Protein-phosphotyrosine proteome profiling by superbinder-SH2 domain affinity purification mass spectrometry, sSH2-AP-MS.

PubMed

Tong, Jiefei; Cao, Biyin; Martyn, Gregory D; Krieger, Jonathan R; Taylor, Paul; Yates, Bradley; Sidhu, Sachdev S; Li, Shawn S C; Mao, Xinliang; Moran, Michael F

2017-03-01

Recently, "superbinder" SH2 domain variants with three amino acid substitutions (sSH2) were reported to have 100-fold or greater affinity for protein-phosphotyrosine (pY) than natural SH2 domains. Here we report a protocol in which His-tagged Src sSH2 efficiently captures pY-peptides from protease-digested HeLa cell total protein extracts. Affinity purification of pY-peptides by this method shows little bias for pY-proximal amino acid sequences, comparable to that achieved by using antibodies to pY, but with equal or higher yield. Superbinder-SH2 affinity purification mass spectrometry (sSH2-AP-MS) therefore provides an efficient and economical approach for unbiased pY-directed phospho-proteome profiling without the use of antibodies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Increased actin polymerization and stabilization interferes with neuronal function and survival in the AMPKγ mutant Loechrig.

PubMed

Cook, Mandy; Bolkan, Bonnie J; Kretzschmar, Doris

2014-01-01

loechrig (loe) mutant flies are characterized by progressive neuronal degeneration, behavioral deficits, and early death. The mutation is due to a P-element insertion in the gene for the γ-subunit of the trimeric AMP-activated protein kinase (AMPK) complex, whereby the insertion affects only one of several alternative transcripts encoding a unique neuronal isoform. AMPK is a cellular energy sensor that regulates a plethora of signaling pathways, including cholesterol and isoprenoid synthesis via its downstream target hydroxy-methylglutaryl (HMG)-CoA reductase. We recently showed that loe interferes with isoprenoid synthesis and increases the prenylation and thereby activation of RhoA. During development, RhoA plays an important role in neuronal outgrowth by activating a signaling cascade that regulates actin dynamics. Here we show that the effect of loe/AMPKγ on RhoA prenylation leads to a hyperactivation of this signaling pathway, causing increased phosphorylation of the actin depolymerizating factor cofilin and accumulation of filamentous actin. Furthermore, our results show that the resulting cytoskeletal changes in loe interfere with neuronal growth and disrupt axonal integrity. Surprisingly, these phenotypes were enhanced by expressing the Slingshot (SSH) phosphatase, which during development promotes actin depolymerization by dephosphorylating cofilin. However, our studies suggest that in the adult SSH promotes actin polymerization, supporting in vitro studies using human SSH1 that suggested that SSH can also stabilize and bundle filamentous actin. Together with the observed increase in SSH levels in the loe mutant, our experiments suggest that in mature neurons SSH may function as a stabilization factor for filamentous actin instead of promoting actin depolymerization.

Dynamic Topography and Sea Level Anomalies of the Southern Ocean: Variability and Teleconnections

NASA Astrophysics Data System (ADS)

Armitage, Thomas W. K.; Kwok, Ron; Thompson, Andrew F.; Cunningham, Glenn

2018-01-01

This study combines sea surface height (SSH) estimates of the ice-covered Southern Ocean with conventional open-ocean SSH estimates from CryoSat-2 to produce monthly composites of dynamic ocean topography (DOT) and sea level anomaly (SLA) on a 50 km grid spanning 2011-2016. This data set reveals the full Southern Ocean SSH seasonal cycle for the first time; there is an antiphase relationship between sea level on the Antarctic continental shelf and the deeper basins, with coastal SSH highest in autumn and lowest in spring. As a result of this pattern of seasonal SSH variability, the barotropic component of the Antarctic Slope Current (ASC) has speeds that are regionally up to twice as fast in the autumn. Month-to-month circulation variability of the Ross and Weddell Gyres is strongly influenced by the local wind field, and is correlated with the local wind curl (Ross: -0.58; Weddell: -0.67). SSH variability is linked to both the Southern Oscillation and the Southern Annular Mode, dominant modes of southern hemisphere climate variability. In particular, during the strong 2015-2016 El Niño, a sustained negative coastal SLA of up to -6 cm, implying a weakening of the ASC, was observed in the Pacific sector of the Southern Ocean. The ability to examine sea level variability in the seasonally ice-covered regions of the Southern Ocean—climatically important regions with an acute sparsity of data—makes this new merged sea level record of particular interest to the Southern Ocean oceanography and glaciology communities.

Identification of gene fragments related to nitrogen deficiency in Eichhornia crassipes (Pontederiaceae).

PubMed

Fu, Minghui; Jiang, Lihua; Li, Yuanmei; Yan, Guohua; Zheng, Lijun; Jinping, Peng

2014-12-01

Eichhornia crassipes is an aquatic plant native to the Amazon River Basin. It has become a serious weed in freshwater habitats in rivers, lakes and reservoirs both in tropical and warm temperate areas worldwide. Some research has stated that it can be used for water phytoremediation, due to its strong assimilation of nitrogen and phosphorus, and the accumulation of heavy metals, and its growth and spread may play an important role in environmental ecology. In order to explore the molecular mechanism of E. crassipes to responses to nitrogen deficiency, we constructed forward and reversed subtracted cDNA libraries for E. crassipes roots under nitrogen deficient condition using a suppressive subtractive hybridization (SSH) method. The forward subtraction included 2,100 clones, and the reversed included 2,650 clones. One thousand clones were randomly selected from each library for sequencing. About 737 (527 unigenes) clones from the forward library and 757 (483 unigenes) clones from the reversed library were informative. Sequence BlastX analysis showed that there were more transporters and adenosylhomocysteinase-like proteins in E. crassipes cultured in nitrogen deficient medium; while, those cultured in nitrogen replete medium had more proteins such as UBR4-like e3 ubiquitin-protein ligase and fasciclin-like arabinogalactan protein 8-like, as well as more cytoskeletal proteins, including actin and tubulin. Cluster of Orthologous Group (COG) analysis also demonstrated that in the forward library, the most ESTs were involved in coenzyme transportation and metabolism. In the reversed library, cytoskeletal ESTs were the most abundant. Gene Ontology (GO) analysis categories demonstrated that unigenes involved in binding, cellular process and electron carrier were the most differentially expressed unigenes between the forward and reversed libraries. All these results suggest that E. crassipes can respond to different nitrogen status by efficiently regulating and controlling some transporter gene expressions, certain metabolism processes, specific signal transduction pathways and cytoskeletal construction.

Members of the gibberellin receptor gene family GID1 (GIBBERELLIN INSENSITIVE DWARF1) play distinct roles during Lepidium sativum and Arabidopsis thaliana seed germination

PubMed Central

Voegele, Antje; Linkies, Ada; Müller, Kerstin; Leubner-Metzger, Gerhard

2011-01-01

Germination of endospermic seeds is partly regulated by the micropylar endosperm, which acts as constraint to radicle protrusion. Gibberellin (GA) signalling pathways control coat-dormancy release, endosperm weakening, and organ expansion during seed germination. Three GIBBERELLIN INSENSITIVE DWARF1 (GID1) GA receptors are known in Arabidopsis thaliana: GID1a, GID1b, and GID1c. Molecular phylogenetic analysis of angiosperm GID1s reveals that they cluster into two eudicot (GID1ac, GID1b) groups and one monocot group. Eudicots have at least one gene from each of the two groups, indicating that the different GID1 receptors fulfil distinct roles during plant development. A comparative Brassicaceae approach was used, in which gid1 mutant and whole-seed transcript analyses in Arabidopsis were combined with seed-tissue-specific analyses of its close relative Lepidium sativum (garden cress), for which three GID1 orthologues were cloned. GA signalling via the GID1ac receptors is required for Arabidopsis seed germination, GID1b cannot compensate for the impaired germination of the gid1agid1c mutant. Transcript expression patterns differed temporarily, spatially, and hormonally, with GID1b being distinct from GID1ac in both species. Endosperm weakening is mediated, at least in part, through GA-induced genes encoding cell-wall-modifying proteins. A suppression subtraction hybridization (SSH) cDNA library enriched for sequences that are highly expressed during early germination in the micropylar endosperm contained expansins and xyloglucan endo-transglycosylases/hydrolases (XTHs). Their transcript expression patterns in both species strongly suggest that they are regulated by distinct GID1-mediated GA signalling pathways. The GID1ac and GID1b pathways seem to fulfil distinct regulatory roles during Brassicaceae seed germination and seem to control their downstream targets distinctly. PMID:21778177

Defining Global Gene Expression Changes of the Hypothalamic-Pituitary-Gonadal Axis in Female sGnRH-Antisense Transgenic Common Carp (Cyprinus carpio)

PubMed Central

Xu, Jing; Huang, Wei; Zhong, Chengrong; Luo, Daji; Li, Shuangfei; Zhu, Zuoyan; Hu, Wei

2011-01-01

Background The hypothalamic-pituitary-gonadal (HPG) axis is critical in the development and regulation of reproduction in fish. The inhibition of neuropeptide gonadotropin-releasing hormone (GnRH) expression may diminish or severely hamper gonadal development due to it being the key regulator of the axis, and then provide a model for the comprehensive study of the expression patterns of genes with respect to the fish reproductive system. Methodology/Principal Findings In a previous study we injected 342 fertilized eggs from the common carp (Cyprinus carpio) with a gene construct that expressed antisense sGnRH. Four years later, we found a total of 38 transgenic fish with abnormal or missing gonads. From this group we selected the 12 sterile females with abnormal ovaries in which we combined suppression subtractive hybridization (SSH) and cDNA microarray analysis to define changes in gene expression of the HPG axis in the present study. As a result, nine, 28, and 212 genes were separately identified as being differentially expressed in hypothalamus, pituitary, and ovary, of which 87 genes were novel. The number of down- and up-regulated genes was five and four (hypothalamus), 16 and 12 (pituitary), 119 and 93 (ovary), respectively. Functional analyses showed that these genes involved in several biological processes, such as biosynthesis, organogenesis, metabolism pathways, immune systems, transport links, and apoptosis. Within these categories, significant genes for neuropeptides, gonadotropins, metabolic, oogenesis and inflammatory factors were identified. Conclusions/Significance This study indicated the progressive scaling-up effect of hypothalamic sGnRH antisense on the pituitary and ovary receptors of female carp and provided comprehensive data with respect to global changes in gene expression throughout the HPG signaling pathway, contributing towards improving our understanding of the molecular mechanisms and regulative pathways in the reproductive system of teleost fish. PMID:21695218

SSH gene expression profile of Eisenia andrei exposed in situ to a naturally contaminated soil from an abandoned uranium mine.

PubMed

Lourenço, Joana; Pereira, Ruth; Gonçalves, Fernando; Mendo, Sónia

2013-02-01

The effects of the exposure of earthworms (Eisenia andrei) to contaminated soil from an abandoned uranium mine, were assessed through gene expression profile evaluation by Suppression Subtractive Hybridization (SSH). Organisms were exposed in situ for 56 days, in containers placed both in a contaminated and in a non-contaminated site (reference). Organisms were sampled after 14 and 56 days of exposure. Results showed that the main physiological functions affected by the exposure to metals and radionuclides were: metabolism, oxireductase activity, redox homeostasis and response to chemical stimulus and stress. The relative expression of NADH dehydrogenase subunit 1 and elongation factor 1 alpha was also affected, since the genes encoding these enzymes were significantly up and down-regulated, after 14 and 56 days of exposure, respectively. Also, an EST with homology for SET oncogene was found to be up-regulated. To the best of our knowledge, this is the first time that this gene was identified in earthworms and thus, further studies are required, to clarify its involvement in the toxicity of metals and radionuclides. Considering the results herein presented, gene expression profiling proved to be a very useful tool to detect earthworms underlying responses to metals and radionuclides exposure, pointing out for the detection and development of potential new biomarkers. Copyright © 2012 Elsevier Inc. All rights reserved.

Transcriptional Analysis of Drought-Induced Genes in the Roots of a Tolerant Genotype of the Common Bean (Phaseolus vulgaris L.)

PubMed Central

Recchia, Gustavo Henrique; Caldas, Danielle Gregorio Gomes; Beraldo, Ana Luiza Ahern; da Silva, Márcio José; Tsai, Siu Mui

2013-01-01

In Brazil, common bean (Phaseolus vulgaris L.) productivity is severely affected by drought stress due to low technology cultivation systems. Our purpose was to identify differentially expressed genes in roots of a genotype tolerant to water deficit (BAT 477) when submitted to an interruption of irrigation during its development. A SSH library was constructed taking as “driver” the genotype Carioca 80SH (susceptible to drought). After clustering and data mining, 1572 valid reads were obtained, resulting in 1120 ESTs (expressed sequence tags). We found sequences for transcription factors, carbohydrates metabolism, proline-rich proteins, aquaporins, chaperones and ubiquitins, all of them organized according to their biological processes. Our suppressive subtractive hybridization (SSH) library was validated through RT-qPCR experiment by assessing the expression patterns of 10 selected genes in both genotypes under stressed and control conditions. Finally, the expression patterns of 31 ESTs, putatively related to drought responses, were analyzed in a time-course experiment. Our results confirmed that such genes are more expressed in the tolerant genotype during stress; however, they are not exclusive, since different levels of these transcripts were also detected in the susceptible genotype. In addition, we observed a fluctuation in gene regulation over time for both the genotypes, which seem to adopt and adapt different strategies in order to develop tolerance against this stress. PMID:23538843

Molecular characterization of Brucella abortus chromosome II recombination.

PubMed

Tsoktouridis, Georgios; Merz, Christian A; Manning, Simon P; Giovagnoli-Kurtz, Renée; Williams, Leanne E; Mujer, Cesar V; Hagius, Sue; Elzer, Philip; Redkar, Rajendra J; Patra, Guy; DelVecchio, Vito G

2003-10-01

Large-scale genomic rearrangements including inversions, deletions, and duplications are significant in bacterial evolution. The recently completed Brucella melitensis 16M and Brucella suis 1330 genomes have facilitated the investigation of such events in the Brucella spp. Suppressive subtractive hybridization (SSH) was employed in identifying genomic differences between B. melitensis 16M and Brucella abortus 2308. Analysis of 45 SSH clones revealed several deletions on chromosomes of B. abortus and B. melitensis that encoded proteins of various metabolic pathways. A 640-kb inversion on chromosome II of B. abortus has been reported previously (S. Michaux Charachon, G. Bourg, E. Jumas Bilak, P. Guigue Talet, A. Allardet Servent, D. O'Callaghan, and M. Ramuz, J. Bacteriol. 179:3244-3249, 1997) and is further described in this study. One end of the inverted region is located on a deleted TATGC site between open reading frames BMEII0292 and BMEII0293. The other end inserted at a GTGTC site of the cyclic-di-GMP phosphodiesterase A (PDEA) gene (BMEII1009), dividing PDEA into two unequal DNA segments of 160 and 977 bp. As a consequence of inversion, the 160-bp segment that encodes the N-terminal region of PDEA was relocated at the opposite end of the inverted chromosomal region. The splitting of the PDEA gene most likely inactivated the function of this enzyme. A recombination mechanism responsible for this inversion is proposed.

Molecular Characterization of Brucella abortus Chromosome II Recombination

PubMed Central

Tsoktouridis, Georgios; Merz, Christian A.; Manning, Simon P.; Giovagnoli-Kurtz, Renée; Williams, Leanne E.; Mujer, Cesar V.; Hagius, Sue; Elzer, Philip; Redkar, Rajendra J.; Patra, Guy; DelVecchio, Vito G.

2003-01-01

Large-scale genomic rearrangements including inversions, deletions, and duplications are significant in bacterial evolution. The recently completed Brucella melitensis 16M and Brucella suis 1330 genomes have facilitated the investigation of such events in the Brucella spp. Suppressive subtractive hybridization (SSH) was employed in identifying genomic differences between B. melitensis 16M and Brucella abortus 2308. Analysis of 45 SSH clones revealed several deletions on chromosomes of B. abortus and B. melitensis that encoded proteins of various metabolic pathways. A 640-kb inversion on chromosome II of B. abortus has been reported previously (S. Michaux Charachon, G. Bourg, E. Jumas Bilak, P. Guigue Talet, A. Allardet Servent, D. O'Callaghan, and M. Ramuz, J. Bacteriol. 179:3244-3249, 1997) and is further described in this study. One end of the inverted region is located on a deleted TATGC site between open reading frames BMEII0292 and BMEII0293. The other end inserted at a GTGTC site of the cyclic-di-GMP phosphodiesterase A (PDEA) gene (BMEII1009), dividing PDEA into two unequal DNA segments of 160 and 977 bp. As a consequence of inversion, the 160-bp segment that encodes the N-terminal region of PDEA was relocated at the opposite end of the inverted chromosomal region. The splitting of the PDEA gene most likely inactivated the function of this enzyme. A recombination mechanism responsible for this inversion is proposed. PMID:14526025

The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

PubMed Central

Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

1983-01-01

The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

PubMed Central

Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

1982-01-01

A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

Using ParaView Software on the Peregrine System | High-Performance

Science.gov Websites

come pre-installed on most Linux and Mac systems. On Windows the ssh and terminal functions are provided by the programs plink.exe and cmd.exe, of which only cmd.exe will come pre-installed. The ssh

Identification of low Ca(2+) stress-induced embryo apoptosis response genes in Arachis hypogaea by SSH-associated library lift (SSHaLL).

PubMed

Chen, Hua; Zhang, Chong; Cai, Tie Cheng; Deng, Ye; Zhou, Shuangbiao; Zheng, Yixiong; Ma, Shiwei; Tang, Ronghua; Varshney, Rajeev K; Zhuang, Weijian

2016-02-01

Calcium is a universal signal in the regulation of wide aspects in biology, but few are known about the function of calcium in the control of early embryo development. Ca(2+) deficiency in soil induces early embryo abortion in peanut, producing empty pods, which is a general problem; however, the underlying mechanism remains unclear. In this study, embryo abortion was characterized to be caused by apoptosis marked with cell wall degradation. Using a method of SSH cDNA libraries associated with library lift (SSHaLL), 62 differentially expressed genes were isolated from young peanut embryos. These genes were classified to be stress responses, catabolic process, carbohydrate and lipid metabolism, embryo morphogenesis, regulation, etc. The cell retardation with cell wall degradation was caused by up-regulated cell wall hydrolases and down-regulated cellular synthases genes. HsfA4a, which was characterized to be important to embryo development, was significantly down-regulated under Ca(2+) -deficient conditions from 15 days after pegging (DAP) to 30 DAP. Two AhCYP707A4 genes, encoding abscisic acid (ABA) 8'-hydroxylases, key enzymes for ABA catabolism, were up-regulated by 21-fold under Ca(2+) -deficient conditions upstream of HsfA4a, reducing the ABA level in early embryos. Over-expression of AhCYP707A4 in Nicotiana benthamiana showed a phenotype of low ABA content with high numbers of aborted embryos, small pods and less seeds, which confirms that AhCYP707A4 is a key player in regulation of Ca(2+) deficiency-induced embryo abortion via ABA-mediated apoptosis. The results elucidated the mechanism of low Ca(2+) -induced embryo abortion and described the method for other fields of study. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Dye bias correction in dual-labeled cDNA microarray gene expression measurements.

PubMed Central

Rosenzweig, Barry A; Pine, P Scott; Domon, Olen E; Morris, Suzanne M; Chen, James J; Sistare, Frank D

2004-01-01

A significant limitation to the analytical accuracy and precision of dual-labeled spotted cDNA microarrays is the signal error due to dye bias. Transcript-dependent dye bias may be due to gene-specific differences of incorporation of two distinctly different chemical dyes and the resultant differential hybridization efficiencies of these two chemically different targets for the same probe. Several approaches were used to assess and minimize the effects of dye bias on fluorescent hybridization signals and maximize the experimental design efficiency of a cell culture experiment. Dye bias was measured at the individual transcript level within each batch of simultaneously processed arrays by replicate dual-labeled split-control sample hybridizations and accounted for a significant component of fluorescent signal differences. This transcript-dependent dye bias alone could introduce unacceptably high numbers of both false-positive and false-negative signals. We found that within a given set of concurrently processed hybridizations, the bias is remarkably consistent and therefore measurable and correctable. The additional microarrays and reagents required for paired technical replicate dye-swap corrections commonly performed to control for dye bias could be costly to end users. Incorporating split-control microarrays within a set of concurrently processed hybridizations to specifically measure dye bias can eliminate the need for technical dye swap replicates and reduce microarray and reagent costs while maintaining experimental accuracy and technical precision. These data support a practical and more efficient experimental design to measure and mathematically correct for dye bias. PMID:15033598

Comparison of global brain gene expression profiles between inbred long-sleep and inbred short-sleep mice by high-density gene array hybridization.

PubMed

Xu, Y; Ehringer, M; Yang, F; Sikela, J M

2001-06-01

Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.

Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

1988-07-01

The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Universities and Smart Specialisation Strategy: From Third Mission to Sustainable Development Co-Creation

ERIC Educational Resources Information Center

Rinaldi, Chiara; Cavicchi, Alessio; Spigarelli, Francesca; Lacchè, Luigi; Rubens, Arthur

2018-01-01

Purpose: The paper analyses the emerging role of Social Sciences and Humanities (SSH) universities in contemporary society via third- and fourth-mission activities. In particular, the paper investigates the potential contributions that SSH universities can offer in developing and enhancing capacities, supporting the changing conception of…

Localization of the human tripeptidyl peptidase II gene (TPP2) to 13q32-q33 by nonradioactive in situ hybridization and somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinsson, T.; Vujic, M.; Tomkinson, B.

1993-08-01

The authors have assigned the human tripeptidyl peptidase II (TPP2) gene to chromosome region 13q32-q33 using two different methods. First, a full-length TPP2 cDNA was used as a probe on Southern blots of DNA from a panel of human/rodent somatic cell hybrids. The TPP2 sequences were found to segregate with the human chromosome 13. Second, fluorescence in situ hybridization analysis was performed with the same probe. This analysis supported the chromosome 13 localization and further refined it to region 13q32-q33. 20 refs., 2 figs.

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

hEcd, A Novel Regulator of Mammary Epithelial Cell Survival

DTIC Science & Technology

2009-09-01

theYeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient oncogene to immortalize hMECs in vitro) as a bait and mammary...transformation. We have identified a novel protein us ing the Yeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient...epithelial cell cDNA library, we identified hEcd ( human orthologue of Drosophila Ecdysoneless) as a novel E6 binding partner. To study the cellular

The yeast two hybrid system in a screen for proteins interacting with axolotl (Ambystoma mexicanum) Msx1 during early limb regeneration.

PubMed

Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin

2011-07-01

Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.

Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

PubMed

Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

2018-02-15

Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

Genomic insights into strategies used by Xanthomonas albilineans with its reduced artillery to spread within sugarcane xylem vessels.

PubMed

Pieretti, Isabelle; Royer, Monique; Barbe, Valérie; Carrere, Sébastien; Koebnik, Ralf; Couloux, Arnaud; Darrasse, Armelle; Gouzy, Jérôme; Jacques, Marie-Agnès; Lauber, Emmanuelle; Manceau, Charles; Mangenot, Sophie; Poussier, Stéphane; Segurens, Béatrice; Szurek, Boris; Verdier, Valérie; Arlat, Matthieu; Gabriel, Dean W; Rott, Philippe; Cociancich, Stéphane

2012-11-21

Xanthomonas albilineans causes leaf scald, a lethal disease of sugarcane. X. albilineans exhibits distinctive pathogenic mechanisms, ecology and taxonomy compared to other species of Xanthomonas. For example, this species produces a potent DNA gyrase inhibitor called albicidin that is largely responsible for inducing disease symptoms; its habitat is limited to xylem; and the species exhibits large variability. A first manuscript on the complete genome sequence of the highly pathogenic X. albilineans strain GPE PC73 focused exclusively on distinctive genomic features shared with Xylella fastidiosa-another xylem-limited Xanthomonadaceae. The present manuscript on the same genome sequence aims to describe all other pathogenicity-related genomic features of X. albilineans, and to compare, using suppression subtractive hybridization (SSH), genomic features of two strains differing in pathogenicity. Comparative genomic analyses showed that most of the known pathogenicity factors from other Xanthomonas species are conserved in X. albilineans, with the notable absence of two major determinants of the "artillery" of other plant pathogenic species of Xanthomonas: the xanthan gum biosynthesis gene cluster, and the type III secretion system Hrp (hypersensitive response and pathogenicity). Genomic features specific to X. albilineans that may contribute to specific adaptation of this pathogen to sugarcane xylem vessels were also revealed. SSH experiments led to the identification of 20 genes common to three highly pathogenic strains but missing in a less pathogenic strain. These 20 genes, which include four ABC transporter genes, a methyl-accepting chemotaxis protein gene and an oxidoreductase gene, could play a key role in pathogenicity. With the exception of hypothetical proteins revealed by our comparative genomic analyses and SSH experiments, no genes potentially involved in any offensive or counter-defensive mechanism specific to X. albilineans were identified, supposing that X. albilineans has a reduced artillery compared to other pathogenic Xanthomonas species. Particular attention has therefore been given to genomic features specific to X. albilineans making it more capable of evading sugarcane surveillance systems or resisting sugarcane defense systems. This study confirms that X. albilineans is a highly distinctive species within the genus Xanthomonas, and opens new perpectives towards a greater understanding of the pathogenicity of this destructive sugarcane pathogen.

Gene expression in the scleractinian Acropora microphthalma exposed to high solar irradiance reveals elements of photoprotection and coral bleaching.

PubMed

Starcevic, Antonio; Dunlap, Walter C; Cullum, John; Shick, J Malcolm; Hranueli, Daslav; Long, Paul F

2010-11-12

The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH) from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues. A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs), which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a 'shared metabolic adaptation' between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca(2+)-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis. Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching.

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

The proteins interacting with C-terminal of μ receptor are identified by bacterial two-hybrid system from brain cDNA library in morphine-dependent rats.

PubMed

Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui

2015-12-15

Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.

BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

1998-01-01

We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

1996-01-15

The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

A novel cytochrome P450 gene (CYP4G25) of the silkmoth Antheraea yamamai: cloning and expression pattern in pharate first instar larvae in relation to diapause.

PubMed

Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi

2008-03-01

A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.

Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

PubMed

Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

2010-04-15

The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

Northern North Atlantic Sea Surface Height and Ocean Heat Content Variability

NASA Technical Reports Server (NTRS)

Hakkinen, Sirpa; Rhines, Peter; Worthen, Denise L.

2013-01-01

The evolution of nearly 20 years of altimetric sea surface height (SSH) is investigated to understand its association with decadal to multidecadal variability of the North Atlantic heat content. Altimetric SSH is dominated by an increase of about 14 cm in the Labrador and Irminger seas from 1993 to 2011, while the opposite has occurred over the Gulf Stream region over the same time period. During the altimeter period the observed 0-700 m ocean heat content (OHC) in the subpolar gyre mirrors the increased SSH by its dominantly positive trend. Over a longer period, 1955-2011, fluctuations in the subpolar OHC reflect Atlantic multidecadal variability (AMV) and can be attributed to advection driven by the wind stress ''gyre mode'' bringing more subtropical waters into the subpolar gyre. The extended subpolar warming evident in SSH and OHC during the altimeter period represents transition of the AMV from cold to warm phase. In addition to the dominant trend, the first empirical orthogonal function SSH time series shows an abrupt change 2009-2010 reaching a new minimum in 2010. The change coincides with the change in the meridional overturning circulation at 26.5N as observed by the RAPID (Rapid Climate Change) project, and with extreme behavior of the wind stress gyre mode and of atmospheric blocking. While the general relationship between northern warming and Atlantic meridional overturning circulation (AMOC) volume transport remains undetermined, the meridional heat and salt transport carried by AMOC's arteries are rich with decade-to-century timescale variability.

Intraseasonal-to-semiannual variability of sea-surface height in the eastern, equatorial Indian Ocean and southern Bay of Bengal

NASA Astrophysics Data System (ADS)

Cheng, X.; McCreary, J. P., Jr.; Qiu, B.; Yu, Z.; DU, Y.

2016-12-01

Intraseasonal-to-semiannual variability of sea-surface height (SSH) in the eastern, equatorial Indian Ocean (EEIO) and southern Bay of Bengal (BoB) is investigated using altimetric data, and solutions to 1½-layer (first-baroclinic-mode) and linear, continuously stratified (LCS; multi-baroclinic-mode) models. The amplitude and dominant period of SSH variability differ regionally. Large-amplitude variability is found along the west coast of Sumatra, in a zonal band across the BoB centered along 5°N, east of Sri Lanka, and in the northwestern BoB. Along the Sumatran west coast, SSH variability peaks at 30-60 days, 90 days, and 180 days. Along 5°N and east of Sri Lanka, 30-60-day variability is dominant. Sensitivity experiments using a nonlinear version of the 1½-layer model forced by realistic winds reproduce the observed patterns of intraseasonal variability in the southern BoB. At 30-60 days, the solutions show that eddies (nonlinear Rossby waves) propagating from the east, rather than local wind forcing, account for most of the variance east of Sri Lanka; furthermore, they demonstrate that the variance is significantly enhance by the nonlinear transfer of 90-120-day energy into the intraseasonal band. The LCS solutions show that the first two baroclinic modes explain most of the SSH variance at 90-180 days. The second-baroclinic-mode dominates the SSH variance at 180 days, a consequence of basin resonance and strong wind forcing.

Safety surrogate histograms (SSH): A novel real-time safety assessment of dilemma zone related conflicts at signalized intersections.

PubMed

Ghanipoor Machiani, Sahar; Abbas, Montasir

2016-11-01

Drivers' indecisiveness in dilemma zones (DZ) could result in crash-prone situations at signalized intersections. DZ is to the area ahead of an intersection in which drivers encounter a dilemma regarding whether to stop or proceed through the intersection when the signal turns yellow. An improper decision to stop by the leading driver, combined with the following driver deciding to go, can result in a rear-end collision, unless the following driver recognizes a collision is imminent and adjusts his or her behavior at or shortly after the onset of yellow. Considering the significance of DZ-related crashes, a comprehensive safety measure is needed to characterize the level of safety at signalized intersections. In this study, a novel safety surrogate measure was developed utilizing real-time radar field data. This new measure, called safety surrogate histogram (SSH), captures the degree and frequency of DZ-related conflicts at each intersection approach. SSH includes detailed information regarding the possibility of crashes, because it is calculated based on the vehicles conflicts. An example illustrating the application of the new methodology at two study sites in Virginia is presented and discussed, and a comparison is provided between SSH and other DZ-related safety surrogate measures mentioned in the literature. The results of the study reveal the efficacy of the SSH as complementary to existing surrogate measures. Copyright © 2015 Elsevier Ltd. All rights reserved.

SSh versus TSE sequence protocol in rapid MR examination of pediatric patients with programmable drainage system.

PubMed

Brichtová, Eva; Šenkyřík, J

2017-05-01

A low radiation burden is essential during diagnostic procedures in pediatric patients due to their high tissue sensitivity. Using MR examination instead of the routinely used CT reduces the radiation exposure and the risk of adverse stochastic effects. Our retrospective study evaluated the possibility of using ultrafast single-shot (SSh) sequences and turbo spin echo (TSE) sequences in rapid MR brain imaging in pediatric patients with hydrocephalus and a programmable ventriculoperitoneal drainage system. SSh sequences seem to be suitable for examining pediatric patients due to the speed of using this technique, but significant susceptibility artifacts due to the programmable drainage valve degrade the image quality. Therefore, a rapid MR examination protocol based on TSE sequences, less sensitive to artifacts due to ferromagnetic components, has been developed. Of 61 pediatric patients who were examined using MR and the SSh sequence protocol, a group of 15 patients with hydrocephalus and a programmable drainage system also underwent TSE sequence MR imaging. The susceptibility artifact volume in both rapid MR protocols was evaluated using a semiautomatic volumetry system. A statistically significant decrease in the susceptibility artifact volume has been demonstrated in TSE sequence imaging in comparison with SSh sequences. Using TSE sequences reduced the influence of artifacts from the programmable valve, and the image quality in all cases was rated as excellent. In all patients, rapid MR examinations were performed without any need for intravenous sedation or general anesthesia. Our study results strongly suggest the superiority of the TSE sequence MR protocol compared to the SSh sequence protocol in pediatric patients with a programmable ventriculoperitoneal drainage system due to a significant reduction of susceptibility artifact volume. Both rapid sequence MR protocols provide quick and satisfactory brain imaging with no ionizing radiation and a reduced need for intravenous or general anesthesia.

On the Direct Assimilation of Along-track Sea Surface Height Observations into a Free-surface Ocean Model Using a Weak Constraints Four Dimensional Variational (4dvar) Method

NASA Astrophysics Data System (ADS)

Ngodock, H.; Carrier, M.; Smith, S. R.; Souopgui, I.; Martin, P.; Jacobs, G. A.

2016-02-01

The representer method is adopted for solving a weak constraints 4dvar problem for the assimilation of ocean observations including along-track SSH, using a free surface ocean model. Direct 4dvar assimilation of SSH observations along the satellite tracks requires that the adjoint model be integrated with Dirac impulses on the right hand side of the adjoint equations for the surface elevation equation. The solution of this adjoint model will inevitably include surface gravity waves, and it constitutes the forcing for the tangent linear model (TLM) according to the representer method. This yields an analysis that is contaminated by gravity waves. A method for avoiding the generation of the surface gravity waves in the analysis is proposed in this study; it consists of removing the adjoint of the free surface from the right hand side (rhs) of the free surface mode in the TLM. The information from the SSH observations will still propagate to all other variables via the adjoint of the balance relationship between the barotropic and baroclinic modes, resulting in the correction to the surface elevation. Two assimilation experiments are carried out in the Gulf of Mexico: one with adjoint forcing included on the rhs of the TLM free surface equation, and the other without. Both analyses are evaluated against the assimilated SSH observations, SSH maps from Aviso and independent surface drifters, showing that the analysis that did not include adjoint forcing in the free surface is more accurate. This study shows that when a weak constraint 4dvar approach is considered for the assimilation of along-track SSH observations using a free surface model, with the aim of correcting the mesoscale circulation, an independent model error should not be assigned to the free surface.

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

A Novel Approach to the Elucidation of the Mechanism of Development of Androgen-Independent Growth of Prostate Cancer

DTIC Science & Technology

2001-01-01

with 1.0 with differential hybridization to the two probes. Phage plaques corresponding ml of RIPA buffer with protease inhibitors (PBS, 1% NP40, 0.5...hybridized to radiolabeled probe prepared from plaque-purified phage . at 10,000 X g for 20 min; supernatants were collected and centrifuged again to...Screening. Lambda phage plaques from the primary unamplified Differential expression screening of cDNA libraries constructed CWR22 library were plated

A Label-Free Photoluminescence Genosensor Using Nanostructured Magnesium Oxide for Cholera Detection

NASA Astrophysics Data System (ADS)

Patel, Manoj Kumar; Ali, Md. Azahar; Krishnan, Sadagopan; Agrawal, Ved Varun; Al Kheraif, Abdulaziz A.; Fouad, H.; Ansari, Z. A.; Ansari, S. G.; Malhotra, Bansi D.

2015-11-01

Nanomaterial-based photoluminescence (PL) diagnostic devices offer fast and highly sensitive detection of pesticides, DNA, and toxic agents. Here we report a label-free PL genosensor for sensitive detection of Vibrio cholerae that is based on a DNA hybridization strategy utilizing nanostructured magnesium oxide (nMgO; size >30 nm) particles. The morphology and size of the synthesized nMgO were determined by transmission electron microscopic (TEM) studies. The probe DNA (pDNA) was conjugated with nMgO and characterized by X-ray photoelectron and Fourier transform infrared spectroscopic techniques. The target complementary genomic DNA (cDNA) isolated from clinical samples of V. cholerae was subjected to DNA hybridization studies using the pDNA-nMgO complex and detection of the cDNA was accomplished by measuring changes in PL intensity. The PL peak intensity measured at 700 nm (red emission) increases with the increase in cDNA concentration. A linear range of response in the developed PL genosensor was observed from 100 to 500 ng/μL with a sensitivity of 1.306 emi/ng, detection limit of 3.133 ng/μL and a regression coefficient (R2) of 0.987. These results show that this ultrasensitive PL genosensor has the potential for applications in the clinical diagnosis of cholera.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA; construction of cDNA clones and identification of a rabbit mu heavy chain clone.

PubMed

Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R

1983-01-01

Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.

Chromosomal mapping of the human M6 genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olinsky, S.; Loop, B.T.; DeKosky, A.

1996-05-01

M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

Investigating Auditory Processing of Syntactic Gaps with L2 Speakers Using Pupillometry

ERIC Educational Resources Information Center

Fernandez, Leigh; Höhle, Barbara; Brock, Jon; Nickels, Lyndsey

2018-01-01

According to the Shallow Structure Hypothesis (SSH), second language (L2) speakers, unlike native speakers, build shallow syntactic representations during sentence processing. In order to test the SSH, this study investigated the processing of a syntactic movement in both native speakers of English and proficient late L2 speakers of English using…

Experiments in interdisciplinarity: Responsible research and innovation and the public good

PubMed Central

Åm, Heidrun

2018-01-01

In Europe, responsible research and innovation (RRI) has emerged as a science policy measure that demands the early integration of a broad range of social actors and perspectives into research and development (R&D). More collaboration of the social sciences and humanities (SSH) with science and engineering appears within this policy framework as a crucial element that will enable better technological development. However, RRI is new to both natural scientists and SSH scholars, and interdisciplinary collaborations are challenging for many reasons. In this paper, we discuss these challenges while suggesting that what RRI can be in a particular project is not a given but remains an empirical question. Natural scientists and SSH scholars need to coresearch RRI in an experimental mode. PMID:29579043

Experiments in interdisciplinarity: Responsible research and innovation and the public good.

PubMed

Delgado, Ana; Åm, Heidrun

2018-03-01

In Europe, responsible research and innovation (RRI) has emerged as a science policy measure that demands the early integration of a broad range of social actors and perspectives into research and development (R&D). More collaboration of the social sciences and humanities (SSH) with science and engineering appears within this policy framework as a crucial element that will enable better technological development. However, RRI is new to both natural scientists and SSH scholars, and interdisciplinary collaborations are challenging for many reasons. In this paper, we discuss these challenges while suggesting that what RRI can be in a particular project is not a given but remains an empirical question. Natural scientists and SSH scholars need to coresearch RRI in an experimental mode.

Isolation of genes differentially expressed during development and ripening of Fragaria chiloensis fruit by suppression subtractive hybridization.

PubMed

Pimentel, Paula; Salvatierra, Ariel; Moya-León, María Alejandra; Herrera, Raúl

2010-09-15

Fragaria chiloensis, the native Chilean strawberry, is noted for its good fruit quality characters. However, it is a highly perishable fruit due to its rapid softening. With the aim to screen for genes differentially expressed during development and ripening of strawberry fruit, the subtractive suppressive hybridization (SSH) methodology was employed. Six libraries were generated contrasting transcripts from four different developmental stages. A set of 1807 genes was isolated and characterized. In our EST collection, approximately 90% of partial cDNAs showed significant similarity to proteins with known or unknown function registered in databases. Among them, proteins related to protein fate were identified in a large green fruit library and protein related with cellular transport, cell wall-related proteins, and transcription regulators were identified in a ripe fruit library. Thirteen genes were analyzed by qRT-PCR during development and ripening of the Chilean strawberry fruit. The information generated in this study provides new clues to aid the understanding of the ripening process in F. chiloensis fruit. Copyright 2010 Elsevier GmbH. All rights reserved.

Meta-analysis of studies using suppression subtractive hybridization and microarrays to investigate the effects of environmental stress on gene transcription in oysters.

PubMed

Anderson, Kelli; Taylor, Daisy A; Thompson, Emma L; Melwani, Aroon R; Nair, Sham V; Raftos, David A

2015-01-01

Many microarray and suppression subtractive hybridization (SSH) studies have analyzed the effects of environmental stress on gene transcription in marine species. However, there have been no unifying analyses of these data to identify common stress response pathways. To address this shortfall, we conducted a meta-analysis of 14 studies that investigated the effects of different environmental stressors on gene expression in oysters. The stressors tested included chemical contamination, hypoxia and infection, as well as extremes of temperature, pH and turbidity. We found that the expression of over 400 genes in a range of oyster species changed significantly after exposure to environmental stress. A repeating pattern was evident in these transcriptional responses, regardless of the type of stress applied. Many of the genes that responded to environmental stress encoded proteins involved in translation and protein processing (including molecular chaperones), the mitochondrial electron transport chain, anti-oxidant activity and the cytoskeleton. In light of these findings, we put forward a consensus model of sub-cellular stress responses in oysters.

Meta-Analysis of Studies Using Suppression Subtractive Hybridization and Microarrays to Investigate the Effects of Environmental Stress on Gene Transcription in Oysters

PubMed Central

Thompson, Emma L.; Melwani, Aroon R.; Nair, Sham V.; Raftos, David A.

2015-01-01

Many microarray and suppression subtractive hybridization (SSH) studies have analyzed the effects of environmental stress on gene transcription in marine species. However, there have been no unifying analyses of these data to identify common stress response pathways. To address this shortfall, we conducted a meta-analysis of 14 studies that investigated the effects of different environmental stressors on gene expression in oysters. The stressors tested included chemical contamination, hypoxia and infection, as well as extremes of temperature, pH and turbidity. We found that the expression of over 400 genes in a range of oyster species changed significantly after exposure to environmental stress. A repeating pattern was evident in these transcriptional responses, regardless of the type of stress applied. Many of the genes that responded to environmental stress encoded proteins involved in translation and protein processing (including molecular chaperones), the mitochondrial electron transport chain, anti-oxidant activity and the cytoskeleton. In light of these findings, we put forward a consensus model of sub-cellular stress responses in oysters. PMID:25768438

Cloning of the cocaine-sensitive bovine dopamine transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usdin, T.B.; Chen, C.; Brownstein, M.J.

1991-12-15

A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Intraseasonal-to-semiannual variability of sea-surface height in the astern, equatorial Indian Ocean and southern Bay of Bengal

NASA Astrophysics Data System (ADS)

Cheng, Xuhua; McCreary, Julian P.; Qiu, Bo; Qi, Yiquan; Du, Yan

2017-05-01

Intraseasonal-to-semiannual variability of sea-surface height (SSH) in the eastern, equatorial Indian Ocean (EEIO) and southern Bay of Bengal (BoB) is investigated using altimetric data, and solutions to 1½ layer (first baroclinic mode) and linear, continuously stratified (LCS; multibaroclinic-mode) models. The amplitude and dominant periods of SSH variability differ regionally. Large-amplitude variability is found along the west coast of Sumatra, in a zonal band across the BoB centered along 5°N, east of Sri Lanka, and in the northwestern BoB, respectively. Along the Sumatran west coast, SSH variability peaks at 30-60, 90, and 180 days. Along 5°N and east of Sri Lanka, the 30-60 day variability is dominant. Sensitivity experiments using a nonlinear version of the 1½ layer model forced by realistic winds reproduce the observed patterns of intraseasonal variability in the southern BoB. At 30-60 days, the solutions show that eddies (nonlinear Rossby waves) propagating from the east, rather than local wind forcing, account for most of the variance east of Sri Lanka; furthermore, they demonstrate that the variance is significantly enhanced by the nonlinear transfer of 90-120 day energy into the intraseasonal band of 30-60 days. The LCS solutions show that the first two baroclinic modes explain most of the SSH variance at 90-180 days. The second baroclinic mode dominates the SSH variance at 180 days, a consequence of basin resonance and strong wind forcing.

A balanced Kalman filter ocean data assimilation system with application to the South Australian Sea

NASA Astrophysics Data System (ADS)

Li, Yi; Toumi, Ralf

2017-08-01

In this paper, an Ensemble Kalman Filter (EnKF) based regional ocean data assimilation system has been developed and applied to the South Australian Sea. This system consists of the data assimilation algorithm provided by the NCAR Data Assimilation Research Testbed (DART) and the Regional Ocean Modelling System (ROMS). We describe the first implementation of the physical balance operator (temperature-salinity, hydrostatic and geostrophic balance) to DART, to reduce the spurious waves which may be introduced during the data assimilation process. The effect of the balance operator is validated in both an idealised shallow water model and the ROMS model real case study. In the shallow water model, the geostrophic balance operator eliminates spurious ageostrophic waves and produces a better sea surface height (SSH) and velocity analysis and forecast. Its impact increases as the sea surface height and wind stress increase. In the real case, satellite-observed sea surface temperature (SST) and SSH are assimilated in the South Australian Sea with 50 ensembles using the Ensemble Adjustment Kalman Filter (EAKF). Assimilating SSH and SST enhances the estimation of SSH and SST in the entire domain, respectively. Assimilation with the balance operator produces a more realistic simulation of surface currents and subsurface temperature profile. The best improvement is obtained when only SSH is assimilated with the balance operator. A case study with a storm suggests that the benefit of the balance operator is of particular importance under high wind stress conditions. Implementing the balance operator could be a general benefit to ocean data assimilation systems.

Waveform identification and retracking analyses of Jason-2 altimeter satellite data for improving sea surface height estimation in Southern Java Island Waters and Java Sea, Indonesia

NASA Astrophysics Data System (ADS)

Nababan, Bisman; Hakim, Muhammad R.; Panjaitan, James P.

2018-05-01

Indonesian waters containing many small islands and shallow waters leads to a less accurate of sea surface height (SSH) estimation from satellite altimetry. Little efforts are also given for the validation of SSH estimation from the satellite in Indonesian waters. The purpose of this research was to identify and retrack waveforms of Jason-2 altimeter satellite data in southern Java island waters and Java Sea using several retrackers and performed improvement percentage analyses for new SSH estimation. The study used data of the Sensor Geophysical Data Record type D (SGDR-D) of Jason-2 satellite altimeter of the year 2010 in the southern Java island waters and 2012-2014 in Java Sea. Waveform retracking analyses were conducted using several retrackers (Offset Center of Gravity, Ice, Threshold, and Improved Threshold) and examined using a world reference undulation geoid of EGM08 and Oceanic retracker. Result showed that shape and pattern of waveforms were varied in all passes, seasons, and locations specifically along the coastal regions. In general, non-Brownish and complex waveforms were identified along coastal region specifically within the distance of 0-10 km from the shoreline. In contrary, generally Brownish waveforms were found in offshore. However, Brownish waveform can also be found within coastal region and non-Brownish waveforms within offshore region. The results were also showed that the four retrackers produced a better SSH estimation in coastal region. However, there was no dominant retracker to improve the accuracy of the SSH estimate.

Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections

USDA-ARS?s Scientific Manuscript database

To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

Genes from the 20Q13 amplicon and their uses

DOEpatents

Gray, Joe; Collins, Colin; Hwang, Soo-in; Godfrey, Tony; Kowbel, David; Rommens, Johanna

1999-01-01

The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases.

Deception Using an SSH Honeypot

DTIC Science & Technology

2017-09-01

the device itself but also the device’s cloud and mobile infrastructure. This increase in unsecured devices connected to the Internet presents...have SSH enabled on their systems without knowledge that this service is running. Computer -security professionals use several techniques to gain...early 2000s. Honeypots are decoy computer systems intended for no other purpose than to collect data on attackers. They gather information about

Variability of sea surface height and circulation in the North Atlantic: Forcing mechanisms and linkages

NASA Astrophysics Data System (ADS)

Wang, Zeliang; Lu, Youyu; Dupont, Frederic; W. Loder, John; Hannah, Charles; G. Wright, Daniel

2015-03-01

Simulations with a coarse-resolution global ocean model during 1958-2004 are analyzed to understand the inter-annual and decadal variability of the North Atlantic. Analyses of Empirical Orthogonal Functions (EOFs) suggest relationships among basin-scale variations of sea surface height (SSH) and depth-integrated circulation, and the winter North Atlantic Oscillation (NAO) or the East Atlantic Pattern (EAP) indices. The linkages between the atmospheric indices and ocean variables are shown to be related to the different roles played by surface momentum and heat fluxes in driving ocean variability. In the subpolar region, variations of the gyre strength, SSH in the central Labrador Sea and the NAO index are highly correlated. Surface heat flux is important in driving variations of SSH and circulation in the upper ocean and decadal variations of the Atlantic Meridional Overturning Circulation (AMOC). Surface momentum flux drives a significant barotropic component of flow and makes a noticeable contribution to the AMOC. In the subtropical region, momentum flux plays a dominant role in driving variations of the gyre circulation and AMOC; there is a strong correlation between gyre strength and SSH at Bermuda.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

PubMed

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Isolation and characterization of a J domain protein that interacts with ARC1 from ornamental kale (Brassica oleracea var. acephala).

PubMed

Lan, Xingguo; Yang, Jia; Cao, Mingming; Wang, Yanhong; Kawabata, Saneyuki; Li, Yuhua

2015-05-01

A novel J domain protein, JDP1, was isolated from ornamental kale. The C-terminus of JDP1 specifically interacted with ARC1, which has a conserved role in self-incompatibility signaling. Armadillo (ARM)-repeat containing 1 (ARC1) plays a conserved role in self-incompatibility signaling across the Brassicaceae and functions downstream of the S-locus receptor kinase. Here, we identified a J domain protein 1 (JDP1) that interacts with ARC1 using a yeast two-hybrid screen against a stigma cDNA library from ornamental kale (Brassica oleracea var. acephala). JDP1, a 38.4-kDa protein with 344 amino acids, is a member of the Hsp40 family. Fragment JDP1(57-344), originally isolated from a yeast two-hybrid cDNA library, interacted specifically with ARC1 in yeast two-hybrid assays. The N-terminus of JDP1 (JDP1(1-68)) contains a J domain, and the C-terminus of JDP1 (JDP1(69-344)) contains an X domain of unknown function. However, JDP1(69-344) was required and sufficient for interaction with ARC1 in yeast two-hybrid assays and in vitro binding assays. Moreover, JDP1(69-344) regulated the trafficking of ARC1 from the cytoplasm to the plasma membrane by interacting with ARC1 in Arabidopsis mesophyll protoplasts. Finally, Tyr(8) in the JDP1 N-terminal region was identified to be the specific site for regulating the interaction between JDP1 and BoARC1 in yeast two-hybrid assays. Possible roles of JDP1 as an interactor with ARC1 in Brassica are discussed.

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Bismarck or Beveridge: a beauty contest between dinosaurs

PubMed Central

van der Zee, Jouke; Kroneman, Madelon W

2007-01-01

Background Health systems delivery systems can be divided into two broad categories: National Health Services (NHS) on the one hand and Social Security (based) Health care systems (SSH) on the other hand. Existing literature is inconclusive about which system performs best. In this paper we would like to improve the evidence-base for discussion about pros and cons of NHS-systems versus SSH-system for health outcomes, expenditure and population satisfaction. Methods In this study we used time series data for 17 European countries, that were characterized as either NHS or SSH country. We used the following performance indicators: For health outcome: overall mortality rate, infant mortality rate and life expectancy at birth. For health care costs: health care expenditure per capita in pppUS$ and health expenditure as percentage of GDP. Time series dated from 1970 until 2003 or 2004, depending on availability. Sources were OECD health data base 2006 and WHO health for all database 2006. For satisfaction we used the Eurobarometer studies from 1996, 1998 and 1999. Results SSH systems perform slightly better on overall mortality rates and life expectancy (after 1980). For infant mortality the rates converged between the two types of systems and since 1980 no differences ceased to exist. SSH systems are more expensive and NHS systems have a better cost containment. Inhabitants of countries with SSH-systems are on average substantially more satisfied than those in NHS countries. Conclusion We concluded that the question 'which type of system performs best' can be answered empirically as far as health outcomes, health care expenditures and patient satisfaction are concerned. Whether this selection of indicators covers all or even most relevant aspects of health system comparison remains to be seen. Perhaps further and more conclusive research into health system related differences in, for instance, equity should be completed before the leading question of this paper can be answered. We do think, however, that this study can form a base for a policy debate on the pros and cons of the existing health care systems in Europe. PMID:17594476

Strong FANCA/FANCG but weak FANCA/FANCC interaction in the yeast 2-hybrid system.

PubMed

Reuter, T; Herterich, S; Bernhard, O; Hoehn, H; Gross, H J

2000-01-15

Three of at least 8 Fanconi anemia (FA) genes have been cloned (FANCA, FANCC, FANCG), but their functions remain unknown. Using the yeast 2-hybrid system and full-length cDNA, the authors found a strong interaction between FANCA and FANCG proteins. They also obtained evidence for a weak interaction between FANCA and FANCC. Neither FANCA nor FANCC was found to interact with itself. These results support the notion of a functional association between the FA gene products. (Blood. 2000;95:719-720)

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Differences in brain gene expression between sleep and waking as revealed by mRNA differential display and cDNA microarray technology.

PubMed

Cirelli, C; Tononi, G

1999-06-01

The consequences of sleep and sleep deprivation at the molecular level are largely unexplored. Knowledge of such molecular events is essential to understand the restorative processes occurring during sleep as well as the cellular mechanisms of sleep regulation. Here we review the available data about changes in neural gene expression across different behavioural states using candidate gene approaches such as in situ hybridization and immunocytochemistry. We then describe new techniques for systematic screening of gene expression in the brain, such as subtractive hybridization, mRNA differential display, and cDNA microarray technology, outlining advantages and disadvantages of these methods. Finally, we summarize our initial results of a systematic screening of gene expression in the rat brain across behavioural states using mRNA differential display and cDNA microarray technology. The expression pattern of approximately 7000 genes was analysed in the cerebral cortex of rats after 3 h of spontaneous sleep, 3 h of spontaneous waking, or 3 h of sleep deprivation. While the majority of transcripts were expressed at the same level among these three conditions, 14 mRNAs were modulated by sleep and waking. Six transcripts, four more expressed in waking and two more expressed in sleep, corresponded to novel genes. The eight known transcripts were all expressed at higher levels in waking than in sleep and included transcription factors and mitochondrial genes. A possible role for these known transcripts in mediating neural plasticity during waking is discussed.

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

PubMed

Ginsberg, Stephen D; Che, Shaoli

2004-08-01

The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

PubMed

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

Molecular characterization of infectious bursal disease virus isolates from Nepal based on hypervariable region of VP2 gene.

PubMed

Sharma, K; Hair-Bejo, M; Omar, A R; Aini, I

2005-01-01

Two Infectious bursal disease virus (IBDV) isolates, NP1SSH and NP2K were obtained from a severe infectious bursal disease (IBD) outbreak in Nepal in 2002. The hypervariable (HV) region of VP2 gene (1326 bp) of the isolates was generated by RT-PCR and sequenced. The obtained nucleotide sequences were compared with those of twenty other IBDV isolates/strains. Phylogenetic analysis based on this comparison revealed that NP1SSH and NP2K clustered with very virulent (vv) IBDV strains of serotype 1. In contrast, classical, Australian classical and attenuated strains of serotype 1 and avirulent IBDV strains of serotype 2 formed a different cluster. The deduced amino acid sequences of the two isolates showed a 98.3% identity with each other and 97.1% and 98.3% identities, respectively with very virulent IBDV (vvIBDV) isolates/strains. Three amino acids substitutions at positions 300 (E-->A), 308 (I-->F) and 334 (A-->P) within the HV region were common for both the isolates. The amino acids substitutions at positions 27 (S-->T), 28 (I-->T), 31 (D-->A), 36 (H-->Y), 135 (E-->G), 223 (G-->S), 225 (V-->I), 351 (L-->I), 352 (V-->E) and 399 (I-->S) for NP1SSH and at position 438 (I-->S) for NP2K were unique and differed from other IBDV isolates/strains. NP1SSH and NP2K showed highest similarity (97.8%) with the BD399 strain from Bangladesh as compared with other vvIBDV isolates/strains. We conclude that the NP1SSH and NP2K isolates of IBDV from Nepal represent vvIBDV of serotype 1.

[Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

PubMed

Yang, Li-Wei; Shi, Ji-Sen

2012-04-01

To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

Identification and transcriptional profile of multiple genes in the posterior kidney of Nile tilapia at 6h post bacterial infections

USDA-ARS?s Scientific Manuscript database

To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

Inheritance of RFLP loci in a loblolly pine three-generation pedigree

Treesearch

M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale

1991-01-01

A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...

Distribution of cholecystokinin mRNA and peptides in the human brain.

PubMed

Lindefors, N; Brené, S; Kopp, J; Lindén, A; Brodin, E; Sedvall, G; Persson, H

1991-01-01

Expression of preprocholecystokinin mRNA was studied in regions of post mortem human brain using RNA blot analysis (Northern blot) and in situ hybridization. Northern blot analysis using a cDNA probe showed high levels of an approximately 0.8 kb preprocholecystokinin mRNA in all regions of neocortex examined. Lower levels of preprocholecystokinin mRNA were detected in amygdaloid body and thalamus. In situ hybridization analysis using the same cDNA probe revealed numerous weakly labelled neurons in different areas of human neocortex and less numerous neurons in hippocampus and amygdaloid body. High-performance liquid-chromatography and gel-chromatography combined with radioimmunoassay of cholecystokinin-like immunoreactivity from human cerebral cortex and caudate nucleus revealed two major forms, one coeluting with sulphated cholecystokinin-8 and the other coeluting with sulphated cholecystokinin-58. Two minor components coeluting with cholecystokinin-4 and cholecystokinin-5 were also detected. The finding of cholecystokinin-like immunoreactivity corresponding to cholecystokinin-8 and cholecystokinin-58 in caudate nucleus where no preprocholecystokinin mRNA was found, indicates the presence of these peptides in afferent nerve terminals.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

PubMed

Hargreaves, Adam D; Mulley, John F

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

PubMed Central

Hargreaves, Adam D.

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

Globus File Transfer Services | High-Performance Computing | NREL

Science.gov Websites

Account To get a Globus account, sign up on the Globus account website. To get access to the NREL endpoint continue. Use the Globus credentials you used to register your Globus.org account. Go to the Transfer Files Globus.org account to allow ssh CLI access To use the CLI you must have a Globus account with ssh access

Expression profiling of Crambe abyssinica under arsenate stress identifies genes and gene networks involved in arsenic metabolism and detoxification

PubMed Central

2010-01-01

Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH) approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown novel proteins serve as molecular evidence for the physiological responses to arsenate stress in plants. Additionally, many of these cDNA clones showing strong upregulation due to arsenate stress could be used as valuable markers. Further characterization of these differentially expressed genes would be useful to develop novel strategies for efficient phytoremediation as well as for engineering arsenic tolerant crops with reduced arsenic translocation to the edible parts of plants. PMID:20546591

Complexities and sequence similarities of mRNA populations of cholinergic (NS20-Y) and adrenergic (N1E-115) murine neuroblastoma cell lines.

PubMed

Strauss, W L

1990-07-01

The clonal murine neuroblastoma cell lines NS20-Y and N1E-115 have been proposed as models for examining the commitment of neural crest cells to either the cholinergic or adrenergic phenotype, respectively. The validity of this model depends in part on the extent to which these two cell lines have diverged as a result of their transformed, rather than neuronal properties. In order to quantitate differences in gene expression between NS20-Y and N1E-115 cells, the mRNA complexity of each cell type was determined. An analysis of the kinetics of hybridization of NS20-Y cell mRNA with cDNA prepared from NS20-Y cell mRNA demonstrated the presence of approximately 11,700 mRNA species assuming an average length of 1900 nucleotides. A similar analysis using mRNA isolated from N1E-115 cells and cDNA prepared from N1E-115 cell mRNA demonstrated that the adrenergic cell line expressed approximately 11,600 mRNA species. The species of mRNA expressed by each cell line were resolved into high, intermediate, and low abundance populations. In order to determine whether mRNAs were expressed by the cholinergic, but not by the adrenergic cell line, NS20-Y cDNA was hybridized to an excess of N1E-115 cell mRNA. An analysis of the solution hybridization kinetics from this procedure demonstrated that the two cell lines do not differ significantly in the nucleotide complexity of their mRNA populations. The extensive similarity between the two mRNA populations suggests that only a small number of genes are expressed differentially between the two cell lines and supports their use as models for the differentiation of cholinergic and adrenergic neurons.

On Verifying Currents and Other Features in the Hawaiian Islands Region Using Fully Coupled Ocean/Atmosphere Mesoscale Prediction System Compared to Global Ocean Model and Ocean Observations

NASA Astrophysics Data System (ADS)

Jessen, P. G.; Chen, S.

2014-12-01

This poster introduces and evaluates features concerning the Hawaii, USA region using the U.S. Navy's fully Coupled Ocean/Atmosphere Mesoscale Prediction System (COAMPS-OS™) coupled to the Navy Coastal Ocean Model (NCOM). It also outlines some challenges in verifying ocean currents in the open ocean. The system is evaluated using in situ ocean data and initial forcing fields from the operational global Hybrid Coordinate Ocean Model (HYCOM). Verification shows difficulties in modelling downstream currents off the Hawaiian islands (Hawaii's wake). Comparing HYCOM to NCOM current fields show some displacement of small features such as eddies. Generally, there is fair agreement from HYCOM to NCOM in salinity and temperature fields. There is good agreement in SSH fields.

In vitro detection of canine distemper virus nucleic acid with a virus-specific cDNA probe by dot-blot and in situ hybridization.

PubMed

Oglesbee, M; Jackwood, D; Perrine, K; Axthelm, M; Krakowka, S; Rice, J

1986-11-01

A cDNA library was prepared from canine distemper viral (CDV) messenger RNA (mRNA) derived from Vero cells lytically infected with the Onderstepoort strain (Ond) of CDV. A 300 base pair insert was identified which, by Northern blot analysis and Sanger sequence data, was shown to be specific to the nucleocapsid gene. The nucleocapsid (NC) clone was radiolabelled with 32P using nick translation and used to detect viral RNA in both dot-blot and in situ preparations of Vero cells lytically infected with Onderstepoort CDV (Ond-CDV) and immortalized mink lung cells persistently infected with racoon origin CDV (CCL64-RCDV). Dot-blot hybridization results paralleled immunofluorescent results in the lytically infected cells. In 18 persistently infected cell lines from the RCDV-CCL64 parental stock, 13 lines were positive and two were negative on both immunofluorescence and dot-blot hybridization analysis for CDV antigen and RNA, respectively. Viral nucleic acid was detected in these persistently infected cells, where as few as 1.9% of the members of a line were positive on immunofluorescence. A dot-blot autoradiographic signal was obtained in three lines which were negative for CDV antigen. CDV RNA was detected in both lytically and persistently infected cell lines by in situ hybridization, where decreasing probe length was important in increasing the sensitivity of this assay. Viral RNA was detected in over 90% of the lytically infected cells, where only 70% were positive for viral antigen by immunofluorescence.

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

Differential Gene Expression at Coral Settlement and Metamorphosis - A Subtractive Hybridization Study

PubMed Central

Hayward, David C.; Hetherington, Suzannah; Behm, Carolyn A.; Grasso, Lauretta C.; Forêt, Sylvain; Miller, David J.; Ball, Eldon E.

2011-01-01

Background A successful metamorphosis from a planktonic larva to a settled polyp, which under favorable conditions will establish a future colony, is critical for the survival of corals. However, in contrast to the situation in other animals, e.g., frogs and insects, little is known about the molecular basis of coral metamorphosis. We have begun to redress this situation with previous microarray studies, but there is still a great deal to learn. In the present paper we have utilized a different technology, subtractive hybridization, to characterize genes differentially expressed across this developmental transition and to compare the success of this method to microarray. Methodology/Principal Findings Suppressive subtractive hybridization (SSH) was used to identify two pools of transcripts from the coral, Acropora millepora. One is enriched for transcripts expressed at higher levels at the pre-settlement stage, and the other for transcripts expressed at higher levels at the post-settlement stage. Virtual northern blots were used to demonstrate the efficacy of the subtractive hybridization technique. Both pools contain transcripts coding for proteins in various functional classes but transcriptional regulatory proteins were represented more frequently in the post-settlement pool. Approximately 18% of the transcripts showed no significant similarity to any other sequence on the public databases. Transcripts of particular interest were further characterized by in situ hybridization, which showed that many are regulated spatially as well as temporally. Notably, many transcripts exhibit axially restricted expression patterns that correlate with the pool from which they were isolated. Several transcripts are expressed in patterns consistent with a role in calcification. Conclusions We have characterized over 200 transcripts that are differentially expressed between the planula larva and post-settlement polyp of the coral, Acropora millepora. Sequence, putative function, and in some cases temporal and spatial expression are reported. PMID:22065994

A Record-High Ocean Bottom Pressure in the South Pacific Observed by GRACE

NASA Technical Reports Server (NTRS)

Boening, Carmen; Lee, Tong; Zlotnicki, Victor

2011-01-01

In late 2009 to early 2010, the Gravity Recovery and Climate Experiment (GRACE) satellite pair observed a record increase in ocean bottom pressure (OBP) over a large mid-latitude region of the South East Pacific. Its magnitude is substantially larger than other oceanic events in the Southern Hemisphere found in the entire GRACE data records (2003-2010) on multi-month time scales. The OBP data help to understand the nature of a similar signal in sea surface height (SSH) anomaly observed by altimetry: the SSH increase is mainly due to mass convergence. Analysis of the barotropic vorticity equation using scatterometer data, atmospheric reanalysis product, and GRACE and altimeter an atmospheric reanalysis product observations suggests that the observed OBP/SSH signal was primarily caused by wind stress curl associated with a strong and persistent anticyclone in late 2009 in combination with effects of planetary vorticity gradient, bottom topography, and friction

Cloning, expression analysis, and chromosomal localization of HIP1R, an isolog of huntingtin interacting protein (HIP1).

PubMed

Seki, N; Muramatsu, M; Sugano, S; Suzuki, Y; Nakagawara, A; Ohhira, M; Hayashi, A; Hori, T; Saito, T

1998-01-01

Huntington disease (HD) is an inherited neurodegenerative disorder which is associated with CAG expansion in the coding region of the gene for huntingtin protein. Recently, a huntingtin interacting protein, HIP1, was isolated by the yeast two-hybrid system. Here we report the isolation of a cDNA clone for HIP1R (huntingtin interacting protein-1 related), which encodes a predicted protein product sharing a striking homology with HIP1. RT-PCR analysis showed that the messenger RNA was ubiquitously expressed in various human tissues. Based on PCR-assisted analysis of a radiation hybrid panel and fluorescence in situ hybridization, HIP1R was localized to the q24 region of chromosome 12.

Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Claffey, K.P.; Herrera, V.L.; Brecher, P.

1987-12-01

A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

An RNA isolation system for plant tissues rich in secondary metabolites

PubMed Central

2011-01-01

Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

PubMed

Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

2006-07-01

To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

PubMed

Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2015-02-02

Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Modulations of RNA sequences by cytokinin in pumpkin cotyledons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, C.; Ertl, J.; Chen, C.

1987-04-01

Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10/sup -4/ M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of (/sup 35/S) methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs aremore » modulated upward or downward by the hormone.« less

[Identification of genes that are specifically/preferentially expressed in developing cotton fibers by mRNA fluorescence differential display (FDD)].

PubMed

Sun, Jie; Li, Yuan-Li; Wang, Ruo-Hai; Xia, Gui-Xian

2004-01-01

Fluorescence differential display (FDD) technique was used to identify genes that are specifically or preferentially expressed in different developmental stages of cotton fiber cells. One hundred and nine differentially displayed cDNA fragments were isolated using 9, 21 and 27 DPA (days postanthesis) fibers as experimental materials. By a combination of two rounds of reverse Northern hybridization and Northern blot analyses, a number of such cDNA fragments were proved to represent fiber-specific/preferential genes. Sequencing determination and database searching indicated that most of these genes are novel. This work is an important step towards cloning the full-length cDNAs and characterizing the cellular functions of aforementioned genes in fiber development.

Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Livi, G.P.; McHale, M.J.; Sathe, G.M.

1990-06-01

The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

Isolation and expression of homeobox genes from the embryonic chicken eye.

PubMed

Dhawan, R R; Schoen, T J; Beebe, D C

1997-06-11

To identify homeobox-containing genes that may play a role in the differentiation of ocular tissues. Total RNA was isolated from microdissected chicken embryo eye tissues at 3.5 days of development (embryonic day 3.5; E3.5). An "anchor-oligo-dT primer" was used for the synthesis of cDNA. Degenerate oligonucleotides designed from highly-conserved sequences in the third helix of the homeobox and the "anchor-primer" were used to amplify cDNAs by polymerase chain reaction (PCR). PCR products were cloned and sequenced. The spatial and temporal expression of selected transcripts was mapped by whole-mount in situ hybridization and northern blot analysis. After sequencing eighteen clones we identified a member of the distal-less family (dlx-3) in cDNA from presumptive neural retina and three chicken homologs of the Xenopus "anterior neural fold" (Xanf-1) in cDNA from anterior eye tissue. Dlx transcripts were mapped by in situ hybridization. Expression began at Hamburger and Hamilton stage 14 (E2.5) and was widely distributed in embryonic mesenchyme on E3 and E4. Expression increased in the retina during early development and persisted until after hatching. The one anf clone selected for further study was not detected by in situ or northern blot analysis. It is feasible to isolate homeobox cDNAs directly from microdissected embryonic tissues. Chicken dlx-3 mRNA has a wider distribution in the embryo than expected, based on the expression of the mouse homolog. Dlx-3 may play a role in establishing or maintaining the differentiation of the retina.

Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

PubMed

Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

2008-03-31

We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

Phosducin-like protein: an ethanol-responsive potential modulator of guanine nucleotide-binding protein function.

PubMed

Miles, M F; Barhite, S; Sganga, M; Elliott, M

1993-11-15

Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.

High-performance and versatile electrochemical aptasensor based on self-supported nanoporous gold microelectrode and enzyme-induced signal amplification.

PubMed

Shi, Lei; Rong, Xiaojiao; Wang, Yan; Ding, Shiming; Tang, Wanying

2018-04-15

Herein, novel and versatile electrochemical aptasensors were constructed on a self-supported nanoporous gold (np-Au) microelectrode, integrating with an exonuclease III (Exo III) induced signal amplification strategy. Self-supported np-Au microelectrode with 3D bicontinuous nanoporous structures possesses tremendously large specific area, clean surface, high stability and biocompatibility, bringing about significant advantages in both molecular recognition and signal response. As paradigms, two analytes of bisphenol A (BPA) and ochratoxin A (OTA) were selected to demonstrate the superiority and versatility of designed aptasensors. Trace amounts of mDNA (associated with BPA or OTA concentration) hybridized with cDNA strands assembled on np-Au microelectrode, activating the cleavage reaction with Exo III. Thus, cDNA was digested and mDNA was released to undergo a new hybridization and cleavage cycle. Finally, residual cDNA strands were recognized by methylene blue labelled rDNA/AuNPs with the assistance of hDNA to generate the electrochemical signals, which were used to quantitatively monitor targets. Under the optimized conditions, prepared aptasensors exhibited wide linear ranges (25pg/mL to 2ng/mL for BPA, 10pg/mL to 5ng/mL for OTA) with ultralow detection limits (10pg/mL for BPA, 5pg/mL for OTA), excellent selectivity and stability, and reliable detection in real samples. This work opens a new horizon for constructing promising electrochemical aptasensors for environmental monitoring, medical diagnostics and food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Reporting Errors in Siblings’ Survival Histories and Their Impact on Adult Mortality Estimates: Results From a Record Linkage Study in Senegal

PubMed Central

Helleringer, Stéphane; Pison, Gilles; Kanté, Almamy M.; Duthé, Géraldine; Andro, Armelle

2014-01-01

Estimates of adult mortality in countries with limited vital registration (e.g., sub-Saharan Africa) are often derived from information about the survival of a respondent’s siblings. We evaluated the completeness and accuracy of such data through a record linkage study conducted in Bandafassi, located in southeastern Senegal. We linked at the individual level retrospective siblings’ survival histories (SSH) reported by female respondents (n = 268) to prospective mortality data and genealogies collected through a health and demographic surveillance system (HDSS). Respondents often reported inaccurate lists of siblings. Additions to these lists were uncommon, but omissions were frequent: respondents omitted 3.8 % of their live sisters, 9.1 % of their deceased sisters, and 16.6 % of their sisters who had migrated out of the DSS area. Respondents underestimated the age at death of the siblings they reported during the interview, particularly among siblings who had died at older ages (≥45 years). Restricting SSH data to person-years and events having occurred during a recent reference period reduced list errors but not age and date errors. Overall, SSH data led to a 20 % underestimate of 45q15 relative to HDSS data. Our study suggests new quality improvement strategies for SSH data and demonstrates the potential use of HDSS data for the validation of “unconventional” demographic techniques. PMID:24493063

Reporting errors in siblings' survival histories and their impact on adult mortality estimates: results from a record linkage study in Senegal.

PubMed

Helleringer, Stéphane; Pison, Gilles; Kanté, Almamy M; Duthé, Géraldine; Andro, Armelle

2014-04-01

Estimates of adult mortality in countries with limited vital registration (e.g., sub-Saharan Africa) are often derived from information about the survival of a respondent's siblings. We evaluated the completeness and accuracy of such data through a record linkage study conducted in Bandafassi, located in southeastern Senegal. We linked at the individual level retrospective siblings' survival histories (SSH) reported by female respondents (n = 268) to prospective mortality data and genealogies collected through a health and demographic surveillance system (HDSS). Respondents often reported inaccurate lists of siblings. Additions to these lists were uncommon, but omissions were frequent: respondents omitted 3.8 % of their live sisters, 9.1 % of their deceased sisters, and 16.6 % of their sisters who had migrated out of the DSS area. Respondents underestimated the age at death of the siblings they reported during the interview, particularly among siblings who had died at older ages (≥45 years). Restricting SSH data to person-years and events having occurred during a recent reference period reduced list errors but not age and date errors. Overall, SSH data led to a 20 % underestimate of 45 q 15 relative to HDSS data. Our study suggests new quality improvement strategies for SSH data and demonstrates the potential use of HDSS data for the validation of "unconventional" demographic techniques.

SSH-2 measurements of cirrus at 18-28 micrometers from the King Air during FIRE 2

NASA Technical Reports Server (NTRS)

Griffin, Michael K.

1993-01-01

In November of 1991, the First ISCCP (International Satellite Cloud Climatology Project) Regional Experiment (FIRE) Phase II cirrus study took place at Coffeyville, Kansas. The field experiment incorporated instrumentation from surface, aircraft, and satellite to attempt to define the optical, radiative, and microphysical characteristics of these high altitude, predominantly ice clouds. The NCAR King Air research aircraft was outfitted with a variety of radiative and microphysical instrumentation for the FIRE II project. Included for this project was the SSH-2, a 16-channel passive radiometer. The SSH-2 was originally designed as a space-qualified infrared (IR) temperature and water vapor sounder for deployment onboard the Defense Meteorological Satellite Program (DMSP) series of environmental satellites. For this experiment, only those channels associated with the water vapor profiling function have been examined although downwelling radiance measurements were taken at all channels during the project. With supporting information from the aircraft telemetry observations it may be possible to relate these SSH-2 measurements to cloud radiative and microphysical properties. The following sections will describe the spectral characteristics of the instrument, the calibration scheme used to convert the raw measured counts into calibrated radiances, and the case studies that will be covered in this paper. This will be followed by a discussion of the results of this preliminary investigation and a description of future work to be done.

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

What role for social sciences in socio-hydrology? Results from an online survey among hydrologists

NASA Astrophysics Data System (ADS)

Seidl, Roman; Barthel, Roland; Stauffacher, Michael

2015-04-01

The necessity of a more integrated approach in hydrological research has been highlighted by the IAHS scientific decade 2013-2022 "Panta Rhei", dedicated to foster multi-disciplinary research activities on changes in hydrology and society (Montanari, Young et al. 2013). On a similar note, the concept of Socio-Hydrology (Sivapalan, Savenije et al. 2012) suggests a much deeper involvement of hydrologists in socio-economic questions. Despite this general consensus, it remains unclear how such interdisciplinary approaches should be carried out and, in particular, which roles hydrological sciences (HS) and social sciences and the humanities (SSH) should assume. In order to evaluate the opinion of HS on the mutual contributions of HS and SSH to the process of integration, an online survey was prepared by the authors and announced through the newsletters of the International Association of Hydrogeologists (IAH) and the International Association of Hydrological Sciences (IAHS). Two sets of questions offered a choice of potential contributions to interdisciplinary processes of HS and SSH respectively. A third group of questions asked for the status of integration of HS and SSH and if improvements are needed. Finally, participants were asked to rank different options to foster or improve cooperation between natural and social scientists. 141 questionnaires could be used for further analysis. As expected the background of most participants is hydrology, but many also mention more than one discipline. Most participants have their main place of work in Europe. The answers were analysed using Factor and Cluster analysis to reveal potential patterns in the data. The main results from the survey can be summarized like this: The majority of respondents agrees that SSH is not well integrated into hydrological research as yet and most participants see a need for better cooperation. Expectations from hydrologists who should do what in integrative work, reveal that some roles are perceived similarly for both SSH and HS: Facilitate resource management, Exchange knowledge, Communicate the results, Reflect about the normative aspects, Secure public acceptance. However, hydrologists assume it is clearly more the role of SSH to study socio-economic aspects and the impact of human decisions on the environment, for instance. Higher status and acknowledgment by other colleagues does not seem to be a major incentive for integrative work, ranking lowest of all offered statements. However, the statement Hydrologists themselves should consider and integrate socio-economic aspects in their own work, was rated most often as most preferable. One can speculate that hydrologists (at least many in our sample) would like to learn from SSH but then apply that knowledge themselves; that is, "integrate" social science tasks into their field, or rather into a new discipline, socio-hydrology but not collaborate at eye-level with social scientists. We conclude that researchers interested in the integration of disciplines should explicitly specify how they would like to achieve this, what mutual expectations they have. In the case of the Panta Rhei initiative or Social Hydrology, this seems neither evident nor explicitly done. References: Montanari, A., et al. (2013). ""Panta Rhei -- Everything Flows": Change in hydrology and society -- The IAHS Scientific Decade 2013-2022." Hydrological Sciences Journal: 1-20. Sivapalan, M., et al. (2012). "Socio-hydrology: A new science of people and water." Hydrological Processes 26(8): 1270-1276.

A next generation altimeter for mapping the sea surface height variability: opportunities and challenges

NASA Astrophysics Data System (ADS)

Fu, Lee-Lueng; Morrow, Rosemary

2016-07-01

The global observations of the sea surface height (SSH) have revolutionized oceanography since the beginning of precision radar altimetry in the early 1990s. For the first time we have continuous records of SSH with spatial and temporal sampling for detecting the global mean sea level rise, the waxing and waning of El Niño, and the ocean circulation from gyres to ocean eddies. The limit of spatial resolution of the present constellation of radar altimeters in mapping SSH variability is approaching 100 km (in wavelength) with 3 or more simultaneous altimetric satellites in orbit. At scales shorter than 100 km, the circulation contains substantial amount of kinetic energy in currents, eddies and fronts that are responsible for the stirring and mixing of the ocean, especially from the vertical exchange of the upper ocean with the deep. A mission currently in development will use the technique of radar interferometry for making high-resolution measurement of the height of water over the ocean as well as on land. It is called Surface Water and Ocean Topography (SWOT), which is a joint mission of US NASA and French CNES, with contributions from Canada and UK. SWOT promises the detection of SSH at scales approaching 15 km, depending on the sea state. SWOT will make SSH measurement over a swath of 120 km with a nadir gap of 20 km in a 21-day repeat orbit. A conventional radar altimeter will provide measurement along the nadir. This is an exploratory mission with applications in oceanography and hydrology. The increased spatial resolution offers an opportunity to study ocean surface processes to address important questions about the ocean circulation. However, the limited temporal sampling poses challenges to map the evolution of the ocean variability that changes rapidly at the small scales. The measurement technique and the development of the mission will be presented with emphasis on its science program with outlook on the opportunities and challenges.

Effects of Sacubitril/Valsartan (LCZ696) on Natriuresis, Diuresis, Blood Pressures, and NT-proBNP in Salt-Sensitive Hypertension.

PubMed

Wang, Tzung-Dau; Tan, Ru-San; Lee, Hae-Young; Ihm, Sang-Hyun; Rhee, Moo-Yong; Tomlinson, Brian; Pal, Parasar; Yang, Fan; Hirschhorn, Elizabeth; Prescott, Margaret F; Hinder, Markus; Langenickel, Thomas H

2017-01-01

Salt-sensitive hypertension (SSH) is characterized by impaired sodium excretion and subnormal vasodilatory response to salt loading. Sacubitril/valsartan (LCZ696) was hypothesized to increase natriuresis and diuresis and result in superior blood pressure control compared with valsartan in Asian patients with SSH. In this randomized, double-blind, crossover study, 72 patients with SSH received sacubitril/valsartan 400 mg and valsartan 320 mg once daily for 4 weeks each. SSH was diagnosed if the mean arterial pressure increased by ≥10% when patients switched from low (50 mmol/d) to high (320 mmol/d) sodium diet. The primary outcome was cumulative 6- and 24-hour sodium excretion after first dose administration. Compared with valsartan, sacubitril/valsartan was associated with a significant increase in natriuresis (adjusted treatment difference: 24.5 mmol/6 hours, 50.3 mmol/24 hours, both P<0.001) and diuresis (adjusted treatment difference: 291.2 mL/6 hours, P<0.001; 356.4 mL/24 hours, P=0.002) on day 1, but not on day 28, and greater reductions in office and ambulatory blood pressure on day 28. Despite morning dosing of both drugs, ambulatory blood pressure reductions were more pronounced at nighttime than at daytime or the 24-hour average. Compared with valsartan, sacubitril/valsartan significantly reduced N-terminal pro B-type natriuretic peptide levels on day 28 (adjusted treatment difference: -20%; P=0.001). Sacubitril/valsartan and valsartan were safe and well tolerated with no significant changes in body weight or serum sodium and potassium levels with either treatments. In conclusion, sacubitril/valsartan compared with valsartan was associated with short-term increases in natriuresis and diuresis, superior office and ambulatory blood pressure control, and significantly reduced N-terminal pro B-type natriuretic peptide levels in Asian patients with SSH. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01681576. © 2016 American Heart Association, Inc.

Gene Expression in the Scleractinian Acropora microphthalma Exposed to High Solar Irradiance Reveals Elements of Photoprotection and Coral Bleaching

PubMed Central

Starcevic, Antonio; Dunlap, Walter C.; Cullum, John; Shick, J. Malcolm; Hranueli, Daslav; Long, Paul F.

2010-01-01

Background The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH) from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues. Methodology/Principal Findings A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs), which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a ‘shared metabolic adaptation’ between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca2+-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis. Conclusions/Significance Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching. PMID:21103042

Gene regulation by NMDA receptor activation in the SDN-POA neurons of male rats during sexual development.

PubMed

Hsu, Hseng-Kuang; Shao, Pei-Lin; Tsai, Ke-Li; Shih, Huei-Chuan; Lee, Tzu-Ying; Hsu, Chin

2005-04-01

The present study was designed to identify possible signaling pathways, which may play a role in prevention of neuronal apoptosis in the sexually dimorphic nucleus of the preoptic area (SDN-POA) after physiological activation of the N-methyl-D-aspartate (NMDA) receptor. Gene response to the blockage of the NMDA receptor by an antagonist (dizocilpine hydrogen maleate; MK-801) was screened after suppression subtractive hybridization (SSH). The results showed that differential screening after SSH detected the presence of some neurotrophic genes (RNA binding motif protein 3 (RBM3), alpha-tubulin) as well as apoptosis-related genes (Bcl-2, cytochrome oxidase subunit II, cytochrome oxidase subunit III) in the SDN-POA of male rats, which were down-regulated by blocking the NMDA receptor. The RT-PCR products of the aforementioned genes in MK-801-treated males were significantly less than that in untreated males. In particular, the expression of Bcl-2 mRNA, including Bcl-2 protein, in male rats were significantly suppressed by MK-801 treatment. Moreover, the binding activity of nuclear factor kappaB (NFkappaB) was significantly higher in male rats than in females, but significantly diminished by blocking the NMDA receptor with MK-801 in male rats. No significant difference in cAMP response element-binding protein (CREB) binding activity was observed among untreated male, MK-801-treated male, untreated female and MK-801-treated female groups. These results suggest that genes regulated by NMDA receptor activation might participate in neuronal growth and/or anti-apoptosis, and support an important signaling pathway of NFkappaB activation and its target gene, Bcl-2, in preventing neuronal apoptosis in the SDN-POA of male rats during sexual development.

Fine-tuning of the flavonoid and monolignol pathways during apple early fruit development.

PubMed

Baldi, Paolo; Moser, Mirko; Brilli, Matteo; Vrhovsek, Urska; Pindo, Massimo; Si-Ammour, Azeddine

2017-05-01

A coordinated regulation of different branches of the flavonoid pathway was highlighted that may contribute to elucidate the role of this important class of compounds during the early stages of apple fruit development. Apple (Malus × domestica Borkh.) is an economically important fruit appreciated for its organoleptic characteristics and its benefits for human health. The first stages after fruit set represent a very important and still poorly characterized developmental process. To enable the profiling of genes involved in apple early fruit development, we combined the suppression subtractive hybridization (SSH) protocol to next-generation sequencing. We identified and characterized genes induced and repressed during fruit development in the apple cultivar 'Golden Delicious'. Our results showed an opposite regulation of genes coding for enzymes belonging to flavonoid and monolignol pathways, with a strong induction of the former and a simultaneous repression of the latter. Two isoforms of phenylalanine ammonia-lyase and 4-coumarate:CoA ligase, key enzymes located at the branching point between flavonoid and monolignol pathways, showed opposite expression patterns during the period in analysis, suggesting a possible regulation mechanism. A targeted metabolomic analysis supported the SSH results and revealed an accumulation of the monomers catechin and epicatechin as well as several forms of procyanidin oligomers in apple fruitlets starting early after anthesis, together with a decreased production of other classes of flavonoids such as some flavonols and the dihydrochalcone phlorizin. Moreover, gene expression and metabolites accumulation of 'Golden Delicious' were compared to a wild apple genotype of Manchurian crabapple (Malus mandshurica (Maxim.) Kom.). Significant differences in both gene expression and metabolites accumulation were found between the two genotypes.

Identification of differentially expressed genes of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss) in response to Tetracapsuloides bryosalmonae (Myxozoa).

PubMed

Kumar, Gokhlesh; Abd-Elfattah, Ahmed; El-Matbouli, Mansour

2015-03-01

Tetracapsuloides bryosalmonae Canning et al., 1999 (Myxozoa) is the causative agent of proliferative kidney disease in various species of salmonids in Europe and North America. We have shown previously that the development and distribution of the European strain of T. bryosalmonae differs in the kidney of brown trout (Salmo trutta) Linnaeus, 1758 and rainbow trout (Oncorhynchus mykiss) Walbaum, 1792, and that intra-luminal sporogonic stages were found in brown trout but not in rainbow trout. We have now compared transcriptomes from kidneys of brown trout and rainbow trout infected with T. bryosalmonae using suppressive subtractive hybridization (SSH). The differentially expressed transcripts produced by SSH were cloned, transformed, and tested by colony PCR. Differential expression screening of PCR products was validated using dot blot, and positive clones having different signal intensities were sequenced. Differential screening and a subsequent NCBI-BLAST analysis of expressed sequence tags revealed nine clones expressed differently between both fish species. These differentially expressed genes were validated by quantitative real-time PCR of kidney samples from both fish species at different time points of infection. Expression of anti-inflammatory (TSC22 domain family protein 3) and cell proliferation (Prothymin alpha) genes were upregulated significantly in brown trout but downregulated in rainbow trout. The expression of humoral immune response (immunoglobulin mu) and endocytic pathway (Ras-related protein Rab-11b) genes were significantly upregulated in rainbow trout but downregulated in brown trout. This study suggests that differential expression of host anti-inflammatory, humoral immune and endocytic pathway responses, cell proliferation, and cell growth processes do not inhibit the development of intra-luminal sporogonic stages of the European strain of T. bryosalmonae in brown trout but may suppress it in rainbow trout.

Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

PubMed

Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

2015-01-15

This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Selective interaction between Chloroplast B ATPase and TGB1 retards severe symptoms caused by Alternanthera mosaic virus infection

USDA-ARS?s Scientific Manuscript database

The multifunctional triple gene block protein 1 (TGB1) of the Potexvirus Alternanthera mosaic virus (AltMV) has been reported to have silencing suppressor, cell-to-cell movement, and helicase functions. Yeast two hybrid screening using an Arabidopsis thaliana cDNA library with TGB1 as bait, and co-p...

Isolation of candidate genes for apomictic development in buffelgrass (Pennisetum ciliare).

PubMed

Singh, Manjit; Burson, Byron L; Finlayson, Scott A

2007-08-01

Asexual reproduction through seeds, or apomixis, is a process that holds much promise for agricultural advances. However, the molecular mechanisms underlying apomixis are currently poorly understood. To identify genes related to female gametophyte development in apomictic ovaries of buffelgrass (Pennisetum ciliare (L.) Link), Suppression Subtractive Hybridization of ovary cDNA with leaf cDNA was performed. Through macroarray screening of subtracted cDNAs two genes were identified, Pca21 and Pca24, that showed differential expression between apomictic and sexual ovaries. Sequence analysis showed that both Pca21 and Pca24 are novel genes not previously characterized in plants. Pca21 shows homology to two wheat genes that are also expressed during reproductive development. Pca24 has similarity to coiled-coil-helix-coiled-coil-helix (CHCH) domain containing proteins from maize and sugarcane. Northern blot analysis revealed that both of these genes are expressed throughout female gametophyte development in apomictic ovaries. In situ hybridizations localized the transcript of these two genes to the developing embryo sacs in the apomictic ovaries. Based on the expression patterns it was concluded that Pca21 and Pca24 likely play a role during apomictic development in buffelgrass.

The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

1993-01-01

Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

Isolation and characterization of a novel acidic matrix protein hic22 from the nacreous layer of the freshwater mussel, Hyriopsis cumingii.

PubMed

Liu, X J; Jin, C; Wu, L M; Dong, S J; Zeng, S M; Li, J L

2016-07-29

Matrix proteins that either weakly acidic or unusually highly acidic have important roles in shell biomineralization. In this study, we have identified and characterized hic22, a weakly acidic matrix protein, from the nacreous layer of Hyriopsis cumingii. Total protein was extracted from the nacre using 5 M EDTA and hic22 was purified using a DEAE-sepharose column. The N-terminal amino acid sequence of hic22 was determined and the complete cDNA encoding hic22 was cloned and sequenced by rapid amplification of cDNA ends-polymerase chain reaction. Finally, the localization and distribution of hic22 was determined by in situ hybridization. Our results revealed that hic22 encodes a 22-kDa protein composed of 185 amino acids. Tissue expression analysis and in situ hybridization indicated that hic22 is expressed in the dorsal epithelial cells of the mantle pallial; moreover, significant expression levels of hic22 were observed after the early formation of the pearl sac (days 19-77), implying that hic22 may play an important role in biomineralization of the nacreous layer.

Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

PubMed

Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

2002-07-01

In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Dreyfus, P.; Soreq, H.

1989-01-01

A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-06-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

Comparison of the Predictive Accuracy of DNA Array-Based Multigene Classifiers across cDNA Arrays and Affymetrix GeneChips

PubMed Central

Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos

2005-01-01

We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308

FragIdent--automatic identification and characterisation of cDNA-fragments.

PubMed

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

An SSH key management system: easing the pain of managing key/user/account associations

NASA Astrophysics Data System (ADS)

Arkhipkin, D.; Betts, W.; Lauret, J.; Shiryaev, A.

2008-07-01

Cyber security requirements for secure access to computing facilities often call for access controls via gatekeepers and the use of two-factor authentication. Using SSH keys to satisfy the two factor authentication requirement has introduced a potentially challenging task of managing the keys and their associations with individual users and user accounts. Approaches for a facility with the simple model of one remote user corresponding to one local user would not work at facilities that require a many-to-many mapping between users and accounts on multiple systems. We will present an SSH key management system we developed, tested and deployed to address the many-to-many dilemma in the environment of the STAR experiment. We will explain its use in an online computing context and explain how it makes possible the management and tracing of group account access spread over many sub-system components (data acquisition, slow controls, trigger, detector instrumentation, etc.) without the use of shared passwords for remote logins.

California serogroup and Powassan virus infection of cats.

PubMed

Keane, D P; Parent, J; Little, P B

1987-08-01

One hundred and seventy five sera from cats in Ontario, Canada, were tested for hemagglutination inhibition (HI) antibodies to three arboviruses; namely, Powassan (POW) of the Flavivirus serogroup, and Snowshoe hare (SSH) and Jamestown Canyon (JC) viruses of the California (CAL) serogroup. All sera were negative for antibodies to POW virus. Twelve cats possessed CAL serogroup antibodies including 3 with antibodies to SSH alone, 6 with antibodies to JC alone, and 3 with antibodies to both SSH and JC antigens. POW virus was inoculated into seven cats, one intracerebrally and six intravenously. Neurologic signs were not detected in any of the cats. Histologic lesions of a nonsuppurative encephalitis and encephalomyelitis were observed in the intracerebrally inoculated cat and in one of the intravenously inoculated cats, respectively. POW virus was not isolated from the brain or spinal cord of either of these two cats. HI antibodies were detected in the sera of all inoculated animals. HI antibodies were not detected in the CSF of any animal.

Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

PubMed

Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

2012-01-01

Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

Using OpenSSH to secure mobile LAN network traffic

NASA Astrophysics Data System (ADS)

Luu, Brian B.; Gopaul, Richard D.

2002-08-01

Mobile Internet Protocol (IP) Local Area Network (LAN) is a technique, developed by the U.S. Army Research Laboratory, which allows a LAN to be IP mobile when attaching to a foreign IP-based network and using this network as a means to retain connectivity to its home network. In this paper, we describe a technique that uses Open Secure Shell (OpenSSH) software to ensure secure, encrypted transmission of a mobile LAN's network traffic. Whenever a mobile LAN, implemented with Mobile IP LAN, moves to a foreign network, its gateway (router) obtains an IP address from the new network. IP tunnels, using IP encapsulation, are then established from the gateway through the foreign network to a home agent on its home network. These tunnels provide a virtual two-way connection to the home network for the mobile LAN as if the LAN were connected directly to its home network. Hence, when IP mobile, a mobile LAN's tunneled network traffic must traverse one or more foreign networks that may not be trusted. This traffic could be subject to eavesdropping, interception, modification, or redirection by malicious nodes in these foreign networks. To protect network traffic passing through the tunnels, OpenSSH is used as a means of encryption because it prevents surveillance, modification, and redirection of mobile LAN traffic passing across foreign networks. Since the software is found in the public domain, is available for most current operating systems, and is commonly used to provide secure network communications, OpenSSH is the software of choice.

Tumor necrosis factor-α, kidney function, and hypertension.

PubMed

Mehaffey, Eamonn; Majid, Dewan S A

2017-10-01

Hypertension is considered to be a low-grade inflammatory condition characterized by the presence of various proinflammatory cytokines. Tumor necrosis factor-α (TNF-α) is a constituent of the proinflammatory cytokines that is associated with salt-sensitive hypertension (SSH) and related renal injury. Elevated angiotensin II (ANG II) and other factors such as oxidative stress conditions promote TNF-α formation. Many recent studies have provided evidence that TNF-α exerts a direct renal action by regulating hemodynamic and excretory function in the kidney. The cytokine incites a strong natriuretic response and plays a part in regulation of the intrarenal renin-angiotensin system. The exact mechanistic role of TNF-α in the development of SSH is as yet poorly understood. While TNF-α antagonism has been shown to attenuate hypertensive responses in many hypertensive animal models, contrasting findings demonstrate that the direct systemic administration of TNF-α usually induces hypotensive as well as natriuretic responses, indicating a counterregulatory role of TNF-α in SSH. Differential activities of two cell surface receptors of TNF-α (receptor type 1 and type 2) may explain the contradictory functions of TNF-α in the setting of hypertension. This short review will evaluate ongoing research studies that investigate the action of TNF-α within the kidney and its role as an influential pathophysiological variable in the development of SSH and renal injury. This information may help to develop specific TNF-α receptor targeting as an effective treatment strategy in this clinical condition. Copyright © 2017 the American Physiological Society.

Interdisciplinary promises versus practices in medicine: the decoupled experiences of social sciences and humanities scholars.

PubMed

Albert, Mathieu; Paradis, Elise; Kuper, Ayelet

2015-02-01

This paper explores social scientists' and humanities (SSH) scholars' integration within the academic medical research environment. Three questions guided our investigation: Do SSH scholars adapt to the medical research environment? How do they navigate their career within a culture that may be inconsistent with their own? What strategies do they use to gain legitimacy? The study builds on three concepts: decoupling, doxa, and epistemic habitus. Twenty-nine semi-structured interviews were conducted with SSH scholars working in 11 faculties of medicine across Canada. Participants were selected through purposeful and snowball sampling. The data were analyzed by thematic content analysis. For most of our participants, moving into medicine has been a challenging experience, as their research practices and views of academic excellence collided with those of medicine. In order to achieve some level of legitimacy more than half of our participants altered their research practices. This resulted in a dissonance between their internalized appreciation of academic excellence and their new, altered, research practices. Only six participants experienced no form of challenge or dissonance after moving into medicine, while three decided to break with their social science and humanities past and make the medical research community their new home. We conclude that the work environment for SSH scholars in faculties of medicine does not deliver on the promise of inclusiveness made by calls for interdisciplinarity in Canadian health research. Copyright © 2014 Elsevier Ltd. All rights reserved.

Determination of Mean Dynamic Topography (MDT) to Bridge Geoid and Mean Sea Surface Height (SSH) with a New Elliptic Equation

NASA Astrophysics Data System (ADS)

Chu, P. C.

2016-12-01

Mean dynamic topography (MDT, η) bridges the geoid and the mean sea surface (from satellite altimetry) and constrains large scale surface geostrophic circulations. It can be estimated from either satellite or underwater ocean temperature (T) and salinity (S) data. Satellite altimeter measures sea surface height (SSH) with high precision and unique resolution above a reference ellipsoid (not geoid). Two Gravity Recovery and Climate Experiment (GRACE) satellites launched in 2002, provide data to compute the marine geoid [called the GRACE Gravity Model (GGM)] (see website: http://www.csr.utexas.edu/grace/). The MDT is the difference of altimetry-derived mean SSH and the mean marine geoid (using GGM or pre-GRACE gravity model such as EGM96). A major difficulty arises that the spatial variations in mean SSH and marine geoid are approximately two orders of magnitude larger than the spatial variations in η.The second approach (using T, Sdata) is based on geostrophic balance, which is at the minimum energy state in the linear Boussinesq primitive equations with conservation of potential vorticity. In this paper, a new elliptic equation, -[∂x(gh/f2)∂xη+∂y(gh/f2)∂yη]+η = (g/f2)(∂C/∂x-∂B/∂y)is derived to determine MDT with H the water depth, g the gravitational acceleration, and coefficients (B, C) depend on 3D mean temperature (T) and salinity (S) data. Numerical approach transforms the elliptic equation into a set of well-posed linear algebraic equations of η at grid points. The solution for the North Atlantic Ocean (100oW-6oW, 7oN-72oN) on 1oX1ogrids with the coefficients (B, C) calculated from the three-dimensional (T, S) data of the NOAA National Centers for Environmental Information (NCEI) World Ocean Atlas 2013 version 2 (http://www.nodc.noaa.gov/OC5/woa13/woa13data.html) and H from the NOAA ETOPO5 (https://www.ngdc.noaa.gov/mgg/fliers/93mgg01.html), compares well with the difference (also considered as the MDT) between the time-averaged SSH and the geoid from the NASA/JPL (http://gracetellus.jpl.nasa.gov/data/dot/). Further application of this elliptic equation method on the high-precision altimetry measurements of SSH such as the Surface Water and Ocean Topography (SWOT) is also presented.

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

PubMed

Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

1995-07-01

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Ranalexin. A novel antimicrobial peptide from bullfrog (Rana catesbeiana) skin, structurally related to the bacterial antibiotic, polymyxin.

PubMed

Clark, D P; Durell, S; Maloy, W L; Zasloff, M

1994-04-08

Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.

The cloning and characterization of a localized maternal transcript in Xenopus laevis whose zygotic counterpart is detected in the CNS.

PubMed

Reddy, B A; Kloc, M; Etkin, L D

1992-12-01

We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.

Expression of lectin genes during seed development in normal and phytohemagglutinin-deficient cultivars of Phaseolus vulgaris.

PubMed

Staswick, P; Chrispeels, M J

1984-01-01

Phytohemagglutinin (PHA), the major lectin of the common bean Phaseolus vulgaris, is synthesized during the development of the seeds. In most cultivars PHA makes up 5-10% of the total seed protein, but certain cultivars do not contain PHA. In vivo labeling of a normal cultivar (Greensleeves) and a PHA-minus cultivar (Pinto 111) showed that PHA was not synthesized in the PHA-minus cultivar. To find out whether the lack of synthesis was due to the absence of mRNA for PHA, recombinant cDNA clones for PHA were obtained. Total poly(A)+ RNA was isolated from cotyledons of developing seeds of Greensleeves and used to direct cDNA synthesis. The double stranded cDNA was cloned in pUC8 and transformants of Escherichia coli screened with pPVL134, a recombinant plasmid which contains the complete coding sequence for a PHA-like protein. Two weakly hybridizing clones (pSC1 and pSC2) were selected. Hybrid selection experiments showed that these two clones selected mRNAs which could be translated into polypeptides identical in size to PHA and recognized by antibodies to PHA. The recombinant pPVL134 selected mRNA which translated into polypeptides which were slightly smaller than those of PHA, and poorly recognized by antibodies to PHA. The recombinant clones were used to demonstrate that the genes for PHA and for the PHA-like protein are under temporal control during seed development. The cultivar Pinto 111, which has no detectable PHA, also has greatly reduced levels of mRNA for PHA. However, the gene for the PHA-like protein encoded by pPVL134 is expressed to the same degree in the cultivars Greensleeves and Pinto 111.

Functional characterization of two flap endonuclease-1 homologues in rice.

PubMed

Kimura, Seisuke; Furukawa, Tomoyuki; Kasai, Nobuyuki; Mori, Yoko; Kitamoto, Hiroko K; Sugawara, Fumio; Hashimoto, Junji; Sakaguchi, Kengo

2003-09-18

Flap endonuclease-1 (FEN-1) is an important enzyme involved in DNA replication and repair. Previously, we isolated and characterized a complementary DNA (cDNA) from rice (Oryza sativa) encoding a protein which shows homology with the eukaryotic flap endonuclease-1 (FEN-1). In this report, we found that rice (O. sativa L. cv. Nipponbare) possessed two FEN-1 homologues designated as OsFEN-1a and OsFEN-1b. The OsFEN-1a and OsFEN-1b genes were mapped to chromosome 5 and 3, respectively. Both genes contained 17 exons and 16 introns. Alignment of OsFEN-1a protein with OsFEN-1b protein showed a high degree of sequence similarity, particularly around the N and I domains. Northern hybridization and in situ hybridization analysis demonstrated preferential expression of OsFEN-1a and OsFEN-1b in proliferating tissues such as the shoot apical meristem or young leaves. The levels of OsFEN-1a and OsFEN-1b expression were significantly reduced when cell proliferation was temporarily halted by the removal of sucrose from the growth medium. When the growth-halted cells began to regrow following the addition of sucrose to the medium, both OsFEN-1a and OsFEN-1b were again expressed at high level. These results suggested that OsFEN-1a and OsFEN-1b are required for cell proliferation. Functional complementation assay suggested that OsFEN-1a cDNA had the ability to complement Saccharomyces cerevisiae rad27 null mutant. On the other hand, OsFEN-1b cDNA could not complement the rad27 mutant. The roles of OsFEN-1a and OsFEN-1b in plant DNA replication and repair are discussed.

dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

PubMed

Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

2015-08-11

The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of floral cells, thus, this technique may have application in floriculture biotechnology.

Implementation of Wetting and Drying in NCOM: Description and Validation Test Report

DTIC Science & Technology

2015-08-04

is mainly affected by the amplitude of the tides and the amount of “set down” of the SSH caused by the winds . The amount of set up or set down at the...coast depends on the strength and direction of the winds and the shape of the local coastline and bathymetry. For example, the gradient of the SSH...between the mouth and head of a bay is approximately proportional to the distance between the mouth and the head of the bay and the magnitude of the wind

1/32 Degree Real-Time Global Ocean Prediction and Value-Added Over 1/16 Degree Resolution

DTIC Science & Technology

2007-07-30

SSH ridge to the south of these eddies are captured by at least one of the two data narrowing the trough, both assisting in cutting off eddy...In Section 3.4, the off from a GFO track a week later (Fig. 3D). Eddy #12 Hawaiian Islands region is used to compare results where was already...Journal of Marine Systems 65 (2007) 3-26 13 The second example is the cluster of 6 small eddies week leading up to 29 Sept. This formed an SSH trough

Comparison of Two Global Ocean Reanalyses, NRL Global Ocean Forecast System (GOFS) and U. Maryland Simple Ocean Data Assimilation (SODA)

NASA Astrophysics Data System (ADS)

Richman, J. G.; Shriver, J. F.; Metzger, E. J.; Hogan, P. J.; Smedstad, O. M.

2017-12-01

The Oceanography Division of the Naval Research Laboratory recently completed a 23-year (1993-2015) coupled ocean-sea ice reanalysis forced by NCEP CFS reanalysis fluxes. The reanalysis uses the Global Ocean Forecast System (GOFS) framework of the HYbrid Coordinate Ocean Model (HYCOM) and the Los Alamos Community Ice CodE (CICE) and the Navy Coupled Ocean Data Assimilation 3D Var system (NCODA). The ocean model has 41 layers and an equatorial resolution of 0.08° (8.8 km) on a tri-polar grid with the sea ice model on the same grid that reduces to 3.5 km at the North Pole. Sea surface temperature (SST), sea surface height (SSH) and temperature-salinity profile data are assimilated into the ocean every day. The SSH anomalies are converted into synthetic profiles of temperature and salinity prior to assimilation. Incremental analysis updating of geostrophically balanced increments is performed over a 6-hour insertion window. Sea ice concentration is assimilated into the sea ice model every day. Following the lead of the Ocean Reanalysis Intercomparison Project (ORA-IP), the monthly mean upper ocean heat and salt content from the surface to 300 m, 700m and 1500 m, the mixed layer depth, the depth of the 20°C isotherm, the steric sea surface height and the Atlantic Meridional Overturning Circulation for the GOFS reanalysis and the Simple Ocean Data Assimilation (SODA 3.3.1) eddy-permitting reanalysis have been compared on a global uniform 0.5° grid. The differences between the two ocean reanalyses in heat and salt content increase with increasing integration depth. Globally, GOFS trends to be colder than SODA at all depth. Warming trends are observed at all depths over the 23 year period. The correlation of the upper ocean heat content is significant above 700 m. Prior to 2004, differences in the data assimilated lead to larger biases. The GOFS reanalysis assimilates SSH as profile data, while SODA doesn't. Large differences are found in the Western Boundary Currents, Southern Ocean and equatorial regions. In the Indian Ocean, the Equatorial Counter Current extends to far to the east and the subsurface flow in the thermocline is too weak in GOFS. The 20°C isotherm is biased 2 m shallow in SODA compared to GOFS, but the monthly anomalies in the depth are highly correlated.

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed Central

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-01-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies. Images PMID:2987946

Up-regulated transcripts in a compatible powdery mildew-grapevine interaction.

PubMed

Fekete, Csaba; Fung, Raymond W M; Szabó, Zoltán; Qiu, Wenping; Chang, Le; Schachtman, Daniel P; Kovács, László G

2009-08-01

Powdery mildews (Erysiphales) are obligate biotrophic pathogens that invade susceptible plant cells without triggering cell death. This suggests a highly adept mechanism of parasitism which enables powdery mildews to avoid detection or evade defenses by their host. To better understand this plant-pathogen interaction, we employed suppression subtractive hybridization (SSH), differential hybridization and quantitative real-time (qRT) PCR for the identification of grapevine (Vitis vinifera L.) genes that were specifically up-regulated in response to the grape powdery mildew Erysiphe necator Schwein. We identified 25 grapevine transcripts that increased in abundance upon infection in leaves of the susceptible host V. vinifera Cabernet Sauvignon. Despite the compatible interaction between the pathogen and plant, several of the E. necator-induced transcripts represented typical defense response genes. Among the transcripts identified were those that encoded a leucine-rich repeat serine/threonine kinase-like receptor, an MYB transcription factor, and two ubiquitination-associated proteins, indicating the stimulation of intracellular signal transduction and regulatory functions. A number of genes characteristic of senescence processes, including metallothioneins, a deoxyribonuclease, an aspartyl protease and a subtilase-like serine protease, also were identified. These transcripts expanded the list of previously identified E. necator-responsive grapevine genes and facilitated a more comprehensive view of the molecular events that underlie this economically important plant-pathogen interaction.

Construction of C35 gene bait recombinants and T47D cell cDNA library.

PubMed

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Tle Triangulation Campaign by Japanese High School Students as a Space Educational Project of the Ssh Consortium Kochi

NASA Astrophysics Data System (ADS)

Yamamoto, Masa-Yuki; Okamoto, Sumito; Miyoshi, Terunori; Takamura, Yuzaburo; Aoshima, Akira; Hinokuchi, Jin

As one of the space educational projects in Japan, a triangulation observation project of TLE (Transient Luminous Events: sprites, elves, blue-jets, etc.) has been carried out since 2006 in collaboration between 29 Super Science High-schools (SSH) and Kochi University of Technol-ogy (KUT). Following with previous success of sprite observations by "Astro High-school" since 2004, the SSH consortium Kochi was established as a national space educational project sup-ported by Japan Science and Technology Agency (JST). High-sensitivity CCD camera (Watec, Neptune-100) with 6 mm F/1.4 C-mount lens (Fujinon) and motion-detective software (UFO-Capture, SonotaCo) were given to each participating team in order to monitor Northern night sky of Japan with almost full-coverage. During each school year (from April to March in Japan) since 2006, thousands of TLE images were taken by many student teams, with considerably large numbers of successful triangulations, i.e., (School year, Numbers of TLE observations, Numbers of triangulations) are (2006, 43, 3), (2007, 441, 95), (2008, 734, 115), and (2009, 337, 78). Note that, school year in Japan begins on April 1 and ends on March 31. The observation campaign began in December 2006, numbers are as of Feb. 28, 2010. Recently, some high schools started wide field observations using multiple cameras, and others started VLF observations using handmade loop antennae and amplifiers. Infomation exchange among the SSH consortium Kochi is frequently communicated with scientific discussion via KUT's mailing lists. Also, interactions with amateur observers in Japan are made through an internet forum of "SonotaCo Network Japan" (http://sonotaco.jp). Not only as an educational project but also as a scientific one, the project is also in success. In February 2008, simultaneous observations of Elves were obtained, in November 2009 a Giant "Graft-shaped" Sprites driven by Jets was clearly imaged with VLF signals. Most recently, ob-servations of Elves and sprite halos with stripes like wave structures on airglow were successfully imaged in January 2010. In this talk, four years activities of the SSH consortium Kochi will be presented by participating high-school students and teachers with their own impressions.

Planarian homolog of puromycin-sensitive aminopeptidase DjPsa is required for brain regeneration.

PubMed

Wu, Suge; Liu, Bin; Yuan, Zuoqing; Zhang, Xiufang; Liu, Hong; Pang, Qiuxiang; Zhao, Bosheng

2017-06-01

Puromycin-sensitive aminopeptidase (PSA) belongs to the M1 zinc metallopeptidase family. PSA is the most abundant aminopeptidase in the brain and plays a role in the metabolism of neuropeptides including those involved in neurodegeneration. A cDNA DjPsa was identified from the planarian Dugesia japonica cDNA library. It contains a 639-bp open reading frame corresponding to a deduced protein of 212 amino acids. Whole mount in situ hybridization revealed that DjPsa is expressed in the brain and ventral nerve cords of intact and regenerating animals and demonstrates a tissue and stage-specific expression pattern of DjPsa in developing embryos and larvae. Knocking down DjPsa gene expression with RNA interference during planarian regeneration inhibits the brain reformation completely. The results suggest that DjPsa is required for planarian brain regeneration.

Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

PubMed

Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

2018-04-30

Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Pandolfo, M.

1994-09-01

Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

Evaluation of Oceanic Surface Observation for Reproducing the Upper Ocean Structure in ECHAM5/MPI-OM

NASA Astrophysics Data System (ADS)

Luo, Hao; Zheng, Fei; Zhu, Jiang

2017-12-01

Better constraints of initial conditions from data assimilation are necessary for climate simulations and predictions, and they are particularly important for the ocean due to its long climate memory; as such, ocean data assimilation (ODA) is regarded as an effective tool for seasonal to decadal predictions. In this work, an ODA system is established for a coupled climate model (ECHAM5/MPI-OM), which can assimilate all available oceanic observations using an ensemble optimal interpolation approach. To validate and isolate the performance of different surface observations in reproducing air-sea climate variations in the model, a set of observing system simulation experiments (OSSEs) was performed over 150 model years. Generally, assimilating sea surface temperature, sea surface salinity, and sea surface height (SSH) can reasonably reproduce the climate variability and vertical structure of the upper ocean, and assimilating SSH achieves the best results compared to the true states. For the El Niño-Southern Oscillation (ENSO), assimilating different surface observations captures true aspects of ENSO well, but assimilating SSH can further enhance the accuracy of ENSO-related feedback processes in the coupled model, leading to a more reasonable ENSO evolution and air-sea interaction over the tropical Pacific. For ocean heat content, there are still limitations in reproducing the long time-scale variability in the North Atlantic, even if SSH has been taken into consideration. These results demonstrate the effectiveness of assimilating surface observations in capturing the interannual signal and, to some extent, the decadal signal but still highlight the necessity of assimilating profile data to reproduce specific decadal variability.

Timescales of Equatorward Transport through the Solomon Sea from Glider and Altimetry

NASA Astrophysics Data System (ADS)

Hristova, H. G.; Kessler, W. S.; Davis, R.

2016-12-01

Passage through the semi-enclosed Solomon Sea is the last hurdle in the equatorward journey of the South Pacific western boundary currents before reaching the equator where they contribute to the mass, heat and salt budgets of the equatorial Pacific. We use satellite sea surface height (SSH) and in-situ data from 10 years of glider observations in the Solomon Sea to relate surface geostrophic currents to equatorward transport variability estimated from the gliders. The interior Solomon Sea has enhanced SSH variability compared to the surrounding ocean — its magnitude is largest on ENSO timescales, but also includes significant contributions from the annual and intraseasonal (<120 days) frequencies. Intraseasonal surface variability is dominated by basin-scale, westward propagating disturbances with 60-90 day period, consistent with basin resonance. Because the period of these disturbances is comparable to the time it takes a glider to complete a section across the Sea, the energetic intraseasonal variability is aliased in the glider data and results in section to section spikes in the glider transport estimates. Lower frequency (interannual and annual) SSH correlates well with dynamic height relative to 500m from the glider. Thus, a good lower frequency transport time-series can be obtained from SSH alone. However, the glider provides in addition a vertical structure for the mass transport, as well as estimates of heat and salt transport through the Sea. Two major El Nino events (2009/2010 and 2015/2016) occurred during the glider observation period, both of which show a distinct signature in the mass and heat transport anomalies.

The Global Mode-1 S2 Internal Tide

NASA Astrophysics Data System (ADS)

Zhao, Zhongxiang

2017-11-01

The global mode-1 S2 internal tide is observed using sea surface height (SSH) measurements from four satellite altimeters: TOPEX/Poseidon, Jason-1, Jason-2, and Geosat Follow-On. Plane wave analysis is employed to extract three mode-1 S2 internal tidal waves in any given 250 km by 250 km window, which are temporally coherent over a 20 year period from 1992 to 2012. Depth-integrated energy and flux of the S2 internal tide are calculated from the SSH amplitude and a conversion function built from climatological hydrographic profiles in the World Ocean Atlas 2013. The results show that the S2 and M2 internal tides have similar spatial patterns. Both S2 and M2 internal tides originate at major topographic features and propagate over long distances. The S2 internal tidal beams are generally shorter, likely because the relatively weaker S2 internal tide is easily overwhelmed by nontidal noise. The northbound S2 and M2 internal tides from the Hawaiian Ridge are observed to travel over 3500 km across the Northeast Pacific. The globally integrated energy of the mode-1 S2 internal tide is 7.8 PJ (1 PJ = 1015 J), about 20% that of M2 (36.4 PJ). The histogram of S2 to M2 SSH ratios peaks at 0.4, consistent with the square root of their energy ratio. In terms of SSH, S2 is greater than M2 in ≈10% of the global ocean and ≥50% of M2 in about half of the global ocean.

Repeated psychological stress-induced alterations of visceral sensitivity and colonic motor functions in mice: influence of surgery and postoperative single housing on visceromotor responses.

PubMed

Larauche, Muriel; Gourcerol, Guillaume; Million, Mulugeta; Adelson, David W; Taché, Yvette

2010-07-01

Visceral pain modulation by chronic stress in mice has been little studied. Electromyography (EMG) recording of abdominal muscle contractions, as a proxy to the visceromotor response (VMR), requires electrode implantation and post-surgical single housing (SH) which could affect the VMR to stress. To test this hypothesis, male mice had electrode implantation surgery (S) plus SH, or no surgery and were group housed (NS-GH) or single housed (NS-SH) and exposed to either water avoidance stress (WAS, 1 h/day) or left undisturbed in their home cages for 10 days. The VMR to phasic ascending colorectal distension (CRD) was assessed before (basal) and 24 h after 10 days of WAS or no stress using a surgery-free method of intraluminal colonic pressure (ICP) recording (solid-state manometry). WAS heightened significantly the VMR to CRD at 30, 45, and 60 mmHg in S-SH vs. NS-GH, but not compared to NS-SH conscious mice. Compared to basal CRD, WAS increased VMR at 60 mmHg in the S-SH group and decreased it at 30-60 mmHg in NS-GH mice, while having no effect in NS-SH mice. The average defecation during the hour of repeated WAS over 10 days was 1.9 and 2.4 fold greater in S-SH vs. NS-GH and NS-SH mice, respectively. These data indicate that the combination of S-SH required for VMR monitoring with EMG is an important component of repeated WAS-induced post-stress visceral hypersensitivity and defecation in mice.

Cloning and expression analysis of a transformer gene in Daphnia pulex during different reproduction stages.

PubMed

Chen, Ping; Xu, Shan-Liang; Zhou, Wei; Guo, Xiao-Ge; Wang, Chun-Lin; Wang, Dan-Li; Zhao, Yun-Long

2014-05-01

The full-length cDNA of a transformer gene (Dptra) was cloned from the cladoceran Daphnia pulex using RACE. Dptra expression was assessed by qPCR and whole-mount in situ hybridization in different reproductive stages. The Dptra cDNA, 1652bp in length, has a 1158-bp open reading frame that encodes a 385 amino acid polypeptide containing one Sex determination protein N terminal (SDP_N) superfamily, eight putative phosphorylation sites, and an arginine-serine (RS)-rich domain at the N-terminus. Dptra showed 81%, 53%, 51% and 45% identity to orthologous genes in Daphnia magna, Apis mellifera, Apis cerana and Bombus terrestris, respectively. Phylogenetic analysis based on deduced amino acid sequences revealed that Dptra clustered in the hymenopteran clade and was most closely related to D. magna and A. mellifera. qPCR showed that Dptra expression increased significantly (P<0.05) in different reproductive stages in the following order: male, ephippial female, parthenogenetic female, resting egg and juvenile female. Dptra expression is significantly different between males and females and it is significantly greater in ephippial females and males than in parthenogenetic D. pulex (with summer eggs). Whole-mount in situ hybridization revealed that Dptra was expressed at different levels between males and females. In males, hybridization signals were found in the first antennae, second antennae and thoracic limb, whereas expression levels in the corresponding sites of parthenogenetic and ephippial females were relatively weak. This suggests that the Dptra gene plays significant roles in switching modes of reproduction and in sexual differentiation. Copyright © 2014 Elsevier B.V. All rights reserved.

Expression and distribution of octopus gonadotropin-releasing hormone in the central nervous system and peripheral organs of the octopus (Octopus vulgaris) by in situ hybridization and immunohistochemistry.

PubMed

Iwakoshi-Ukena, Eiko; Ukena, Kazuyoshi; Takuwa-Kuroda, Kyoko; Kanda, Atshuhiro; Tsutsui, Kazuyoshi; Minakata, Hiroyuki

2004-09-20

We recently purified a peptide with structural features similar to vertebrate gonadotropin-releasing hormone (GnRH) from the brain of Octopus vulgaris, cloned a cDNA encoding the precursor protein, and named it oct-GnRH. In the current study, we investigated the expression and distribution of oct-GnRH throughout the central nervous system (CNS) and peripheral organs of Octopus by in situ hybridization on the basis of the cDNA sequence and by immunohistochemistry using a specific antiserum against oct-GnRH. Oct-GnRH mRNA-expressing cell bodies were located in 10 of 19 lobes in the supraesophageal and subesophageal parts of the CNS. Several oct-GnRH-like immunoreactive fibers were seen in all the neuropils of the CNS lobes. The sites of oct-GnRH mRNA expression and the mature peptide distribution were consistent with each other as judged by in situ hybridization and immunohistochemistry. In addition, many immunoreactive fibers were distributed in peripheral organs such as the heart, the oviduct, and the oviducal gland. Modulatory effects of oct-GnRH on the contractions of the heart and the oviduct were demonstrated. The results suggested that, in the context of reproduction, oct-GnRH is a key peptide in the subpedunculate lobe and/or posterior olfactory lobe-optic gland-gonadal axis, an octopus analogue of the hypothalamo-hypophysial-gonadal axis. It may also act as a modulatory factor in controlling higher brain functions such as feeding, memory, movement, maturation, and autonomic functions

[Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

PubMed

Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

2011-07-01

Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

Evaluation of Genomic Instability in the Abnormal Prostate

DTIC Science & Technology

2006-12-01

array CGH maps copy number aberrations relative to the genome sequence by using arrays of BAC or cDNA clones as the hybridization target instead of...data produced from these analyses complicate the interpretation of results . For these reasons, and as outlined by Davies et al., 22 it is desirable...There have been numerous studies of these abnormalities and several techniques, including 9 chromosome painting, array CGH and SNP arrays , have

Overexpression of DEMETER, a DNA demethylase, promotes early apical bud maturation in poplar.

PubMed

Conde, Daniel; Moreno-Cortés, Alicia; Dervinis, Christopher; Ramos-Sánchez, José M; Kirst, Matias; Perales, Mariano; González-Melendi, Pablo; Allona, Isabel

2017-11-01

The transition from active growth to dormancy is critical for the survival of perennial plants. We identified a DEMETER-like (CsDML) cDNA from a winter-enriched cDNA subtractive library in chestnut (Castanea sativa Mill.), an economically and ecologically important species. Next, we characterized this DNA demethylase and its putative ortholog in the more experimentally tractable hybrid poplar (Populus tremula × alba), under the signals that trigger bud dormancy in trees. We performed phylogenetic and protein sequence analysis, gene expression profiling, and 5-methyl-cytosine methylation immunodetection studies to evaluate the role of CsDML and its homolog in poplar, PtaDML6. Transgenic hybrid poplars overexpressing CsDML were produced and analysed. Short days and cold temperatures induced CsDML and PtaDML6. Overexpression of CsDML accelerated short-day-induced bud formation, specifically from Stages 1 to 0. Buds acquired a red-brown coloration earlier than wild-type plants, alongside with the up-regulation of flavonoid biosynthesis enzymes and accumulation of flavonoids in the shoot apical meristem and bud scales. Our data show that the CsDML gene induces bud formation needed for the survival of the apical meristem under the harsh conditions of winter. © 2017 John Wiley & Sons Ltd.

Chromosomal localization and cDNA cloning of the human DBP and TEF genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khatib, Z.A.; Inaba, T.; Valentine, M.

1994-09-15

The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

Su-Schrieffer-Heeger chain with one pair of [Formula: see text]-symmetric defects.

PubMed

Jin, L; Wang, P; Song, Z

2017-07-19

The topologically nontrivial edge states induce [Formula: see text] transition in Su-Schrieffer-Heeger (SSH) chain with one pair of gain and loss at boundaries. In this study, we investigated a pair of [Formula: see text]-symmetric defects located inside the SSH chain, in particular, the defects locations are at the chain centre. The [Formula: see text] symmetry breaking of the bound states leads to the [Formula: see text] transition, the [Formula: see text]-symmetric phases and the localized states were studied. In the broken [Formula: see text]-symmetric phase, all energy levels break simultaneously in topologically trivial phase; however, two edge states in topologically nontrivial phase are free from the influence of the [Formula: see text]-symmetric defects. We discovered [Formula: see text]-symmetric bound states induced by the [Formula: see text]-symmetric local defects at the SSH chain centre. The [Formula: see text]-symmetric bound states significantly increase the [Formula: see text] transition threshold and coalesce to the topologically protected zero mode with vanishing probabilities on every other site of the left-half chain and the right-half chain, respectively.

Pilot-scale bioconversion of rice and sunflower agro-residues into medicinal mushrooms and laccase enzymes through solid-state fermentation with Ganoderma lucidum.

PubMed

Postemsky, P D; Bidegain, M A; González-Matute, R; Figlas, N D; Cubitto, M A

2017-05-01

Solid-state fermentation was evaluated at the pilot-scale for the bioconversion and valorization of rice husks and straw (RSH), or sunflower seed hulls (SSH), into medicinal mushrooms and crude extracts, with laccase activity. The average mushroom yield was 56kg dry weight per ton of agro-residues. Laccase activity in crude aqueous extracts showed its maximum value of 10,927Ukg -1 in RSH (day 10, Exudate phase) and 16,442Ukg -1 in SSH (day 5, Full colonization phase), the activity at the Residual substrate phase being 511Ukg -1 in RSH and 803Ukg -1 in SSH, respectively. Crude extracts obtained with various protocols revealed differences in the extraction yields. Lyophilization followed by storage at 4°C allowed the preservation of laccase activity for more than one month. It is proposed that standard mushroom farms could increase their profits by obtaining laccase as a byproduct during the gaps in mycelium running. Copyright © 2017 Elsevier Ltd. All rights reserved.

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

Development of an eddy-resolving reanalysis using the 1/12° global HYbrid Coordinate Ocean Model and the Navy Coupled Ocean Data Assimilation Scheme

NASA Astrophysics Data System (ADS)

Allard, Richard; Metzger, E. Joseph; Broome, Robert; Franklin, Deborah; Smedstad, Ole Martin; Wallcraft, Alan

2013-04-01

Multiple international agencies have performed atmospheric reanalyses using static dynamical models and assimilation schemes while ingesting all available quality controlled observational data. Some are clearly aimed at climate time scales while others focus on the more recent time period in which assimilated satellite data are used to constrain the system. Typically these are performed at horizontal and vertical resolutions that are coarser than the existing operational atmospheric prediction system. Multiple agencies have also performed ocean reanalyses using some of the atmospheric forcing products described above. However, only a few are eddy-permitting and none are capable of resolving oceanic mesoscale features (eddies and current meanders) across the entire globe. To fill this void, the Naval Research Laboratory is performing an eddy-resolving 1993-2010 ocean reanalysis using the 1/12° global HYbrid Coordinate Ocean Model (HYCOM) that employs the Navy Coupled Ocean Data Assimilation (NCODA) scheme. A 1/12° global HYCOM/NCODA prediction system has been running in real-time at the Naval Oceanographic Office (NAVOCEANO) since 22 December 2006. It has undergone operational testing and will become an operational product by early 2013. It is capable of nowcasting and forecasting the oceanic "weather" which includes the 3D ocean temperature, salinity and current structure, the surface mixed layer, and the location of mesoscale features such as eddies, meandering currents and fronts. The system has a mid-latitude resolution of ~7 km and employs 32 hybrid vertical coordinate surfaces. Compared to traditional isopycnal coordinate models, the hybrid vertical coordinate extends the geographic range of applicability toward shallow coastal seas and the unstratified parts of the world ocean. HYCOM contains a built-in thermodynamic ice model, where ice grows and melts due to heat flux and sea surface temperature (SST) changes, but it does not contain advanced rheological physics. The ice edge is constrained by satellite ice concentration. Once per day, NCODA performs a 3D ocean analysis using all available observational data and the 1-day HYCOM forecast as the first guess in a sequential incremental update cycle. Observational data include surface observations from satellites, including sea surface height (SSH) anomalies, SST, and sea ice concentrations, plus in-situ SST observations from ships and buoys as well as temperature and salinity profiles from XBTs, CTDs and Argo profiling floats. Surface information is projected downward using synthetic profiles from the Modular Ocean Data Assimilation System (MODAS) at those locations with a predefined SSH anomaly. Unlike previous reanalyses, this ocean reanalysis will be integrated at the same horizontal and vertical resolution as the operational system running at NAVOCEANO. The system is forced with atmospheric output from the National Centers for Environmental Prediction (NCEP) Climate Forecast System Reanalysis (CFSR) and the observations listed above. The reanalysis began in 1993 because of the advent of satellite altimeter data that will constrain the oceanic mesoscale. Significant effort has been put into obtaining and quality controlling all input observational data, with special emphasis on the profile data. The computational resources are obtained through the High Performance Computing Modernization Office.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Isolation and characterization of a cDNA from Cuphea lanceolata encoding a beta-ketoacyl-ACP reductase.

PubMed

Klein, B; Pawlowski, K; Höricke-Grandpierre, C; Schell, J; Töpfer, R

1992-05-01

A cDNA encoding beta-ketoacyl-ACP reductase (EC 1.1.1.100), an integral part of the fatty acid synthase type II, was cloned from Cuphea lanceolata. This cDNA of 1276 bp codes for a polypeptide of 320 amino acids with 63 N-terminal residues presumably representing a transit peptide and 257 residues corresponding to the mature protein of 27 kDa. The encoded protein shows strong homology with the amino-terminal sequence and two tryptic peptides from avocado mesocarp beta-ketoacyl-ACP reductase, and its total amino acid composition is highly similar to those of the beta-ketoacyl-ACP reductases of avocado and spinach. Amino acid sequence homologies to polyketide synthase, beta-ketoreductases and short-chain alcohol dehydrogenases are discussed. An engineered fusion protein lacking most of the transit peptide, which was produced in Escherichia coli, was isolated and proved to possess beta-ketoacyl-ACP reductase activity. Hybridization studies revealed that in C. lanceolata beta-ketoacyl-ACP reductase is encoded by a small family of at least two genes and that members of this family are expressed in roots, leaves, flowers and seeds.

In Vitro Synthesized RNA Generated from cDNA Clones of Both Genomic Components of Cucurbit yellow stunting disorder virus Replicates in Cucumber Protoplasts

PubMed Central

Owen, Carolyn A.; Moukarzel, Romy; Huang, Xiao; Kassem, Mona A.; Eliasco, Eleonora; Aranda, Miguel A.; Coutts, Robert H. A.; Livieratos, Ioannis C.

2016-01-01

Cucurbit yellow stunting disorder virus (CYSDV), a bipartite whitefly-transmitted virus, constitutes a major threat to commercial cucurbit production worldwide. Here, construction of full-length CYSDV RNA1 and RNA2 cDNA clones allowed the in vitro synthesis of RNA transcripts able to replicate in cucumber protoplasts. CYSDV RNA1 proved competent for replication; transcription of both polarities of the genomic RNA was detectable 24 h post inoculation. Hybridization of total RNA extracted from transfected protoplasts or from naturally CYSDV-infected cucurbits revealed high-level transcription of the p22 subgenomic RNA species. Replication of CYSDV RNA2 following co-transfection with RNA1 was also observed, with similar transcription kinetics. A CYSDV RNA2 cDNA clone (T3CM8Δ) comprising the 5′- and 3′-UTRs plus the 3′-terminal gene, generated a 2.8 kb RNA able to replicate to high levels in protoplasts in the presence of CYSDV RNA1. The clone T3CM8Δ will facilitate reverse genetics studies of CYSDV gene function and RNA replication determinants. PMID:27314380

Label-free detection of DNA using a light-addressable potentiometric sensor modified with a positively charged polyelectrolyte layer

NASA Astrophysics Data System (ADS)

Wu, Chunsheng; Bronder, Thomas; Poghossian, Arshak; Werner, Carl Frederik; Schöning, Michael J.

2015-03-01

A multi-spot (16 spots) light-addressable potentiometric sensor (MLAPS) consisting of an Al-p-Si-SiO2 structure modified with a weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was applied for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization by the intrinsic molecular charge for the first time. To achieve a preferentially flat orientation of DNA strands and thus, to reduce the distance between the DNA charge and MLAPS surface, the negatively charged probe single-stranded DNAs (ssDNA) were electrostatically adsorbed onto the positively charged PAH layer using a simple layer-by-layer (LbL) technique. In this way, more DNA charge can be positioned within the Debye length, yielding a higher sensor signal. The surface potential changes in each spot induced due to the surface modification steps (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), non-specific adsorption of mismatched ssDNA) were determined from the shifts of photocurrent-voltage curves along the voltage axis. A high sensor signal of 83 mV was registered after immobilization of probe ssDNA onto the PAH layer. The hybridization signal increases from 5 mV to 32 mV with increasing the concentration of cDNA from 0.1 nM to 5 μM. In contrast, a small signal of 5 mV was recorded in the case of non-specific adsorption of fully mismatched ssDNA (5 μM). The obtained results demonstrate the potential of the MLAPS in combination with the simple and rapid LbL immobilization technique as a promising platform for the future development of multi-spot light-addressable label-free DNA chips with direct electrical readout.A multi-spot (16 spots) light-addressable potentiometric sensor (MLAPS) consisting of an Al-p-Si-SiO2 structure modified with a weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was applied for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization by the intrinsic molecular charge for the first time. To achieve a preferentially flat orientation of DNA strands and thus, to reduce the distance between the DNA charge and MLAPS surface, the negatively charged probe single-stranded DNAs (ssDNA) were electrostatically adsorbed onto the positively charged PAH layer using a simple layer-by-layer (LbL) technique. In this way, more DNA charge can be positioned within the Debye length, yielding a higher sensor signal. The surface potential changes in each spot induced due to the surface modification steps (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), non-specific adsorption of mismatched ssDNA) were determined from the shifts of photocurrent-voltage curves along the voltage axis. A high sensor signal of 83 mV was registered after immobilization of probe ssDNA onto the PAH layer. The hybridization signal increases from 5 mV to 32 mV with increasing the concentration of cDNA from 0.1 nM to 5 μM. In contrast, a small signal of 5 mV was recorded in the case of non-specific adsorption of fully mismatched ssDNA (5 μM). The obtained results demonstrate the potential of the MLAPS in combination with the simple and rapid LbL immobilization technique as a promising platform for the future development of multi-spot light-addressable label-free DNA chips with direct electrical readout. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07225a

Uncertainty estimates of altimetric Global Mean Sea Level timeseries

NASA Astrophysics Data System (ADS)

Scharffenberg, Martin; Hemming, Michael; Stammer, Detlef

2016-04-01

An attempt is being presented concerned with providing uncertainty measures for global mean sea level time series. For this purpose sea surface height (SSH) fields, simulated by the high resolution STORM/NCEP model for the period 1993 - 2010, were subsampled along altimeter tracks and processed similar to techniques used by five working groups to estimate GMSL. Results suggest that the spatial and temporal resolution have a substantial impact on GMSL estimates. Major impacts can especially result from the interpolation technique or the treatment of SSH outliers and easily lead to artificial temporal variability in the resulting time series.

Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

PubMed

Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

2001-08-17

Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

Screening of binding proteins that interact with Chinese sacbrood virus VP3 capsid protein in Apis cerana larvae cDNA library by the yeast two-hybrid method.

PubMed

Fei, Dongliang; Wei, Dong; Yu, Xiaolei; Yue, Jinjin; Li, Ming; Sun, Li; Jiang, Lili; Li, Yijing; Diao, Qingyun; Ma, Mingxiao

2018-03-15

Chinese sacbrood virus (CSBV) causes larval death and apiary collapse of Apis cerana. VP3 is a capsid protein of CSBV but its function is poorly understood. To determine the function of VP3 and screen for novel binding proteins that interact with VP3, we conducted yeast two-hybrid screening, glutathione S-transferase pull-down, and co-immunoprecipitation assays. Galectin (GAL) is a protein involved in immune regulation and host-pathogen interactions. The yeast two-hybrid screen implicated GAL as a major VP3-binding candidate. The assays showed that the VP3 interacted with GAL. Identification of these cellular targets and clarifying their contributions to the host-pathogen interaction may be useful for the development of novel therapeutic and prevention strategies against CSBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning and Characterization of the Scalloped Region of Drosophila Melanogaster

PubMed Central

Campbell, S. D.; Duttaroy, A.; Katzen, A. L.; Chovnick, A.

1991-01-01

Viable mutants of the scalloped gene (sd) of Drosophila melanogaster exhibit defects that can include gapping of the wing margin and ectopic bristle formation on the wing. Lethal sd alleles characterized in the present study now implicate this gene in a genetic function essential for normal development. In order to further characterize the developmental role of this gene, we have undertaken to clone and characterize the region where sd maps. A P[ry(+)] transposon insertion at 13F associated with sd([ry+2216]) served as the starting point for a 42-kb chromosomal walk. Molecular lesions associated with viable and lethal sd alleles were characterized by genomic hybridization analysis as a means of defining the extent of the gene. DNA rearrangements associated with 11 viable sd alleles map to a 2-kb interval which appears to be a ``hot spot'' for P element activity. Four of five recessive lethal sd mutations were mapped by denaturing gradient gel electrophoresis to a region 12-14 kb away from the region of viable lesions. In a sd(+) genotype, at least two structurally related and developmentally regulated transcripts hybridize to the genomic region where several sd lethal alleles have been localized. A viable mutation, sd(58), used for comparison in the transcript analysis, makes at least two slightly smaller transcripts that also hybridize to this region. Preliminary analysis of cDNA clones has identified three structurally related transcripts that hybridize to this genomic region. The 5' end of these transcripts extends into the 2-kb genomic region wherein DNA rearrangements were seen in the P element rearrangements. We favor the view that the transcripts represented by these cDNA clones are products of the sd gene. If this is true, the sd gene would include genomic sequences extending over at least 14 kb of the described chromosomal walk, and would appear to be subject to alternative splicing. PMID:1706292

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

Problem-solving test: Southwestern blotting.

PubMed

Szeberényi, József

2014-01-01

Terms to be familiar with before you start to solve the test: Southern blotting, Western blotting, restriction endonucleases, agarose gel electrophoresis, nitrocellulose filter, molecular hybridization, polyacrylamide gel electrophoresis, proto-oncogene, c-abl, Src-homology domains, tyrosine protein kinase, nuclear localization signal, cDNA, deletion mutants, expression plasmid, transfection, RNA polymerase II, promoter, Shine-Dalgarno sequence, polyadenylation element, affinity chromatography, Northern blotting, immunoprecipitation, sodium dodecylsulfate, autoradiography, tandem repeats. Copyright © 2014 The International Union of Biochemistry and Molecular Biology.

Exploring image data assimilation in the prospect of high-resolution satellite data

NASA Astrophysics Data System (ADS)

Verron, J. A.; Duran, M.; Gaultier, L.; Brankart, J. M.; Brasseur, P.

2016-02-01

Many recent works show the key importance of studying the ocean at fine scales including the meso- and submesoscales. Satellite observations such as ocean color data provide informations on a wide range of scales but do not directly provide information on ocean dynamics. Satellite altimetry provide informations on the ocean dynamic topography (SSH) but so far with a limited resolution in space and even more, in time. However, in the near future, high-resolution SSH data (e.g. SWOT) will give a vision of the dynamic topography at such fine space resolution. This raises some challenging issues for data assimilation in physical oceanography: develop reliable methodology to assimilate high resolution data, make integrated use of various data sets including biogeochemical data, and even more simply, solve the challenge of handling large amont of data and huge state vectors. In this work, we propose to consider structured information rather than pointwise data. First, we take an image data assimilation approach in studying the feasibility of inverting tracer observations from Sea Surface Temperature and/or Ocean Color datasets, to improve the description of mesoscale dynamics provided by altimetric observations. Finite Size Lyapunov Exponents are used as an image proxy. The inverse problem is formulated in a Bayesian framework and expressed in terms of a cost function measuring the misfits between the two images. Second, we explore the inversion of SWOT-like high resolution SSH data and more especially the various possible proxies of the actual SSH that could be used to control the ocean circulation at various scales. One focus is made on controlling the subsurface ocean from surface only data. A key point lies in the errors and uncertainties that are associated to SWOT data.

Impact of salt exposure on N-acetylgalactosamine-4-sulfatase (arylsulfatase B) activity, glycosaminoglycans, kininogen, and bradykinin

PubMed Central

Kotlo, Kumar; Bhattacharyya, Sumit; Yang, Bo; Feferman, Leonid; Tejaskumar, Shah; Linhardt, Robert; Danziger, Robert

2013-01-01

N -acetylgalactosamine-4-sulfatase (Arylsulfatase B; ARSB) is the enzyme that removes sulfate groups from the N-acetylgalactosamine-4-sulfate residue at the non-reducing end of chondroitin-4-sulfate (C4S) and dermatan sulfate (DS). Previous studies demonstrated reduction in cell-bound high molecular weight kininogen in normal rat kidney (NRK) epithelial cells when chondroitin-4-sulfate content was reduced following overexpression of ARSB activity, and chondroitinase ABC produced similar decline in cell-bound kininogen. Reduction in the cell-bound kininogen was associated with increase in secreted bradykinin. In this report, we extend the in vitro findings to in vivo models, and present findings in Dahl salt-sensitive (SS) rats exposed to high (SSH) and low salt (SSL) diets. In the renal tissue of the SSH rats, ARSB activity was significantly less than in the SSL rats, and chondroitin-4-sulfate and total sulfated glycosaminoglycan content were significantly greater. Disaccharide analysis confirmed marked increase in C4S disaccharides in the renal tissue of the SSH rats. In contrast, unsulfated, hyaluronan-derived disaccharides were increased in the rats on the low salt diet. In the SSH rats, with lower ARSB activity and higher C4S levels, cell-bound, high-molecular weight kininogen was greater and urinary bradykinin was lower. ARSB activity in renal tissue and NRK cells declined when exogenous chloride concentration was increased in vitro. The impact of high chloride exposure in vivo on ARSB, chondroitin-4-sulfation, and C4S-kininogen binding provides a mechanism that links dietary salt intake with bradykinin secretion and may be a factor in blood pressure regulation. PMID:23385884

Repeated psychological stress-induced alterations of visceral sensitivity and colonic motor functions in mice: Influence of surgery and postoperative single housing on visceromotor responses

PubMed Central

Larauche, Muriel; Gourcerol, Guillaume; Million, Mulugeta; Adelson, David W.; Taché, Yvette

2012-01-01

Visceral pain modulation by chronic stress in mice has been little studied. Electromyography (EMG) recording of abdominal muscle contractions, as a proxy to the visceromotor response (VMR), requires electrode implantation and post-surgical single housing (SH) which could affect the VMR to stress. To test this hypothesis, male mice had electrode implantation surgery (S) plus SH, or no surgery and were group housed (NS-GH) or single housed (NS-SH) and exposed to either water avoidance stress (WAS, 1 h/day) or left undisturbed in their home cages for 10 days. The VMR to phasic ascending colorectal distension (CRD) was assessed before (basal) and 24 h after 10 days of WAS or no stress using a surgery-free method of intraluminal colonic pressure (ICP) recording (solid-state manometry). WAS heightened significantly the VMR to CRD at 30, 45, and 60 mmHg in S-SH vs. NS-GH, but not compared to NS-SH conscious mice. Compared to basal CRD, WAS increased VMR at 60 mmHg in the S-SH group and decreased it at 30–60 mmHg in NS-GH mice, while having no effect in NS-SH mice. The average defecation during the hour of repeated WAS over 10 days was 1.9 and 2.4 fold greater in S-SH vs. NS-GH and NS-SH mice, respectively. These data indicate that the combination of S-SH required for VMR monitoring with EMG is an important component of repeated WAS-induced post-stress visceral hypersensitivity and defecation in mice. PMID:20536336

Using a dynamical advection to reconstruct a part of the SSH evolution in the context of SWOT, application to the Mediterranean Sea

NASA Astrophysics Data System (ADS)

Rogé, Marine; Morrow, Rosemary; Ubelmann, Clément; Dibarboure, Gérald

2017-08-01

The main oceanographic objective of the future SWOT mission is to better characterize the ocean mesoscale and sub-mesoscale circulation, by observing a finer range of ocean topography dynamics down to 20 km wavelength. Despite the very high spatial resolution of the future satellite, it will not capture the time evolution of the shorter mesoscale signals, such as the formation and evolution of small eddies. SWOT will have an exact repeat cycle of 21 days, with near repeats around 5-10 days, depending on the latitude. Here, we investigate a technique to reconstruct the missing 2D SSH signal in the time between two satellite revisits. We use the dynamical interpolation (DI) technique developed by Ubelmann et al. (2015). Based on potential vorticity (hereafter PV) conservation using a one and a half layer quasi-geostrophic model, it features an active advection of the SSH field. This model has been tested in energetic open ocean regions such as the Gulf Stream and the Californian Current, and has given promising results. Here, we test this model in the Western Mediterranean Sea, a lower energy region with complex small scale physics, and compare the SSH reconstruction with the high-resolution Symphonie model. We investigate an extension of the simple dynamical model including a separated mean circulation. We find that the DI gives a 16-18% improvement in the reconstruction of the surface height and eddy kinetic energy fields, compared with a simple linear interpolation, and a 37% improvement in the Northern Current subregion. Reconstruction errors are higher during winter and autumn but statistically, the improvement from the DI is also better for these seasons.

Impact of salt exposure on N-acetylgalactosamine-4-sulfatase (arylsulfatase B) activity, glycosaminoglycans, kininogen, and bradykinin.

PubMed

Kotlo, Kumar; Bhattacharyya, Sumit; Yang, Bo; Feferman, Leonid; Tejaskumar, Shah; Linhardt, Robert; Danziger, Robert; Tobacman, Joanne K

2013-10-01

N-acetylgalactosamine-4-sulfatase (Arylsulfatase B; ARSB) is the enzyme that removes sulfate groups from the N-acetylgalactosamine-4-sulfate residue at the non-reducing end of chondroitin-4-sulfate (C4S) and dermatan sulfate (DS). Previous studies demonstrated reduction in cell-bound high molecular weight kininogen in normal rat kidney (NRK) epithelial cells when chondroitin-4-sulfate content was reduced following overexpression of ARSB activity, and chondroitinase ABC produced similar decline in cell-bound kininogen. Reduction in the cell-bound kininogen was associated with increase in secreted bradykinin. In this report, we extend the in vitro findings to in vivo models, and present findings in Dahl salt-sensitive (SS) rats exposed to high (SSH) and low salt (SSL) diets. In the renal tissue of the SSH rats, ARSB activity was significantly less than in the SSL rats, and chondroitin-4-sulfate and total sulfated glycosaminoglycan content were significantly greater. Disaccharide analysis confirmed marked increase in C4S disaccharides in the renal tissue of the SSH rats. In contrast, unsulfated, hyaluronan-derived disaccharides were increased in the rats on the low salt diet. In the SSH rats, with lower ARSB activity and higher C4S levels, cell-bound, high-molecular weight kininogen was greater and urinary bradykinin was lower. ARSB activity in renal tissue and NRK cells declined when exogenous chloride concentration was increased in vitro. The impact of high chloride exposure in vivo on ARSB, chondroitin-4-sulfation, and C4S-kininogen binding provides a mechanism that links dietary salt intake with bradykinin secretion and may be a factor in blood pressure regulation.

Quantitative trait loci affecting the 3D skull shape and size in mouse and prioritization of candidate genes in-silico

PubMed Central

Maga, A. Murat; Navarro, Nicolas; Cunningham, Michael L.; Cox, Timothy C.

2015-01-01

We describe the first application of high-resolution 3D micro-computed tomography, together with 3D landmarks and geometric morphometrics, to map QTL responsible for variation in skull shape and size using a backcross between C57BL/6J and A/J inbred strains. Using 433 animals, 53 3D landmarks, and 882 SNPs from autosomes, we identified seven QTL responsible for the skull size (SCS.qtl) and 30 QTL responsible for the skull shape (SSH.qtl). Size, sex, and direction-of-cross were all significant factors and included in the analysis as covariates. All autosomes harbored at least one SSH.qtl, sometimes up to three. Effect sizes of SSH.qtl appeared to be small, rarely exceeding 1% of the overall shape variation. However, they account for significant amount of variation in some specific directions of the shape space. Many QTL have stronger effect on the neurocranium than expected from a random vector that will parcellate uniformly across the four cranial regions. On the contrary, most of QTL have an effect on the palate weaker than expected. Combined interval length of 30 SSH.qtl was about 315 MB and contained 2476 known protein coding genes. We used a bioinformatics approach to filter these candidate genes and identified 16 high-priority candidates that are likely to play a role in the craniofacial development and disorders. Thus, coupling the QTL mapping approach in model organisms with candidate gene enrichment approaches appears to be a feasible way to identify high-priority candidates genes related to the structure or tissue of interest. PMID:25859222

An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wenlong Cho; Deitsch, K.W.; Raikhel, A.S.

1991-12-01

The authors report a phenomenon previously unknown for oviparous animals; in Aedes aegypti mosquitoes a serine carboxypeptidase is synthesized extraovarially and then internalized by oocytes. The cDNA encoding mosquito vitellogenic carboxypeptidase (VCP) was cloned and sequenced. The VCP cDNA hybridizes to a 1.5-kilobase mRNA present only in the fat body of vitellogenic females. The deduced amino acid sequence of VCP shares significant homology with members of the serine carboxypeptidase family. Binding assays using a serine protease inhibitor, ({sup 3}H)diisopropyl fluorophosphate, showed that VCP is activated in eggs at the onset of embryonic development. Activation of VCP is associated with themore » reduction in its size from 53 kDa (inactive proenzyme) to 48 kDa (active enzyme). The active, 48-kDa, form of VCP is maximally present at the middle of embryonic development and disappears by the end.« less

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

PubMed

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stadler, H.S.; Padanilam, B.J.; Solursh, M.

1992-12-01

A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less

Triazophos up-regulated gene expression in the female brown planthopper, Nilaparvata lugens.

PubMed

Bao, Yan-Yuan; Li, Bao-Ling; Liu, Zhao-Bu; Xue, Jian; Zhu, Zeng-Rong; Cheng, Jia-An; Zhang, Chuan-Xi

2010-09-01

The widespread use of insecticides has caused the resurgence of the brown planthopper, Nilaparvata lugens, in Asia. In this study, we investigated an organo-phosphorous insecticide, triazophos, and its ability to induce gene expression variation in female N. lugens nymphs just before emergence. By using the suppression subtractive hybridization method, a triazophos-induced cDNA library was constructed. In total, 402 differentially expressed cDNA clones were obtained. Real-time qPCR analysis confirmed that triazophos up-regulated the expression of six candidate genes at the transcript level in nymphs on day 3 of the 5th instar. These genes encode N. lugens vitellogenin, bystin, multidrug resistance protein (MRP), purine nucleoside phosphorylase (PNP), pyrroline-5-carboxylate reductase (P5CR) and carboxylesterase. Our results imply that the up-regulation of these genes may be involved in the induction of N. lugens female reproduction or resistance to insecticides.

Sequence of the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase from Nicotiana plumbaginifolia and phylogenetic origin of the gene family.

PubMed

Habenicht, A; Quesada, A; Cerff, R

1997-10-01

A cDNA-library has been constructed from Nicotiana plumbaginifolia seedlings, and the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN, EC 1.2.1.9) was isolated by plaque hybridization using the cDNA from pea as a heterologous probe. The cDNA comprises the entire GapN coding region. A putative polyadenylation signal is identified. Phylogenetic analysis based on the deduced amino acid sequences revealed that the GapN gene family represents a separate ancient branch within the aldehyde dehydrogenase superfamily. It can be shown that the GapN gene family and other distinct branches of the superfamily have its phylogenetic origin before the separation of primary life-forms. This further demonstrates that already very early in evolution, a broad diversification of the aldehyde dehydrogenases led to the formation of the superfamily.

Gene Expression Profiling in Fish Toxicology: A Review.

PubMed

Kumar, Girish; Denslow, Nancy D

In this review, we present an overview of transcriptomic responses to chemical exposures in a variety of fish species. We have discussed the use of several molecular approaches such as northern blotting, differential display reverse transcription-polymerase chain reaction (DDRT-PCR), suppression subtractive hybridization (SSH), real time quantitative PCR (RT-qPCR), microarrays, and next-generation sequencing (NGS) for measuring gene expression. These techniques have been mainly used to measure the toxic effects of single compounds or simple mixtures in laboratory conditions. In addition, only few studies have been conducted to examine the biological significance of differentially expressed gene sets following chemical exposure. Therefore, future studies should focus more under field conditions using a multidisciplinary approach (genomics, proteomics and metabolomics) to understand the synergetic effects of multiple environmental stressors and to determine the functional significance of differentially expressed genes. Nevertheless, recent developments in NGS technologies and decreasing costs of sequencing holds the promise to uncover the complexity of anthropogenic impacts and biological effects in wild fish populations.

Expression of zinc and cadmium responsive genes in leaves of willow (Salix caprea L.) genotypes with different accumulation characteristics

PubMed Central

Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres

2013-01-01

Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. PMID:23562959

Characterization of early follicular cDNA library suggests evidence for genetic polymorphisms in the inbred strain C108 of Bombyx mori.

PubMed

Mills, D R; Goldsmith, M R

2000-04-01

Recent work towards the completion of a saturated molecular genetic linkage map for the lepidopteran silkworm, Bombyx mori (n = 28), has provided evidence for existing polymorphisms in the inbred strain C108. Two inbred parental strains, p50 and C108, were crossed to produce the F1 (P/C) hybrid offspring. The populations used in this project were comprised of a combination of 29 F2 (F1 x F1) and 31 reciprocal backcross (P/C x C/C, P/C x P/P) progeny. All restriction fragment length polymorphisms (RFLPs) for the initial analysis were hybridized with anonymous probes derived from a random early follicular cDNA (Rcf) library from Bombyx. A total of 19 Rcf probes were selected as showing scorable codominant polymorphic patterns when screened against F2 and backcross DNAs digested with the restriction enzymes EcoRI, HindIII, or PstI, and Southern blotted to nylon membranes for hybridization. Of the newly reported Rcf probes, 7 (37%) were characterized as producing 'simple' polymorphic patterns, while 12 (63%) were characterized as producing 'complex' polymorphic patterns. Further characterization of the complex patterns subdivided this group into two general classes: polymorphisms that contained an additional allele, and multiple bands that contained an easily scored two banded polymorphism. Because the extra allele class was limited to the (P/C x C/C) backcross progeny, it is suggested that the inbred parental strain C108 harbors polymorphic loci that are inherited in a simple Mendelian fashion. A genetic analysis discussing plausible origins and maintenance of these polymorphisms is presented.

Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

PubMed

Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

1998-09-25

A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

Identification of sennoside A as a novel inhibitor of the slingshot (SSH) family proteins related to cancer metastasis.

PubMed

Lee, Seon Young; Kim, Wooil; Lee, Young Geun; Kang, Hyo Jin; Lee, Sang-Hyun; Park, Sun Young; Min, Jeong-Ki; Lee, Sang-Rae; Chung, Sang J

2017-05-01

Phospho-cofilin (p-cofilin), which has a phosphate group on Ser-3, is involved in actin polymerization. Its dephosphorylated form promotes filopodia formation and cell migration by enhancing actin depolymerization. Protein phosphatase slingshot homologs (SSHs), known as dual-specificity phosphatases, catalyze hydrolytic removal of the Ser-3 phosphate group from phospho-cofilin. Aberrant SSH activity results in cancer metastasis, implicating SSHs as potential therapeutic targets for cancer metastasis. In this study, we screened 658 natural products purified from traditional oriental medicinal plants to identify three potent SSH inhibitors with submicromolar or single-digit micromolar K i values: gossypol, hypericin, and sennoside A. The three compounds were purified from cottonseed, Saint John's wort, and rhubarb, respectively. Sennoside A markedly increased cofilin phosphorylation in pancreatic cancer cells, leading to impaired actin dynamics in pancreatic cancer cells with or without EGF stimulation and reduced motility and invasiveness in vitro and in vivo. Collaboratively, these results demonstrate that sennoside A is a novel inhibitor of SSHs and suggest that it may be valuable in the development of pharmaceutical drugs for treating cancer metastasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Efficient ensemble system based on the copper binding motif for highly sensitive and selective detection of cyanide ions in 100% aqueous solutions by fluorescent and colorimetric changes.

PubMed

Jung, Kwan Ho; Lee, Keun-Hyeung

2015-09-15

A peptide-based ensemble for the detection of cyanide ions in 100% aqueous solutions was designed on the basis of the copper binding motif. 7-Nitro-2,1,3-benzoxadiazole-labeled tripeptide (NBD-SSH, NBD-SerSerHis) formed the ensemble with Cu(2+), leading to a change in the color of the solution from yellow to orange and a complete decrease of fluorescence emission. The ensemble (NBD-SSH-Cu(2+)) sensitively and selectively detected a low concentration of cyanide ions in 100% aqueous solutions by a colorimetric change as well as a fluorescent change. The addition of cyanide ions instantly removed Cu(2+) from the ensemble (NBD-SSH-Cu(2+)) in 100% aqueous solutions, resulting in a color change of the solution from orange to yellow and a "turn-on" fluorescent response. The detection limits for cyanide ions were lower than the maximum allowable level of cyanide ions in drinking water set by the World Health Organization. The peptide-based ensemble system is expected to be a potential and practical way for the detection of submicromolar concentrations of cyanide ions in 100% aqueous solutions.

PyPele Rewritten To Use MPI

NASA Technical Reports Server (NTRS)

Hockney, George; Lee, Seungwon

2008-01-01

A computer program known as PyPele, originally written as a Pythonlanguage extension module of a C++ language program, has been rewritten in pure Python language. The original version of PyPele dispatches and coordinates parallel-processing tasks on cluster computers and provides a conceptual framework for spacecraft-mission- design and -analysis software tools to run in an embarrassingly parallel mode. The original version of PyPele uses SSH (Secure Shell a set of standards and an associated network protocol for establishing a secure channel between a local and a remote computer) to coordinate parallel processing. Instead of SSH, the present Python version of PyPele uses Message Passing Interface (MPI) [an unofficial de-facto standard language-independent application programming interface for message- passing on a parallel computer] while keeping the same user interface. The use of MPI instead of SSH and the preservation of the original PyPele user interface make it possible for parallel application programs written previously for the original version of PyPele to run on MPI-based cluster computers. As a result, engineers using the previously written application programs can take advantage of embarrassing parallelism without need to rewrite those programs.

The GTPase Activating Rap/RanGAP Domain-Like 1 Gene Is Associated with Chicken Reproductive Traits

PubMed Central

Shen, Xu; Zeng, Hua; Xie, Liang; He, Jun; Li, Jian; Xie, Xiujuan; Luo, Chenglong; Xu, Haiping; Zhou, Min; Nie, Qinghua; Zhang, Xiquan

2012-01-01

Background Abundant evidence indicates that chicken reproduction is strictly regulated by the hypothalamic-pituitary-gonad (HPG) axis, and the genes included in the HPG axis have been studied extensively. However, the question remains as to whether any other genes outside of the HPG system are involved in regulating chicken reproduction. The present study was aimed to identify, on a genome-wide level, novel genes associated with chicken reproductive traits. Methodology/Principal Finding Suppressive subtractive hybridization (SSH), genome-wide association study (GWAS), and gene-centric GWAS were used to identify novel genes underlying chicken reproduction. Single marker-trait association analysis with a large population and allelic frequency spectrum analysis were used to confirm the effects of candidate genes. Using two full-sib Ningdu Sanhuang (NDH) chickens, GARNL1 was identified as a candidate gene involved in chicken broodiness by SSH analysis. Its expression levels in the hypothalamus and pituitary were significantly higher in brooding chickens than in non-brooding chickens. GWAS analysis with a NDH two tail sample showed that 2802 SNPs were significantly associated with egg number at 300 d of age (EN300). Among the 2802 SNPs, 2 SNPs composed a block overlapping the GARNL1 gene. The gene-centric GWAS analysis with another two tail sample of NDH showed that GARNL1 was strongly associated with EN300 and age at first egg (AFE). Single marker-trait association analysis in 1301 female NDH chickens confirmed that variation in this gene was related to EN300 and AFE. The allelic frequency spectrum of the SNP rs15700989 among 5 different populations supported the above associations. Western blotting, RT-PCR, and qPCR were used to analyze alternative splicing of the GARNL1 gene. RT-PCR detected 5 transcripts and revealed that the transcript, which has a 141 bp insertion, was expressed in a tissue-specific manner. Conclusions/Significance Our findings demonstrate that the GARNL1 gene contributes to chicken reproductive traits. PMID:22496769

Virtual Northern analysis of the human genome.

PubMed

Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

2007-05-23

We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

Expression of calmodulin mRNA in rat olfactory neuroepithelium.

PubMed

Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

1991-04-01

A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

Candidate gene database and transcript map for peach, a model species for fruit trees.

PubMed

Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn

2005-05-01

Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.; Yan, D.; McHenry, C.

1994-09-01

Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

A genome-wide 20 K citrus microarray for gene expression analysis

PubMed Central

Martinez-Godoy, M Angeles; Mauri, Nuria; Juarez, Jose; Marques, M Carmen; Santiago, Julia; Forment, Javier; Gadea, Jose

2008-01-01

Background Understanding of genetic elements that contribute to key aspects of citrus biology will impact future improvements in this economically important crop. Global gene expression analysis demands microarray platforms with a high genome coverage. In the last years, genome-wide EST collections have been generated in citrus, opening the possibility to create new tools for functional genomics in this crop plant. Results We have designed and constructed a publicly available genome-wide cDNA microarray that include 21,081 putative unigenes of citrus. As a functional companion to the microarray, a web-browsable database [1] was created and populated with information about the unigenes represented in the microarray, including cDNA libraries, isolated clones, raw and processed nucleotide and protein sequences, and results of all the structural and functional annotation of the unigenes, like general description, BLAST hits, putative Arabidopsis orthologs, microsatellites, putative SNPs, GO classification and PFAM domains. We have performed a Gene Ontology comparison with the full set of Arabidopsis proteins to estimate the genome coverage of the microarray. We have also performed microarray hybridizations to check its usability. Conclusion This new cDNA microarray replaces the first 7K microarray generated two years ago and allows gene expression analysis at a more global scale. We have followed a rational design to minimize cross-hybridization while maintaining its utility for different citrus species. Furthermore, we also provide access to a website with full structural and functional annotation of the unigenes represented in the microarray, along with the ability to use this site to directly perform gene expression analysis using standard tools at different publicly available servers. Furthermore, we show how this microarray offers a good representation of the citrus genome and present the usefulness of this genomic tool for global studies in citrus by using it to catalogue genes expressed in citrus globular embryos. PMID:18598343

Protein interactome analysis of 12 mitogen-activated protein kinase kinase kinase in rice using a yeast two-hybrid system.

PubMed

Singh, Raksha; Lee, Jae-Eun; Dangol, Sarmina; Choi, Jihyun; Yoo, Ran Hee; Moon, Jae Sun; Shim, Jae-Kyung; Rakwal, Randeep; Agrawal, Ganesh Kumar; Jwa, Nam-Soo

2014-01-01

The mitogen-activated protein kinase (MAPK) cascade is composed at least of MAP3K (for MAPK kinase kinase), MAP2K, and MAPK family modules. These components together play a central role in mediating extracellular signals to the cell and vice versa by interacting with their partner proteins. However, the MAP3K-interacting proteins remain poorly investigated in plants. Here, we utilized a yeast two-hybrid system and bimolecular fluorescence complementation in the model crop rice (Oryza sativa) to map MAP3K-interacting proteins. We identified 12 novel nonredundant interacting protein pairs (IPPs) representing 11 nonredundant interactors using 12 rice MAP3Ks (available as full-length cDNA in the rice KOME (http://cdna01.dna.affrc.go.jp/cDNA/) at the time of experimental design and execution) as bait and a rice seedling cDNA library as prey. Of the 12 MAP3Ks, only six had interacting protein partners. The established MAP3K interactome consisted of two kinases, three proteases, two forkhead-associated domain-containing proteins, two expressed proteins, one E3 ligase, one regulatory protein, and one retrotransposon protein. Notably, no MAP3K showed physical interaction with either MAP2K or MAPK. Seven IPPs (58.3%) were confirmed in vivo by bimolecular fluorescence complementation. Subcellular localization of 14 interactors, together involved in nine IPPs (75%) further provide prerequisite for biological significance of the IPPs. Furthermore, GO of identified interactors predicted their involvement in diverse physiological responses, which were supported by a literature survey. These findings increase our knowledge of the MAP3K-interacting proteins, help in proposing a model of MAPK modules, provide a valuable resource for developing a complete map of the rice MAPK interactome, and allow discussion for translating the interactome knowledge to rice crop improvement against environmental factors. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular cloning and expression of a chloride channel-associated protein pICln in human young red blood cells: association with actin.

PubMed

Schwartz, R S; Rybicki, A C; Nagel, R L

1997-10-15

We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.

Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, V.; Bonnycastle, L.; Poorkai, P.

1994-09-01

We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less

Identification of differentially expressed genes associated with changes in the morphology of Pichia fermentans on apple and peach fruit.

PubMed

Fiori, Stefano; Scherm, Barbara; Liu, Jia; Farrell, Robert; Mannazzu, Ilaria; Budroni, Marilena; Maserti, Bianca E; Wisniewski, Michael E; Migheli, Quirico

2012-11-01

Pichia fermentans (strain DISAABA 726) is an effective biocontrol agent against Monilinia fructicola and Botrytis cinerea when inoculated in artificially wounded apple fruit but is an aggressive pathogen when inoculated on wounded peach fruit, causing severe fruit decay. Pichia fermentans grows as budding yeast on apple tissue and exhibits pseudohyphal growth on peach tissue, suggesting that dimorphism may be associated with pathogenicity. Two complementary suppressive subtractive hybridization (SSH) strategies, that is, rapid subtraction hybridization (RaSH) and PCR-based subtraction, were performed to identify genes differentially expressed by P. fermentans after 24-h growth on apple vs. peach fruit. Gene products that were more highly expressed on peach than on apple tissue, or vice versa, were sequenced and compared with available yeast genome sequence databases. Several of the genes more highly expressed, when P. fermentans was grown on peach, were related to stress response, glycolysis, amino acid metabolism, and alcoholic fermentation but surprisingly not to cell wall degrading enzymes such as pectinases or cellulases. The dual activity of P. fermentans as both a biocontrol agent and a pathogen emphasizes the need for a thorough risk analysis of potential antagonists to avoid unpredictable results that could negatively impact the safe use of postharvest biocontrol strategies. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Characterizing the stress/defense transcriptome of Arabidopsis

PubMed Central

Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V

2003-01-01

Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105

Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jian-Hua; Chen, Shi-Shu

2002-07-01

To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

Genes expressed during the development and ripening of watermelon fruit.

PubMed

Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

2006-11-01

A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

KSC-04PD-2216

NASA Technical Reports Server (NTRS)

2004-01-01

KENNEDY SPACE CENTER, FLA. This panel comprising former and current Safety and Mission Assurance (S&MA) management talk about identifying and comparing safety challenges of the past, present and future during Spaceport Super Safety and Health Day (SS&H) at KSC. Larry Crawford, left, is director of S&MA. SS&H Day included guest speakers Dr. Pamela Peeke, Navy Com. Stephen E. Iwanowicz, NASAs Dr. Kristine Calderon and Olympic-great Bruce Jenner. In addition, many vendors exhibits were on display for employees. Super Safety and Health Day was initiated at KSC in 1998 to increase awareness of the importance of safety and health among the government and contractor workforce. The theme for this years event was Safety and Health: A Winning Combination.

Pyrolysis of sunflower seed hulls for obtaining bio-oils.

PubMed

Casoni, Andrés I; Bidegain, Maximiliano; Cubitto, María A; Curvetto, Nestor; Volpe, María A

2015-02-01

Bio-oils from pyrolysis of as received sunflower seed hulls (SSH), hulls previously washed with acid (SSHA) and hulls submitted to a mushroom enzymatic attack (BSSH) were analyzed. The concentration of lignin, hemicellulose and cellulose varied with the pre-treatment. The liquid corresponding to SSH presented a relatively high concentration of acetic acid and a high instability to storage. The bio-oil from SSHA showed a high concentration of furfural and an appreciable amount of levoglucosenone. Lignin was degraded upon enzymatic activity, for this reason BSSH led to the highest yield of bio-oil, with relative high concentration of acetic acid and stability to storage. Copyright © 2014 Elsevier Ltd. All rights reserved.

Remote observing with NASA's Deep Space Network

NASA Astrophysics Data System (ADS)

Kuiper, T. B. H.; Majid, W. A.; Martinez, S.; Garcia-Miro, C.; Rizzo, J. R.

2012-09-01

The Deep Space Network (DSN) communicates with spacecraft as far away as the boundary between the Solar System and the interstellar medium. To make this possible, large sensitive antennas at Canberra, Australia, Goldstone, California, and Madrid, Spain, provide for constant communication with interplanetary missions. We describe the procedures for radioastronomical observations using this network. Remote access to science monitor and control computers by authorized observers is provided by two-factor authentication through a gateway at the Jet Propulsion Laboratory (JPL) in Pasadena. To make such observations practical, we have devised schemes based on SSH tunnels and distributed computing. At the very minimum, one can use SSH tunnels and VNC (Virtual Network Computing, a remote desktop software suite) to control the science hosts within the DSN Flight Operations network. In this way we have controlled up to three telescopes simultaneously. However, X-window updates can be slow and there are issues involving incompatible screen sizes and multi-screen displays. Consequently, we are now developing SSH tunnel-based schemes in which instrument control and monitoring, and intense data processing, are done on-site by the remote DSN hosts while data manipulation and graphical display are done at the observer's host. We describe our approaches to various challenges, our experience with what worked well and lessons learned, and directions for future development.

Regional sea level variability in a high-resolution global coupled climate model

NASA Astrophysics Data System (ADS)

Palko, D.; Kirtman, B. P.

2016-12-01

The prediction of trends at regional scales is essential in order to adapt to and prepare for the effects of climate change. However, GCMs are unable to make reliable predictions at regional scales. The prediction of local sea level trends is particularly critical. The main goal of this research is to utilize high-resolution (HR) (0.1° resolution in the ocean) coupled model runs of CCSM4 to analyze regional sea surface height (SSH) trends. Unlike typical, lower resolution (1.0°) GCM runs these HR runs resolve features in the ocean, like the Gulf Stream, which may have a large effect on regional sea level. We characterize the variability of regional SSH along the Atlantic coast of the US using tide gauge observations along with fixed radiative forcing runs of CCSM4 and HR interactive ensemble runs. The interactive ensemble couples an ensemble mean atmosphere with a single ocean realization. This coupling results in a 30% decrease in the strength of the Atlantic meridional overturning circulation; therefore, the HR interactive ensemble is analogous to a HR hosing experiment. By characterizing the variability in these high-resolution GCM runs and observations we seek to understand what processes influence coastal SSH along the Eastern Coast of the United States and better predict future SLR.

Seasonal and Interannual Variability of the Brazil - Malvinas Front: an Altimetry Perspective

NASA Astrophysics Data System (ADS)

Saraceno, M.; Valla, D.; Pelegrí, J. L.; Piola, A. R.

2016-02-01

The Brazil and Malvinas Confluence in the Southwestern Atlantic is one of the most energetic regions of the world ocean. Using recent measurements of sub-surface velocity currents, collected along 2348 nautical miles with a vessel mounted acoustic Doppler profiler onboard R/V BIO Hespérides, we validate geostrophic velocities derived from gridded fields of sea surface height (SSH). A remarkable correspondence between in-situ surface hydrographic data collected from the vessel and satellite sea surface temperature (SST), color and altimetry data allows selecting a specific SSH contour to track the position of the Brazil-Malvinas front. We then use 22 years of SSH data distributed by AVISO to show that the Brazil-Malvinas front shows a NS orientation in winter and a NE-SW orientation in summer, in good agreement with results based on the analysis of SST gradients. Furthermore, a clear southward migration of the front during the 22 year period is observed. The migration is associated with the southward shift of the South Atlantic high-pressure system that is in turn related to large climate changes in the southern portion of the South American continent. The seasonal variability in the orientation of the front is related to the Brazil and Malvinas encountering currents.

Biological Hydropersulfides and Related Polysulfides: A New Concept and Perspective in Redox Biology.

PubMed

Fukuto, Jon M; Ignarro, Louis J; Nagy, Peter; Wink, David A; Kevil, Christopher G; Feelisch, Martin; Cortese-Krott, Miriam M; Bianco, Christopher L; Kumagai, Yoshito; Hobbs, Adrian J; Lin, Joseph; Ida, Tomoaki; Akaike, Takaaki

2018-05-12

The chemical biology of thiols (RSH, e.g., cysteine and cysteine containing proteins/peptides) has been a topic of extreme interest for many decades due to their reported roles in protein structure/folding, redox signaling, metal ligation, cellular protection and enzymology. While many of the studies on thiol/sulfur biochemistry have focused on thiols, relatively ignored have been hydropersulfides (RSSH) and higher order polysulfur species (RSS n H, RSS n R, n > 1). Recent and provocative work has alluded to the prevalence and likely physiological importance of RSSH and related RSS n H. RSSH of cysteine (Cys-SSH) has been found to be prevalent in mammalian systems along with Cys-SSH-containing proteins. The RSSH functionality has not been examined to the extent of other biologically relevant sulfur derivatives (e.g., sulfenic acids, disulfides, etc.), whose roles in cell signaling are strongly indicated. The recent finding of Cys-SSH biosynthesis and translational incorporation into proteins is an unequivocal indication of its fundamental importance and necessitates a more profound look into the physiology of RSSH. In this Review, we discuss the currently reported chemical biology of RSSH (and related species) as a prelude to discussing their possible physiological roles. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The Neurobiological Mechanism of Chemical Aversion (Emetic) Therapy for Alcohol Use Disorder: An fMRI Study

PubMed Central

Elkins, Ralph L.; Richards, Todd L.; Nielsen, Robert; Repass, Richard; Stahlbrandt, Henriettae; Hoffman, Hunter G.

2017-01-01

A recent NIH epidemiology study found the lifetime prevalence of alcohol use disorder in the United States to be 29%. Alcohol drinking behavior is strongly “learned” via pleasure center activation/reinforcement. Alcohol craving is a powerful desire to drink alcoholic beverages. Craving was added as one of the defining criteria for alcohol use disorder in DSM5, and craving reduction is becoming an increasingly important treatment goal. In the current study, patients with alcohol use disorder received 10 days of inpatient multi-modal treatments at Schick Shadel Hospital (SSH) of Seattle. The treatments included five chemical aversion conditioning sessions that associated alcohol cues (and alcohol) with nausea and emesis. All patients met DSM4 criteria for alcohol use disorder, were heavy drinkers, and reported craving alcohol pre-treatment. Craving reduction was one of the primary treatment goals. This is the first fMRI study to measure the effects of chemical aversion therapy on alcohol craving-related brain activity. Patients were recruited as subjects for the University of Washington (UW) brain scan study following SSH admission but before treatment onset. Prior to treatment, patients reported craving/desire for alcohol. After treatment (after four SSH chemical aversion treatments, again after five SSH chemical treatments, 30 and 90-days post-discharge), these same patients reported avoidance/aversion to alcohol. Most of the participants (69%) reported being still sober 12 months post-treatment. Consistent with a craving reduction mechanism of how chemical aversion therapy facilitates sobriety, results of the UW fMRI brain scans showed significant pre- to post-treatment reductions in craving-related brain activity in the occipital cortex. Additional fMRI brain scan studies are needed to further explore the neurobiological mechanism of chemical aversion therapy treatment for alcohol use disorder, and other substance use disorders for which chemical aversion therapy is used (e.g., opioid dependence and cocaine dependence). Substance use disorders are estimated to affect well over one billion people worldwide. PMID:29033802

Investigating the influence of sea level oscillations in the Danish Straits on the Baltic Sea dynamics

NASA Astrophysics Data System (ADS)

Tikhonova, Natalia; Gusev, Anatoly; Diansky, Nikolay; Zakharchuk, Evgeny

2016-04-01

In this research, we study the influence of dynamic processes in the Danish Straits on the sea surface height (SSH) oscillations in the Baltic Sea. For this purpose, we use the model of marine and oceanic circulation INMOM (Institute of Numerical Mathematics Ocean Model). The simulations were carried out for the period 2009-2010, and the coastal station data were used for verification of SSH modelling quality. Comparison of the simulated data with the ones measured in the coastal points showed us that the model does not describe SSH variability in different areas of the Baltic Sea well enough, so in the following simulation series the in situ SSH data of the coastal measurements were assimilated at the open boundary in the Danish Straits. The results of the new simulation showed us that this approach significantly increases the SSH simulation quality in all areas of the sea, where the comparison was made. In particular, the correlation coefficients between the simulated and measured SSH data increased from 0.21-0.73 to 0.81-0.90. On the basis of these results, it has been suggested that the Baltic Sea SSH variability is largely determined by the influence of the dynamic processes in the Danish Straits, which can be represented as a superposition of oscillations of different space-time scales. These oscillations can either be generated in the straits themselves, or propagate from the North Sea. For verification of this hypothesis and assessment of the oscillation propagation distance in the Baltic Sea, the following experiment was performed. At the open boundary in the Danish Straits, the six harmonics were set with the following parameters: the periods are 1.5, 3.0, 6.0, 13.5, 40.5, and 121.5 days, and the amplitude for all the harmonics is 50 cm. The results showed us that the prescribed harmonic oscillations at the open boundary propagate into all areas of the sea without changing the frequency, but with decreasing amplitude. The decrease in amplitude is not related to the distance between the measurement point and open boundary. For example, in the Gulfs of Finland and Riga, the 36hr harmonic has an amplitude substantially higher than in the open sea, and in the Stockholm area, this harmonic is at the noise level. The 40dy and 121dy harmonics have slightly lower amplitudes than the original prescribed signal, but they are almost unchanged while propagating further into the sea, and in all the investigated locations have almost identical peaks of spectral density. The 3dy and 6dy harmonics significantly lost their amplitude in all parts of the sea, and spectral density peaks are at the noise level. The simulation results showed us that the Danish straits do not filter 121dy and 40dy oscillations, and their amplitude does not decrease much. The 13dy, 6dy and 3dy oscillations significantly lose in amplitude and have no significant peaks of the spectral density. The 1.5dy harmonic propagates to the Gulfs of Finland and Riga, and increases in amplitude due to resonance at the natural frequency of the basin. It is suggested that, while Danish straits do not filter or transform frequency characteristics of oscillations propagated from the North Sea, but the Baltic Sea configuration may affect the magnitude and propagation extent of these oscillations. Thus, the fluctuations in the North Sea and the Danish Straits can significantly contribute to the Baltic Sea dynamics in the low-frequency range of the spectrum, and the periods of natural oscillations of the basin. The research was supported by the Russian Foundation for Basic Research (grant № 16-05-00534) and Saint-Petersburg State University (grant №18.37.140.2014)

A novel 53-kDa nodulin of the symbiosome membrane of soybean nodules, controlled by Bradyrhizobium japonicum.

PubMed

Winzer, T; Bairl, A; Linder, M; Linder, D; Werner, D; Müller, P

1999-03-01

A nodule-specific 53-kDa protein (GmNOD53b) of the symbiosome membrane from soybean was isolated and its LysC digestion products were microsequenced. cDNA clones of this novel nodulin, obtained from cDNA library screening with an RT-PCR (reverse-transcriptase polymerase chain reaction)-generated hybridization probe exhibited no homology to proteins identified so far. The expression of GmNOD53b coincides with the onset of nitrogen fixation. Therefore, it is a late nodulin. Among other changes, the GmNOD53b is significantly reduced in nodules infected with the Bradyrhizobium japonicum mutant 184 on the protein level as well as on the level of mRNA expression, compared with the wild-type infected nodules. The reduction of GmNOD53b mRNA is related to an inactivation of the sipF gene in B. japonicum 184, coding for a functionally active signal peptidase.

An Acidic PATHOGENESIS-RELATED1 Gene of Oryza grandiglumis is Involved in Disease Resistance Response Against Bacterial Infection

PubMed Central

Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo

2014-01-01

Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005

Expression and localization of a novel phosducin-like protein from amphioxus Branchiostoma belcheri

NASA Astrophysics Data System (ADS)

Saren, Gaowa; Zhao, Yonggang

2009-05-01

A full length amphioxus cDNA, encoding a novel phosducin-like protein ( Amphi-PhLP), was identified for the first time from the gut cDNA library of Branchiostoma belcheri. It is comprised of 1 550 bp and an open reading frame (ORF) of 241 amino acids, with a predicted molecular mass of approximately 28 kDa. In situ hybridization histochemistry revealed a tissue-specific expression pattern of Amphi-PhLP with the high levels in the ovary, and at a lower level in the hind gut and testis, hepatic caecum, gill, endostyle, and epipharyngeal groove, while it was absent in the muscle, neural tube and notochord. In the Chinese Hamster Ovary (CHO) cells transfected with the expression plasmid pEGFP-N1/ Amphi-PhLP, the fusion protein was targeted in the cytoplasm of CHO cells, suggesting that Amphi-PhLP is a cytosolic protein. This work may provide a framework for further understanding of the physiological function of Amphi-PhLP in B. belcheri.

Planarian myosin essential light chain is involved in the formation of brain lateral branches during regeneration.

PubMed

Yu, Shuying; Chen, Xuhui; Yuan, Zuoqing; Zhou, Luming; Pang, Qiuxiang; Mao, Bingyu; Zhao, Bosheng

2015-08-01

The myosin essential light chain (ELC) is a structure component of the actomyosin cross-bridge, however, the functions in the central nervous system (CNS) development and regeneration remain poorly understood. Planarian Dugesia japonica has revealed fundamental mechanisms and unique aspects of neuroscience and neuroregeneration. In this study, the cDNA DjElc, encoding a planarian essential light chain of myosin, was identified from the planarian Dugesia japonica cDNA library. It encodes a deduced protein with highly conserved functionally domains EF-Hand and Ca(2+) binding sites that shares significant similarity with other members of ELC. Whole mount in situ hybridization studies show that DjElc expressed in CNS during embryonic development and regeneration of adult planarians. Loss of function of DjElc by RNA interference during planarian regeneration inhibits brain lateral branches regeneration completely. In conclusion, these results demonstrated that DjElc is required for maintenance of neurons and neurite outgrowth, particularly for involving the brain later branch regeneration.

Sex- and tissue-specific expression of P450 aromatase (cyp19a1a) in the yellowtail clownfish, Amphiprion clarkii.

PubMed

Kobayashi, Yasuhisa; Horiguchi, Ryo; Miura, Saori; Nakamura, Masaru

2010-02-01

To investigate the role of estrogen in the gonad of yellowtail clownfish Amphiprion clarkii, we isolated cDNA encoding cytochrome P450 aromatase (Cyp19a1a) from the adult ovary. The full-length cDNA of clownfish cyp19a1a is 1928-bp long and encodes 520 amino acids. Real-time quantitative RT-PCR analysis showed that cyp19a1a was expressed mainly in the ovary of female-phase fish. In situ hybridization and immunohistochemical observations showed that positive signals were restricted to the ovarian follicle of the female-phase fish. In contrast, Cyp19a1a signal was not detected in the ambisexual gonad of the male-phase fish. These findings suggest that Cyp19a1a is involved in oogenesis in the female-phase fish, but not in the ambisexual gonad of male-phase fish. 2009 Elsevier Inc. All rights reserved.

Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chassin, D.; Laurent, A.; Janneau, J.L.

1995-09-20

A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, O.P.

Potato leafroll virus (PLRV) was aphid-transmitted from potato (Solanum tuberosum cultivar Russett Burbank) to ground cherry (Physalis floridana), where it was maintained by serial aphid transmission. Serological and plant differential tests indicated that the isolate was not contaminated with beet western yellows virus. Purified PLRV RNA was poly(A)-tailed in vitro and used as a template for reverse transcriptase, primed with oligo(dT). Alkaline gel electrophoresis of /sup 32/P-labeled first-strand complementary DNA (cDNA) indicated a major size range of 0.1 to 3.5 kilobases (kb). A small percentage of transcripts corresponded to full length PLRV RNA. Following RNase H and DNA polymerase I-mediatedmore » second strand synthesis, double-stranded cDNA was cloned into the Pst I site of the plasmid pUC9 using oligo (dC)-oligo(dG) tailing methodology. Escherichia coli JM109 transformants were screened with first-strand /sup 32/P-cDNA in colony hybridization experiments to confirm that recombinants contained PLRV-specific sequences.« less

Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.

PubMed

Meloche, S; Beatty, B G; Pellerin, J

1996-10-03

We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jianhua; Chen, Shishu

2002-10-01

To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

Virtual Northern Analysis of the Human Genome

PubMed Central

Hurowitz, Evan H.; Drori, Iddo; Stodden, Victoria C.; Donoho, David L.; Brown, Patrick O.

2007-01-01

Background We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. Methodology/Principal Findings We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Conclusions/Significance Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes. PMID:17520019

Chitin synthase in the filarial parasite, Brugia malayi.

PubMed

Harris, M T; Lai, K; Arnold, K; Martinez, H F; Specht, C A; Fuhrman, J A

2000-12-01

Fragments of putative chitin synthase (chs) genes from two filarial species (Brugia malayi and Dirofilaria immitis) were amplified by PCR using degenerate primers. The full genomic and cDNA sequences were obtained for the B. malayi chs gene (Bm-chs-1); the predicted amino acid sequence is highly similar, over a large region, to two CHS sequences of the nematode Caenorhabditis elegans and also to two insect CHS sequences. Bm-chs-1 is abundantly transcribed in B. malayi adult females, independent of their fertilization status, but is also expressed in males and microfilariae. Oocytes and early embryos contain large amounts of Bm-chs-1 transcript by in situ hybridization, but later stage embryos within the maternal uterus show little or no Bm-chs-1 transcript. No specific hybridization could be demonstrated in maternal somatic tissues. Polyclonal antibodies were raised against a peptide expressed from a recombinant cDNA fragment of Bm-chs-1; immunostaining detected CHS protein in oocytes and early to midstage embryos. These studies characterize a gene that is likely to be essential to oogenesis and embryonic development in a parasitic nematode. Because chitin synthesis and eggshell formation begin after fertilization, the presence of CHS protein in early oocytes suggests that the enzyme must be activated as a result of fertilization. These studies also demonstrate that chitin synthesis may not be restricted to eggshell formation in nematodes, as the Bm-chs-1 gene is transcribed in life cycle stages other than adult females.

Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

1988-05-01

Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

PubMed Central

Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

1993-01-01

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

NASA Technical Reports Server (NTRS)

Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

1993-01-01

An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

Cytosolic NADP(+)-dependent isocitrate dehydrogenase protects macrophages from LPS-induced nitric oxide and reactive oxygen species.

PubMed

Maeng, Oky; Kim, Yong Chan; Shin, Han-Jae; Lee, Jie-Oh; Huh, Tae-Lin; Kang, Kwang-il; Kim, Young Sang; Paik, Sang-Gi; Lee, Hayyoung

2004-04-30

Macrophages activated by microbial lipopolysaccharides (LPS) produce bursts of nitric oxide and reactive oxygen species (ROS). Redox protection systems are essential for the survival of the macrophages since the nitric oxide and ROS can be toxic to them as well as to pathogens. Using suppression subtractive hybridization (SSH) we found that cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) is strongly upregulated by nitric oxide in macrophages. The levels of IDPc mRNA and of the corresponding enzymatic activity were markedly increased by treatment of RAW264.7 cells or peritoneal macrophages with LPS or SNAP (a nitric oxide donor). Over-expression of IDPc reduced intracellular peroxide levels and enhanced the survival of H2O2- and SNAP-treated RAW264.7 macrophages. IDPc is known to generate NADPH, a cellular reducing agent, via oxidative decarboxylation of isocitrate. The expression of enzymes implicated in redox protection, superoxide dismutase (SOD) and catalase, was relatively unaffected by LPS and SNAP. We propose that the induction of IDPc is one of the main self-protection mechanisms of macrophages against LPS-induced oxidative stress.

Internal gravity wave contributions to global sea surface variability

NASA Astrophysics Data System (ADS)

Savage, A.; Arbic, B. K.; Richman, J. G.; Shriver, J. F.; Buijsman, M. C.; Zamudio, L.; Wallcraft, A. J.; Sharma, H.

2016-02-01

High-resolution (1/12th and 1/25th degree) 41-layer simulations of the HYbrid Coordinate Ocean Model (HYCOM), forced by both atmospheric fields and the astronomical tidal potential, are used to construct global maps of sea-surface height (SSH). The HYCOM output has been separated into steric, non-steric, and total sea-surface height and the maps display variance in subtidal, tidal, and supertidal bands. Two of the global maps are of particular interest in planning for the upcoming Surface Water and Ocean Topography (SWOT) wide-swath satellite altimeter mission; (1) a map of the nonstationary tidal signal (estimated after removing the stationary tidal signal via harmonic analysis), and (2) a map of the steric supertidal contributions, which are dominated by the internal gravity wave continuum. Both of these maps display signals of order 1 cm2, the target accuracy for the SWOT mission. Therefore, both non-stationary internal tides and non-tidal internal gravity waves are likely to be important sources of "noise" that must be accurately removed before examination of lower-frequency phenomena can take place.

Endopolygalacturonase in Apples (Malus domestica) and Its Expression during Fruit Ripening.

PubMed Central

Wu, Q.; Szakacs-Dobozi, M.; Hemmat, M.; Hrazdina, G.

1993-01-01

The activity of polygalacturonase (PG) has been detected in ripe McIntosh apples (Malus domestica Borkh. cv McIntosh) both by enzyme activity measurement and immunoblotting using an anti-tomato-PG antibody preparation. PG activity increased during fruit ripening and remained steady, or decreased slightly, after 5 months of controlled atmospheric storage. The enzyme had a relative molecular weight of 45,000 as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 56,000 to 61,000 when determined by gel filtration. Viscosity and reducing end group measurements with a commercial pectin preparation showed that the enzyme is endo acting. In RNA and DNA blot hybridization experiments, a full-length tomato PG cDNA hybridized with the apple RNA and DNA, showing the identity of genes encoding the activity of the enzyme in tomato and apple. PMID:12231813

Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagner, B.J.; Long, L.; Pettenati, M.J.

Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

Docker Container Manager: A Simple Toolkit for Isolated Work with Shared Computational, Storage, and Network Resources

NASA Astrophysics Data System (ADS)

Polyakov, S. P.; Kryukov, A. P.; Demichev, A. P.

2018-01-01

We present a simple set of command line interface tools called Docker Container Manager (DCM) that allow users to create and manage Docker containers with preconfigured SSH access while keeping the users isolated from each other and restricting their access to the Docker features that could potentially disrupt the work of the server. Users can access DCM server via SSH and are automatically redirected to DCM interface tool. From there, they can create new containers, stop, restart, pause, unpause, and remove containers and view the status of the existing containers. By default, the containers are also accessible via SSH using the same private key(s) but through different server ports. Additional publicly available ports can be mapped to the respective ports of a container, allowing for some network services to be run within it. The containers are started from read-only filesystem images. Some initial images must be provided by the DCM server administrators, and after containers are configured to meet one’s needs, the changes can be saved as new images. Users can see the available images and remove their own images. DCM server administrators are provided with commands to create and delete users. All commands were implemented as Python scripts. The tools allow to deploy and debug medium-sized distributed systems for simulation in different fields on one or several local computers.

Coil-to-coil physiological noise correlations and their impact on fMRI time-series SNR

PubMed Central

Triantafyllou, C.; Polimeni, J. R.; Keil, B.; Wald, L. L.

2017-01-01

Purpose Physiological nuisance fluctuations (“physiological noise”) are a major contribution to the time-series Signal to Noise Ratio (tSNR) of functional imaging. While thermal noise correlations between array coil elements have a well-characterized effect on the image Signal to Noise Ratio (SNR0), the element-to-element covariance matrix of the time-series fluctuations has not yet been analyzed. We examine this effect with a goal of ultimately improving the combination of multichannel array data. Theory and Methods We extend the theoretical relationship between tSNR and SNR0 to include a time-series noise covariance matrix Ψt, distinct from the thermal noise covariance matrix Ψ0, and compare its structure to Ψ0 and the signal coupling matrix SSH formed from the signal intensity vectors S. Results Inclusion of the measured time-series noise covariance matrix into the model relating tSNR and SNR0 improves the fit of experimental multichannel data and is shown to be distinct from Ψ0 or SSH. Conclusion Time-series noise covariances in array coils are found to differ from Ψ0 and more surprisingly, from the signal coupling matrix SSH. Correct characterization of the time-series noise has implications for the analysis of time-series data and for improving the coil element combination process. PMID:26756964

Using altimetry to help explain patchy changes in hydrographic carbon measurements

NASA Astrophysics Data System (ADS)

Rodgers, Keith B.; Key, Robert M.; Gnanadesikan, Anand; Sarmiento, Jorge L.; Aumont, Olivier; Bopp, Laurent; Doney, Scott C.; Dunne, John P.; Glover, David M.; Ishida, Akio; Ishii, Masao; Jacobson, Andrew R.; Lo Monaco, Claire; Maier-Reimer, Ernst; Mercier, Herlé; Metzl, Nicolas; PéRez, Fiz F.; Rios, Aida F.; Wanninkhof, Rik; Wetzel, Patrick; Winn, Christopher D.; Yamanaka, Yasuhiro

2009-09-01

Here we use observations and ocean models to identify mechanisms driving large seasonal to interannual variations in dissolved inorganic carbon (DIC) and dissolved oxygen (O2) in the upper ocean. We begin with observations linking variations in upper ocean DIC and O2 inventories with changes in the physical state of the ocean. Models are subsequently used to address the extent to which the relationships derived from short-timescale (6 months to 2 years) repeat measurements are representative of variations over larger spatial and temporal scales. The main new result is that convergence and divergence (column stretching) attributed to baroclinic Rossby waves can make a first-order contribution to DIC and O2 variability in the upper ocean. This results in a close correspondence between natural variations in DIC and O2 column inventory variations and sea surface height (SSH) variations over much of the ocean. Oceanic Rossby wave activity is an intrinsic part of the natural variability in the climate system and is elevated even in the absence of significant interannual variability in climate mode indices. The close correspondence between SSH and both DIC and O2 column inventories for many regions suggests that SSH changes (inferred from satellite altimetry) may prove useful in reducing uncertainty in separating natural and anthropogenic DIC signals (using measurements from Climate Variability and Predictability's CO2/Repeat Hydrography program).

Ocean Bottom Pressure Variation Associated with the Large Meander of the Kuroshio South of Japan in 2004-2005

NASA Astrophysics Data System (ADS)

Nagano, A.; Hasegawa, T.; Matsumoto, H.; Ariyoshi, K.

2016-02-01

The Kuroshio, the western boundary current of the North Pacific subtropical gyre, takes a stable meandering path off the southern coast of Japan, called the large meander (LM), on interannual to decadal timescales. The LM of the Kuroshio formed in July 2004 associated with the intensified anticyclonic recirculation gyre south of the Kuroshio, and gradually decayed in the latter half of 2005. The variations of the Kuroshio and the southern recirculating currents may be related to deep currents, which are expected to be associated with bottom pressure (BP) variation. In order to examine the variation of BP associated with the variations of the sea surface currents, we analyzed data of eleven pressure sensors equipped to inverted echo sounders deployed from July 2004 to October 2006. An abrupt enhancement of BP is found on the continental slope off Shikoku, lagging a few months behind an elevation of sea surface height (SSH) due to the onshore shift of the recirculation gyre associated with the LM formation. Subsequently, BP beneath the recirculation gyre dwindles, leading the gradual depression of SSH due to the decay of the LM. The relationship between BP and SSH may suggest that the occurrence and decay of the LM depend on the extension of the recirculation gyre current down to the ocean bottom.

Establishment of a rat hepatoma-derived cell line proliferating in D-phenylalanine medium and expressing D-amino-acid oxidase.

PubMed

Yoda, N; Konno, R; Nagashima, S

2001-01-01

A cell line (R-Y121B.DF) has been established from a cell line (R-Y121B) derived from a rat hepatoma line (H4-II-E). The R-Y121B.DF cells have been continuously cultured in a serum-free modified Eagle's minimum essential medium in which L-phenylalanine was replaced by D-phenylalanine. They had D-amino-acid oxidase (DAO) activity which is essential for the growth in the medium containing D-amino acids. The enzyme activity of the R-Y121B.DF cells was approximately one-fourth of that of the rat liver. Northern hybridization using a DAO cDNA probe detected a hybridizing signal in the R-Y121B.DF cells and the rat liver but not in the parental R-Y121B and H4-II-E cells. Reverse transcription-polymerase chain reaction using DAO-specific primers amplified a DNA fragment of the expected size in the R-Y121B.DF cells but not in the R-Y121B and H4-II-E cells. This fragment was confirmed to be DAO cDNA by nucleotide sequencing. Western blotting showed that DAO protein was present in the R-Y121B.DF cells and the rat liver but not in the R-Y121B and H4-II-E cells. Southern hybridization showed that the DAO gene structure was not different among the R-Y121B.DF cells, R-Y121B cells, H4-II-E cells, and the rat liver. These results indicate that the R-Y121B.DF is a unique cell line which proliferates in the medium containing D-phenylalanine and explicitly expresses DAO. This line is useful for the study of DAO in vitro.

Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon.

PubMed

Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F

2011-05-19

Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be immediately applied to large scale screening and discovery of novel protein-protein interactions. All libraries are freely available for distribution to the research community.

Chicken immunoglobulin gamma-heavy chains: limited VH gene repertoire, combinatorial diversification by D gene segments and evolution of the heavy chain locus.

PubMed

Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I

1988-03-01

cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.

Trends in Arctic Ocean bottom pressure, sea surface height and freshwater content using GRACE and the ice-ocean model PIOMAS from 2008-2012

NASA Astrophysics Data System (ADS)

Peralta-Ferriz, Cecilia; Morison, James; Zhang, Jinlun; Bonin, Jennifer

2014-05-01

The variability of ocean bottom pressure (OBP) in the Arctic is dominated by the variations in sea surface height (SSH) from daily to monthly timescales. Conversely, OBP variability is dominated by the changes in the steric pressure (StP) at inter-annual timescales, particularly off the continental shelves. The combination of GRACE-derived ocean bottom pressure and ICESat altimetry-derived sea surface height variations in the Arctic Ocean have provided new means of identifying inter-annual trends in StP (StP = OBP-SSH) and associated freshwater content (FWC) of the Arctic region (Morison et al., 2012). Morison et al. (2012) showed that from 2004 to 2008, the FWC increased in the Beaufort Gyre and decreased in the Siberian and Central Arctic, resulting in a relatively small net basin-averaged FWC change. In this work, we investigate the inter-annual trends from 2008 to 2012 in OBP from GRACE, SSH from the state-of-the-art pan-Arctic ocean model PIOMAS -validated with tide and pressure gauges in the Arctic-, and compute the trends in StP and FWC from 2008-2012. We compare these results with the previous trends from 2005-2008 described in Morison et al. (2012). Our initial findings suggest increased salinity in the entire Arctic basin (relative to the climatological seasonal variation) from 2008-2012, compared to the preceding four years (2005-2008). We also find that the trends in OBP, SSH and StP from 2008-2012 present a different behavior during the spring-summer and fall-winter, unlike 2005-2008, in which the trends were generally consistent through all months of the year. It seems since 2009, when the Beaufort Gyre relaxed and the export of freshwater from the Canada Basin into the Canadian Archipelago and Fram Strait, via the Lincoln Sea, was anomalously large (de Steur et al., 2013), the Arctic Ocean has entered a new circulation regime. The causes of such changes in the inter-annual trends of OBP, SSH and StP -hence FWC-, associated with the changes in the shape and strength of the Arctic Oscillation (AO) and the wind patterns, as well as with the changes in sea ice conditions will be explored. References: Morison, J., R. Kwok, C. Peralta-Ferriz, M. Alkire, I. Rigor, R. Andersen, and M. Steele, Changing Arctic Ocean Freshwater Pathways Measured With ICESat and GRACE, Nature, 481, 66-70, DOI: 10.1038/nature10705, 2012. de Steur, L., et al. (2013), Hydrographic changes in the Lincoln Sea in the Arctic Ocean with focus on an upper ocean freshwater anomaly between 2007 and 2010, J. Geophys. Res. Oceans, 118, 4699-4715, doi:10.1002/jgrc.20341.

Mesoscale dynamics in the Lofoten Basin - a sub-Arctic "hot spot" of oceanic variability

NASA Astrophysics Data System (ADS)

Volkov, D. L.; Belonenko, T. V.; Foux, V. R.

2012-12-01

A sub-Arctic "hot spot" of intense mesoscale variability is observed in the Lofoten Basin (LB) - a topographic depression with a maximum depth of about 3250 m, located in the Norwegian Sea. The standard deviation of sea surface height (SSH), measured with satellite altimetry, reaches nearly 15 cm in the center of the basin (Figure 1a). Using a space-time lagged correlation analysis of altimetry data, we discover a cyclonic propagation of the mesoscale SSH anomalies around the center of the LB with time-averaged phase speeds of 2-4 km/day, strongly linked to bottom topography (Figure 1c). The fact that surface drifter trajectories do not exhibit cyclonic circulation in the LB (Figure 1b) suggests that, at least in the upper ocean, satellite altimetry observes only the propagation of form without the corresponding transfer of mass. Linearly propagating wavelike disturbances that do not trap fluid inside are related to planetary or Rossby waves. Variations in topography may lead to the concentration of wave energy in certain regions or wave trapping. The dispersion analysis suggests that the observed wavelike cyclonic propagation of SSH anomalies in the LB is the manifestation of baroclinic topographic Rossby waves, that we term "the basin waves" in order to distinguish them from the other types of topographic waves, such as shelf or trench waves. We identify two modes of basin waves in the LB: a di-pole mode and a quadri-pole mode. The wavelength of each mode is about 500 km. The frequency of these modes is not constant and the phase speed varies from about 2 to 8 km/day. We show that the cyclonically rotating basin waves are responsible for the observed amplification of SSH variability in the LB. Because the baroclinic basin waves in the LB are probably associated with large vertical displacements of the thermocline and due to possible wave breaking events, they can play an important role in the mixing of the inflowing Atlantic Water with ambient water masses.(a) Standard deviation of SSH (cm) in the Nordic seas. Bottom topography is shown by 1000, 2000, and 3000 m isobaths. Abbreviations: GB - Greenland Basin, LB - Lofoten Basin, NB - Norwegian Basin, NwAC - Norwegian Atlantic Current, VP - Vøring Plateau. The study region is bounded by the blue rectangle. (b) Trajectories of 100 surface drifters (blue curves) that were present in the study region from September 1996 to August 2010 and their geostrophic velocity vectors (red arrows) averaged over 1°×0.25° (longitude × latitude) bins. (c) MDT_CNES_CLS09 mean dynamic topography (color, cm) and the velocities of eddy propagation (arrows). Two ellipsoidal contours, along which the dispersion relation was analyzed, are shown.

[Identification of proteins interacting with the circadian clock protein PER1 in tumors using bacterial two-hybrid system technique].

PubMed

Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin

2015-04-01

To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.

A PROP1-binding factor, AES cloned by yeast two-hybrid assay represses PROP1-induced Pit-1 gene expression.

PubMed

Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko

2013-08-25

PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Comparative genomic characterization of citrus-associated Xylella fastidiosa strains.

PubMed

da Silva, Vivian S; Shida, Cláudio S; Rodrigues, Fabiana B; Ribeiro, Diógenes C D; de Souza, Alessandra A; Coletta-Filho, Helvécio D; Machado, Marcos A; Nunes, Luiz R; de Oliveira, Regina Costa

2007-12-21

The xylem-inhabiting bacterium Xylella fastidiosa (Xf) is the causal agent of Pierce's disease (PD) in vineyards and citrus variegated chlorosis (CVC) in orange trees. Both of these economically-devastating diseases are caused by distinct strains of this complex group of microorganisms, which has motivated researchers to conduct extensive genomic sequencing projects with Xf strains. This sequence information, along with other molecular tools, have been used to estimate the evolutionary history of the group and provide clues to understand the capacity of Xf to infect different hosts, causing a variety of symptoms. Nonetheless, although significant amounts of information have been generated from Xf strains, a large proportion of these efforts has concentrated on the study of North American strains, limiting our understanding about the genomic composition of South American strains - which is particularly important for CVC-associated strains. This paper describes the first genome-wide comparison among South American Xf strains, involving 6 distinct citrus-associated bacteria. Comparative analyses performed through a microarray-based approach allowed identification and characterization of large mobile genetic elements that seem to be exclusive to South American strains. Moreover, a large-scale sequencing effort, based on Suppressive Subtraction Hybridization (SSH), identified 290 new ORFs, distributed in 135 Groups of Orthologous Elements, throughout the genomes of these bacteria. Results from microarray-based comparisons provide further evidence concerning activity of horizontally transferred elements, reinforcing their importance as major mediators in the evolution of Xf. Moreover, the microarray-based genomic profiles showed similarity between Xf strains 9a5c and Fb7, which is unexpected, given the geographical and chronological differences associated with the isolation of these microorganisms. The newly identified ORFs, obtained by SSH, represent an approximately 10% increase in our current knowledge of the South American Xf gene pool and include new putative virulence factors, as well as novel potential markers for strain identification. Surprisingly, this list of novel elements include sequences previously believed to be unique to North American strains, pointing to the necessity of revising the list of specific markers that may be used for identification of distinct Xf strains.

Differential gene expression profile from haematopoietic tissue stem cells of red claw crayfish, Cherax quadricarinatus, in response to WSSV infection.

PubMed

Liu, Hai-peng; Chen, Rong-yuan; Zhang, Qiu-xia; Peng, Hui; Wang, Ke-jian

2011-07-01

White spot syndrome virus (WSSV) is one of the most important viral pathogens in crustaceans. During WSSV infection, multiple cell signaling cascades are activated, leading to the generation of antiviral molecules and initiation of programmed cell death of the virus infected cells. To gain novel insight into cell signaling mechanisms employed in WSSV infection, we have used suppression subtractive hybridization (SSH) to elucidate the cellular response to WSSV challenge at the gene level in red claw crayfish haematopoietic tissue (Hpt) stem cell cultures. Red claw crayfish Hpt cells were infected with WSSV for 1h (L1 library) and 12h (L12 library), respectively, after which the cell RNA was prepared for SSH using uninfected cells as drivers. By screening the L1 and L12 forward libraries, we have isolated the differentially expressed genes of crayfish Hpt cells upon WSSV infection. Among these genes, the level of many key molecules showed clearly up-regulated expression, including the genes involved in immune responses, cytoskeletal system, signal transduction molecules, stress, metabolism and homestasis related genes, and unknown genes in both L1 and L12 libraries. Importantly, of the 2123 clones screened, 176 novel genes were found the first time to be up-regulated in WSSV infection in crustaceans. To further confirm the up-regulation of differentially expressed genes, the semi-quantitative RT-PCR were performed to test twenty randomly selected genes, in which eight of the selected genes exhibited clear up-regulation upon WSSV infection in red claw crayfish Hpt cells, including DNA helicase B-like, multiprotein bridging factor 1, apoptosis-linked gene 2 and an unknown gene-L1635 from L1 library; coatomer gamma subunit, gabarap protein gene, tripartite motif-containing 32 and an unknown gene-L12-254 from L2 library, respectively. Taken together, as well as in immune and stress responses are regulated during WSSV infection of crayfish Hpt cells, our results also light the significance of cytoskeletal system, signal transduction and other unknown genes in the regulation of antiviral signals during WSSV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

Overview of Continuing Education Financing and Budgeting.

ERIC Educational Resources Information Center

Shipp, Travis

1982-01-01

Continuing education agencies have cycles of financial activities that are all parts of financial management, including obtaining funding and venture capital, setting fees, and controlling costs for cost recovery. (Author/SSH)

Mapping coastal sea level at high resolution with radar interferometry: the SWOT Mission

NASA Astrophysics Data System (ADS)

Fu, L. L.; Chao, Y.; Laignel, B.; Turki, I., Sr.

2017-12-01

The spatial resolution of the present constellation of radar altimeters in mapping two-dimensional sea surface height (SSH) variability is approaching 100 km (in wavelength). At scales shorter than 100 km, the eddies and fronts are responsible for the stirring and mixing of the ocean, especially important in the various coastal processes. A mission currently in development will make high-resolution measurement of the height of water over the ocean as well as on land. It is called Surface Water and Ocean Topography (SWOT), which is a joint mission of US NASA and French CNES, with contributions from Canada and UK. SWOT will carry a pair of interferometry radars and make 2-dimensional SSH measurements over a swath of 120 km with a nadir gap of 20 km in a 21-day repeat orbit. The synthetic aperture radar of SWOT will make SSH measurement at extremely high resolution of 10-70 m. SWOT will also carry a nadir looking conventional altimeter and make 1-dimensional SSH measurements along the nadir gap. The temporal sampling varies from 2 repeats per 21 days at the equator to more than 4 repeats at mid latitudes and more than 6 at high latitudes. This new mission will allow a continuum of fine-scale observations from the open ocean to the coasts, estuaries and rivers, allowing us to investigate a number of scientific and technical questions in the coastal and estuarine domain to assess the coastal impacts of regional sea level change, such as the interaction of sea level with river flow, estuary inundation, storm surge, coastal wetlands, salt water intrusion, etc. As examples, we will illustrate the potential impact of SWOT to the studies of the San Francisco Bay Delta, and the Seine River estuary, etc. Preliminary results suggest that the SWOT Mission will provide fundamental data to map the spatial variability of water surface elevations under different hydrodynamic conditions and at different scales (local, regional and global) to improve our knowledge of the complex physical processes in the coastal and estuarine systems in response to global sea level changes.

Epistemology, culture, justice and power: non-bioscientific knowledge for medical training.

PubMed

Kuper, Ayelet; Veinot, Paula; Leavitt, Jennifer; Levitt, Sarah; Li, Amanda; Goguen, Jeannette; Schreiber, Martin; Richardson, Lisa; Whitehead, Cynthia R

2017-02-01

While medical curricula were traditionally almost entirely comprised of bioscientific knowledge, widely accepted competency frameworks now make clear that physicians must be competent in far more than biomedical knowledge and technical skills. For example, of the influential CanMEDS roles, six are conceptually based in the social sciences and humanities (SSH). Educators frequently express uncertainty about what to teach in this area. This study concretely identifies the knowledge beyond bioscience needed to support the training of physicians competent in the six non-Medical Expert CanMEDS roles. We interviewed 58 non-clinician university faculty members with doctorates in over 20 SSH disciplines. We abstracted our transcripts (meaning condensation, direct quotations) resulting in approximately 300 pages of data which we coded using top-down (by CanMEDS role) and bottom-up (thematically) approaches and analysed within a critical constructivist framework. Participants and clinicians with SSH PhDs member-checked and refined our results. Twelve interrelated themes were evident in the data. An understanding of epistemology, including the constructed nature of social knowledge, was seen as the foundational theme without which the others could not be taught or understood. Our findings highlighted three anchoring themes (Justice, Power, Culture), all of which link to eight more specific themes concerning future physicians' relationships to the world and the self. All 12 themes were cross-cutting, in that each related to all six non-Medical Expert CanMEDS roles. The data also provided many concrete examples of potential curricular content. There is a definable body of SSH knowledge that forms the academic underpinning for important physician competencies and is outside the experience of most medical educators. Curricular change incorporating such content is necessary if we are to strengthen the non-Medical Expert physician competencies. Our findings, particularly our cross-cutting themes, also provide a pedagogically useful mechanism for holistically teaching the underpinnings of physician competence. We are now implementing our findings into medical curricula. © 2016 John Wiley & Sons Ltd and The Association for the Study of Medical Education.

A Japanese New Altimetry Mission, COMPIRA - Towards High Temporal and Spatial Sampling of Sea Surface Height Measurement

NASA Astrophysics Data System (ADS)

Ito, N.; Uematsu, A.; Yajima, Y.; Isoguchi, O.

2014-12-01

Japan Aerospace Exploration Agency (JAXA) is working on a conceptual study of altimeter mission named Coastal and Ocean measurement Mission with Precise and Innovative Radar Altimeter (COMPIRA), which will carry a wide-swath altimeter named Synthetic aperture radar (SAR) Height Imaging Oceanic Sensor with Advanced Interferometry (SHIOSAI). Capturing meso/submeso-scale phenomena is one of important objectives of the COMPIRA mission, as well as operational oceanography and fishery. For operational oceanography including coastal forecast, swath of SHIOSAI is selected to be 80 km in left and right sides to maximize temporal and spatial sampling of the sea surface height. Orbit specifications are also designed to be better sampling especially for mid-latitude region. That is, a spatial grid sampling is 5 km and an observation times per revisit period (about 10 days) is 2 to 3 times. In order to meet both sampling frequency and spatial coverage requirements as much as possible, orbit inclination was set relatively low, 51 degrees. Although this sampling frequency is, of course, not enough high to capture time evolution of coastal phenomena, an assimilation process would compensate its time evolution if 2D SSH fields was observed at least once within decal time scale of phenomena. JAXA has launched a framework called "Coastal forecast core team" to aim at developing coastal forecast system through pre-launch activities toward COMPIRA. Assimilation segment as well as satellite and in situ data provision will play an important role on these activities. As a first step, we evaluated effects of ocean current forecast improvement with COMPIRA-simulated wide-swath and high sampling sea surface heights (SSH) data. Simulated SSH data are generated from regional ocean numerical models and the COMPIRA orbit and error specifications. Then, identical twin experiments are conducted to investigate the effect of wide-swath SSH measurements on coastal forecast in the Tohoku Pacific coast region. The experiment shows that simulated sea surface current using COMPIRA data as an input data for assimilation well represents vortical feature, which cannot be reproduced by conventional nadir altimeters.

Understanding the Steric Height Long Term Variability at the Bermuda Atlantic Time-Series Study (BATS) Site with a Neutral Density Approach

NASA Astrophysics Data System (ADS)

Goncalves Neto, A.; Johnson, R. J.; Bates, N. R.

2016-02-01

Rising sea level is one of the main concerns for human life in a scenario with global atmosphere and ocean warming, which is of particular concern for oceanic islands. Bermuda, located in the center of the Sargasso Sea, provides an ideal location to investigate sea level rise since it has a long term tide gauge (1933-present) and is in close proximity to deep ocean time-series sites, namely, Hydrostation `S' (1954-present) and the Bermuda Atlantic Time-Series Study site (1988-present). In this study, we use the monthly CTD deep casts at BATS to compute the contribution of steric height (SH) to the local sea surface height (SSH) for the past 24 years. To determine the relative contribution from the various water masses we first define 8 layers (Surface Layer, Upper Thermocline, Subtropical Mode-Water, Lower Thermocline, Antarctic Intermediate Water, Labrador Sea Water, Iceland-Scotland Overflow Water, Denmark Strait Overflow Water) based on neutral density criteria for which SH is computed. Additionally, we calculate the thermosteric and halosteric components for each of the defined neutral density layers. Surprisingly, the results show that, despite a 3.3mm/yr sea level rise observed at the Bermuda tide gauge, the steric contribution to the SSH at BATS has decreased at a rate of -1.1mm/yr during the same period. The thermal component is found to account for the negative trend in the steric height (-4.4mm/yr), whereas the halosteric component (3.3mm/yr) partially compensates the thermal signal and can be explained by an overall cooling and freshening at the BATS site. Although the surface layer and the upper thermocline waters are warming, all the subtropical and polar water masses, which represent most of the local water column, are cooling and therefore drive the overall SH contribution to the local SSH. Hence, it suggests that the mass contribution to the local SSH plays an important role in the sea level rise, for which we investigate with GRACE data.

Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

PubMed

Sarmiento, U M; Storb, R F

1988-01-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

1989-08-01

ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1.

PubMed Central

Kalenik, J L; Chen, D; Bradley, M E; Chen, S J; Lee, T C

1997-01-01

Muscle-restricted transcription of sarcomeric actin genes is negatively controlled by the zinc finger protein YY1, which is down-regulated at the protein level during myogenic differentiation. To identify cellular proteins that might mediate the function/stability of YY1 in muscle cells, we screened an adult human muscle cDNA library using the yeast two-hybrid cloning system. We report the isolation and characterization of a novel protein termed YAF2 (YY1- associated factor 2) that interacts with YY1. The YAF2 cDNA encodes a 180 amino acid basic protein (pI 10.5) containing a single N-terminal C2-X10-C2 zinc finger. Lysine clusters are present that may function as a nuclear localization signal. Domain mapping analysis shows that the first and second zinc fingers of YY1 are targeted for YAF2 protein interaction. In contrast to the down-regulation of YY1, YAF2 message levels increase during in vitro differentiation of both rat skeletal and cardiac muscle cells. YAF2 appears to have a promyogenic regulatory role, since overexpression of YAF2 in C2 myoblasts stimulates myogenic promoter activity normally restricted by YY1. Co-transfection of YY1 reverses the stimulatory effect of YAF2. YAF2 also greatly potentiates proteolytic cleavage of YY1 by the calcium- activated protease m-calpain. The isolation of YAF2 may help in understanding the mechanisms through which inhibitors of myogenic transcription may be antagonized or eliminated by proteolysis during muscle development. PMID:9016636

Construction, database integration, and application of an Oenothera EST library.

PubMed

Mrácek, Jaroslav; Greiner, Stephan; Cho, Won Kyong; Rauwolf, Uwe; Braun, Martha; Umate, Pavan; Altstätter, Johannes; Stoppel, Rhea; Mlcochová, Lada; Silber, Martina V; Volz, Stefanie M; White, Sarah; Selmeier, Renate; Rudd, Stephen; Herrmann, Reinhold G; Meurer, Jörg

2006-09-01

Coevolution of cellular genetic compartments is a fundamental aspect in eukaryotic genome evolution that becomes apparent in serious developmental disturbances after interspecific organelle exchanges. The genus Oenothera represents a unique, at present the only available, resource to study the role of the compartmentalized plant genome in diversification of populations and speciation processes. An integrated approach involving cDNA cloning, EST sequencing, and bioinformatic data mining was chosen using Oenothera elata with the genetic constitution nuclear genome AA with plastome type I. The Gene Ontology system grouped 1621 unique gene products into 17 different functional categories. Application of arrays generated from a selected fraction of ESTs revealed significantly differing expression profiles among closely related Oenothera species possessing the potential to generate fertile and incompatible plastid/nuclear hybrids (hybrid bleaching). Furthermore, the EST library provides a valuable source of PCR-based polymorphic molecular markers that are instrumental for genotyping and molecular mapping approaches.

[Construction of porous hydroxyapatite (HA) block loaded with cultured chondrocytes].

PubMed

Yan, M; Dang, G

1999-07-01

To construct a kind of bone healing enhancing implant with cultured chondrocytes bound to hydroxyapatite (HA). Chondrocytes were obtained from the costicartilage of rat and were cultured on the porous HA blocks, 3 mm x 3 mm x 4 mm size, for three and seven days. Scanning electron micrograph was taken to show whether the cells grew outside and inside the pore of HA block. The cells cultured on tiny glass sheet for 2 days were used to prove where the cells come from by in situ hybridization technique with alpha1 (II) cDNA probe. Scanning electron micrographs showed that the pores of the HA surface and inside of the blocks are filled with cultured cells, especially the longer cultured block. The cells were chondrocytes confirmed by in situ hybridization. The porous HA can be used as cell cultured substrate and chondrocyte can adhere and proliferate inside the porous HA block.

Molecular analysis of the biological bleaching of kraft pulps by Trametes versicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumonceaux, T.J.; Archibald, F.S.

1996-10-01

Biological bleaching of kraft pulps by the fungus Trametes versicolor, based on the biodegradation of the recalcitrant polymer, lignin, could replace chlorine-based bleaching in Canadian pulp and paper mills. Enzymes that may be involved in lignin degradation include manganese peroxidase (MnP), laccase, and cellobiose-quinone oxidoreductase (CBQase). All three of these enzymatic activities are thought to interact extensively in cyclic oxidation/reduction reactions which ultimately bring about the degradation of lignin. We have constructed a cDNA library from T versicolor with the aim of isolating clones encoding factors that are relevant to biobleaching. We first determined the optimum growth conditions for expressionmore » of bleaching-related mRNA. A clear induction of bleaching ability was observed when the fungus was preincubated with 0.25% acid-washed pulp; the augmentation of bleaching was not explained by differences in MnP or laccase levels, suggesting that the expression of either CBQase or unidentified biobleaching factors was responsible for the increased pulp brightness. mRNA isolated from induced cultures was used to construct a cDNA library in a XZAP vector. This library has been probed with a degenerate oligonucleotide probe based upon a peptide sequence derived from purified CBQase, resulting in the identification of several hybridizing cDNA molecules. The CBQase clone will be used to examine in further detail the potential role of this enzyme in pulp biobleaching and lignin degradation.« less

Creatine kinase and alpha-actin mRNA levels decrease in diabetic rat hearts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popovich, B.; Barrieux, A.; Dillmann, W.H.

1987-05-01

Diabetic cardiomyopathy is associated with cardiac atrophy and isoenzyme redistribution. To determine if tissue specific changes occur in mRNAs coding for ..cap alpha..-actin and creatine kinase (CK), they performed RNA blot analysis. Total ventricular RNA from control (C) and 4 wk old diabetic (D) rats were hybridized with /sup 32/P cDNA probes for ..cap alpha..-actin and CK. A tissue independent cDNA probe, CHOA was also used. Signal intensity was quantified by photodensitometry. D CK mRNA was 47 +/- 16% lower in D vs C. Insulin increases CK mRNA by 20% at 1.5 hs, and completely reverses the deficit after 4more » wks. D ..cap alpha..-actin mRNA is 66 +/- 18% lower in D vs C. Insulin normalized ..cap alpha..-actin mRNA by 5 hs. CHOA mRNA is unchanged in D vs C, but D + insulin CHOA mRNA is 30 +/- 2% lower than C. In rats with diabetic cardiomyopathy, muscle specific CK and ..cap alpha..-actin mRNAs are decreased. Insulin treatment reverses these changes.« less

A novel protein involved in heart development in Ambystoma mexicanum is localized in endoplasmic reticulum.

PubMed

Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F

2008-11-01

The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

PubMed

Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

2013-08-01

Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

Cloning and characterization of two novel zebrafish P2X receptor subunits.

PubMed

Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

2002-07-26

In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

PubMed Central

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

Dose-response relationships in gene expression profiles in rainbow trout, Oncorhyncus mykiss, exposed to ethynylestradiol.

PubMed

Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

2006-07-01

Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss,were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as "expression signatures". Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.

Isolation and characterization of the chicken trypsinogen gene family.

PubMed Central

Wang, K; Gan, L; Lee, I; Hood, L

1995-01-01

Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

A novel extracellular matrix protein from tomato associated with lignified secondary cell walls.

PubMed Central

Domingo, C; Gómez, M D; Cañas, L; Hernández-Yago, J; Conejero, V; Vera, P

1994-01-01

A cDNA clone representing a novel cell wall protein was isolated from a tomato cDNA library. The deduced amino acid sequence shows that the encoded protein is very small (88 amino acids), contains an N-terminal hydrophobic signal peptide, and is enriched in lysine and tyrosine. We have designated this protein TLRP for tyrosine- and lysine-rich protein. RNA gel blot hybridization identified TLRP transcripts constitutively present in roots, stems, and leaves from tomato plants. The encoded protein seems to be highly insolubilized in the cell wall, and we present evidence that this protein is specifically localized in the modified secondary cell walls of the xylem and in cells of the sclerenchyma. In addition, the protein is localized in the protective periderm layer of the growing root. The highly localized deposition in cells destined to give support and protection to the plant indicates that this cell wall protein alone and/or in collaboration with other cell wall structural proteins may have a specialized structural function by mechanically strengthening the walls. PMID:7919979

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

HRD and the Steel-Collar Worker.

ERIC Educational Resources Information Center

Byham, William C.

1984-01-01

The author argues that, as robots begin to take over more and more industrial tasks, the impact on human workers at all levels will increase geometrically and trainers will play a strategic role. (SSH)

High-frequency fluctuations in Denmark Strait transport

NASA Astrophysics Data System (ADS)

Haine, T. W. N.

2010-07-01

Denmark Strait ocean current transport exhibits quasi-regular fluctuations immediately south of the sill with periods of 2-4 days. The transport variability is similar to the mean transport itself. Using a circulation model we explore prospects to monitor the fluctuations. The model has realistic transport and shows water leaving Denmark Strait in equivalent-barotropic cyclones that are nearly geostrophic and correlate with sea-surface height (SSH). Existing satellite altimeter observations of SSH have adequate space/time sampling to reconstruct the transport fluctuations using a regression developed from the model results, but measurement error overwhelms the signal. From the model results, the pending Surface Water and Ocean Topography (SWOT) wide-swath altimeter appears accurate enough, and with good-enough coverage, to allow the transport fluctuations to be reconstructed. Bottom pressure recorders at the exit of the Denmark Strait can also reproduce the transport variability.

Seasonal variability of the Red Sea, from satellite gravity, radar altimetry, and in situ observations

NASA Astrophysics Data System (ADS)

Wahr, John; Smeed, David A.; Leuliette, Eric; Swenson, Sean

2014-08-01

Seasonal variations of sea surface height (SSH) and mass within the Red Sea are caused mostly by exchange of heat with the atmosphere and by flow through the strait opening into the Gulf of Aden to the south. That flow involves a net mass transfer into the Red Sea during fall and out during spring, though in summer there is an influx of cool water at intermediate depths. Thus, summer water in the south is warmer near the surface due to higher air temperatures, but cooler at intermediate depths. Summer water in the north experiences warming by air-sea exchange only. The temperature affects water density, which impacts SSH but has no effect on mass. We study this seasonal cycle by combining GRACE mass estimates, altimeter SSH measurements, and steric contributions derived from the World Ocean Atlas temperature climatology. Among our conclusions are: mass contributions are much larger than steric contributions; the mass is largest in winter, consistent with winds pushing water into the Red Sea in fall and out during spring; the steric signal is largest in summer, consistent with surface warming; and the cool, intermediate-depth water flowing into the Red Sea in spring has little impact on the steric signal, because contributions from the lowered temperature are offset by effects of decreased salinity. The results suggest that the combined use of altimeter and GRACE measurements can provide a useful alternative to in situ data for monitoring the steric signal.

Bioinformatics and expressional analysis of cDNA clones from floral buds

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2017-08-01

The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Optimization of in vitro regeneration and Agrobacterium tumefaciens-mediated transformation with heat-resistant cDNA in Brassica oleracea subsp. italica cv. Green Marvel.

PubMed

Ravanfar, Seyed Ali; Aziz, Maheran Abdul; Saud, Halimi Mohd; Abdullah, Janna Ong

2015-11-01

An efficient system for shoot regeneration and Agrobacterium tumefaciens-mediated transformation of Brassica oleracea cv. Green Marvel cultivar is described. This study focuses on developing shoot regeneration from hypocotyl explants of broccoli cv. Green Marvel using thidiazuron (TDZ), zeatin, and kinetin, the optimization of factors affecting Agrobacterium-mediated transformation of the hypocotyl explants with heat-resistant cDNA, followed by the confirmation of transgenicity of the regenerants. High shoot regeneration was observed in 0.05-0.1 mg dm(-3) TDZ. TDZ at 0.1 mg dm(-3) produced among the highest percentage of shoot regeneration (96.67 %) and mean number of shoot formation (6.17). The highest percentage (13.33 %) and mean number (0.17) of putative transformant production were on hypocotyl explants subjected to preculture on shoot regeneration medium (SRM) with 200 µM acetosyringone. On optimization of bacterial density and inoculation time, the highest percentage and mean number of putative transformant production were on hypocotyl explants inoculated with a bacterial dilution of 1:5 for 30 min. Polymerase chain reaction (PCR) assay indicated a transformation efficiency of 8.33 %. The luciferase assay showed stable integration of the Arabidopsis thaliana HSP101 (AtHSP101) cDNA in the transgenic broccoli regenerants. Three out of five transgenic lines confirmed through PCR showed positive hybridization bands of the AtHSP101 cDNA through Southern blot analysis. The presence of AtHSP101 transcripts in the three transgenic broccoli lines indicated by reverse transcription-PCR (RT-PCR) confirmed the expression of the gene. In conclusion, an improved regeneration system has been established from hypocotyl explants of broccoli followed by successful transformation with AtHSP101 for resistance to high temperature.

Sequence of a cDNA and expression of the gene encoding a putative epidermal chitin synthase of Manduca sexta.

PubMed

Zhu, Yu-Cheng; Specht, Charles A; Dittmer, Neal T; Muthukrishnan, Subbaratnam; Kanost, Michael R; Kramer, Karl J

2002-11-01

Glycosyltransferases are enzymes that synthesize oligosaccharides, polysaccharides and glycoconjugates. One type of glycosyltransferase is chitin synthase, a very important enzyme in biology, which is utilized by insects, fungi, and other invertebrates to produce chitin, a polysaccharide of beta-1,4-linked N-acetylglucosamine. Chitin is an important component of the insect's exoskeletal cuticle and gut lining. To identify and characterize a chitin synthase gene of the tobacco hornworm, Manduca sexta, degenerate primers were designed from two highly conserved regions in fungal and nematode chitin synthase protein sequences and then used to amplify a similar region from Manduca cDNA. A full-length cDNA of 5152 nucleotides was assembled for the putative Manduca chitin synthase gene, MsCHS1, and sequencing of genomic DNA verified the contiguity of the sequence. The MsCHS1 cDNA has an ORF of 4692 nucleotides that encodes a transmembrane protein of 1564 amino acid residues with a mass of approximately 179 kDa (GenBank no. AY062175). It is most similar, over its entire length of protein sequence, to putative chitin synthases from other insects and nematodes, with 68% identity to enzymes from both the blow fly, Lucilia cuprina, and the fruit fly, Drosophila melanogaster. The similarity with fungal chitin synthases is restricted to the putative catalytic domain, and the MsCHS1 protein has, at equivalent positions, several amino acids that are essential for activity as revealed by mutagenesis of the fungal enzymes. A 5.3-kb transcript of MsCHS1 was identified by northern blot hybridization of RNA from larval epidermis, suggesting that the enzyme functions to make chitin deposited in the cuticle. Further examination by RT-PCR showed that MsCHS1 expression is regulated in the epidermis, with the amount of transcript increasing during phases of cuticle deposition.

System Access | High-Performance Computing | NREL

Science.gov Websites

) systems. Photo of man looking at a large computer monitor with a colorful, visual display of data. System secure shell gateway (SSH) or virtual private network (VPN). User Accounts Request a user account

Complete genome sequence of a novel extrachromosomal virus-like element identified in planarian Girardia tigrina

PubMed Central

Rebrikov, Denis V; Bulina, Maria E; Bogdanova, Ekaterina A; Vagner, Loura L; Lukyanov, Sergey A

2002-01-01

Background Freshwater planarians are widely used as models for investigation of pattern formation and studies on genetic variation in populations. Despite extensive information on the biology and genetics of planaria, the occurrence and distribution of viruses in these animals remains an unexplored area of research. Results Using a combination of Suppression Subtractive Hybridization (SSH) and Mirror Orientation Selection (MOS), we compared the genomes of two strains of freshwater planarian, Girardia tigrina. The novel extrachromosomal DNA-containing virus-like element denoted PEVE (Planarian Extrachromosomal Virus-like Element) was identified in one planarian strain. The PEVE genome (about 7.5 kb) consists of two unique regions (Ul and Us) flanked by inverted repeats. Sequence analyses reveal that PEVE comprises two helicase-like sequences in the genome, of which the first is a homolog of a circoviral replication initiator protein (Rep), and the second is similar to the papillomavirus E1 helicase domain. PEVE genome exists in at least two variant forms with different arrangements of single-stranded and double-stranded DNA stretches that correspond to the Us and Ul regions. Using PCR analysis and whole-mount in situ hybridization, we characterized PEVE distribution and expression in the planarian body. Conclusions PEVE is the first viral element identified in free-living flatworms. This element differs from all known viruses and viral elements, and comprises two potential helicases that are homologous to proteins from distant viral phyla. PEVE is unevenly distributed in the worm body, and is detected in specific parenchyma cells. PMID:12065025

Suppression Subtractive Hybridization Analysis of Genes Regulated by Application of Exogenous Abscisic Acid in Pepper Plant (Capsicum annuum L.) Leaves under Chilling Stress.

PubMed

Guo, Wei-Li; Chen, Ru-Gang; Gong, Zhen-Hui; Yin, Yan-Xu; Li, Da-Wei

2013-01-01

Low temperature is one of the major factors limiting pepper (Capsicum annuum L.) production during winter and early spring in non-tropical regions. Application of exogenous abscisic acid (ABA) effectively alleviates the symptoms of chilling injury, such as wilting and formation of necrotic lesions on pepper leaves; however, the underlying molecular mechanism is not understood. The aim of this study was to identify genes that are differentially up- or downregulated in ABA-pretreated hot pepper seedlings incubated at 6°C for 48 h, using a suppression subtractive hybridization (SSH) method. A total of 235 high-quality ESTs were isolated, clustered and assembled into a collection of 73 unigenes including 18 contigs and 55 singletons. A total of 37 unigenes (50.68%) showed similarities to genes with known functions in the non-redundant database; the other 36 unigenes (49.32%) showed low similarities or unknown functions. Gene ontology analysis revealed that the 37 unigenes could be classified into nine functional categories. The expression profiles of 18 selected genes were analyzed using quantitative RT-PCR; the expression levels of 10 of these genes were at least two-fold higher in the ABA-pretreated seedlings under chilling stress than water-pretreated (control) plants under chilling stress. In contrast, the other eight genes were downregulated in ABA-pretreated seedlings under chilling stress, with expression levels that were one-third or less of the levels observed in control seedlings under chilling stress. These results suggest that ABA can positively and negatively regulate genes in pepper plants under chilling stress.

Complementation of non-tumorigenicity of HPV18-positive cervical carcinoma cells involves differential mRNA expression of cellular genes including potential tumor suppressor genes on chromosome 11q13.

PubMed

Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin

2013-01-01

The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.

DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

PubMed

Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

2015-09-16

Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

Leisure Time of Husbands and Wives.

ERIC Educational Resources Information Center

Nickols, Sharon Y.; Abdel-Ghany, Mohamed

1983-01-01

The results of this analysis of leisure time of husband and wife indicate the importance of family roles and relationships in the allocation of time to leisure. Previous examinations have seldom considered leisure time in a family context. (SSH)

The Causes and Costs of Promotion Trauma.

ERIC Educational Resources Information Center

Darling, Lu Ann W.; McGrath, Loraine G.

1983-01-01

Minimizing the stress that nurses experience after a promotion requires an understanding of the factors associated with moving up the managerial ladder. Knowing these factors, nursing administrators can plan their programs to support their managers in transition. (SSH)

Perceptions of the Value of Extended Service in Horticulture.

ERIC Educational Resources Information Center

Watkins, Larae; Miller, Larry E.

1983-01-01

This study suggests the need for several improvements in the summer vocational horticulture education programs. Knowledge of the summer program, its aims, and the teacher's responsibilities appears to be lacking in the groups studied. (SSH)

GPCR-mediated PLCβγ/PKCβ/PKD signaling pathway regulates the cofilin phosphatase slingshot 2 in neutrophil chemotaxis

PubMed Central

Xu, Xuehua; Gera, Nidhi; Li, Hongyan; Yun, Michelle; Zhang, Liyong; Wang, Youhong; Wang, Q. Jane; Jin, Tian

2015-01-01

Chemotaxis requires precisely coordinated polymerization and depolymerization of the actin cytoskeleton at leading fronts of migrating cells. However, GPCR activation-controlled F-actin depolymerization remains largely elusive. Here, we reveal a novel signaling pathway, including Gαi, PLC, PKCβ, protein kinase D (PKD), and SSH2, in control of cofilin phosphorylation and actin cytoskeletal reorganization, which is essential for neutrophil chemotaxis. We show that PKD is essential for neutrophil chemotaxis and that GPCR-mediated PKD activation depends on PLC/PKC signaling. More importantly, we discover that GPCR activation recruits/activates PLCγ2 in a PI3K-dependent manner. We further verify that PKCβ specifically interacts with PKD1 and is required for chemotaxis. Finally, we identify slingshot 2 (SSH2), a phosphatase of cofilin (actin depolymerization factor), as a target of PKD1 that regulates cofilin phosphorylation and remodeling of the actin cytoskeleton during neutrophil chemotaxis. PMID:25568344

Simulation and assimilation of satellite altimeter data at the oceanic mesoscale

NASA Technical Reports Server (NTRS)

Demay, P.; Robinson, A. R.

1984-01-01

An improved "objective analysis' technique is used along with an altimeter signal statistical model, an altimeter noise statistical model, an orbital model, and synoptic surface current maps in the POLYMODE-SDE area, to evaluate the performance of various observational strategies in catching the mesoscale variability at mid-latitudes. In particular, simulated repetitive nominal orbits of ERS-1, TOPEX, and SPOT/POSEIDON are examined. Results show the critical importance of existence of a subcycle, scanning in either direction. Moreover, long repeat cycles ( 20 days) and short cross-track distances ( 300 km) seem preferable, since they match mesoscale statistics. Another goal of the study is to prepare and discuss sea-surface height (SSH) assimilation in quasigeostrophic models. Restored SSH maps are shown to meet that purpose, if an efficient extrapolation method or deep in-situ data (floats) are used on the vertical to start and update the model.

Spin-Down of the North Atlantic Subpolar Circulation

NASA Technical Reports Server (NTRS)

Hakkinen, S.; Rhines, P. B.

2004-01-01

Dramatic changes have occurred in the mid-to-high-latitude North Atlantic Ocean as evidenced by TOPEX/Poseidon observations of sea surface height (SSH) in the subpolar gyre and the Gulf Stream. Analysis of altimeter data shows that subpolar SSH has increased during the 1990s and the geostrophic velocity derived from altimeter data shows a decline in the gyre circulation. Direct current-meter observations in the boundary current of the Labrador Sea support the trend in the 199Os, and, together with hydrographic data show that in the mid-late 1990s the trend extends deep in the water column. We find that buoyancy forcing over the northern North Atlantic has a dynamic effect consistent with the altimeter data and hydrographic observations: a weak thermohaline forcing and the subsequent decay of the domed structure of the subpolar isopycnals would give rise to the observed anticyclonic circulation trend.

Identifying Environmental Risk Factors of Cholera in a Coastal Area with Geospatial Technologies

PubMed Central

Xu, Min; Cao, Chunxiang; Wang, Duochun; Kan, Biao

2014-01-01

Satellites contribute significantly to environmental quality and public health. Environmental factors are important indicators for the prediction of disease outbreaks. This study reveals the environmental factors associated with cholera in Zhejiang, a coastal province of China, using both Remote Sensing (RS) and Geographic information System (GIS). The analysis validated the correlation between the indirect satellite measurements of sea surface temperature (SST), sea surface height (SSH) and ocean chlorophyll concentration (OCC) and the local cholera magnitude based on a ten-year monthly data from the year 1999 to 2008. Cholera magnitude has been strongly affected by the concurrent variables of SST and SSH, while OCC has a one-month time lag effect. A cholera prediction model has been established based on the sea environmental factors. The results of hot spot analysis showed the local cholera magnitude in counties significantly associated with the estuaries and rivers. PMID:25551518

Identifying environmental risk factors of cholera in a coastal area with geospatial technologies.

PubMed

Xu, Min; Cao, Chunxiang; Wang, Duochun; Kan, Biao

2014-12-29

Satellites contribute significantly to environmental quality and public health. Environmental factors are important indicators for the prediction of disease outbreaks. This study reveals the environmental factors associated with cholera in Zhejiang, a coastal province of China, using both Remote Sensing (RS) and Geographic information System (GIS). The analysis validated the correlation between the indirect satellite measurements of sea surface temperature (SST), sea surface height (SSH) and ocean chlorophyll concentration (OCC) and the local cholera magnitude based on a ten-year monthly data from the year 1999 to 2008. Cholera magnitude has been strongly affected by the concurrent variables of SST and SSH, while OCC has a one-month time lag effect. A cholera prediction model has been established based on the sea environmental factors. The results of hot spot analysis showed the local cholera magnitude in counties significantly associated with the estuaries and rivers.

Mean Dynamic Topography of the Arctic Ocean

NASA Technical Reports Server (NTRS)

Farrell, Sinead Louise; Mcadoo, David C.; Laxon, Seymour W.; Zwally, H. Jay; Yi, Donghui; Ridout, Andy; Giles, Katherine

2012-01-01

ICESat and Envisat altimetry data provide measurements of the instantaneous sea surface height (SSH) across the Arctic Ocean, using lead and open water elevation within the sea ice pack. First, these data were used to derive two independent mean sea surface (MSS) models by stacking and averaging along-track SSH profiles gathered between 2003 and 2009. The ICESat and Envisat MSS data were combined to construct the high-resolution ICEn MSS. Second, we estimate the 5.5-year mean dynamic topography (MDT) of the Arctic Ocean by differencing the ICEn MSS with the new GOCO02S geoid model, derived from GRACE and GOCE gravity. Using these satellite-only data we map the major features of Arctic Ocean dynamical height that are consistent with in situ observations, including the topographical highs and lows of the Beaufort and Greenland Gyres, respectively. Smaller-scale MDT structures remain largely unresolved due to uncertainties in the geoid at short wavelengths.

Mitogenome Diversity in Sardinians: A Genetic Window onto an Island's Past

PubMed Central

Olivieri, Anna; Sidore, Carlo; Achilli, Alessandro; Angius, Andrea; Posth, Cosimo; Furtwängler, Anja; Brandini, Stefania; Capodiferro, Marco Rosario; Gandini, Francesca; Zoledziewska, Magdalena; Pitzalis, Maristella; Maschio, Andrea; Busonero, Fabio; Lai, Luca; Skeates, Robin; Gradoli, Maria Giuseppina; Beckett, Jessica; Marongiu, Michele; Mazzarello, Vittorio; Marongiu, Patrizia; Rubino, Salvatore; Rito, Teresa; Macaulay, Vincent; Semino, Ornella; Pala, Maria; Abecasis, Gonçalo R.; Schlessinger, David; Conde-Sousa, Eduardo; Soares, Pedro; Richards, Martin B.

2017-01-01

Sardinians are “outliers” in the European genetic landscape and, according to paleogenomic nuclear data, the closest to early European Neolithic farmers. To learn more about their genetic ancestry, we analyzed 3,491 modern and 21 ancient mitogenomes from Sardinia. We observed that 78.4% of modern mitogenomes cluster into 89 haplogroups that most likely arose in situ. For each Sardinian-specific haplogroup (SSH), we also identified the upstream node in the phylogeny, from which non-Sardinian mitogenomes radiate. This provided minimum and maximum time estimates for the presence of each SSH on the island. In agreement with demographic evidence, almost all SSHs coalesce in the post-Nuragic, Nuragic and Neolithic-Copper Age periods. For some rare SSHs, however, we could not dismiss the possibility that they might have been on the island prior to the Neolithic, a scenario that would be in agreement with archeological evidence of a Mesolithic occupation of Sardinia. PMID:28177087

Tracking the Polar Front south of New Zealand using penguin dive data

NASA Astrophysics Data System (ADS)

Sokolov, Serguei; Rintoul, Stephen R.; Wienecke, Barbara

2006-04-01

Nearly 36,000 vertical temperature profiles collected by 15 king penguins are used to map oceanographic fronts south of New Zealand. There is good correspondence between Antarctic Circumpolar Current (ACC) front locations derived from temperatures sampled in the upper 150 m along the penguin tracks and front positions inferred using maps of sea surface height (SSH). Mesoscale features detected in the SSH maps from this eddy-rich region are also reproduced in the individual temperature sections based on dive data. The foraging strategy of Macquarie Island king penguins appears to be influenced strongly by oceanographic structure: almost all the penguin dives are confined to the region close to and between the northern and southern branches of the Polar Front. Surface chlorophyll distributions also reflect the influence of the ACC fronts, with the northern branch of the Polar Front marking a boundary between low surface chlorophyll to the north and elevated values to the south.

Data Quality Assessment of In Situ and Altimeter Observations Through Two-Way Intercomparison Methods

NASA Astrophysics Data System (ADS)

Guinehut, Stephanie; Valladeau, Guillaume; Legeais, Jean-Francois; Rio, Marie-Helene; Ablain, Michael; Larnicol, Gilles

2013-09-01

This proceeding presents an overview of the two-way inter-comparison activities performed at CLS for both space and in situ observation agencies and why this activity is a required step to obtain accurate and homogenous data sets that can then be used together for climate studies or in assimilation/validation tools. We first describe the work performed in the frame of the SALP program to assess the stability of altimeter missions through SSH comparisons with tide gauges (GLOSS/CLIVAR network). Then, we show how the SSH comparison between the Argo array and altimeter time series allows the detection of drifts or jumps in altimeter (SALP program) but also for some Argo floats (Ifremer/Coriolis center). Lastly, we describe how the combine use of altimeter and wind observations helps the detection of drogue loss of surface drifting buoys (GDP network) and allow the computation of a correction term for wind slippage.

Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

PubMed Central

Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

2013-01-01

Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

Two pectin lyase genes, pnl-1 and pnl-2, from Colletotrichum gloeosporioides f. sp. malvae differ in a cellulose-binding domain and in their expression during infection of Malva pusilla.

PubMed

Wei, Yangdou; Shih, Jenny; Li, Jieran; Goodwin, Paul H

2002-07-01

Two pectin lyase genes, designated pnl-1 and pnl-2, were cloned from Colletotrichum gloeosporioides f. sp. malvae, a pathogen of round-leaved mallow (Malva pusilla). pnl-1 was isolated using cDNA from infected plant material; pnl-2 was isolated using cDNA from 3-day-old mycelia grown in mallow-cell-wall extract (MCWE) broth. pnl-1 is the first pectinase gene described thus far to encode a cellulose-binding domain (CBD), which is common in cellulases and xylanases, whereas pnl-2 encodes a pectin lyase that lacks a CBD. In pure culture, pnl-1 expression could be detected when purified pectin or glucose was the sole carbon source, but not when MCWE was the sole carbon source. The lack of pnl-1 expression appeared to be due to gene repression by some unknown factor(s) in the cell-wall extract. In contrast, expression of pnl-2 was detected in cultures when MCWE, but not when purified pectin or glucose, was the sole carbon source. In infected tissue, detection of pnl-1 expression by Northern-blot hybridization and by RT-PCR began with the onset of the necrotrophic phase of infection. Expression ofpnl-2 was not detectable by Northern-blot hybridization, but was observed byRT-PCR in both the biotrophic and necrotrophic phases of infection. The differences between pnl-1 and pnl-2 (i.e. pnl-1 encoding a CBD and differences in the expression patterns of both genes) may be related to the requirements of C. gloeosporioides f. sp. malvae to be able to grow in host tissue under the different conditions present during the biotrophic and necrotrophic phases of infection.

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Eddy heat flux across the Antarctic Circumpolar Current estimated from sea surface height standard deviation

NASA Astrophysics Data System (ADS)

Foppert, Annie; Donohue, Kathleen A.; Watts, D. Randolph; Tracey, Karen L.

2017-08-01

Eddy heat flux (EHF) is a predominant mechanism for heat transport across the zonally unbounded mean flow of the Antarctic Circumpolar Current (ACC). Observations of dynamically relevant, divergent, 4 year mean EHF in Drake Passage from the cDrake project, as well as previous studies of atmospheric and oceanic storm tracks, motivates the use of sea surface height (SSH) standard deviation, H*, as a proxy for depth-integrated, downgradient, time-mean EHF (>[EHF>¯>]) in the ACC. Statistics from the Southern Ocean State Estimate corroborate this choice and validate throughout the ACC the spatial agreement between H* and >[EHF>¯>] seen locally in Drake Passage. Eight regions of elevated >[EHF>¯>] are identified from nearly 23.5 years of satellite altimetry data. Elevated cross-front exchange usually does not span the full latitudinal width of the ACC in each region, implying a hand-off of heat between ACC fronts and frontal zones as they encounter the different >[EHF>¯>] hot spots along their circumpolar path. Integrated along circumpolar streamlines, defined by mean SSH contours, there is a convergence of ∮>[EHF>¯>] in the ACC: 1.06 PW enters from the north and 0.02 PW exits to the south. Temporal trends in low-frequency [EHF] are calculated in a running-mean sense using H* from overlapping 4 year subsets of SSH. Significant increases in downgradient [EHF] magnitude have occurred since 1993 at Kerguelen Plateau, Southeast Indian Ridge, and the Brazil-Malvinas Confluence, whereas the other five >[EHF>¯>] hot spots have insignificant trends of varying sign.

Neural Network Technique for Global Ocean Color (Chl-a) Estimates Bridging Multiple Satellite Missions

NASA Astrophysics Data System (ADS)

Garraffo, Z. D.; Nadiga, S.; Krasnopolsky, V.; Mehra, A.; Bayler, E. J.; Kim, H. C.; Behringer, D.

2016-02-01

A Neural Network (NN) technique is used to produce consistent global ocean color estimates, bridging multiple satellite ocean color missions by linking ocean color variability - primarily driven by biological processes - with the physical processes of the upper ocean. Satellite-derived surface variables - sea-surface temperature (SST) and sea-surface height (SSH) fields - are used as signatures of upper-ocean dynamics. The NN technique employs adaptive weights that are tuned by applying statistical learning (training) algorithms to past data sets, providing robustness with respect to random noise, accuracy, fast emulations, and fault-tolerance. This study employs Sea-viewing Wide Field-of-View Sensor (SeaWiFS) chlorophyll-a data for 1998-2010 in conjunction with satellite SSH and SST fields. After interpolating all data sets to the same two-degree latitude-longitude grid, the annual mean was removed and monthly anomalies extracted . The NN technique wass trained for even years of that period and tested for errors and bias for the odd years. The NN output are assessed for: (i) bias, (ii) variability, (iii) root-mean-square error (RMSE), and (iv) cross-correlation. A Jacobian is evaluated to estimate the impact of each input (SSH, SST) on the NN chlorophyll-a estimates. The differences between an ensemble of NNs vs a single NN are examined. After the NN is trained for the SeaWiFS period, the NN is then applied and validated for 2005-2015, a period covered by other satellite missions — the Moderate Resolution Imaging Spectroradiometer (MODIS AQUA) and the Visible Imaging Infrared Radiometer Suite (VIIRS).

Microtubule actin cross-linking factor (MACF): a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons.

PubMed

Leung, C L; Sun, D; Zheng, M; Knowles, D R; Liem, R K

1999-12-13

We cloned and characterized a full-length cDNA of mouse actin cross-linking family 7 (mACF7) by sequential rapid amplification of cDNA ends-PCR. The completed mACF7 cDNA is 17 kb and codes for a 608-kD protein. The closest relative of mACF7 is the Drosophila protein Kakapo, which shares similar architecture with mACF7. mACF7 contains a putative actin-binding domain and a plakin-like domain that are highly homologous to dystonin (BPAG1-n) at its NH(2) terminus. However, unlike dystonin, mACF7 does not contain a coiled-coil rod domain; instead, the rod domain of mACF7 is made up of 23 dystrophin-like spectrin repeats. At its COOH terminus, mACF7 contains two putative EF-hand calcium-binding motifs and a segment homologous to the growth arrest-specific protein, Gas2. In this paper, we demonstrate that the NH(2)-terminal actin-binding domain of mACF7 is functional both in vivo and in vitro. More importantly, we found that the COOH-terminal domain of mACF7 interacts with and stabilizes microtubules. In transfected cells full-length mACF7 can associate not only with actin but also with microtubules. Hence, we suggest a modified name: MACF (microtubule actin cross-linking factor). The properties of MACF are consistent with the observation that mutations in kakapo cause disorganization of microtubules in epidermal muscle attachment cells and some sensory neurons.

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

Quantitative high-throughput profiling of snake venom gland transcriptomes and proteomes (Ovophis okinavensis and Protobothrops flavoviridis)

PubMed Central

2013-01-01

Background Advances in DNA sequencing and proteomics have facilitated quantitative comparisons of snake venom composition. Most studies have employed one approach or the other. Here, both Illumina cDNA sequencing and LC/MS were used to compare the transcriptomes and proteomes of two pit vipers, Protobothrops flavoviridis and Ovophis okinavensis, which differ greatly in their biology. Results Sequencing of venom gland cDNA produced 104,830 transcripts. The Protobothrops transcriptome contained transcripts for 103 venom-related proteins, while the Ovophis transcriptome contained 95. In both, transcript abundances spanned six orders of magnitude. Mass spectrometry identified peptides from 100% of transcripts that occurred at higher than contaminant (e.g. human keratin) levels, including a number of proteins never before sequenced from snakes. These transcriptomes reveal fundamentally different envenomation strategies. Adult Protobothrops venom promotes hemorrhage, hypotension, incoagulable blood, and prey digestion, consistent with mammalian predation. Ovophis venom composition is less readily interpreted, owing to insufficient pharmacological data for venom serine and metalloproteases, which comprise more than 97.3% of Ovophis transcripts, but only 38.0% of Protobothrops transcripts. Ovophis venom apparently represents a hybrid strategy optimized for frogs and small mammals. Conclusions This study illustrates the power of cDNA sequencing combined with MS profiling. The former quantifies transcript composition, allowing detection of novel proteins, but cannot indicate which proteins are actually secreted, as does MS. We show, for the first time, that transcript and peptide abundances are correlated. This means that MS can be used for quantitative, non-invasive venom profiling, which will be beneficial for studies of endangered species. PMID:24224955

Crystal structure of chiral gammaPNA with complementary DNA strand: insights into the stability and specificity of recognition and conformational preorganization.

PubMed

Yeh, Joanne I; Shivachev, Boris; Rapireddy, Srinivas; Crawford, Matthew J; Gil, Roberto R; Du, Shoucheng; Madrid, Marcela; Ly, Danith H

2010-08-11

We have determined the structure of a PNA-DNA duplex to 1.7 A resolution by multiple-wavelength anomalous diffraction phasing method on a zinc derivative. This structure represents the first high-resolution 3D view of a hybrid duplex containing a contiguous chiral PNA strand with complete gamma-backbone modification ("gammaPNA"). Unlike the achiral counterpart, which adopts a random-fold, this particular gammaPNA is already preorganized into a right-handed helix as a single strand. The new structure illustrates the unique characteristics of this modified PNA, possessing conformational flexibility while maintaining sufficient structural integrity to ultimately adopt the preferred P-helical conformation upon hybridization with DNA. The unusual structural adaptability found in the gammaPNA strand is crucial for enabling the accommodation of backbone modifications while constraining conformational states. In conjunction with NMR analysis characterizing the structures and substructures of the individual building blocks, these results provide unprecedented insights into how this new class of chiral gammaPNA is preorganized and stabilized, before and after hybridization with a cDNA strand. Such knowledge is crucial for the future design and development of PNA for applications in biology, biotechnology, and medicine.

Social Security.

ERIC Educational Resources Information Center

Social and Labour Bulletin, 1983

1983-01-01

This group of articles discusses a variety of studies related to social security and retirement benefits. These studies are related to both developing and developed nations and are also concerned with studying work conditions and government role in administering a democratic social security system. (SSH)

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946