Authentication of Piper betle L. folium and quantification of their antifungal-activity.

PubMed

Wirasuta, I Made Agus Gelgel; Srinadi, I Gusti Ayu Made; Dwidasmara, Ida Bagus Gede; Ardiyanti, Ni Luh Putu Putri; Trisnadewi, I Gusti Ayu Arya; Paramita, Ni Luh Putu Vidya

2017-07-01

The TLC profiles of intra- and inter-day precision for Piper betle L . (PBL) folium methanol extract was studied for their peak marker recognition and identification. The Numerical chromatographic parameters (NCPs) of the peak markers, the hierarchical clustering analysis (HCA) and the principal component analysis (PCA) were applied to authenticate the PBL. folium extract from other Piper species folium extract and to ensure the antifungal activity quality of the PBL essential oil. The spotted extract was developed with the mobile phase of toluene: ethyl acetate; 93:7, (v/v). The eluted plate was viewed with the TLC-Visualizer, scanned under absorption and fluorescent mode detection, and on each sample the in-situ UV spectra were recorded between 190 to 400 nm. The NCPs profiles of intra- and inter-day precision results offered multi-dimensional chromatogram fingerprints for better marker peak pattern recognition and identification. Using the r -value fingerprints data series generated with this method allowed more precise discrimination the PBL. from other Piper species compared to the marker peak area fingerprint method. The cosine pair comparison was a simple method for authentication of two different fingerprints. The ward linkage clustering and the pair cross-correlation comparison were better chemometric methods to determine the consistency peak area ratio between fingerprints. The first component PCA-loading values of peak marker area fingerprints were correlated linearly to both the bio-marker concentration as well as the antifungal activity. This relationship could be used to control the quality and pharmacological potency. This simple method was developed for the authentication and quantification of herbal medicine.

Risk assessment of free hydroquinone derived from Arctostaphylos Uva-ursi folium herbal preparations.

PubMed

de Arriba, Susana Garcia; Naser, Belal; Nolte, Klaus-Ulrich

2013-01-01

Uva-ursi folium (bearberry leaf) has been traditionally used to treat symptoms of lower urinary tract infections. The most representative constituent of this herbal drug is arbutin that is rapidly absorbed in the small intestine and undergoes hepatic conjugation to form hydroquinone (HQ) conjugates. As free HQ is crucial for the safety of the herbal preparation, we reviewed published and unpublished experimental and human studies to clarify some outdated assumptions and to support the safety of therapeutic daily doses of Uva-ursi folium extract. Specifically, data on pharmacokinetics and the human exposure of arbutin and HQ were reviewed. A therapeutic recommended human daily dose of bearberry leaf extract (420 mg hydroquinone derivatives calculated as anhydrous arbutin) liberates free HQ in urine at a maximum exposure level of 11 µg/kg body weight (bw)/d. By means of an experimental no observed effect level value, a permitted daily exposure dose below which there is a negligible risk to human health was estimated for free HQ (100 µg/kg bw/d). Dietary sources of arbutin/HQ that are regularly consumed long term by humans generate comparable free HQ exposure levels. There is no direct evidence, regarding human data, supporting the fact that free HQ causes convulsion, hepatotoxicity, nephrotoxicity, or promotion of tumors in humans. Free HQ had no activity promoting pancreatic, bladder, stomach, or liver carcinogenesis. In conclusion, under the recommended use conditions Uva-ursi folium is a safe therapeutic option for treating lower urinary tract infections.

n-Butanol extract from Folium isatidis inhibits lipopolysaccharide-induced inflammatory cytokine production in macrophages and protects mice against lipopolysaccharide-induced endotoxic shock

PubMed Central

Jiang, Lili; Lu, Yili; Jin, Jiahui; Dong, Lili; Xu, Fengli; Chen, Shuangshuang; Wang, Zhanyue; Liang, Guang; Shan, Xiaoou

2015-01-01

Sepsis, which is caused by severe infection, is an important cause of mortality, but effective clinical treatment against sepsis is extremely limited. As the main component of the outer membrane of Gram-negative bacteria, lipopolysaccharide (LPS) plays a major role in inflammatory responses. Studies have shown beneficial pharmacological effects for Folium isatidis. The present study further illuminated the effects of n-butanol extract from Folium isatidis in LPS-induced septic shock and identified the main active chemical components. Our study showed that pretreatment with n-butanol extract from Folium isatidis not only significantly inhibited LPS-induced tumor necrosis factor-α and interleukin-6 production but also markedly and dose dependently enhanced the recruitment of MyD88, the phosphorylation of extracellular signal-regulated kinase, and the degradation of IκB-α. Additionally, the extract exhibited dramatic protective effects against lung injury and death in mice with septic shock. Eight main active compounds were identified, including organic acids, glycoside, indolinones, and flavonoids. These findings provide a perspective on the respiratory protection offered by n-butanol extract from Folium isatidis in LPS-induced sepsis and outline a novel therapeutic strategy for the treatment of sepsis. PMID:26491261

[Discussion on the botanical origin of Isatidis radix and Isatidis folium based on DNA barcoding].

PubMed

Sun, Zhi-Ying; Pang, Xiao-Hui

2013-12-01

This paper aimed to investigate the botanical origins of Isatidis Radix and Isatidis Folium, and clarify the confusion of its classification. The second internal transcribed spacer (ITS2) of ribosomal DNA, the chloroplast matK gene of 22 samples from some major production areas were amplified and sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner. Phylogenetic study was performed using MEGA 4.0 software in accordance with the Kimura 2-Parameter (K2P) model, and the phylogenetic tree was constructed using the neighbor-joining methods. The results showed that the length of ITS2 sequence of the botanical origins of Isatidis Radix and Isatidis Folium was 191 bp. The sequence showed that some samples had several SNP sites, and some samples had heterozygosis sites. In the NJ tree, based on ITS2 sequence, the studied samples were separated into two groups, and one of them was gathered with Isatis tinctoria L. The studied samples also were divided into two groups obviously based on the chloroplast matK gene. In conclusion, our results support that the botanical origins of Isatidis Radix and Isatidis Folium are Isatis indigotica Fortune, and Isatis indigotica and Isatis tinctoria are two distinct species. This study doesn't support the opinion about the combination of these two species in Flora of China.

Pro blood clotting activity of Scoparia dulcis in rats

PubMed Central

Ediriweera, E. R. H. S. S.; Jayakody, J. R. A. C.; Ratnasooriya, W. D.

2011-01-01

Scoparia dulcis Linn (Family: Scrophulariaceae, Sinhala: WalKoththamalli) is a perennial herb growing in many tropical countries including Sri Lanka. Traditional Physicians in rural down south areas apply crushed S. dulcis plant on cuts and bruises to stop bleeding. S. dulcis may also have Rakta Sthambhana property. The study on effect of decoction (water extract) of S. dulcis on blood clotting time in rats was carried out to investigate this. Two groups of rats, 12 males and 42 females were used in this experimental study. Forty-two female rats were assigned into seven equal groups (n = 6/gp). Different doses of DE (25, 50, 100, 1000, 1500 mg/kg) (group 1-5) or 2 ml of distilled water (DW) (group 6) were orally administered. 0.1 ml of vitamin K was injected intramuscularly (group 7) as reference drug to seventh the group. Twelve male rats were assigned into two equal groups (n = 6/gp), 2 ml of distilled water (DW) and doses of DE (1500 mg/kg) were orally administered. Clotting time was determined on the Days 1, 2, and 7 using Lee and White method. In the DE treated groups with all doses, there was no reduction in clotting time on the Day 1 but a significant reduction of clotting time (P < 0.05) was observed on the Days 2 and 7. In the group treated with vitamin K, there was no significant reduction in clotting time on Day 1 or 2, but there was a significant reduction in clotting time on Day 7. It is concluded that S. dulcis has proclotting activity (rakthasthambhana property) and this was faster than vitamin K. PMID:22408315

Pro blood clotting activity of Scoparia dulcis in rats.

PubMed

Ediriweera, E R H S S; Jayakody, J R A C; Ratnasooriya, W D

2011-04-01

Scoparia dulcis Linn (Family: Scrophulariaceae, Sinhala: WalKoththamalli) is a perennial herb growing in many tropical countries including Sri Lanka. Traditional Physicians in rural down south areas apply crushed S. dulcis plant on cuts and bruises to stop bleeding. S. dulcis may also have Rakta Sthambhana property. The study on effect of decoction (water extract) of S. dulcis on blood clotting time in rats was carried out to investigate this. Two groups of rats, 12 males and 42 females were used in this experimental study. Forty-two female rats were assigned into seven equal groups (n = 6/gp). Different doses of DE (25, 50, 100, 1000, 1500 mg/kg) (group 1-5) or 2 ml of distilled water (DW) (group 6) were orally administered. 0.1 ml of vitamin K was injected intramuscularly (group 7) as reference drug to seventh the group. Twelve male rats were assigned into two equal groups (n = 6/gp), 2 ml of distilled water (DW) and doses of DE (1500 mg/kg) were orally administered. Clotting time was determined on the Days 1, 2, and 7 using Lee and White method. In the DE treated groups with all doses, there was no reduction in clotting time on the Day 1 but a significant reduction of clotting time (P < 0.05) was observed on the Days 2 and 7. In the group treated with vitamin K, there was no significant reduction in clotting time on Day 1 or 2, but there was a significant reduction in clotting time on Day 7. It is concluded that S. dulcis has proclotting activity (rakthasthambhana property) and this was faster than vitamin K.

The intensely sweet herb, Lippia dulcis Trev.: historical uses, field inquiries, and constituents.

PubMed

Compadre, C M; Robbins, E F; Kinghorn, A D

1986-01-01

Lippia dulcis Trev. (Verbenaceae) is the source of hernandulcin, the first known intensely sweet sesquiterpenoid, a compound which is a volatile oil constituent. The literature on the uses of this species, dating back to early colonial times in Mexico, has been examined. This plant began to be used as an official drug in the late 19th century for the treatment of coughs and bronchitis, and at that time preliminary phytochemical investigations were undertaken. Field work carried out in Mexico in 1981 and 1982 has indicated that there is still an active trade involving L. dulcis, which is sold primarily in market places for its alleged abortifacient activity. We have obtained no evidence, either from the literature or from field inquiries, that L. dulcis has ever been used for sweetening foods or beverages. Fourteen L. dulcis volatile oil constituents, mainly mono- and sesquiterpenoids, were identified by gas chromatography/mass spectrometry. The toxic compound, camphor, was found to constitute 53% w/w of the volatile oil of this species. The potential use of L. dulcis for the extraction of hernandulcin is discussed.

Microscopic characterization of Scoparia dulcis Linn.(Scrophulariaceae)

PubMed Central

Mishra, Manas Ranjan; Mishra, Ashutosh; Pradhan, Dusmanta Kumar; Behera, Rajani Kanta; Jha, Shivesh; Panda, Ashok Kumar; Choudhary, Punit Ram

2012-01-01

This manuscript covers a detailed pharmacognostic evaluation of Scoparia dulcis Linn. whole plant (Scrophulariaceae), including morphology, microscopy, physicochemical, and phytochemical screening. Microscopy of different plant part was done by performing transverse sections and longitudinal sections, which were identified by the different staining reagents and dyes. Physicochemical constants were done for whole plant; it includes ash value, extractive value and moisture content. Phytochemical screening was done for aqueous and methanolic extract in maceration and soxhletion, results revealed the presence of alkaloids, glycosides, carbohydrates, phenolic compound, flavonoids, saponins, proteins, and amino acids. These study includes parameters to establish the authenticity of S. dulcis and can possibly help to differentiate the drug from its other species. PMID:23929991

Microscopic characterization of Scoparia dulcis Linn.(Scrophulariaceae).

PubMed

Mishra, Manas Ranjan; Mishra, Ashutosh; Pradhan, Dusmanta Kumar; Behera, Rajani Kanta; Jha, Shivesh; Panda, Ashok Kumar; Choudhary, Punit Ram

2012-07-01

This manuscript covers a detailed pharmacognostic evaluation of Scoparia dulcis Linn. whole plant (Scrophulariaceae), including morphology, microscopy, physicochemical, and phytochemical screening. Microscopy of different plant part was done by performing transverse sections and longitudinal sections, which were identified by the different staining reagents and dyes. Physicochemical constants were done for whole plant; it includes ash value, extractive value and moisture content. Phytochemical screening was done for aqueous and methanolic extract in maceration and soxhletion, results revealed the presence of alkaloids, glycosides, carbohydrates, phenolic compound, flavonoids, saponins, proteins, and amino acids. These study includes parameters to establish the authenticity of S. dulcis and can possibly help to differentiate the drug from its other species.

Antidiabetic Properties, Bioactive Constituents, and Other Therapeutic Effects of Scoparia dulcis.

PubMed

Pamunuwa, Geethi; Karunaratne, D Nedra; Waisundara, Viduranga Y

2016-01-01

This review discusses the antidiabetic activities of Scoparia dulcis as well as its antioxidant and anti-inflammatory properties in relation to the diabetes and its complications. Ethnomedical applications of the herb have been identified as treatment for jaundice, stomach problems, skin disease, fever, and kidney stones, reproductory issues, and piles. Evidence has been demonstrated through scientific studies as to the antidiabetic effects of crude extracts of S. dulcis as well as its bioactive constituents. The primary mechanisms of action of antidiabetic activity of the plant and its bioactive constituents are through α-glucosidase inhibition, curbing of PPAR-γ and increased secretion of insulin. Scoparic acid A, scoparic acid D, scutellarein, apigenin, luteolin, coixol, and glutinol are some of the compounds which have been identified as responsible for these mechanisms of action. S. dulcis has also been shown to exhibit analgesic, antimalarial, hepatoprotective, sedative, hypnotic, antiulcer, antisickling, and antimicrobial activities. Given this evidence, it may be concluded that S. dulcis could be promoted among the masses as an alternative and complementary therapy for diabetes, provided further scientific studies on the toxicological and pharmacological aspects are carried out through either in vivo or clinical means.

Antidiabetic Properties, Bioactive Constituents, and Other Therapeutic Effects of Scoparia dulcis

PubMed Central

Karunaratne, D. Nedra

2016-01-01

This review discusses the antidiabetic activities of Scoparia dulcis as well as its antioxidant and anti-inflammatory properties in relation to the diabetes and its complications. Ethnomedical applications of the herb have been identified as treatment for jaundice, stomach problems, skin disease, fever, and kidney stones, reproductory issues, and piles. Evidence has been demonstrated through scientific studies as to the antidiabetic effects of crude extracts of S. dulcis as well as its bioactive constituents. The primary mechanisms of action of antidiabetic activity of the plant and its bioactive constituents are through α-glucosidase inhibition, curbing of PPAR-γ and increased secretion of insulin. Scoparic acid A, scoparic acid D, scutellarein, apigenin, luteolin, coixol, and glutinol are some of the compounds which have been identified as responsible for these mechanisms of action. S. dulcis has also been shown to exhibit analgesic, antimalarial, hepatoprotective, sedative, hypnotic, antiulcer, antisickling, and antimicrobial activities. Given this evidence, it may be concluded that S. dulcis could be promoted among the masses as an alternative and complementary therapy for diabetes, provided further scientific studies on the toxicological and pharmacological aspects are carried out through either in vivo or clinical means. PMID:27594892

Antispasmodic activity of essential oil from Lippia dulcis Trev.

PubMed

Görnemann, T; Nayal, R; Pertz, H H; Melzig, M F

2008-04-17

To investigate the essential oil of Lippia dulcis Trev. (Verbenaceae) that is traditionally used in the treatment of cough, colds, bronchitis, asthma, and colic in Middle America for antispasmodic activity. We used a porcine bronchial bioassay to study contractile responses to carbachol and histamine in the absence or presence of the essential oil. The essential oil showed anti-histaminergic and anti-cholinergic activities at 100 microg/ml. The anti-histaminergic and anti-cholinergic activities of the essential oil of Lippia dulcis support the rational use of the plant or plant extracts to treat bronchospasm.

Hydrangea-like magneto-fluorescent nanoparticles through thiol-inducing assembly

NASA Astrophysics Data System (ADS)

Chen, Shun; Zhang, Junjun; Song, Shaokun; Xiong, Chuanxi; Dong, Lijie

2017-01-01

Magneto-fluorescent nanoparticles (NPs), recognized as an emerging class of materials, have drawn much attention because of their potential applications. Due to surface functionalization and thiol-metal bonds, a simple method has been put forward for fabricating hydrangea-like magneto-fluorescent Fe3O4-SH@QD NPs, through assembling thiol-modified Fe3O4 NPs with sub-size multi-layer core/shell CdSe/CdS/ZnS QDs. After a refined but controllable silane hydrolysis process, thiol-modified Fe3O4 was fabricated, resulting in Fe3O4-SH@QD NPs with QDs, while preventing the quenching of the QDs. As a result, the core Fe3O4 NPs were 18 nm in diameter, while the scattered CdSe/CdS/ZnS QDs were 7 nm in diameter. The resultant magneto-fluorescent Fe3O4-SH@QD NPs exhibit efficient fluorescence, superparamagnetism at room temperature, and rapid response to the external field, which make them ideal candidates for difunctional probes in MRI and bio-labels, targeting and photodynamic therapy, and cell tracking and separation.

Antihyperlipidemic effect of Scoparia dulcis (sweet broomweed) in streptozotocin diabetic rats.

PubMed

Pari, Leelavinothan; Latha, Muniappan

2006-01-01

We have investigated Scoparia dulcis, an indigenous plant used in Ayurvedic medicine in India, for its possible antihyperlipidemic effect in rats with streptozotocin-induced experimental diabetes. Oral administration of an aqueous extract of S. dulcis plant (200 mg/kg of body weight) to streptozotocin diabetic rats for 6 weeks resulted in a significant reduction in blood glucose, serum and tissue cholesterol, triglycerides, free fatty acids, phospholipids, 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase activity, and very low-density lipoprotein and low-density lipoprotein cholesterol levels. The decreased serum high-density lipoprotein cholesterol, anti-atherogenic index, and HMG-CoA reductase activity in diabetic rats were also reversed towards normalization after the treatment. Similarly, the administration of S. dulcis plant extract (SPEt) to normal animals resulted in a hypolipidemic effect. The effect was compared with glibenclamide (600 microg/kg of body weight). The results showed that SPEt had antihyperlipidemic action in normal and experimental diabetic rats in addition to its antidiabetic effect.

Cytotoxic diterpenes from Scoparia dulcis.

PubMed

Ahsan, Monira; Islam, S K N; Gray, Alexander I; Stimson, William H

2003-07-01

Four new labdane-derived diterpenes, iso-dulcinol (1), 4-epi-scopadulcic acid B (2), dulcidiol (4), and scopanolal (5), together with two known diterpenes, dulcinol/scopadulciol (3) and scopadiol (6), were isolated from the aerial parts of Scoparia dulcis. The structures were determined by extensive NMR studies. The crude extracts as well as the pure diterpenes showed cytotoxicity against a panel of six human stomach cancer cell lines.

Insulin-secretagogue activity and cytoprotective role of the traditional antidiabetic plant Scoparia dulcis (Sweet Broomweed).

PubMed

Latha, Muniappan; Pari, Leelavinothan; Sitasawad, Sandhya; Bhonde, Ramesh

2004-09-03

Scoparia dulcis (Sweet Broomweed) has been documented as a traditional treatment of diabetes. The administration of an aqueous extract of Scoparia dulcis at a dose of 200 mg/kg body weight significantly decreased the blood glucose with significant increase in plasma insulin level in streptozotocin diabetic rats at the end of 15 days treatment. The insulin secretagogue action of Scoparia dulcis plant extract (SPEt) was further investigated using isolated pancreatic islets from mice. SPEt at a dose of 10 microg/ml evoked 6.0 fold stimulation of insulin secretion from isolated islets indicating its insulin secretagogue activity. In addition the effect of SPEt on streptozotocin induced cell death and nitric oxide (NO) in terms of nitrite production were also examined. SPEt protected against streptozotocin- mediated cytotoxicity (88%) and NO production in rat insulinoma cell line (RINm5F). Above results suggest the glucose lowering effect of SPEt to be associated with potentiation of insulin release from pancreatic islets. Our results revealed the possible therapeutic value of Scoparia dulcis for the better control, management and prevention of diabetes mellitus progression.

Phytochemical and antimicrobial study of an antidiabetic plant: Scoparia dulcis L.

PubMed

Latha, M; Ramkumar, K M; Pari, L; Damodaran, P N; Rajeshkannan, V; Suresh, T

2006-01-01

The antimicrobial and antifungal effects of different concentrations of chloroform/methanol fractions of Scoparia dulcis were investigated. The isolated fractions were tested against different bacteria like Salmonella typhii, Staphylococcus aureus, Escherichia coli, Bacillus subtilis, Pseudomonas aeruginosa, and Proteus vulgaris and fungal strains such as Alternaria macrospora, Candida albicans, Aspergillus niger, and Fusarium oxysporum. The isolated fractions exhibited significant antimicrobial and antifungal activity against all the tested organisms compared with respective reference drugs. The isolated fractions of S. dulcis showed properties like antimicrobial and antifungal activities that will enable researchers in turn to look for application-oriented principles.

Optimization of microwave roasting of almond (Prunus dulcis)

USDA-ARS?s Scientific Manuscript database

Microwave (MW) almond roasting was investigated as an alternative to hot air (HA) roasting. Nonpareil almonds (Prunus dulcis) were roasted at 140°C in a convection oven for different times to achieve light, medium, and dark roasting levels. Several instrumental measurements were taken, establishin...

Effect of an aqueous extract of Scoparia dulcis on plasma and tissue glycoproteins in streptozotocin induced diabetic rats.

PubMed

Latha, M; Pari, L

2005-02-01

The influence of Scoparia dulcis, a traditionally used plant for the treatment of diabetes mellitus, was examined in streptozotocin diabetic rats on dearrangement in glycoprotein levels. Diabetes was induced in male Wistar rats by a single intraperitoneal injection of streptozotocin. An aqueous extract of Scoparia dulcis plant was administered orally for 6 weeks. The effect of the Scoparia dulcis extract on blood glucose, plasma insulin, plasma and tissue glycoproteins studied was in comparison to glibenclamide. The levels of blood glucose and plasma glycoproteins were increased significantly whereas the level of plasma insulin was significantly decreased in diabetic rats. There was a significant decrease in the level of sialic acid and elevated levels of hexose, hexosamine and fucose in the liver and kidney of streptozotocin diabetic rats. Oral administration of Scoparia dulcis plant extract (SPEt) to diabetic rats led to decreased levels of blood glucose and plasma glycoproteins. The levels of plasma insulin and tissue sialic acid were increased whereas the levels of tissue hexose, hexosamine and fucose were near normal. The present study indicates that Scoparia dulcis possesses a significant beneficial effect on glycoproteins in addition to its antidiabetic effect.

(+)-4 beta-hydroxyhernandulcin, a new sweet sesquiterpene from the leaves and flowers of Lippia dulcis.

PubMed

Kaneda, N; Lee, I S; Gupta, M P; Soejarto, D D; Kinghorn, A D

1992-08-01

From the leaves and flowers of Lippia dulcis collected in Panama, a new sweet sesquiterpene identified as (+)-4 beta-hydroxyhernandulcin [2] was isolated, accompanied by (+)-hernandulcin [1], (-)-epihernandulcin [3] (a novel natural product), and 6-methyl-5-hepten-2-one [4]. Acteoside (verbascoside) [5], a known bitter phenylpropanoid glycoside, was isolated from the flowers of L. dulcis. The structure of (+)-4 beta-hydroxyhernandulcin was established by interpretation of its spectral data.

Anatomy and cell wall polysaccharides of almond (Prunus dulcis D. A. Webb) seeds.

PubMed

Dourado, Fernando; Barros, António; Mota, Manuel; Coimbra, Manuel A; Gama, Francisco M

2004-03-10

The anatomy of Prunus dulcis was analyzed by applying several differential staining techniques and light microscopy. Prunus dulcis seed has a thin and structurally complex seed coat, with lignified cellulosic tissue. The embryo has two voluminous cotyledons. Cotyledon cells have a high number of protein and lipid bodies, some of which have phytin. The provascular tissue, located in the cotyledons, is oriented in small bundles perpendicular to the transverse embryonic axis. Prunus dulcis cell wall material is very rich in arabinose (45 mol %). Glucose (23%), uronic acids (12%), and xylose (12%) are also major sugar components. The polymers obtained from the imidazole and Na(2)CO(3) extracts contain mainly pectic substances rich in arabinose, but the sugar content of these extracts was very low. The majority of the pectic substances (also rich in arabinose) was recovered with the KOH extracts. These extracts, with high sugar content, yielded also xyloglucans and acidic xylans. The 4 M KOH + H(3)BO(3) extracts yielded polysaccharides rich in uronic acids and xylose and very rich in arabinose, accounting for 27% of the cell wall material.

Preparation of carboxymethyl cellulose produced from purun tikus (Eleocharis dulcis)

NASA Astrophysics Data System (ADS)

Sunardi, Febriani, Nina Mutia; Junaidi, Ahmad Budi

2017-08-01

Sodium carboxymethyl cellulose (Na-CMC) is one of the important modified cellulose, a water-soluble cellulose, which is widely used in many application of food, pharmaceuticals, detergent, paper coating, dispersing agent, and others. The main raw material of modified cellulose is cellulose from wood and cotton. Recently, much attention has been attracted to the use of various agriculture product and by-product, grass, and residual biomass as cellulose and modified cellulose source for addressing an environmental and economic concern. Eleocharis dulcis, commonly known as purun tikus (in Indonesia), is a native aquatic plant of swamp area (wetland) in Kalimantan, which consists of 30-40% cellulose. It is significantly considered as one of the alternative resources for cellulose. The aims of present study were to isolate cellulose from E. dulcis and then to synthesise Na-CMC from isolated cellulose. Preparation of carboxymethyl cellulose from E. dulcis was carried out by an alkalization and etherification process of isolated cellulose, using various concentration of sodium hydroxide (NaOH) and monochloroacetic acid (MCA). The results indicated that the optimum reaction of alkalization was reached at 20% NaOH and etherification at the mass fraction ratio of MCA to cellulose 1.0. The optimum reaction has the highest solubility and degree of substitution. The carboxymethylation process of cellulose was confirmed by Fourier Transform Infrared spectroscopy (FTIR). In addition, changes in crystallinity of cellulose and Na-CMC were evaluated by X-ray diffraction (XRD).

Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

PubMed

Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

2009-06-01

A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

PubMed

Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

2017-08-26

Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

[Analysis of total proteins in the seed of almond (Prunus dulcis) by two-dimensional electrophoresis].

PubMed

Li, Dong-dong; He, Shao-heng

2004-07-01

To analyse the total proteins in the seeds of almond (Prunus dulcis), one of the popular ingestent allergens in China, by two-dimensional electrophoresis. The total proteins of the seeds were extracted by trichloracetic acid (TCA) method, and then separated by isoelectric focusing as first dimension and SDS-PAGE as the second dimension. The spots of proteins were visualized by staining with Coomassie Brilliant Blue R-250. After analysis with software (ImageMaster 2D), 188 different proteins were detected. The isoelectric points (pI) for approximately 28% of total proteins were between 4.5-5.5, and the relative molecular mass (M(r)) of approximately 62% total proteins were between (20-25)x10(3). This was the first high-resolution, two-dimensional protein map of the seed of almond (Prunus dulcis) in China. Our finding has laid a solid foundation for further identification, characterization, gene cloning and standardization of allergenic proteins in the seed of almond (Prunus dulcis).

Endophytic Penicillium citrinum Thom. from Scoparia dulcis Linn.

PubMed

Mathew, Annie J; Jayachandran, K; Mathew, Jyothis

2010-10-01

Scoparia dulcis of Scrophulariaceae is an annual herb distributed through out the tropics. Penicillium citrinum was obtained from apparently healthy roots, stem, leaves and fruits of this plant. Callus and multiple shoots produced during micropropagation from various explants were also symptomless but showed occurrence of Penicillium citrinum when cultured in Murashige & Skoog liquid medium for the production of secondary metabolites.

Free Radical Scavenging Activity of Scoparia dulcis Extract.

PubMed

Babincová, M.; Sourivong, P.

2001-01-01

We studied the scavenging capabilities of an extract of Scoparia dulcis (a cosmopolitan weed widespread in Laos and Vietnam) for 1-diphenyl-2-picrylhydrazyl and measured hemoglobin-catalyzed linoleic acid peroxidation with an oxygen electrode. Our results demonstrated strong antioxidant activity corresponding to mitigation of the generation of hydroxyl radicals, a possible rationale for the observed therapeutic effects of this weed.

Anti-inflammatory activity of Lippia dulcis.

PubMed

Pérez, S; Meckes, M; Pérez, C; Susunaga, A; Zavala, M A

2005-10-31

Lippia dulcis hexane and ethanol extracts were tested for its anti-inflammatory activity in several animal models. Hexane extract showed to be inactive, but the ethanol extract at doses of 400 mg/kg produced significant inhibition of carrageenan-induced paw oedema and reduced the weight of cotton pellet-induced granuloma, moreover, the topical application of 0.5 mg/ear of this extract inhibited the edema induced with TPA by 49.13%, an effect which is of less intensity than that produced by indomethacine at the same dose.

Cytokinin induced shoot regeneration and flowering of Scoparia dulcis L. (Scrophulariaceae)-an ethnomedicinal herb

PubMed Central

Premkumar, G; Sankaranarayanan, R; Jeeva, S; Rajarathinam, K

2011-01-01

Objective To develop an improved protocol for micropropagation of ethnomedicinally important Scoparia dulcis (S. dulcis) L. Methods Explants were inoculated on MS basal medium supplemented with kinetin and 6-benzylaminopurine for shoot bud induction. To enhance the shoot induction, various auxins like 3-indoleacetic acid or 3-indolebutyric acid or α-naphthylacetic acid were tested along with 2.32 M KI and 4.44 µM BAP. The regenerated shoots were rooted in half strength MS medium supplemented with various concentrations of IAA, IBA or NAA. After roots were developed, the plantlets were transplanted to pots filled with vermiculate and sand and kept in growth chamber with 70%–80% humidity under 16 h photoperiod. After acclimatization, the plantlets were transferred to the garden and survival percentage was calculated. Data were statistically analyzed and means were compared using Duncan's multiple range test (P<0.05). Results An in vitro method was developed to induce high frequency shoots regeneration from stem, mature leaf and young leaf explants of S. dulcis. Shoot induction on young leaf explants was most successful in MS medium supplemented with combination of two cytokinins (2.32 µM KI and 4.44 µM BAP) 2.85 µM IAA, 10% CM and 1 483.79 µM adenine sulfate. A single young leaf explant was capable of producing 59 shoots after 13 days of culture. Flower was induced in medium supplemented with combination of KI and BAP. Conclusions Cytokinins are the key factor to induce the direct shoot regeneration and flowering of S. dulcis. PMID:23569752

Cytokinin induced shoot regeneration and flowering of Scoparia dulcis L. (Scrophulariaceae)-an ethnomedicinal herb.

PubMed

Premkumar, G; Sankaranarayanan, R; Jeeva, S; Rajarathinam, K

2011-06-01

To develop an improved protocol for micropropagation of ethnomedicinally important Scoparia dulcis (S. dulcis) L. Explants were inoculated on MS basal medium supplemented with kinetin and 6-benzylaminopurine for shoot bud induction. To enhance the shoot induction, various auxins like 3-indoleacetic acid or 3-indolebutyric acid or α-naphthylacetic acid were tested along with 2.32 M KI and 4.44 µM BAP. The regenerated shoots were rooted in half strength MS medium supplemented with various concentrations of IAA, IBA or NAA. After roots were developed, the plantlets were transplanted to pots filled with vermiculate and sand and kept in growth chamber with 70%-80% humidity under 16 h photoperiod. After acclimatization, the plantlets were transferred to the garden and survival percentage was calculated. Data were statistically analyzed and means were compared using Duncan's multiple range test (P<0.05). An in vitro method was developed to induce high frequency shoots regeneration from stem, mature leaf and young leaf explants of S. dulcis. Shoot induction on young leaf explants was most successful in MS medium supplemented with combination of two cytokinins (2.32 µM KI and 4.44 µM BAP) 2.85 µM IAA, 10% CM and 1 483.79 µM adenine sulfate. A single young leaf explant was capable of producing 59 shoots after 13 days of culture. Flower was induced in medium supplemented with combination of KI and BAP. Cytokinins are the key factor to induce the direct shoot regeneration and flowering of S. dulcis.

Potent Insulin Secretagogue from Scoparia dulcis Linn of Nepalese Origin.

PubMed

Sharma, Khaga Raj; Adhikari, Achyut; Hafizur, Rahman M; Hameed, Abdul; Raza, Sayed Ali; Kalauni, Surya Kant; Miyazaki, Jun-Ichi; Choudhary, M Iqbal

2015-10-01

Ethno-botanical inspired isolation from plant Scoparia dulcis Linn. (Sweet Broomweed) yielded six compounds, coixol (1), glutinol (2), glutinone (3), friedelin (4), betulinic acid (5), and tetratriacontan-1-ol (6). There structures were identified using mass and 1D- and 2D-NMR spectroscopy techniques. Compounds 1-6 were evaluated for their insulin secretory activity on isolated mice islets and MIN-6 pancreatic β-cell line, and compounds 1 and 2 were found to be potent and mildly active, respectively. Compound 1 was further evaluated for insulin secretory activity on MIN-6 cells. Compound 1 was subjected to in vitro cytotoxicity assay against MIN-6, 3T3 cell lines, and islet cells, and in vivo acute toxicity test in mice that was found to be non-toxic. The insulin secretory activity of compounds 1 and 2 supported the ethno-botanic uses of S. dulcis as an anti-diabetic agent. Copyright © 2015 John Wiley & Sons, Ltd.

Protective role of Scoparia dulcis plant extract on brain antioxidant status and lipidperoxidation in STZ diabetic male Wistar rats

PubMed Central

Pari, Leelavinothan; Latha, Muniappan

2004-01-01

Background The aim of the study was to investigate the effect of aqueous extract of Scoparia dulcis on the occurrence of oxidative stress in the brain of rats during diabetes by measuring the extent of oxidative damage as well as the status of the antioxidant defense system. Methods Aqueous extract of Scoparia dulcis plant was administered orally (200 mg/kg body weight) and the effect of extract on blood glucose, plasma insulin and the levels of thiobarbituric acid reactive substances (TBARS), hydroperoxides, superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione-S-transferase (GST) and reduced glutathione (GSH) were estimated in streptozotocin (STZ) induced diabetic rats. Glibenclamide was used as standard reference drug. Results A significant increase in the activities of plasma insulin, superoxide dismutase, catalase, glutathione peroxidase, glutathione-S-transferase and reduced glutathione was observed in brain on treatment with 200 mg/kg body weight of Scoparia dulcis plant extract (SPEt) and glibenclamide for 6 weeks. Both the treated groups showed significant decrease in TBARS and hydroperoxides formation in brain, suggesting its role in protection against lipidperoxidation induced membrane damage. Conclusions Since the study of induction of the antioxidant enzymes is considered to be a reliable marker for evaluating the antiperoxidative efficacy of the medicinal plant, these findings suggest a possible antiperoxidative role for Scoparia dulcis plant extract. Hence, in addition to antidiabetic effect, Scoparia dulcis possess antioxidant potential that may be used for therapeutic purposes. PMID:15522116

Protective role of Scoparia dulcis plant extract on brain antioxidant status and lipidperoxidation in STZ diabetic male Wistar rats.

PubMed

Pari, Leelavinothan; Latha, Muniappan

2004-11-02

The aim of the study was to investigate the effect of aqueous extract of Scoparia dulcis on the occurrence of oxidative stress in the brain of rats during diabetes by measuring the extent of oxidative damage as well as the status of the antioxidant defense system. Aqueous extract of Scoparia dulcis plant was administered orally (200 mg/kg body weight) and the effect of extract on blood glucose, plasma insulin and the levels of thiobarbituric acid reactive substances (TBARS), hydroperoxides, superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione-S-transferase (GST) and reduced glutathione (GSH) were estimated in streptozotocin (STZ) induced diabetic rats. Glibenclamide was used as standard reference drug. A significant increase in the activities of plasma insulin, superoxide dismutase, catalase, glutathione peroxidase, glutathione-S-transferase and reduced glutathione was observed in brain on treatment with 200 mg/kg body weight of Scoparia dulcis plant extract (SPEt) and glibenclamide for 6 weeks. Both the treated groups showed significant decrease in TBARS and hydroperoxides formation in brain, suggesting its role in protection against lipidperoxidation induced membrane damage. Since the study of induction of the antioxidant enzymes is considered to be a reliable marker for evaluating the antiperoxidative efficacy of the medicinal plant, these findings suggest a possible antiperoxidative role for Scoparia dulcis plant extract. Hence, in addition to antidiabetic effect, Scoparia dulcis possess antioxidant potential that may be used for therapeutic purposes.

Antisickling and toxicological evaluation of the leaves of Scoparia dulcis Linn (Scrophulariaceae).

PubMed

Abere, Tavs A; Okoye, Chiagozie J; Agoreyo, Freddy O; Eze, Gerald I; Jesuorobo, Rose I; Egharevba, Clement O; Aimator, Pauline O

2015-11-23

Scoparia dulcis Linn (Scrophulariaceae) together with other medicinal plants serve as antisickling remedies in Africa. This study was aimed at investigating the antisickling activity of the leaves of the plant as well as establishing the toxicological profile. Chemical tests were employed in phytochemical investigations. Evaluation of the antisickling activity involved the inhibition of sodium metabisulphite-induced sickling of the HbSS red blood cells obtained from confirmed sickle cell patients who were not in crises. Concentrations of the crude extract and its fractions were tested with normal saline and p-hydroxybenzoic acid serving as controls. Acute toxicological evaluation was carried out in mice while 30-day assessment was done in rats. Phytochemical screening revealed the presence of alkaloids, tannins, flavonoids and saponins. Percentage sickling inhibitions of the aqueous methanol extracts of S. dulcis were significant all through the period of assay p < 0. 05 compared to normal saline, but not significant with PHBA. The fractions had less activity compared to the crude extracts. The LD 50 of the extract in mice was above 8000 mg/kg body weight when administered orally. Toxicological evaluations at 250 and 500 mg/kg showed mild congestion in virtually all the target organs. The antisickling results confirmed traditional usage of Scoparia dulcis in the management of Sickle cell disorders and a candidate for further investigations.

Evaluation of Sedative and Hypnotic Activity of Ethanolic Extract of Scoparia dulcis Linn.

PubMed Central

Moniruzzaman, Md.; Atikur Rahman, Md.; Ferdous, Afia

2015-01-01

Scoparia dulcis Linn. (SD) is a perennial herb that has been well studied for its antioxidant, anti-inflammatory, antidiabetic, and hepatoprotective effects. However, scientific information on SD regarding the neuropharmacological effect is limited. This study evaluated the sedative and hypnotic effect of the ethanolic extract of whole plants of Scoparia dulcis (EESD). For this purpose, the whole plants of S. dulcis were extracted with ethanol following maceration process and tested for the presence of phytochemical constituents. The sedative and hypnotic activity were then investigated using hole cross, open field, hole-board, rota-rod, and thiopental sodium-induced sleeping time determination tests in mice at the doses of 50, 100, and 200 mg/kg of EESD. Diazepam at the dose of 1 mg/kg was used as a reference drug in all the experiments. We found that EESD produced a significant dose-dependent inhibition of locomotor activity of mice both in hole cross and open field tests (P < 0.05). Besides, it also decreased rota-rod performances and the number of head dips in hole-board test. Furthermore, EESD significantly decreased the induction time to sleep and prolonged the duration of sleeping, induced by thiopental sodium. Taken together, our study suggests that EESD may possess sedative principles with potent hypnotic properties. PMID:25861372

Evaluation of Sedative and Hypnotic Activity of Ethanolic Extract of Scoparia dulcis Linn.

PubMed

Moniruzzaman, Md; Atikur Rahman, Md; Ferdous, Afia

2015-01-01

Scoparia dulcis Linn. (SD) is a perennial herb that has been well studied for its antioxidant, anti-inflammatory, antidiabetic, and hepatoprotective effects. However, scientific information on SD regarding the neuropharmacological effect is limited. This study evaluated the sedative and hypnotic effect of the ethanolic extract of whole plants of Scoparia dulcis (EESD). For this purpose, the whole plants of S. dulcis were extracted with ethanol following maceration process and tested for the presence of phytochemical constituents. The sedative and hypnotic activity were then investigated using hole cross, open field, hole-board, rota-rod, and thiopental sodium-induced sleeping time determination tests in mice at the doses of 50, 100, and 200 mg/kg of EESD. Diazepam at the dose of 1 mg/kg was used as a reference drug in all the experiments. We found that EESD produced a significant dose-dependent inhibition of locomotor activity of mice both in hole cross and open field tests (P < 0.05). Besides, it also decreased rota-rod performances and the number of head dips in hole-board test. Furthermore, EESD significantly decreased the induction time to sleep and prolonged the duration of sleeping, induced by thiopental sodium. Taken together, our study suggests that EESD may possess sedative principles with potent hypnotic properties.

Effect of juice and fermented vinegar from Hovenia dulcis peduncles on chronically alcohol-induced liver damage in mice.

PubMed

Xiang, Jinle; Zhu, Wenxue; Li, Zhixi; Ling, Shengbao

2012-06-01

The protective effects of juice and fermented vinegar from Hovenia dulcis peduncles on chronically ethanol-induced biochemical changes in male mice were investigated. Administration of ethanol (50%, v/v, 10 mL kg⁻¹) to mice for 6 weeks induced liver damage with a significant increase (P < 0.01) of the liver index, aspartate transaminase (AST), alanine transaminase (ALT), gamma glutamyl transferase (γ-GT) in the serum and the hepatic lipid peroxidation (LPO) level. In contrast, administration of juice or fermented vinegar from Hovenia dulcis peduncles (10 mL kg⁻¹ bw) along with alcohol significantly (P < 0.05) decreased the activities of the enzymes (AST, ALT and γ-GT), liver index, concentrations of triglyceride (TG) and total cholesterol (TCH) in the serum and the hepatic TG and LPO levels. Mice treated with juice or fermented vinegar from Hovenia dulcis peduncles showed better profiles of the antioxidant systems with relatively higher glutathione (GSH) content, total superoxide dismutase (T-SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) activities. All these results were accompanied by histological observations in liver. The results demonstrate that both of the juice and fermented vinegar from Hovenia dulcis peduncles have beneficial effects in reducing the adverse effect of alcohol.

Analgesic, diuretic, and anti-inflammatory principle from Scoparia dulcis.

PubMed

Ahmed, M; Shikha, H A; Sadhu, S K; Rahman, M T; Datta, B K

2001-08-01

Scoparinol, a diterpene, isolated from Scoparia dulcis showed significant analgesic (p < 0.001) and anti-inflammatory activity (p < 0.01) in animals. A sedative action of scoparinol was demonstrated by a marked potentiation of pentobarbital-induced sedation with a significant effect on both onset and duration of sleep (p < 0.05). Measurement of urine volume after administration of scoparinol indicated its significant diuretic action.

Sympathomimetic effects of Scoparia dulcis L. and catecholamines isolated from plant extracts.

PubMed

Freire, S M; Torres, L M; Souccar, C; Lapa, A J

1996-06-01

The herb Scoparia dulcis L. is used in Brazilian folk medicine to treat bronchitis, gastric disorders, haemorrhoids, insect bites and skin wounds, and in oriental medicine to treat hypertension. A previous study has shown that extracts of S. dulcis have analgesic and anti-inflammatory properties; in this work the sympathomimetic activity of an ethanolic extract of Scoparia dulcis L. has been investigated in rodent preparations in-vivo and in-vitro. Administration of the extract (0.5-2 mg kg-1, i.v.) to anaesthetized rats produced dose-related hypertension blocked by the alpha-adrenoceptor antagonist prazosin (1 mg kg-1). Partition of the extract in chloroform-water yielded an aqueous phase 20 times more potent than the extract; this produced hypertension in either reserpine-treated or pithed rats. In untreated and reserpine-treated rats the same fraction (1-3 x 10(3) micrograms mL-1) produced concentration-dependent contractions of the vas deferens musculature parallel to those obtained with noradrenaline (10(-8)-10(-4)M). Prazosin (10(-7)M) reduced the maximum contractile effect of the aqueous fraction, and shifted the concentration-response curves for noradrenaline to the right. The aqueous fraction (25 and 50 micrograms mL-1) increased the inotropism of electrically driven left atria of rats, the effect being blocked by propranolol (0.4 microgram mL-1). In preparations of guinea-pig tracheal rings the aqueous fraction (1-3 x 10(3) micrograms mL-1) relaxed the muscle contraction induced by histamine (10(-4) M) in proportion to the concentration. The effect was antagonized competitively by propranolol (1.5 microM). High-performance liquid-chromatographic analysis of the aqueous fraction revealed the presence of both noradrenaline and adrenaline in the plant extract. The results indicated that both catecholamines may account for the hypertensive and inotropic effects obtained after parenteral administration of S. dulcis extracts. This sympathomimetic activity is

Chemical and biological evaluation on scopadulane-type diterpenoids from Scoparia dulcis of Vietnamese origin.

PubMed

Phan, Minh Giang; Phan, Tong Son; Matsunami, Katsuyoshi; Otsuka, Hideaki

2006-04-01

From the aerial parts of Scoparia dulcis L. (Scrophulariaceae) grown in Vietnam, four scopadulane-type diterpenoids (4-7), of which 7 is new and was given the trivial name scopadulcic acid C, together with nine known compounds were isolated. Their structures were elucidated by spectroscopic analyses. The absolute configurations of 4-7 were ascertained by applying the modified Mosher's method to iso-dulcinol (6). The isolation of the lignans nirtetralin and niranthin for the first time from S. dulcis is also of chemotaxonomic interest. The cytotoxic activity in KB cells, inhibitory effect on LPS/IFNgamma-induced NO production, inhibition of multidrug resistance (MDR), and antibacterial and antifungal activities of the scopadulane-type diterpenoids 4-7 were examined in this study.

Essential oil from leaves of Lippia dulcis grown in Colombia.

PubMed

Moreno-Murillo, Bárbara; Quijano-Célis, Clara; Romero, Arturo R; Pino, Jorge A

2010-04-01

The chemical composition of the volatile compounds from the leaves of Lippia dulcis Trev. (Verbenaceae) from Colombia was studied by GC and GC/MS. Forty volatile compounds were identified, of which the major ones were alpha-copaene (18.0%), beta-caryophyllene (17.8%), and delta-cadinene (14.7%). The sweet bisabolane sesquiterpenoid, hernandulcin, formed only 1.1% of the leaf oil.

Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

PubMed

Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

2001-02-01

cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

Self-(in)compatibility of the almonds P. dulcis and P. webbii: detection and cloning of 'wild-type Sf ' and new self-compatibility alleles encoding inactive S-RNases.

PubMed

Bosković, Radovan I; Tobutt, Kenneth R; Ortega, Encarnación; Sutherland, Bruce G; Godini, Angelo

2007-12-01

Prunus dulcis, the almond, is a predominantly self-incompatible (SI) species with a gametophytic self-incompatibility system mediated by S-RNases. The economically important allele Sf, which results in self-compatibility in P. dulcis, is said to have arisen by introgression from Prunus webbii in the Italian region of Apulia. We investigated the range of self-(in)compatibility alleles in Apulian material of the two species. About 23 cultivars of P. dulcis (14 self-compatible (SC) and nine SI) and 33 accessions of P. webbii (16 SC, two SI and 15 initially of unknown status), all from Apulia, were analysed using PCR of genomic DNA to amplify S-RNase alleles and, in most cases, IEF and staining of stylar protein extracts to detect S-RNase activity. Some amplification products were cloned and sequenced. The allele Sf was present in nearly all the SC cultivars of P. dulcis but, surprisingly, was absent from nearly all SC accessions of P. webbii. And of particular interest was the presence in many SI cultivars of P. dulcis of a new active allele, labelled S30, the sequence of which showed it to be the wild-type of Sf so that Sf can be regarded as a stylar part mutant S30 degrees . These findings indicate Sf may have arisen within P. dulcis, by mutation. One SC cultivar of P. dulcis, 'Patalina', had a new self-compatibility allele lacking RNase activity, Sn5, which could be useful in breeding programmes. In the accessions of P. webbii, some of which were known to be SC, three new alleles were found which lacked RNase activity but had normal DNA sequences.

Antidiabetic effect of Scoparia dulcis: effect on lipid peroxidation in streptozotocin diabetes.

PubMed

Pari, L; Latha, M

2005-03-01

Oxidative damage has been suggested to be a contributory factor in the development and complications of diabetes. The antioxidant effect of an aqueous extract of Scoparia dulcis, an indigenous plant used in Ayurvedic medicine in India was studied in rats with streptozotocin-induced diabetes. Oral administration of Scoparia dulcis plant extract (SPEt) (200 mg/kg body weight) for 3 weeks resulted in a significant reduction in blood glucose and an increase in plasma insulin. The aqueous extract also resulted in decreased free radical formation in tissues (liver and kidney) studied. The decrease in thiobarbituric acid reactive substances (TBARS) and hydroperoxides (HPX) and increase in the activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), reduced glutathione (GSH) and glutathione-S-transferase (GST) clearly show the antioxidant properties of SPEt in addition to its antidiabetic effect. The effect of SPEt at 200 mg/kg body weight was better than glibenclamide, a reference drug.

Effect of scoparia dulcis (Sweet Broomweed) plant extract on plasma antioxidants in streptozotocin-induced experimental diabetes in male albino Wistar rats.

PubMed

Pari, L; Latha, M

2004-07-01

Clinical research has confirmed the efficacy of several plants in the modulation of oxidative stress associated with diabetes mellitus. Scoparia dulcis plant extract is tried for prevention and treatment of diabetes mellitus induced experimentally by streptozotocin injection. A single dose of streptozotocin (45 mg/kg body weight) produced decrease in insulin, hyperglycemia, increased lipid peroxidation (Thiobarbituric reactive substances and lipid hydroperoxides) and decreased antioxidant levels (vitamin C, vitamin E, reduced glutathione, ceruloplasmin). Oral administration of an aqueous extract of Scoparia dulcis plant (200 mg/kg body weight) for 6 weeks to diabetic rats significantly increased the plasma insulin and plasma antioxidants and significantly decreased lipid peroxidation. The effect of Scoparia dulcis plant extract at 200 mg/kg body weight was better than that of glibenclamide, a reference drug.

Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

PubMed

Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

2008-11-01

A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

A comparative study of the antioxidant, antimicrobial, cytotoxic and thrombolytic potential of the fruits and leaves of Spondias dulcis

PubMed Central

Islam, Shawkat Md. Aminul; Ahmed, Kh Tanvir; Manik, Mohammad Kawsar; Wahid, Md. Arif; Kamal, Chowdhury Shafayat Ibne

2013-01-01

Objective To investigate the antioxidant, antimicrobial, cytotoxic and thrombolytic property of the fruits and leaves of Spondias dulcis (S. dulcis). Methods Methanolic extracts of fruits and leaves of S. dulcis were partitioned with chloroform and dichloromethane. The antioxidant potential of the crude extract and partitioned fractions were evaluated in terms of total phenolic content, total flavonoid content, DPPH radical scavenging potential, reducing potential and total antioxidant capacity by specific standard procedures. The antimicrobial activity was evaluated using disc diffusion method. The cytotoxicity was evaluated by using brine shrimp lethality bioassay and compared with vincristine sulfate. The thrombolytic activity was compared with streptokinase. Results The methanolic fruit extract exhibited the highest phenolic content, flavonoid content and antioxidant capacity, among the other extracts, with the highest DPPH radical scavenging activity at a concentration of 10 µg/mL (IC50: 1.91 µg/mL) and maximum reducing power at a concentration of 100 µg/mL (EC50: 3.58 µg/mL). Though all extract showed moderate antimicrobial activity against the bacterial strains, weak or no activity against fungus. The range of LC50 value of all extracts was 1.335-14.057 µg/mL which was far lower than the cut off index for cytotoxicity. All extracts exhibited statistically significant (P<0.001) thrombolytic activity. Conclusions Our study suggested that S. dulcis exhibits antimicrobial activities against a wide variety of strains while it possesses significant antioxidant, cytotoxic and thrombolytic activity. PMID:23998007

A comparative study of the antioxidant, antimicrobial, cytotoxic and thrombolytic potential of the fruits and leaves of Spondias dulcis.

PubMed

Islam, Shawkat Md Aminul; Ahmed, Kh Tanvir; Manik, Mohammad Kawsar; Wahid, Md Arif; Kamal, Chowdhury Shafayat Ibne

2013-09-01

To investigate the antioxidant, antimicrobial, cytotoxic and thrombolytic property of the fruits and leaves of Spondias dulcis (S. dulcis). Methanolic extracts of fruits and leaves of S. dulcis were partitioned with chloroform and dichloromethane. The antioxidant potential of the crude extract and partitioned fractions were evaluated in terms of total phenolic content, total flavonoid content, DPPH radical scavenging potential, reducing potential and total antioxidant capacity by specific standard procedures. The antimicrobial activity was evaluated using disc diffusion method. The cytotoxicity was evaluated by using brine shrimp lethality bioassay and compared with vincristine sulfate. The thrombolytic activity was compared with streptokinase. The methanolic fruit extract exhibited the highest phenolic content, flavonoid content and antioxidant capacity, among the other extracts, with the highest DPPH radical scavenging activity at a concentration of 10 µg/mL (IC50: 1.91 µg/mL) and maximum reducing power at a concentration of 100 µg/mL (EC50: 3.58 µg/mL). Though all extract showed moderate antimicrobial activity against the bacterial strains, weak or no activity against fungus. The range of LC50 value of all extracts was 1.335-14.057 µg/mL which was far lower than the cut off index for cytotoxicity. All extracts exhibited statistically significant (P<0.001) thrombolytic activity. Our study suggested that S. dulcis exhibits antimicrobial activities against a wide variety of strains while it possesses significant antioxidant, cytotoxic and thrombolytic activity.

Antiviral agents of plant origin. III. Scopadulin, a novel tetracyclic diterpene from Scoparia dulcis L.

PubMed

Hayashi, T; Kawasaki, M; Miwa, Y; Taga, T; Morita, N

1990-04-01

The structure and stereochemistry of scopadulin, a novel aphidicolane-type diterpene isolated from Scoparia dulcis L. have been established from spectral data and single-crystal X-ray analysis of its acetone solvate.

Bisabolane-type sesquiterpenes from the aerial parts of Lippia dulcis.

PubMed

Ono, Masateru; Tsuru, Tsuyoshi; Abe, Hiroaki; Eto, Masashi; Okawa, Masafumi; Abe, Fumiko; Kinjo, Junei; Ikeda, Tsuyoshi; Nohara, Toshihiro

2006-10-01

Six new bisabolane-type sesquiterpenes, peroxylippidulcines A-C (3-5), peroxyepilippidulcine B (6), and epilippidulcines B (7) and C (8), have been isolated from the aerial parts of Lippia dulcis, along with two known bisabolane-type sesquiterpenes, seven known flavonoids, and a known triterpenoid. The structures of 3-8 were characterized on the basis of NMR, MS, specific rotation, and X-ray crystallographic analysis data and chemical evidence.

Modulatory effect of Scoparia dulcis in oxidative stress-induced lipid peroxidation in streptozotocin diabetic rats.

PubMed

Latha, M; Pari, L

2003-01-01

In light of evidence that diabetes mellitus is associated with oxidative stress and altered antioxidant status, we investigated the effect of Scoparia dulcis plant extracts (SPEt) (aqueous, ethanolic, and chloroform) in streptozotocin diabetic rats. Significant increases in the activities of insulin, superoxide dismutase, catalase, glutathione peroxidase, glutathione-S-transferase, reduced glutathione, vitamin C, and vitamin E were observed in liver, kidney, and brain on treatment with SPEt. In addition, the treated groups also showed significant decreases in blood glucose, thiobarbituric acid-reactive substances, and hydroperoxide formation in tissues, suggesting its role in protection against lipid peroxidation-induced membrane damage. Thus, the results of the present study indicate that extracts of S. dulcis, especially the aqueous extract, showed a modulatory effect by attenuating the above lipid peroxidation in streptozotocin diabetes.

Elucidation of terpenoid metabolism in Scoparia dulcis by RNA-seq analysis.

PubMed

Yamamura, Yoshimi; Kurosaki, Fumiya; Lee, Jung-Bum

2017-03-07

Scoparia dulcis biosynthesize bioactive diterpenes, such as scopadulcic acid B (SDB), which are known for their unique molecular skeleton. Although the biosynthesis of bioactive diterpenes is catalyzed by a sequence of class II and class I diterpene synthases (diTPSs), the mechanisms underlying this process are yet to be fully identified. To elucidate these biosynthetic machinery, we performed a high-throughput RNA-seq analysis, and de novo assembly of clean reads revealed 46,332 unique transcripts and 40,503 two unigenes. We found diTPSs genes including a putative syn-copalyl diphosphate synthase (SdCPS2) and two kaurene synthase-like (SdKSLs) genes. Besides them, total 79 full-length of cytochrome P450 (CYP450) genes were also discovered. The expression analyses showed selected CYP450s associated with their expression pattern of SdCPS2 and SdKSL1, suggesting that CYP450 candidates involved diterpene modification. SdCPS2 represents the first predicted gene to produce syn-copalyl diphosphate in dicots. In addition, SdKSL1 potentially contributes to the SDB biosynthetic pathway. Therefore, these identified genes associated with diterpene biosynthesis lead to the development of genetic engineering focus on diterpene metabolism in S. dulcis.

Hepatoprotective Effect of Polyphenol-Enriched Fraction from Folium Microcos on Oxidative Stress and Apoptosis in Acetaminophen-Induced Liver Injury in Mice.

PubMed

Wu, Hongtan; Zhang, Gang; Huang, Lisen; Pang, Haiyue; Zhang, Na; Chen, Yupei; Wang, Gueyhorng

2017-01-01

Folium Microcos (FM), the leaves of Microcos paniculata L., shows various biological functions including antioxidant activity and α -glucosidase inhibitory effect. However, its therapeutic potential in acute liver injury is still unknown. This study investigated the hepatoprotective effect and underlying mechanisms of the polyphenol-enriched fraction (FMF) from Folium Microcos . FMF exhibited strong free radical scavenging activities and prevented HepG2/Hepa1-6 cells from hydrogen peroxide- (H 2 O 2 -) induced ROS production and apoptosis in vitro. Antioxidant activity and cytoprotective effects were further verified by alleviating APAP-induced hepatotoxicity in mice. Western blot analysis revealed that FMF pretreatment significantly abrogated APAP-mediated phosphorylation of MAPKs, activation of proapoptotic protein caspase-3/9 and Bax, and restored expression of antiapoptotic protein Bcl2. APAP-intoxicated mice pretreated with FMF showed increased nuclear accumulation of nuclear factor erythroid 2-related factor (Nrf2) and elevated hepatic expression of its target genes, NAD(P)H:quinine oxidoreductase 1 (NQO1) and hemeoxygenase-1(HO-1). HPLC analysis revealed the four predominantly phenolic compounds present in FMF: narcissin, isorhamnetin-3-O- β -D-glucoside, isovitexin, and vitexin. Consequently, these findings indicate that FMF possesses a hepatoprotective effect against APAP-induced hepatotoxicity mainly through dual modification of ROS/MAPKs/apoptosis axis and Nrf2-mediated antioxidant response, which may be attributed to the strong antioxidant activity of phenolic components.

[Effects of flavonoids from Pyrrosiae folium on pathological changes and inflammatory response of diabetic nephropathy].

PubMed

Liu, Xu-Lin; Liu, Wen-Ping; Wang, Li-Li; Feng, Liang

2018-06-01

Diabetic nephropathy (DN) is closely related to immune-mediated inflammatory damage. Pyrrosiae folium is used commonly for the urinary system diseases with a good efficacy, which contains abundant flavonoids (SWHT). This study was performed to investigate the therapeutic effect of SWHT on DN and its effect on inflammatory response. In this study, the main active components of SWHT were identified by high performance liquid chromatography (HPLC). The results showed that SWHT mainly contained mangiferin and isomucoside. Rat model of diabetic nephropathy (DN) was established by feeding high glucose & high fat diet and injecting streptozocin (STZ). Then the rats were randomly divided into control group, DN model group, positive control group, and SWHT groups (50, 100, 200 mg·kg⁻¹, ig). The levels of AGEs and RAGE in serum were measured by ELISA after 12 weeks of drug administration. The serum creatinine, blood urea nitrogen and total protein levels were detected by using test kit. HE staining and transmission electron microscopy were applied to observe the pathological changes and structure of renal tissue. Western blot and ELISA were used to detect the protein expression and content levels of interleukin 6 (IL-6), tumor necrosis factor (TNF-α) and IL-1β in renal tissue. Results showed that SWHT significantly decreased serum AGEs and RAGE levels in DN rats; decreased serum creatinine, blood urea nitrogen and total urinary protein levels, improved renal pathological damages and reduced basement membrane thickening in DN rats. In addition, SWHT down-regulated the protein expression levels of inflammatory mediators IL-6, TNF-α and IL-1β. The research studies indicated that SWHT component had a potential anti-diabetic nephropathy activity, and its improvement effect on pathological damages may be related to reducing inflammation. This provides the basis for the scientific and rational application of P. folium, and also provides active components for further

Medicinal flowers. XXXX . Structures of dihydroisocoumarin glycosides and inhibitory effects on aldose reducatase from the flowers of Hydrangea macrophylla var.thunbergii.

PubMed

Liu, Jiang; Nakamura, Seikou; Zhuang, Yan; Yoshikawa, Masayuki; Hussein, Ghazi Mohamed Eisa; Matsuo, Kyohei; Matsuda, Hisashi

2013-01-01

Six dihydroisocoumarin glycosides, florahydrosides I and II, thunberginol G 8-O-β-d-glucopyranoside, thunberginol C 8-O-β-d-glucopyranoside, 4-hydroxythunberginol G 3'-O-β-d-glucopyranoside, and thunberginol D 3'-O-β-d-glucopyranoside, have been isolated from the flowers of Hydrangea macrophylla Seringe var. thunbergii Makino (Saxifragaceae) together with 20 known compounds. The chemical structures of the new compounds were elucidated on the basis of chemical and physicochemical evidence. Among the constituents, acylated quinic acid analog, neochlorogenic acid, was shown to substantially inhibit aldose reductase [IC50=5.6 µm]. In addition, the inhibitory effects on aldose reductase of several caffeoylquinic acid analogs were examined for structure-activity relationship study. As the results, 4,5-O-trans-p-dicaffeoyl-d-quinic acid was found to exhibit a potent inhibitory effect [IC50=0.29 µm].

Transcriptional activation of a geranylgeranyl diphosphate synthase gene, GGPPS2, isolated from Scoparia dulcis by treatment with methyl jasmonate and yeast extract.

PubMed

Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F

2014-10-01

A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.

Elucidation of terpenoid metabolism in Scoparia dulcis by RNA-seq analysis

PubMed Central

Yamamura, Yoshimi; Kurosaki, Fumiya; Lee, Jung-Bum

2017-01-01

Scoparia dulcis biosynthesize bioactive diterpenes, such as scopadulcic acid B (SDB), which are known for their unique molecular skeleton. Although the biosynthesis of bioactive diterpenes is catalyzed by a sequence of class II and class I diterpene synthases (diTPSs), the mechanisms underlying this process are yet to be fully identified. To elucidate these biosynthetic machinery, we performed a high-throughput RNA-seq analysis, and de novo assembly of clean reads revealed 46,332 unique transcripts and 40,503 two unigenes. We found diTPSs genes including a putative syn-copalyl diphosphate synthase (SdCPS2) and two kaurene synthase-like (SdKSLs) genes. Besides them, total 79 full-length of cytochrome P450 (CYP450) genes were also discovered. The expression analyses showed selected CYP450s associated with their expression pattern of SdCPS2 and SdKSL1, suggesting that CYP450 candidates involved diterpene modification. SdCPS2 represents the first predicted gene to produce syn-copalyl diphosphate in dicots. In addition, SdKSL1 potentially contributes to the SDB biosynthetic pathway. Therefore, these identified genes associated with diterpene biosynthesis lead to the development of genetic engineering focus on diterpene metabolism in S. dulcis. PMID:28266568

Roles of the Declive, Folium, and Tuber Cerebellar Vermian Lobules in Sportspeople

PubMed Central

Park, In Sung; Lee, Nam Joon

2018-01-01

The cerebellum plays vital roles in balance control and motor learning, including in saccadic adaptation and coordination. It consists of the vermis and two hemispheres and is anatomically separated into ten lobules that are designated as I–X. Although neuroimaging and clinical studies suggest that functions are compartmentalized within the cerebellum, the function of each cerebellar lobule is not fully understood. Electrophysiological and lesion studies in animals as well as neuroimaging and lesion studies in humans have revealed that vermian lobules VI and VII (declive, folium, and tuber) are critical for controlling postural balance, saccadic eye movements, and coordination. In addition, recent structural magnetic resonance imaging studies have revealed that these lobules are larger in elite basketball and short-track speed skaters. Furthermore, in female short-track speed skaters, the volume of this region is significantly correlated with static balance. This article reviews the function of vermian lobules VI and VII, focusing on the control of balance, eye movements, and coordination including coordination between the eyes and hands and bimanual coordination. PMID:29141275

European Ethnopharmaceuticals for Self-Medication in Japan: Review Experience of Vitis vinifera L., Folium Extract and Vitex agnus-castus L., Fructus Extract as OTC Drugs.

PubMed

Hoshino, Tatsuro; Muto, Nanami; Tsukada, Shinsuke; Nakamura, Takatoshi; Maegawa, Hikoichiro

2018-01-06

Since the publication of "Application Guideline for Western Traditional Herbal Medicines as OTC Drugs" in 2007, only two European ethnopharmaceuticals, Vitis vinifera L., folium extract (Antistax) and Vitex agnus-castus L., fructus extract (Prefemin), have been approved as OTC drugs in Japan. In this review, we describe the current regulation of Western ethnopharmaceuticals in Japan, summarize our regulatory experiences and discuss the scientific and regulatory issues involved.

Key Aroma Compounds in Lippia dulcis (Dushi Button).

PubMed

Schmitt, Rainer; Cappi, Michael; Pollner, Gwendola; Greger, Veronika

2018-03-14

An aroma extract dilution analysis (AEDA) applied on aroma extracts prepared from the edible flower Dushi Button ( Lippia dulcis) resulted in the detection of 34 odor-active compounds. The highest flavor dilution (FD) factors were determined for methyl 2-methylbutanoate, ethyl 2-methylbutanoate, 4-mercapto-4-methyl-2-pentanone, an unknown caramel-like compound, and vanillin. Quantitative measurements performed by application of stable isotope dilution assays (SIDA), followed by a calculation of odor activity values (OAVs), resulted in the revelation of 4-mercapto-4-methyl-2-pentanone, linalool, myrcene, ethyl 2-methylbutanoate, methyl 2-methylbutanoate, and ( Z)-3-hexenal as important contributors to the flavor of Dushi Buttons.

In vivo inhibition of gastric acid secretion by the aqueous extract of Scoparia dulcis L. in rodents.

PubMed

Mesía-Vela, Sonia; Bielavsky, Monica; Torres, Luce Maria Brandão; Freire, Sonia Maria; Lima-Landman, Maria Teresa R; Souccar, Caden; Lapa, Antonio José

2007-05-04

The freeze-dried aqueous extract (AE) from the aerial parts of Scoparia dulcis was tested for its effects on experimental gastric hypersecretion and ulcer in rodents. Administration of AE to animals with 4h pylorus ligature potently reduced the gastric secretion with ED(50)s of 195 mg/kg (rats) and 306 mg/kg (mice). The AE also inhibited the histamine- or bethanechol-stimulated gastric secretion in pylorus-ligated mice with similar potency suggesting inhibition of the proton pump. Bio-guided purification of the AE yielded a flavonoid-rich fraction (BuF), with a specific activity 4-8 times higher than the AE in the pylorus ligature model. BuF also inhibited the hydrolysis of ATP by H(+),K(+)-ATPase with an IC(50) of 500 microg/ml, indicating that the inhibition of gastric acid secretion of Scoparia dulcis is related to the inhibition of the proton pump. Furthermore, the AE inhibited the establishment of acute gastric lesions induced in rats by indomethacin (ED(50)=313 mg/kg, p.o.) and ethanol (ED(50)=490 mg/kg, p.o.). No influence of the AE on gastrointestinal transit allowed discarding a possible CNS or a cholinergic interaction in the inhibition of gastric secretion by the AE. Collectively, the present data pharmacologically validates the popular use of Scoparia dulcis in gastric disturbances.

Ethnoecology of the palm Brahea dulcis (Kunth) Mart. in central Mexico.

PubMed

Pulido, María T; Coronel-Ortega, Mayte

2015-01-05

There have been few studies on the sustainable use of non-timber forest products in arid and semi-arid zones. The palm Brahea dulcis has been one of the most important resources in semi-arid Mesoamerica, since pre-Hispanic times. Currently, some populations grow within protected natural areas, representing both a challenge and an opportunity for local development. This ethnoecological study of B. dulcis in central Mexico aimed to evaluate their uses, harvesting context, and potential for exploitation, in order to give practical advice on their best use and management. Ethnographic and ecological information was obtained in Barranca de Metztitlán Biosphere Reserve and Valle del Mezquital, Mexico. We studied the population structure and density; additionally, we evaluated the rate of leaf production, leaf renewal rate, percent survival of new leaves, the development of reproductive structures and performed a one-year defoliation experiment (involving a control and four treatments including a mix of semiannual and annual frequency of harvest and removal of two new leaves and/or two mature leaves). Twenty uses of the palm were recorded in the study area. Religious/symbolic and handicraft uses are highlighted. The population density of this species was the highest reported for the genus (1244 ± 231.7 ind/ha). The leaf production rate was the highest reported for arborescent palms of the Americas (11.83 ± 0.036 leaves/individual/year). The sexual reproductive cycle was 2.3 years long. A one-year defoliation experiment did not show statistically significant differences. Recommendations include: 1) implement management focused on increasing the abundance and quality of this useful resource in Metztitlán; 2) employ a strategy of focusing on ethnicity and gender in promoting their exploitation; 3) learn from theoretical frameworks of other non timber forest product studies. We propose that Brahea dulcis is the palm with the highest potential for sustainable use

Ameliorative effects of Artemisia argyi Folium extract on 2,4-dinitrochlorobenzene-induced atopic dermatitis-like lesions in BALB/c mice

PubMed Central

Han, Hyoung-Min; Kim, Seung-Ju; Kim, Jong-Sik; Kim, Bum Hoi; Lee, Hai Woong; Lee, Yong Tae; Kang, Kyung-Hwa

2016-01-01

Artemisia argyi Folium has been used to treat skin diseases, including eczema and dermatitis, in South Korean medicine. The present study investigated the curative effects of Artemisia argyi Folium extract (AAFE) on 2,4-dinitrochlorobenzene (DNCB)-induced atopic dermatitis (AD)-like skin lesions in a BALB/c mouse model. Briefly, the dorsal skin of the BALB/c mice was sensitized three times with DNCB, whereas the ears were challenged twice. Repeated treatment with DNCB induced AD-like lesions. The effects of AAFE on AD-like lesions were evaluated by clinical observation, histopathological analysis, immunohistochemistry and enzyme-linked immunosorbent assay. In addition, reverse transcription-polymerase chain reaction and western blotting were performed. Treatment with AAFE reduced AD-like lesions, as determined by clinical observation, histopathological analysis, and detection of the serum levels of histamine, immunoglobulin E and cytokines. With regards to its mechanism of action, AAFE inhibited the phosphorylation of Lck/yes-related novel tyrosine kinase (Lyn), spleen tyrosine kinase (Syk), mitogen-activated protein kinases (MAPKs), phosphoinositide 3-kinase (PI3K)/Akt and IκBα, which have essential roles in the production of various cytokines in lymph nodes. The suppressive activity of AAFE may be due to the inhibition of a series of immunopathological events, including the release of proinflammatory cytokines. The results of the present study strongly suggest that AAFE exerts an anti-AD effect by inhibiting the Lyn, Syk, MAPKs, PI3K/Akt and IκBα pathways. Therefore, AAFE may be considered an effective herbal remedy for the treatment of AD. PMID:27571702

Acetylated flavonoid glycosides potentiating NGF action from Scoparia dulcis.

PubMed

Li, Yushan; Chen, Xigui; Satake, Masayuki; Oshima, Yasukatsu; Ohizumi, Yasushi

2004-04-01

Three new acetylated flavonoid glycosides, 5,6,4'-trihydroxyflavone 7-O-alpha-L-2,3-di-O-acetylrhamnopyranosyl-(1-->6)-beta-D-glucopyranoside (1), apigenin 7-O-alpha-L-3-O-acetylrhamnopyranosyl-(1-->6)-beta-D-glucopyranoside (2), and apigenin 7-O-alpha-L-2,3-di-O-acetylrhamnopyranosyl-(1-->6)-beta-D-glucopyranoside (3), were isolated from Scoparia dulcis together with the known compound eugenyl beta-D-glucopyranoside (4). Their structures were elucidated by spectroscopic analyses. Compounds 2 and 3 showed an enhancing activity of nerve growth factor-mediated neurite outgrowth in PC12D cells.

European Ethnopharmaceuticals for Self-Medication in Japan: Review Experience of Vitis vinifera L., Folium Extract and Vitex agnus-castus L., Fructus Extract as OTC Drugs

PubMed Central

Hoshino, Tatsuro; Muto, Nanami; Tsukada, Shinsuke; Nakamura, Takatoshi; Maegawa, Hikoichiro

2018-01-01

Since the publication of “Application Guideline for Western Traditional Herbal Medicines as OTC Drugs” in 2007, only two European ethnopharmaceuticals, Vitis vinifera L., folium extract (Antistax) and Vitex agnus-castus L., fructus extract (Prefemin), have been approved as OTC drugs in Japan. In this review, we describe the current regulation of Western ethnopharmaceuticals in Japan, summarize our regulatory experiences and discuss the scientific and regulatory issues involved. PMID:29316611

Isolation and identification of flavonoids, including flavone rotamers, from the herbal drug 'Crataegi folium cum flore' (hawthorn).

PubMed

Rayyan, S; Fossen, T; Solheim Nateland, H; Andersen, O M

2005-01-01

Twelve flavonoids, including seven flavones, four flavonols and one flavanone, were isolated from methanolic extract of the herbal drug 'Crataegi folium cum flore' (hawthorn leaves and flowers) by a combination of CC (over Amberlite XAD-7 and Sephadex LH-20) and preparative HPLC. Their structures, including that of the novel flavonol 8-methoxykaempferol 3-O-(6"-malonyl-beta-glucopyranoside), were elucidated by homo- and heteronuclear NMR and electrospray/MS. The 1H- and 13C-NMR of all compounds, including rotameric pairs of five flavone C-glycosides, were assigned. The presence and relative proportion of each rotamer was shown by various NMR experiments, including two-dimensional nuclear Overhauser and exchange spectroscopy, to depend on solvent, linkage position and structure of the C-glycosyl substituent.

Hernandulcin in hairy root cultures of Lippia dulcis.

PubMed

Sauerwein, M; Yamazaki, T; Shimomura, K

1991-02-01

The hairy root culture of Lippia dulcis Trev., Verbenaceae, was established by transformation with Agrobacterium rhizogenes A4. The transformed roots grew well in Murashige and Skoog medium containing 2% sucrose. The roots turned light green when they were cultured under 16 h/day light. The green hairy roots produced the sweet sesquiterpene hernandulcin (ca. 0.25 mg/g dry wt) together with 20 other mono- and sesquiterpenes, while no terpenes were detected in the nontransformed root cultures. The growth and hernandulcin production in the hairy root cultures were influenced by the addition of auxins to the medium. The addition of a low concentration of chitosan (0.2 - 10.0 mg / l) enhanced the production of hernandulcin 5-fold.

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less

In vivo immunoprotective role of Indigofera tinctoria and Scoparia dulcis aqueous extracts against chronic noise stress induced immune abnormalities in Wistar albino rats.

PubMed

Madakkannu, Boothapandi; Ravichandran, Ramanibai

2017-01-01

Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w) showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days) induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant's aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices.

Stable plastid transformation in Scoparia dulcis L.

PubMed

Muralikrishna, Narra; Srinivas, Kota; Kumar, Kalva Bharath; Sadanandam, Abbagani

2016-10-01

In the present investigation we report stable plastid transformation in Scoparia dulcis L., a versatile medicinal herb via particle gun method. The vector KNTc, harbouring aadA as a selectable marker and egfp as a reporter gene which were under the control of synthetic promoter pNG1014a, targets inverted repeats, trnR / t rnN of the plastid genome. By use of this heterologous vector, recovery of transplastomic lines with suitable selection protocol have been successfully established with overall efficiency of two transgenic lines for 25 bombarded leaf explants. PCR and Southern blot analysis demonstrated stable integration of foreign gene into the target sequences. The results represent a significant advancement of the plastid transformation technology in medicinal plants, which relevantly implements a change over in enhancing and regulating of certain metabolic pathways.

The effect of aqueous extract of Kalanchoe Folium on methylprednisolone pharmacokinetic profile

NASA Astrophysics Data System (ADS)

Indriyanti, Niken; Garmana, Afrillia Nuryanti; Setiawan, Finna; Sukandar, Elin Yulinah; Adnyana, I. Ketut

2016-03-01

Aqueous extract of Kalanchoe pinnata leaves had immunosupressant effect on lupus nephritis model. When it combined with methylprednisolone, there is a risk of interaction. In this study rats divided into two groups, a group that received methylprednisolone (MP) (0.72 mg/kgBW) and a group that received MP in combination with extract (0.36 mg/kg BW MP and 140 mg/kg BW extract). These treatment were given everyday for 4 weeks. Methylprednisolone concentration in rats serum was measured using HPLC with extraction method according to Lawson method (1985). The column used was Inertsil C-18 using mobile phase KH2PO4 : metanol (15:85) buffer, flow rate 0.6 mL/minutes, UV detector (λ = 230 nm) and pressure 1319 psi. The result showed that there was an interaction occurred. The combination of MP and aqueous extract of K. pinnata leaves showed interaction which causing methylprednisolone level comparable with methylprednisolone level in MP group. Mean of decreasing MP level in serum was 0.285 ppm. It means that aqueous extract of Kalanchoe Folium could elevate methylprednisolone concentration in plasma. Adjustment of the dose must be considered in this combination.

Sensitive quantification of coixol, a potent insulin secretagogue, in Scoparia dulcis extract using high-performance liquid chromatography combined with tandem mass spectrometry and UV detection.

PubMed

Ali, Arslan; Haq, Faraz Ul; Ul Arfeen, Qamar; Sharma, Khaga Raj; Adhikari, Achyut; Musharraf, Syed Ghulam

2017-10-01

Diabetes is a major global health problem which requires new studies for its prevention and control. Scoparia dulcis, a herbal product, is widely used for treatment of diabetes. Recent studies demonstrate coixol as a potent and nontoxic insulin secretagog from S. dulcis. This study focuses on developing two quantitative methods of coixol in S. dulcis methanol-based extracts. Quantification of coixol was performed using high-performance liquid chromatography-tandem mass spectrometry (method 1) and high-performance liquid chromatography-ultraviolet detection (method 2) with limits of detection of 0.26 and 11.6 pg/μL, respectively, and limits of quantification of 0.78 and 35.5 pg/μL, respectively. S. dulcis is rich in coixol content with values of 255.5 ± 2.1 mg/kg (method 1) and 220.4 ± 2.9 mg/kg (method 2). Excellent linearity with determination coefficients >0.999 was achieved for calibration curves from 10 to 7500 ng/mL (method 1) and from 175 to 7500 ng/mL (method 2). Good accuracy (bias < -8.6%) and precision (RSD < 8.5%) were obtained for both methods. Thus, they can be employed to analyze coixol in plant extracts and herbal formulations. Copyright © 2017 John Wiley & Sons, Ltd.

HPTLC analysis of Scoparia dulcis Linn (Scrophulariaceae) and its larvicidal potential against dengue vector Aedes aegypti.

PubMed

Wankhar, Wankupar; Srinivasan, Sakthivel; Rathinasamy, Sheeladevi

2015-01-01

This study evaluates the larvicidal activity of Scoparia dulcis aqueous extract against dengue vector and determines its major chemical components. The extract was tested at various concentrations ranging from 0.1 to 2 mg/mL against Aedes aegypti larvae. The extracts displayed significant larvicidal efficacy against Ae. aegypt species after 24 h exposure revealing LC50 of 3.3835 (mg/mL) and LC90 of 5.7578 (mg/mL). Finger printing profile carried out by CAMAG automatic TLC sample applicator programmed through WIN CATS software revealed peaks with different Rf values for three different volumes injected: 16, 15 and 18 peaks were spotted for 3, 6 and 9 μL, respectively. Ascending order of Rf values was also ascertained for each peak recorded. This study clearly signifies that S. dulcis extract contains numerous compounds that are known to have larvicidal properties which clearly substantiates its efficacy on Ae. aegypti larvae.

DNA Barcode for Identifying Folium Artemisiae Argyi from Counterfeits.

PubMed

Mei, Quanxi; Chen, Xiaolu; Xiang, Li; Liu, Yue; Su, Yanyan; Gao, Yuqiao; Dai, Weibo; Dong, Pengpeng; Chen, Shilin

2016-01-01

Folium Artemisiae Argyi is an important herb in traditional Chinese medicine. It is commonly used in moxibustion, medicine, etc. However, identifying Artemisia argyi is difficult because this herb exhibits similar morphological characteristics to closely related species and counterfeits. To verify the applicability of DNA barcoding, ITS2 and psbA-trnH were used to identify A. argyi from 15 closely related species and counterfeits. Results indicated that total DNA was easily extracted from all the samples and that both ITS2 and psbA-trnH fragments can be easily amplified. ITS2 was a more ideal barcode than psbA-trnH and ITS2+psbA-trnH to identify A. argyi from closely related species and counterfeits on the basis of sequence character, genetic distance, and tree methods. The sequence length was 225 bp for the 56 ITS2 sequences of A. argyi, and no variable site was detected. For the ITS2 sequences, A. capillaris, A. anomala, A. annua, A. igniaria, A. maximowicziana, A. princeps, Dendranthema vestitum, and D. indicum had single nucleotide polymorphisms (SNPs). The intraspecific Kimura 2-Parameter distance was zero, which is lower than the minimum interspecific distance (0.005). A. argyi, the closely related species, and counterfeits, except for Artemisia maximowicziana and Artemisia sieversiana, were separated into pairs of divergent clusters by using the neighbor joining, maximum parsimony, and maximum likelihood tree methods. Thus, the ITS2 sequence was an ideal barcode to identify A. argyi from closely related species and counterfeits to ensure the safe use of this plant.

Molecular cloning and characterization of (+)-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural sweetener, hernandulcin, in Lippia dulcis.

PubMed

Attia, Mohamed; Kim, Soo-Un; Ro, Dae-Kyun

2012-11-01

Hernandulcin, a C15 sesquiterpene ketone, is a natural sweetener isolated from the leaves of Lippia dulcis. It is a promising sugar substitute due to its safety and low caloric potential. However, the biosynthesis of hernandulcin in L. dulcis remains unknown. The first biochemical step of hernandulcin is the synthesis of (+)-epi-α-bisabolol from farnesyl diphosphate, which is presumed to be catalyzed by a unique sesquiterpene synthase in L. dulcis. In order to decipher hernandulcin biosynthesis, deep transcript sequencings (454 and Illumina) were performed, which facilitated the molecular cloning of five new sesquiterpene synthase cDNAs from L. dulcis. In vivo activity evaluation of these cDNAs in yeast identified them as the sesquiterpene synthases for α-copaene/δ-cadinene, bicyclogermacrene, β-caryophyllene, trans-α-bergamotene, and α-bisabolol. The engineered yeast could synthesize a significant amount (~0.3 mg per mL) of α-bisabolol in shake-flask cultivation. This efficient in vivo production was congruent with the competent kinetic properties of recombinant α-bisabolol synthase (K(m) 4.8 μM and k(cat) 0.04 s(-1)). Detailed chemical analyses of the biosynthesized α-bisabolol confirmed its configuration to be (+)-epi-α-bisabolol, the core skeleton of hernandulcin. These results demonstrated that enzymatic, stereoselective synthesis of (+)-epi-α-bisabolol can be achieved, promising the heterologous production of a natural sweetener, hernandulcin. Copyright © 2012 Elsevier Inc. All rights reserved.

Characterization of ent-kaurene synthase and kaurene oxidase involved in gibberellin biosynthesis from Scoparia dulcis.

PubMed

Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum

2018-03-01

Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.

Enantioselective Synthesis of Various Cyanohydrins Using Covalently Immobilized Preparations of Hydroxynitrile Lyase from Prunus dulcis.

PubMed

Alagöz, Dilek; Tükel, S Seyhan; Yildirim, Deniz

2015-11-01

The carrier-based and carrier-free (cross-linked enzyme aggregate) covalent immobilizations of Prunus dulcis hydroxynitrile lyase were investigated. The immobilized preparations were tested for enantioselective carbon-carbon bond formation activity in the biphasic medium. Of the tested preparations, only cross-linked enzyme aggregate of P. dulcis hydroxynitrile lyase (PdHNL-CLEA) achieved the synthesis of (R)-mandelonitrile with 93% yield and 99% enantiopurity. PdHNL-CLEA was also used in the synthesis of various (R)-cyanohydrins from corresponding aldehydes/ketones and hydrocyanic acid. When 4-methoxybenzaldehyde, 4-methyl benzaldehyde, and 4-hydroxybenzaldehyde were used as substrates, the yield-enantiomeric excess of corresponding (R)-cyanohydrins were obtained as 95-95, 85-79, and 2-25%, respectively, after 96 h at pH 4.0 and 5 °C. For acetophenone, 4-fluoroacetophenone, 4-chloroacetophenone, 4-bromoacetophenone, and 4-iodoacetophenone, the yield-enantiomeric excess of corresponding (R)-cyanohydrins were 1-99, 20-84, 11-95, 5-99, and 3-24%, respectively at the same conditions. The results demonstrate PdHNL-CLEA can be effectively used in the synthesis of (R)-mandelonitrile.

Analgesic activity of a triterpene isolated from Scoparia dulcis L. (Vassourinha).

PubMed

Freire, S M; Torres, L M; Roque, N F; Souccar, C; Lapa, A J

1991-01-01

Analgesic and anti-inflammatory activities of water (WE) and ethanolic (EE) extracts of Scoparia dulcis L. were investigated in rats and mice, and compared to the effects induced by Glutinol, a triterpene isolated by purification of EE. Oral administration (p.o.) of either WE or EE (up to 2 g/kg) did not alter the normal spontaneous activity of mice and rats. The sleeping time induced by sodium pentobarbital (50 mg/kg, i.p.) was prolonged by 2 fold in mice pretreated with 0.5 g/kg EE, p.o. Neither extract altered the tail flick response of mice in immersion test, but previous administration of EE (0.5 g/kg, p.o.) reduced writhings induced by 0.8% acetic acid (0.1 ml/10 g, i.p.) in mice by 47%. EE (0.5 and 1 g/kg, p.o.) inhibited the paw edema induced by carrageenan in rats by respectively 46% and 58% after 2 h, being ineffective on the paw edema induced by dextran. No significant analgesic or anti-edema effects were detected in animals pretreated with WE (1 g/kg, p.o.). Administration of Glutinol (30 mg/kg, p.o.) reduced writhing induced by acetic acid in mice by 40% and the carrageenan induced paw edema in rats by 73%. The results indicate that the analgesic activity of S. dulcis L. may be explained by an anti-inflammatory activity probably related to the triterpene Glutinol.

Antioxidant and anti-inflammatory effects of Scoparia dulcis L.

PubMed

Coulibaly, Ahmed Y; Kiendrebeogo, Martin; Kehoe, Patrick G; Sombie, Pierre A E D; Lamien, Charles E; Millogo, Jeanne F; Nacoulma, Odile G

2011-12-01

Different extracts were obtained from Scoparia dulcis L. (Scrophulariaceae) by successive extraction with hexane, chloroform, and methanol. These extracts exhibited significant antioxidant capacity in various antioxidant models mediated (xantine oxidase and lipoxygenase) or not mediated (2,2-diphenyl-picrylhydrazyl, ferric-reducing antioxidant power, β-carotene bleaching, lipid peroxidation) by enzymes. The antioxidant activity of the extracts was related to their phytochemical composition in terms of polyphenol and carotenoid contents. The chloroform extract was richest in phytochemicals and had the highest antioxidant activity in the different antioxidant systems. All the extracts exhibited less than 50% inhibition on xanthine oxidase but more than 50% inhibition on lipid peroxidation and lipoxygenase. The extracts strongly inhibited lipid peroxidation mediated by lipoxygenase.

Intercultural Usage of Mori Folium: Comparison Review from a Korean Medical Perspective

PubMed Central

Joh, Byungjin; Jeon, Eun Sang; Lim, Su Hye; Park, Yu Lee; Park, Wansu

2015-01-01

Objectives. A review on studies related to the use of Mori folium, the leaves of Morus alba, was conducted with the goal of identifying new clinical applications in Korean medicine. Methods. Global literature search was conducted using three electronic databases up to January 2015 with the term Morus alba and its Korean terms. KM literatures including textbooks and standard pharmacopoeia were separately hand-searched and reviewed to provide comparison. Data were extracted according to predetermined criteria, and clinical uses were standardized with ICD-10 categories. Results. 159 potentially relevant studies were identified, and 18 articles including 12 ethnopharmacologic and 6 clinical studies were finally included in this analysis. Ethnopharmacologic studies from 8 countries provided 17 clinical uses. We found that five out of six clinical trials were related to diabetes and suggested a moderate short-term to mild long-term effect. And 43 Korean texts also provided 156 clinical uses in 35 categories including ocular and respiratory disorders. Discussion and Conclusions. Though majority of the clinical uses were also found in Korean medicine literature, treatment of infertility, jaundice, cognitive disorder, and hyperpigmentation was found to be effective and diabetes with Morus alba was recognized to have clinical importance. PMID:26539223

Antioxidant mediated response of Scoparia dulcis in noise-induced redox imbalance and immunohistochemical changes in rat brain.

PubMed

Wankhar, Wankupar; Srinivasan, Sakthivel; Rajan, Ravindran; Sheeladevi, Rathinasamy

2017-01-19

Noise has been regarded as an environmental/occupational stressor that causes damages to both auditory and non-auditory organs. Prolonged exposure to these mediators of stress has often resulted in detrimental effect, where oxidative/nitrosative stress plays a major role. Hence, it would be appropriate to examine the possible role of free radicals in brain discrete regions and the "antioxidants" mediated response of S. dulcis. Animals were subjected to noise stress for 15 days (100 dB/4 hours/day) and estimation of endogenous free radical and antioxidant activity were carried out on brain discrete regions (the cerebral cortex, cerebellum, brainstem, striatum, hippocampus and hypothalamus). The result showed that exposure to noise could alleviate endogenous free radical generation and altered antioxidant status in brain discrete regions when compared to that of the control groups. This alleviated free radical generation (H 2 O 2 and NO) is well supported by an upregulated protein expression on immunohistochemistry of both iNOS and nNOS in the cerebral cortex on exposure to noise stress. These findings suggest that increased free radical generation and altered anti-oxidative status can cause redox imbalance in the brain discrete regions. However, free radical scavenging activity of the plant was evident as the noise exposed group treated with S. dulcis[200 mg/(kg·b·w)] displayed a therapeutic effect by decreasing the free radical level and regulate the anti-oxidative status to that of control animals. Hence, it can be concluded that the efficacy of S. dulcis could be attributed to its free radical scavenging activity and anti-oxidative property.

Antioxidant mediated response of Scoparia dulcis in noise-induced redox imbalance and immunohistochemical changes in rat brain

PubMed Central

Wankhar, Wankupar; Srinivasan, Sakthivel; Rajan, Ravindran; Sheeladevi, Rathinasamy

2017-01-01

Noise has been regarded as an environmental/occupational stressor that causes damages to both auditory and non-auditory organs. Prolonged exposure to these mediators of stress has often resulted in detrimental effect, where oxidative/nitrosative stress plays a major role. Hence, it would be appropriate to examine the possible role of free radicals in brain discrete regions and the "antioxidants" mediated response of S. dulcis. Animals were subjected to noise stress for 15 days (100 dB/4 hours/day) and estimation of endogenous free radical and antioxidant activity were carried out on brain discrete regions (the cerebral cortex, cerebellum, brainstem, striatum, hippocampus and hypothalamus). The result showed that exposure to noise could alleviate endogenous free radical generation and altered antioxidant status in brain discrete regions when compared to that of the control groups. This alleviated free radical generation (H2O2 and NO) is well supported by an upregulated protein expression on immunohistochemistry of both iNOS and nNOS in the cerebral cortex on exposure to noise stress. These findings suggest that increased free radical generation and altered anti-oxidative status can cause redox imbalance in the brain discrete regions. However, free radical scavenging activity of the plant was evident as the noise exposed group treated with S. dulcis[200 mg/(kg·b·w)] displayed a therapeutic effect by decreasing the free radical level and regulate the anti-oxidative status to that of control animals. Hence, it can be concluded that the efficacy of S. dulcis could be attributed to its free radical scavenging activity and anti-oxidative property. PMID:28808196

Scoparic acid A, a beta-glucuronidase inhibitor from Scoparia dulcis.

PubMed

Hayashi, T; Kawasaki, M; Okamura, K; Tamada, Y; Morita, N; Tezuka, Y; Kikuchi, T; Miwa, Y; Taga, T

1992-12-01

The 70% EtOH extract of Scoparia dulcis showed inhibitory activity against beta-glucuronidase from bovine liver. Bioassay-directed fractionation of the active extract led to the isolation of three labdane-type diterpene acids, scoparic acid A [1] [6-benzoyl-12-hydroxy-labda-8(17), 13-dien-18-oic acid], scoparic acid B [2] [6-benzoyl-14,15-dinor-13-oxo-8(17)-labden-18-oic acid], and scoparic acid C [3] [6-benzoyl-15-nor-14-oxo-8(17)-labden-18-oic acid], the structures of which were established by spectral means, including X-ray analysis. Scoparic acid A was found to be a potent beta-glucuronidase inhibitor.

High electrochemical performances of hierarchical hydrangea macrophylla like NiCo{sub 2}O{sub 4} and NiCo{sub 2}S{sub 4} as anode materials for Li-ion batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Rencheng, E-mail: jinrc427@126.com; Liu, Gang; Liu, Chunping

2016-08-15

Graphical abstract: Mesoporous hydrangea macrophylla like NiCo{sub 2}O{sub 4} and NiCo{sub 2}S{sub 4} have been fabricated, which present excellent electrochemical performances as anode materials for Li-ion batteries. - Highlights: • Hierarchical NiCo{sub 2}O{sub 4} is successfully fabricated. • Hierarchical NiCo{sub 2}S{sub 4} is prepared via sulfide anion exchange. • The hierarchical NiCo{sub 2}O{sub 4} and NiCo{sub 2}S{sub 4} exhibit good electrochemical properties. - Abstract: In this work, hierarchical hydrangea macrophylla like NiCo{sub 2}O{sub 4} has been synthesized by solvothermal method followed by calcination treatment in air. By using Na{sub 2}S as sulfur source, the NiCo{sub 2}O{sub 4} is converted intomore » NiCo{sub 2}S{sub 4}. Such hierarchical NiCo{sub 2}O{sub 4} exhibits a high specific capacity and excellent cycling stability (928 mAh g{sup −1} at a current density of 100 mA g{sup −1} after 100 cycles). Even at high current density of 2000 mA g{sup −1}, the electrode still delivers a specific capacity of 371 mAh g{sup −1} after 50 cycles. When the NiCo{sub 2}S{sub 4} is used as anode materials for lithium-ion batteries, a high discharge capacity of 1204 mAh g{sup −1} can be achieved. Meanwhile, the NiCo{sub 2}S{sub 4} electrode displays good cycling stability and rate capability. The excellent electrochemical performances can be attributed to the unique porous structure, which can effectively reduce the diffusion length for lithium ions and electrons, and alleviate volume expansion during the charge-discharge processes.« less

Lippia dulcis shoot cultures as a source of the sweet sesquiterpene hernandulcin.

PubMed

Sauerwein, M; Flores, H E; Yamazaki, T; Shimomura, K

1991-04-01

The axenic shoot culture of Lippia dulcis Trev., Verbenaceae, was established on hormone-free Murashige-Skoog solid medium containing 3% sucrose. Shoots were cultured in various liquid or solid media. Woody Plant liquid medium was best for shoot multiplication, but the production of hernandulcin was relatively low. The highest hernandulcin content (2.9% dry wt) was obtained after 28 days of culture on Murashige-Skoog solid medium containing 2% sucrose. The addition of chitosan to the culture media enhanced the growth of shoots as well as the production of hernandulcin, especially with the liquid medium.

Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats.

PubMed

Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

The antibacterial activity of syringopicroside, its metabolites and natural analogues from Syringae Folium.

PubMed

Zhou, Zhengyuan; Han, Na; Liu, Zhihui; Song, Zehai; Wu, Peng; Shao, Jingxuan; Zhang, Jia Ming; Yin, Jun

2016-04-01

In the present study, the in vitro antibacterial activity of an effective fraction (ESF) from Syringae Folium (SF) on Methicillin-resistant Staphylococcus aureus (MRSA) was evaluated and then its in vivo activity was evaluated by using the MRSA-infected mouse peritonitis model. The ESF showed a significant in vitro and in vivo activity on decreasing the Minimum Inhibitory Concentrations (MICs) and increasing the survival rate of mouse from 42.8% to 100%. Six iridoid glucosides (IGs) of ESF were characterized by UPLC-TOF-MS method and also isolated by column chromatography. Most of them showed in vitro anti MRSA activity. Syringopicroside (Sy), the major compound of IGs, was found to increase the survival rate from 42.8% to 92.8% of the MRSA-infected mouse, which revealed Sy is also the main active components of ESF. In order to know why the effect of oral administration of SF is better than its injections in clinic and the metabolites of Sy, seven metabolites of Sy were isolated from rat urine and identified on the basis of NMR and MS spectra. Most of metabolites possessed stronger in vitro anti-MRSA activity than that of Sy, which furtherly proved the clinical result. Copyright © 2016 Elsevier B.V. All rights reserved.

Biolistic transformation of Scoparia dulcis L.

PubMed

Srinivas, Kota; Muralikrishna, Narra; Kumar, Kalva Bharath; Raghu, Ellendula; Mahender, Aileni; Kiranmayee, Kasula; Yashodahara, Velivela; Sadanandam, Abbagani

2016-01-01

Here, we report for the first time, the optimized conditions for microprojectile bombardment-mediated genetic transformation in Vassourinha (Scoparia dulcis L.), a Plantaginaceae medicinal plant species. Transformation was achieved by bombardment of axenic leaf segments with Binary vector pBI121 harbouring β-glucuronidase gene (GUS) as a reporter and neomycin phosphotransferase II gene (npt II) as a selectable marker. The influence of physical parameters viz., acceleration pressure, flight distance, gap width & macroprojectile travel distance of particle gun on frequency of transient GUS and stable (survival of putative transformants) expressions have been investigated. Biolistic delivery of the pBI121 yielded the best (80.0 %) transient expression of GUS gene bombarded at a flight distance of 6 cm and rupture disc pressure/acceleration pressure of 650 psi. Highest stable expression of 52.0 % was noticed in putative transformants on RMBI-K medium. Integration of GUS and npt II genes in the nuclear genome was confirmed through primer specific PCR. DNA blot analysis showed more than one transgene copy in the transformed plantlet genomes. The present study may be used for metabolic engineering and production of biopharmaceuticals by transplastomic technology in this valuable medicinal plant.

Benzoxazinoids from Scoparia dulcis (sweet broomweed) with antiproliferative activity against the DU-145 human prostate cancer cell line.

PubMed

Wu, Wan-Hsun; Chen, Tzu-Yu; Lu, Rui-Wen; Chen, Shui-Tein; Chang, Chia-Chuan

2012-11-01

Sweet broomweed (Scoparia dulcis) is an edible perennial medicinal herb widely distributed in tropical and subtropical regions of Asia, Africa, and the Americas. Four compounds, (2R)-7-methoxy-2H-1,4-benzoxazin-3(4H)-one 2-O-β-galactopyranoside [(2R)-HMBOA-2-O-Gal], 3,6-dimethoxy-benzoxazolin-2(3H)-one (3,6-M2BOA), 3-hydroxy-6-methoxy-2-benzoxazolinone (3-OH-MBOA), and scutellarein 7-O-β-glucuronamide, along with eight known compounds, including two 7-methoxy-1,4-benzoxazin-3(2H)-one 3-O-hexopyranosides [(2R)-HMBOA-2-O-Glc and (2R)-HDMBOA-2-O-Glc], 6-methoxy-benzoxazolin-2(3H)-one (MBOA), acteoside, sodium scutellarin, p-coumaric acid, and two monosaccharides (fructose and glucose), were isolated from the aqueous extract of S. dulcis. Antiproliferative activities of the six benzoxazinoid compounds against the DU-145 human prostate cancer cell line were assayed, and one of these displayed an IC₅₀ of 65.8 μg/mL. Copyright © 2012 Elsevier Ltd. All rights reserved.

Modification and translocation of Rac/Rop guanosine 5'-triphosphate-binding proteins of Scoparia dulcis in response to stimulation with methyl jasmonate.

PubMed

Mitamura, Toshiaki; Yamamura, Yoshimi; Kurosaki, Fumiya

2011-01-01

Translocation of two Rac/Rop guanosine 5'-triphosphate-binding proteins from Scoparia dulcis, Sdrac-1 and Sdrac-2, was examined employing transformed belladonna which overproduces these proteins as glutathione-S-transferase-tagged forms. The transferase activities of the fused proteins in microsomal fraction of belladonna markedly increased by the incubation with methyl jasmonate either in Sdrac-1 or Sdrac-2 transformant, while low and constant activities were observed in the untreated control. Recombinant Sdrac-2 protein was found to bind to prenyl chain in the presence of cell extracts prepared from methyl jasmonate-treated S. dulcis, however, Sdrac-1 was palmitoylated by the addition of the cell extracts. These results suggest that both Sdrac-1 and Sdrac-2 translocate to plant membranes by the stimulation with methyl jasmonate, however, targeting of these proteins is triggered by the independent modification mechanisms, palmitoylation for Sdrac-1 and prenylation for Sdrac-2.

New Bisabolane-Type Sesquiterpenes from the Aerial Parts of Lippia dulcis.

PubMed

Ono, Masateru; Morinaga, Hiroaki; Masuoka, Chikako; Ikeda, Tsuyoshi; Okawa, Masafumi; Kinjo, Junei; Nohara, Toshihiro

2005-09-01

Two new bisabolane-type sesquiterpenes, lippidulcine A (3) and epilippidulcine A (4), have been isolated from the aerial parts of Lippia dulcis TREV. along with five known flavonoids, cirsimaritin (5), salvigenin (6), eupatorin (7), 5-hydroxy-6,7,3',4'-tetramethoxyflavone (8) and 5,3'-dihydroxy-6,7,4',5'-tetramethoxyflavone (9), three known phenylethanoid glycosides, decaffeoylverbascoside (10), acteoside (11) and isoacteoside (12), and two known iridoid glucosides, 8-epiloganin (13) and lamiide (14). Their chemical structures have been determined on the basis of spectroscopic data. Among them, 5, 7, and 9 exhibited almost the same activity as that of alpha-tocopherol, and 10-12 were identified as stronger antioxidants than alpha-tocopherol using the ferric thiocyanate method.

Systems Pharmacology Dissection of the Anti-Inflammatory Mechanism for the Medicinal Herb Folium Eriobotryae

PubMed Central

Zhang, Jingxiao; Li, Yan; Chen, Su-Shing; Zhang, Lilei; Wang, Jinghui; Yang, Yinfeng; Zhang, Shuwei; Pan, Yanqiu; Wang, Yonghua; Yang, Ling

2015-01-01

Inflammation is a hallmark of many diseases like diabetes, cancers, atherosclerosis and arthritis. Thus, lots of concerns have been raised toward developing novel anti-inflammatory agents. Many alternative herbal medicines possess excellent anti-inflammatory properties, yet their precise mechanisms of action are yet to be elucidated. Here, a novel systems pharmacology approach based on a large number of chemical, biological and pharmacological data was developed and exemplified by a probe herb Folium Eriobotryae, a widely used clinical anti-inflammatory botanic drug. The results show that 11 ingredients of this herb with favorable pharmacokinetic properties are predicted as active compounds for anti-inflammatory treatment. In addition, via systematic network analyses, their targets are identified to be 43 inflammation-associated proteins including especially COX2, ALOX5, PPARG, TNF and RELA that are mainly involved in the mitogen-activated protein kinase (MAPK) signaling pathway, the rheumatoid arthritis pathway and NF-κB signaling pathway. All these demonstrate that the integrated systems pharmacology method provides not only an effective tool to illustrate the anti-inflammatory mechanisms of herbs, but also a new systems-based approach for drug discovery from, but not limited to, herbs, especially when combined with further experimental validations. PMID:25636035

Scoparia dulcis, a traditional antidiabetic plant, protects against streptozotocin induced oxidative stress and apoptosis in vitro and in vivo.

PubMed

Latha, Muniappan; Pari, Leelavinothan; Sitasawad, Sandhya; Bhonde, Ramesh

2004-01-01

Oxidative stress is implicated in the pathogenesis of diabetic complications. The experiments were performed on normal and experimental male Wistar rats treated with Scoparia dulcis plant extract (SPEt). The effect of SPEt was tested on streptozotocin (STZ) treated Rat insulinoma cell lines (RINm5F cells) and isolated islets in vitro. Administration of an aqueous extract of Scoparia dulcis by intragastric intubation (po) at a dose of 200 mg/kg body weight significantly decreased the blood glucose and lipid peroxidative marker thiobarbituric acid reactive substances (TBARS) with significant increase in the activities of plasma insulin, pancreatic superoxide dismutase (SOD), catalase (CAT), and reduced glutathione (GSH) in streptozotocin diabetic rats at the end of 15 days treatment. Streptozotocin at a dose of 10 mug/mL evoked 6-fold stimulation of insulin secretion from isolated islets indicating its insulin secretagogue activity. The extract markedly reduced the STZ-induced lipidperoxidation in RINm5F cells. Further, SPEt protected STZ-mediated cytotoxicity and nitric oxide (NO) production in RINm5F cells. Treatment of RINm5F cells with 5 mM STZ and 10 mug of SPEt completely abrogated apoptosis induced by STZ, suggesting the involvement of oxidative stress. Flow cytometric assessment on the level of intracellular peroxides using fluorescent probe 2'7'-dichlorofluorescein diacetate (DCF-DA) confirmed that STZ (46%) induced an intracellular oxidative stress in RINm5F cells, which was suppressed by SPEt (21%). In addition, SPEt also reduced (33%) the STZ-induced apoptosis (72%) in RINm5F cells indicating the mode of protection of SPEt on RIN m5Fcells, islets, and pancreatic beta-cell mass (histopathological observations). Present study thus confirms antihyperglycemic effect of SPEt and also demonstrated the consistently strong antioxidant properties of Scoparia dulcis used in the traditional medicine. (c) 2004 Wiley Periodicals, Inc.

Investigation on traditional medicines of Guarany Indio and studies on diterpenes from Scoparia dulcis.

PubMed

Hayashi, Toshimitsu

2011-01-01

In interviews on the traditional herbal medicines of Tupi-Guarany Indians at the herbal market of Asuncion and questionnaire from their users, it was clarified that various useful medicinal plants are available in Paraguay and most of them are generally used without drying. In the search for bioactive substances from those plants, a β-glucuronidase-inhibitory diterpene called scoparic acid A (SA) was isolated from Scoparia dulcis L. together with scoparic acid B, scoparic acid C, and the aphidicolin-like tetracyclic diterpenes scopadulcic acid A (SDA) and scopadulcic acid B (SDB). HPLC analysis of diterpenes in the individual plants of Paraguayan and Asian S. dulcis revealed the presence of three chemotypes based on major component, i.e., SA type, SDB type, and SDX type containing mainly scopadiol and scopadulciol (SDC). SA and SDB were elucidated to be mainly biosynthesized in the leaves via 2-C-methyl-D-erythritol- 4-phosphate pathway, and a leaf organ culture system containing methyl jasmonate 10 µM was found to enhance the production of diterpenes by activation of Ca-signal transduction systems such as calmodulin and protein kinase C. On the other hand, SDB and SDC were found to show multifaceted pharmacological effects such as inhibitory effects on gastric acid excretion, bone resorption, replication of herpes simplex virus type 1 (HSV-1), etc. In addition, SDC was suggested to be applicable to cancer gene therapy using ganciclovir or acyclovir and the HSV-1 thymidine kinase gene called the suicide gene.

Antitumor-promoting activity of scopadulcic acid B, isolated from the medicinal plant Scoparia dulcis L.

PubMed

Nishino, H; Hayashi, T; Arisawa, M; Satomi, Y; Iwashima, A

1993-01-01

Scopadulcic acid B (SDB), a tetracyclic diterpenoid isolated from a medicinal plant, Scoparia dulcis L., inhibited the effects of tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in vitro and in vivo; SDB inhibited TPA-enhanced phospholipid synthesis in cultured cells, and also suppressed the promoting effect of TPA on skin tumor formation in mice initiated with 7,12-dimethylbenz[a]anthracene. The potency of SDB proved to be stronger than that of other natural antitumor-promoting terpenoids, such as glycyrrhetinic acid.

Production comparisons of Chinese water chestnut [Eleocharis dulcis (Burm. f.) Trin. ex Hensch] functional corms grown in hydroponics versus flooded sand

USDA-ARS?s Scientific Manuscript database

Chinese water chestnut [Eleocharis dulcis (Burm. f.) Trin. ex Hensch.] corms are used as a canned or raw vegetable worldwide and may have potential use as a functional vegetable for human health uses. The accessions in the USDA, ARS, Plant Genetic Resources Conservation Unit do not produce very many...

Transgenic fertile Scoparia dulcis L., a folk medicinal plant, conferred with a herbicide-resistant trait using an Ri binary vector.

PubMed

Yamazaki, M; Son, L; Hayashi, T; Morita, N; Asamizu, T; Mourakoshi, I; Saito, K

1996-01-01

Transgenic herbicide-resistant Scoparia dulcis plants were obtained by using an Ri binary vector system. The chimeric bar gene encoding phosphinothricin acetyltransferase flanked by the promoter for cauliflower mosaic virus 35S RNA and the terminal sequence for nopaline synthase was introduced in the plant genome by Agrobacterium-mediated transformation by means of scratching young plants. Hairy roots resistant to bialaphos were selected and plantlets (R0) were regenerated. Progenies (S1) were obtained by self-fertilization. The transgenic state was confirmed by DNA-blot hybridization and assaying of neomycin phosphotransferase II. Expression of the bar gene in the transgenic R0 and S1 progenies was indicated by the activity of phosphinothricin acetyltransferase. Transgenic plants accumulated scopadulcic acid B, a specific secondary metabolite of S. dulcis, in amounts of 15-60% compared with that in normal plants. The transgenic plants and progenies showed resistant trait towards bialaphos and phosphinothricin. These results suggest that an Ri binary system is one of the useful tools for the transformation of medicinal plants for which a regeneration protocol has not been established.

[Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae), Piper tuberculatum (Piperaceae), Scoparia dulcis (Arecaceae) and Solanum subinerme (Solanaceae) from Sucre, Venezuela].

PubMed

Ordaz, Gabriel; D'Armas, Haydelba; Yáñez, Dayanis; Moreno, Shailili

2011-06-01

Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary metabolites in some plant species in order to contribute to their chemotaxonomy. Leaves from Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis and Solanum subinerme were collected and their essential oils were obtained by means of hydro-distillation. The oil fraction was analyzed and identified by GC/MS. The extraction yields were of 0.004, 0.032, 0.016 and 0.005%, and the oil constituents of 88.00, 89.80, 87.50 and 89.47%, respectively. The principal oils found were: non-terpenoids volatile secondary metabolites (30.28%) in H. guazumifolia; sesquiterpenoids (20.82 and 26.09%) and oxigen derivated (52.19 and 25.18%) in P. tuberculatum and S. dulcis; and oxigen diterpenoids (39.67%) in S. subinerme. The diisobuthylphtalate (13.11%) in H. guazumifolia, (-)-spathulenol (11.37%) in P. tuberculatum and trans-phytol (8.29 and 36.00%) in S. dulcis and S. subinerme, were the principal constituents in their respective essential oils. The diisooctylphtalate were the essential oil common to all species, but the volatile compounds such as trans-pinane, L-linalool, beta-ionone, isophytol, neophytadiene, trans-phytol, dibutylphtalate and methyl hexadecanoate, were only detected in three of these essences. This suggests that these plants may require similar secondary metabolites for their ecological interactions, possibly due to common environmental factors.

Selective enhancement of scopadulcic acid B production in the cultured tissues of Scoparia dulcis by methyl jasmonate.

PubMed

Nkembo, Kasidimoko Marguerite; Lee, Jung-Bum; Hayashi, Toshimitsu

2005-07-01

The effects of methyl jasmonate (MeJA) on isoprenoid production were evaluated in cultured tissues of Scoparia dulcis. It was found that MeJA suppressed the accumulation of chlorophylls, carotenoids, phytol and beta-sitosterol in the tissues. MeJA, however, remarkably enhanced the production of scopadulcic acid B (SDB), with 10 microM being optimal observed concentration for stimulation of SDB production. The maximum concentration of SDB was observed 6 d after MeJA treatment.

Mori Folium and Mori Fructus Mixture Attenuates High-Fat Diet-Induced Cognitive Deficits in Mice

PubMed Central

Jeong, Hyun Uk; Park, Gunhyuk; Kim, Hocheol; Lim, Yunsook; Oh, Myung Sook

2015-01-01

Obesity has become a global health problem, contributing to various diseases including diabetes, hypertension, cancer, and dementia. Increasing evidence suggests that obesity can also cause neuronal damage, long-term memory loss, and cognitive impairment. The leaves and the fruits of Morus alba L., containing active phytochemicals, have been shown to possess antiobesity and hypolipidemic properties. Thus, in the present study, we assessed their effects on cognitive functioning in mice fed a high-fat diet by performing immunohistochemistry, using antibodies against c-Fos, synaptophysin, and postsynaptic density protein 95 and a behavioral test. C57BL/6 mice fed a high-fat diet for 21 weeks exhibited increased body weight, but mice coadministered an optimized Mori Folium and Mori Fructus extract mixture (2 : 1; MFE) for the final 12 weeks exhibited significant body weight loss. Additionally, obese mice exhibited not only reduced neural activity, but also decreased presynaptic and postsynaptic activities, while MFE-treated mice exhibited recovery of these activities. Finally, cognitive deficits induced by the high-fat diet were recovered by cotreatment with MFE in the novel object recognition test. Our findings suggest that the antiobesity effects of MFE resulted in recovery of the cognitive deficits induced by the high-fat diet by regulation of neural and synaptic activities. PMID:25945108

Mori folium and mori fructus mixture attenuates high-fat diet-induced cognitive deficits in mice.

PubMed

Kim, Hyo Geun; Jeong, Hyun Uk; Park, Gunhyuk; Kim, Hocheol; Lim, Yunsook; Oh, Myung Sook

2015-01-01

Obesity has become a global health problem, contributing to various diseases including diabetes, hypertension, cancer, and dementia. Increasing evidence suggests that obesity can also cause neuronal damage, long-term memory loss, and cognitive impairment. The leaves and the fruits of Morus alba L., containing active phytochemicals, have been shown to possess antiobesity and hypolipidemic properties. Thus, in the present study, we assessed their effects on cognitive functioning in mice fed a high-fat diet by performing immunohistochemistry, using antibodies against c-Fos, synaptophysin, and postsynaptic density protein 95 and a behavioral test. C57BL/6 mice fed a high-fat diet for 21 weeks exhibited increased body weight, but mice coadministered an optimized Mori Folium and Mori Fructus extract mixture (2 : 1; MFE) for the final 12 weeks exhibited significant body weight loss. Additionally, obese mice exhibited not only reduced neural activity, but also decreased presynaptic and postsynaptic activities, while MFE-treated mice exhibited recovery of these activities. Finally, cognitive deficits induced by the high-fat diet were recovered by cotreatment with MFE in the novel object recognition test. Our findings suggest that the antiobesity effects of MFE resulted in recovery of the cognitive deficits induced by the high-fat diet by regulation of neural and synaptic activities.

Anti-hyperglycaemic effects of herbal porridge made of Scoparia dulcis leaf extract in diabetics - a randomized crossover clinical trial.

PubMed

Senadheera, Senadheera Pathirannehelage Anuruddhika Subhashinie; Ekanayake, Sagarika; Wanigatunge, Chandanie

2015-11-19

Leaf extracts of Scoparia dulcis, is used as a herbal remedy by diabetics worldwide. Fresh Scoparia dulcis porridge elicited a low glycaemic index (GI) and anti-hyperglycaemic effects when fed to diabetic Wistar rats. Commercially produced Scoparia dulcis porridge (SDC) elicited medium GI. Present study was aimed at studying the anti-diabetic effects of consumption of commercially produced S. dulcis porridge. A randomized crossover clinical trial with type 2 diabetic patients (n = 35) on medication, with mild and moderate diabetes [fasting blood glucose (FBG) 126-300 mg/dL, age 35-70 years] was conducted. Within the first three months (study period 1) group 1 was the test and group 2 was the control. Following a wash-out period, the two groups were crossed over (study period 2: group 1 - control; group 2 - test). Test group consumed commercially produced SDC for 3 days/week for three months and the control group any other food. At the onset and end of each study period glucose measurements [Fasting Blood Glucose (FBG), HbA1c], lipid measurements (total cholesterol, HDL-C, LDL-C, triglycerides, cholesterol ratios), toxicity parameters (liver enzymes, creatinine, CRP, eGFR) were analyzed by enzyme assay kit methods using a KONELAB 20XT auto analyzer. Significances between groups were analyzed by one way ANOVA (normal distribution) and Mann Whitney test (if the values were not normally distributed). Within group comparisons were carried out by Bonferroni post hoc test. During the crossover clinical trial HbA1c of group 1 decreased from 7.9 ± 0.5 to 6.5 ± 0.3 (p = 0.003) while HbA1c of group 2 decreased from 7.0 ± 0.3to 6.7 ± 0.3 while in the test group. Therefore, both test groups (1 and 2) elicited a decrease in HbA1c compared to respective control groups. Both test groups elicited a non significant decrease in FBG following the intervention (group 1 - from 174 ± 14 to 160 ± 10 mg/dL; group 2 - from 183 ± 13 to 160 ± 7 mg/dL). No significant differences (p >0

Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase.

PubMed

Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U

2000-07-01

cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.

Antimutagenic action of the triterpene betulinic acid isolated from Scoparia dulcis (Scrophulariaceae).

PubMed

de Freitas, P L; Dias, A C S; Moreira, V R; Monteiro, S G; Pereira, S R F

2015-08-19

The mutagenic and antimutagenic activities of triterpene betulinic acid {3b-3-hydroxy-lup-20(29)-en-28-oic} isolated from the roots of Scoparia dulcis (Scrophulariaceae) were analyzed using the somatic mutation and recombination test (SMART) in the wings of Drosophila melanogaster. The mutagenic potential of betulinic acid was evaluated at 3 different concentrations (1.64, 3.28, and 6.57 mM). Antimutagenic activity evaluation was performed by co-treatment trials in which the flies received betulinic acid at 3 different concentrations in addition to 10 mM pro-mutagenic urethane. The results demonstrated that betulinic acid was not capable of causing DNA damage. However, the frequency of small single spots, large spots, and twin spots was significantly reduced. In the high bioactivation cross, betulinic acid was significantly active and exerted enhanced antimutagenic activity, possibly as a desmutagen.

Scoparia dulcis (SDF7) endowed with glucose uptake properties on L6 myotubes compared insulin.

PubMed

Beh, Joo Ee; Latip, Jalifah; Abdullah, Mohd Puad; Ismail, Amin; Hamid, Muhajir

2010-05-04

Insulin stimulates glucose uptake and promotes the translocation of glucose transporter 4 (Glut 4) to the plasma membrane on L6 myotubes. The aim of this study is to investigate affect of Scoparia dulcis Linn water extracts on glucose uptake activity and the Glut 4 translocation components (i.e., IRS-1, PI 3-kinase, PKB/Akt2, PKC and TC 10) in L6 myotubes compared to insulin. Extract from TLC fraction-7 (SDF7) was used in this study. The L6 myotubes were treated by various concentrations of SDF7 (1 to 50 microg/ml) and insulin (1 to 100 nM). The glucose uptake activities of L6 myotubes were evaluated using 2-Deoxy-D-glucose uptake assay in with or without fatty acid-induced medium. The Glut 4 translocation components in SDF7-treated L6 myotubes were detected using immunoblotting and quantified by densitometry compared to insulin. Plasma membrane lawn assay and glycogen colorimetry assay were carried out in SDF7- and insulin-treated L6 myotubes in this study. Here, our data clearly shows that SDF7 possesses glucose uptake properties on L6 myotubes that are dose-dependent, time-dependent and plasma membrane Glut 4 expression-dependent. SDF7 successfully stimulates glucose uptake activity as potent as insulin at a maximum concentration of 50 microg/ml at 480 min on L6 myotubes. Furthermore, SDF7 stimulates increased Glut 4 expression and translocation to plasma membranes at equivalent times. Even in the insulin resistance stage (free fatty acids-induced), SDF7-treated L6 myotubes were found to be more capable at glucose transport than insulin treatment. Thus, we suggested that Scoparia dulcis has the potential to be categorized as a hypoglycemic medicinal plant based on its good glucose transport properties. (c) 2010 Elsevier Ireland Ltd. All rights reserved.

Role of Scoparia dulcis linn on noise-induced nitric oxide synthase (NOS) expression and neurotransmitter assessment on motor function in Wistar albino rats.

PubMed

Wankhar, Wankupar; Srinivasan, Sakthivel; Sundareswaran, Loganathan; Wankhar, Dapkupar; Rajan, Ravindran; Sheeladevi, Rathinasamy

2017-02-01

Noise pollution is one of the most widespread and fast growing environmental and occupational menaces in the modern era. Exposure to noise above 100dB is not adaptable through the brain homeostatic mechanism. Yet, the detrimental effects of noise have often been ignored. Developing reliable animal models to understand the neurobiology of noise stress and advance our research in the field of medicine to impede this growing stressor is needed. In this study experimental animals were divided into four groups, (i) Control and (ii) S. dulcis extract (200mg/kgbw) treated control group. (iii) To mimic the influence of noise, animals in this group were exposed to noise stress (100dB/4h/day) for 15days and finally, (iv) Noise exposed treated with S. dulcis extract (200mg/kgbw) group. Rota-rod and narrow beam performance results showed impaired motor co-ordination in noise exposed group on both 1st and 15th day when compared to controls. This impaired motor function on exposure to noise could be attributed to the altered norepinephrine, dopamine and serotonin levels in both the striatum and cerebellum. Moreover, the motor impaired associated changes could also be attributed to upregulated nNOS and iNOS protein expression in the cerebellum resulting in increased nitric oxide radical production. This increased reactive free radicals species can initiate lipid peroxidation mediated changes in the cerebellar Purkinje cells, which is responsible for initiating inhibitory motor response and ultimately leading to impaired motor co-ordination. Treatment with S. dulcis extract (200mg/kgbw) could control motor impairment and regulate neurotransmitter level as that of control groups when compared to noise exposed group. One key aspect of therapeutic efficacy of the plant could have resulted due to attenuated lipid peroxidation mediated damages on the cerebellar Purkinje cells thereby regulating motor impairment. Thus, targeting the antioxidant and free radicals scavenging properties of

Involvement of 2-C-methyl-D-erythritol-4-phosphate pathway in biosynthesis of aphidicolin-like tetracyclic diterpene of Scoparia dulcis.

PubMed

Nkembo, Marguerite Kasidimoko; Lee, Jung-Bum; Nakagiri, Takeshi; Hayashi, Toshimitsu

2006-05-01

Specific inhibitors of the MVA pathway (pravastatin) and the MEP pathway (fosmidomycin) were used to interfere with the biosynthetic flux which leads to the production of aphidicolin-like diterpene in leaf organ cultures of Scoparia dulcis. Treatment of leaf organs with fosmidomycin resulted in dose dependent inhibition of chlorophylls, carotenoids, scopadulcic acid B (SDB) and phytol production, and no effect on sterol production was observed. In response to the pravastatin treatment, a significant decrease in sterol and perturbation of SDB production was observed.

An assessment of traditional Uighur medicine in current Xinjiang region (China).

PubMed

Ma, Zhi Qiao; Hu, Hao; He, Tian Tian; Guo, Hong; Zhang, Mao Yu; Chen, Mei Wan; Wang, Yi Tao

2014-01-01

The main objectives of this study were to assess the current research and development of traditional Uighur medicine in Xinjiang (China), and to evaluate the promising pharmacological products of traditional Uighur medicine for further studies. Traditional Uighur medicine data of medicine registry, patent, and academic publications was collected and analyzed. Data showed that, among the registered and studied traditional Uighur medicine, the main therapeutic areas of traditional Uighur medicine focused on skin disease, urogenital disease, rheumatism and digestive system disease. The representative traditional Uighur patent medicine included the following: BaixuanXiatare Tablets, Kaliziran Tincture and Vernoniaanthelmintica Injection (Psoriasis and vitiligo); Xi-payimazibiziLiquid (prostatitis); KursiKaknaq (urinary tract infection); Tongzhisurunjiang Capsules (anti-rheumatism medicine); HuganBuzure Granules (digestive system disease). Moreover, ten Uighur herbs were widely used, including: ResinaScammoniae, Folium FumicisDentati, HerbaDracocephali, Semen AmygdaliDulcis, HerbaChamomillae, FructusPimpinellaeanisi, Cortex Foeniculi, FructusVernoniae, FructusApii, and Radix AnacycliPyrethri. This study concluded by indicating that traditional Uighur medicine with excellent curative effect should be screened in details for their phytochemical properties and pharmacological activity to discover new bioactive constituents.

Photoproducts of carminic acid formed by a composite from Manihot dulcis waste.

PubMed

Antonio-Cisneros, Cynthia M; Dávila-Jiménez, Martín M; Elizalde-González, María P; García-Díaz, Esmeralda

2015-04-15

Carbon-TiO2 composites were obtained from carbonised Manihot dulcis waste and TiO2 using glycerol as an additive and thermally treating the composites at 800 °C. Furthermore, carbon was obtained from manihot to study the adsorption, desorption and photocatalysis of carminic acid on these materials. Carminic acid, a natural dye extracted from cochineal insects, is a pollutant produced by the food industry and handicrafts. Its photocatalysis was observed under different atmospheres, and kinetic curves were measured by both UV-Vis and HPLC for comparison, yielding interesting differences. The composite was capable of decomposing approximately 50% of the carminic acid under various conditions. The reaction was monitored by UV-Vis spectroscopy and LC-ESI-(Qq)-TOF-MS-DAD, enabling the identification of some intermediate species. The deleterious compound anthracene-9,10-dione was detected both in N2 and air atmospheres. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effects of cadmium on lipids of almond seedlings (Prunus dulcis).

PubMed

Elloumi, Nada; Zouari, Mohamed; Chaari, Leila; Jomni, Chiraz; Marzouk, Brahim; Ben Abdallah, Ferjani

2014-12-01

Cadmium uptake and distribution, as well as its effects on lipid composition was investigated in almond seedlings (Prunus dulcis) grown in culture solution supplied with two concentrations of Cd (50 and 150 μM). The accumulation of Cd increased with external metal concentrations, and was considerably higher in roots than in leaves. Fourteen days after Cd treatment, the membrane lipids were extracted and separated on silica-gel thin layer chromatography (TLC). Fatty acid methyl esters were analyzed by FID-GC on a capillary column. Our results showed that Cd stress decreased the quantities of all lipids classes (phospholipids, galactolipids and neutral lipids). Galactolipid, phospholipid and neutral lipid concentrations decreased more in roots than in leaves by Cd-treatment. In almost all lipid classes the proportion of palmitic acid (16:0), linoleic (18: 2) and that of linolenic (18: 3) acid decreased, suggesting that heavy metal treatment induced an alteration in the fatty acid synthesis processes. In conclusion, our results show that the changes found in total fatty acids, in the quantities of all lipids classes, and in the in the profiles of individual polar lipids suggest that membrane structure and function might be altered by Cd stress.

Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.

PubMed

Xie, Liyang; Bolling, Bradley W

2014-04-01

Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Proteome analysis of the almond kernel (Prunus dulcis).

PubMed

Li, Shugang; Geng, Fang; Wang, Ping; Lu, Jiankang; Ma, Meihu

2016-08-01

Almond (Prunus dulcis) is a popular tree nut worldwide and offers many benefits to human health. However, the importance of almond kernel proteins in the nutrition and function in human health requires further evaluation. The present study presents a systematic evaluation of the proteins in the almond kernel using proteomic analysis. The nutrient and amino acid content in almond kernels from Xinjiang is similar to that of American varieties; however, Xinjiang varieties have a higher protein content. Two-dimensional electrophoresis analysis demonstrated a wide distribution of molecular weights and isoelectric points of almond kernel proteins. A total of 434 proteins were identified by LC-MS/MS, and most were proteins that were experimentally confirmed for the first time. Gene ontology (GO) analysis of the 434 proteins indicated that proteins involved in primary biological processes including metabolic processes (67.5%), cellular processes (54.1%), and single-organism processes (43.4%), the main molecular function of almond kernel proteins are in catalytic activity (48.0%), binding (45.4%) and structural molecule activity (11.9%), and proteins are primarily distributed in cell (59.9%), organelle (44.9%), and membrane (22.8%). Almond kernel is a source of a wide variety of proteins. This study provides important information contributing to the screening and identification of almond proteins, the understanding of almond protein function, and the development of almond protein products. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Effect of an aqueous extract of Scoparia dulcis on blood glucose, plasma insulin and some polyol pathway enzymes in experimental rat diabetes.

PubMed

Latha, M; Pari, L

2004-04-01

The effects of an aqueous extract of the plant Scoparia dulcis (200 mg/kg) on the polyol pathway and lipid peroxidation were examined in the liver of streptozotocin adult diabetic male albino Wistar rats. The diabetic control rats (N = 6) presented a significant increase in blood glucose, sorbitol dehydrogenase, glycosylated hemoglobin and lipid peroxidation markers such as thiobarbituric acid reactive substances (TBARS) and hydroperoxides, and a significant decrease in plasma insulin and antioxidant enzymes such as glutathione peroxidase (GPx), glutathione-S-transferase (GST) and reduced glutathione (GSH) compared to normal rats (N = 6). Scoparia dulcis plant extract (SPEt, 200 mg kg-1 day-1) and glibenclamide (600 microg kg-1 day-1), a reference drug, were administered by gavage for 6 weeks to diabetic rats (N = 6 for each group) and significantly reduced blood glucose, sorbitol dehydrogenase, glycosylated hemoglobin, TBARS, and hydroperoxides, and significantly increased plasma insulin, GPx, GST and GSH activities in liver. The effect of the SPEt was compared with that of glibenclamide. The effect of the extract may have been due to the decreased influx of glucose into the polyol pathway leading to increased activities of antioxidant enzymes and plasma insulin and decreased activity of sorbitol dehydrogenase. These results indicate that the SPEt was effective in attenuating hyperglycemia in rats and their susceptibility to oxygen free radicals.

Tactile responses in the granule cell layer of cerebellar folium crus IIa of freely behaving rats

NASA Technical Reports Server (NTRS)

Hartmann, M. J.; Bower, J. M.

2001-01-01

We recorded activity from the granule cell layer (GCL) of cerebellar folium Crus IIa as freely moving rats engaged in a variety of natural behaviors, including grooming, eating, and free tactile exploration. Multiunit responses in the 1000-4500 Hz range were found to be strongly correlated with tactile stimulation of lip and whisker (perioral) regions. These responses occurred regardless of whether the stimulus was externally or self-generated and during both active and passive touch. In contrast, perioral movements that did not tactually stimulate this region of the face (e.g., chewing) produced no detectable increases in GCL activity. In addition, GCL responses were not correlated with movement extremes. When rats used their lips actively for palpation and exploration, the tactile responses in the GCL were not detectably modulated by ongoing jaw movements. However, active palpation and exploratory behaviors did result in the largest and most continuous bursts of GCL activity: responses were on average 10% larger and 50% longer during palpation and exploration than during grooming or passive stimulation. Although activity levels differed between behaviors, the position and spatial extent of the peripheral receptive field was similar over all behaviors that resulted in tactile input. Overall, our data suggest that the 1000-4500 Hz multiunit responses in the Crus IIa GCL of awake rats are correlated with tactile input rather than with movement or any movement parameter and that these responses are likely to be of particular importance during the acquisition of sensory information by perioral structures.

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis.

PubMed

Gaur, Vineet; Sethi, Dhruv K; Salunke, Dinakar M

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4(1) (or P4(3)), with unit-cell parameters a = b = 150.7, c = 164.9 A.

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

PubMed Central

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M.

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P41 (or P43), with unit-cell parameters a = b = 150.7, c = 164.9 Å. PMID:18097098

Green Synthesis of NiFe2O4 Spinel-Structured Nanoparticles Using Hydrangea paniculata Flower Extract with Excellent Magnetic Property

NASA Astrophysics Data System (ADS)

Karunakaran, Gopalu; Jagathambal, Matheswaran; Van Minh, Nguyen; Kolesnikov, Evgeny; Kuznetsov, Denis

2018-05-01

Nickel ferrite (NiFe2O4) spinel-structured nanoparticles (NPs) were synthesized by a green synthesis approach using Hydrangea paniculata flower extract. Green synthesis of NPs was preliminary monitored by a color change. Further confirmation was carried out using different techniques. X-ray diffraction analysis confirmed the cubic crystalline system (fcc) of NiFe2O4. Energy-dispersive spectrum analysis showed the presence of iron, nickel, oxygen, and carbon. Scanning electron microscopy revealed the agglomerating nature of the NPs (30-50 nm). The specific surface area was found to be 46.73 m2/g, revealing the average size D of NPs to be 24 nm. Transmission electron microscopy confirmed the spherical, oval, and irregular shapes of the NPs with a size range between 10 nm and 45 nm, and an average size of 28 nm. The magnetization of the obtained NiFe2O4 NPs in a high magnetic field of 20 kOe was found to be 20 emu/g. The values of remanent magnetization (M r) and coercive field (H c) were found to be 1.1 emu/g and 28 Oe, respectively. In the process of magnetization reversal (with a small value of M r/M s, 0.055), NiFe2O4 NPs had a loop with low energy loss, showing that the obtained NiFe2O4 NPs were soft magnetic materials. The magnetization curve with a sigmoidal shape indicated that the obtained NiFe2O4 NPs are super-paramagnetic material. In addition, the comparison of green synthesis with the methods available in the literature proved that the green synthesis is the best method. Thus, it is clear that green synthesis is a novel eco-friendly approach for the synthesis of magnetic NiFe2O4 NPs.

Antiproliferative terpenoids from almond hulls (Prunus dulcis): identification and structure-activity relationships.

PubMed

Amico, Vincenzo; Barresi, Vincenza; Condorelli, Daniele; Spatafora, Carmela; Tringali, Corrado

2006-02-08

Bioassay-guided fractionation of the EtOAc crude extract from Sicilian almond hulls, a waste material from Prunus dulcis crop, allowed identification of 10 constituents, isolated as pure compounds (1-5, 7, and 10) or unseparable mixtures (5 + 6 and 8 + 9). All compounds were subjected to spectroscopic analysis and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide bioassay on MCF-7 human breast cancer cells. In addition to the main components oleanolic (1), ursolic (2), and betulinic (3) acids, the 2-hydroxy analogues alphitolic (4), corosolic (5), and maslinic (6) acids, as well as the related aldehydes, namely, betulinic (7), oleanolic (8), and ursolic (9), were identified. From a more polar fraction, the beta-sitosterol 3-O-glucoside (10) was also identified. A sample of commercially available betulin (11) was also included in bioassays as further support to a structure-activity relationship study. Betulinic acid showed antiproliferative activity toward MCF-7 cells (GI50 = 0.27 microM), higher than the anticancer drug 5-fluorouracil.

Bioactive diterpenoids and flavonoids from the aerial parts of Scoparia dulcis.

PubMed

Liu, Qing; Yang, Qi-Ming; Hu, Hai-Jun; Yang, Li; Yang, Ying-Bo; Chou, Gui-Xin; Wang, Zheng-Tao

2014-07-25

Six new diterpenoids, 4-epi-7α-O-acetylscoparic acid A (1), 7α-hydroxyscopadiol (2), 7α-O-acetyl-8,17β-epoxyscoparic acid A (3), neo-dulcinol (4), dulcinodal-13-one (5), and 4-epi-7α-hydroxydulcinodal-13-one (6), and a new flavonoid, dillenetin 3-O-(6″-O-p-coumaroyl)-β-D-glucopyranoside (10), along with 12 known compounds, were isolated from the aerial parts of Scoparia dulcis. The 7S absolute configuration of the new diterpenoids 1-4 and 6 was deduced by comparing their NOESY spectra with that of a known compound, (7S)-4-epi-7-hydroxyscoparic acid A (7), which was determined by the modified Mosher's method. The flavonoids scutellarein (11), hispidulin (12), apigenin (15), and luteolin (16) and the terpenoids 4-epi-scopadulcic acid B (9) and betulinic acid (19) showed more potent α-glucosidase inhibitory effects (with IC50 values in the range 13.7-132.5 μM) than the positive control, acarbose. In addition, compounds 1, 11, 12, 15, 16, and acerosin (17) exhibited peroxisome proliferator-activated receptor gamma (PPAR-γ) agonistic activity, with EC50 values ranging from 0.9 to 24.9 μM.

In vitro and in vivo study of the clastogenicity of the flavone cirsitakaoside extracted from Scoparia dulcis L. (Scrophulariaceae).

PubMed

Pereira-Martins, S R; Takahashi, C S; Tavares, D C; Torres, L M

1998-01-01

The mutagenic effect of the flavone cirsitakaoside extracted from the medicinal herb Scoparia dulcis was evaluated in vitro by using human peripheral blood cultures treated with doses of 5, 10, and 15 microg of the flavone/ml culture medium for 48 h. The compound proved to be mutagenic at the highest concentration tested (15 microg/ml). Furthermore, the proliferative index was significantly reduced in all cultures treated with the flavone, although the mitotic index was not reduced. However, the clastogenic activity of the flavone cirsitakaoside was not observed when Swiss mice were treated orally with doses of 10, 20, and 30 mg/animal for 24 h.

Scopadulciol, an inhibitor of gastric H+, K(+)-ATPase from Scoparia dulcis, and its structure-activity relationships.

PubMed

Hayashi, T; Asano, S; Mizutani, M; Takeguchi, N; Kojima, T; Okamura, K; Morita, N

1991-01-01

A new tetracyclic diterpenoid, scopadulciol [3], together with 6-methoxybenzoxazolinone, glutinol, and acacetin, was isolated from the 70% EtOH extract of Scoparia dulcis collected in Taiwan. Its structure was elucidated to be 6 beta-benzoyl-12-methyl-13-oxo-9(12)a,9(12)b-dihomo-18-podocarpanol on the basis of spectral data. It mildly inhibited hog gastric H+, K(+)-ATPase. Examination of the inhibitory activities of derivatives of scopadulcic acid B [2], including 3, revealed that methylation of the carboxyl group and introduction of an acetyl group or oxime at C-13 or C-18 markedly enhanced the inhibitory activity, while debenzoylation reduced the activity. Among the 30 compounds tested, compound 12, a methyl ester of scopadulcic acid B [2], showed the most potent activity.

Antiproliferative constituents in plants 9. Aerial parts of Lippia dulcis and Lippia canescens.

PubMed

Abe, Fumiko; Nagao, Tsuneatsu; Okabe, Hikaru

2002-07-01

The antiproliferative constituents in the MeOH extracts of the aerial parts of Lippia dulcis Trev. and Lippia canescens Kunth (Verbenaceae) were investigated. Activity-guided chemical investigation of the MeOH extracts resulted in the isolation of the three bisabolane-type sesquiterpenes [(+)-hernandulcin (1), (-)-epihernandulcin (2), and (+)-anymol (3)] and four phenylethanoid glycosides [acteoside (4), isoacteoside (5), martynoside (6), and a new diacetylmartynoside (7)] from the former, and four phenylethanoid glycosides [acteoside (4), isoacteoside (5), arenarioside (8), and leucosceptoside A (9)] and three flavones [desmethoxycentaureidin (10), eupafolin (11), and 6-hydroxyluteolin (12)] from the latter. Antiproliferative activity of the isolated compounds against murine melanoma (B16F10), human gastric adenocarcinoma (MK-1), and human uterine carcinoma (HeLa) cells was estimated. (+)-Anymol (3), acteoside (4), isoacteoside (5), arenarioside (8), eupafolin (11), and 6-hydroxyluteolin (12) had GI50 values of 10-16 microM against B16F10 cell. Desmethoxycentaureidin (10) and eupafolin (11) showed high inhibitory activity against HeLa cell growth (GI50 9 microM, and 6 microM, respectively).

Efficient removal of Acid Green 25 dye from wastewater using activated Prunus Dulcis as biosorbent: Batch and column studies.

PubMed

Jain, Suyog N; Gogate, Parag R

2018-03-15

Biosorbent synthesized from dead leaves of Prunus Dulcis with chemical activation during the synthesis was applied for the removal of Acid Green 25 dye from wastewater. The obtained biosorbent was characterized using Brunauer-Emmett-Teller analysis, Fourier transform-infrared spectroscopy and scanning electron microscopy measurements. It was demonstrated that alkali treatment during the synthesis significantly increased surface area of biosorbent from 67.205 to 426.346 m 2 /g. The effect of various operating parameters on dye removal was investigated in batch operation and optimum values of parameters were established as pH of 2, 14 g/L as the dose of natural biosorbent and 6 g/L as the dose of alkali treated biosorbent. Relative error values were determined to check fitting of obtained data to the different kinetic and isotherm models. It was established that pseudo-second order kinetic model and Langmuir isotherm fitted suitably to the obtained batch experimental data. Maximum biosorption capacity values were estimated as 22.68 and 50.79 mg/g for natural biosorbent and for alkali activated Prunus Dulcis, respectively. Adsorption was observed as endothermic and activation energy of 6.22 kJ/mol confirmed physical type of adsorption. Column experiments were also conducted to probe the effectiveness of biosorbent for practical applications in continuous operation. Breakthrough parameters were established by studying the effect of biosorbent height, flow rate of dye solution and initial dye concentration on the extent of dye removal. The maximum biosorption capacity under optimized conditions in the column operation was estimated as 28.57 mg/g. Thomas and Yoon-Nelson models were found to be suitably fitted to obtained column data. Reusability study carried out in batch and continuous column operations confirmed that synthesized biosorbent can be used repeatedly for dye removal from wastewater. Copyright © 2018 Elsevier Ltd. All rights reserved.

Hepatoprotective activity of petroleum ether, diethyl ether, and methanol extract of Scoparia dulcis L. against CCl4-induced acute liver injury in mice.

PubMed

Praveen, T K; Dharmaraj, S; Bajaj, Jitendra; Dhanabal, S P; Manimaran, S; Nanjan, M J; Razdan, Rema

2009-06-01

The present study was aimed at assessing the hepatoprotective activity of 1:1:1 petroleum ether, diethyl ether, and methanol (PDM) extract of Scoparia dulcis L. against carbon tetrachloride-induced acute liver injury in mice. The PDM extract (50, 200, and 800 mg/kg, p.o.) and standard, silymarin (100 mg/kg, p.o) were tested for their antihepatotoxic activity against CCl4-induced acute liver injury in mice. The hepatoprotective activity was evaluated by measuring aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and total proteins in serum, glycogen, lipid peroxides, superoxide dismutase, and glutathione reductase levels in liver homogenate and by histopathological analysis of the liver tissue. In addition, the extract was also evaluated for its in vitro antioxidant activity using 1, 1-Diphenyl-2-picrylhydrazyl scavenging assay. The extract at the dose of 800 mg/kg, p.o., significantly prevented CCl4-induced changes in the serum and liver biochemistry (P < 0.05) and changes in liver histopathology. The above results are comparable to standard, silymarin (100 mg/kg, p.o.). In the in vitro 1, 1-diphenyl-2-picrylhydrazyl scavenging assay, the extract showed good free radical scavenging potential (IC 50 38.9 +/- 1.0 mug/ml). The results of the study indicate that the PDM extract of Scoparia dulcis L. possesses potential hepatoprotective activity, which may be attributed to its free radical scavenging potential, due to the terpenoid constituents.

Hepatoprotective activity of petroleum ether, diethyl ether, and methanol extract of Scoparia dulcis L. against CCl4-induced acute liver injury in mice

PubMed Central

Praveen, T.K.; Dharmaraj, S.; Bajaj, Jitendra; Dhanabal, S.P.; Manimaran, S.; Nanjan, M.J.; Razdan, Rema

2009-01-01

Objectives: The present study was aimed at assessing the hepatoprotective activity of 1:1:1 petroleum ether, diethyl ether, and methanol (PDM) extract of Scoparia dulcis L. against carbon tetrachloride-induced acute liver injury in mice. Materials and Methods: The PDM extract (50, 200, and 800 mg/kg, p.o.) and standard, silymarin (100 mg/kg, p.o) were tested for their antihepatotoxic activity against CCl4-induced acute liver injury in mice. The hepatoprotective activity was evaluated by measuring aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and total proteins in serum, glycogen, lipid peroxides, superoxide dismutase, and glutathione reductase levels in liver homogenate and by histopathological analysis of the liver tissue. In addition, the extract was also evaluated for its in vitro antioxidant activity using 1, 1-Diphenyl-2-picrylhydrazyl scavenging assay. Results: The extract at the dose of 800 mg/kg, p.o., significantly prevented CCl4-induced changes in the serum and liver biochemistry (P < 0.05) and changes in liver histopathology. The above results are comparable to standard, silymarin (100 mg/kg, p.o.). In the in vitro 1, 1-diphenyl-2-picrylhydrazyl scavenging assay, the extract showed good free radical scavenging potential (IC 50 38.9 ± 1.0 μg/ml). Conclusions: The results of the study indicate that the PDM extract of Scoparia dulcis L. possesses potential hepatoprotective activity, which may be attributed to its free radical scavenging potential, due to the terpenoid constituents. PMID:20442817

Saccharides and fructooligosaccharides composition of green and ripe Averrhoa carambola, Blighia sapida and Spondias dulcis fruits.

PubMed

Benkeblia, Noureddine; Lopez, Mercedes G

2015-06-01

The maturation of fruits is characterized by numerous compositional changes during ripening and these changes contribute in their quality attributes. This study aimed to assess the contents of saccharides and potential fructooligosaccharides (FOS) of ackee (Blighia sapida Köenig), carambola (Averrhoa carambola) and June plum (Spondias dulcis), at green and ripe stages. Beside glucose and fructose and lower sucrose content, three short chain fructooligosaccharides were identified in ackee fruit, namely 1-kestose (1(F)-β-d-fructofuranosyl sucrose), nystose (1(F)(1-β-d-fructofuranosyl)2 sucrose) and DP5 (1(F)(1-β-d-fructofuranosyl)3 sucrose), while in carambola and June plum DP5 (1(F)(1-β-d-fructofuranosyl)3 sucrose) was not detected. Ripening stage also affected significantly the contents of these saccharides and sFOS. Copyright © 2014 Elsevier Ltd. All rights reserved.

Almond (Prunus dulcis (Mill.) D.A. Webb) skins as a potential source of bioactive polyphenols.

PubMed

Monagas, Maria; Garrido, Ignacio; Lebrón-Aguilar, Rosa; Bartolome, Begoña; Gómez-Cordovés, Carmen

2007-10-17

An exhaustive study of the phenolic composition of almond ( Prunus dulcis (Mill.) D.A. Webb) skins was carried out in order to evaluate their potential application as a functional food ingredient. Using the HPLC-DAD/ESI-MS technique, a total of 33 compounds corresponding to flavanols, flavonols, dihydroflavonols and flavanones, and other nonflavonoid compounds were identified. Peaks corresponding to another 23 structure-related compounds were also detected. MALDI-TOF MS was applied to characterize almond skin proanthocyanidins, revealing the existence of a series of A- and B-type procyanidins and propelargonidins up to heptamers, and A- and B-type prodelphinidins up to hexamers. Flavanols and flavonol glycosides were the most abundant phenolic compounds in almond skins, representing up to 38-57% and 14-35% of the total quantified phenolics, respectively. Due to their antioxidant properties, measured as oxygen-radical absorbance capacity (ORAC) at 0.398-0.500 mmol Trolox/g, almond skins can be considered as a value-added byproduct for elaborating dietary antioxidant ingredients.

Inhibition of LDL oxidation and oxidized LDL-induced foam cell formation in RAW 264.7 cells show anti-atherogenic properties of a foliar methanol extract of Scoparia dulcis.

PubMed

Nambiar, Sinjitha S; Shetty, Nandini Prasad; Bhatt, Praveena; Neelwarne, Bhagyalakshmi

2014-04-01

Oxidation of low density lipoproteins and their further uptake by macrophages is known to result in the formation of foam cells, which are critical in the initiation of atherosclerosis through activation of inflammatory signalling cascades. Thus, powerful dietary antioxidants are receiving attention for the reversal of such pathological states. Extracts of Scoparia dulcis have been used as tea and health drinks with various health promoting effects. In the present study, we examined the reactive oxygen scavenging potential as well as anti-inflammatory and anti-atherogenic efficacies, using leaf extracts obtained after successive extraction with various solvents. A methanol extract showed potent antioxidant activity with an IC50 value of 570 μg/ml, caused hydrogen peroxide scavenging (28.9 µg/ml) and anti-inflammatory effects by improving human erythrocyte membrane stabilisation (about 86%). The methanol extract also efficiently inhibited lipid peroxidation and oxidation of low density lipoproteins, thus preventing foam cell formation in cultured RAW 264.7 cells. Furthermore, phytochemical screening of the extracts showed high accumulation of flavonoids. The foliar methanol extract of Scoparia dulcis has a strong anti-atherogenic potential and this property could be attributed maybe due to presence of flavonoids since HPLC analysis showed high concentrations of myricetin and rutin in the methanol extract.

Effect of Temperature and Moisture on the Development of Concealed Damage in Raw Almonds (Prunus dulcis).

PubMed

Rogel-Castillo, Cristian; Zuskov, David; Chan, Bronte Lee; Lee, Jihyun; Huang, Guangwei; Mitchell, Alyson E

2015-09-23

Concealed damage (CD) is a brown discoloration of nutmeat that appears only after kernels are treated with moderate heat (e.g., roasting). Identifying factors that promote CD in almonds is of significant interest to the nut industry. Herein, the effect of temperature (35 and 45 °C) and moisture (<5, 8, and 11%) on the composition of volatiles in raw almonds (Prunus dulcis var. Nonpareil) was studied using HS-SPME-GC/MS. A CIE LCh colorimetric method was developed to identify raw almonds with CD. A significant increase in CD was demonstrated in almonds exposed to moisture (8% kernel moisture content) at 45 °C as compared to 35 °C. Elevated levels of volatiles related to lipid peroxidation and amino acid degradation were observed in almonds with CD. These results suggest that postharvest moisture exposure resulting in an internal kernel moisture ≥ 8% is a key factor in the development of CD in raw almonds and that CD is accelerated by temperature.

Effect of Scoparia dulcis extract on insulin receptors in streptozotocin induced diabetic rats: studies on insulin binding to erythrocytes.

PubMed

Pari, Leelavinothan; Latha, Muniappan; Rao, Chippada Appa

2004-01-01

We investigated the insulin-receptor-binding effect of Scoparia dulcis plant extract in streptozotocin (STZ)-induced male Wistar rats, using circulating erythrocytes (ER) as a model system. An aqueous extract of S dulcis plant (SPEt) (200 mg/kg body weight) was administered orally. We measured blood levels of glucose and plasma insulin and the binding of insulin to cell-membrane ER receptors. Glibenclamide was used as standard reference drug. The mean specific binding of insulin to ER was significantly lower in diabetic control rats (DC) (55.0 +/- 2.8%) than in SPEt-treated (70.0 +/- 3.5%)- and glibenclamide-treated (65.0 +/- 3.3%) diabetic rats, resulting in a significant decrease in plasma insulin. Scatchard plot analysis demonstrated that the decrease in insulin binding was accounted for by a lower number of insulin receptor sites per cell in DC rats when compared with SPEt- and glibenclamide-treated rats. High-affinity (Kd1), low-affinity (Kd2), and kinetic analysis revealed an increase in the average receptor affinity in ER from SPEt and glibenclamide treated diabetic rats having 2.5 +/- 0.15 x 10(10) M(-1) (Kd1); 17.0 +/- 1.0 x 10(-8) M(-1) (Kd2), and 2.0 +/- 0.1 x 10(-10) M(-1) (Kd1); 12.3 +/- 0.9 x 10(-8) M(-1) (Kd2) compared with 1.0 +/- 0.08 x 10(-10) M(-1) (Kd1); 2.7 +/- 0.25 x 10(-8) M(-1) (Kd2) in DC rats. The results suggest an acute alteration in the number of insulin receptors on ER membranes in STZ-induced diabetic rats. Treatment with SPEt and glibenclamide significantly improved specific insulin binding, with receptor number and affinity binding (p < 0.001) reaching almost normal non-diabetic levels. The data presented here show that SPEt and glibenclamide increase total ER membrane insulin binding sites with a concomitant significant increase in plasma insulin.

Alteration in Memory and Electroencephalogram Waves with Sub-acute Noise Stress in Albino Rats and Safeguarded by Scoparia dulcis.

PubMed

Loganathan, Sundareswaran; Rathinasamy, Sheeladevi

2016-01-01

Noise stress has different effects on memory and novelty and the link between them with an electroencephalogram (EEG) has not yet been reported. To find the effect of sub-acute noise stress on the memory and novelty along with EEG and neurotransmitter changes. Eight-arm maze (EAM) and Y-maze to analyze the memory and novelty by novel object test. Four groups of rats were used: Control, control treated with Scoparia dulcis extract, noise exposed, and noise exposed which received Scoparia extract. The results showed no marked difference observed between control and control treated with Scoparia extract on EAM, Y-maze, novel object test, and EEG in both prefrontal and occipital region, however, noise stress exposed rats showed significant increase in the reference memory and working memory error in EAM and latency delay, triad errors in Y-maze, and prefrontal and occipital EEG frequency rate with the corresponding increase in plasma corticosterone and epinephrine, and significant reduction in the novelty test, and significant reduction in the novelty test, amplitude of prefrontal, occipital EEG, and acetylcholine. These noise stress induced changes in EAM, Y-maze, novel object test, and neurotransmitters were significantly prevented when treated with Scoparia extract and these changes may be due to the normalizing action of Scoparia extract on the brain, which altered due to noise stress. Noise stress exposure causes EEG, behavior, and neurotransmitter alteration in the frontoparietal and occipital regions mainly involved in planning and recognition memoryOnly the noise stress exposed animals showed the significant alteration in the EEG, behavior, and neurotransmittersHowever, these noise stress induced changes in EEG behavior and neurotransmitters were significantly prevented when treated with Scoparia extractThese changes may be due to the normalizing action of Scoparia dulcis (adoptogen) on the brain which altered by noise stress. Abbreviations used: EEG

Alteration in Memory and Electroencephalogram Waves with Sub-acute Noise Stress in Albino Rats and Safeguarded by Scoparia dulcis

PubMed Central

Loganathan, Sundareswaran; Rathinasamy, Sheeladevi

2016-01-01

Background: Noise stress has different effects on memory and novelty and the link between them with an electroencephalogram (EEG) has not yet been reported. Objective: To find the effect of sub-acute noise stress on the memory and novelty along with EEG and neurotransmitter changes. Materials and Methods: Eight-arm maze (EAM) and Y-maze to analyze the memory and novelty by novel object test. Four groups of rats were used: Control, control treated with Scoparia dulcis extract, noise exposed, and noise exposed which received Scoparia extract. Results: The results showed no marked difference observed between control and control treated with Scoparia extract on EAM, Y-maze, novel object test, and EEG in both prefrontal and occipital region, however, noise stress exposed rats showed significant increase in the reference memory and working memory error in EAM and latency delay, triad errors in Y-maze, and prefrontal and occipital EEG frequency rate with the corresponding increase in plasma corticosterone and epinephrine, and significant reduction in the novelty test, and significant reduction in the novelty test, amplitude of prefrontal, occipital EEG, and acetylcholine. Conclusion: These noise stress induced changes in EAM, Y-maze, novel object test, and neurotransmitters were significantly prevented when treated with Scoparia extract and these changes may be due to the normalizing action of Scoparia extract on the brain, which altered due to noise stress. SUMMARY Noise stress exposure causes EEG, behavior, and neurotransmitter alteration in the frontoparietal and occipital regions mainly involved in planning and recognition memoryOnly the noise stress exposed animals showed the significant alteration in the EEG, behavior, and neurotransmittersHowever, these noise stress induced changes in EEG behavior and neurotransmitters were significantly prevented when treated with Scoparia extractThese changes may be due to the normalizing action of Scoparia dulcis (adoptogen) on

Inhibition of LDL oxidation and oxidized LDL-induced foam cell formation in RAW 264.7 cells show anti-atherogenic properties of a foliar methanol extract of Scoparia dulcis

PubMed Central

Nambiar, Sinjitha S.; Shetty, Nandini Prasad; Bhatt, Praveena; Neelwarne, Bhagyalakshmi

2014-01-01

Background: Oxidation of low density lipoproteins and their further uptake by macrophages is known to result in the formation of foam cells, which are critical in the initiation of atherosclerosis through activation of inflammatory signalling cascades. Thus, powerful dietary antioxidants are receiving attention for the reversal of such pathological states. Materials and Methods: Extracts of Scoparia dulcis have been used as tea and health drinks with various health promoting effects. In the present study, we examined the reactive oxygen scavenging potential as well as anti-inflammatory and anti-atherogenic efficacies, using leaf extracts obtained after successive extraction with various solvents. Results: A methanol extract showed potent antioxidant activity with an IC50 value of 570 μg/ml, caused hydrogen peroxide scavenging (28.9 µg/ml) and anti-inflammatory effects by improving human erythrocyte membrane stabilisation (about 86%). The methanol extract also efficiently inhibited lipid peroxidation and oxidation of low density lipoproteins, thus preventing foam cell formation in cultured RAW 264.7 cells. Furthermore, phytochemical screening of the extracts showed high accumulation of flavonoids. Conclusions: The foliar methanol extract of Scoparia dulcis has a strong anti-atherogenic potential and this property could be attributed maybe due to presence of flavonoids since HPLC analysis showed high concentrations of myricetin and rutin in the methanol extract. PMID:24991098

Pollination Requirements of Almond (Prunus dulcis): Combining Laboratory and Field Experiments.

PubMed

Henselek, Yuki; Eilers, Elisabeth J; Kremen, Claire; Hendrix, Stephen D; Klein, Alexandra-Maria

2018-05-28

Almond (Prunus dulcis (Mill.) D. A. Webb; Rosales: Rosaceae) is a cash crop with an estimated global value of over seven billion U.S. dollars annually and commercial varieties are highly dependent on insect pollination. Therefore, the understanding of basic pollination requirements of the main varieties including pollination efficiency of honey bees (Apis mellifera, Linnaeus, Hymenoptera: Apidae) and wild pollinators is essential for almond production. We first conducted two lab experiments to examine the threshold number of pollen grains needed for successful pollination and to determine if varietal identity or diversity promotes fruit set and weight. Further, we examined stigma and ovules of flowers visited by Apis and non-Apis pollinators in the field to study the proportion of almond to non-almond pollen grains deposited, visitation time per flower visit, and tube set. Results indicate that the threshold for successful fertilization is around 60 pollen grains, but pollen can be from any compatible variety as neither pollen varietal identity nor diversity enhanced fruit set or weight. Andrena cerasifolii Cockerell (Hymenoptera: Andrenidae) was a more effective pollinator on a per single visit basis than Apis and syrphid flies. Nevertheless, Apis was more efficient than A. cerasifolii and syrphid flies as they spent less time on a flower during a single visit. Hence, planting with two compatible varieties and managing for both Apis and non-Apis pollinators is likely to be an optimal strategy for farmers to secure high and stable pollination success.

Hepatoprotective effects of ethanol extracts from Folium Syringae against acetaminophen-induced hepatotoxicity in vitro and in vivo.

PubMed

Shi, Chen-Xi; Lin, Yue-Xia; Liu, Fang-Ping; Chang, Yi-Cong; Li, Rui; Li, Chang-Wen; Li, Ying; He, Jing-Shan; Ma, Xin; Li, Zhi

2017-10-01

The leaves of Folium Syringae (FS) have been long used as a traditional Chinese folk medicine for their anti-inflammatory effect, utilized as an antibacterial and antiviral treatment. The purpose of this study was to investigate the potential hepatoprotective effects of FS on acetaminophen-induced hepatic injury in primary hepatocytes and mice. Hepatocytes obtained by the inverse perfusion method were divided randomly into five groups. Prior to acetaminophen exposure, 3 different doses of FS ethanol extracts were given to hepatocytes and mice, respectively. Thereafter, transaminases, glutathione S-transferase A1 (GSTA1) and some hepatic indices were determined. FS ethanol extracts (200 μg/mL) pretreatment prevented all of the alterations, returning their levels to nearly those levels observed in the control group in vitro. Treatment with FS ethanol extracts (200 mg/kg) significantly reduced the toxicity induced by acetaminophen in vivo, which manifested as a decrease in transaminases, and the hepatoprotective effects of FS were similar to Silymarin (positive group). GSTA1 represented the same change trend as transaminases and hepatic indices, and at a dose of 100 μg/mL FS ethanol extracts in vitro and 100 mg/kg in vivo, GSTA1 content changed significantly (p < 0.01), but transaminases were insignificant (p > 0.05). The results of our investigation suggested that FS ethanol extracts possess significant protective effects against hepatotoxicity induced by acetaminophen both in vitro and in vivo. In addition, GSTA1 could be used as an indicator assessing the extents of hepatic injury, which is more sensitive than transaminases. Copyright © 2017. Published by Elsevier Taiwan LLC.

Anti-inflammatory effects of Scoparia dulcis L. and betulinic acid.

PubMed

Tsai, Jen-Chieh; Peng, Wen-Huang; Chiu, Tai-Hui; Lai, Shang-Chih; Lee, Chao-Ying

2011-01-01

The aims of this study intended to investigate the anti-inflammatory activity of the 70% ethanol extract from Scoparia dulcis (SDE) and betulinic acid on λ-carrageenan-induced paw edema in mice. The anti-inflammatory mechanism of SDE and betulinic acid was examined by detecting the levels of cyclooxygenase-2 (COX-2), nitric oxide (NO), tumor necrosis factor (TNF-α), interleukin-1β (IL-1β) and malondialdehyde (MDA) in the edema paw tissue and the activities of superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione reductase (GRd) in the liver. The betulinic acid content in SDE was detected by high performance liquid chromatography (HPLC). In the anti-inflammatory model, the results showed that SDE (0.5 and 1.0 g/kg) and betulinic acid (20 and 40 mg/kg) reduced the paw edema at 3, 4 and 5 h after λ-carrageenan administration. Moreover, SDE and betulinic acid affected the levels of COX-2, NO, TNF-α and IL1-β in the λ-carrageenan-induced edema paws. The activities of SOD, GPx and GRd in the liver tissue were increased and the MDA levels in the edema paws were decreased. It is suggested that SDE and betulinic acid possessed anti-inflammatory activities and the anti-inflammatory mechanisms appear to be related to the reduction of the levels of COX-2, NO, TNF-α and IL1-β in inflamed tissues, as well as the inhibition of MDA level via increasing the activities of SOD, GPx and GRd. The analytical result showed that the content of betulinic acid in SDE was 6.25 mg/g extract.

Inhibitory effect of the branches of Hovenia dulcis Thunb. and its constituent pinosylvin on the activities of IgE-mediated mast cells and passive cutaneous anaphylaxis in mice.

PubMed

Lim, Sue Ji; Kim, Myungsuk; Randy, Ahmad; Nho, Chu Won

2015-04-01

Hovenia dulcis Thunb. (Rhamnaceae) is a hardy tree native to Europe, the Middle East, and North Africa, and it is also grown in parts of Asia and has been used in traditional medicine to treat liver toxicity, stomach disorders, and inflammation. This study investigated the anti-allergy potential of an extract of the branches of H. dulcis (HDB) using the antigen-stimulated mast cell-like cell line rat basophilic leukemia (RBL)-2H3 and a passive cutaneous anaphylaxis (PCA) mouse model. Degranulation assay, reverse transcription PCR, enzyme-lined immunosorbent assays, western blot analyses, and PCA were performed to measure allergic responses and proinflammatory mediators in antigen-stimulated rat basophilic leukemia (RBL)-2H3 mast cells and the PCA mouse model. In antigen-stimulated RBL-2H3 cells, HDB inhibited the secretion of β-hexosaminidase (indicating the inhibition of degranulation) and histamine release; decreased expression and production of the inflammatory mediators, cyclooxygenase-2 and prostaglandin E2, and cytokines interleukin-4 and tumor necrosis factor-α; and suppressed activation of nuclear factor κB, a transcription factor involved in the response to cytokines. HDB attenuated phosphorylation of the mast cell downstream effectors Lyn, Syk, phospholipase Cγ, protein kinase Cμ, extracellular signal-regulated kinase and p38. In IgE-sensitized mice, HDB inhibited mast cell-dependent PCA. Furthermore, HDB contained pinosylvin and possessed significant anti-allergic activities. These results suggest that HDB would be of value in the prevention and treatment of allergic diseases.

Enhanced accumulation of atropine in Atropa belladonna transformed by Rac GTPase gene isolated from Scoparia dulcis.

PubMed

Asano, Kyouhei; Lee, Jung-Bum; Yamamura, Yoshimi; Kurosaki, Fumiya

2013-12-01

Leaf tissues of Atropa belladonna were transformed by Sdrac2, a Rac GTPase gene, that is isolated from Scoparia dulcis, and the change in atropine concentration of the transformants was examined. Re-differentiated A. belladonna overexpressing Sdrac2 accumulated considerable concentration of atropine in the leaf tissues, whereas the leaves of plants transformed by an empty vector accumulated only a very low concentration of the compound. A. belladonna transformed by CASdrac2, a modified Sdrac2 of which translate was expected to bind guanosine triphosphate (GTP) permanently, accumulated very high concentrations of atropine (approximately 2.4-fold excess to those found in the wild-type plant in its natural habitat). In sharp contrast, the atropine concentration in transformed A. belladonna prepared with negatively modified Sdrac2, DNSdrac2, expected to bind guanosine diphosphate instead of GTP, was very low. These results suggested that Rac GTPases play an important role in the regulation of secondary metabolism in plant cells and that overexpression of the gene(s) may be capable of enhancing the production of natural products accumulated in higher plant cells.

Anatomy, Ultrastructure and Chemical Composition of Food Bodies of Hovenia dulcis (Rhamnaceae)

PubMed Central

Buono, Rafael Andrade; de Oliveira, Alaíde Braga; Paiva, Elder Antonio Sousa

2008-01-01

Background and Aims Food bodies (FBs) are structures that promote mutualism between plants and ants, which help protect them against herbivores. The present study aims to describe the anatomical organization, ultrastructure and chemical composition of the FBs in Hovenia dulcis, which represent the first structures of this type described in Rhamnaceae. Methods Leaves in various stages of development were collected and fixed for examination under light, transmission and scanning electron microscopy. Samples of FBs were subjected to chemical analysis using thin-layer chromatography and nuclear magnetic resonance of 1H and 13C. Key Results The FBs vary from globose to conical and are restricted to the abaxial leaf surface, having a mixed origin, including epidermis and parenchyma. The FB epidermis is uniseriate, slightly pilose and has a thin cuticle. The epidermal cells are vacuolated and pigments or food reserves are absent. The parenchyma cells of immature FBs have dense cytoplasm showing mitochondria, endoplasmic reticulum and plastids. Mature FB cells store oils, which are free in the cytosol and occupy a large portion of the cell lumen. In these cells the plastids accumulate starch. Conclusions The lipids present in FBs are glycerin esters characteristic of plant energy reserves. Ants were observed collecting these FBs, which allows us to infer that these structures mediate plant–ant interactions and can help protect the young plants against herbivores, as these structures are prevalent at this developmental stage. PMID:18413656

Synthesis of disaccharides using β-glucosidases from Aspergillus niger, A. awamori and Prunus dulcis.

PubMed

da Silva, Ayla Sant'Ana; Molina, Javier Freddy; Teixeira, Ricardo Sposina Sobral; Valdivieso Gelves, Luis G; Bon, Elba P S; Ferreira-Leitão, Viridiana S

2017-11-01

Glucose conversion into disaccharides was performed with β-glucosidases from Prunus dulcis (β-Pd), Aspergillus niger (β-An) and A. awamori (β-Aa), in reactions containing initial glucose of 700 and 900 g l -1 . The reactions' time courses were followed regarding glucose and product concentrations. In all cases, there was a predominant formation of gentiobiose over cellobiose and also of oligosaccharides with a higher molecular mass. For reactions containing 700 g glucose l -1 , the final substrate conversions were 33, 38, and 23.5% for β-An, β-Aa, and β-Pd, respectively. The use of β-An yielded 103 g gentiobiose l -1 (15.5% yield), which is the highest reported for a fungal β-glucosidase. The increase in glucose concentration to 900 g l -1 resulted in a significant increase in disaccharide synthesis by β-Pd, reaching 128 g gentiobiose l -1 (15% yield), while for β-An and β-Aa, there was a shift toward the synthesis of higher oligosaccharides. β-Pd and the fungal β-An and β-Aa β-glucosidases present quite dissimilar kinetics and selective properties regarding the synthesis of disaccharides; while β-Pd showed the highest productivity for gentiobiose synthesis, β-An presented the highest specificity.

Compositional analysis of Chinese water chestnut (Eleocharis dulcis) cell-wall material from parenchyma, epidermis, and subepidermal tissues.

PubMed

Grassby, Terri; Jay, Andrew J; Merali, Zara; Parker, Mary L; Parr, Adrian J; Faulds, Craig B; Waldron, Keith W

2013-10-09

Chinese water chestnut (Eleocharis dulcis (Burman f.) Trin ex Henschel) is a corm consumed globally in Oriental-style cuisine. The corm consists of three main tissues, the epidermis, subepidermis, and parenchyma; the cell walls of which were analyzed for sugar, phenolic, and lignin content. Sugar content, measured by gas chromatography, was higher in the parenchyma cell walls (931 μg/mg) than in the subepidermis (775 μg/mg) or epidermis (685 μg/mg). The alkali-extractable phenolic content, measured by high-performance liquid chromatography, was greater in the epidermal (32.4 μg/mg) and subepidermal cell walls (21.7 μg/mg) than in the cell walls of the parenchyma (12.3 μg/mg). The proportion of diferulic acids was higher in the parenchyma. The Klason lignin content of epidermal and subepidermal cell walls was ~15%. Methylation analysis of Chinese water chestnut cell-wall polysaccharides identified xyloglucan as the predominant hemicellulose in the parenchyma for the first time, and also a significant pectin component, similar to other nongraminaceous monocots.

In situ seasonal study of the volatile production of almonds (Prunus dulcis) var. 'Nonpareil' and relationship to navel orangeworm.

PubMed

Beck, John J; Merrill, Glory B; Higbee, Bradley S; Light, Douglas M; Gee, Wai S

2009-05-13

Nonpareil almonds, Prunus dulcis , account for the largest percentage of almond varieties grown in the Central Valley of California. Several studies have investigated the various nonvolatile and volatile components of various plant parts; however, the volatile organic compound (VOC) emission of almonds from a single cultivar has not been studied over the course of a growing season. This aspect is particularly relevant to research concerning the navel orangeworm (NOW), a major insect pest of almonds and other tree nuts. Despite the continued presence of NOW, the identification of particular VOCs and their relationship to NOW have not been addressed. The VOC emission of Nonpareil almonds was collected in situ over the course of a growing season by solid-phase microextraction (SPME). The VOCs (Z)-hex-3-enyl acetate, (Z)-hex-3-enyl butyrate, undecan-2-ol, beta-bourbonene, and tetradecane were present for the majority of the days investigated. Several VOCs exhibited positive electroantennographic signals from male and/or female NOW moths.

Antidiabetic effects of scoparic acid D isolated from Scoparia dulcis in rats with streptozotocin-induced diabetes.

PubMed

Latha, Muniappan; Pari, Leelavinothan; Ramkumar, Kunga Mohan; Rajaguru, Palanisamy; Suresh, Thangaraj; Dhanabal, Thangavel; Sitasawad, Sandhya; Bhonde, Ramesh

2009-01-01

We evaluated the antihyperglycaemic effect of scoparic acid D (SAD), a diterpenoid isolated from the ethanol extract of Scoparia dulcis in streptozotocin (STZ)-induced diabetic male Wistar rats. SAD was administered orally at a dose of 10, 20 and 40 mg kg(-1) bodyweight for 15 days. At the end of the experimental period, the SAD-treated STZ diabetic rats showed decreased levels of glucose as compared with diabetic control rats. The improvement in blood glucose levels of SAD-treated rats was associated with a significant increase in plasma insulin levels. SAD at a dose of 20 mg kg(-1) bodyweight exhibited a significant effect when compared with other doses. Further, the effect of SAD was tested on STZ-treated rat insulinoma cell lines (RINm5F cells) and isolated islets in vitro. SAD at a dose of 20 microg mL(-1) evoked two-fold stimulation of insulin secretion from isolated islets, indicating its insulin secretagogue activity. Further, SAD protected STZ-mediated cytotoxicity and nitric oxide (NO) production in RINm5F cells. The present study thus confirms the antihyperglycaemic effect of SAD and also demonstrated the consistently strong cytoprotective properties of SAD.

Bouldering: an alternative strategy to long-vertical climbing in root-climbing hortensias

PubMed Central

Granados Mendoza, Carolina; Isnard, Sandrine; Charles-Dominique, Tristan; Van den Bulcke, Jan; Rowe, Nick P.; Van Acker, Joris; Goetghebeur, Paul; Samain, Marie-Stéphanie

2014-01-01

In the Neotropics, the genus Hydrangea of the popular ornamental hortensia family is represented by climbing species that strongly cling to their support surface by means of adhesive roots closely positioned along specialized anchoring stems. These root-climbing hortensia species belong to the nearly exclusive American Hydrangea section Cornidia and generally are long lianescent climbers that mostly flower and fructify high in the host tree canopy. The Mexican species Hydrangea seemannii, however, encompasses not only long lianescent climbers of large vertical rock walls and coniferous trees, but also short ‘shrub-like’ climbers on small rounded boulders. To investigate growth form plasticity in root-climbing hortensia species, we tested the hypothesis that support variability (e.g. differences in size and shape) promotes plastic responses observable at the mechanical, structural and anatomical level. Stem bending properties, architectural axis categorization, tissue organization and wood density were compared between boulder and long-vertical tree-climbers of H. seemannii. For comparison, the mechanical patterns of a closely related, strictly long-vertical tree-climbing species were investigated. Hydrangea seemannii has fine-tuned morphological, mechanical and anatomical responses to support variability suggesting the presence of two alternative root-climbing strategies that are optimized for their particular environmental conditions. Our results suggest that variation of some stem anatomical traits provides a buffering effect that regulates the mechanical and hydraulic demands of two distinct plant architectures. The adaptive value of observed plastic responses and the importance of considering growth form plasticity in evolutionary and conservation studies are discussed. PMID:25079869

In vitro and in vivo antiviral activity of scopadulcic acid B from Scoparia dulcis, Scrophulariaceae, against herpes simplex virus type 1.

PubMed

Hayashi, K; Niwayama, S; Hayashi, T; Nago, R; Ochiai, H; Morita, N

1988-09-01

The antiviral activity of five diterpenoids isolated from Scoparia dulcis L., Scrophulariaceae, was examined in vitro against herpes simplex virus type 1. Among these compounds, only scopadulcic acid B was found to inhibit the viral replication with the in vitro therapeutic index of 16.7. The action of scopadulcic acid B was not due to a direct virucidal effect or inhibition of virus attachment to host cells. Single-cycle replication experiments indicated that the compound interfered with considerably early events of virus growth. The influence of scopadulcic acid B on the course of the primary corneal herpes simplex virus infection was investigated by means of a hamster test model. When the treatment was initiated immediately after virus inoculation, scopadulcic acid B, when applied orally or intraperitoneally, effectively prolonged both the appearance of herpetic lesions and the survival time at the dose of 100 and 200 mg/kg per day.

A flexible UV nanosensor based on reduced graphene oxide decorated ZnO nanostructures

NASA Astrophysics Data System (ADS)

Wang, Zhenxing; Zhan, Xueying; Wang, Yajun; Muhammad, Safdar; Huang, Ying; He, Jun

2012-03-01

A low-cost, compatible with flexible electronics, high performance UV sensor has been achieved from a reduced graphene oxide (RGO) decorated hydrangea-like ZnO film on a PDMS substrate. The hydrangea-like ZnO UV sensor has the best UV sensing performance among devices made of three kinds of ZnO nanostructures synthesized by a hydrothermal method, and demonstrated a dramatic enhancement in on/off ratio and photoresponse current by introducing an appropriate weight ratio of RGO. The on/off ratio of the 0.05% RGO/ZnO sensor increases almost one order of magnitude compared to that of a pristine hydrangea-like ZnO UV sensor. While for the 5% RGO decorated ZnO sensor, the photoresponse current reaches as high as ~1 μA and exceeds 700 times that of a ZnO UV sensor. These results indicate that RGO is an appropriate material to enhance the performance of ZnO nanostructure UV sensors based on its unique features, especially the high optical transparency and excellent electronic conductivity. Our findings will make RGO/ZnO nanohybrids extraordinarily promising in optoelectronics, flexible electronics and sensor applications.

A flexible UV nanosensor based on reduced graphene oxide decorated ZnO nanostructures.

PubMed

Wang, Zhenxing; Zhan, Xueying; Wang, Yajun; Muhammad, Safdar; Huang, Ying; He, Jun

2012-04-21

A low-cost, compatible with flexible electronics, high performance UV sensor has been achieved from a reduced graphene oxide (RGO) decorated hydrangea-like ZnO film on a PDMS substrate. The hydrangea-like ZnO UV sensor has the best UV sensing performance among devices made of three kinds of ZnO nanostructures synthesized by a hydrothermal method, and demonstrated a dramatic enhancement in on/off ratio and photoresponse current by introducing an appropriate weight ratio of RGO. The on/off ratio of the 0.05% RGO/ZnO sensor increases almost one order of magnitude compared to that of a pristine hydrangea-like ZnO UV sensor. While for the 5% RGO decorated ZnO sensor, the photoresponse current reaches as high as ∼1 μA and exceeds 700 times that of a ZnO UV sensor. These results indicate that RGO is an appropriate material to enhance the performance of ZnO nanostructure UV sensors based on its unique features, especially the high optical transparency and excellent electronic conductivity. Our findings will make RGO/ZnO nanohybrids extraordinarily promising in optoelectronics, flexible electronics and sensor applications.

Dual role of imidazole as activator/inhibitor of sweet almond (Prunus dulcis) β-glucosidase.

PubMed

Caramia, Sara; Gatius, Angela Gala Morena; Dal Piaz, Fabrizio; Gaja, Denis; Hochkoeppler, Alejandro

2017-07-01

The activity of Prunus dulcis (sweet almond) β-glucosidase at the expense of p -nitrophenyl-β-d-glucopyranoside at pH 6 was determined, both under steady-state and pre-steady-state conditions. Using crude enzyme preparations, competitive inhibition by 1-5 mM imidazole was observed under both kinetic conditions tested. However, when imidazole was added to reaction mixtures at 0.125-0.250 mM, we detected a significant enzyme activation. To further inspect this effect exerted by imidazole, β-glucosidase was purified to homogeneity. Two enzyme isoforms were isolated, i.e. a full-length monomer, and a dimer containing a full-length and a truncated subunit. Dimeric β-glucosidase was found to perform much better than the monomeric enzyme, independently of the kinetic conditions used to assay enzyme activity. In addition, the sensitivity towards imidazole was found to differ between the two isoforms. While monomeric enzyme was indeed found to be relatively insensitive to imidazole, dimeric β-glucosidase was observed to be significantly activated by 0.125-0.250 mM imidazole under pre-steady-state conditions. Further, steady-state assays revealed that the addition of 0.125 mM imidazole to reaction mixtures increases the K m of dimeric enzyme from 2.3 to 6.7 mM. The activation of β-glucosidase dimer by imidazole is proposed to be exerted via a conformational transition poising the enzyme towards proficient catalysis.

Therapeutic potency of saponin rich aqueous extract of Scoparia dulcis L. in alloxan induced diabetes in rats.

PubMed

Perumal, P Saravana; Anaswara, P V; Muthuraman, A; Krishan, S

2014-04-01

Diabetes mellitus is major metabolic disorders of carbohydrate metabolism. This leads to alter the multiple organ system. To investigate the antidiabetic and antioxidant effects of the saponin rich aqueous extract of Scoparia dulcis (SRE-SD) using alloxan-induced hyperglycemic rat model. The single dose of alloxan was injected for the induction of diabetes in rats. The SRE-SD and glibenclamide were administered for 15 consecutive days from the 3(rd) day of alloxan administration. Quantity of food and water intake was measured at day 0, and 18. Further, body weight was recorded and blood samples were collected at different time intervals that is, day 0, 3, 8, 13, and 18. The oxidative biomarkers (i.e. thiobarbituric acid reactive substances (TBARS), reduced glutathione (GSH) and nitrite (NO(2-)) levels were also estimated in the serum sample. The SRE-SD showed a remarkable dose and time-dependent changes in alloxan-induced rise in the level of food consumption and water intake, serum glucose level, TBARS, NO(2-) and fall in the level of GSH. Further, significant attenuation was observed at 20 and 30 mg/kg of SRE-SD treated group. These findings demonstrate that SRE-SD has both antidiabetic and antioxidant effects on the experimental model of diabetes in rat.

Effects of roasting temperature and duration on fatty acid composition, phenolic composition, Maillard reaction degree and antioxidant attribute of almond (Prunus dulcis) kernel.

PubMed

Lin, Jau-Tien; Liu, Shih-Chun; Hu, Chao-Chin; Shyu, Yung-Shin; Hsu, Chia-Ying; Yang, Deng-Jye

2016-01-01

Roasting treatment increased levels of unsaturated fatty acids (linoleic, oleic and elaidic acids) as well as saturated fatty acids (palmitic and stearic acids) in almond (Prunus dulcis) kernel oils with temperature (150 or 180 °C) and duration (5, 10 or 20 min). Nonetheless, higher temperature (200 °C) and longer duration (10 or 20 min) roasting might result in breakdown of fatty acids especially for unsaturated fatty acids. Phenolic components (total phenols, flavonoids, condensed tannins and phenolic acids) of almond kernels substantially lost in the initial phase; afterward these components gradually increased with roasting temperature and duration. Similar results also observed for their antioxidant activities (scavenging DPPH and ABTS(+) radicals and ferric reducing power). The changes of phenolic acid and flavonoid compositions were also determined by HPLC. Maillard reaction products (estimated with non-enzymatic browning index) also increased with roasting temperature and duration; they might also contribute to enhancing the antioxidant attributes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Assessing the Crop-Water Status in Almond (Prunus dulcis Mill.) Trees via Thermal Imaging Camera Connected to Smartphone.

PubMed

García-Tejero, Iván Francisco; Ortega-Arévalo, Carlos José; Iglesias-Contreras, Manuel; Moreno, José Manuel; Souza, Luciene; Tavira, Simón Cuadros; Durán-Zuazo, Víctor Hugo

2018-03-31

Different tools are being implemented in order to improve the water management in agricultural irrigated areas of semiarid environments. Thermography has been progressively introduced as a promising technique for irrigation scheduling and the assessing of crop-water status, especially when deficit irrigation is being implemented. However, an important limitation is related to the cost of the actual cameras, this being a severe limitation to its practical usage by farmers and technicians. This work evaluates the potential and the robustness of a thermal imaging camera that is connected to smartphone (Flir One) recently developed by Flir Systems Inc. as a first step to assess the crop water status. The trial was developed in mature almond ( Prunus dulcis Mill.) trees that are subjected to different irrigation treatments. Thermal information obtained by the Flir One camera was deal with the thermal information obtained with a conventional Thermal Camera (Flir SC660) with a high resolution, and subsequently, confronted with other related plant physiological parameters (leaf water potential, Ψ leaf , and stomatal conductance, g s ). Thermal imaging camera connected to smartphone provided useful information in estimating the crop-water status in almond trees, being a potential promising tool to accelerate the monitoring process and thereby enhance water-stress management of almond orchards.

Assessing the Crop-Water Status in Almond (Prunus dulcis Mill.) Trees via Thermal Imaging Camera Connected to Smartphone

PubMed Central

García-Tejero, Iván Francisco; Ortega-Arévalo, Carlos José; Iglesias-Contreras, Manuel; Moreno, José Manuel; Souza, Luciene; Tavira, Simón Cuadros; Durán-Zuazo, Víctor Hugo

2018-01-01

Different tools are being implemented in order to improve the water management in agricultural irrigated areas of semiarid environments. Thermography has been progressively introduced as a promising technique for irrigation scheduling and the assessing of crop-water status, especially when deficit irrigation is being implemented. However, an important limitation is related to the cost of the actual cameras, this being a severe limitation to its practical usage by farmers and technicians. This work evaluates the potential and the robustness of a thermal imaging camera that is connected to smartphone (Flir One) recently developed by Flir Systems Inc. as a first step to assess the crop water status. The trial was developed in mature almond (Prunus dulcis Mill.) trees that are subjected to different irrigation treatments. Thermal information obtained by the Flir One camera was deal with the thermal information obtained with a conventional Thermal Camera (Flir SC660) with a high resolution, and subsequently, confronted with other related plant physiological parameters (leaf water potential, Ψleaf, and stomatal conductance, gs). Thermal imaging camera connected to smartphone provided useful information in estimating the crop-water status in almond trees, being a potential promising tool to accelerate the monitoring process and thereby enhance water-stress management of almond orchards. PMID:29614740

Therapeutic potency of saponin rich aqueous extract of Scoparia dulcis L. in alloxan induced diabetes in rats

PubMed Central

Perumal, P. Saravana; Anaswara, P. V.; Muthuraman, A.; Krishan, S.

2014-01-01

Background: Diabetes mellitus is major metabolic disorders of carbohydrate metabolism. This leads to alter the multiple organ system. Aims: To investigate the antidiabetic and antioxidant effects of the saponin rich aqueous extract of Scoparia dulcis (SRE-SD) using alloxan-induced hyperglycemic rat model. Material and Methods: The single dose of alloxan was injected for the induction of diabetes in rats. The SRE-SD and glibenclamide were administered for 15 consecutive days from the 3rd day of alloxan administration. Quantity of food and water intake was measured at day 0, and 18. Further, body weight was recorded and blood samples were collected at different time intervals that is, day 0, 3, 8, 13, and 18. The oxidative biomarkers (i.e. thiobarbituric acid reactive substances (TBARS), reduced glutathione (GSH) and nitrite (NO2−) levels were also estimated in the serum sample. Results: The SRE-SD showed a remarkable dose and time-dependent changes in alloxan-induced rise in the level of food consumption and water intake, serum glucose level, TBARS, NO2− and fall in the level of GSH. Further, significant attenuation was observed at 20 and 30 mg/kg of SRE-SD treated group. Conclusions: These findings demonstrate that SRE-SD has both antidiabetic and antioxidant effects on the experimental model of diabetes in rat. PMID:25558170

Response of nitrogen and potassium fertigation to "Waris" almond (Prunus dulcis) under northwestern Himalayan Region of India.

PubMed

Kumar, Dinesh; Ahmed, N

2014-01-01

A field experiment was conducted on almond (Prunus dulcis) to study the effect of N&K fertigation on growth, yields and leaf nutrient status over two seasons (2011 and 2012) in Srinagar, Jammu and Kashmir, India. There were six treatments, namely, T1--100% recommended dose of fertilizers as soil application, T2--100% RDF through fertigations, T3--75% RDF through fertigation, T4--75% RDF through fertigation (split application), T5--50% RDF through fertigation and T6--50% RDF through fertigation (split application) with three replications under randomized block design. The results indicated that the maximum tree height (3.21 m and 3.56 m), nut weight (2.73 g and 1.94 g), nut yield (2.41 kg/tree and 5.98 kg/tree; 2.67 t/ha and 6.64 t/ha), and leaf nutrient content (2.34 and 2.38% N; 0.14 and 0.17% P; 1.37 and 1.41% K) were recorded in T4 treatment, whereas the highest TCSA of main trunk, primary, secondary, and tertiary branches (72.67 and 90.28 cm(2); 16.75 and 24.26 cm(2); 3.83 and 7.49 cm(2); 0.47 and 1.23 cm(2)), canopy volume (7.15 and 8.11 m(3)), and fruit number (990 and 3083/tree) were recorded in T2 in almond variety Waris.

Chemical composition and functional properties of gum exudates from the trunk of the almond tree (Prunus dulcis).

PubMed

Mahfoudhi, N; Chouaibi, M; Donsì, F; Ferrari, G; Hamdi, S

2012-06-01

The physicochemical components and functional properties of the gum exudates from the trunk of the almond tree (Prunus dulcis) have been investigated, along with the emulsification and foaming properties. The gum exudates are composed on dry weight basis by 2.45% of proteins, 0.85% of fats and 92.36% of carbohydrates. The latter consist of arabinose, xylitol, galactose and uronic acid (46.8 : 10.9 : 35.5 : 6.0 mass ratio) with traces of rhamnose, mannose and glucose. Moreover, gum exudates are rich in minerals, such as sodium, potassium, magnesium, calcium and iron. The emulsifying capacity was studied for a 20% w/w olive oil in water emulsion as a function of gum concentration (from 3% to 12% w/w in the aqueous phase) as well as pH levels (from 3.0 to 10.0). The most stable and homogeneous emulsion was prepared with an 8% w/w aqueous almond gum solution at a pH between 5.0 and 8.0. In particular, for the same formulation, the emulsion processed by high pressure homogenization (5 passes at 200 MPa) resulted to be extremely stable under accelerated ageing, exhibiting no significant change in droplet size distribution for 14 days at 55 °C. All the tested systems exhibited an extremely low foaming capacity.

Hepatoprotective effect of Scoparia dulcis on carbon tetrachloride induced acute liver injury in mice.

PubMed

Tsai, Jen-Chieh; Peng, Wen-Huang; Chiu, Tai-Hui; Huang, Shun-Chieh; Huang, Tai-Hung; Lai, Shang-Chih; Lai, Zhen-Rung; Lee, Chao-Ying

2010-01-01

This study aims to investigate the hepatoprotective activity and active constituents of the ethanol extract of Scoparia dulcis (SDE). The hepatoprotective effect of SDE (0.1, 0.5 and 1 g/kg) was evaluated on the carbon tetrachloride (CCl(4))-induced acute liver injury. The active constituents were detected by high performance liquid chromatography (HPLC). Mice pretreated orally with SDE (0.5 and 1.0 g/kg) and silymarin (200 mg/kg) for five consecutive days before the administering of a single dose of 0.2% CCl(4) (10 ml/kg of bw, ip) showed a significant inhibition of the increase of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Histological analyses also showed that SDE (0.5 and 1.0 g/kg) and silymarin reduced the extent of liver lesions induced by CCl(4), including vacuole formation, neutrophil infiltration and necrosis. Moreover, SDE decreased the malondialdehyde (MDA) level and elevated the content of reduced glutathione (GSH) in the liver as compared to those in the CCl(4) group. Furthermore, SDE (0.5 and 1.0 g/kg) enhanced the activities of anti-oxidative enzymes including superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione reductase (GRd) and glutathione-S-transferase (GST). The quantities of active constituents in SDE were about 3.1 mg luteolin/g extract and 1.1 mg apigenin/g extract. The hepatoprotective mechanisms of SDE were likely associated to the decrease in MDA level and increase in GSH level by increasing the activities of antioxidant enzymes such as SOD, GPx, GRd and GST. These results demonstrated that SDE could alleviate CCl(4)-induced acute liver injury in mice.

Anti-steatotic and anti-inflammatory effects of Hovenia dulcis Thunb. extracts in chronic alcohol-fed rats.

PubMed

Choi, Ra-Yeong; Woo, Moon-Jae; Ham, Ju Ri; Lee, Mi-Kyung

2017-06-01

The anti-steatotic and anti-inflammatory effects of fruit water extract (FW) and seed ethanol extract (SE) of Hovenia dulcis Thunb. in chronic alcohol-fed rats were investigated. Rats were fed a liquid diet containing 36% calories from alcohol and orally administered FW or SE (300 and 500mg/kg/day). Both FW and SE reduced hepatic lipid contents and droplets, serum lipid concentration and inflammatory markers (hs-CRP, TNF-α and IL-6) levels compared with the alcohol control group. Alcohol led to significant decreases in the hepatic fatty acid oxidative gene (Ppargc1a, Cpt1a and Acsl1) levels, while it significantly increased the Myd88 and Tnfa gene levels. However, FW or SE supplementation significantly up-regulated gene expression of Ppargc1a, Ppara, Cpt1a and Acsl1, and down-regulated gene expression of Myd88, Tnfa and Crp compared with the alcohol control group. FW or SE supplementation also significantly decreased hepatic activities of fatty acid synthase and phosphatidate phosphohydrolase in chronic alcohol-fed rats. Plasma alcohol and acetaldehyde levels, hepatic enzyme activity and protein expression of CYP2E1 were lowered by FW or SE supplementation. These results indicate that both FW and SE play an important role in improvement of alcoholic hepatic steatosis and inflammation via regulation of lipid and inflammation metabolism. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Scopadulcic acid B, a new tetracyclic diterpenoid from Scoparia dulcis L. Its structure, H+, K(+)-adenosine triphosphatase inhibitory activity and pharmacokinetic behaviour in rats.

PubMed

Hayashi, T; Okamura, K; Kakemi, M; Asano, S; Mizutani, M; Takeguchi, N; Kawasaki, M; Tezuka, Y; Kikuchi, T; Morita, N

1990-10-01

The structure of scopadulcic acid B (2, SDB), a major ingredient of the Paraguayan herb "Typychá kuratũ" (Scoparia dulcis L.), was elucidated mainly by comparison of its spectral data with that of scopadulcic acid A (1). SDB inhibited both the K(+)-dependent adenosine triphosphatase (ATPase) activity of a hog gastric proton pump (H+, K(+)-ATPase) with a value of 20-30 microM for IC50 and proton transport into gastric vesicles. Pharmacokinetic studies of SDB in rats indicated that plasma SDB concentrations after i.v. injection of the sodium salt of SDB (SDB-Na) were described reasonably well by a two-compartment open model with Michaelis-Menten elimination kinetics. Plasma concentrations after oral administration of SDB-Na or SDB showed a much slower decline than what was expected following the i. v. study. It was suggested that the sustained plasma level of SDB after oral administration of SDB-Na or SDB was accounted for by relatively slow but efficient gastro-intestinal absorption in rats.

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

PubMed

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

A Comparison of Food-grade Folium mori (桑葉 Sāng Yè) Extract and 1-Deoxynojirimycin for Glycemic Control and Renal Function in Streptozotocin-induced Diabetic Rats

PubMed Central

Huang, Shiang-Suo; Yan, Yi-Hui; Ko, Chien-Hui; Chen, Ke-Ming; Lee, Shih-Chieh; Liu, Cheng-Tzu

2014-01-01

Folium mori (桑葉 Sāng Yè, leaf of Morus alba L.; FM) is known to possess hypoglycemic effects, and 1-deoxynojirimycin (1-DNJ) has been proposed as an important functional compound in FM. However, the hypoglycemic activity of purified 1-DNJ has been rarely studied. It is also not known how FM and 1-DNJ affect the development of DM nephropathy. This study compared the antidiabetic effect of a commercial FM product with that of purified 1-DNJ in streptozotocin-induced diabetic rats. Seven days after induction, the diabetic rats were gavaged with FM (1, 3, 10, and 30 mg/kg/day), 1-DNJ (30 mg/kg/day), or vehicle (distilled deionized water; 2 ml/kg/day) for 7 days. All doses of FM ameliorated fasting and post-prandial blood glucose concomitantly with an increase in peripheral and pancreatic levels of insulin and improved homeostasis model assessment (HOMA-IR) in diabetic rats in a dose-dependent manner. Increased thiobarbituric acid reactive substances (TBARS) and nitrate/nitrite levels in the kidney, liver, and muscle of diabetic rats were reversed by all doses of FM. The renal function of the diabetic rats was normalized by all doses of FM, while blood pressure changes were reversed by FM at doses of 3 mg/kg and above. Moreover, most of the above-mentioned parameters were improved by FM at doses of 3 mg/kg and above to a similar extent as that of 1-DNJ. The results showed superior antidiabetic potential of the commercial FM product for glycemic control and protection against the development of diabetic nephropathy. PMID:25161921

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

2008-07-09

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

Purification, structure and immunobiological activity of an arabinan-rich pectic polysaccharide from the cell walls of Prunus dulcis seeds.

PubMed

Dourado, Fernando; Madureira, Pedro; Carvalho, Vera; Coelho, Ricardo; Coimbra, Manuel A; Vilanova, Manuel; Mota, Manuel; Gama, Francisco M

2004-10-20

The structure and bioactivity of a polysaccharide extracted and purified from a 4M KOH + H3BO3 solution from Prunus dulcis seed cell wall material was studied. Anion-exchange chromatography of the crude extract yielded two sugar-rich fractions: one neutral (A), the other acidic (E). These fractions contain a very similar monosaccharide composition: 5:2:1 for arabinose, uronic acids and xylose, respectively, rhamnose and galactose being present in smaller amounts. As estimated by size-exclusion chromatography, the acidic fraction had an apparent molecular mass of 762 kDa. Methylation analysis (from the crude and fractions A and E), suggests that the polysaccharide is an arabinan-rich pectin. In all cases, the polysaccharides bear the same type of structural Ara moieties with highly branched arabinan-rich pectic polysaccharides. The average relative proportions of the arabinosyl linkages is 3:2:1:1 for T-Araf:(1-->5)-Araf:(1-->3,5)-Araf:(1-->2,3,5)-Araf. The crude polysaccharide extract and fractions A and E induced a murine lymphocyte stimulatory effect, as evaluated by the in vitro and in vivo expression of lymphocyte activation markers and spleen mononuclear cells culture proliferation. The lymphocyte stimulatory effect was stronger on B- than on T-cells. No evidence of cytotoxic effects induced by the polysaccharide fractions was found.

[Effects of three traditional Chinese medicine with pungent-flavor, warm-nature and meridian tropism in lung on lung-yang deficiency rats induced by compound factors].

PubMed

Chen, Suhong; Lv, Guiyuan; Huang, Mincong; Su, Jie; Fang, Hui; Mou, Xiuhua

2011-06-01

To observe the effects of three traditional Chinese medicine (TCM) such as Amomi Fructus Rotundus, Perillae Folium and Angelicae Dahuricae Radix on lung-yang deficiency rats induced by compound factors. Lung-yang deficiency rats were established with three-factor combination, such as smoking (exogenous evil effect on lung), swimming in common and ice water (cold body and exhaustoin) and drinking ice water (inhale cold). Meanwhile, rats were given water extracts of the three TCM by intragastric administration for 24 days everyday. Indexes such as general behavior, weight, rectal temperature, back temperature and grip strength were observed. Blood was collected to determine NO, IgG in blood serum. Lung and heart were dissected to measure organs index. The water extracts of Amomi Fructrs Rotundus, Perillae Folium and Angelicae Dahuricae Radix could markedly heighten weight, back temperature, grip strength, content of IgG in blood serum, reduce content of NO in blood serum, lung index and heart index. The water extracts of Amomi Fructrs Rotundus and Perillae Folium could heighten rectal temperature. Amomi Fructrs Rotundus, Perillae Folium and Angelicae Dahuricae Radix were TCM with pungent-flavor, warm-nature and meridian tropism in lung, which could improve the symptoms of physique emaciation, aversion to cold of the back, weary and acratia and so on. It provides an important reference for the regularity of the properties theories about pungent-flavor, warm-nature and meridian tropism in lung.

Characterization of two geraniol synthases from Valeriana officinalis and Lippia dulcis: similar activity but difference in subcellular localization.

PubMed

Dong, Lemeng; Miettinen, Karel; Goedbloed, Miriam; Verstappen, Francel W A; Voster, Alessandra; Jongsma, Maarten A; Memelink, Johan; van der Krol, Sander; Bouwmeester, Harro J

2013-11-01

Two geraniol synthases (GES), from Valeriana officinalis (VoGES) and Lippia dulcis (LdGES), were isolated and were shown to have geraniol biosynthetic activity with Km values of 32 µM and 51 µM for GPP, respectively, upon expression in Escherichia coli. The in planta enzymatic activity and sub-cellular localization of VoGES and LdGES were characterized in stable transformed tobacco and using transient expression in Nicotiana benthamiana. Transgenic tobacco expressing VoGES or LdGES accumulate geraniol, oxidized geraniol compounds like geranial, geranic acid and hexose conjugates of these compounds to similar levels. Geraniol emission of leaves was lower than that of flowers, which could be related to higher levels of competing geraniol-conjugating activities in leaves. GFP-fusions of the two GES proteins show that VoGES resides (as expected) predominantly in the plastids, while LdGES import into to the plastid is clearly impaired compared to that of VoGES, resulting in both cytosolic and plastidic localization. Geraniol production by VoGES and LdGES in N. benthamiana was nonetheless very similar. Expression of a truncated version of VoGES or LdGES (cytosolic targeting) resulted in the accumulation of 30% less geraniol glycosides than with the plastid targeted VoGES and LdGES, suggesting that the substrate geranyl diphosphate is readily available, both in the plastids as well as in the cytosol. The potential role of GES in the engineering of the TIA pathway in heterologous hosts is discussed. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Response of Nitrogen and Potassium Fertigation to “Waris” Almond (Prunus dulcis) under Northwestern Himalayan Region of India

PubMed Central

Ahmed, N.

2014-01-01

A field experiment was conducted on almond (Prunus dulcis) to study the effect of N&K fertigation on growth, yields and leaf nutrient status over two seasons (2011 and 2012) in Srinagar, Jammu and Kashmir, India. There were six treatments, namely, T1—100% recommended dose of fertilizers as soil application, T2—100% RDF through fertigations, T3—75% RDF through fertigation, T4—75% RDF through fertigation (split application), T5—50% RDF through fertigation and T6—50% RDF through fertigation (split application) with three replications under randomized block design. The results indicated that the maximum tree height (3.21 m and 3.56 m), nut weight (2.73 g and 1.94 g), nut yield (2.41 kg/tree and 5.98 kg/tree; 2.67 t/ha and 6.64 t/ha), and leaf nutrient content (2.34 and 2.38% N; 0.14 and 0.17% P; 1.37 and 1.41% K) were recorded in T4 treatment, whereas the highest TCSA of main trunk, primary, secondary, and tertiary branches (72.67 and 90.28 cm2; 16.75 and 24.26 cm2; 3.83 and 7.49 cm2; 0.47 and 1.23 cm2), canopy volume (7.15 and 8.11 m3), and fruit number (990 and 3083/tree) were recorded in T2 in almond variety Waris. PMID:24587708

Are extraction methods in quantitative assays of pharmacopoeia monographs exhaustive? A comparison with pressurized liquid extraction.

PubMed

Basalo, Carlos; Mohn, Tobias; Hamburger, Matthias

2006-10-01

The extraction methods in selected monographs of the European and the Swiss Pharmacopoeia were compared to pressurized liquid extraction (PLE) with respect to the yield of constituents to be dosed in the quantitative assay for the respective herbal drugs. The study included five drugs, Belladonnae folium, Colae semen, Boldo folium, Tanaceti herba and Agni casti fructus. They were selected to cover different classes of compounds to be analyzed and different extraction methods to be used according to the monographs. Extraction protocols for PLE were optimized by varying the solvents and number of extraction cycles. In PLE, yields > 97 % of extractable analytes were typically achieved with two extraction cycles. For alkaloid-containing drugs, the addition of ammonia prior to extraction significantly increased the yield and reduced the number of extraction cycles required for exhaustive extraction. PLE was in all cases superior to the extraction protocol of the pharmacopoeia monographs (taken as 100 %), with differences ranging from 108 % in case of parthenolide in Tanaceti herba to 343 % in case of alkaloids in Boldo folium.

Knowledge Representation and Natural-Language Semantics.

DTIC Science & Technology

1986-11-07

involving things ( Wittgenstein spoke of facts or states-of-affairs) that represent. Thus, it is not the hydrangea that carries information, it is the...assuming certain conditions on a’s utterance-roughly, that it be intentional.) Let’s connect this bit of wisdom with that coming from Wittgenstein . In

[Review for treatment effect and signaling pathway regulation of kidney-tonifying traditional Chinese medicine on osteoporosis].

PubMed

Xiao, Ya-Ping; Zeng, Jie; Jiao, Lin-Na; Xu, Xiao-Yu

2018-01-01

The treatment effect and signaling pathway regulation effects of kidney-tonifying traditional Chinese medicine on osteoporosis have been widely studied, but there is no systematic summary currently. This review comprehensively collected and analyzed the traditional Chinese medicines on the treatment and signaling pathway regulation of osteoporosis in recent ten years, such as Epimedii Folium, Drynariae Rhizoma, Cnidii Fructus, Eucommiae Cortex, Psoraleae Fructus and Dipsaci Radix. Based on the existing findings, the following conclusions were obtained: ①kidney-tonifying traditional Chinese medicine treated osteoporosis mainly through BMP-Smads, Wnt/ β -catenin, MAPK, PI3K/AKT signaling pathway to promote osteoblast bone formation and through OPG/RANKL/ RANK, estrogen, CTSK signaling pathway to inhibit osteoclasts of bone resorption. Epimedii Folium, Drynariae Rhizoma, Cnidii Fructus and Psoraleae Fructus up-regulated the expression of key proteins and genes of BMP-Smads and Wnt/ β -catenin signaling pathways to promote bone formation. Epimedii Folium, Drynariae Rhizoma, Cnidii Fructus, Eucommiae Cortex, Psoraleae Fructus and Dipsaci Radix inhibited the bone resorption by mediating the OPG/RANKL/RANK signaling pathway. ②Kidney-tonifying traditional Chinese medicine prevented and treated osteoporosis through a variety of ways: icariin in Epimedii Folium, naringin in Drynariae Rhizoma, osthole in Cnidii Fructus and psoralen in Psoraleae Fructus can regulate BMP-Smads, Wnt/ β -catenin signaling pathway to promote bone formation, but also activate OPG/RANKL/RANK, CTSK and other signaling pathways to inhibit bone resorption. ③The crosstalk of the signaling pathways and the animal experiments of the traditional Chinese medicine on the prevention and treatment of osteoporosis as well as their multi-target mechanism and comprehensive regulation need further clarification. Copyright© by the Chinese Pharmaceutical Association.

Integrated strategy for identifying minor components in complex samples combining mass defect, diagnostic ions and neutral loss information based on ultra-performance liquid chromatography-high resolution mass spectrometry platform: Folium Artemisiae Argyi as a case study.

PubMed

Ren, Dabing; Ran, Lu; Yang, Chong; Xu, Meilin; Yi, Lunzhao

2018-05-18

Ultra-performance liquid chromatography coupled to high-resolution mass spectrometry (UPLC-HRMS) has been used as a powerful tool to profile chemicals in traditional Chinese medicines. However, identification of potentially bioactive compounds is still a challenging work because of the large amount of information contained in the raw UPLC-HRMS data. Especially the ubiquitous matrix interference makes it more difficult to characterize the minor components. Therefore, rapid recognition and efficient extraction of the corresponding parent ions is critically important for identifying the attractive compounds in complex samples. Herein, we propose an integrated filtering strategy to remove un-related or interference MS 1 ions from the raw UPLC-HRMS data, which helps to retain the MS features of the target components and expose the compounds of interest as effective as possible. The proposed strategy is based on the use of a combination of different filtering methods, including nitrogen rule, mass defect, and neutral loss/diagnostic fragment ions filtering. The strategy was validated by rapid screening and identification of 16 methoxylated flavonoids and 55 chlorogenic acids analogues from the raw UPLC-HRMS dataset of Folium Artemisiae Argyi. Particularly, successful detection of several minor components indicated that the integrated strategy has obvious advantages over individual filtering methods, and it can be used as a promising method for screening and identifying compounds from complex samples, such as herbal medicines. Copyright © 2018 Elsevier B.V. All rights reserved.

Scopadulciol, Isolated from Scoparia dulcis, Induces β-Catenin Degradation and Overcomes Tumor Necrosis Factor-Related Apoptosis Ligand Resistance in AGS Human Gastric Adenocarcinoma Cells.

PubMed

Fuentes, Rolly G; Toume, Kazufumi; Arai, Midori A; Sadhu, Samir K; Ahmed, Firoj; Ishibashi, Masami

2015-04-24

Scopadulciol (1), a scopadulan-type diterpenoid, was isolated from Scoparia dulcis along with three other compounds (2-4) by an activity-guided approach using the TCF reporter (TOP) luciferase-based assay system. A fluorometric microculture cytotoxicity assay (FMCA) revealed that compound 1 was cytotoxic to AGS human gastric adenocarcinoma cells. The treatment of AGS cells with 1 decreased β-catenin levels and also inhibited its nuclear localization. The pretreatment of AGS cells with a proteasome inhibitor, either MG132 or epoxomicin, protected against the degradation of β-catenin induced by 1. The 1-induced degradation of β-catenin was also abrogated in the presence of pifithrin-α, an inhibitor of p53 transcriptional activity. Compound 1 inhibited TOP activity in AGS cells and downregulated the protein levels of cyclin D1, c-myc, and survivin. Compound 1 also sensitized AGS cells to tumor necrosis factor-related apoptosis ligand (TRAIL)-induced apoptosis by increasing the levels of the death receptors, DR4 and DR5, and decreasing the level of the antiapoptotic protein Bcl-2. Collectively, our results demonstrated that 1 induced the p53- and proteasome-dependent degradation of β-catenin, which resulted in the inhibition of TCF/β-catenin transcription in AGS cells. Furthermore, 1 enhanced apoptosis in TRAIL-resistant AGS when combined with TRAIL.

De novo transcriptome assembly and comparative analysis of differentially expressed genes in Prunus dulcis Mill. in response to freezing stress.

PubMed

Mousavi, Sadegh; Alisoltani, Arghavan; Shiran, Behrouz; Fallahi, Hossein; Ebrahimie, Esameil; Imani, Ali; Houshmand, Saadollah

2014-01-01

Almond (Prunus dulcis Mill.), one of the most important nut crops, requires chilling during winter to develop fruiting buds. However, early spring chilling and late spring frost may damage the reproductive tissues leading to reduction in the rate of productivity. Despite the importance of transcriptional changes and regulation, little is known about the almond's transcriptome under the cold stress conditions. In the current research, we used RNA-seq technique to study the response of the reproductive tissues of almond (anther and ovary) to frost stress. RNA sequencing resulted in more than 20 million reads from anther and ovary tissues of almond, individually. About 40,000 contigs were assembled and annotated de novo in each tissue. Profile of gene expression in ovary showed significant alterations in 5,112 genes, whereas in anther 6,926 genes were affected by freezing stress. Around two thousands of these genes were common altered genes in both ovary and anther libraries. Gene ontology indicated the involvement of differentially expressed (DE) genes, responding to freezing stress, in metabolic and cellular processes. qRT-PCR analysis verified the expression pattern of eight genes randomly selected from the DE genes. In conclusion, the almond gene index assembled in this study and the reported DE genes can provide great insights on responses of almond and other Prunus species to abiotic stresses. The obtained results from current research would add to the limited available information on almond and Rosaceae. Besides, the findings would be very useful for comparative studies as the number of DE genes reported here is much higher than that of any previous reports in this plant.

De Novo Transcriptome Assembly and Comparative Analysis of Differentially Expressed Genes in Prunus dulcis Mill. in Response to Freezing Stress

PubMed Central

Shiran, Behrouz; Fallahi, Hossein; Ebrahimie, Esameil; Imani, Ali; Houshmand, Saadollah

2014-01-01

Almond (Prunus dulcis Mill.), one of the most important nut crops, requires chilling during winter to develop fruiting buds. However, early spring chilling and late spring frost may damage the reproductive tissues leading to reduction in the rate of productivity. Despite the importance of transcriptional changes and regulation, little is known about the almond’s transcriptome under the cold stress conditions. In the current reserch, we used RNA-seq technique to study the response of the reporuductive tissues of almond (anther and ovary) to frost stress. RNA sequencing resulted in more than 20 million reads from anther and ovary tissues of almond, individually. About 40,000 contigs were assembled and annotated de novo in each tissue. Profile of gene expression in ovary showed significant alterations in 5,112 genes, whereas in anther 6,926 genes were affected by freezing stress. Around two thousands of these genes were common altered genes in both ovary and anther libraries. Gene ontology indicated the involvement of differentially expressed (DE) genes, responding to freezing stress, in metabolic and cellular processes. qRT-PCR analysis verified the expression pattern of eight genes randomley selected from the DE genes. In conclusion, the almond gene index assembled in this study and the reported DE genes can provide great insights on responses of almond and other Prunus species to abiotic stresses. The obtained results from current research would add to the limited available information on almond and Rosaceae. Besides, the findings would be very useful for comparative studies as the number of DE genes reported here is much higher than that of any previous reports in this plant. PMID:25122458

Evaluation of the chemical and nutritional characteristics of almonds (Prunus dulcis (Mill). D.A. Webb) as influenced by harvest time and cultivar.

PubMed

Summo, Carmine; Palasciano, Marino; De Angelis, Davide; Paradiso, Vito M; Caponio, Francesco; Pasqualone, Antonella

2018-04-30

Several authors studied the effect of harvest time on chemical and nutritional composition of almonds, but the results are partly conflicting, probably due to differences in the cultivars considered and to different agronomic and climatic conditions in the growing areas. In this paper the influence of harvest time and cultivar on the chemical and nutritional composition of almonds (Prunus dulcis (Mill). D.A. Webb) was evaluated. Ten cultivars were considered, grown in the same orchard and subjected to the same agronomical regime. Almonds were collected at two different harvest times: i) when the fruits were unripe, but already edible, and showed green and moist hull, and ii) when the fruits were ripe, with dry brown hull. The analyses of proximate composition, fatty acid profile, total phenolic compounds and antioxidant activity were carried out. Lipid content increased (p<0.001) during ripening, while both protein and carbohydrate content decreased (p<0.01). Fatty acid composition showed a not univocal behavior during ripening and was highly influenced by cultivar. Total phenolic compounds and antioxidant activity varied among cultivars but increased during ripening with the exception of Marcona cv. Genco and Francolì cvs were found to be phenolic-rich cultivars. Harvest time and cultivars significantly influenced the chemical and nutritional composition of almonds. Genotype strongly influenced fatty acid composition and total phenolic compounds. The changes of bioactive compounds and antioxidant activity suggest that the synthesis of antioxidants occur also in the last stage of ripening. Unripe almonds, a valuable niche product, showed interesting nutritional value. This article is protected by copyright. All rights reserved.

Crosslinked enzyme aggregates of hydroxynitrile lyase partially purified from Prunus dulcis seeds and its application for the synthesis of enantiopure cyanohydrins.

PubMed

Yildirim, Deniz; Tükel, S Seyhan; Alagöz, Dilek

2014-01-01

Hydroxynitrile lyases are powerful catalysts in the synthesis of enantiopure cyanohydrins which are key synthons in the preparations of a variety of important chemicals. The response surface methodology including three-factor and three-level Box-Behnken design was applied to optimize immobilization of hydroxynitrile lyase purified partially from Prunus dulcis seeds as crosslinked enzyme aggregates (PdHNL-CLEAs). The quadratic model was developed for predicting the response and its adequacy was validated with the analysis of variance test. The optimized immobilization parameters were initial glutaraldehyde concentration, ammonium sulfate saturation concentration, and crosslinking time, and the response was relative activity of PdHNL-CLEA. The optimal conditions were determined as initial glutaraldehyde concentration of 25% w/v, ammonium sulfate saturation concentration of 43% w/v, and crosslinking time of 18 h. The preparations of PdHNL-CLEA were examined for the synthesis of (R)-mandelonitrile, (R)-2-chloromandelonitrile, (R)-3,4-dihydroxymandelonitrile, (R)-2-hydroxy-4-phenyl butyronitrile, (R)-4-bromomandelonitrile, (R)-4-fluoromandelonitrile, and (R)-4-nitromandelonitrile from their corresponding aldehydes and hydrocyanic acid. After 96-h reaction time, the yield-enantiomeric excess values (%) were 100-99, 100-21, 100-99, 83-91, 100-99, 100-72, and 100-14%, respectively, for (R)-mandelonitrile, (R)-2-chloromandelonitrile, (R)-3,4-dihydroxymandelonitrile, (R)-2-hydroxy-4-phenyl butyronitrile, (R)-4-bromomandelonitrile, (R)-4-fluoromandelonitrile, and (R)-4-nitromandelonitrile. The results show that PdHNL-CLEA offers a promising potential for the preparation of enantiopure (R)-mandelonitrile, (R)-3,4-dihydroxymandelonitrile, (R)-2-hydroxy-4-phenyl butyronitrile, and (R)-4-bromomandelonitrile with a high yield and enantiopurity. © 2014 American Institute of Chemical Engineers.

Differences in proleptic and epicormic shoot structures in relation to water deficit and growth rate in almond trees (Prunus dulcis)

PubMed Central

Negrón, Claudia; Contador, Loreto; Lampinen, Bruce D.; Metcalf, Samuel G.; Guédon, Yann; Costes, Evelyne; DeJong, Theodore M.

2014-01-01

Background and Aims Shoot characteristics differ depending on the meristem tissue that they originate from and environmental conditions during their development. This study focused on the effects of plant water status on axillary meristem fate and flowering patterns along proleptic and epicormic shoots, as well as on shoot growth rates on ‘Nonpareil’ almond trees (Prunus dulcis). The aims were (1) to characterize the structural differences between proleptic and epicormic shoots, (2) to determine whether water deficits modify shoot structures differently depending on shoot type, and (3) to determine whether shoot structures are related to shoot growth rates. Methods A hidden semi-Markov model of the axillary meristem fate and number of flower buds per node was built for two shoot types growing on trees exposed to three plant water status treatments. The models segmented observed shoots into successive homogeneous zones, which were compared between treatments. Shoot growth rates were calculated from shoot extension measurements made during the growing season. Key Results Proleptic shoots had seven successive homogeneous zones while epicormic shoots had five zones. Shoot structures were associated with changes in growth rate over the season. Water deficit (1) affected the occurrence and lengths of the first zones of proleptic shoots, but only the occurrence of the third zone was reduced in epicormic shoots; (2) had a minor effect on zone flowering patterns and did not modify shoot or zone composition of axillary meristem fates; and (3) reduced growth rates, although patterns over the season were similar among treatments. Conclusions Two meristem types, with different latency durations, produced shoots with different growth rates and distinct structures. Differences between shoot type structure responses to water deficit appeared to reflect their ontogenetic characteristics and/or resource availability for their development. Tree water deficit appeared to stimulate

Differences in proleptic and epicormic shoot structures in relation to water deficit and growth rate in almond trees (Prunus dulcis).

PubMed

Negrón, Claudia; Contador, Loreto; Lampinen, Bruce D; Metcalf, Samuel G; Guédon, Yann; Costes, Evelyne; DeJong, Theodore M

2014-02-01

Shoot characteristics differ depending on the meristem tissue that they originate from and environmental conditions during their development. This study focused on the effects of plant water status on axillary meristem fate and flowering patterns along proleptic and epicormic shoots, as well as on shoot growth rates on 'Nonpareil' almond trees (Prunus dulcis). The aims were (1) to characterize the structural differences between proleptic and epicormic shoots, (2) to determine whether water deficits modify shoot structures differently depending on shoot type, and (3) to determine whether shoot structures are related to shoot growth rates. A hidden semi-Markov model of the axillary meristem fate and number of flower buds per node was built for two shoot types growing on trees exposed to three plant water status treatments. The models segmented observed shoots into successive homogeneous zones, which were compared between treatments. Shoot growth rates were calculated from shoot extension measurements made during the growing season. Proleptic shoots had seven successive homogeneous zones while epicormic shoots had five zones. Shoot structures were associated with changes in growth rate over the season. Water deficit (1) affected the occurrence and lengths of the first zones of proleptic shoots, but only the occurrence of the third zone was reduced in epicormic shoots; (2) had a minor effect on zone flowering patterns and did not modify shoot or zone composition of axillary meristem fates; and (3) reduced growth rates, although patterns over the season were similar among treatments. Two meristem types, with different latency durations, produced shoots with different growth rates and distinct structures. Differences between shoot type structure responses to water deficit appeared to reflect their ontogenetic characteristics and/or resource availability for their development. Tree water deficit appeared to stimulate a more rapid progression through ontogenetic states.

Endogenous hormones response to cytokinins with regard to organogenesis in explants of peach (Prunus persica L. Batsch) cultivars and rootstocks (P. persica × Prunus dulcis).

PubMed

Pérez-Jiménez, Margarita; Cantero-Navarro, Elena; Pérez-Alfocea, Francisco; Cos-Terrer, José

2014-11-01

Organogenesis in peach (Prunus persica L. Batsch) and peach rootstocks (P. persica × Prunus dulcis) has been achieved and the action of the regeneration medium on 7 phytohormones, zeatin (Z), zeatin riboside (ZR), indole-3-acetic acid (IAA), abscisic acid (ABA), ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC), salicylic acid (SA), and jasmonic acid (JA), has been studied using High performance liquid chromatography - mass spectrometry (HPLC-MS/MS). Three scion peach cultivars, 'UFO-3', 'Flariba' and 'Alice Bigi', and the peach × almond rootstocks 'Garnem' and 'GF677' were cultured in two different media, Murashige and Skoog supplemented with plant growth regulators (PGRs) (regeneration medium) and without PGRs (control medium), in order to study the effects of the media and/or genotypes in the endogenous hormones content and their role in organogenesis. The highest regeneration rate was obtained with the peach × almond rootstocks and showed a lower content of Z, IAA, ABA, ACC and JA. Only Z, ZR and IAA were affected by the action of the culture media. This study shows which hormones are external PGRs-dependent and what is the weight of the genotype and hormones in peach organogenesis that provide an avenue to manipulate in vitro organogenesis in peach. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Antimicrobial and antioxidant activities of Cortex Magnoliae Officinalis and some other medicinal plants commonly used in South-East Asia

PubMed Central

Chan, Lai Wah; Cheah, Emily LC; Saw, Constance LL; Weng, Wanyu; Heng, Paul WS

2008-01-01

Background Eight medicinal plants were tested for their antimicrobial and antioxidant activities. Different extraction methods were also tested for their effects on the bioactivities of the medicinal plants. Methods Eight plants, namely Herba Polygonis Hydropiperis (Laliaocao), Folium Murraya Koenigii (Jialiye), Rhizoma Arachis Hypogea (Huashenggen), Herba Houttuyniae (Yuxingcao), Epipremnum pinnatum (Pashulong), Rhizoma Typhonium Flagelliforme (Laoshuyu), Cortex Magnoliae Officinalis (Houpo) and Rhizoma Imperatae (Baimaogen) were investigated for their potential antimicrobial and antioxidant properties. Results Extracts of Cortex Magnoliae Officinalis had the strongest activities against M. Smegmatis, C. albicans, B. subtilis and S. aureus. Boiled extracts of Cortex Magnoliae Officinalis, Folium Murraya Koenigii, Herba Polygonis Hydropiperis and Herba Houttuyniae demonstrated greater antioxidant activities than other tested medicinal plants. Conclusion Among the eight tested medicinal plants, Cortex Magnoliae Officinalis showed the highest antimicrobial and antioxidant activities. Different methods of extraction yield different spectra of bioactivities. PMID:19038060

Quantifying dominance of intra-storm phase of interception process by small isolated canopies

NASA Astrophysics Data System (ADS)

Yerk, Walter; Montalto, Franco

2014-05-01

Precipitation interception by vegetation canopies has long been recognized as a major component of the hydrologic cycle; however, historically most research has been dedicated to closed or sparse canopy forests. The goal of our research was to quantify rainfall partitioning by small isolated canopies in an urban setting. The field experiment involved small forms of four shrub species (Prunus laurocerasus, Cornus sericea, Itea virginica and Hydrangea quercifolia) with crown heights 40 - 80 cm and diameters 35 - 60 cm. Each plant had ten rain gauges to measure throughfall with a sampling frequency of 5 seconds. An on-site automated weather station provided meteorological data. Leaf area index (LAI) was measured by manual counting. We estimated the canopy storage capacities of all four species to be less than 0.5 mm. The obtained data showed statistically significant differences in interception properties among all four species, except between Cornus and Itea. Cumulative interception loss for the period of August-December 2013 was 10% for Cornus, 16% for Itea, 29% for Hydrangea, and 49% for Prunus. The observations revealed a weak relationship between interception abilities and LAI for all four species. Throughfall and precipitation intensities (mm/hr) expressed very strong linear relationship (adjusted coefficients of determination were from 0.80 to 0.95) for the entire range of observed rainfall intensities. For Cornus the ratio of throughfall to precipitation intensity was close to 0.93:1, for Itea it was 0.82:1. The ratios were lesser for Hydrangea (0.65:1), and especially for Prunus (0.48:1). Therefore we show that reduced by the canopy, throughfall intensity results in the bulk of precipitation depth intercepted during the rain events. In contrast, the amount of water stored on the canopy and evaporated between and after rain events contributes minimally to interception. Simulations of potential evaporation based on the Penman-Monteith method showed a large

The connection between mass, environment, and slow rotation in simulated galaxies

NASA Astrophysics Data System (ADS)

Lagos, Claudia del P.; Schaye, Joop; Bahé, Yannick; Van de Sande, Jesse; Kay, Scott T.; Barnes, David; Davis, Timothy A.; Dalla Vecchia, Claudio

2018-06-01

Recent observations from integral field spectroscopy (IFS) indicate that the fraction of galaxies that are slow rotators (SRs), FSR, depends primarily on stellar mass, with no significant dependence on environment. We investigate these trends and the formation paths of SRs using the EAGLE and HYDRANGEA hydrodynamical simulations. EAGLE consists of several cosmological boxes of volumes up to (100 Mpc)^3, while HYDRANGEA consists of 24 cosmological simulations of galaxy clusters and their environment. Together they provide a statistically significant sample in the stellar mass range 10^{9.5}-10^{12.3} M_{⊙}, of 16 358 galaxies. We construct IFS-like cubes and measure stellar spin parameters, λR, and ellipticities, allowing us to classify galaxies into slow/fast rotators as in observations. The simulations display a primary dependence of FSR on stellar mass, with a weak dependence on environment. At fixed stellar mass, satellite galaxies are more likely to be SRs than centrals. FSR shows a dependence on halo mass at fixed stellar mass for central galaxies, while no such trend is seen for satellites. We find that ≈70 per cent of SRs at z = 0 have experienced at least one merger with mass ratio ≥0.1, with dry mergers being at least twice more common than wet mergers. Individual dry mergers tend to decrease λR, while wet mergers mostly increase it. However, 30 per cent of SRs at z = 0 have not experienced mergers, and those inhabit haloes with median spins twice smaller than the haloes hosting the rest of the SRs. Thus, although the formation paths of SRs can be varied, dry mergers and/or haloes with small spins dominate.

Inheritance of floral and plant size traits in hydrangea macrophylla

USDA-ARS?s Scientific Manuscript database

Transgressive segregation occurs when trait values for offspring in experimental crosses fall outside (either above or below) the range of values recorded for the parents. Transgressive segregation is important to plant breeders as a source of novel or extreme traits. While widespread, it is diffic...

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Hypoglycaemic activity of Scopariadulcis L. extract in alloxan induced hyperglycaemic rats.

PubMed

Pari, L; Venkateswaran, S

2002-11-01

Scoparia dulcis L. commonly known as 'Sweet Broomweed' is widely used in Indian folk medicine for the treatment of diabetes mellitus. Oral administration of 0.15, 0.30 and 0.45 g/kg body weight of the aqueous extract of the Scoparia dulcis leaves (SLEt) for 45 days resulted in a significant reduction in blood glucose, glycosylated haemoglobin and an increase in total haemoglobin but in the case of 0.45 g/kg body weight the effect was highly significant. The aqueous extract also prevented a decrease in the body weight. An oral glucose tolerance test was also performed in experimental diabetic rats, in which there was a significant improvement in glucose tolerance in animals treated with SLEt and the effect was comparable to that of glibenclamide. Copyright 2002 John Wiley & Sons, Ltd.

SDF7, a group of Scoparia dulcis Linn. derived flavonoid compounds, stimulates glucose uptake and regulates adipocytokines in 3T3-F442a adipocytes.

PubMed

Beh, Joo Ee; Khoo, Li Teng; Latip, Jalifah; Abdullah, Mohd Paud; Alitheen, Noorjahan Baru Mohamed; Adam, Zainah; Ismail, Amin; Hamid, Muhajir

2013-10-28

Adipocytes are major tissues involved in glucose uptake second to skeletal muscle and act as the main adipocytokines mediator that regulates glucose uptake mechanism and cellular differentiation. The objective of this study were to examine the effect of the SDF7, which is a fraction consists of four flavonoid compounds (quercetin: p-coumaric acid: luteolin: apigenin=8: 26: 1: 3) from Scoparia dulcis Linn., on stimulating the downstream components of insulin signalling and the adipocytokines expression on different cellular fractions of 3T3-F442a adipocytes. Morphology and lipid accumulation of differentiated 3T3-F442a adipocytes by 100 nM insulin treated with different concentrations of SDF7 and rosiglitazone were examined followed by the evaluation of glucose uptake activity expressions of insulin signalling downstream components (IRS-1, PI3-kinase, PKB, PKC, TC10 and GLUT4) from four cellular fractions (plasma membrane, cytosol, high density microsome and low density microsome). Next, the expression level of adipocytokines (TNF-α, adiponectin and leptin) and immunoblotting of treated 3T3-F442 adipocytes was determined at 30 min and 480 min. Glucose transporter 4 (GLUT4) translocation of 3T3-F442a adipocytes membrane was also determined. Lastly, mRNA expression of adiponectin and PPAR-γ of 3T3-F442a adipocytes were induced and compared with basal concentration. It was found that SDF7 was able to induce adipocytes differentiation with great extends of morphological changes, lipid synthesis and lipid stimulation in vitro. SDF7 stimulation of glucose transport on 3T3-F442a adipocytes are found to be dose independent, time-dependent and plasma membrane GLUT4 expression-dependent. Moreover, SDF7 are observed to be able to suppress TNF-α and leptin expressions that were mediated by 3T3-F442a adipocytes, while stimulated adiponectin secretion on the cells. There was a significant expression (p<0.01) of protein kinase C and small G protein TC10 on 3T3-F442a adipocytes

Evolutionary genomics of peach and almond domestication

USDA-ARS?s Scientific Manuscript database

The domesticated almond [Prunus dulcis (L.) Batsch] and peach [P. persica (Mill.) D. A. Webb] originate on opposite sides of Asia and were independently domesticated approximately 5000 years ago. While interfertile, they possess alternate mating systems and di er in a number of morphological and ph...

Leaching behavior of water-soluble carbohydrates from almond hulls

USDA-ARS?s Scientific Manuscript database

Over 58% of the dry matter content of the hulls from the commercial almond (Prunus dulcis (Miller) D.A. Webb) is soluble in warm water (50-70°C) extraction. The water-soluble extractables include useful amounts of fermentable sugars (glucose, fructose, sucrose), sugar alcohols (inositol and sorbito...

Which ornamental plant species effectively remove benzene from indoor air?

NASA Astrophysics Data System (ADS)

Liu, Yan-Ju; Mu, Yu-Jing; Zhu, Yong-Guan; Ding, Hui; Crystal Arens, Nan

Phytoremediation—using plants to remove toxins—is an attractive and cost effective way to improve indoor air quality. This study screened ornamental plants for their ability to remove volatile organic compounds from air by fumigating 73 plant species with 150 ppb benzene, an important indoor air pollutant that poses a risk to human health. The 10 species found to be most effective at removing benzene from air were fumigated for two more days (8 h per day) to quantify their benzene removal capacity. Crassula portulacea, Hydrangea macrophylla, Cymbidium Golden Elf., Ficus microcarpa var. fuyuensis, Dendranthema morifolium, Citrus medica var. sarcodactylis, Dieffenbachia amoena cv. Tropic Snow; Spathiphyllum Supreme; Nephrolepis exaltata cv. Bostoniensis; Dracaena deremensis cv. Variegata emerged as the species with the greatest capacity to remove benzene from indoor air.

Peduncles elicit large-mammal endozoochory in a dry-fruited plant

PubMed Central

Zhou, Youbing; Newman, Chris; Xie, Zongqiang; Macdonald, David W.

2013-01-01

Background and Aims Plants have evolved a variety of seed dispersal mechanisms to overcome lack of mobility. Many species embed seeds in fleshy pulp to elicit endozoochory, i.e. disseminating seed through the animal gut. In contrast to well-studied fleshy fruited plants, dry-fruited plants may exploit this dispersal mutualism by producing fleshy appendages as a nutritional reward to entice animals to swallow their diaspores, but this has been little studied. In this study, it is hypothesized that these accessory fruits represent co-adaptations facilitating the syndrome of mammalian endozoochorous dispersal. Methods Field observations (focal tree watches, faecal surveys and fruiting phenology) with experimental manipulations (examination of seed germination and feeding trials) were conducted over 2 years in a native population of the raisin tree, Hovenia dulcis, which produces enlarged, twisted brown peduncles with external black seeds, in central China. Key Results Birds were not observed to swallow seeds or carry infructescences away during 190 h of focal tree watches. However, H. dulcis seeds were detected in 247 faecal samples, representative of two herbivore and four carnivore mammalian species. Feeding trials revealed that peduncles attracted mammals to consume the entire infructescence, thereby facilitating effective seed dispersal. The germination rate of egested seeds proved higher than that of unconsumed seeds. It was also noted that this mutualism was most vulnerable in degraded forest. Conclusions Hovenia dulcis peduncle sets are confirmed to adapt primarily to mammalian endozoochory, a mutualistic association similar in function to fleshy pulp or foliage. This demonstrates that plant organ systems can be adapted to unique mutualisms that utilize animal dispersal agents. Such an ecological role has until now been attributed only to bird epizoochory. Future studies should consider more widely the putative role of peduncle sets and mammalian endozoochory

Summary Report on a Review of Biological Mechanisms for Application to Instrument Design

DTIC Science & Technology

1962-01-01

of which is far from being well understood. The variations in form and complexity of aural receptors among the phyla offer a broad source of...11. a-amirio acids are usuallv sweet (Cohn’s dulci ,.eni crouip C NH 2 3 and V-arniino acids are not usually sweet, particularly the latter. The

[The in vitro action of plants on Vibrio cholerae].

PubMed

Guevara, J M; Chumpitaz, J; Valencia, E

1994-01-01

Natural products of several plants, according to the geographic location, are used by Peruvian people in the popular treatment of diarrhea, with good success. When cholerae cases appeared in Peru, we were interested to know the "in vitro" effect against Vibrio cholerae 01, of these useful plants to treat diarrhea. The following plants were tested: Cichorium intybus, Althaea officinalis, Psorela glandulosa, Geranium maculatum, Punica granatum, Malus sativa, Cydonia oblonga, Chenopodium ambrosoides, Krameria triandria, Tea chinensis, Daucus carota, Persea gratissima, Psidium guayaba and Lippia dulcis. Decoction or infusion of the plants were used in the "in vitro" experiments. The following plants showed no "in vitro" effect against V. cholerae: Cichorium intybus, Althaea officinalis, Psorela glandulosa, Geranium maculatum, Chenopodium ambrosoides, Krameria triandria, Psidium guayaba, Lippia dulcis and Daucus carota. Decoction of Malus sativa and Cydenia oblonga showed bactericidal effect for their acidity and stone avocado (Persea gratissima) a late bactericidal effect. Tea infusión and the decoction of Punica granatum peel, showed the best bactericidal effect and we suggest to use them as to stop cholera spreading.

TNT removal from culture media by three commonly available wild plants growing in the Caribbean.

PubMed

Correa-Torres, Sandra N; Pacheco-Londoño, Leonardo C; Espinosa-Fuentes, Eduardo A; Rodríguez, Lolita; Souto-Bachiller, Fernando A; Hernández-Rivera, Samuel P

2012-01-01

Plants growing in the Caribbean, Rubia tinctorum, Lippia dulcis and Spermacoce remota, were used in vitro to remove TNT from culture media. Plants were found to be resistant to high TNT levels. S. remota was able to remove TNT in less than 48 h. Part of the TNT was physically removed from the culture media by evaporation.

Gene flow among wild and domesticated almond species: insights from chloroplast and nuclear markers

PubMed Central

Delplancke, Malou; Alvarez, Nadir; Espíndola, Anahí; Joly, Hélène; Benoit, Laure; Brouck, Elise; Arrigo, Nils

2012-01-01

Hybridization has played a central role in the evolutionary history of domesticated plants. Notably, several breeding programs relying on gene introgression from the wild compartment have been performed in fruit tree species within the genus Prunus but few studies investigated spontaneous gene flow among wild and domesticated Prunus species. Consequently, a comprehensive understanding of genetic relationships and levels of gene flow between domesticated and wild Prunus species is needed. Combining nuclear and chloroplastic microsatellites, we investigated the gene flow and hybridization among two key almond tree species, the cultivated Prunus dulcis and one of the most widespread wild relative Prunus orientalis in the Fertile Crescent. We detected high genetic diversity levels in both species along with substantial and symmetric gene flow between the domesticated P. dulcis and the wild P. orientalis. These results were discussed in light of the cultivated species diversity, by outlining the frequent spontaneous genetic contributions of wild species to the domesticated compartment. In addition, crop-to-wild gene flow suggests that ad hoc transgene containment strategies would be required if genetically modified cultivars were introduced in the northwestern Mediterranean. PMID:25568053

Role of scanning electron microscopy in identifying drugs used in medical practice.

PubMed

Fazil Marickar, Y M; Sylaja, N; Koshy, Peter

2009-10-01

Several plant preparations are administered for treatment of stone disease without scientific basis. This paper presents the results of in vitro and animal experimental studies using scanning electron microscopy (SEM) in the identification of the therapeutic properties of trial drugs in medicine. In the first set of the study, urinary crystals namely calcium oxalate monohydrate and calcium oxalate dehydrate were grown in six sets of Hane's tubes in silica gel medium. Trial drugs namely scoparia dulcis Lynn, musa sapiens and dolicos biflorus were incorporated in the gel medium to identify the dopant effect of the trial drugs on the size and extent of crystal column growth. The changes in morphology of crystals were studied using SEM. In the second set, six male Wistar rats each were calculogenised by administering sodium oxalate and ethylene glycol and diabetised using streptozotocin. The SEM changes of calculogenisation were studied. The rats were administered trial drugs before calculogenisation or after. The kidneys of the rats studied under the scanning electron microscope showed changes in tissue morphology and crystal deposition produced by calculogenisation and alterations produced by addition of trial drugs. The trial drugs produced changes in the pattern of crystal growth and in the crystal morphology of both calcium oxalate monohydrate and calcium oxalate dihydrate grown in vitro. Elemental distribution analysis showed that the crystal purity was not altered by the trial drugs. Scoparia dulcis Lynn was found to be the most effective anticalculogenic agent. Musa sapiens and dolicos biflorus were found to have no significant effect in inhibiting crystal growth. The kidneys of rats on calculogenisation showed different grades of crystals in the glomerulus and interstitial tissues, extrusion of the crystals into the tubular lumen, collodisation and tissue inflammatory cell infiltration. Scoparia dulcis Lynn exhibited maximum protector effect against the

Almond (Prunus dulcis L.) protein quality.

PubMed

Ahrens, Susan; Venkatachalam, Mahesh; Mistry, Anahita M; Lapsley, Karen; Sathe, Shridhar K

2005-09-01

Three marketing varieties of almonds; Carmel, Mission, and Nonpareil; were analyzed for proximate composition and protein nutritive quality. Moisture, lipids, protein, ash, sugars, and tannins ranges were 3.05-4.33%, 43.37-47.50%, 20.68-23.30%, 3.74-4.56%, 5.35-7.45%, and 0.12-0.18%, respectively. No detectable hemagglutinating and trypsin inhibitory activities were present in Carmel, Mission, and Nonpareil almonds. Amino acid analyses indicated the sulfur amino acids (methionine + cysteine), lysine, and threonine to be the first, second, and third limiting amino acids in almonds when compared to the recommended amino acid pattern for children 2-5-year old. However, compared to the recommended amino acid pattern for adults, sulfur amino acids were the only limiting amino acids in almonds tested. True Protein Digestibility (% TPD) values for Carmel, Mission, and Nonpareil were 88.55 +/- 1.26, 92.25 +/- 1.05, and 82.62 +/- 1.47, respectively. Protein Digestibility Corrected Amino Acid Scoring (PDCAAS) values suggested almond proteins to be of poor nutritional quality.

[Exploration of rapidly determining quality of traditional Chinese medicines by (NIR) spectroscopy based on internet sharing mode].

PubMed

Ni, Li-Jun; Luan, Shao-Rong; Zhang, Li-Guo

2016-10-01

Because of the numerous varieties of herbal species and active ingredients in the traditional Chinese medicine(TCM),the traditional methods employed could hardly satisfy the current determination requirements of TCM.The present work proposed an idea to realize rapid determination of the quality of TCM based on near infrared(NIR)spectroscopy and internet sharing mode. Low cost and portable multi-source composite spectrometer was invented by our group for in-site fast measurement of spectra of TCM samples. The database could be set up by sharing spectra and quality detection data of TCM samples among TCM enterprises based on the internet platform.A novel method called as keeping same relationship between X and Y space based on K nearest neighbors(KNN-KSR for short)was applied to predict the contents of effective compounds of the samples. In addition,a comparative study between KNN-KSR and partial least squares(PLS)was conducted. Two datasets were applied to validate above idea:one was about 58 Ginkgo Folium samples samples measured with four near-infrared spectroscopy instruments and two multi-source composite spectrometers,another one was about 80 corn samples available online measured with three NIR instruments. The results show that the KNN-KSR method could obtain more reliable outcomes without correcting spectrum.However transforming the PLS models to other instruments could hardly acquire better predictive results until spectral calibration is performed. Meanwhile,the similar analysis results of total flavonoids and total lactones of Ginkgo Folium samples are achieved on the multi-source composite spectrometers and near-infrared spectroscopy instruments,and the prediction results of KNN-KSR are better than PLS. The idea proposed in present study is in urgent need of more samples spectra, and then to be verified by more case studies. Copyright© by the Chinese Pharmaceutical Association.

Hernandulcin: an intensely sweet compound discovered by review of ancient literature.

PubMed

Compadre, C M; Pezzuto, J M; Kinghorn, A D; Kamath, S K

1985-01-25

Ancient Mexican botanical literature was systematically searched for new plant sources of intensely sweet substances. Lippia dulcis Trev., a sweet plant, emerged as a candidate for fractionation studies, and hernandulcin, a sesquiterpene, was isolated and judged by a human taste panel as more than 1000 times sweeter than sucrose. The structure of the sesquiterpene was determined spectroscopically and confirmed by chemical synthesis. Hernandulcin was nontoxic when administered orally to mice, and it did not induce bacterial mutation.

Oil from Tobacco Leaves: FOLIUM - Installation of Hydrocarbon Accumulating Pathways in Tobacco Leaves

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2012-01-01

PETRO Project: LBNL is modifying tobacco to enable it to directly produce fuel molecules in its leaves for use as a biofuel. Tobacco is a good crop for biofuels production because it is an outstanding biomass crop, has a long history of cultivation, does not compete with the national food supply, and is highly responsive to genetic manipulation. LBNL will incorporate traits for hydrocarbon biosynthesis from cyanobacteria and algae, and enhance light utilization and carbon uptake in tobacco, improving the efficiency of photosynthesis so more fuel can be produced in the leaves. The tobacco-generated biofuels can be processed for gasoline,more » jet fuel or diesel alternatives. LBNL is also working to optimize methods for planting, cultivating and harvesting tobacco to increase biomass production several-fold over the level of traditional growing techniques.« less

Preparative isolation of oligomeric procyanidins from Hawthorn (Crataegus spp.).

PubMed

Zumdick, S; Petereit, F; Luftmann, H; Hensel, A

2009-04-01

The oligomeric procyanidins (OPC) from Hawthorn leaves and flowers (Crataegi folium cum flore) are considered to be in part responsible for the cardiotonic clinical activity of the herbal material. Effective methods for rapid isolation of these heterogenous oligomeric clusters with defined molecular weight as reference compounds are not published until now. Therefore the water soluble fraction of an acetone/water (7 + 3) extract of Hawthorn leaves and flowers was fractionated by a combination of MPLC on RP-18 material and preparative HPLC using a diol stationary phase. This procedure resulted in the effective isolation of procyanidins with a distinct degree of polymerization (DP) from dimers DP2 up to tridecamers DP13. Exact mass measurements with negative ESI-TOF/MS were employed to confirm the respective structures of the isolated procyanidins.

Evaluation of enzymes inhibition activities of medicinal plant from Burkina Faso.

PubMed

Bangou, Mindiédiba Jean; Kiendrebeogo, Martin; Meda, Nâg-Tiero Roland; Coulibaly, Ahmed Yacouba; Compaoré, Moussa; Zeba, Boukaré; Millogo-Rasolodimby, Jeanne; Nacoulma, Odile Germaine

2011-01-15

The aim of the present study was to evaluate some enzymes inhibitory effects of 11 plant species belonging to 9 families from Burkina Faso. Methanolic extracts were used for their Glutathione-s-transferase (GST), Acetylcholinesterase (AChE), Carboxylesterase (CES) and Xanthine Oxidase (XO) inhibitory activities at final concentration of 100 microg mL(-1). The total phenolics, flavonoids and tannins were also determined spectrophotometrically using Folin-Ciocalteu, AlCl3 and ammonium citrate iron reagents, respectively. Among the 11 species tested, the best inhibitory percentages were found with Euphorbia hirta, Sclerocarya birrea and Scoparia dulcis (inhibition > 40%) followed by Annona senegalensis, Annona squamosa, Polygala arenaria and Ceratotheca sesamoides (inhibition > 25%). The best total phenolic and tannin contents were found with S. birrea with 56.10 mg GAE/100 mg extract and 47.75 mg TAE/100 mg extract, respectively. E hirta presented the higher total flavonoids (9.96 mg QE/100 mg extract). It's was found that Sclerocarya birrea has inhibited all enzymes at more than 30% and this activity is correlated to total tannins contents. Contrary to S. birrea, the enzymatic activities of E. hirta and S. dulcis are correlated to total flavonoids contents. Present findings suggest that the methanolic extracts of those plant species are potential inhibitors of GST, AChE, CES and XO and confirm their traditional uses in the treatment of mental disorders, gout, painful inflammations and cardiovascular diseases.

Observations on the sexual segment of the kidney of snakes with emphasis on ultrastructure in the yellow-bellied sea snake, Pelamis platurus.

PubMed

Sever, David M; Rheubert, Justin L; Gautreaux, Jillian; Hill, Toren G; Freeborn, Layla R

2012-05-01

The sexual segment of the kidney (SSK) is an accessory sex structure in male lizards and snakes (Squamata). We describe histology of the SSK in 12 species of snakes, including one from the basal Scolecophidia, Leptotyphlops dulcis, and from the more advanced Alethinophidia, species from the Acrochordidae (Acrochordus granulatus), Homalopsidae (Cerberus rynchops), Uropeltidae (Teretrurus sanguineus), and eight species from the Elapidae, including six species of sea snakes. We also describe the ultrastructure of the SSK of the sea snake, Pelamis platurus. The SSK of L. dulcis does not include the ureter but does include distal convoluted tubules (DCTs) and collecting ducts. In all other snakes examined, the SSK is limited to the DCTs and does not differ in histology by any consistent character. We found apparently mature individuals of several species with inactive SSKs. Hypertrophied SSKs give positive reactions for protein secretions but variable reactions for carbohydrates. Ultrastructure of the SSK of P. platurus reveals nuclei situated medially in the epithelium and mature electron dense secretory vacuoles in other areas of the cytoplasm. Product release is apocrine. Junctional complexes only occur at the luminal border, and intercellular canaliculi become widened and are open basally. No cytologically unique characters occur in the SSK of P. platurus. The ancestral condition of the SSK in squamates is the presence of simple columnar epithelium specialized for secretion of a protein + carbohydrate product that matures and is released seasonally. Copyright © 2012 Wiley Periodicals, Inc.

Stigma development and receptivity in almond (Prunus dulcis).

PubMed

Yi, Weiguang; Law, S Edward; McCoy, Dennis; Wetzstein, Hazel Y

2006-01-01

Fertilization is essential in almond production, and pollination can be limiting in production areas. This study investigated stigma receptivity under defined developmental stages to clarify the relationship between stigma morphology, pollen germination, tube growth and fruit set. Light and scanning electron microscopy were employed to examine stigma development at seven stages of flower development ranging from buds that were swollen to flowers in which petals were abscising. Flowers at different stages were hand pollinated and pollen germination and tube growth assessed. Artificial pollinations in the field were conducted to determine the effect of flower age on fruit set. Later stages of flower development exhibited greater stigma receptivity, i.e. higher percentages of pollen germination and more extensive tube growth occurred in older (those opened to the flat petal stage or exhibiting petal fall) than younger flowers. Enhanced stigma receptivity was associated with elongation of stigmatic papillae and increased amounts of stigmatic exudate that inundated papillae at later developmental stages. Field pollinations indicated that the stigma was still receptive and nut set was maintained in older flowers. Stigma receptivity in almond does not become optimal until flowers are past the fully open stage. The stigma is still receptive and fruit set is maintained in flowers even at the stage when petals are abscising. Strategies to enhance pollination and crop yield, including the timing and placement of honey bees, should consider the effectiveness of developmentally advanced flowers.

SSR allelic variation in almond (Prunus dulcis Mill.).

PubMed

Xie, Hua; Sui, Yi; Chang, Feng-Qi; Xu, Yong; Ma, Rong-Cai

2006-01-01

Sixteen SSR markers including eight EST-SSR and eight genomic SSRs were used for genetic diversity analysis of 23 Chinese and 15 international almond cultivars. EST- and genomic SSR markers previously reported in species of Prunus, mainly peach, proved to be useful for almond genetic analysis. DNA sequences of 117 alleles of six of the 16 SSR loci were analysed to reveal sequence variation among the 38 almond accessions. For the four SSR loci with AG/CT repeats, no insertions or deletions were observed in the flanking regions of the 98 alleles sequenced. Allelic size variation of these loci resulted exclusively from differences in the structures of repeat motifs, which involved interruptions or occurrences of new motif repeats in addition to varying number of AG/CT repeats. Some alleles had a high number of uninterrupted repeat motifs, indicating that SSR mutational patterns differ among alleles at a given SSR locus within the almond species. Allelic homoplasy was observed in the SSR loci because of base substitutions, interruptions or compound repeat motifs. Substitutions in the repeat regions were found at two SSR loci, suggesting that point mutations operate on SSRs and hinder the further SSR expansion by introducing repeat interruptions to stabilize SSR loci. Furthermore, it was shown that some potential point mutations in the flanking regions are linked with new SSR repeat motif variation in almond and peach.

Plants used in Guatemala for the treatment of gastrointestinal disorders. 3. Confirmation of activity against enterobacteria of 16 plants.

PubMed

Cáceres, A; Fletes, L; Aguilar, L; Ramirez, O; Figueroa, L; Taracena, A M; Samayoa, B

1993-01-01

Ethnobotanical surveys and literature review identified 408 plants used in Guatemala for the treatment of gastrointestinal disorders. The screening of 84 showed that 34 inhibit one or more enterobacteria; 16 of these were selected for further investigation. Extracts were obtained with three solvents of different polarity (n-hexane, acetone and alcohol) and the in vitro activity was demonstrated against enteropathogenic Escherichia coli, Salmonella enteritidis and Shigella flexneri. The activity of nine ethanolic extracts against enterobacteria, particularly Acalypha guatemalensis, Diphysa robinioides, Lippia dulcis, Psidium guajava and Spondias purpurea was confirmed. The plants with antibacterial activity are discussed.

An Improved Ultrasensitive Enzyme-Linked Immunosorbent Assay Using Hydrangea-Like Antibody-Enzyme-Inorganic Three-in-One Nanocomposites.

PubMed

Wei, Tianxiang; Du, Dan; Zhu, Mei-Jun; Lin, Yuehe; Dai, Zhihui

2016-03-01

Protein-inorganic nanoflowers, composed of protein and copper(II) phosphate (Cu3(PO4)2), have recently grabbed people's attention. Because the synthetic method requires no organic solvent and because of the distinct hierarchical nanostructure, protein-inorganic nanoflowers display enhanced catalytic activity and stability and would be a promising tool in biocatalytical processes and biological and biomedical fields. In this work, we first coimmobilized the enzyme, antibody, and Cu3(PO4)2 into a three-in-one hybrid protein-inorganic nanoflower to enable it to possess dual functions: (1) the antibody portion retains the ability to specifically capture the corresponding antigen; (2) the nanoflower has enhanced enzymatic activity and stability to produce an amplified signal. The prepared antibody-enzyme-inorganic nanoflower was first applied in an enzyme-linked immunosorbent assay to serve as a novel enzyme-labeled antibody for Escherichia coli O157:H7 (E. coli O157:H7) determination. The detection limit is 60 CFU L(-1), which is far superior to commercial ELISA systems. The three-in-one antibody (anti-E. coli O157:H7 antibody)-enzyme (horseradish peroxidase)-inorganic (Cu3(PO4)2) nanoflower has some advantages over commercial enzyme-antibody conjugates. First, it is much easier to prepare and does not need any complex covalent modification. Second, it has fairly high capture capability and catalytic activity because it is presented as aggregates of abundant antibodies and enzymes. Third, it has enhanced enzymatic stability compared to the free form of enzyme due to the unique hierarchical nanostructure.

[Salvia officinalis l. I. Botanic characteristics, composition, use and cultivation].

PubMed

Daniela, T

1993-06-01

Salvia officinalis L. is an essential oil containing plant, which does not wildly grow in the territories of the Czech and Slovak Republics but it can be successfully cultivated. It is a perennial half-shrub, from which non-flowering herbaceous sprouts or leaves are collected for pharmaceutical purposes. After drying at a temperature not exceeding 35 degrees C they are the plant drugs Herba salviae or Folium salviae. In PhBs, Herba salviae is official. The drug contains mainly ethereal oil (1-2%), diterpenes, triterpenes and tannin. The pharmacopoeial criterion of quality is the content of essential oil, which is produced in an increased amount in the plant in warm summer months. Herba salviae and the extracts prepared from it are used as an antiseptic agent, an antiphlogistic agent, in the inflammations of the oral cavity and gingivitis and also as a stomachic and an antihydrotic agent. Its utilization in cosmetics and food industry is also of importance.

Moxibustion for Cephalic Version of Breech Presentation.

PubMed

Schlaeger, Judith M; Stoffel, Cynthia L; Bussell, Jeanie L; Cai, Hui Yan; Takayama, Miho; Yajima, Hiroyoshi; Takakura, Nobuari

2018-05-01

Moxibustion, a form of traditional Chinese medicine (TCM), is the burning of the herb moxa (Folium Artemisiae argyi or mugwort) over acupuncture points. It is often used in China to facilitate cephalic version of breech presentation. This article reviews the history, philosophy, therapeutic use, possible mechanisms of action, and literature pertaining to its use for this indication. For moxibustion, moxa can be rolled into stick form, placed directly on the skin, or placed on an acupuncture needle and ignited to warm acupuncture points. Studies have demonstrated that moxibustion may promote cephalic version of breech presentation and may facilitate external cephalic version. However, there is currently a paucity of research on the effects of moxibustion on cephalic version of breech presentation, and thus there is a need for further studies. Areas needing more investigation include efficacy, safety, optimal technique, and best protocol for cephalic version of breech presentation. © 2018 by the American College of Nurse-Midwives.

Metabolic profiling of nuciferine in rat urine, plasma, bile and feces after oral administration using ultra-high performance liquid chromatography-diode array detection-quadrupole time-of-flight mass spectrometry.

PubMed

Wu, Xiao-Lei; Wu, Ming-Jiang; Chen, Xin-Ze; Ma, Hao-Ling; Ding, Li-Qin; Qiu, Feng; Pan, Qin; Zhang, De-Qin

2017-06-05

Nuciferine, a major alkaloid found in Nelumbinis Folium, exhibits a broad spectrum of bioactivities, such as antiobesity, anti-diabetes and anti-inflammatory. However, many research regarding nuciferine focused on the extraction, isolation and biological activity, the metabolism is not comprehensively explained in vivo. Thence, the present of this paper is to establish a simple method for speculating metabolites of nuciferine. A total of 15 metabolites were detected and tentatively identified through ultra high performance liquid chromatography-diode array detection-quadrupole time-of-flight mass spectrometry (UHPLC-DAD-QTOF-MS), including 7 new metabolites. Among them, we also discovered a previously unmentioned metabolically active site at the C 1 -OCH 3 position. These metabolites suggested that demethylation, oxidation, glucuronidation and sulfation were major metabolic pathways. This study provided significant experiment basis for its safety estimate and valuable information about the metabolism of nuciferine, which will be advantageous for new drug development. Copyright © 2017 Elsevier B.V. All rights reserved.

An exploration of the potential mechanisms and translational potential of five medicinal plants for applications in Alzheimer’s disease

PubMed Central

Shakir, Taner; Coulibaly, Ahmed Y; Kehoe, Patrick G

2013-01-01

Alzheimer’s disease (AD) is the most common type of dementia, and represents a vast worldwide socio-economic burden, and in the absence of a current cure, effective therapeutic strategies are still needed. Cholinergic and cerebral blood flow deficits, excessive levels of oxidative stress, neuroinflammation and glutamate excitatory mechanisms are all believed to contribute to the development and progression of the disease. Scoparia dulcis, Catharanthus roseus, Sesamum indicum, Erythrina senegalensis and Vigna unguiculata represent five plants that have been used as traditional medicines for the treatment of AD in certain cultures. Review of the scientific literature was conducted to explore the properties of these plants that might be beneficial and explain what would be perceived by many to be largely anecdotal evidence of their benefit. All plants were found to possess varying levels of anti-oxidant capability. Scoparia dulcis was also found to potentiate nerve growth factor-like effects upon cell lines. Catharanthus roseus appears to inhibit acetylcholinesterase with relatively high potency, while Sesamum indicum demonstrated the strongest antioxidant ability. Comparisons with currently used plant derived therapeutics illustrate how these plants may be likely to have some therapeutic benefits in AD. The evidence presented also highlights how appropriate dietary supplementation with some of these plants in various cultural settings might have effects analogous or complementary to the so-called protective Mediterranean diet. However, prior to embarking on making any formal recommendations to this end, further rigorous evaluation is needed to better elucidate the breadth and potential toxicological aspects of medicinal properties harboured by these plants. This would be vital to ensuring a more informed and safe delivery of preparations of these plants if they were to be considered as a form of dietary supplementation and where appropriate, how these might

Study of antihyperglycaemic activity of medicinal plant extracts in alloxan induced diabetic rats

PubMed Central

Attanayake, Anoja P.; Jayatilaka, Kamani A. P. W.; Pathirana, Chitra; Mudduwa, Lakmini K. B.

2013-01-01

Background: Diabetes mellitus, for a long time, has been treated with plant derived medicines in Sri Lanka. Aim: The aim of this study is to determine the efficacy and dose response of oral antihyperglycaemic activity of eight Sri Lankan medicinal plant extracts, which are used to treat diabetes in traditional medicine in diabetic rats. Materials and Methods: Medicinal plants selected for the study on the basis of documented effectiveness and wide use among traditional Ayurveda physicians in the Southern region of Sri Lanka for the treatment of diabetes mellitus. The effect of different doses of aqueous stem bark extracts of Spondias pinnata (Anacardiaceae), Kokoona zeylanica (Celastraceae), Syzygium caryophyllatum (Myrtaceae), Gmelina arborea (Verbenaceae), aerial part extracts of Scoparia dulcis (Scrophulariaceae), Sida alnifolia (Malvaceae), leaf extract of Coccinia grandis (Cucurbitaceae) and root extract of Languas galanga (Zingiberaceae) on oral glucose tolerance test was evaluated. A single dose of 0.25, 0.50, 0.75, 1.00, 1.25, 2.00 g/kg of plant extract was administered orally to alloxan induced (150 mg/kg, ip) diabetic Wistar rats (n = 6). Glibenclamide (0.50 mg/kg) was used as the standard drug. The acute effect was evaluated over a 4 h period using area under the oral glucose tolerance curve. Statistical Analysis: The results were evaluated by analysis of variance followed by Dunnett's test. Results: The eight plant extracts showed statistically significant dose dependent improvement on glucose tolerance (P < 0.05). The optimum effective dose on glucose tolerance for six extracts was found to be 1.00 g/kg in diabetic rats with the exception of C. grandis: 0.75 g/kg and L. galanga: 1.25 g/kg. Conclusion: The aqueous extract of G. arborea, S. pinnata, K. zeylanica, S. caryophyllatum, S. dulcis, S. alnifolia, L. galanga and C. grandis possess potent acute antihyperglycaemic activity in alloxan induced diabetic rats. PMID:24991066

Study of antihyperglycaemic activity of medicinal plant extracts in alloxan induced diabetic rats.

PubMed

Attanayake, Anoja P; Jayatilaka, Kamani A P W; Pathirana, Chitra; Mudduwa, Lakmini K B

2013-04-01

Diabetes mellitus, for a long time, has been treated with plant derived medicines in Sri Lanka. The aim of this study is to determine the efficacy and dose response of oral antihyperglycaemic activity of eight Sri Lankan medicinal plant extracts, which are used to treat diabetes in traditional medicine in diabetic rats. Medicinal plants selected for the study on the basis of documented effectiveness and wide use among traditional Ayurveda physicians in the Southern region of Sri Lanka for the treatment of diabetes mellitus. The effect of different doses of aqueous stem bark extracts of Spondias pinnata (Anacardiaceae), Kokoona zeylanica (Celastraceae), Syzygium caryophyllatum (Myrtaceae), Gmelina arborea (Verbenaceae), aerial part extracts of Scoparia dulcis (Scrophulariaceae), Sida alnifolia (Malvaceae), leaf extract of Coccinia grandis (Cucurbitaceae) and root extract of Languas galanga (Zingiberaceae) on oral glucose tolerance test was evaluated. A single dose of 0.25, 0.50, 0.75, 1.00, 1.25, 2.00 g/kg of plant extract was administered orally to alloxan induced (150 mg/kg, ip) diabetic Wistar rats (n = 6). Glibenclamide (0.50 mg/kg) was used as the standard drug. The acute effect was evaluated over a 4 h period using area under the oral glucose tolerance curve. The results were evaluated by analysis of variance followed by Dunnett's test. The eight plant extracts showed statistically significant dose dependent improvement on glucose tolerance (P < 0.05). The optimum effective dose on glucose tolerance for six extracts was found to be 1.00 g/kg in diabetic rats with the exception of C. grandis: 0.75 g/kg and L. galanga: 1.25 g/kg. The aqueous extract of G. arborea, S. pinnata, K. zeylanica, S. caryophyllatum, S. dulcis, S. alnifolia, L. galanga and C. grandis possess potent acute antihyperglycaemic activity in alloxan induced diabetic rats.

Search for constituents with neurotrophic factor-potentiating activity from the medicinal plants of paraguay and Thailand.

PubMed

Li, Yushan; Ohizumi, Yasushi

2004-07-01

20 medicinal plants of Paraguay and 3 medicinal plants of Thailand were examined on nerve growth factor (NGF)-potentiating activities in PC12D cells. The trail results demonstrated that the methanol extracts of four plants, Verbena littoralis, Scoparia dulcis, Artemisia absinthium and Garcinia xanthochymus, markedly enhanced the neurite outgrowth induced by NGF from PC12D cells. Furthermore, utilizing the bioactivity-guided separation we successfully isolated 32, 4 and 5 constituents from V. littoralis, S. dulcis and G. xanthochymus, respectively, including nine iridoid and iridoid glucosides (1-9), two dihydrochalcone dimers (10 and 11), two flavonoids and three flavonoid glycosides (12-16), two sterols (17 and 18), ten triterpenoids (19-28), five xanthones (29-33), one naphthoquinone (34), one benzenepropanamide (35), four phenylethanoid glycosides (36-39) and two other compounds (40 and 41). Among which, 15 compounds (1-4, 10-11, 14-18, 29-31 and 34) were new natural products. The results of pharmacological trails verified that littoralisone (1), gelsemiol (5), 7a-hydroxysemperoside aglucone (6), verbenachalcone (10), littorachalcone (11), stigmast-5-ene 3beta,7alpha,22alpha-triol (18), ursolic acid (19), 3beta-hydroxyurs-11-en-28,13beta-olide (24), oleanolic acid (25), 2alpha,3beta-dihydroxyolean-12-en-28-oic acid (26), 1,4,5,6-tetrahydroxy-7,8-di(3-methylbut-2-enyl)xanthone (29), 1,2,6-trihydroxy-5-methoxy-7-(3-methylbut-2-enyl)xanthone (30), 1,3,5,6-tetrahydroxy-4,7,8-tri(3-methyl-2-butenyl)xanthone (31), 12b-hydroxy-des-D-garcigerrin A (32), garciniaxanthone E (33) and (4R)-4,9-dihydroxy-8-methoxy-alpha-lapachone (34) elicited marked enhancement of NGF-mediated neurite outgrowth in PC12D cells. These substances may contribute to the basic study and the medicinal development for the neurodegenerative disorder.

An exploration of the potential mechanisms and translational potential of five medicinal plants for applications in Alzheimer's disease.

PubMed

Shakir, Taner; Coulibaly, Ahmed Y; Kehoe, Patrick G

2013-01-01

Alzheimer's disease (AD) is the most common type of dementia, and represents a vast worldwide socio-economic burden, and in the absence of a current cure, effective therapeutic strategies are still needed. Cholinergic and cerebral blood flow deficits, excessive levels of oxidative stress, neuroinflammation and glutamate excitatory mechanisms are all believed to contribute to the development and progression of the disease. Scoparia dulcis, Catharanthus roseus, Sesamum indicum, Erythrina senegalensis and Vigna unguiculata represent five plants that have been used as traditional medicines for the treatment of AD in certain cultures. Review of the scientific literature was conducted to explore the properties of these plants that might be beneficial and explain what would be perceived by many to be largely anecdotal evidence of their benefit. All plants were found to possess varying levels of anti-oxidant capability. Scoparia dulcis was also found to potentiate nerve growth factor-like effects upon cell lines. Catharanthus roseus appears to inhibit acetylcholinesterase with relatively high potency, while Sesamum indicum demonstrated the strongest antioxidant ability. Comparisons with currently used plant derived therapeutics illustrate how these plants may be likely to have some therapeutic benefits in AD. The evidence presented also highlights how appropriate dietary supplementation with some of these plants in various cultural settings might have effects analogous or complementary to the so-called protective Mediterranean diet. However, prior to embarking on making any formal recommendations to this end, further rigorous evaluation is needed to better elucidate the breadth and potential toxicological aspects of medicinal properties harboured by these plants. This would be vital to ensuring a more informed and safe delivery of preparations of these plants if they were to be considered as a form of dietary supplementation and where appropriate, how these might interact

Ethnobotanical study of the medicinal plants from Tlanchinol, Hidalgo, México.

PubMed

Andrade-Cetto, Adolfo

2009-02-25

The people in Mexico still depend upon the use of medicinal plants to treat simple health problems, including those who live in regions like Tlanchinol Hidalgo, where it is still possible to find people who speak the pre-Hispanic Nahua language. This area is surrounded by rain forest, which is more or less well conserved, so ethnopharmacological field studies are quite relevant. The cultural knowledge about the use of medicinal plants converge with the richness in the surrounding flora making this region ideal for the selection of traditionally used medicinal plants. To present the results of an ethnopharmacological field survey conducted in the municipality of Tlanchinol Hidalgo, Mexico analyzed with two different quantitative tools, with the aim of selecting the most important species used in traditional medicine. Direct interviews with the people were performed in several short visits to the municipality of Tlanchinol Hidalgo. The plants were collected, and the species were determined. The interviews were analyzed with two quantitative tools. First, the factor informant consensus highlighted the agreement in the use of plants and the fidelity level defined as: the ratio between the number of informants who independently suggested the use of a species for the same major purpose and the total number of informants who mentioned the plant for any use. Furthermore, we analyzed the use-mentions for the plants. The results of the factor informant consensus showed that the gastrointestinal category had the greatest agreement, followed by the respiratory and dermatological categories. The most important species according to their fidelity are: Coleus blumei, Plantago australis and Lippia dulcis for the gastrointestinal category; Borago officinalis, Foeniculum vulgare, and Eucalyptus globulus for the respiratory category; and Ageratum houstonianum and Solanum nigrescens for the dermatological category. As a result of the present study, we recommend the plants listed in

Characterization of Pseudomonas pathovars isolated from rosaceous fruit trees in East Algeria.

PubMed

Harzallah, D; Sadallah, S; Larous, L

2004-01-01

A survey of bacterial diseases due to Pseudomonas on rosaceous fruit trees was conducted. In forty two orchards located in the Constantine region ( East Algeria). Pseudomonas isolates were identified on the bases of their cultural and biochemical characteristics . A total of fifty nine phytopathogenic bacteria were isolated from diseased pome and stone fruit trees. Thirty one strains comparable to Pseudomonas syringae pv. syringae were isolated from cherry (Prunus avium L.), plum (P. domestica L.), apricot (P. armeniaca L.), almond (P. dulcis L.) and pear trees (Pirus communis L.); sixteen strains comparable to Pseudomonas syringae pv. morsprunorum were obtained from samples of cherry and plum. Twelve strains of Pseudomonas viridiflava were isolated from cherry, apricot and peach (Prunus persica L.).

Volumetric analysis of cerebellum in short-track speed skating players.

PubMed

Park, In Sung; Lee, Nam Joon; Kim, Tae-Young; Park, Jin-Hoon; Won, Yu-Mi; Jung, Yong-Ju; Yoon, Jin-Hwan; Rhyu, Im Joo

2012-12-01

The cerebellum is associated with balance control and coordination, which might be important for gliding on smooth ice at high speeds. A number of case studies have shown that cerebellar damage induces impaired balance and coordination. As a positive model, therefore, we investigated whether plastic changes in the volumes of cerebellar subregions occur in short-track speed skating players who must have extraordinary abilities of balance and coordination, using three-dimensional magnetic resonance imaging volumetry. The manual tracing was performed and the volumes of cerebellar hemisphere and vermian lobules were compared between short-track speed skating players (n=16) and matched healthy controls (n=18). We found larger right cerebellar hemisphere volume and vermian lobules VI-VII (declive, folium, and tuber) in short-track speed skating players in comparison with the matched controls. The finding suggests that the specialized abilities of balance and coordination are associated with structural plasticity of the right hemisphere of cerebellum and vermian VI-VII and these regions play an essential role in balance and coordination.

Involvement of Apoptosis in Host-Parasite Interactions in the Zebra Mussel

PubMed Central

Minguez, Laëtitia; Brulé, Nelly; Sohm, Bénédicte; Devin, Simon; Giambérini, Laure

2013-01-01

The question of whether cell death by apoptosis plays a biological function during infection is key to understanding host-parasite interactions. We investigated the involvement of apoptosis in several host-parasite systems, using zebra mussels Dreissena polymorpha as test organisms and their micro- and macroparasites. As a stress response associated with parasitism, heat shock proteins (Hsp) can be induced. In this protein family, Hsp70 are known to be apoptosis inhibitors. Mussels were diagnosed for their respective infections by standard histological methods; apoptosis was detected using the TUNEL methods on paraffin sections and Hsp70 by immunohistochemistry on cryosections. Circulating hemocytes were the main cells observed in apoptosis whereas infected tissues displayed no or few apoptotic cells. Parasitism by intracellular bacteria Rickettsiales-like and the trematode Bucephalus polymorphus were associated with the inhibition of apoptosis whereas ciliates Ophryoglena spp. or the trematode Phyllodistomum folium did not involve significant differences in apoptosis. Even if some parasites were able to modulate apoptosis in zebra mussels, we did not see evidence of any involvement of Hsp70 on this mechanism. PMID:23785455

The diuretic effect in human subjects of an extract of Taraxacum officinale folium over a single day.

PubMed

Clare, Bevin A; Conroy, Richard S; Spelman, Kevin

2009-08-01

Taraxacum officinale (L.) Weber (Asteraceae) has been extensively employed as a diuretic in traditional folk medicine and in modern phytotherapy in Europe, Asia, and the Americas without prior clinical trial substantiation. In this pilot study, a high-quality fresh leaf hydroethanolic extract of the medicinal plant T. officinale (dandelion) was ingested by volunteers to investigate whether an increased urinary frequency and volume would result. Volume of urinary output and fluid intake were recorded by subjects. Baseline values for urinary frequency and excretion ratio (urination volume:fluid intake) were established 2 days prior to dandelion dosing (8 mL TID) and monitored throughout a 1-day dosing period and 24 hours postdosing. For the entire population (n = 17) there was a significant (p < 0.05) increase in the frequency of urination in the 5-hour period after the first dose. There was also a significant (p < 0.001) increase in the excretion ratio in the 5-hour period after the second dose of extract. The third dose failed to change any of the measured parameters. Based on these first human data, T. officinale ethanolic extract shows promise as a diuretic in humans. Further studies are needed to establish the value of this herb for induction of diuresis in human subjects.

The Diuretic Effect in Human Subjects of an Extract of Taraxacum officinale Folium over a Single Day

PubMed Central

Clare, Bevin A.; Conroy, Richard S.

2009-01-01

Abstract Background Taraxacum officinale (L.) Weber (Asteraceae) has been extensively employed as a diuretic in traditional folk medicine and in modern phytotherapy in Europe, Asia, and the Americas without prior clinical trial substantiation. Objectives In this pilot study, a high-quality fresh leaf hydroethanolic extract of the medicinal plant T. officinale (dandelion) was ingested by volunteers to investigate whether an increased urinary frequency and volume would result. Design Volume of urinary output and fluid intake were recorded by subjects. Baseline values for urinary frequency and excretion ratio (urination volume:fluid intake) were established 2 days prior to dandelion dosing (8 mL TID) and monitored throughout a 1-day dosing period and 24 hours postdosing. Results For the entire population (n = 17) there was a significant (p < 0.05) increase in the frequency of urination in the 5-hour period after the first dose. There was also a significant (p < 0.001) increase in the excretion ratio in the 5-hour period after the second dose of extract. The third dose failed to change any of the measured parameters. Conclusions Based on these first human data, T. officinale ethanolic extract shows promise as a diuretic in humans. Further studies are needed to establish the value of this herb for induction of diuresis in human subjects. PMID:19678785

Disruption of endosperm development: an inbreeding effect in almond (Prunus dulcis).

PubMed

Ortega, Encarnación; Martínez-García, Pedro J; Dicenta, Federico; Egea, José

2010-06-01

A homozygous self-compatible almond, originated from self-fertilization of a self-compatible genotype and producing a reasonable yield following open pollination, exhibited a very high fruit drop rate when self-pollinated. To investigate whether fruit dropping in this individual is related to an abnormal development of the embryo sac following self-fertilization, histological sections of ovaries from self and cross-pollinated flowers were observed by light microscopy. Additionally, the presence of pollen tubes in the ovary and fruit set were determined for both types of pollination. Despite pollen tubes reached the ovary after both pollinations, differences in embryo sac and endosperm development after fertilization were found. Thus, while for cross-fertilized ovules a pro-embryo and an endosperm with abundant nuclei were generally observed, most self-fertilized ovules remained in a previous developmental stage in which the embryo sac was not elongated and endosperm nuclei were absent. Although 30 days after pollination fruit set was similar for both pollination types, at 60 days it was significantly reduced for self-pollination. These results provide evidence that the high fruit drop in this genotype is the consequence of a disrupted development of the endosperm, what could be an expression of its high level of inbreeding.

Influence of storage on volatile profiles in roasted almonds (Prunus dulcis).

PubMed

Lee, Jihyun; Xiao, Lu; Zhang, Gong; Ebeler, Susan E; Mitchell, Alyson E

2014-11-19

Hexanal, peroxide value, and lipid hydroperoxides are common indicators of lipid oxidation in food products. However, these markers are not always reliable as levels are dynamic and often can be detected only after significant oxidation has occurred. Changes in the volatile composition of light- and dark-roast almonds were evaluated during storage over 24 weeks at 25 or 35 °C using headspace solid phase microextraction (HS-SPME) gas chromatography-mass spectrometry (GC-MS). Several volatile changes were identified in association with early oxidation events in roasted almonds. Hexenal decreased significantly during the first 6 weeks of storage and did not increase above initial levels until 20-24 weeks of storage depending upon the degree of roast. In contrast, levels of 1-heptanol and 1-octanol increased at 16-20 weeks, depending upon the degree of roast, and no initial losses were observed. Seventeen new compounds, absent in raw and freshly roasted almonds but detectable after 6 weeks of storage, were identified. Of these, 2-octanone, 2-nonanone, 3-octen-2-one, 2-decanone, (E)-2-decenal, 2,4-nonadienal, pentyl oxirane, and especially acetic acid increased significantly (that is, >10 ng/g). The degree of roasting did not correlate with the levels of these compounds. Significant decreases in roasting-related aroma volatiles such as 2-methylbutanal, 3-methylbutanal, furfural, 2-phenylacetaldehyde, 2,3-butanedione, 2-methylpyrazine, and 1-methylthio-2-propanol were observed by 4 weeks of storage independent of the degree of roast or storage conditions.

Comparison of Multiple Bioactive Constituents in Different Parts of Eucommia ulmoides Based on UFLC-QTRAP-MS/MS Combined with PCA.

PubMed

Yan, Ying; Zhao, Hui; Chen, Cuihua; Zou, Lisi; Liu, Xunhong; Chai, Chuan; Wang, Chengcheng; Shi, Jingjing; Chen, Shuyu

2018-03-13

Eucommia ulmoides Oilv. (EU), also called Du-zhong, is a classical traditional Chinese medicine. Its bark, leaf, and male flower are all used for medicinal purposes, called Eucommiae Cortex (EC), Eucommiae Folium (EF), and Eucommiae Flos Male (EFM). In order to study the difference in synthesis and the accumulation of metabolites in different parts of EU, a reliable method based on ultra-fast liquid chromatography tandem triple quadrupole mass spectrometry (UFLC-QTRAP-MS/MS) was developed for the simultaneous determination of a total of 21 constituents, including two lignans, 6 iridoids, 6 penylpropanoids, 6 flavonoids, and one phenol in the samples (EC, EF, and EFM). Furthermore, principal component analysis (PCA) was performed to evaluate and classify the samples according to the contents of these 21 constituents. All of the results demonstrated that the chemical compositions in EC, EF, and EFM were significantly different and the differential constituents (i.e., aucubin, geniposidic acid, chlorogenic acid, pinoresinol-di- O -β-d-glucopyranoside, geniposide, cryptochlorogenic acid, rutin, and quercetin) were remarkably associated with sample classifications. The research will provide the basic information for revealing the laws of metabolite accumulation in EC, EF, and EFM from the same origin.

Recent progress of research on medicinal mushrooms, foods, and other herbal products used in traditional Chinese medicine

PubMed Central

Lee, Kuo-Hsiung; Morris-Natschke, Susan L.; Yang, Xiaoming; Huang, Rong; Zhou, Ting; Wu, Shou-Fang; Shi, Qian; Itokawa, Hideji

2012-01-01

This article will review selected herbal products used in traditional Chinese medicine, including medicinal mushrooms (巴西蘑菇 bā xī mó gū; Agaricus blazei, 雲芝 yún zhī; Coriolus versicolor, 靈芝 líng zhī; Ganoderma lucidum, 香蕈 xiāng xùn; shiitake, Lentinus edodes, 牛樟芝 niú zhāng zhī; Taiwanofungus camphoratus), Cordyceps (冬蟲夏草 dōng chóng xià cǎo), pomegranate (石榴 shí liú; Granati Fructus), green tea (綠茶 lǜ chá; Theae Folium Non Fermentatum), garlic (大蒜 dà suàn; Allii Sativi Bulbus), turmeric (薑黃 jiāng huáng; Curcumae Longae Rhizoma), and Artemisiae Annuae Herba (青蒿 qīng hāo; sweet wormwood). Many of the discussed herbal products have gained popularity in their uses as dietary supplements for health benefits. The review will focus on the active constituents of the herbs and their bioactivities, with emphasis on the most recent progress in research for the period of 2003 to 2011. PMID:24716120

Application of Partial Internal Transcribed Spacer Sequences for the Discrimination of Artemisia capillaris from Other Artemisia Species

PubMed Central

Doh, Eui Jeong; Paek, Seung-Ho; Lee, Guemsan; Lee, Mi-Young; Oh, Seung-Eun

2016-01-01

Several Artemisia species are used as herbal medicines including the dried aerial parts of Artemisia capillaris, which are used as Artemisiae Capillaris Herba (known as “Injinho” in Korean medicinal terminology and “Yin Chen Hao” in Chinese). In this study, we developed tools for distinguishing between A. capillaris and 11 other Artemisia species that grow and/or are cultured in China, Japan, and Korea. Based on partial nucleotide sequences in the internal transcribed spacer (ITS) that differ between the species, we designed primers to amplify a DNA marker for A. capillaris. In addition, to detect other Artemisia species that are contaminants of A. capillaris, we designed primers to amplify DNA markers of A. japonica, A. annua, A. apiacea, and A. anomala. Moreover, based on random amplified polymorphic DNA analysis, we confirmed that primers developed in a previous study could be used to identify Artemisia species that are sources of Artemisiae Argyi Folium and Artemisiae Iwayomogii Herba. By using these primers, we found that multiplex polymerase chain reaction (PCR) was a reliable tool to distinguish between A. capillaris and other Artemisia species and to identify other Artemisia species as contaminants of A. capillaris in a single PCR. PMID:27313651

1291 cases of cholelithiasis treated with electric shock on otoacupoints.

PubMed

Zhang, Y; Zhang, L; Yang, H; Zhang, H; Zhu, Y

1991-06-01

Since 1985, the authors began to use electric shock on otoacupoints of varying electric resistance for the treatment of cholelithiasis. The instrument used was the Channel Therapeutic Instrument made in China, and the otoacupoints of varying electric resistance were Sympathetic, Pancreas--Gall Bladder, Stomach, Liver, Sanjiao, Endocrine, and Ermigen. In the 1291 cases treated, the total effective rate was 99.69%, the rate of calculus excretion was 91.32%, and the rate of total excretion was 19.51%. The composition of the calculi was cholesterol crystals (31.25%), bilirubin crystals (28.17%), and mixed crystals (40.58%). The largest calculus excreted was an extrahepatic biliary duct calculus of 1.75 cm X 1.5 cm; the largest number of calculi excreted was 152 cholecystic stones 0.3 cm X 0.5 cm in size. In 100 random cases, the biliary system was shown to manifest vigorous dilations and constrictions under Ultrasonic B-scan when the relevant otoacupoints were stimulated with electric shock. Among the 78 control cases, no cholecystic stones were excreted, inspite of the Magnesium Sulfate, Folium Cassiae and fatty meals administered to many cases with constipation.

An HPLC method to determine sennoside A and sennoside B in Sennae fructus and Sennae folium.

PubMed

Rosenthal, Immanuel; Wolfram, Evelyn; Meier, Beat

2014-01-01

The current Ph. Eur. monographs for senna pods, senna leaf and senna leaf dry extract standardised describe a photometric assay based on the Bornträger reaction to determine hydroxyanthracene glycosides, calculated as sennoside B. The method is timeconsuming, unspecific for sennosides and the precision is not adequate for a modern assay. The photometric method shall therefore be replaced by a modern HPLC method. About 70 % of the total anthrachinone content in herbal drugs of senna species is due to sennoside A and sennoside B. These substances are therefore suitable for the standardisation of Senna products. The Japanese Pharmacopoeia (JP) already describes an HPLC method to determine sennoside A and sennoside B in the monograph for senna leaf. It uses ion-pair chromatography with tetraheptylammoniumbromide. The procedure described in the monograph has a runtime of 70 min. The adapted and validated method described here uses solid-phase extraction (SPE) which allows a selective sample preparation by using an anion exchange phase. A conventional RP C18 column Tosh TSKgel ODS-80TS (4.6 mm × 150 mm), 5 μm, was used as stationary phase and acetonitrile for chromatography R, water R, phosphoric acid R (200:800:1 V/V/V) as mobile phase. The flow rate was 1.2 mL/min, the column temperature 40 °C, the detection wavelength 380 nm, and the injection volume 20 μL. The runtime is 10 min, the chromatogram shows 2 peaks due to sennoside A/B and 2 additional smaller compounds. One of them is rhein-8-O-glucoside. The procedure has been successfully validated according to ICH guidelines. We analysed 6 batches of Senna. The pods (Senna angustifolia) showed a total content of sennoside A and B of 1.74-2.76 % m/m and the content of senna leaves was clearly lower with 1.07-1.19 % m/m, respectively. The suggested method is considered to be suitable to determine sennoside A and sennoside B in senna leaves and senna pods. The consideration is based on the performed validation and on the results for the analysed samples. A short run time and better resolution are clear advantages of the suggested method, compared to other methods.

Population Structure of Xylella fastidiosa Associated with Almond Leaf Scorch Disease in the San Joaquin Valley of California.

PubMed

Lin, Hong; Islam, Md Sajedul; Cabrera-La Rosa, Juan C; Civerolo, Edwin L; Groves, Russell L

2015-06-01

Xylella fastidiosa causes disease in many commercial crops, including almond leaf scorch (ALS) disease in susceptible almond (Prunus dulcis). In this study, genetic diversity and population structure of X. fastidiosa associated with ALS disease were evaluated. Isolates obtained from two almond orchards in Fresno and Kern County in the San Joaquin Valley of California were analyzed for two successive years. Multilocus simple-sequence repeat (SSR) analysis revealed two major genetic clusters that were associated with two host cultivars, 'Sonora' and 'Nonpareil', respectively, regardless of the year of study or location of the orchard. These relationships suggest that host cultivar selection and adaptation are major driving forces shaping ALS X. fastidiosa population structure in the San Joaquin Valley. This finding will provide insight into understanding pathogen adaptation and host selection in the context of ALS disease dynamics.

Phyllodulcin, a Natural Sweetener, Regulates Obesity-Related Metabolic Changes and Fat Browning-Related Genes of Subcutaneous White Adipose Tissue in High-Fat Diet-Induced Obese Mice.

PubMed

Kim, Eunju; Lim, Soo-Min; Kim, Min-Soo; Yoo, Sang-Ho; Kim, Yuri

2017-09-21

Phyllodulcin is a natural sweetener found in Hydrangea macrophylla var. thunbergii . This study investigated whether phyllodulcin could improve metabolic abnormalities in high-fat diet (HFD)-induced obese mice. Animals were fed a 60% HFD for 6 weeks to induce obesity, followed by 7 weeks of supplementation with phyllodulcin (20 or 40 mg/kg body weight (b.w.)/day). Stevioside (40 mg/kg b.w./day) was used as a positive control. Phyllodulcin supplementation reduced subcutaneous fat mass, levels of plasma lipids, triglycerides, total cholesterol, and low-density lipoprotein cholesterol and improved the levels of leptin, adiponectin, and fasting blood glucose. In subcutaneous fat tissues, supplementation with stevioside or phyllodulcin significantly decreased mRNA expression of lipogenesis-related genes, including CCAAT/enhancer-binding protein α ( C/EBPα ), peroxisome proliferator activated receptor γ ( PPARγ ), and sterol regulatory element-binding protein-1C ( SREBP-1c ) compared to the high-fat group. Phyllodulcin supplementation significantly increased the expression of fat browning-related genes, including PR domain containing 16 ( Prdm16 ), uncoupling protein 1 ( UCP1 ), and peroxisome proliferator-activated receptor γ coactivator 1-α ( PGC-1α ), compared to the high-fat group. Hypothalamic brain-derived neurotrophic factor-tropomyosin receptor kinase B (BDNF-TrkB) signaling was upregulated by phyllodulcin supplementation. In conclusion, phyllodulcin is a potential sweetener that could be used to combat obesity by regulating levels of leptin, fat browning-related genes, and hypothalamic BDNF-TrkB signaling.

Expression, purification, and characterization of almond (Prunus dulcis) allergen Pru du 4

USDA-ARS?s Scientific Manuscript database

Biochemical characterizations of food allergens are required for understanding the allergenicity of food allergens. Such studies require a relatively large amount of highly purified allergens. Profilins from numerous species are known to be allergens, including food allergens, such as almond (Prunus...

Expression, purification, and characterization of almond (Prunus dulcis) allergen Pru du 4.

PubMed

Zhang, Yuzhu; Du, Wen-Xian; Fregevu, Cécile; Kothary, Mahendra H; Harden, Leslie; McHugh, Tara H

2014-12-31

Biochemical characterizations of food allergens are required for understanding the allergenicity of food allergens. Such studies require a relatively large amount of highly purified allergens. The level of Pru du 4 in almond is low, and its expression in a soluble form in Escherichia coli required an expression tag. An MBP tag was used to enhance its expression and solubility. Sumo was used for the first time as a peptidase recognition site. The expression tag was removed with a sumo protease, and the resulting wild-type Pru du 4 was purified chromatographically. The stability of the allergen was investigated with chemical denaturation. The Gibbs free energy of Pru du 4 folding-unfolding transition was determined to be 5.4 ± 0.7 kcal/mol.

Effects of processing and storage on almond (Prunus dulcis L.) amandin immunoreactivity.

PubMed

Su, Mengna; Liu, Changqi; Roux, Kenneth H; Gradziel, Thomas M; Sathe, Shridhar K

2017-10-01

A murine monoclonal antibody (mAb)-based enzyme-linked immunosorbent assay (ELISA) was used to assess amandin immunoreactivity in processed and long-term stored almonds. The results demonstrated that amandin immunoreactivity is stable in variously processed almond seeds. Using the ELISA, amandin immunoreactivity could be detected in commercial whole raw and processed (blanched, sliced, dry roasted, and indicated combinations thereof) almond seeds stored for eleven years and eight months, defatted almond seed flours from several almond varieties/hybrids and their borate saline buffer-solubilized protein extracts stored for ten years and seven months, and several almond varieties grown in different California counties (full fat flours and their defatted flour counterparts). Roasting Nonpareil whole full fat almond seeds, full fat flour, and defatted flour at 170°C for 20min each with 2, 5, 10, and 20% w/w corn syrup or sucrose did not prevent amandin detection by ELISA. Similarly, amandin detection in select food matrices spiked with Nonpareil almond protein extract was not inhibited. In conclusion, amandin is a stable target protein for almond detection under the tested processing and storage conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Relationships between spur- and orchard-level fruit bearing in almond (Prunus dulcis).

PubMed

Tombesi, Sergio; Lampinen, Bruce D; Metcalf, Samuel; DeJong, Theodore M

2011-12-01

Almond is often considered to be a moderately alternate-bearing species but historical yield data typically do not exhibit clear patterns of alternate bearing at the orchard level, while research has indicated that spurs (the main fruit bearing unit in almond trees) rarely produce fruit in two subsequent years. The objective of the present work was to analyze the bearing behavior of almond trees at both the orchard level and the individual spur level over multiple years to explain this apparent paradox. The 10-year yield patterns of three almond cultivars grown at three different sites within California were analyzed for tendencies of alternate bearing at the orchard level. At the individual spur level, data on spur viability, and number of flowers and fruits per spur were collected on 2400 individually tagged spurs that were observed over 6 years to characterize bearing at that level. At the orchard level one cultivar (Nonpareil) did exhibit a tendency for alternate bearing at one site (Kern) but other cultivars and sites did not. The orchard and the individual trees in which the spur population study was conducted showed tendencies for alternate bearing but the spur population did not. Only a relatively small percentage of the total tagged spur population bore fruit in any given year and therefore while individual fruiting spurs exhibited a high level of non-bearing after fruiting the previous year the spurs that did produce fruit in any year generally did not constitute enough of the total spur population to exhibit alternate bearing at the whole population level. Our results suggest that annual bearing fluctuations in almond are probably mainly due to year-to-year variations of parameters affecting fruit set and that high rates of fruit set in a given year may involve a larger-than-normal percentage of a spur population in fruit bearing. This would limit the size of the spur population available for flowering in the subsequent year and could cause alternate year bearing. However, from historical records, this would appear to be the exception rather than a normal circumstance. Therefore, almond should not be considered to be a strictly alternate-bearing species.

Immunoreactivity of Biochemically Purified Amandin from Thermally Processed Almonds (Prunus dulcis L.).

PubMed

Zaffran, Valerie D; Sathe, Shridhar K

2018-06-15

Almond seeds were subjected to select thermal processing and amandin was purified from processed and unprocessed (control) seeds using cryoprecipitation. Amandin immunoreactivity was assessed using two murine monoclonal antibodies (mAbs)-4C10 and 4F10 detecting human IgE-relevant conformational and linear epitopes, respectively. Overall amandin immunoreactivity following thermal treatment ranged from 64.9% to 277.8% (4C10) and 81.3% to 270.3% (4F10). Except for autoclaving (121 °C, 15 psi, 30 min) and roasting (160 °C, 30 min), the tested processing conditions resulted in increased immunoreactivity as determined by mAbs 4C10 and 4F10-based enzyme-linked immunosorbent assays (ELISAs). A significant, yet not complete, reduction in immunoreactivity was caused by autoclaving (121 °C, 15 psi, 30 min) and roasting (160 °C, 30 min). Western- and dot-blot immunoassays corroborated the ELISA results, confirming amandin thermal stability. The tested immunoassays indicated amandin to be stable, regardless of the targeted epitope and the processing method that whole almond seeds were subjected to. © 2018 Institute of Food Technologists®.

Plants used in Guatemala for the treatment of respiratory diseases. 1. Screening of 68 plants against gram-positive bacteria.

PubMed

Caceres, A; Alvarez, A V; Ovando, A E; Samayoa, B E

1991-02-01

Respiratory ailments are important causes of morbidity and mortality in developing countries. Ethnobotanical surveys and literature reviews conducted in Guatemala during 1986-88 showed that 234 plants from 75 families, most of them of American origin, have been used for the treatment of respiratory ailments. Three Gram-positive bacteria causing respiratory infections (Staphylococcus aureus, Streptococcus pneumoniae and Streptococcus pyogenes) were used to screen 68 of the most commonly used plants for activity. Twenty-eight of these (41.2%) inhibited the growth of one or more of the bacteria tested. Staphylococcus aureus was inhibited by 18 of the plant extracts, while 7 extracts were effective against Streptococcus pyogenes. Plants of American origin which exhibited antibacterial activity were: Gnaphalium viscosum, Lippia alba, Lippia dulcis, Physalis philadelphica, Satureja brownei, Solanum nigrescens and Tagetes lucida. These preliminary in vitro results provide scientific basis for the use of these plants against bacterial respiratory infections.

Evaluation of monitoring traps with novel bait for navel orangeworm (Lepidoptera: Pyralidae) in California almond and pistachio orchards.

PubMed

Nay, Justin E; Peterson, Elonce M; Boyd, Elizabeth A

2012-08-01

Experiments conducted in three almond, Prunus dulcis (Rosales: Rosaceae), orchards and three pistachio, Pistacia vera (Sapindales: Anicardiaceae), orchards in 2009 and 2010, and determined that sticky bottom wing traps baited with ground pistachio mummies, or a combination of ground pistachio plus ground almond mummies, trapped more adult female navel orangeworm, Amyelois transitella (Walker) (Lepidoptera: Pyralidae), than did traps baited with ground almond mummies alone. During both years of this study, 2.9 and 1.8 more moths were caught in traps baited with pistachio mummies compared with traps baited with almond mummies in almond orchards and pistachio orchards, respectively. Also, traps located in pistachio orchards caught 5.9 and 8.3 times more navel orangeworm than were trapped from almond orchards in 2009 and 2010, respectively. Implications for use of this novel baited trap in almond and pistachio orchard integrated pest management programs are discussed.

Medicinal plants with promising antileishmanial activity in Iran: a systematic review and meta-analysis.

PubMed

Soosaraei, Masoud; Fakhar, Mahdi; Hosseini Teshnizi, Saeed; Ziaei Hezarjaribi, Hajar; Banimostafavi, Elham Sadat

2017-09-01

Leishmaniasis is a major public health problem worldwide. The aim of the present study was to investigate medicinal plants with anti- Leishmania activity which used in Iran. Data were systematically gathered from five English databases including Ebsco, Science Direct, PubMed, Google Scholar and Scopus, four Persian databases including Magiran, Iran doc, Iran medex and the Scientific Information Database (SID) from 1999 to April 2015. Information obtained included plant family, extraction method, concentrations of extracts, animal models and parasite strains. A total of 68 articles including 188 experiments (140 in vitro and 48 in vivo) between 1999 and 2015, met our eligibility criteria. Thoroughly, 98 types of plants were examined against three genera of Leishmania spp. For the heterogeneity study conducted, it was showed that there was a great deal of variation among studies. Based on random effect, meta-analysis pooled mean of IC50 was obtained 456.64 (95% CI: 396.15, 517.12). The most Iranian plants used as anti-leishmanial activity were Artemisia species , Allium sativum , Achilleamille folium , Peganum harmala and Thymus vulgaris . The present systematic and meta-analysis review provide valuable information about natural products with anti- Leishmania activity, which would be examined in the future experimental and clinical trials and herbal combination therapy.

Chemical Isotope Labeling LC-MS for Monitoring Disease Progression and Treatment in Animal Models: Plasma Metabolomics Study of Osteoarthritis Rat Model

NASA Astrophysics Data System (ADS)

Chen, Deying; Su, Xiaoling; Wang, Nan; Li, Yunong; Yin, Hua; Li, Liang; Li, Lanjuan

2017-01-01

We report a chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS) method generally applicable for tracking metabolomic changes from samples collected in an animal model for studying disease development and treatment. A rat model of surgically induced osteoarthritis (OA) was used as an example to illustrate the workflow and technical performance. Experimental duplicate analyses of 234 plasma samples were carried out using dansylation labeling LC-MS targeting the amine/phenol submetabolome. These samples composed of 39 groups (6 rats per group) were collected at multiple time points with sham operation, OA control group, and OA rats with treatment, separately, using glucosamine/Celecoxib and three traditional Chinese medicines (Epimedii folium, Chuanxiong Rhizoma and Bushen-Huoxue). In total, 3893 metabolites could be detected and 2923 of them were consistently detected in more than 50% of the runs. This high-coverage submetabolome dataset could be used to track OA progression and treatment. Many differentiating metabolites were found and 11 metabolites including 2-aminoadipic acid, saccharopine and GABA were selected as potential biomarkers of OA progression and OA treatment. This study illustrates that CIL LC-MS is a very useful technique for monitoring incremental metabolomic changes with high coverage and accuracy for studying disease progression and treatment in animal models.

Non-invasive investigation on a VI century purple codex from Brescia, Italy

NASA Astrophysics Data System (ADS)

Aceto, Maurizio; Idone, Ambra; Agostino, Angelo; Fenoglio, Gaia; Gulmini, Monica; Baraldi, Pietro; Crivello, Fabrizio

2014-01-01

Purple codices are among the most relevant and prestigious book productions of Late Antique and Medieval age. They usually contained texts from Holy Writings written with golden or silver inks on parchment dyed in a purple hue. According to the tradition, the colour of parchment was obtained by the well renowned Tyrian purple dye. From the material point of view, however, very little is known about the compounds actually used in the manufacture of these manuscripts. Presently, the information available is limited to the ancient art treatises, with very few diagnostic evidences supporting them and, moreover, none confirming the presence of Tyrian purple. It is more than apparent, then, the need to have at disposal larger and more complete information at the concern, in order to verify what came to us from the literary tradition only. In this study, preliminary results are presented from non-invasive investigation on a VI century purple codex, the so-called CodexBrixianus, held in the Biblioteca Civica Queriniana at Brescia (Italy). Analyses were carried out with XRF spectrometry, UV-visible diffuse reflectance spectrophotometry, molecular spectrofluorimetry and optical microscopy. The results suggest the hypothesis that Tyrian purple had been used as a minor component mixed with other less precious dyes such as folium or orchil.

Research on effect of ginkgo aglucone flavone to human body organs and immune function.

PubMed

Wang, Xiong

2014-07-01

Ginkgo aglucone flavone is a kind of effective natural antioxidant. Lots of researches show that ginkgo aglucone flavone has various biological activities and it is of great importance to antioxidant, anti-aging, free radial scavenging and immunoregulation. However, researches on effect of ginkgo aglucone flavone to immune function are rare so far. Thus, it is important to go into the effect of ginkgo aglucone flavone to immune function. We can find out more effective measurement that resist immunosuppression through research and provide referable science activity form and suggestion of sports nutrition supplements. It can guide people to improve habitus through supports and establish important basis for new area development of folium ginkgo extract. This paper aims to discuss the effect of ginkgo aglucone flavone to human body organs and immune function. Patients with ginkgo aglucone flavone indications are selected for experiment. Their peripheral blood T lymphocyte subsets and content of serum immunoglobin is detected before and two weeks after drug use. The result shows that specific ratio of T lymphocyte subsets CD3 and CD4 and the content of serum IgG significantly increase after pharmacy of patients. It can be concluded that ginkgo aglucone flavone have acceleration on immune system function.

Chemical Isotope Labeling LC-MS for Monitoring Disease Progression and Treatment in Animal Models: Plasma Metabolomics Study of Osteoarthritis Rat Model

PubMed Central

Chen, Deying; Su, Xiaoling; Wang, Nan; Li, Yunong; Yin, Hua; Li, Liang; Li, Lanjuan

2017-01-01

We report a chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS) method generally applicable for tracking metabolomic changes from samples collected in an animal model for studying disease development and treatment. A rat model of surgically induced osteoarthritis (OA) was used as an example to illustrate the workflow and technical performance. Experimental duplicate analyses of 234 plasma samples were carried out using dansylation labeling LC-MS targeting the amine/phenol submetabolome. These samples composed of 39 groups (6 rats per group) were collected at multiple time points with sham operation, OA control group, and OA rats with treatment, separately, using glucosamine/Celecoxib and three traditional Chinese medicines (Epimedii folium, Chuanxiong Rhizoma and Bushen-Huoxue). In total, 3893 metabolites could be detected and 2923 of them were consistently detected in more than 50% of the runs. This high-coverage submetabolome dataset could be used to track OA progression and treatment. Many differentiating metabolites were found and 11 metabolites including 2-aminoadipic acid, saccharopine and GABA were selected as potential biomarkers of OA progression and OA treatment. This study illustrates that CIL LC-MS is a very useful technique for monitoring incremental metabolomic changes with high coverage and accuracy for studying disease progression and treatment in animal models. PMID:28091618

[The influence of stinging nettle (Urtica dioica L.) extracts on the activity of catalase in THP1 monocytes/macrophages].

PubMed

Wolska, Jolanta; Janda, Katarzyna; Szkyrpan, Sylwia; Gutowska, Izabela

2015-01-01

Stinging nettle (Urtica dioicd L.) is one of the most valuable plants used in phytotherapy. The herbal raw material is a herb (Urticae herba), leaves (Urticae folium), roots (Urticae radix) and seeds (Urticae semina). This plant is a good source of vitamins, minerals, fibre, protein and biologically active compounds with antioxidant properties. The literature provides limited information about the chemical composition and properties of the seed heads. No papers are available on the effect of extracts of this plant on catalase activity in human cells. The aim of this study was to investigate the impact of stinging nettle (Urtica dioica L.) extracts on the antioxidant activity of catalase in THP1 macrophages. Two types of extracts: water and alcohol, at two different concentrations, were used in experiments. Nettle was collected in September and October in 2012 in the area of Szczecin. The collected plant material was frozen and lyophilized. After those procedures water and alcohol extracts of nettle were prepared and then added to THP1 cells. The antioxidant activity of catalase was established with the spectrophotometric method. The study showed that both extracts (water and alcohol) significantly increased the antioxidant activity of catalase in THP1 cells. The increase in catalase was directly proportional to the concentration of the added alcohol extract.

Discrimination of almonds (Prunus dulcis) geographical origin by minerals and fatty acids profiling.

PubMed

Amorello, Diana; Orecchio, Santino; Pace, Andrea; Barreca, Salvatore

2016-09-01

Twenty-one almond samples from three different geographical origins (Sicily, Spain and California) were investigated by determining minerals and fatty acids compositions. Data were used to discriminate by chemometry almond origin by linear discriminant analysis. With respect to previous PCA profiling studies, this work provides a simpler analytical protocol for the identification of almonds geographical origin. Classification by using mineral contents data only was correct in 77% of the samples, while, by using fatty acid profiles, the percentages of samples correctly classified reached 82%. The coupling of mineral contents and fatty acid profiles lead to an increased efficiency of the classification with 87% of samples correctly classified.

Characterization of ellagitannins, gallotannins, and bound proanthocyanidins from California almond (Prunus dulcis) varieties.

PubMed

Xie, Liyang; Roto, Anna V; Bolling, Bradley W

2012-12-12

Extractable and bound proanthocyanidins and hydrolyzable tannins were characterized in Nonpareil, Carmel, and Butte almond varieties from California, with n = 3 samples/variety. Bound proanthocyanidins were recovered from extracted defatted almond residue by hydrolysis with 4 N sodium hydroxide and represented 3-21% of the total proanthocyanidin content among varieties. The bound proanthocyanidins were recovered primarily as monomers and dimers. In contrast, acid hydrolysis of extracted almond residue did not yield bound proanthocyanidins. Hydrolyzable tannins were characterized in aqueous acetone extracts of defatted almond using two-dimensional TLC and further quantitated by HPLC following acid hydrolysis. Almond hydrolyzable tannin content was 54.7 ± 2.3 mg ellagic acid and 27.4 ± 7.3 mg gallic acid per 100 g almond among varieties. The tannin contents of Nonpareil, Carmel, and Butte almond varieties were not significantly different. Thus, bound proanthocyanidins and hydrolyzable tannins significantly contribute to almond polyphenol content.

Quantifying interception associated with new urban vegetation canopies

NASA Astrophysics Data System (ADS)

Yerk, W.; Montalto, F. A.

2013-12-01

Interception of precipitation by vegetation canopies has long been recognized as an important component of the hydrologic cycle, though most research has been in closed or sparse canopy forests. Much less work has been published on interception by urban vegetation, and especially associated with the low growing shrubs commonly installed in green infrastructure program. To inform urban watershed model with vegetation-specific interception data, a field experiment was designed to directly measure canopy throughfall associated with two shrub species commonly included in urban greening programs. Data was collected at a high (e.g. five second) sampling frequency. A non-parametric Kruskal-Wallis test performed on data collected between August and October of 2012 demonstrated statistically significant (p= 0.0011) differences in recorded throughfall between two species (94% for Itea virginica, 86% for Cornus sericea). Additionally, the results suggested that the relationship of throughfall to rainfall intensity varied by species. For Itea, the ratio of throughfall to precipitation intensity was close to 1:1. However, for Cornus, the throughfall rate was on average slower (or 0.85 of the precipitation intensity). An improved and expanded set-up installed in 2013 added two additional species (Prunus laurocerasus and Hydrangea quercifolia). The 2013 results confirm interspecies differences in both throughfall amount, and in the relationship of throughfall rate to precipitation intensity. The results are discussed with respect to droplet splashing and enhanced evaporation within the canopy. Both years' findings suggest that the quantity of water intercepted by vegetation canopies exceeds the canopy storage capacity, as assumed in many conventional hydrologic models.

Quantification of Stemflow in Three Shrub Species in an Urban Environment

NASA Astrophysics Data System (ADS)

Rakestraw, E.; Montalto, F. A.

2015-12-01

As precipitation falls on vegetated areas, it is partitioned into throughfall, stemflow and vapor. Stemflow has often been neglected in hydrologic budgeting of both trees and shrubs due to the small volume, and limited number of quantitative studies conducted. Studies of stemflow in shrub species are especially rare, and this study intends to decrease uncertainty of its occurrence. Six shrubs of species Prunus laurocerasus 'Otto Luyken', Hydrangea quercifolia 'Alice' , and Itea virginica 'Little Henry' were studied in an urban environment in Philadelphia, PA. During the 2015 growing season, total incident rainfall and measured stemflow were recorded. Stemflow was collected using aluminum collars attached to four stems of each individual. Vinyl tubing transported stemflow from the collars into collection bottles that were weighed after each rain event. Canopy areas of each collared branch were calculated. Impact of branch and leaf attachment angles, leaf area index, stem diameter, and bark properties on stemflow were analyzed. In addition to species characteristics, rain depth, rain intensity and wind speed were considered. Stemflow averages were found to be 12 %, 4 %, and 3 % for P. laurocerasus, H. quercifolia, and I. virginica respectively, with values up to 24 % in certain P. laurocerasus branches during some storms. The results show that although in some shrub species stemflow may be negligible, in others it can be high enough to be considered substantial in hydrologic budget calculations. By examining how the quantity of stemflow is affected by both meteorological and species characteristics, the partitioning of rainfall can be more accurately calculated.

Electrochemical quantification of the antioxidant capacity of medicinal plants using biosensors.

PubMed

Rodríguez-Sevilla, Erika; Ramírez-Silva, María-Teresa; Romero-Romo, Mario; Ibarra-Escutia, Pedro; Palomar-Pardavé, Manuel

2014-08-08

The working area of a screen-printed electrode, SPE, was modified with the enzyme tyrosinase (Tyr) using different immobilization methods, namely entrapment with water-soluble polyvinyl alcohol (PVA), cross-linking using glutaraldehyde (GA), and cross-linking using GA and human serum albumin (HSA); the resulting electrodes were termed SPE/Tyr/PVA, SPE/Tyr/GA and SPE/Tyr/HSA/GA, respectively. These biosensors were characterized by means of amperometry and EIS techniques. From amperometric evaluations, the apparent Michaelis-Menten constant, Km', of each biosensor was evaluated while the respective charge transfer resistance, Rct, was assessed from impedance measurements. It was found that the SPE/Tyr/GA had the smallest Km' (57 ± 7) µM and Rct values. This electrode also displayed both the lowest detection and quantification limits for catechol quantification. Using the SPE/Tyr/GA, the Trolox Equivalent Antioxidant Capacity (TEAC) was determined from infusions prepared with "mirto" (Salvia microphylla), "hHierba dulce" (Lippia dulcis) and "salve real" (Lippia alba), medicinal plants commonly used in Mexico.

Antioxidant potential of chestnut (Castanea sativa L.) and almond (Prunus dulcis L.) by-products.

PubMed

Barreira, J C M; Ferreira, I C F R; Oliveira, M B P P; Pereira, J A

2010-06-01

The antioxidant properties of almond green husks (Cvs. Duro Italiano, Ferraduel, Ferranhês, Ferrastar and Orelha de Mula), chestnut skins and chestnut leaves (Cvs. Aveleira, Boa Ventura, Judia and Longal) were evaluated through several chemical and biochemical assays in order to provide a novel strategy to stimulate the application of waste products as new suppliers of useful bioactive compounds, namely antioxidants. All the assayed by-products revealed good antioxidant properties, with very low EC(50) values (lower than 380 μg/mL), particularly for lipid peroxidation inhibition (lower than 140 μg/mL). The total phenols and flavonoids contents were also determined. The correlation between these bioactive compounds and DPPH (2,2-diphenyl-1-picrylhydrazyl) radical scavenging activity, reducing power, inhibition of β-carotene bleaching and inhibition of lipid peroxidation in pig brain tissue through formation of thiobarbituric acid reactive substances, was also obtained. Although, all the assayed by-products proved to have a high potential of application in new antioxidants formulations, chestnut skins and leaves demonstrated better results.

Antitumor, Antioxidant, and Nitrite Scavenging Effects of Chinese Water Chestnut (Eleocharis dulcis) Peel Flavonoids.

PubMed

Zhan, Ge; Pan, Leiqing; Tu, Kang; Jiao, Shunshan

2016-10-01

The preparation, quantification, and characterization of flavonoid compounds from Chinese water chestnut peel (CWCP) flavonoid extract and ethyl acetate fraction (EF), n-butanol fraction, and water fraction were studied. Among these, EF showed the maximum free radical levels (IC 50 values of 0.36, 0.40, and 0.37 mg/mL for DPPH•, ABTS• + , and •OH, respectively), nitrite scavenging effects (IC 50 = 1.89 mg/mL), and A549 cell inhibitory activities (IC 50 = 776.12 μg/mL) with the highest value of total flavonoid content (TFC, 421.32 mg/g). Moreover, the contents of 8 flavonoids in this fraction were quantified using high-performance liquid chromatography, and fisetin, diosmetin, luteolin, and tectorigenin were the 4 major flavonoids with levels of 31.66, 29.91, 13.69, and 12.41 mg/g, respectively. Luteolin produced a greater inhibition of human lung cancer A549 cells (IC 50 = 59.60 μg/mL) than did fisetin, diosmetin, and tectorigenin. Flow cytometry revealed that the cellular mechanisms of luteolin inhibition of A549 cells were achieved via the induction of cell proliferation arrest at G 1 phase and apoptosis/necrosis. Our findings suggest that flavonoids are closely associated with antitumor, antioxidant, and nitrite scavenging effects of CWCP. © 2016 Institute of Food Technologists®.

Application of capillary electrophoresis for organic acid analysis in herbal studies.

PubMed

Fung, Y S; Tung, H S

2001-07-01

A capillary electrophoresis (CE) procedure has been developed for the separation of 25 inorganic and organic acid anions using a buffer system consisting of 15 mM tris(hydroxymethyl)aminomethane, 3 mM 1,2,4-benzenetricarboxylic acid, 1.5 mM tetraethylenepentaamine (TEPA) and 20% methanol with pH adjusted to 8.4. A good separation of organic acids extracted from a mixture of Chinese traditional medicine (TCM) containing three herbs, Flos chrysthemi, Spica prunellae, and Folium mori was obtained using the procedure developed with satisfactory working range (0.20-77 mg/g), low detection limit (90-190 microg/g), and good repeatability (relative standard deviation 4.47-6.99%, n = 4). A satisfactory extraction of organic acids was achieved within 20 min using 0.1 M NaOH. The addition of TEPA to provide a reduced electroosmotic flow (EOF) environment was shown to remove interfering organic compounds extracted from TCM. The applicability of using organic acids as markers for determining the mixing ratio of constituent herbs for a TCM mixture was investigated using a three-component mixture with a 1:1:1 mixing ratio. A satisfactory mixing ratio of 1.04:1.09:0.98 was obtained using the methodology developed based on organic acids as markers. The application of our method for determining more complicated TCM mixtures has been discussed.

Non-invasive investigation on a VI century purple codex from Brescia, Italy.

PubMed

Aceto, Maurizio; Idone, Ambra; Agostino, Angelo; Fenoglio, Gaia; Gulmini, Monica; Baraldi, Pietro; Crivello, Fabrizio

2014-01-03

Purple codices are among the most relevant and prestigious book productions of Late Antique and Medieval age. They usually contained texts from Holy Writings written with golden or silver inks on parchment dyed in a purple hue. According to the tradition, the colour of parchment was obtained by the well renowned Tyrian purple dye. From the material point of view, however, very little is known about the compounds actually used in the manufacture of these manuscripts. Presently, the information available is limited to the ancient art treatises, with very few diagnostic evidences supporting them and, moreover, none confirming the presence of Tyrian purple. It is more than apparent, then, the need to have at disposal larger and more complete information at the concern, in order to verify what came to us from the literary tradition only. In this study, preliminary results are presented from non-invasive investigation on a VI century purple codex, the so-called CodexBrixianus, held in the Biblioteca Civica Queriniana at Brescia (Italy). Analyses were carried out with XRF spectrometry, UV-visible diffuse reflectance spectrophotometry, molecular spectrofluorimetry and optical microscopy. The results suggest the hypothesis that Tyrian purple had been used as a minor component mixed with other less precious dyes such as folium or orchil. Copyright © 2013 Elsevier B.V. All rights reserved.

A novel quantified bitterness evaluation model for traditional Chinese herbs based on an animal ethology principle.

PubMed

Han, Xue; Jiang, Hong; Han, Li; Xiong, Xi; He, Yanan; Fu, Chaomei; Xu, Runchun; Zhang, Dingkun; Lin, Junzhi; Yang, Ming

2018-03-01

Traditional Chinese herbs (TCH) are currently gaining attention in disease prevention and health care plans. However, their general bitter taste hinders their use. Despite the development of a variety of taste evaluation methods, it is still a major challenge to establish a quantitative detection technique that is objective, authentic and sensitive. Based on the two-bottle preference test (TBP), we proposed a novel quantitative strategy using a standardized animal test and a unified quantitative benchmark. To reduce the difference of results, the methodology of TBP was optimized. The relationship between the concentration of quinine and animal preference index (PI) was obtained. Then the PI of TCH was measured through TBP, and bitterness results were converted into a unified numerical system using the relationship of concentration and PI. To verify the authenticity and sensitivity of quantified results, human sensory testing and electronic tongue testing were applied. The quantified results showed a good discrimination ability. For example, the bitterness of Coptidis Rhizoma was equal to 0.0579 mg/mL quinine, and Nelumbinis Folium was equal to 0.0001 mg/mL. The validation results proved that the new assessment method for TCH was objective and reliable. In conclusion, this study provides an option for the quantification of bitterness and the evaluation of taste masking effects.

Bioactivity Evaluation of Plant Extracts Used in Indigenous Medicine against the Snail, Biomphalaria glabrata, and the Larvae of Aedes aegypti.

PubMed

Dos Santos, Edilson Alves; de Carvalho, Cenira M; Costa, Ana L S; Conceição, Adilva S; Moura, Flávia de B Prado; Santana, Antônio Euzébio Goulart

2012-01-01

This investigation examined the molluscicidal and larvicidal activity of eight plants that are used in the traditional medicine of the Pankararé indigenous people in the Raso da Catarina region, Bahia state, Brazil. The tested plants were chosen based on the results of previous studies. Only those plants that were used either as insect repellents or to treat intestinal parasitic infections were included in the study. Crude extracts (CEs) of these plants were tested for their larvicidal activity (against Aedes aegypti larvae in the fourth instar) and molluscicidal activity (against the snail Biomphalaria glabrata). The plant species Scoparia dulcis and Helicteres velutina exhibited the best larvicidal activities (LC(50) 83.426 mg/L and LC(50) 138.896 mg/L, resp.), and Poincianella pyramidalis, Chenopodium ambrosoides, and Mimosa tenuiflora presented the best molluscicidal activities (LC(50) 0.94 mg/L, LC(50) 13.51 mg/L, and LC(50) 20.22 mg/L, resp.). As we used crude extracts as the tested materials, further study is warranted to isolate and purify the most active compounds.

Glycomyces scopariae sp. nov. and Glycomyces mayteni sp. nov., isolated from medicinal plants in China.

PubMed

Qin, Sheng; Chen, Hua-Hong; Klenk, Hans-Peter; Zhao, Guo-Zhen; Li, Jie; Xu, Li-Hua; Li, Wen-Jun

2009-05-01

Two actinomycete strains, designated YIM 56256(T) and YIM 61331(T), were isolated from the roots of Scoparia dulcis and Maytenus austroyunnanensis, two Chinese medicinal plants, and their taxonomic status was established based on a polyphasic investigation. The organisms were found to have chemical and morphological markers typical of members of the genus Glycomyces. 16S rRNA gene sequence analysis showed that they were closely related to each other and to Glycomyces sambucus E71(T). A battery of physiological characteristics and levels of DNA-DNA relatedness indicated that strains YIM 56256(T) and YIM 61331(T) represent two novel species, clearly different from the related known Glycomyces species. On the basis of the data presented, it is evident that each of these strains represents a novel species of the genus Glycomyces, for which the names Glycomyces scopariae sp. nov. (type strain YIM 56256(T) =KCTC 19158(T) =DSM 44968(T)) and Glycomyces mayteni sp. nov. (type strain YIM 61331(T) =KCTC 19527(T) =CCTCC AA 208004(T)) are proposed.

Electrochemical Quantification of the Antioxidant Capacity of Medicinal Plants Using Biosensors

PubMed Central

Rodríguez-Sevilla, Erika; Ramírez-Silva, María-Teresa; Romero-Romo, Mario; Ibarra-Escutia, Pedro; Palomar-Pardavé, Manuel

2014-01-01

The working area of a screen-printed electrode, SPE, was modified with the enzyme tyrosinase (Tyr) using different immobilization methods, namely entrapment with water-soluble polyvinyl alcohol (PVA), cross-linking using glutaraldehyde (GA), and cross-linking using GA and human serum albumin (HSA); the resulting electrodes were termed SPE/Tyr/PVA, SPE/Tyr/GA and SPE/Tyr/HSA/GA, respectively. These biosensors were characterized by means of amperometry and EIS techniques. From amperometric evaluations, the apparent Michaelis-Menten constant, Km′, of each biosensor was evaluated while the respective charge transfer resistance, Rct, was assessed from impedance measurements. It was found that the SPE/Tyr/GA had the smallest Km′ (57 ± 7) μM and Rct values. This electrode also displayed both the lowest detection and quantification limits for catechol quantification. Using the SPE/Tyr/GA, the Trolox Equivalent Antioxidant Capacity (TEAC) was determined from infusions prepared with “mirto” (Salvia microphylla), “hHierba dulce” (Lippia dulcis) and “salve real” (Lippia alba), medicinal plants commonly used in Mexico. PMID:25111237

Hymenopteran parasitoids associated with frugivorous larvae in a Brazilian caatinga-cerrado ecotone.

PubMed

De Souza, A R; Lopes-Mielezrski, G N; Lopes, E N; Querino, R B; Corsato, C D A; Giustolin, T A; Zucchi, R A

2012-04-01

The purpose of this study was to investigate native species of parasitoids of frugivorous larvae and their associations with host plants in commercial guava orchards and in typical native dry forests of a caatinga-cerrado ecotone in the State of Minas Gerais, Brazil. Nine species of parasitoids were associated with larvae of Anastrepha (Tephritidae) and Neosilba (Lonchaeidae) in fruit of Psidium guajava L. (Myrtaceae), Ziziphus joazeiro Mart. (Rhamnaceae), Spondias tuberosa Arruda (Anacardiaceae), Spondias dulcis Forst. (Anacardiaceae), Syzygium cumini (L.) Skeels (Myrtaceae), and Randia armata (Sw.) DC. (Rubiaceae). Doryctobracon areolatus was the most abundant species, obtained from puparia of Anastrepha zenildae, An. sororcula, An. fraterculus, An. obliqua, and An. turpiniae. This is the first report of Asobara obliqua in Brazil and of As. anastrephae and Tropideucoila weldi in dry forests of Minas Gerais State. The number of species of parasitoids was higher in areas with greater diversity of cultivated species and lower pesticide use. The forest fragments adjacent to the orchards served as shelter for parasitoids of frugivorous larvae.

In silico and experimental evaluation of DNA-based detection methods for the ability to discriminate almond from other Prunus spp.

PubMed

Brežná, Barbara; Šmíd, Jiří; Costa, Joana; Radvanszky, Jan; Mafra, Isabel; Kuchta, Tomáš

2015-04-01

Ten published DNA-based analytical methods aiming at detecting material of almond (Prunus dulcis) were in silico evaluated for potential cross-reactivity with other stone fruits (Prunus spp.), including peach, apricot, plum, cherry, sour cherry and Sargent cherry. For most assays, the analysis of nucleotide databases suggested none or insufficient discrimination of at least some stone fruits. On the other hand, the assay targeting non-specific lipid transfer protein (Röder et al., 2011, Anal Chim Acta 685:74-83) was sufficiently discriminative, judging from nucleotide alignments. Empirical evaluation was performed for three of the published methods, one modification of a commercial kit (SureFood allergen almond) and one attempted novel method targeting thaumatin-like protein gene. Samples of leaves and kernels were used in the experiments. The empirical results were favourable for the method from Röder et al. (2011) and a modification of SureFood allergen almond kit, both showing cross-reactivity <10(-3) compared to the model almond. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bioactivity Evaluation of Plant Extracts Used in Indigenous Medicine against the Snail, Biomphalaria glabrata, and the Larvae of Aedes aegypti

PubMed Central

dos Santos, Edilson Alves; de Carvalho, Cenira M.; Costa, Ana L. S.; Conceição, Adilva S.; Moura, Flávia de B. Prado; Santana, Antônio Euzébio Goulart

2012-01-01

This investigation examined the molluscicidal and larvicidal activity of eight plants that are used in the traditional medicine of the Pankararé indigenous people in the Raso da Catarina region, Bahia state, Brazil. The tested plants were chosen based on the results of previous studies. Only those plants that were used either as insect repellents or to treat intestinal parasitic infections were included in the study. Crude extracts (CEs) of these plants were tested for their larvicidal activity (against Aedes aegypti larvae in the fourth instar) and molluscicidal activity (against the snail Biomphalaria glabrata). The plant species Scoparia dulcis and Helicteres velutina exhibited the best larvicidal activities (LC50 83.426 mg/L and LC50 138.896 mg/L, resp.), and Poincianella pyramidalis, Chenopodium ambrosoides, and Mimosa tenuiflora presented the best molluscicidal activities (LC50 0.94 mg/L, LC50 13.51 mg/L, and LC50 20.22 mg/L, resp.). As we used crude extracts as the tested materials, further study is warranted to isolate and purify the most active compounds. PMID:22194773

Plants used by native Amazonian groups from the Nanay River (Peru) for the treatment of malaria.

PubMed

Ruiz, Lastenia; Ruiz, Liliana; Maco, Martha; Cobos, Marianela; Gutierrez-Choquevilca, Andréa-Luz; Roumy, Vincent

2011-01-27

In order to evaluate the antimalarial potential of traditional remedies used in Peru, Indigenous and Mestizo populations from the river Nanay in Loreto were interviewed about traditional medication for the treatment of malaria. The survey took place on six villages and led to the collection of 59 plants. 35 hydro-alcoholic extractions were performed on the 21 most cited plants. The extracts were then tested for antiplasmodial activity in vitro on Plasmodium falciparum chloroquine resistant strain (FCR-3), and ferriprotoporphyrin inhibition test was also performed in order to assume pharmacological properties. Extracts from 9 plants on twenty-one tested (Abuta rufescens, Ayapana lanceolata, Capsiandra angustifolia, Citrus limon, Citrus paradise, Minquartia guianensis, Potalia resinífera, Scoparia dulcis, and Physalis angulata) displayed an interesting antiplasmodial activity (IC(50)<10 μg/ml) and 16 remedies were active on the ferriprotoporphyrin inhibition test. The results give scientific validation to the traditional medical knowledge of the Amerindian and Mestizo populations from Loreto and exhibit a source of potentially active plants. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Crystal Structure of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Tengchuan; Albillos, Silvia M.; Guo, Feng

Seed storage proteins are accumulated during seed development and act as a reserve of nutrition for seed germination and young sprout growth. Plant seeds play an important role in human nutrition by providing a relatively inexpensive source of protein. However, many plant foods contain allergenic proteins, and the number of people suffering from food allergies has increased rapidly in recent years. The 11S globulins are the most widespread seed storage proteins, present in monocotyledonous and dicotyledonous seeds as well as in gymnosperms (conifers) and other spermatophytes. This family of proteins accounts for a number of known major food allergens. Theymore » are of interest to both the public and industry due to food safety concerns. Because of the interests in the structural basis of the allergenicity of food allergens, we sought to determine the crystal structure of Pru1, the major component of the 11 S storage protein from almonds. The structure was refined to 2.4 {angstrom}, and the R/Rfree for the final refined structure is 17.2/22.9. Pru1 is a hexamer made of two trimers. Most of the back-to-back trimer-trimer association was contributed by monomer-monomer interactions. An {alpha} helix (helix 6) at the C-terminal end of the acidic domain of one of the interacting monomers lies at the cleft of the two protomers. The residues in this helix correspond to a flexible region in the peanut allergen Ara h 3 that encompasses a previously defined linear IgE epitope.« less

HS-SPME GC/MS characterization of volatiles in raw and dry-roasted almonds (Prunus dulcis).

PubMed

Xiao, Lu; Lee, Jihyun; Zhang, Gong; Ebeler, Susan E; Wickramasinghe, Niramani; Seiber, James; Mitchell, Alyson E

2014-05-15

A robust HS-SPME and GC/MS method was developed for analyzing the composition of volatiles in raw and dry-roasted almonds. Almonds were analyzed directly as ground almonds extracted at room temperature. In total, 58 volatiles were identified in raw and roasted almonds. Straight chain aldehydes and alcohols demonstrated significant but minimal increases, while the levels of branch-chain aldehydes, alcohols, heterocyclic and sulfur containing compounds increased significantly (500-fold) in response to roasting (p<0.05). Benzaldehyde decreased from 2934.6±272.5 ng/g (raw almonds) to 315.8±70.0 ng/g (averaged across the roasting treatments evaluated i.e. 28, 33 and 38 min at 138 °C) after roasting. Pyrazines were detected in only the roasted almonds, with the exception of 2,5-dimethylpyrazine, which was also found in raw almonds. The concentration of most alcohols increased in the roasted samples with the exception of 2-methyl-1-propanol, 3-methyl-1-butanol and 2-phenylethyl alcohol, which decreased 68%, 80%, and 86%, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

Cloning and characterization of profilin (Pru du 4), a cross-reactive almond (Prunus dulcis) allergen.

PubMed

Tawde, Pallavi; Venkatesh, Yeldur P; Wang, Fang; Teuber, Suzanne S; Sathe, Shridhar K; Roux, Kenneth H

2006-10-01

The identity of allergenic almond proteins is incomplete. Our objective was to characterize patient IgE reactivity to a recombinant and corresponding native almond allergen. An almond cDNA library was screened with sera from patients with allergy for IgE binding proteins. Two reactive clones were sequenced, and 1 was expressed. The expressed recombinant allergen and its native counterpart (purified from unprocessed almond flour) were assayed by 1-dimensional and 2-dimensional gel electrophoresis, dot blot, and ELISA, and screened for cross-reactivity with grass profilin. The 2 selected clones encoded profilin (designated Pru du 4) sequences that differed by 2 silent mutations. By dot-blot analyses, 6 of 18 patient sera (33%) reacted with the recombinant Pru du 4 protein, and 8 of 18 (44%) reacted with the native form. ELISA results were similar. Almond and ryegrass profilins were mutually inhibitable. Two-dimensional immunoblotting revealed the presence of more than 1 native almond profilin isoform. The strength of reactivity of some patients' serum IgE differed markedly between assays and between native and recombinant profilins. Almond nut profilin is an IgE-binding food protein that is cross-reactive with grass pollen profilin and is susceptible to denaturation, resulting in variable reactivity between assay types and between patients. Serum IgE of nearly half of the tested patients with almond allergy reacts with almond nut profilin. Because most patients also had pollinosis, the well-known cross-reactivity between pollen and food profilins could account for this pattern of reactivity.

Crystal structure of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Jin, Tengchuan; Albillos, Silvia M; Guo, Feng; Howard, Andrew; Fu, Tong-Jen; Kothary, Mahendra H; Zhang, Yu-Zhu

2009-09-23

Seed storage proteins are accumulated during seed development and act as a reserve of nutrition for seed germination and young sprout growth. Plant seeds play an important role in human nutrition by providing a relatively inexpensive source of protein. However, many plant foods contain allergenic proteins, and the number of people suffering from food allergies has increased rapidly in recent years. The 11S globulins are the most widespread seed storage proteins, present in monocotyledonous and dicotyledonous seeds as well as in gymnosperms (conifers) and other spermatophytes. This family of proteins accounts for a number of known major food allergens. They are of interest to both the public and industry due to food safety concerns. Because of the interests in the structural basis of the allergenicity of food allergens, we sought to determine the crystal structure of Pru1, the major component of the 11 S storage protein from almonds. The structure was refined to 2.4 A, and the R/Rfree for the final refined structure is 17.2/22.9. Pru1 is a hexamer made of two trimers. Most of the back-to-back trimer-trimer association was contributed by monomer-monomer interactions. An alpha helix (helix 6) at the C-terminal end of the acidic domain of one of the interacting monomers lies at the cleft of the two protomers. The residues in this helix correspond to a flexible region in the peanut allergen Ara h 3 that encompasses a previously defined linear IgE epitope.

A murine monoclonal antibody based enzyme-linked immunosorbent assay for almond (Prunus dulcis L.) detection.

PubMed

Su, Mengna; Venkatachalam, Mahesh; Liu, Changqi; Zhang, Ying; Roux, Kenneth H; Sathe, Shridhar K

2013-11-13

A sandwich enzyme-linked immunosorbent assay (ELISA) using anti-almond soluble protein rabbit polyclonal antibodies as capture antibodies and murine monoclonal antibody 4C10 as the detection antibodies was developed. The assay is specific and sensitive (3-200 ng almond protein/mL) for almond detection. The standardized assay is accurate (<15% CV) and reproducible (intra- and inter assay variability <15% CV). The assay did not register any cross-reactivity with the tested food matrices, suggesting the assay to be almond amandin specific. The assay could detect the presence of declared almond in the tested matched commercial samples. Further, the assay reliably detected the presence of almonds in the laboratory prepared food samples spiked with almond flour.

Influence of deficit irrigation strategies on fatty acid and tocopherol concentration of almond (Prunus dulcis).

PubMed

Zhu, Ying; Taylor, Cathy; Sommer, Karl; Wilkinson, Kerry; Wirthensohn, Michelle

2015-04-15

The effects of deficit irrigation on almond fatty acid and tocopherol levels were studied in a field trial. Mature almond trees were subjected to three levels of deficit irrigation (85%, 70% and 55% of potential crop evapotranspiration (ETo), as well as control (100% ETo) and over-irrigation (120% ETo) treatments. Two deficit irrigation strategies were employed: regulated deficit irrigation (RDI) and sustained deficit irrigation (SDI). Moderate deficit irrigation (85% RDI and 85% SDI) had no detrimental impact on almond kernel lipid content, but severe and extreme deficiencies (70% and 55%) influenced lipid content. Unsaturated fatty acid (USFA) and saturated fatty acid (SFA) contents fluctuated under these treatments, the oleic/linoleic ratio increased under moderate water deficiency, but decreased under severe and extreme water deficiency. Almond tocopherols concentration was relatively stable under deficit irrigation. The variation between years indicated climate has an effect on almond fruit development. In conclusion it is feasible to irrigate almond trees using less water than the normal requirement, without significant loss of kernel quality. Copyright © 2014 Elsevier Ltd. All rights reserved.

Comprehensive analysis of chemical constituents in Xingxiong injection by high performance liquid chromatography coupled with mass spectrometry.

PubMed

Guo, Long; Dou, Li-Li; Duan, Li; Liu, Ke; Bi, Zhi-Ming; Li, Ping; Liu, E-Hu

2015-09-01

Xingxiong injection (XXI) is a widely used Chinese herbal formula prepared by the folium ginkgo extract and ligustrazine for the treatment of cardiovascular and cerebrovascular diseases. Compared with the pharmacological studies, chemical analysis and quality control studies on this formula are relatively limited. In the present study, a high performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (HPLC-QTOF MS) method was applied to comprehensive analysis of constituents in XXI. According to the fragmentation rules and previous reports, thirty ginkgo flavonoids, four ginkgo terpene lactones, and one alkaloid were identified. A high performance liquid chromatography coupled with triple quadrupole mass spectrometry (HPLC-QQQ MS) method was then applied to quantify ten major constituents in XXI. The method validation results indicated that the developed method had desirable specificity, linearity, precision and accuracy. The total contents of ginkgo flavonoids were about 22.05-25.51 μg·mL(-1) and the ginkgo terpene lactones amounts were about 4.41-8.70 μg·mL(-1) in six batches of XXI samples, respectively. Furthermore, cosine ratio algorithm and distance measurements were employed to evaluate the similarity of XXI samples, and the results demonstrated a high-quality consistency. This work could provide comprehensive information on the quality control of Xingxiong injection, which be helpful in the establishment of a rational quality control standard. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Cutaneous and periodontal inputs to the cerebellum of the naked mole-rat (Heterocephalus glaber)

PubMed Central

Sarko, Diana K.; Leitch, Duncan B.; Catania, Kenneth C.

2013-01-01

The naked mole-rat (Heterocephalus glaber) is a small fossorial rodent with specialized dentition that is reflected by the large cortical area dedicated to representation of the prominent incisors. Due to naked mole-rats’ behavioral reliance on the incisors for digging and for manipulating objects, as well as their ability to move the lower incisors independently, we hypothesized that expanded somatosensory representations of the incisors would be present within the cerebellum in order to accommodate a greater degree of proprioceptive, cutaneous, and periodontal input. Multiunit electrophysiological recordings targeting the ansiform lobule were used to investigate tactile inputs from receptive fields on the entire body with a focus on the incisors. Similar to other rodents, a fractured somatotopy appeared to be present with discrete representations of the same receptive fields repeated within each folium of the cerebellum. These findings confirm the presence of somatosensory inputs to a large area of the naked mole-rat cerebellum with particularly extensive representations of the lower incisors and mystacial vibrissae. We speculate that these extensive inputs facilitate processing of tactile cues as part of a sensorimotor integration network that optimizes how sensory stimuli are acquired through active exploration and in turn adjusts motor outputs (such as independent movement of the lower incisors). These results highlight the diverse sensory specializations and corresponding brain organizational schemes that have evolved in different mammals to facilitate exploration of and interaction with their environment. PMID:24302898

Establishment of orchards with black polyethylene film mulching: effect on nematode and fungal pathogens, water conservation, and tree growth.

PubMed

Duncan, R A; Stapleton, J J; McKenry, M V

1992-12-01

Placement of a 3-m-wide, black, polyethylene film mulch down rows of peach (Prunus persica 'Red Haven' on 'Lovell' rootstock) and almond (Prunus dulcis 'Nonpareil' on 'Lovell') trees in the San Joaquin Valley of California resulted in irrigation water conservation of 75%, higher soil temperature in the surface 30 cm, a tendency toward greater root mass, elimination of weeds, and a greater abundance of Meloidogyne incognita second-stage juveniles in soil but reduced root galling when compared to the nonmulched control. Population levels of Pratylenchus hexincisus, a nematode found within tree roots, were reduced by mulching, as were those of Tylenchulus semipenetrans, which survived on old grape roots remaining from a previously planted vineyard, and Paratrichodorus minor, which probably fed on roots of various weed species growing in the nonmulched soil. Populations of Pythium ultimum were not significantly changed, probably also due to the biological refuge of the old grape roots and moderate soil heating level. Trunk diameters of peach trees were increased by mulching, but those of almond trees were reduced by the treatment. Leaf petiole analysis indicated that concentrations of mineral nutrients were inconsistent, except for a significant increase in Ca in both tree species.

Elemental composition of edible nuts: fast optimization and validation procedure of an ICP-OES method.

PubMed

Tošić, Snežana B; Mitić, Snežana S; Velimirović, Dragan S; Stojanović, Gordana S; Pavlović, Aleksandra N; Pecev-Marinković, Emilija T

2015-08-30

An inductively coupled plasma-optical emission spectrometry method for the speedy simultaneous detection of 19 elements in edible nuts (walnuts: Juglans nigra; almonds: Prunus dulcis; hazelnuts: Corylus avellana; Brazil nuts: Bertholletia excelsa; cashews: Anacardium occidentalle; pistachios: Pistacia vera; and peanuts: Arachis hypogaea) available on the Serbian markets, was optimized and validated through the selection of instrumental parameters and analytical lines free from spectral interference and with the lowest matrix effects. The analysed macro-elements were present in the following descending order: Na > Mg > Ca > K. Of all the trace elements, the tested samples showed the highest content of Fe. The micro-element Se was detected in all the samples of nuts. The toxic elements As, Cd and Pb were either not detected or the contents were below the limit of detection. One-way analysis of variance, Student's t-test, Tukey's HSD post hoc test and hierarchical agglomerative cluster analysis were applied in the statistical analysis of the results. Based on the detected content of analysed elements it can be concluded that nuts may be a good additional source of minerals as micronutrients. © 2014 Society of Chemical Industry.

La Serra d'Almos (Tarragona): an example of phenological data rescue and preservation in Catalonia

NASA Astrophysics Data System (ADS)

Busto, Montserrat; Cunillera, Jordi; de Yzaguirre, Xavi; Borrell, Josep

2016-04-01

The interruption of important phenological series and the progressive disappearance of phenological observations in Catalonia led the Meteorological Service of Catalonia (SMC) to design and impulse a new phenological network promoted by the Climate Change Unit of this Met Service. The "Fenocat" network was born in March 2013, and currently has around fifty observers distributed throughout Catalonia that observe plants, birds and butterflies. We are providing data from different plant phenophases to PEP725 database. Besides this new phenological network (Fenocat), one of the aims of SMC is to rescue and preserve historical data from different observation points in Catalonia. We show in this poster the example of rescue and preservation of phenological data from la Serra d'Almos (in Tivissa, near Tarragona, Catalonia, NE Iberian Peninsula), an observation series that began in 1973. After digitalization process and quality control tasks, we show preliminary results of this phenological series, and we compare them with those of similar European series. We show the evolution trends for different observed species, such as almond tree (Prunus dulcis), hazel (Corylus avellana), plum (Prunus domestica), olive tree (Olea europea), apple tree (Malus domestica) or vineyard (Vitis vinifera).

Sugars profiles of different chestnut (Castanea sativa Mill.) and almond (Prunus dulcis) cultivars by HPLC-RI.

PubMed

Barreira, João C M; Pereira, José Alberto; Oliveira, M Beatriz P P; Ferreira, Isabel C F R

2010-03-01

Sugar profiles of different almond and chestnut cultivars were obtained by high-performance liquid chromatography (HPLC), by means of a refractive index (RI) detector. A solid-liquid extraction procedure was used in defatted and dried samples. The chromatographic separation was achieved using a Eurospher 100-5 NH(2) column using an isocratic elution with acetonitrile/water (70:30, v/v) at a flow rate of 1.0 ml/min. All the compounds were separated in 16 min. The method was optimized and proved to be reproducible and accurate. Generally, more than 95% of sugars were identified for both matrixes. Sugars profiles were quite homogeneous for almond cultivars; sucrose was the main sugar (11.46 +/- 0.14 in Marcona to 22.23 +/- 0.59 in Ferragnes g/100 g of dried weight), followed by raffinose (0.71 +/- 0.05 in Ferraduel to 2.11 +/- 0.29 in Duro Italiano), glucose (0.42 +/- 0.12 in Pegarinhos two seeded to 1.47 +/- 0.19 in Ferragnes) and fructose (0.11 +/- 0.02 in Pegarinhos two seeded to 0.59 +/- 0.05 in Gloriette). Commercial cultivars proved to have higher sucrose contents, except in the case of Marcona. Nevertheless, chestnut cultivars revealed a high heterogeneity. Sucrose was the main sugar in Aveleira (22.05 +/- 1.48), Judia (23.30 +/- 0.83) and Longal (9.56 +/- 0.91), while glucose was slightly prevalent in Boa Ventura (6.63 +/- 0.49). The observed variance could serve for inter-cultivar discrimination.

Fatty acid composition and anticancer activity in colon carcinoma cell lines of Prunus dulcis seed oil.

PubMed

Mericli, Filiz; Becer, Eda; Kabadayı, Hilal; Hanoglu, Azmi; Yigit Hanoglu, Duygu; Ozkum Yavuz, Dudu; Ozek, Temel; Vatansever, Seda

2017-12-01

Almond oil is used in traditional and complementary therapies for its numerous health benefits due to high unsaturated fatty acids content. This study investigated the composition and in vitro anticancer activity of almond oil from Northern Cyprus and compared with almond oil from Turkey. Almond oil from Northern Cyprus was obtained by supercritical CO 2 extraction and analyzed by GC-MS. Almond oil of Turkey was provided from Turkish pharmacies. Different concentrations of almond oils were incubated for 24 and 48 h with Colo-320 and Colo-741 cells. Cell growth and cytotoxicity were measured by MTT assays. Anticancer and antiprolifetarive activities of almond oils were investigated by immunocytochemistry using antibodies directed against to BMP-2, β-catenin, Ki-67, LGR-5 and Jagged 1. Oleic acid (77.8%; 75.3%), linoleic acid (13.5%; 15.8%), palmitic acid (7.4%; 6.3%), were determined as the major compounds of almond oil from Northern Cyprus and Turkey, respectively. In the MTT assay, both almond oils were found to be active against Colo-320 and Colo-741 cells with 1:1 dilution for both 24 h and 48 h. As a result of immunohistochemical staining, while both almond oils exhibited significant antiproliferative and anticancer activity, these activities were more similar in Colo-320 cells which were treated with Northern Cyprus almond oil. Almond oil from Northern Cyprus and Turkey may have anticancer and antiproliferative effects on colon cancer cells through molecular signalling pathways and, thus, they could be potential novel therapeutic agents.

Ultrasound-assisted extraction and preliminary purification of proanthocyanidins and chlorogenic acid from almond (Prunus dulcis) skin.

PubMed

Ma, Xue; Zhou, Xin-Yu; Qiang, Qian-Qian; Zhang, Zhi-Qi

2014-07-01

An aqueous solution of polyethylene glycol (PEG) as a green solvent was employed for the first time to develop the ultrasound-assisted extraction of proanthocyanidins (PA) and chlorogenic acid (CA) from almond skin. The optimized extraction parameters were determined based on response surface methodology, and corresponded to an ultrasound power of 120 W, a liquid-to-solid ratio of 20:1 (mL/g), and a PEG concentration of 50% (v/v). Under these optimized conditions, the extraction yields of PAs and CA from almond skin were 32.68 ± 0.22 and 16.01 ± 0.19 mg/g, respectively. Compared with organic solvent extraction, PEG solution extraction produced higher yields. Different macroporous resins were compared for their performance in purifying PAs and CA from almond skin extract. Static adsorption/desorption experimental results demonstrated that AB-8 resin exhibits excellent purification performance at pH 4. Under the optimized dynamic adsorption/desorption conditions on the AB-8 column, the total recovery of purification for PAs and CA was 80.67%. The total content of PAs and CA in the preliminarily purified extract was 89.17% (with respective contents of 60.90 and 28.27%). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

PubMed

Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

2005-03-01

Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

The classification of almonds (Prunus dulcis) by country and variety using UHPLC-HRMS-based untargeted metabolomics.

PubMed

Gil Solsona, R; Boix, C; Ibáñez, M; Sancho, J V

2018-03-01

The aim of this study was to use an untargeted UHPLC-HRMS-based metabolomics approach allowing discrimination between almonds based on their origin and variety. Samples were homogenised, extracted with ACN:H 2 O (80:20) containing 0.1% HCOOH and injected in a UHPLC-QTOF instrument in both positive and negative ionisation modes. Principal component analysis (PCA) was performed to ensure the absence of outliers. Partial least squares - discriminant analysis (PLS-DA) was employed to create and validate the models for country (with five different compounds) and variety (with 20 features), showing more than 95% accuracy. Additional samples were injected and the model was evaluated with blind samples, with more than 95% of samples being correctly classified using both models. MS/MS experiments were carried out to tentatively elucidate the highlighted marker compounds (pyranosides, peptides or amino acids, among others). This study has shown the potential of high-resolution mass spectrometry to perform and validate classification models, also providing information concerning the identification of the unexpected biomarkers which showed the highest discriminant power.

The Small-RNA Profiles of Almond (Prunus dulcis Mill.) Reproductive Tissues in Response to Cold Stress.

PubMed

Karimi, Marzieh; Ghazanfari, Farahnaz; Fadaei, Adeleh; Ahmadi, Laleh; Shiran, Behrouz; Rabei, Mohammad; Fallahi, Hossein

2016-01-01

Spring frost is an important environmental stress that threatens the production of Prunus trees. However, little information is available regarding molecular response of these plants to the frost stress. Using high throughput sequencing, this study was conducted to identify differentially expressed miRNAs, both the conserved and the non-conserved ones, in the reproductive tissues of almond tolerant H genotype under cold stress. Analysis of 50 to 58 million raw reads led to identification of 174 unique conserved and 59 novel microRNAs (miRNAs). Differential expression pattern analysis showed that 50 miRNA families were expressed differentially in one or both of almond reproductive tissues (anther and ovary). Out of these 50 miRNA families, 12 and 15 displayed up-regulation and down-regulation, respectively. The distribution of conserved miRNA families indicated that miR482f harbor the highest number of members. Confirmation of miRNAs expression patterns by quantitative real- time PCR (qPCR) was performed in cold tolerant (H genotype) alongside a sensitive variety (Sh12 genotype). Our analysis revealed differential expression for 9 miRNAs in anther and 3 miRNAs in ovary between these two varieties. Target prediction of miRNAs followed by differential expression analysis resulted in identification of 83 target genes, mostly transcription factors. This study comprehensively catalogued expressed miRNAs under different temperatures in two reproductive tissues (anther and ovary). Results of current study and the previous RNA-seq study, which was conducted in the same tissues by our group, provide a unique opportunity to understand the molecular basis of responses of almond to cold stress. The results can also enhance the possibility for gene manipulation to develop cold tolerant plants.

Determination of advanced glycation endproducts by LC-MS/MS in raw and roasted almonds (Prunus dulcis).

PubMed

Zhang, Gong; Huang, Guangwei; Xiao, Lu; Mitchell, Alyson E

2011-11-23

A sensitive and reliable LC-(ESI)MS/MS method was developed and validated for the simultaneous analysis of five common advanced glycation endproducts (AGEs) after enzymatic digestion in raw and roasted almonds. AGEs included carboxymethyl-lysine (CML), carboxyethyl-lysine (CEL), pyralline (Pyr), argpyrimidine (Arg-p), and pentosidine (Pento-s). This method allows accurate quantitation of free and AGE-protein adducts of target AGEs. Results indicate that CML and CEL are found in both raw and roasted almonds. Pyr was identified for the first time in roasted almonds and accounted for 64.4% of free plus bound measured AGEs. Arg-p and Pento-s were below the limit of detection in all almond samples tested. Free AGEs accounted for 1.3-26.8% of free plus bound measured AGEs, indicating that protein-bound forms predominate. The roasting process significantly increased CML, CEL, and Pyr formation, but no significant correlation was observed between these AGEs and roasting temperature.

The Small-RNA Profiles of Almond (Prunus dulcis Mill.) Reproductive Tissues in Response to Cold Stress

PubMed Central

Shiran, Behrouz; Rabei, Mohammad; Fallahi, Hossein

2016-01-01

Spring frost is an important environmental stress that threatens the production of Prunus trees. However, little information is available regarding molecular response of these plants to the frost stress. Using high throughput sequencing, this study was conducted to identify differentially expressed miRNAs, both the conserved and the non-conserved ones, in the reproductive tissues of almond tolerant H genotype under cold stress. Analysis of 50 to 58 million raw reads led to identification of 174 unique conserved and 59 novel microRNAs (miRNAs). Differential expression pattern analysis showed that 50 miRNA families were expressed differentially in one or both of almond reproductive tissues (anther and ovary). Out of these 50 miRNA families, 12 and 15 displayed up-regulation and down-regulation, respectively. The distribution of conserved miRNA families indicated that miR482f harbor the highest number of members. Confirmation of miRNAs expression patterns by quantitative real- time PCR (qPCR) was performed in cold tolerant (H genotype) alongside a sensitive variety (Sh12 genotype). Our analysis revealed differential expression for 9 miRNAs in anther and 3 miRNAs in ovary between these two varieties. Target prediction of miRNAs followed by differential expression analysis resulted in identification of 83 target genes, mostly transcription factors. This study comprehensively catalogued expressed miRNAs under different temperatures in two reproductive tissues (anther and ovary). Results of current study and the previous RNA-seq study, which was conducted in the same tissues by our group, provide a unique opportunity to understand the molecular basis of responses of almond to cold stress. The results can also enhance the possibility for gene manipulation to develop cold tolerant plants. PMID:27253370

Suppressive effect of an aqueous extract of Diospyros kaki calyx on dust mite extract/2,4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions.

PubMed

Yu, Ju-Hee; Jin, Meiling; Choi, Young-Ae; Jeong, Na-Hee; Park, Jeong-Sook; Shin, Tae-Yong; Kim, Sang-Hyun

2017-08-01

Atopic dermatitis (AD) is a common chronic inflammatory skin disease, affecting 10-20% of individuals worldwide. Therefore, the discovery of drugs for treating AD is an attractive subject and important to human health. Diospyros kaki and Diospyros kaki (D. kaki) folium exert beneficial effects on allergic inflammation. However, the effect of D. kaki calyx on AD remains elusive. The present study evaluated the effects of an aqueous extract of D. kaki calyx (AEDKC) on AD-like skin lesions using mouse and keratinocyte models. We used a mouse AD model by the repeated skin exposure of house dust mite extract [Dermatophagoides farinae extract (DFE)] and 2,4-dinitrochlorobenzene (DNCB) to the ears. In addition, to determine the underlying mechanism of its operation, tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ)-activated keratinocytes (HaCaT) were used. Oral administration of AEDKC decreased AD-like skin lesions, as demonstrated by the reduced ear thickness, serum immunoglobulin E (IgE), DFE-specific IgE, IgG2a, histamine level and inflammatory cell infiltration. AEDKC inhibited the expression of pro-inflammatory cytokines and a chemokine via downregulation of nuclear factor-κB and signal transducer and activator of transcription 1 in HaCaT cells. On examination of the AD-related factors in vivo and in vitro, it was confirmed that AEDKC decreased AD-like skin lesions. Taken together, the results suggest that AEDKC is a potential drug candidate for the treatment of AD.

Role of serotonin in the intestinal mucosal epithelium barrier in weaning mice undergoing stress-induced diarrhea.

PubMed

Dong, Yulan; Wang, Zixu; Qin, Zhuoming; Cao, Jing; Chen, Yaoxing

2018-02-01

Stress-induced diarrhea is a frequent and challenging threat to humans and domestic animals. Serotonin (5-HT) has been shown to be involved in the pathological process of stress-induced diarrhea. However, the role of 5-HT in stress-induced diarrhea remains unclear. A stress-induced diarrhea model was established in 21-day-old ICR weaning mice through an intragastric administration of 0.25 mL of 0.4 g/mL folium sennae and restraint of the hind legs with adhesive tape for 4 h to determine whether 5-HT regulates the mucosal barrier to cause diarrhea. Mice with decreased levels of 5-HT were pretreated with an intraperitoneal injection of 300 mg/kg p-chlorophenylalanine (PCPA), a 5-HT synthesis inhibitor. After 5 days of treatment, the stress level, body weight and intestinal mucosal morphology indexes were measured. Compared to the controls, the mice with stress-induced diarrhea displayed a stress reaction, with increased corticosterone levels, as well as increased 5-HT-positive cells. However, the mice with stress-induced diarrhea exhibited decreased body weights, villus height to crypt depth ratios (V/C), and Occludin and Claudin1 expression. The PCPA injection reversed these effects in mice with different degrees of stress-induced diarrhea. Based on these findings, inhibition of 5-HT synthesis relieved the stress response and improved the health of the intestinal tract, including both the intestinal absorption capacity, as determined by the villus height and crypt depth, and the mucosal barrier function, as determined by the tight junction proteins of epithelial cell.

Structural stability of Amandin, a major allergen from almond (Prunus dulcis), and its acidic and basic polypeptides.

PubMed

Albillos, Silvia M; Menhart, Nicholas; Fu, Tong-Jen

2009-06-10

Information relating to the resistance of food allergens to thermal and/or chemical denaturation is critical if a reduction in protein allergenicity is to be achieved through food-processing means. This study examined the changes in the secondary structure of an almond allergen, amandin, and its acidic and basic polypeptides as a result of thermal and chemical denaturation. Amandin ( approximately 370 kDa) was purified by cryoprecipitation followed by gel filtration chromatography and subjected to thermal (13-96 degrees C) and chemical (urea and dithiothreitol) treatments. Changes in the secondary structure of the protein were followed using circular dichroism spectroscopy. The secondary structure of the hexameric amandin did not undergo remarkable changes at temperatures up to 90 degrees C, although protein aggregation was observed. In the presence of a reducing agent, irreversible denaturation occurred with the following experimental values: T(m) = 72.53 degrees C (transition temperature), DeltaH = 87.40 kcal/mol (unfolding enthalpy), and C(p) = 2.48 kcal/(mol degrees C) (heat capacity). The concentration of urea needed to achieve 50% denaturation was 2.59 M, and the Gibbs free energy of chemical denaturation was calculated to be DeltaG = 3.82 kcal/mol. The basic and acidic polypeptides of amandin had lower thermal stabilities than the multimeric protein.

Supervised chemical pattern recognition in almond ( Prunus dulcis ) Portuguese PDO cultivars: PCA- and LDA-based triennial study.

PubMed

Barreira, João C M; Casal, Susana; Ferreira, Isabel C F R; Peres, António M; Pereira, José Alberto; Oliveira, M Beatriz P P

2012-09-26

Almonds harvested in three years in Trás-os-Montes (Portugal) were characterized to find differences among Protected Designation of Origin (PDO) Amêndoa Douro and commercial non-PDO cultivars. Nutritional parameters, fiber (neutral and acid detergent fibers, acid detergent lignin, and cellulose), fatty acids, triacylglycerols (TAG), and tocopherols were evaluated. Fat was the major component, followed by carbohydrates, protein, and moisture. Fatty acids were mostly detected as monounsaturated and polyunsaturated forms, with relevance of oleic and linoleic acids. Accordingly, 1,2,3-trioleoylglycerol and 1,2-dioleoyl-3-linoleoylglycerol were the major TAG. α-Tocopherol was the leading tocopherol. To verify statistical differences among PDO and non-PDO cultivars independent of the harvest year, data were analyzed through an analysis of variance, a principal component analysis, and a linear discriminant analysis (LDA). These differences identified classification parameters, providing an important tool for authenticity purposes. The best results were achieved with TAG analysis coupled with LDA, which proved its effectiveness to discriminate almond cultivars.

Acrylamide formation in almonds (Prunus dulcis): influences of roasting time and temperature, precursors, varietal selection, and storage.

PubMed

Zhang, Gong; Huang, Guangwei; Xiao, Lu; Seiber, James; Mitchell, Alyson E

2011-08-10

Acrylamide is a probable human carcinogen that is found in many roasted and baked foods. This paper describes two sensitive and reliable LC-(ESI)MS/MS methods for the analysis of (1) acrylamide and (2) common acrylamide precursors (i.e., glucose, fructose, asparagine, and glutamine) in raw and roasted almonds. These methods were used to evaluate the impact of roasting temperatures (between 129 and 182 °C) and times on acrylamide formation. Controlling the roasting temperature at or below 146 °C resulted in acrylamide levels below 200 ppb at all roasting times evaluated. Six varieties of almonds collected in various regions of California over two harvest years and roasted at 138 °C for 22 min had acrylamide levels ranging from 117 ± 5 μg/kg (Sonora) to 221 ± 95 μg/kg (Butte) with an average of 187 ± 71 μg/kg. A weak correlation between asparagine content in raw almonds and acrylamide formation was observed (R(2) = 0.6787). No statistical relationship was found between acrylamide formation and almond variety, orchard region, or harvest year. Stability studies on roasted almonds indicated that acrylamide levels decreased by 12.9-68.5% (average of 50.2%) after 3 days of storage at 60 °C. Short-term elevated temperature storage may be another approach for mitigating acrylamide levels in roasted almonds.

Production of in vivo biotinylated scFv specific to almond (Prunus dulcis) proteins by recombinant Pichia pastoris.

PubMed

de la Cruz, Silvia; Alcocer, Marcos; Madrid, Raquel; García, Aina; Martín, Rosario; González, Isabel; García, Teresa

2016-06-10

The methylotropic yeast Pichia pastoris has demonstrated its suitability for large-scale production of recombinant proteins. As an eukaryotic organism P. pastoris presents a series of advantages at expression and processing of heterologous proteins when compared with Escherichia coli. In this work, P. pastoris has been used to express a scFv from a human synthetic library previously shown to bind almond proteins. In order to facilitate purification and post processing manipulations, the scFv was engineered with a C-terminal tag and biotinylated in vivo. After purification, biotinylated scFv were bound to avidin conjugated with HRP producing a multimeric scFv. The multimeric scFv showed to maintain their ability to recognize almond protein when assayed in ELISA, reaching a LOD of 470mgkg(-1). This study describes an easy method to produce large quantities of in vivo biotinylated scFv in P. pastoris. By substituting the enzyme or fluorochromes linked to avidin, it will be possible to generate a diverse number of multimeric scFv as probes to suit different analytical platforms in the detection of almond in food products. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of roasting conditions on color and volatile profile including HMF level in sweet almonds (Prunus dulcis).

PubMed

Agila, Amal; Barringer, Sheryl

2012-04-01

Microwave, oven, and oil roasting of almonds were used to promote almond flavor and color formation. Raw pasteurized almonds were roasted in a microwave for 1 to 3 min, in an oven at 177 °C for 5, 10, 15, and 20 min; and at 135 and 163 °C for 20 min, and in oil at 135, 163, and 177 °C for 5 min and 177 °C for 10 min. Volatile compounds were quantified in the headspace of ground almonds, both raw and roasted, by selected ion flow tube mass spectrometry. Strong correlations were found between L value, chroma, and 5-(hydroxy methyl)-2- furfural; and were independent of roasting method. Raw almonds had lower concentrations of most volatiles than roasted almonds. Conditions that produced color equivalent to commercial samples were 2 min in the microwave, 5 min at 177 °C in the oven, and 5 min at 135 °C in oil. Microwave heating produced higher levels of most volatiles than oven and oil roasting at commercial color. Sensory evaluation indicated that microwave-roasted almonds had the strongest aroma and were the most preferred. Oil-roasted almonds showed significantly lower levels of volatiles than other methods, likely due to loss of these volatiles into the oil. Alcohols such as benzyl alcohols and strecker aldehydes including benzaldehyde and methional were at higher concentrations than other volatiles in roasted almonds. The oxidation of lipids to form alkanals such as nonanal and degradation of sugars to form furan type compounds was also observed. The Maillard reaction contributed to the formation of more of the total volatiles in almonds than the lipid oxidation reaction. The level of 5-(hydroxy methyl)-2- furfural (HMF), color, volatile profile, and sensory perception can be used to develop the best roasting method, time, and temperature for almonds. The rate of color development and the production of volatiles differ under different roasting conditions. Based on the color, volatile, and sensory assessments of the 3 almonds, the use of microwave technology as a process for roasting almonds reduces processing time and leads to an almond product with better flavor than oven or oil roasting. © 2012 Institute of Food Technologists®

An efficient regeneration and rapid micropropagation protocol for Almond using dormant axillary buds as explants.

PubMed

Choudhary, Ravish; Chaudhury, Rekha; Malik, Surendra Kumar; Sharma, Kailash Chandra

2015-07-01

An efficient in vitro protocol was standardized for Almond (Prunus dulcis) propagation using dormant axillary buds as explants. Explants were cultured on Murashige and Skoog (MS) and woody plant medium (WPM) supplemented with different concentration/combination(s) of phytohormones. MS basal medium showed lowest shoot induction and took longest duration for shoot initiation. Multiple shoots were induced in MS medium supplemented with the combination of BAP (0.5 mgL(-1)). Cultures showed poor response for rooting in all combinations of plant growth regulators (PGRs) and took 90 days for initiation. Rooting was higher in half strength of MS than in full-strength. The highest root induction (33.33%) was recorded in half MS medium supplemented with 0.1 mgL(-1) IBA (indole-3-butyric acid) followed by full strength of MS medium (20%) supplemented with IBA (0.1 mgL(-1)). α-Naphthalene acetic acid (NAA) was less effective for rooting than IBA. The highest root induction (25%) was found in half strength of MS medium supplemented with 0.1 mgL(-1) NAA followed by full strength of MS medium (20%). The protocol developed would be of use in mass propagation of almond and also support in vitro conservation.

Ethnopharmacology of Medicinal Plants of the Pantanal Region (Mato Grosso, Brazil)

PubMed Central

Bieski, Isanete Geraldini Costa; Rios Santos, Fabrício; de Oliveira, Rafael Melo; Espinosa, Mariano Martinez; Macedo, Miramy; Albuquerque, Ulysses Paulino; de Oliveira Martins, Domingos Tabajara

2012-01-01

Traditional knowledge is an important source of obtaining new phytotherapeutic agents. Ethnobotanical survey of medicinal plants was conducted in Nossa Senhora Aparecida do Chumbo District (NSACD), located in Poconé, Mato Grosso, Brazil using semi-structured questionnaires and interviews. 376 species of medicinal plants belonging to 285 genera and 102 families were cited. Fabaceae (10.2%), Asteraceae (7.82%) and Lamaceae (4.89%) families are of greater importance. Species with the greater relative importance were Himatanthus obovatus (1.87), Hibiscus sabdariffa (1.87), Solidago microglossa (1.80), Strychnos pseudoquina (1.73) and Dorstenia brasiliensis, Scoparia dulcis L., and Luehea divaricata (1.50). The informant consensus factor (ICF) ranged from 0.13 to 0.78 encompassing 18 disease categories,of which 15 had ICF greater than 0.50, with a predominance of disease categories related to injuries, poisoning and certain other consequences of external causes (ICF  =  0.78) having 65 species cited while 20 species were cited for mental and behavioral disorders (ICF  =  0.77). The results show that knowledge about medicinal plants is evenly distributed among the population of NSACD. This population possesses medicinal plants for most disease categories, with the highest concordance for prenatal, mental/behavioral and respiratory problems. PMID:22474496

Ethnopharmacology of medicinal plants of the pantanal region (mato grosso, Brazil).

PubMed

Bieski, Isanete Geraldini Costa; Rios Santos, Fabrício; de Oliveira, Rafael Melo; Espinosa, Mariano Martinez; Macedo, Miramy; Albuquerque, Ulysses Paulino; de Oliveira Martins, Domingos Tabajara

2012-01-01

Traditional knowledge is an important source of obtaining new phytotherapeutic agents. Ethnobotanical survey of medicinal plants was conducted in Nossa Senhora Aparecida do Chumbo District (NSACD), located in Poconé, Mato Grosso, Brazil using semi-structured questionnaires and interviews. 376 species of medicinal plants belonging to 285 genera and 102 families were cited. Fabaceae (10.2%), Asteraceae (7.82%) and Lamaceae (4.89%) families are of greater importance. Species with the greater relative importance were Himatanthus obovatus (1.87), Hibiscus sabdariffa (1.87), Solidago microglossa (1.80), Strychnos pseudoquina (1.73) and Dorstenia brasiliensis, Scoparia dulcis L., and Luehea divaricata (1.50). The informant consensus factor (ICF) ranged from 0.13 to 0.78 encompassing 18 disease categories,of which 15 had ICF greater than 0.50, with a predominance of disease categories related to injuries, poisoning and certain other consequences of external causes (ICF  =  0.78) having 65 species cited while 20 species were cited for mental and behavioral disorders (ICF  =  0.77). The results show that knowledge about medicinal plants is evenly distributed among the population of NSACD. This population possesses medicinal plants for most disease categories, with the highest concordance for prenatal, mental/behavioral and respiratory problems.

Antibacterial activities of the methanol extracts of Albizia adianthifolia, Alchornea laxiflora, Laportea ovalifolia and three other Cameroonian plants against multi-drug resistant Gram-negative bacteria.

PubMed

Tchinda, Cedric F; Voukeng, Igor K; Beng, Veronique P; Kuete, Victor

2017-05-01

In the last 10 years, resistance in Gram-negative bacteria has been increasing. The present study was designed to evaluate the in vitro antibacterial activities of the methanol extracts of six Cameroonian medicinal plants Albizia adianthifolia , Alchornea laxiflora , Boerhavia diffusa , Combretum hispidum , Laportea ovalifolia and Scoparia dulcis against a panel of 15 multidrug resistant Gram-negative bacterial strains. The broth microdilution was used to determine the minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of the extracts. The preliminary phytochemical screening of the extracts was conducted according to the reference qualitative phytochemical methods. Results showed that all extracts contained compounds belonging to the classes of polyphenols and triterpenes, other classes of chemicals being selectively distributed. The best antibacterial activities were recorded with bark and root extracts of A. adianthifolia as well as with L. ovalifolia extract, with MIC values ranging from 64 to 1024 μg/mL on 93.3% of the fifteen tested bacteria. The lowest MIC value of 64 μg/mL was recorded with A. laxiflora bark extract against Enterobacter aerogenes EA289. Finally, the results of this study provide evidence of the antibacterial activity of the tested plants and suggest their possible use in the control of multidrug resistant phenotypes.

Use of household ingredients as complementary medicines for perceived hypoglycemic benefit among Sri Lankan diabetic patients; a cross-sectional survey.

PubMed

Medagama, Arjuna Bandara; Senadhira, Danusha

2015-01-01

Biologic based therapies are frequently used as complementary medicines in diabetes. The aim of this study was to identify the commonly used herbal remedies and their preparations in Sri Lankan patients with Type 2 diabetes. This is a descriptive, cross-sectional study on 220 diabetic patients using herbal remedies for perceived glycemic benefit. All the patients used their regular conventional medications together with herbal remedies. The most commonly used medication was metformin (91.4%). Ivy gourd (Coccinia grandis) was the most commonly used herbal remedy (32%), followed by crepe ginger (Costus speciosus) (25%) and bitter gourd (Momordica charantia) (20%). Herbal remedies used less frequently were finger millet (Eleusine corocana) (5%), anguna leaves (Wattakaka volubilis) (5%), goat weed (Scoparia dulcis) (4%), Salacia reticulata (4%), fenugreek (Trigonella foenum-graecum) (3%) and tree turmeric (Coscinium fenestratum) (0.5%). None of the patients used commercially available over-the-counter herbal products. The common preparations were salads (72.8%), curries (12.8%), herbal tea (6%), and herbal porridges (6%). The practice of using household ingredients as complementary medicines is common in Sri Lanka. Few herbal remedies and their methods of preparation have limited evidence for efficacy. In view of the frequent use by diabetic patients each needs to be documented for reference and scientifically explored about their hypoglycemic potential.

Evaluation of the effect of clinostat rotation on pollen germination and tube development as a tool for selection of plants in Space

NASA Astrophysics Data System (ADS)

De Micco, Veronica; Scala, Michele; Aronne, Giovanna

2006-05-01

The choice of species and cultivar on which rely to sustain Close Loop Environmental Systems is generally approached by analysing the behaviour of plants in presence of stress (sporophytic selection). In this paper, we investigated the possibility to conduct the selection among genotypes in Space through the male gametophytic selection. Thus, we studied the effect of simulated microgravity on pollen germination and tube development of both woody and herbaceous crop species: Prunus armeniaca (apricot), P. dulcis (almond), Malus domestica (apple) and Vicia faba (broad bean). Pollen collected from just bloomed flowers was assessed for viability and incubated on the optimal growing medium in petri dishes both on a uni-axial clinostat and stationary in 1g. Then, pollen was observed under a light microscope to detect percent germination and growth direction. Histochemical analyses were performed to verify the presence and distribution of storage substances. Moreover, specific stainings and epifluorescent microscopy were applied to count nuclei, follow the migration of sperm cells and investigate the presence, size and morphology of callose plugs. Results showed that simulated microgravity affected pollen tube development. The different response showed by the various species indicates that male-gametophytic selection could be useful for the selection of plants in microgravity.

Lead sorption by waste biomass of hazelnut and almond shell.

PubMed

Pehlivan, Erol; Altun, Türkan; Cetin, Serpil; Iqbal Bhanger, M

2009-08-15

The potential to remove Pb(2+) ion from aqueous solutions using the shells of hazelnut (HNS) (Corylus avellana) and almond (AS) (Prunus dulcis) through biosorption was investigated in batch experiments. The main parameters influencing Pb(2+) ion sorption on HNS and AS were: initial metal ion concentration, amount of adsorbent, contact time and pH value of solution. The influences of initial Pb(2+) ion concentration (0.1-1.0mM), pH (2-9), contact time (10-240 min) and adsorbent amount (0.1-1.0 g) have been investigated. Equilibrium isotherms have been measured and modelled. Adsorption of Pb(2+) ions was in all cases pH-dependent showing a maximum at equilibrium pH values between 6.0 and 7.0, depending on the biomaterial, that corresponded to equilibrium pH values of 6.0 for HNS and 7.0 for AS. The equilibrium sorption capacities of HNS and AS were 28.18 and 8.08 mg/g for lead, respectively after equilibrium time of 2h. The adsorption data fit well with the Langmuir isotherm model and the experimental result inferred that adsorption, chelation and ion exchange are major adsorption mechanisms for binding Pb(2+) ion to the sorbents.

Direct Measurements of Water Canopy Storage Capacity of Broadleaf Shrubs under Different Temperature and Wetting Regimes

NASA Astrophysics Data System (ADS)

Yerk, W.

2016-12-01

It is generally agreed that canopy water storage capacity is one of the defining factors of rainfall interception. Multiple studies of storage capacity by shrubs have been published. However, only a fraction of species have been studied. In the presented study the storage capacity of five species (Aronia melanocarpa, Cornus sericea, Hydrangea quercifolia, Itea virginica, and Prunus laurocerasus) was directly measured in an indoor experiment. Effect of the water temperature on the amount of water stored by the canopy was also investigated. Five branches of each species (length 0.25-0.60 m, LAI 1.3-3.6) were selected. Methods of full submergence in water and a simulated rain of intensity of 187.5±9.9 mm/hr were applied. Water of two different temperatures of 30°C and 1.5°C was used for the submergence method. Weight of the branches fixated in a natural position was measured with a digital balance. Storage capacity was expressed as a depth of water retained by the entire branch divided by the one-sided area of all leaves. The storage capacity obtained by submergence was 0.45±0.5 mm for A. melanocarpa, 0.33±0.03 mm for C. sericea, 0.40±0.02 mm for H. quercifolia, 0.48±0.05 mm for I. virginica, and 0.67±0.09 mm for P. laurocerasus. Difference in the storage capacities obtained by both methods was inconsistent. Water temperature exerted a more pronounced effect on the capacity. The canopies stored 0.01 to 0.05 mm more water (p-value < 0.005 for all species except A. melanocarpa). Our findings correspond with the range of storage capacity reported for shrub species. The directly measured storage capacity exceeds the widely used in hydrological modeling value of 0.2 mm. We were able to detect an increase of capacity to store cold water; however, the increase was below the practical level.

Isolation and quantification of oligomeric and polymeric procyanidins in leaves and flowers of Hawthorn (Crataegus spp.).

PubMed

Hellenbrand, N; Sendker, J; Lechtenberg, M; Petereit, F; Hensel, A

2015-07-01

Proanthocyanidins (PAs) constitute a class of polyphenols with flavan-3-ols as monomeric building blocks. These polyphenols are mostly quantified by colorimetric methods or by chromatographic determination of monomeric flavan-3-ols or low molecular oligomers as lead compounds. No reliable analytical methods are available for unambiguous identification of the homologues series of oligo- and polymeric PAs. For Hawthorn leaf and flower (Crataegi folium cum flore) from Crataegus spp. (Rosaceae) a protocol for preparative isolation of oligomeric and polymeric PAs from an acetone-water extract was developed, yielding procyanidin reference clusters with defined degree of polymerization (DP) from 2 to 10 besides a procyanidin-polymer. Identity and purity of these clusters were proven by HPLC, MS and in part NMR studies. For identification and quantification from Hawthorn an ICH-Q2 validated UHPLC method with fluorimetric detection and less than 10min runtime was developed. The method enabled quantification of procyanidin clusters with DP from 2 to 10 besides the polymer fraction. Batch analysis revealed procyanidin contents of about 20 to 45mg/g from a homologues series of oligomeric PAs and about 50% of polymer fraction. Monitoring of procyanidin distribution during seasonal growth of fresh plants of Crataegus monogyna showed more or less constant contents between 20 and 55mg/g dry weight of oligomeric procyanidins during the growing season in the different plant organs with strong accumulation in the flowers and fruits (55mg/g dry weight). From these data it can be speculated that procyanidins serve as part of the plants defense system in the reproductive organs of the plant. Copyright © 2015 Elsevier B.V. All rights reserved.

Arbutin production via biotransformation of hydroquinone in in vitro cultures of Aronia melanocarpa (Michx.) Elliott.

PubMed

Kwiecień, Inga; Szopa, Agnieszka; Madej, Kornelia; Ekiert, Halina

2013-01-01

Arbutin (hydroquinone β-D-glucoside) is a compound of plant origin possessing valuable therapeutic (urinary tract disinfection) and cosmetic (skin whitening) properties, which can be obtained from in vitro cultures of plants belonging to different taxa via biotransformation of exogenously supplemented hydroquinone. Agitating cultures of Aronia melanocarpa were maintained on the Murashige and Skoog medium containing growth regulators: the cytokinin - BAP (6-benzylaminopurine), 2 mg/l and the auxin NAA (α-naphthaleneacetic acid), 2 mg/l. The biomass was cultured for 2 weeks and then hydroquinone was supplemented at the following doses: 96, 144, 192, 288 and 384 mg/l either undivided or divided into two or three portions added at 24-hour intervals. The content of the reaction product - arbutin, was determined using an HPLC method in methanolic extracts from biomass and lyophilized medium samples collected 24 hours after the addition of the last precursor dose. The total amounts of arbutin were very diverse, from 2.71 to 8.27 g/100g d.w. The production of arbutin rose with increasing hydroquinone concentration. The maximum content of the product was observed after hydroquinone addition at 384 mg/l divided into two portions. Biotransformation efficiency also varied widely, ranging from 37.04% do 73.80%. The identity of the product - arbutin, after its isolation and purification was confirmed by spectral analysis ((1)H-NMR spectrum). The maximum amount of arbutin obtained was higher than that required by the latest 9(th) Edition of the Polish Pharmacopoeia and by the newest 8th Edithion of European Pharmacopoeia for Uvae ursi folium (7.0 g/100g d.w.), and is interesting from practical point of view.

Quantification of amygdalin in nonbitter, semibitter, and bitter almonds (Prunus dulcis) by UHPLC-(ESI)QqQ MS/MS.

PubMed

Lee, Jihyun; Zhang, Gong; Wood, Elizabeth; Rogel Castillo, Cristian; Mitchell, Alyson E

2013-08-14

Amygdalin is a cynaogenic diglucoside responsible for the bitterness of almonds. Almonds display three flavor phenotypes, nonbitter, semibitter, and bitter. Herein, the amygdalin content of 20 varieties of nonbitter, semibitter, and bitter almonds from four primary growing regions of California was determined using solid-phase extraction and ultrahigh-pressure liquid chromatography electrospray triple-quadrupole mass spectrometry (UHPLC-(ESI)QqQ MS/MS). The detection limit for this method is ≤ 0.1 ng/mL (3 times the signal-to-noise ratio) and the LOQ is 0.33 ng/mL (10 times the signal-to-noise ratio), allowing for the reliable quantitation of trace levels of amygdalin in nonbitter almonds (0.13 mg/kg almond). Results indicate that amygdalin concentrations for the three flavor phenotypes were significantly different (p < 0.001). The mean concentrations of amygdalin in nonbitter, semibitter, and bitter almonds are 63.13 ± 57.54, 992.24 ± 513.04, and 40060.34 ± 7855.26 mg/kg, respectively. Levels of amygdalin ranged from 2.16 to 157.44 mg/kg in nonbitter, from 523.50 to 1772.75 mg/kg in semibitter, and from 33006.60 to 53998.30 mg/kg in bitter almonds. These results suggest that phenotype classification may be achieved on the basis of amygdalin levels. Growing region had a statistically significant effect on the amygdalin concentration in commercial varieties (p < 0.05).

Use of household ingredients as complementary medicines for perceived hypoglycemic benefit among Sri Lankan diabetic patients; a cross-sectional survey

PubMed Central

Medagama, Arjuna Bandara; Senadhira, Danusha

2015-01-01

Background: Biologic based therapies are frequently used as complementary medicines in diabetes. The aim of this study was to identify the commonly used herbal remedies and their preparations in Sri Lankan patients with Type 2 diabetes. Methods: This is a descriptive, cross-sectional study on 220 diabetic patients using herbal remedies for perceived glycemic benefit. Results: All the patients used their regular conventional medications together with herbal remedies. The most commonly used medication was metformin (91.4%). Ivy gourd (Coccinia grandis) was the most commonly used herbal remedy (32%), followed by crepe ginger (Costus speciosus) (25%) and bitter gourd (Momordica charantia) (20%). Herbal remedies used less frequently were finger millet (Eleusine corocana) (5%), anguna leaves (Wattakaka volubilis) (5%), goat weed (Scoparia dulcis) (4%), Salacia reticulata (4%), fenugreek (Trigonella foenum-graecum) (3%) and tree turmeric (Coscinium fenestratum) (0.5%). None of the patients used commercially available over-the-counter herbal products. The common preparations were salads (72.8%), curries (12.8%), herbal tea (6%), and herbal porridges (6%). Conclusion: The practice of using household ingredients as complementary medicines is common in Sri Lanka. Few herbal remedies and their methods of preparation have limited evidence for efficacy. In view of the frequent use by diabetic patients each needs to be documented for reference and scientifically explored about their hypoglycemic potential. PMID:26401401

The susceptibility of soil enzymes to inhibition by leaf litter tannins is dependent on the tannin chemistry, enzyme class and vegetation history.

PubMed

Triebwasser, Daniella J; Tharayil, Nishanth; Preston, Caroline M; Gerard, Patrick D

2012-12-01

By inhibiting soil enzymes, tannins play an important role in soil carbon (C) and nitrogen (N) mineralization. The role of tannin chemistry in this inhibitory process, in conjunction with enzyme classes and isoforms, is less well understood. Here, we compared the inhibition efficiencies of mixed tannins (MTs, mostly limited to angiosperms) and condensed tannins (CTs, produced mostly by gymnosperms) against the potential activity of β-glucosidase (BG), N-acetyl-glucosaminidase (NAG), and peroxidase in two soils that differed in their vegetation histories. Compared with CTs, MTs exhibited 50% more inhibition of almond (Prunus dulcis) BG activity and greater inhibition of the potential NAG activity in the gymnosperm-acclimatized soils. CTs exhibited lower BG inhibition in the angiosperm-acclimated soils, whereas both types of tannins exhibited higher peroxidase inhibition in the angiosperm soils than in gymnosperm soils. At all of the tested tannin concentrations, irrespective of the tannin type and site history, the potential peroxidase activity was inhibited two-fold more than the hydrolase activity and was positively associated with the redox-buffering efficiency of tannins. Our finding that the inhibitory activities and mechanisms of MTs and CTs are dependent on the vegetative history and enzyme class is novel and furthers our understanding of the role of tannins and soil isoenzymes in decomposition. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Non-target effects of fungicides on nectar-inhabiting fungi of almond flowers.

PubMed

Schaeffer, Robert N; Vannette, Rachel L; Brittain, Claire; Williams, Neal M; Fukami, Tadashi

2017-04-01

Nectar mediates interactions between plants and pollinators in natural and agricultural systems. Specialized microorganisms are common nectar inhabitants, and potentially important mediators of plant-pollinator interactions. However, their diversity and role in mediating pollination services in agricultural systems are poorly characterized. Moreover, agrochemicals are commonly applied to minimize crop damage, but may present ecological consequences for non-target organisms. Assessment of ecological risk has tended to focus on beneficial macroorganisms such as pollinators, with less attention paid to microorganisms. Here, using culture-independent methods, we assess the impact of two widely-used fungicides on nectar microbial community structure in the mass-flowering crop almond (Prunus dulcis). We predicted that fungicide application would reduce fungal richness and diversity, whereas competing bacterial richness would increase, benefitting from negative effects on fungi. We found that fungicides reduced fungal richness and diversity in exposed flowers, but did not significantly affect bacterial richness, diversity, or community composition. The relative abundance of Metschnikowia OTUs, nectar specialists that can impact pollination, was reduced by both fungicides. Given growing recognition of the importance of nectar microorganisms as mediators of plant-pollinator mutualisms, future research should consider the impact of management practices on plant-associated microorganisms and consequences for pollination services in agricultural landscapes. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Antigenotoxic Effect Against Ultraviolet Radiation-induced DNA Damage of the Essential Oils from Lippia Species.

PubMed

Quintero Ruiz, Nathalia; Córdoba Campo, Yuri; Stashenko, Elena E; Fuentes, Jorge Luis

2017-07-01

The antigenotoxicity against ultraviolet radiation (UV)-induced DNA damage of essential oils (EO) from Lippia species was studied using SOS Chromotest. Based on the minimum concentration that significantly inhibits genotoxicity, the genoprotective potential of EO from highest to lowest was Lippia graveolens, thymol-RC ≈ Lippia origanoides, carvacrol-RC ≈ L. origanoides, thymol-RC > Lippia alba, citral-RC ≈ Lippia citriodora, citral-RC ≈ Lippia micromera, thymol-RC > L. alba, myrcenone-RC. EO from L. alba, carvone/limonene-RC, L. origanoides, α-phellandrene-RC and L. dulcis, trans-β-caryophyllene-RC did not reduce the UV genotoxicity at any of the doses tested. A gas chromatography with flame ionization detection analysis (GC-FID) was conducted to evaluate the solubility of the major EO constituents under our experimental conditions. GC-FID analysis showed that, at least partially, major EO constituents were water-soluble and therefore, they were related with the antigenotoxicity detected for EO. Constituents such as p-cymene, geraniol, carvacrol, thymol, citral and 1,8-cineole showed antigenotoxicity. The antioxidant activity of EO constituents was also determined using the oxygen radical antioxidant capacity (ORAC) assay. The results showed that the antigenotoxicity of the EO constituents was unconnected with their antioxidant activity. The antigenotoxicity to different constituent binary mixtures suggests that synergistic effects can occur in some of the studied EO. © 2017 The American Society of Photobiology.

[Identification of some Piper crude drugs based on Fourier transform infrared spectrometry].

PubMed

Zhou, Ye; Zhang, Qing-Wei; Luo, Xue-Jun; Li, Pei-Fu; Song, Heng; Zhang, Bo-Li

2014-09-01

The common peak ratio and variant peak ratio were calculated by FTIR spectroscopy of seven medicinal plants of Piper. The dual index sequence of common peak ratio and variant peak ratio was established, which showed the sibship of the medicinal plants. The common peak ratio of Piper kadsura (Choisy) Ohwi, Piper wallichii (Miq.) Hand.-Mazz. Piper laetispicum (C. DC.) was greater than 77%, and the variant peak ratio was less than 30%. The results showed the near sibship between the three drugs. The common peak ratio of Piper kadsura (Choisy) Ohwi, Piper nigrum L. and Piper boehmeriae folium Wall (Miq.) C. DC. Var. tonkinense (C. DC.) was about 61% which showed the farther sibship. The common peak ratio of Piper kadsura (Choisy) Ohwi and Piper betle (Linn.) was only 44%, which showed the farthest sibship. Piper kadsura (choisy) Ohwi and its adulterants, such as Piper wallichii (Miq.) Hand. -Mazz., Piper boehmeriaefolium Wall (Miq.) C. DC. Var. tonkinense C. DC. , Piper laetispicum C. DC., Piper nigrum L., could be identified by comparing their second order derivative IR spectrum of the samples. FTIR technique is a non-destructive analysis method which provides information of functional group, type and hydrogen bond without complex pretreatment procedures such as extraction and separatioin. FTIR method has some characteristics such as rapid and simple analysis procedure, good reproducibility, non-destructive testing, few amount of required sample and low cost and is environment-friendly. The method solved the problems of limit in resource of Piper kadsura (Choisy) Ohwi, many fakes and difficulties in identification, and brought the security for the clinical medication. FTIR provides a new method for identification of Piper kadsura (choisy) Ohwi and its fakes and meets the requirement for comprehensive analy sis and global analysis of traditional Chinese medicine.

Quality Control of Traditional Cannabis Tinctures: Pattern, Markers, and Stability

PubMed Central

Peschel, Wieland

2016-01-01

Traditional tinctures of Cannabis sativa L. became obsolete before elucidation of the main cannabinoids and routine quality testing for medicines. In view of increasing medicinal use of cannabinoids and associated safety concerns, tinctures from a Δ9-tetrahydrocannabinol (THC)-type chemovar were studied. High-performance liquid chromatography with diode-array detection (HPLC/DAD) was used to determine THC, Δ9-tetrahydrocannabinolic acid A (THCA), cannabinol (CBN), cannabidiol (CBD), cannabidiolic acid (CBDA), cannabigerol (CBG), cannabigerolic acid (CBGA), cannflavin A/B, and total phenolics. Derived group and ratio markers describe absolute and relative profiles when varying plant part (flos, folium), extraction solvent (EtOH percentage), storage conditions (‘shelf’ or ‘fridge’ up to 15 months), and pasteurization (2 h 70 °C, 20 min 80 °C). Tinctures from female flowering tops contained ten-fold more cannabinoids than tinctures from leaves; tinctures (80%–90% EtOH) contained ten-fold more cannabinoids than tinctures (40% EtOH). The analysis of CBGA + CBG, the main co-cannabinoids aside from THCA + THC, appears more relevant than CBDA + CBD. The decarboxylation of THCA to THC—the main change during storage of freshly prepared tinctures—is after 15 months in the ‘fridge’ comparable to 3 months on the ‘shelf’. Minimally increased CBN totals did not correlate to diminished totals of THCA and THC (up to 15% after 3 months ‘shelf’, 45% after 15 months ‘fridge’). Instead, total cannabinoids or acidic/neutral cannabinoid ratios are better stability markers. Moderate changes after pasteurization and partial losses below 10% for total cannabinoids after 9 months ‘fridge’ indicate possibilities for a reasonable shelf life. Yet storage and use of non-stabilized tinctures remain critical without authorized specification and stability data because a consistent cannabinoid content is not guaranteed. PMID:28117322

Determination of rutin and quercetin in Chinese herbal medicine by ionic liquid-based pressurized liquid extraction-liquid chromatography-chemiluminescence detection.

PubMed

Wu, Hongwei; Chen, Meilan; Fan, Yunchang; Elsebaei, Fawzi; Zhu, Yan

2012-01-15

A novel ionic liquid-based pressurized liquid extraction (IL-PLE) procedure coupled with high performance liquid chromatography (HPLC) tandem chemiluminescence (CL) detection capable of quantifying trace amounts of rutin and quercetin in four Chinese medicine plants including Flos sophorae Immaturus, Crateagus pinnatifida Bunge, Hypericum japonicum Thunb and Folium Mori was described in this paper. To avoid environmental pollution and toxicity to the operators, ionic liquids (ILs), 1-alkyl-3-methylimidazolium chloride ([C(n)mim][Cl]) aqueous solutions were used in the PLE procedure as extractants replacing traditional organic solvents. In addition, chemiluminescence detection was utilized for its minimal interference from endogenous components of complex matrix. Parameters affecting extraction and analysis were carefully optimized. Compared with the conventional ultrasonic-assisted extraction (UAE) and heat-reflux extraction (HRE), the optimized method achieved the highest extraction efficiency in the shortest extraction time with the least solvent consumption. The applicability of the proposed method to real sample was confirmed. Under the optimized conditions, good reproducibility of extraction performance was obtained and good linearity was observed with correlation coefficients (r) between 0.9997 and 0.9999. The detection limits of rutin and quercetin (LOD, S/N=3) were 1.1×10(-2)mg/L and 3.8×10(-3)mg/L, respectively. The average recoveries of rutin and quercetin for real samples were 93.7-105% with relative standard deviation (RSD) lower than 5.7%. To the best of our knowledge, this paper is the first contribution to utilize a combination of IL-PLE with chemiluminescence detection. And the experimental results indicated that the proposed method shows a promising prospect in extraction and determination of rutin and quercetin in medicinal plants. Copyright © 2011 Elsevier B.V. All rights reserved.

Water-extractable magnesium, manganese and copper in leaves and herbs of medicinal plants.

PubMed

Konieczyński, Paweł; Wesołowski, Marek

2012-01-01

Since herbal teas, infusions and decoctions prepared from medicinal plants are popular remedies, it remains a topical question whether these herbal drugs can be treated as sources of essential elements for humans, who often use them in their everyday diet. Therefore, total and water-extractable contents of Mg, Mn and Cu were determined in 41 leaves originating from four botanical species of Plantago lanceolata, Arctostaphyllos uva-ursi, Rubus fruticosus and Betula sp., as well as in 33 samples of herbs represented by three species of Urtica dioica, Hypericum perforatum and Achillea millefolium. The highest level was determined in the case of Mg (in a range from 2.0 to 7.0 mg/g of dry mass [d.m.]), followed by Mn (from 50.0 to 1300.0 mg/kg d.m.), and lowest of all, Cu (from 3.5 to 19.5 mg/kg d.m.). Student's t-test showed that a statistically significant difference exists between samples originating from different plant species regarding the total content and water-extractable forms of Mg, Mn and Cu. By analysis of the relations between elements, it was observed that total level of Cu correlated with total levels of Mg and Mn, which indicates a synergistic interaction between the essential elements under study. With regard to Dietary Reference Intakes (DRIs), the leaves of Rubus fruticosus contained the highest amounts of a water-extractable bioavailable form of Mn, which guarantees from 160 to 200% of the daily requirement of Mn for women and men, respectively. On the other hand, the extract obtained from Urticae folium gave water-extractable Mg in the amount of 76 mg/500 mL, which constitutes about 20% of daily requirement. The plant material richest in water-extractable Cu was Hyperici herba, containing 154.5 microg/500 mL, or 17% of DRI for both sexes.

Ex-vivo in-vitro inhibition of lipopolysaccharide stimulated tumor necrosis factor-alpha and interleukin-1 beta secretion in human whole blood by extractum urticae dioicae foliorum.

PubMed

Obertreis, B; Ruttkowski, T; Teucher, T; Behnke, B; Schmitz, H

1996-04-01

An extract of Urtica dioica folium (IDS 23, Rheuma-Hek), monographed positively for adjuvant therapy of rheumatic diseases and with known effects in partial inhibition of prostaglandin and leukotriene synthesis in vitro, was investigated with respect to effects of the extract on the lipopolysaccharide (LPS) stimulated secretion of proinflammatory cytokines in human whole blood of healthy volunteers. In the assay system used, LPS stimulated human whole blood showed a straight increase of tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 beta (IL-1 beta) secretion reaching maximum concentrations within 24 h following a plateau and slight decrease up to 65 h, respectively. The concentrations of these cytokines was strongly positively correlated with the number of monocytes/macrophages of each volunteer. TNF-alpha and IL-1 beta concentration after LPS stimulation was significantly reduced by simultaneously given IDS 23 in a strictly dose dependent manner. At time 24 h these cytokine concentrations were reduced by 50.8% and 99.7%, respectively, using the highest test IDS 23 assay concentration of 5 mg/ml (p < 0.001). After 65 h the corresponding inhibition was 38.9% and 99.9%, respectively (p < 0.001). On the other hand IDS 23 showed no inhibition but stimulated IL-6 secretion in absence of LPS alone. Simultaneously given LPS and IDS 23 resulted in no further increase. In contrast to described effects on arachidonic acid cascade in vitro, tested Urtica dioica phenol carbon acid derivates and flavonoides such as caffeic malic acid, caffeic acid, chlorogenic acid, quercetin and rutin did not influence LPS stimulated TNF-alpha, IL-1 beta and IL-6 secretion in tested concentrations up to 5 x 10(-5) mol/l. These further findings on the pharmacological mechanism of action of Urticae dioica folia may explain the positive effects of this extract in the treatment of rheumatic diseases.

Use of Near-Infrared Spectroscopy and Chemometrics for the Nondestructive Identification of Concealed Damage in Raw Almonds (Prunus dulcis).

PubMed

Rogel-Castillo, Cristian; Boulton, Roger; Opastpongkarn, Arunwong; Huang, Guangwei; Mitchell, Alyson E

2016-07-27

Concealed damage (CD) is defined as a brown discoloration of the kernel interior (nutmeat) that appears only after moderate to high heat treatment (e.g., blanching, drying, roasting, etc.). Raw almonds with CD have no visible defects before heat treatment. Currently, there are no screening methods available for detecting CD in raw almonds. Herein, the feasibility of using near-infrared (NIR) spectroscopy between 1125 and 2153 nm for the detection of CD in almonds is demonstrated. Almond kernels with CD have less NIR absorbance in the region related with oil, protein, and carbohydrates. With the use of partial least squares discriminant analysis (PLS-DA) and selection of specific wavelengths, three classification models were developed. The calibration models have false-positive and false-negative error rates ranging between 12.4 and 16.1% and between 10.6 and 17.2%, respectively. The percent error rates ranged between 8.2 and 9.2%. Second-derivative preprocessing of the selected wavelength resulted in the most robust predictive model.

Almond (Prunus dulcis (Mill.) D.A. Webb) polyphenols: from chemical characterization to targeted analysis of phenolic metabolites in humans.

PubMed

Bartolomé, Begoña; Monagas, María; Garrido, Ignacio; Gómez-Cordovés, Carmen; Martín-Alvarez, Pedro J; Lebrón-Aguilar, Rosa; Urpí-Sardà, Mireia; Llorach, Rafael; Andrés-Lacueva, Cristina

2010-09-01

In this paper, a survey of our studies on almond polyphenols including their chemical characterization and further bioavailability in humans is reported. Combination of analytical techniques (LC-DAD/fluorescence, LC/ESI-MS and MALDI-TOF-MS) allowed us, for the first time, the identification of A- and B-type procyanidin, propelargonidin and prodelphinidin polymers in almond skins. Glucuronide, O-methyl glucuronide, sulfate and O-methyl sulfate derivatives of (epi)catechin, as well as the glucuronide conjugates of naringenin and isorhamnetin, and sulfate conjugates of isorhamnetin, together with conjugates of hydroxyphenylvalerolactones were detected in plasma and urine samples after the intake of almond skin polyphenols. In addition, numerous microbial-derived metabolites, including hydroxyphenylpropionic, hydroxyphenylacetic, hydroxycinnamic, hydroxybenzoic and hydroxyhippuric acids were also identified. Depending of the type of metabolite, maximum urinary excretion was attained at different time in comparison to the control group in the course of the 24-h period of urine excretion, allowing us to establish the onset of microbial metabolism. 2010 Elsevier Inc. All rights reserved.

Metabolomics study of human urinary metabolome modifications after intake of almond (Prunus dulcis (Mill.) D.A. Webb) skin polyphenols.

PubMed

Llorach, Rafael; Garrido, Ignacio; Monagas, Maria; Urpi-Sarda, Mireia; Tulipani, Sara; Bartolome, Begona; Andres-Lacueva, Cristina

2010-11-05

Almond, as a part of the nut family, is an important source of biological compounds, and specifically, almond skins have been considered an important source of polyphenols, including flavan-3-ols and flavonols. Polyphenol metabolism may produce several classes of metabolites that could often be more biologically active than their dietary precursor and could also become a robust new biomarker of almond polyphenol intake. In order to study urinary metabolome modifications during the 24 h after a single dose of almond skin extract, 24 volunteers (n = 24), who followed a polyphenol-free diet for 48 h before and during the study, ingested a dietary supplement of almond skin phenolic compounds (n = 12) or a placebo (n = 12). Urine samples were collected before ((-2)-0 h) and after (0-2 h, 2-6 h, 6-10 h, and 10-24 h) the intake and were analyzed by liquid chromatography-mass spectrometry (LC-q-TOF) and multivariate statistical analysis (principal component analysis (PCA) and orthogonal projection to latent structures (OPLS)). Putative identification of relevant biomarkers revealed a total of 34 metabolites associated with the single dose of almond extract, including host and, in particular, microbiota metabolites. As far as we know, this is the first time that conjugates of hydroxyphenylvaleric, hydroxyphenylpropionic, and hydroxyphenylacetic acids have been identified in human samples after the consumption of flavan-3-ols through a metabolomic approach. The results showed that this non-targeted approach could provide new intake biomarkers, contributing to the development of the food metabolome as an important part of the human urinary metabolome.

Rheological and interfacial properties at the equilibrium of almond gum tree exudate (Prunus dulcis) in comparison with gum arabic.

PubMed

Mahfoudhi, Nesrine; Sessa, Mariarenata; Ferrari, Giovanna; Hamdi, Salem; Donsi, Francesco

2016-06-01

Almond gum contains an arabinogalactan-type polysaccharide, which plays an important role in defining its interfacial and rheological properties. In this study, rheological and interfacial properties of almond gum and gum arabic aqueous dispersions were comparatively investigated. The interfacial tension of almond gum and gum arabic aqueous dispersions was measured using the pendant drop method in hexadecane. The asymptotic interfacial tension values for almond gum were significantly lower than the corresponding values measured for gum arabic, especially at high concentration. Rheological properties were characterized by steady and oscillatory tests using a coaxial geometry. Almond gum flow curves exhibited a shear thinning non-Newtonian behavior with a tendency to a Newtonian plateau at low shear rate, while gum arabic flow curves exhibited such behavior only at high shear rate. The influence of temperature (5-50  ℃) on the flow curves was studied at 4% (m/m) gum concentration and the Newtonian viscosities at infinite and at zero shear rate, for gum arabic and almond gum, respectively, were accurately fitted by an Arrhenius-type equation. The dynamic properties of the two gum dispersions were also studied. Both gum dispersions exhibited viscoelastic properties, with the viscous component being predominant in a wider range of concentrations for almond gum, while for gum arabic the elastic component being higher than the elastic one especially at higher concentrations.The rheological and interfacial tension properties of almond gum suggest that it may represent a possible substitute of gum arabic in different food applications. © The Author(s) 2015.

Temperature-dependent growth of Botrytis cinerea isolates from potted plants.

PubMed

Martínez, J A; Gómez-Bellot, M J; Bañón, S

2009-01-01

Botrytis cinereo is a common aggressive saprophyte fungus which also invades injured plant tissues, causing Botrytis blight (Grey mould) in many ornamental plants, including potted flowering plants. Several B. cinerea isolates from potted plants (Pelargonium x hortorum, Lantana camara, Lonicera japonica, Hydrangea macrophylla, and Cyclamen persicum) affected by Botrytis blight in the south of Spain were studied and identified by PCR. The isolates showed phenotypic differences between them, as previously reported by the authors. In this work we demonstrate that these isolates show different temperature-dependent growth phenomena, expressed as mycelial growth rates, conidiation (measured as the number of conidia per colony and time of appearance), mass of both aerial and submerged mycelia, and sclerotia production. Growth rates were assessed from differences in colony area and mass of both aerial and submerged mycelium growing in potato dextrose agar culture medium (PDA). Three temperatures were used to measure these variables (6, 16, and 26 degrees C) and to establish the differences among isolates by modelling the effects of temperature on the growth variables. B. cinerea showed a high degree of phenotypic variability and differences in its growth kinetics, depending on temperature and isolate in question. The isolate from P. x hortorum showed the greatest conidiation although this process did not depend on the temperatures assayed. The growth rate of the isolates from P. x hortorum was the highest. The growth rates in all the isolates were determined and the growth kinetics could be fitted to a typical equation of fungi growing on solid culture medium. The isolate from P. x hortorum was the most vigorous, while the least vigorous was the isolate from L. japonica. A relationship between mycelial growth rate, conidiation and aerial mycelium could be established. A temperature of 26 degrees C accelerated sclerotia production, but only in the isolate from C. persicum

Photosynthesis and growth response of almond to increased atmospheric ozone partial pressures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Retzlaff, W.A.; Williams, L.E.; DeJong, T.M.

Uniform nursery stock of five almond cultivars [Prunus dulcis (Mill) D.A. Webb syn. P. amygdalus Batsch, cv. Butte, Carmel, Mission, Nonpareil, and Sonora] propagated on peach (P. domstica L. Batsch.) rootstock were exposed to three different atmospheric ozone (O[sub 3]) partial pressures. The trees were planted in open-top fumigation chambers on 19 Apr. 1989 at the University of California Kearny Agricultural Center located in the San Joaquin Valley of California. Exposures of the trees to three atmospheric O[sub 3] partial pressures lasted from 1 June to 2 Nov. 1989. The mean 12-h [0800-2000 h Pacific Daylight Time (PDT)] O[sub 3]more » partial pressures measured in the open-top chambers during the experimental period were 0.038, 0.060, and 0.112 [mu]Pa Pa[sup [minus]1] O[sub 3] in the charcoal filtered, ambient, and ambient + O[sub 3] treatments, respectively. Leaf net CO[sub 2] assimilation, trunk cross-sectional area growth, and root, trunk, foliage, and total dry weight of Nonpareil were reduced by increased atmospheric O[sub 3] partial pressures. Mission was unaffected by O[sub 3] and Butte, Carmel, and Sonora were intermediate in their responses. Foliage of Nonpareil also abscised prematurely in the ambient and ambient + O[sub 3] treatments. The results indicate that there are almond cultivars that are sensitive to O[sub 3] exposure.« less

Assessment of anti-protozoal activity of plants traditionally used in Ecuador in the treatment of leishmaniasis.

PubMed

Gachet, María Salomé; Lecaro, Javier Salazar; Kaiser, Marcel; Brun, Reto; Navarrete, Hugo; Muñoz, Ricardo A; Bauer, Rudolf; Schühly, Wolfgang

2010-03-02

For the assessment of the in vitro anti-protozoal potential of plants traditionally used in Ecuador in the treatment of leishmaniasis, a combined approach based on interviews with healers as well as a literature search was carried out. From three regions of Ecuador, 256 local healers called "Agents of Traditional Medicine" (ATMs) were interviewed about their knowledge of the use of plants to treat and heal the illness recognized by the ATMs as leishmaniasis. From literature sources, 14 plants were identified as being used in the treatment of leishmaniasis. Subsequently, plant material was collected from a representative selection of 39 species. A total of 140 extracts were screened in vitro against Leishmania donovani, Plasmodium falciparum, Trypanosoma brucei rhodesiense and Trypanosoma cruzi. Additionally, these extracts were evaluated for their anti-microbial activities using five gram-positive and -negative bacteria as well as Candida albicans. The survey resulted in 431 use-records for 145 plant-taxa used for the treatment of leishmaniasis. The 10 most frequently reported taxa accounted for 37.7% of all records. In the case of leishmaniasis, activity was observed for Elephantopus mollis, Minquartia guianensis, Bocconia integrifolia, Gouania lupuloides, Scoparia dulcis, an as-yet-unidentified species of Piper and Brugmansia. For the leaves of M. guianensis and the twigs and bark of G. lupuloides a good selectivity index (SI) was found. IC(50) values and the SI of active plant extracts are presented. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

Variable developmental rate and survival of navel orangeworm (Lepidoptera: Pyralidae) on pistachio.

PubMed

Siegel, Joel P; Bas Kuenen, L P S

2011-04-01

A series of laboratory and field studies were conducted using two lines of navel orangeworm, reared on different stages of new crop and mummy pistachios, Pistacia vera L. This study demonstrated the potential importance of malformed pistachios (pea splits) to the population dynamics of navel orangeworm, because these nuts, which are available as early as two months before mature nuts, supported navel orangeworm development and survival. Overall, the developmental rate on new crop pistachios is fastest on mature nuts, 422.3 +/- 123 degree-days (DD, degrees C), but other factors such as exposure to insecticide residue also sped development, although survival decreased. Development took the longest on unharvested nuts (mummies) dried at 90 degrees C for 24 h, 2664.7 +/- 131.4 DD. In most trials development was variable and two generations could develop at the fastest rate before the slowest individual completed development, which in turn calls into question the concept of discrete generations. Generally, survival was highest on mature pistachios and other stages of new crop nut and lowest on mummies collected in May. Survival was also higher on the new varieties 'Lost Hills' and 'Golden Hills' (24.7 and 32.0%, respectively) than on the most extensively planted variety 'Kerman' (13.3%). In our trials, both the rate of development and survival were dependent on nut stage, age, variety, and quality, indicating that pistachios, like almonds, Prunus dulcis (Mill.) D. A. Webb, are a dynamic rather than a static nutrient source for navel orangeworm.

Phytophthora parsiana sp. nov., a new high-temperature tolerant species.

PubMed

Mostowfizadeh-Ghalamfarsa, R; Cooke, D E L; Banihashemi, Z

2008-07-01

As part of a study to examine the phylogenetic history of the taxonomically challenging species Phytophthora cryptogea and P. drechsleri, a distinct monophyletic group of isolates, previously described as P. drechsleri or P. cryptogea, were characterised. Analysis of their rDNA ITS sequences indicated that these isolates were distinct from P. drechsleri, P. cryptogea, and all members of Phytophthora ITS clades 1-8, clustering instead alongside basal groups previously described as clades 9 and 10. This group comprised six isolates all of which were isolated from woody plants, such as pistachio (Pistacia vera, Iran and USA), fig (Ficus carica, Iran), and almond (Prunus dulcis, Greece). Analysis of sequence data from nuclear (beta-tubulin and translation elongation factor 1alpha) and mitochondrial (cytochrome c oxidase subunit I) genes confirmed the ITS-based analysis as these isolates formed a distinct monophyletic group in all NJ trees. The isolates were fast growing with a relatively high optimum growth temperature of 30 degrees C and, in most cases, rapid colony growth even at 37 degrees C. The isolates produced complex colony patterns on almost all media, especially corn meal agar (CMA). Phylogenetic analysis and examination of all the other morphological and physiological data lead us to infer that this taxon has not been described previously. As this taxon was first isolated and described from Iran we propose that this taxon be formally designated as Phytophthora parsiana.

Nut crop yield records show that budbreak-based chilling requirements may not reflect yield decline chill thresholds

NASA Astrophysics Data System (ADS)

Pope, Katherine S.; Dose, Volker; Da Silva, David; Brown, Patrick H.; DeJong, Theodore M.

2015-06-01

Warming winters due to climate change may critically affect temperate tree species. Insufficiently cold winters are thought to result in fewer viable flower buds and the subsequent development of fewer fruits or nuts, decreasing the yield of an orchard or fecundity of a species. The best existing approximation for a threshold of sufficient cold accumulation, the "chilling requirement" of a species or variety, has been quantified by manipulating or modeling the conditions that result in dormant bud breaking. However, the physiological processes that affect budbreak are not the same as those that determine yield. This study sought to test whether budbreak-based chilling thresholds can reasonably approximate the thresholds that affect yield, particularly regarding the potential impacts of climate change on temperate tree crop yields. County-wide yield records for almond ( Prunus dulcis), pistachio ( Pistacia vera), and walnut ( Juglans regia) in the Central Valley of California were compared with 50 years of weather records. Bayesian nonparametric function estimation was used to model yield potentials at varying amounts of chill accumulation. In almonds, average yields occurred when chill accumulation was close to the budbreak-based chilling requirement. However, in the other two crops, pistachios and walnuts, the best previous estimate of the budbreak-based chilling requirements was 19-32 % higher than the chilling accumulations associated with average or above average yields. This research indicates that physiological processes beyond requirements for budbreak should be considered when estimating chill accumulation thresholds of yield decline and potential impacts of climate change.

Genome-wide DNA-(de)methylation is associated with Noninfectious Bud-failure exhibition in Almond (Prunus dulcis [Mill.] D.A.Webb)

PubMed Central

Fresnedo-Ramírez, Jonathan; Chan, Helen M.; Parfitt, Dan E.; Crisosto, Carlos H.; Gradziel, Thomas M.

2017-01-01

Noninfectious bud-failure (BF) remains a major threat to almond production in California, particularly with the recent rapid expansion of acreage and as more intensive cultural practices and modern cultivars are adopted. BF has been shown to be inherited in both vegetative and sexual progeny, with exhibition related to the age and propagation history of scion clonal sources. These characteristics suggest an epigenetic influence, such as the loss of juvenility mediated by DNA-(de)methylation. Various degrees of BF have been reported among cultivars as well as within sources of clonal propagation of the same cultivar. Genome-wide methylation profiles for different clones within almond genotypes were developed to examine their association with BF levels and association with the chronological time from initial propagation. The degree of BF exhibition was found to be associated with DNA-(de)methylation and clonal age, which suggests that epigenetic changes associated with ageing may be involved in the differential exhibition of BF within and among almond clones. Research is needed to investigate the potential of DNA-(de)methylation status as a predictor for BF as well as for effective strategies to improve clonal selection against age related deterioration. This is the first report of an epigenetic-related disorder threatening a major tree crop. PMID:28202904

Genome-wide DNA-(de)methylation is associated with Noninfectious Bud-failure exhibition in Almond (Prunus dulcis [Mill.] D.A.Webb).

PubMed

Fresnedo-Ramírez, Jonathan; Chan, Helen M; Parfitt, Dan E; Crisosto, Carlos H; Gradziel, Thomas M

2017-02-16

Noninfectious bud-failure (BF) remains a major threat to almond production in California, particularly with the recent rapid expansion of acreage and as more intensive cultural practices and modern cultivars are adopted. BF has been shown to be inherited in both vegetative and sexual progeny, with exhibition related to the age and propagation history of scion clonal sources. These characteristics suggest an epigenetic influence, such as the loss of juvenility mediated by DNA-(de)methylation. Various degrees of BF have been reported among cultivars as well as within sources of clonal propagation of the same cultivar. Genome-wide methylation profiles for different clones within almond genotypes were developed to examine their association with BF levels and association with the chronological time from initial propagation. The degree of BF exhibition was found to be associated with DNA-(de)methylation and clonal age, which suggests that epigenetic changes associated with ageing may be involved in the differential exhibition of BF within and among almond clones. Research is needed to investigate the potential of DNA-(de)methylation status as a predictor for BF as well as for effective strategies to improve clonal selection against age related deterioration. This is the first report of an epigenetic-related disorder threatening a major tree crop.

Profile of plasma and urine metabolites after the intake of almond [Prunus dulcis (Mill.) D.A. Webb] polyphenols in humans.

PubMed

Urpi-Sarda, Mireia; Garrido, Ignacio; Monagas, María; Gómez-Cordovés, Carmen; Medina-Remón, Alexander; Andres-Lacueva, Cristina; Bartolomé, Begoña

2009-11-11

Nut skins are considered to be a rich source of polyphenols and may be partially responsible for the numerous health effects associated with nut consumption. However, more bioavailability studies of nut skin polyphenols are needed to understand the health effects derived from nut consumption. The aim of the present study was to determine the profiles of both phase II and microbial-derived phenolic metabolites in plasma and urine samples before and after the intake of almond skin polyphenols by healthy human subjects (n = 2). Glucuronide, O-methyl glucuronide, sulfate, and O-methyl sulfate derivatives of (epi)catechin, as well as the glucuronide conjugates of naringenin and glucuronide and sulfate conjugates of isorhamnetin, were detected in plasma and urine samples after consumption of almond skin polyphenols. The main microbial-derived metabolites of flavanols, such as 5-(dihydroxyphenyl)-gamma-valerolactone and 5-(hydroxymethoxyphenyl)-gamma-valerolactone, were also detected in their glucuronide and sulfate forms. In addition, numerous metabolites derived from further microbial degradation of hydroxyphenylvalerolactones, including hydroxyphenylpropionic, hydroxyphenylacetic, hydroxycinnamic, hydroxybenzoic, and hydroxyhippuric acids, registered major changes in urine after the consumption of almond skin polyphenols. The urinary excretion of these microbial metabolites was estimated to account for a larger proportion of the total polyphenol ingested than phase II metabolites of (epi)catechin, indicating the important role of intestinal bacteria in the metabolism of highly polymerized almond skin polyphenols. To the authors' knowledge this study constitutes the most complete report of the absorption of almond skin polyphenols in humans.

Foliar application of microbial and plant based biostimulants increases growth and potassium uptake in almond (Prunus dulcis [Mill.] D. A. Webb).

PubMed

Saa, Sebastian; Olivos-Del Rio, Andres; Castro, Sebastian; Brown, Patrick H

2015-01-01

The use of biostimulants has become a common practice in agriculture. However, there is little peer-reviewed research on this topic. In this study we tested, under controlled and replicated conditions, the effect of one biostimulant derived from seaweed extraction (Bio-1) and another biostimulant derived from microbial fermentation (Bio-2). This experiment utilized 2-years-old almond plants over two growing seasons in a randomized complete design with a full 2 × 4 factorial structure with two soil potassium treatments (125 μg g(-1) of K vs. 5 μg g(-1)) and four foliar treatments (No spray, Foliar-K, Bio-1, Bio-2). Rubidium was utilized as a surrogate for short-term potassium uptake and plant growth, nutrient concentration, and final plant biomass were evaluated. There was a substantial positive effect of both biostimulant treatments on total shoot leaf area, and significant increases in shoot length and biomass under adequate soil potassium supply with a positive effect of Bio-1 only under low K supply. Rubidium uptake was increased by Bio-1 application an effect that was greater under the low soil K treatment. Though significant beneficial effects of the biostimulants used on plant growth were observed, it is not possible to determine the mode of action of these materials. The results presented here illustrate the promise and complexity of research involving biostimulants.

Comparison of Laboratory-Developed and Commercial Monoclonal Antibody-Based Sandwich Enzyme-Linked Immunosorbent Assays for Almond (Prunus dulcis) Detection and Quantification.

PubMed

Liu, Changqi; Chhabra, Guneet S; Zhao, Jing; Zaffran, Valerie D; Gupta, Sahil; Roux, Kenneth H; Gradziel, Thomas M; Sathe, Shridhar K

2017-10-01

A commercially available monoclonal antibody (mAb)-based direct sandwich enzyme-linked immunosorbent assay (ELISA) kit (BioFront Technologies, Tallahassee, Fla., U.S.A.) was compared with an in-house developed mAb 4C10-based ELISA for almond detection. The assays were comparable in sensitivity (limit of detection < 1 ppm full fat almond, limit of quantification < 5 ppm full fat almond), specificity (no cross-reactivity with 156 tested foods at a concentration of 100000 ppm whole sample), and reproducibility (intra- and interassay variability < 15% CV). The target antigens were stable and detectable in whole almond seeds subjected to autoclaving, blanching, frying, microwaving, and dry roasting. The almond recovery ranges for spiked food matrices were 84.3% to 124.6% for 4C10 ELISA and 81.2% to 127.4% for MonoTrace ELISA. The almond recovery ranges for commercial and laboratory prepared foods with declared/known almond amount were 30.9% to 161.2% for 4C10 ELISA and 38.1% to 207.6% for MonoTrace ELISA. Neither assay registered any false-positive or negative results among the tested commercial and laboratory prepared samples. Ability to detect and quantify trace amounts of almonds is important for improving safety of almond sensitive consumers. Two monoclonal antibody-based ELISAs were compared for almond detection. The information is useful to food industry, regulatory agencies, scientific community, and almond consumers. © 2017 Institute of Food Technologists®.

Foliar application of microbial and plant based biostimulants increases growth and potassium uptake in almond (Prunus dulcis [Mill.] D. A. Webb)

PubMed Central

Saa, Sebastian; Olivos-Del Rio, Andres; Castro, Sebastian; Brown, Patrick H.

2015-01-01

The use of biostimulants has become a common practice in agriculture. However, there is little peer-reviewed research on this topic. In this study we tested, under controlled and replicated conditions, the effect of one biostimulant derived from seaweed extraction (Bio-1) and another biostimulant derived from microbial fermentation (Bio-2). This experiment utilized 2-years-old almond plants over two growing seasons in a randomized complete design with a full 2 × 4 factorial structure with two soil potassium treatments (125 μg g-1 of K vs. 5 μg g-1) and four foliar treatments (No spray, Foliar-K, Bio-1, Bio-2). Rubidium was utilized as a surrogate for short-term potassium uptake and plant growth, nutrient concentration, and final plant biomass were evaluated. There was a substantial positive effect of both biostimulant treatments on total shoot leaf area, and significant increases in shoot length and biomass under adequate soil potassium supply with a positive effect of Bio-1 only under low K supply. Rubidium uptake was increased by Bio-1 application an effect that was greater under the low soil K treatment. Though significant beneficial effects of the biostimulants used on plant growth were observed, it is not possible to determine the mode of action of these materials. The results presented here illustrate the promise and complexity of research involving biostimulants. PMID:25755660

Analysis of S-RNase alleles of almond (Prunus dulcis): characterization of new sequences, resolution of synonyms and evidence of intragenic recombination.

PubMed

Ortega, Encarnación; Bosković, Radovan I; Sargent, Daniel J; Tobutt, Kenneth R

2006-11-01

Cross-compatibility relationships in almond are controlled by a gametophytically expressed incompatibility system partly mediated by stylar RNases, of which 29 have been reported. To resolve possible synonyms and to provide data for phylogenetic analysis, 21 almond S-RNase alleles were cloned and sequenced from SP (signal peptide region) or C1 (first conserved region) to C5, except for the S29 allele, which could be cloned only from SP to C1. Nineteen sequences (S4, S6, S11-S22, S25-S29)) were potentially new whereas S10 and S24 had previously been published but with different labels. The sequences for S16 and S17 were identical to that for S1, published previously; likewise, S15 was identical to S5. In addition, S4 and S20 were identical, as were S13 and S19. A revised version of the standard table of almond incompatibility genotypes is presented. Several alleles had AT or GA tandem repeats in their introns. Sequences of the 23 distinct newly cloned or already published alleles were aligned. Sliding windows analysis of Ka/Ks identified regions where positive selection may operate; in contrast to the Maloideae, most of the region from the beginning of C3 to the beginning of RC4 appeared not to be under positive selection. Phylogenetic analysis indicated four pairs of alleles had "bootstrap" support > 80%: S5/S10, S4/S8, S11/S24, and S3/S6. Various motifs up to 19 residues long occurred in at least two alleles, and their distributions were consistent with intragenic recombination, as were separate phylogenetic analyses of the 5' and 3' sections. Sequence comparison of phylogenetically related alleles indicated the significance of the region between RC4 and C5 in defining specificity.

Shell cracking strength in almond (Prunus dulcis [Mill.] D.A. Webb.) and its implication in uses as a value-added product.

PubMed

Ledbetter, C A

2008-09-01

Researchers are currently developing new value-added uses for almond shells, an abundant agricultural by-product. Almond varieties are distinguished by processors as being either hard or soft shelled, but these two broad classes of almond also exhibit varietal diversity in shell morphology and physical characters. By defining more precisely the physical and chemical characteristics of almond shells from different varieties, researchers will better understand which specific shell types are best suited for specific industrial processes. Eight diverse almond accessions were evaluated in two consecutive harvest seasons for nut and kernel weight, kernel percentage and shell cracking strength. Shell bulk density was evaluated in a separate year. Harvest year by almond accession interactions were highly significant (p0.01) for each of the analyzed variables. Significant (p0.01) correlations were noted for average nut weight with kernel weight, kernel percentage and shell cracking strength. A significant (p0.01) negative correlation for shell cracking strength with kernel percentage was noted. In some cases shell cracking strength was independent of the kernel percentage which suggests that either variety compositional differences or shell morphology affect the shell cracking strength. The varietal characterization of almond shell materials will assist in determining the best value-added uses for this abundant agricultural by-product.

[Studies on evaluation of natural products for antiviral effects and their applications].

PubMed

Hayashi, Toshimitsu

2008-01-01

In the search for novel antiviral molecules from natural products, we have discovered various antiviral molecules with characteristic mechanisms of action. Scopadulciol (SDC), isolated from the tropical medicinal plant Scoparia dulcis L., showed stimulatory effects on the antiviral potency of acyclovir (ACV) or ganciclovir (GCV). This effect of SDC was exerted via the activation of viral thymidine kinase (HSV-1 TK) and, as a result, an increase in the cellular concentration of the active form of ACV/GCV, i.e., the triphosphate of ACV or GCV. On the basis of these experimental results, cancer gene therapy using the HSV-1 tk gene and ACV/GCV together with SDC was found to be effective in suppressing the growth of cancer cells in animals. Acidic polysaccharides such as calcium spirulan (Ca-SP) from Spirulina platensis, nostoflan from Nostoc flagelliforme, and a fucoidan from the sporophyll of Undaria pinnatifida (mekabu fucoidan) were also found to be potent inhibitors against several enveloped viruses. Their antiviral potency was dependent on molecular weight and content of the sulfate or carboxyl group as well as counterion species chelating with sulfate groups, indicating the importance of the three-dimensional structure of the molecules. In addition, unlike dextran sulfate, Ca-SP was shown to target not only viral absorption/penetration stages but also some replication stages of progeny viruses after penetration into cells. When mekabu fucoidan or nostoflan was administered with oseltamivir phosphate, their synergistic antiviral effects on influenza A virus were confirmed in vitro as well as in vivo.

Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design

PubMed Central

Goonetilleke, Shashi N.; March, Timothy J.; Wirthensohn, Michelle G.; Arús, Pere; Walker, Amanda R.; Mather, Diane E.

2017-01-01

In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond (Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars “Nonpareil” and “Lauranne.” Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. PMID:29141988

Bitterness in Almonds1[C][OA

PubMed Central

Sánchez-Pérez, Raquel; Jørgensen, Kirsten; Olsen, Carl Erik; Dicenta, Federico; Møller, Birger Lindberg

2008-01-01

Bitterness in almond (Prunus dulcis) is determined by the content of the cyanogenic diglucoside amygdalin. The ability to synthesize and degrade prunasin and amygdalin in the almond kernel was studied throughout the growth season using four different genotypes for bitterness. Liquid chromatography-mass spectrometry analyses showed a specific developmentally dependent accumulation of prunasin in the tegument of the bitter genotype. The prunasin level decreased concomitant with the initiation of amygdalin accumulation in the cotyledons of the bitter genotype. By administration of radiolabeled phenylalanine, the tegument was identified as a specific site of synthesis of prunasin in all four genotypes. A major difference between sweet and bitter genotypes was observed upon staining of thin sections of teguments and cotyledons for β-glucosidase activity using Fast Blue BB salt. In the sweet genotype, the inner epidermis in the tegument facing the nucellus was rich in cytoplasmic and vacuolar localized β-glucosidase activity, whereas in the bitter cultivar, the β-glucosidase activity in this cell layer was low. These combined data show that in the bitter genotype, prunasin synthesized in the tegument is transported into the cotyledon via the transfer cells and converted into amygdalin in the developing almond seed, whereas in the sweet genotype, amygdalin formation is prevented because the prunasin is degraded upon passage of the β-glucosidase-rich cell layer in the inner epidermis of the tegument. The prunasin turnover may offer a buffer supply of ammonia, aspartic acid, and asparagine enabling the plants to balance the supply of nitrogen to the developing cotyledons. PMID:18192442

Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

PubMed

Kar, Indrani; Chattopadhyaya, Rajagopal

2017-11-01

The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

Response of postharvest tree nut lepidopteran pests to vacuum treatments.

PubMed

Johnson, J A; Zettler, J L

2009-10-01

Industry concerns over insect resistance, regulatory action, and the needs of organic processors have renewed interest in nonchemical alternative postharvest treatments to fumigants used for California tree nuts. The development of inexpensive polyvinyl chloride containers capable of holding low pressures has increased the practicality of vacuum treatments for durable commodities such as tree nuts. To develop vacuum treatment protocols, we determined the relative tolerance to vacuum (50 mmHg) at 25 and 30 degrees C of different life stages of three postharvest pests of tree nuts: codling moth, Cydia pomonella (L.), navel orangeworm, Amyelois transitella (Walker), and Indianmeal moth, Plodia interpunctella (Hübner). At both temperatures, nondiapausing codling moth larvae were the least tolerant stage tested. LT95 values for diapausing Indianmeal moth larvae were similar to Indianmeal moth eggs at both temperatures. Indianmeal moth diapausing larvae and eggs were the most tolerant at 25 degrees C, whereas navel orangeworm eggs were most tolerant at 30 degrees C. Field tests using GrainPro Cocoons (GrainPro, Inc., Concord, MA) to treat shelled almonds, Prunus dulcis (Mill.) D. A. Webb, in bins at vacuum levels of 18-43 mmHg at average winter temperatures (6-10 degrees C) showed that diapausing codling moth larvae were the most tolerant under these conditions and that exposures of 7-13 d provided incomplete control. Summer field tests treating in-shell almonds in bags at average temperatures of 25-30 degrees C provided complete control with 48 h exposure to average vacuum levels of 50 mmHg, and navel orangeworm eggs were the most tolerant stage.

Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design.

PubMed

Goonetilleke, Shashi N; March, Timothy J; Wirthensohn, Michelle G; Arús, Pere; Walker, Amanda R; Mather, Diane E

2018-01-04

In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond ( Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F 1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars "Nonpareil" and "Lauranne." Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F 1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. Copyright © 2018 Goonetilleke et al.

Alpha-Glucosidase Enzyme Biosensor for the Electrochemical Measurement of Antidiabetic Potential of Medicinal Plants

NASA Astrophysics Data System (ADS)

Mohiuddin, M.; Arbain, D.; Islam, A. K. M. Shafiqul; Ahmad, M. S.; Ahmad, M. N.

2016-02-01

A biosensor for measuring the antidiabetic potential of medicinal plants was developed by covalent immobilization of α-glucosidase (AG) enzyme onto amine-functionalized multi-walled carbon nanotubes (MWCNTs-NH2). The immobilized enzyme was entrapped in freeze-thawed polyvinyl alcohol (PVA) together with p-nitrophenyl-α- d-glucopyranoside (PNPG) on the screen-printed carbon electrode at low pH to prevent the premature reaction between PNPG and AG enzyme. The enzymatic reaction within the biosensor is inhibited by bioactive compounds in the medicinal plant extracts. The capability of medicinal plants to inhibit the AG enzyme on the electrode correlates to the potential of the medicinal plants to inhibit the production of glucose from the carbohydrate in the human body. Thus, the inhibition indicates the antidiabetic potential of the medicinal plants. The performance of the biosensor was evaluated to measure the antidiabetic potential of three medicinal plants such as Tebengau ( Ehretis laevis), Cemumar ( Micromelum pubescens), and Kedondong ( Spondias dulcis) and acarbose (commercial antidiabetic drug) via cyclic voltammetry, amperometry, and spectrophotometry. The cyclic voltammetry (CV) response for the inhibition of the AG enzyme activity by Tebengau plant extracts showed a linear relation in the range from 0.423-8.29 μA, and the inhibition detection limit was 0.253 μA. The biosensor exhibited good sensitivity (0.422 μA/mg Tebengau plant extracts) and rapid response (22 s). The biosensor retains approximately 82.16 % of its initial activity even after 30 days of storage at 4 °C.

Alpha-Glucosidase Enzyme Biosensor for the Electrochemical Measurement of Antidiabetic Potential of Medicinal Plants.

PubMed

Mohiuddin, M; Arbain, D; Islam, A K M Shafiqul; Ahmad, M S; Ahmad, M N

2016-12-01

A biosensor for measuring the antidiabetic potential of medicinal plants was developed by covalent immobilization of α-glucosidase (AG) enzyme onto amine-functionalized multi-walled carbon nanotubes (MWCNTs-NH2). The immobilized enzyme was entrapped in freeze-thawed polyvinyl alcohol (PVA) together with p-nitrophenyl-α-D-glucopyranoside (PNPG) on the screen-printed carbon electrode at low pH to prevent the premature reaction between PNPG and AG enzyme. The enzymatic reaction within the biosensor is inhibited by bioactive compounds in the medicinal plant extracts. The capability of medicinal plants to inhibit the AG enzyme on the electrode correlates to the potential of the medicinal plants to inhibit the production of glucose from the carbohydrate in the human body. Thus, the inhibition indicates the antidiabetic potential of the medicinal plants. The performance of the biosensor was evaluated to measure the antidiabetic potential of three medicinal plants such as Tebengau (Ehretis laevis), Cemumar (Micromelum pubescens), and Kedondong (Spondias dulcis) and acarbose (commercial antidiabetic drug) via cyclic voltammetry, amperometry, and spectrophotometry. The cyclic voltammetry (CV) response for the inhibition of the AG enzyme activity by Tebengau plant extracts showed a linear relation in the range from 0.423-8.29 μA, and the inhibition detection limit was 0.253 μA. The biosensor exhibited good sensitivity (0.422 μA/mg Tebengau plant extracts) and rapid response (22 s). The biosensor retains approximately 82.16 % of its initial activity even after 30 days of storage at 4 °C.

Transcriptome profiling of fully open flowers in a frost-tolerant almond genotype in response to freezing stress.

PubMed

Hosseinpour, Batool; Sepahvand, Sadegh; Kamali Aliabad, Kazem; Bakhtiarizadeh, MohammadReza; Imani, Ali; Assareh, Reza; Salami, Seyed Alireza

2018-02-01

Spring frost is a major limiting abiotic stress for the cultivation of almonds [Prunus dulcis (Mill.)] in Mediterranean areas or the Middle East. Spring frost, in particular, damages almond fully open flowers, resulting to significant reduction in yield. Little is known about the genetic factors expressed after frost stress in Prunus spp. as well as in almond fully open flowers. Here, we provide the molecular signature of pistils of fully open flowers from a frost-tolerant almond genotype. The level of frost tolerance in this genotype was determined for all three flowering stages and was confirmed by comparing it to two other cultivars using several physiological analyses. Afterwards, comprehensive expression profiling of genes expressed in fully open flowers was performed after being exposed to frost temperatures (during post-thaw period). Clean reads, 27,104,070 and 32,730,772, were obtained for non-frost-treated and frost-treated (FT) libraries, respectively. A total of 62.24 Mb was assembled, generating 50,896 unigenes and 66,906 transcripts. Therefore, 863 upregulated genes and 555 downregulated genes were identified in the FT library. Functional annotation showed that most of the upregulated genes were related to various biological processes involved in responding to abiotic stress. For the first time, a highly expressed cold-shock protein was identified in the reproductive organ of fruit trees. The expression of six genes was validated by RT-PCR. As the first comprehensive analysis of open flowers in a frost-tolerant almond genotype, this study represents a key step toward the molecular breeding of fruit tree species for frost tolerance.

Surgical pathology of epilepsy-associated non-neoplastic cerebral lesions: a brief introduction with special reference to hippocampal sclerosis and focal cortical dysplasia

PubMed Central

Miyata, Hajime; Hori, Tomokatsu; Vinters, Harry V.

2014-01-01

Among epilepsy-associated non-neoplastic lesions, mesial temporal lobe epilepsy with hippocampal sclerosis (mTLE-HS) and malformation of cortical development (MCD) including focal cortical dysplasia (FCD), are the two most frequent causes of drug-resistant focal epilepsies constituting about 50% of all surgical pathology of epilepsy. Several distinct histological patterns have been historically recognized in both HS and FCD, and several studies have tried to perform clinicopathological correlation; results, however, have been controversial, particularly in terms of postsurgical seizure outcome. Recently, the International League Against Epilepsy constituted a Task Forces of Neuropathology and FCD within the Commission on Diagnostic Methods, to establish an international consensus of histological classification of HS and FCD, respectively, based on agreement with the recognition of the importance of defining a histopathological classification system that reliably has some clinicopathological correlation. Such consensus classifications are likely to facilitate future clinicopathological study. Meanwhile, we reviewed neuropathology of 41 surgical cases of mTLE, and confirmed three type/patterns of HS along with no HS, based on the qualitative evaluation of the distribution and severity of neuronal loss and gliosis within hippocampal formation; i.e., HS type 1 (61%) equivalent to ‘classical’ Ammon’s horn sclerosis, HS type 2 (2%) representing CA1 sclerosis, HS type 3 (17%) equivalent to end folium sclerosis, and no HS (19%). Furthermore we performed a neuropathological comparative study on mTLE-HS and dementia associated HS (d-HS) in elderly, and confirmed that neuropathological features differ between mTLE-HS and d-HS in the distribution of hippocampal neuronal loss and gliosis, morphology of reactive astrocytes and their protein expression, and presence of concomitant neurodegenerative changes particularly Alzheimer type and TDP-43 pathologies. These

The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

PubMed

Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

2018-04-01

Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined

Detection of upward and downward Solar-induced chlorophyll fluorescence emissions at the forest floor in a cool-temperate deciduous broadleaf forest in Japan

NASA Astrophysics Data System (ADS)

Kato, T.; Tsujimoto, K.; Nasahara, K. N.; Akitsu, T.; Murayama, S.; Noda, H.; Muraoka, H.

2016-12-01

Strong representation of Sun-Induced Fluorescence (SIF) for the ecosystem-level photosynthesis activity has been confirmed by satellite studies [Frankenberg et al., 2011; Joiner et al., 2013] and by field studies [Porcar-Castell, 2011, Yang et al., 2015]. However, the lack of taking care of SIF emission below the tree canopy top may underestimate the contribution of sub-canopy and the understory species to total ecosystem CO2dynamics. To examine the potential contribution of SIF emission from lower part of tree ecosystem to total ecosystem SIF emission, the downward SIF from tree canopy and upward SIF from understory were calculated from the spectrum data in a cool temperate forest in in central Japan (36°08'N, 137°25'E, 1420 masl) as well as the upward SIF from canopy top, and the fractional ratios among them are compared on half-hourly and daily bases from 2006 to 2007. The top canopy is dominated by Oak and Birches, and the sub-canopy layer and shrub layers are dominated by Acer, Hydrangea and Viburnum species. The understory is dominated by an evergreen dwarf bamboo Sasa senanensis, and covered partially by the seedlings of oak and maple, and herbaceous species [Muraoka and Koizumi, 2005]. The SIF was estimated from the spectrums of downward and upward irradiances measured at two heights of 18m and 2m above ground by HemiSpherical Spectro-Radiometer, consisting of the spectroradiometer (MS700, Eko inc., Tokyo, Japan) with the FWHM of 10 nm and wavelength interval of 3.3 nm. The SIF around 760nm (O2-A band) was calculated according to the Fraunhofer Line Depth principle with additional arrangements. Our preliminary results show that the SIF emission intensity was kept in the order as canopy upward > canopy downward > understory upward for most of growing season, except for short spring time between snow melt and canopy greening because of the evergreen Sasa bamboo grass at the forest floor. On the other hand, the relative intensities among three SIF emissions

Green leafy porridges: how good are they in controlling glycaemic response?

PubMed

Anuruddhika Subhashinie Senadheera, Senadheera Pathirannehelage; Ekanayake, Sagarika

2013-03-01

Green leafy porridges made with leaf water extracts, rice and coconut milk are common Sri Lankan dietary remedies for diabetes. Though water and ethanolic extracts of most leaves elicit hypoglycaemic effects, data are not available on the efficacy when leaf extracts are incorporated into porridges. Thus, an effort was made to evaluate the proximate compositions and glycaemic index (GI) of some commonly consumed green leafy porridges. The GI of rice porridge and coconut milk porridge were measured to evaluate the effect of other ingredients other than the leaf extracts. Rice was the main contributor to carbohydrate (56-68% on dry weight) and water was the main component in porridges (89-93%). Fat and total dietary fibre contents ranged between 2.5-27% and 5-10%, respectively. The GI of all porridges was low (GI ≤ 55), except Cassia auriculata which had a high GI of 77 ± 12. The GIs of coconut milk, Aerva lanata, Hemidesmus indicus, Scoparia dulcis, Asparagus racemosus, Cephalandra indica, Cardiospermum halicacabum, Murraya koenigii and Aegle marmelos were 31 ± 5, 32 ± 5, 40 ± 8, 39 ± 8, 37 ± 4, 49 ± 8, 46 ± 8, 44 ± 8 and 50 ± 8, respectively. All porridges had a low or medium glycaemic loads ( ≤ 19). However, peak blood glucose reductions of ≥ 25% were observed in all leafy and coconut milk porridges, except in C. auriculata and Atlantia zeylanica, when compared with the glucose control. Therefore, green leafy porridges, except Cassia, can be recommended as breakfast meals for diabetics due to their low GI, peak blood glucose reduction and presence of other nutrients in green leaves.

Relative Preference and Localized Food Affect Predator Space Use and Consumption of Incidental Prey.

PubMed

Schartel, Tyler E; Schauber, Eric M

2016-01-01

Abundant, localized foods can concentrate predators and their foraging efforts, thus altering both the spatial distribution of predation risk and predator preferences for prey that are encountered incidentally. However, few investigations have quantified the spatial scale over which localized foods affect predator foraging behavior and consumption of incidental prey. In spring 2010, we experimentally tested how point-source foods altered how generalist predators (white-footed mice, Peromyscus leucopus) utilized space and depredated two incidental prey items: almonds (Prunus dulcis; highly profitable) and maple seeds (Acer saccharum; less profitable). We estimated mouse population densities with trapping webs, quantified mouse consumption rates of these incidental prey items, and measured local mouse activity with track plates. We predicted that 1) mouse activity would be elevated near full feeders, but depressed at intermediate distances from the feeder, 2) consumption of both incidental prey would be high near feeders providing less-preferred food and, 3) consumption of incidental prey would be contingent on predator preference for prey relative to feeders providing more-preferred food. Mouse densities increased significantly from pre- to post-experiment. Mean mouse activity was unexpectedly greatest in control treatments, particularly <15 m from the control (empty) feeder. Feeders with highly preferred food (sunflower seeds) created localized refuges for incidental prey at intermediate distances (15 to 25m) from the feeder. Feeders with less-preferred food (corn) generated localized high risk for highly preferred almonds <10 m of the feeder. Our findings highlight the contingent but predictable effects of locally abundant food on risk experienced by incidental prey, which can be positive or negative depending on both spatial proximity and relative preference.

Plant water stress effects on stylet probing behaviors of Homalodisca vitripennis (Hemiptera: Cicadellidae) associated with acquisition and inoculation of the bacterium Xylella fastidiosa.

PubMed

Krugner, Rodrigo; Backus, Elaine A

2014-02-01

ABSTRACT The glassy-winged sharpshooter, Homalodisca vitripennis (Germar) (Hemiptera: Cicadellidae), is a xylem fluid-ingesting leafhopper that transmits Xylella fastidiosa Wells et al., a plant-infecting bacterium that causes several plant diseases in the Americas. Although the role of plant water stress on the population density and dispersal ofH. vitripennis has been studied, nothing is known about the effects of plant water stress on the transmission of X. fastidiosa by H. vitripennis. A laboratory study was conducted to determine the influence of plant water stress on the sharpshooter stylet probing behaviors associated with the acquisition and inoculation of X. fastidiosa. Electrical penetration graph was used to monitor H. vitripennis feeding behaviors for 20-h periods on citrus [Citrus sinensis (L.) Osbeck] and almond [Prunus dulcis (Miller) D.A. Webb] plants subjected to levels of water stress. Adult H. vitripennis successfully located xylem vessels, then performed behaviors related to the evaluation of the xylem cell and fluid, and finally ingested xylem fluid from citrus and almond plants under the tested fluid tensions ranging from -5.5 to -33.0 bars and -6.0 to -24.5 bars, respectively. In general, long and frequent feeding events associated with the acquisition and inoculation of X. fastidiosa were observed only in fully irrigated plants (i.e., >-10 bars), which suggests that even low levels of plant water stress may reduce the spread of X. fastidiosa. Results provided insights to disease epidemiology and support the hypothesis that application of regulated deficit irrigation has the potential to reduce the incidence of diseases caused by X.fastidiosa by reducing the number of vectors and by decreasing pathogen transmission efficiency.

Evolutionary Genomics of Peach and Almond Domestication

PubMed Central

Velasco, Dianne; Hough, Josh; Aradhya, Mallikarjuna; Ross-Ibarra, Jeffrey

2016-01-01

The domesticated almond [Prunus dulcis (L.) Batsch] and peach [P. persica (Mill.) D. A. Webb] originated on opposite sides of Asia and were independently domesticated ∼5000 yr ago. While interfertile, they possess alternate mating systems and differ in a number of morphological and physiological traits. Here, we evaluated patterns of genome-wide diversity in both almond and peach to better understand the impacts of mating system, adaptation, and domestication on the evolution of these taxa. Almond has around seven times the genetic diversity of peach, and high genome-wide FST values support their status as separate species. We estimated a divergence time of ∼8 MYA (million years ago), coinciding with an active period of uplift in the northeast Tibetan Plateau and subsequent Asian climate change. We see no evidence of a bottleneck during domestication of either species, but identify a number of regions showing signatures of selection during domestication and a significant overlap in candidate regions between peach and almond. While we expected gene expression in fruit to overlap with candidate selected regions, instead we find enrichment for loci highly differentiated between the species, consistent with recent fossil evidence suggesting fruit divergence long preceded domestication. Taken together, this study tells us how closely related tree species evolve and are domesticated, the impact of these events on their genomes, and the utility of genomic information for long-lived species. Further exploration of this data will contribute to the genetic knowledge of these species and provide information regarding targets of selection for breeding application, and further the understanding of evolution in these species. PMID:27707802

Prunasin Hydrolases during Fruit Development in Sweet and Bitter Almonds1[C][W][OA

PubMed Central

Sánchez-Pérez, Raquel; Belmonte, Fara Sáez; Borch, Jonas; Dicenta, Federico; Møller, Birger Lindberg; Jørgensen, Kirsten

2012-01-01

Amygdalin is a cyanogenic diglucoside and constitutes the bitter component in bitter almond (Prunus dulcis). Amygdalin concentration increases in the course of fruit formation. The monoglucoside prunasin is the precursor of amygdalin. Prunasin may be degraded to hydrogen cyanide, glucose, and benzaldehyde by the action of the β-glucosidase prunasin hydrolase (PH) and mandelonitirile lyase or be glucosylated to form amygdalin. The tissue and cellular localization of PHs was determined during fruit development in two sweet and two bitter almond cultivars using a specific antibody toward PHs. Confocal studies on sections of tegument, nucellus, endosperm, and embryo showed that the localization of the PH proteins is dependent on the stage of fruit development, shifting between apoplast and symplast in opposite patterns in sweet and bitter cultivars. Two different PH genes, Ph691 and Ph692, have been identified in a sweet and a bitter almond cultivar. Both cDNAs are 86% identical on the nucleotide level, and their encoded proteins are 79% identical to each other. In addition, Ph691 and Ph692 display 92% and 86% nucleotide identity to Ph1 from black cherry (Prunus serotina). Both proteins were predicted to contain an amino-terminal signal peptide, with the size of 26 amino acid residues for PH691 and 22 residues for PH692. The PH activity and the localization of the respective proteins in vivo differ between cultivars. This implies that there might be different concentrations of prunasin available in the seed for amygdalin synthesis and that these differences may determine whether the mature almond develops into bitter or sweet. PMID:22353576

Impact of Pesticide Resistance on Toxicity and Tolerance of Hostplant Phytochemicals in Amyelois Transitella (Lepidoptera: Pyralidae)

PubMed Central

Bagchi, Vikram A.; Siegel, Joel P.; Demkovich, Mark R.; Zehr, Luke N.; Berenbaum, May R.

2016-01-01

For some polyphagous insects, adaptation to phytochemically novel plants can enhance resistance to certain pesticides, but whether pesticide resistance expands tolerance to phytochemicals has not been examined. Amyelois transitella Walker (navel orangeworm) is an important polyphagous pest of nut and fruit tree crops in California. Bifenthrin resistance, partially attributable to enhanced cytochrome P450 (P450)-mediated detoxification, has been reported in an almond-infesting population exposed to intense pesticide selection. We compared the toxicity of bifenthrin and three phytochemicals–chlorogenic acid, and the furanocoumarins xanthotoxin and bergapten–to three strains of A. transitella: pyrethroid-resistant R347 (maintained in the laboratory for ∼10 generations), fig-derived FIG (in the laboratory for ∼25 generations), and CPQ–a laboratory strain derived from almonds ∼40 years ago). Whereas both Ficus carica (fig) and Prunus dulcis (almond) contain chlorogenic acid, furanocoumarins occur only in figs. Both R347 and FIG exhibited 2-fold greater resistance to the three phytochemicals compared with CPQ; surprisingly, bifenthrin resistance was highest in FIG. Piperonyl butoxide, a P450 synergist, increased toxicity of all three phytochemicals only in CPQ, implicating alternate tolerance mechanisms in R347 and FIG. To test the ability of the strains to utilize novel hostplants directly, we compared survival on diets containing seeds of Wisteria sinensis and Prosopis pallida, two non-host Fabaceae species; survival of FIG was highest and survival of R347 was lowest. Our results suggest that, while P450-mediated pesticide resistance enhances tolerance of certain phytochemicals in this species, it is only one of multiple biochemical adaptations associated with acquiring novel hostplants. PMID:27620560

Relative Preference and Localized Food Affect Predator Space Use and Consumption of Incidental Prey

PubMed Central

Schartel, Tyler E.; Schauber, Eric M.

2016-01-01

Abundant, localized foods can concentrate predators and their foraging efforts, thus altering both the spatial distribution of predation risk and predator preferences for prey that are encountered incidentally. However, few investigations have quantified the spatial scale over which localized foods affect predator foraging behavior and consumption of incidental prey. In spring 2010, we experimentally tested how point-source foods altered how generalist predators (white-footed mice, Peromyscus leucopus) utilized space and depredated two incidental prey items: almonds (Prunus dulcis; highly profitable) and maple seeds (Acer saccharum; less profitable). We estimated mouse population densities with trapping webs, quantified mouse consumption rates of these incidental prey items, and measured local mouse activity with track plates. We predicted that 1) mouse activity would be elevated near full feeders, but depressed at intermediate distances from the feeder, 2) consumption of both incidental prey would be high near feeders providing less-preferred food and, 3) consumption of incidental prey would be contingent on predator preference for prey relative to feeders providing more-preferred food. Mouse densities increased significantly from pre- to post-experiment. Mean mouse activity was unexpectedly greatest in control treatments, particularly <15 m from the control (empty) feeder. Feeders with highly preferred food (sunflower seeds) created localized refuges for incidental prey at intermediate distances (15 to 25m) from the feeder. Feeders with less-preferred food (corn) generated localized high risk for highly preferred almonds <10 m of the feeder. Our findings highlight the contingent but predictable effects of locally abundant food on risk experienced by incidental prey, which can be positive or negative depending on both spatial proximity and relative preference. PMID:26978659

OC-15 - Risk factors for cancer development after idiopathic venous thromboembolism.

PubMed

Cosmi, B; Legnani, C; Ghirarduzzi, A; De Micheli, V; Pengo, V; Testa, S; Poli, D; Antonucci, E; Prisco, D; Tripodi, A; Prandoni, P; Palareti, G

2016-04-01

Idiopathic venous thromboembolism (VTE) is associated with the risk of cancer but the risk factors for cancer development in such patients are still uncertain. To assess risk factors for the development of cancer after a standard course of anticoagulation in patients with first episode of idiopathic VTE. Subjects were enrolled in the three large prospective multicentre studies: PROLONG (NEJM 2006) PROLONG II (Blood 2010) and DULCIS (Blood 2014). Women whose index event was hormone related were excluded from the analysis. The development of cancer was recorded during a 2-year follow-up. 1,805 patients were enrolled (M/F: 510/453), mean age: 62, median: 67; range:18-87 years). Cancer developed in 55 patients (3% ; 1.7% pt-years) of whom 15 (2.0%; 1.1% pt-years) had PE with or without DVT and 40 (3.8%; 2.1% pt-years) had DVT without PE (p=0.03). The development of cancer was associated with DVT without PE (HR:1.8; 95% CI: 1.1-3.3) and age >65 (HR: 2.5; 95%: 1.3-4.9). Among patients with DVT, with or without PE, the development of cancer was associated with the presence of residual vein obstruction>4mm (RVO) at compression ultrasound (HR: 1.8, 95% CI: 1.1-3.3) and age>65 (HR: 2.8; 95% CI: 1.3-6.2). Age>65 years, DVT without PE and the presence of RVO are significantly associated with the risk of developing cancer after a first episode of idiopathic VTE over a two-year follow-up. © 2016 Elsevier Ltd. All rights reserved.

Determination of flavonoids and phenolics and their distribution in almonds.

PubMed

Milbury, Paul E; Chen, Chung-Yen; Dolnikowski, Gregory G; Blumberg, Jeffrey B

2006-07-12

Limited information is available concerning the qualitative and quantitative composition of polyphenolic compounds, especially flavonoids, in almonds. We determined total phenols, flavonoids, and phenolic acids in California almond (Prunus dulcis) skins and kernels among the principal almond varieties (Butte, Carmel, Fritz, Mission, Monterey, Nonpareil, Padre, and Price) with high-performance liquid chromatography (HPLC)/electrochemical detection and UV detection. Liquid chromatography/tandem mass spectrometry under identical HPLC conditions was utilized to verify identities of the predominant flavonoids and phenolic acids. Total phenols ranged from 127 (Fritz) to 241 (Padre) mg gallic acid equivalents/100 g of fresh weight. The analyses were compiled to produce a data set of 18 flavonoids and three phenolic acids. The predominant flavonoids were isorhamnetin-3-O-rutinoside and isorhamnetin-3-O-glucoside (in combination), catechin, kaempferol-3-O-rutinoside, epicatechin, quercetin-3-O-galactoside, and isorhamnetin-3-O-galactoside at 16.81, 1.93, 1.17, 0.85, 0.83, and 0.50 mg/100 g of fresh weight almonds, respectively. Using the existing approach of calculating only the aglycone form of flavonoids for use in the U.S. Department of Agriculture nutrient database, whole almonds would provide the most prevalent aglycones of isorhamnetin at 11.70 (3.32), kaempferol at 0.60 (0.17), catechin at 1.93 (0.55), quercetin at 0.72 (0.20), and epicatechin at 0.85 (0.24) mg/100 g of fresh weight (mg/oz serving), respectively. These data can lead to a better understanding of the mechanisms of action underlying the relationship between almond consumption and health-related outcomes and provide values for whole and blanched almonds suitable for inclusion in nutrient databases.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

PubMed

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Effects of Kaolinite (Macsumsuk) and Herb Mixtures on the Quality and Physicochemical Properties of Pork

PubMed Central

Kim, Byung Ki; Hwang, Eun Gyeong; Jung, Dae Jin; Ha, Jae Jung; Oh, Dong Yep

2014-01-01

The current study was conducted to identify technology for the production of high quality pork, based on the meat consumption habits of consumers. Macsumsuk, a type of kaolinite (a clay mineral), and/or a mixture of herbs (Mori Folium, Sophorae Radix, Glycyrrhizae Radix, Citri Leiocarpae Exocarpium, and Pogostemi Herba) were added to the diets of fattening pigs. Sixty barrow pigs (4 kinds of treatment × 5 pigs/treatment × 3 replicates) were randomly assigned to either the Control (no additives), T1 (3% Macsumsuk), T2 (3% Herb mixtures), or T3 (3% Macsumsuk + 3% Herb mixtures) groups, and were fed the diets for 60 d. Dressed weights were in the order of T1 (93.40±4.68kg) > T2 (91.40±6.52kg) > Control (88.80±1.57kg) > T3 (86.80±2.01kg). Back-fat thickness of the Control animals (23.2±1.03) was significantly greater than that of the various treatment groups (p<0.01). Numeric values representing the carcass yield and quality grade were higher for all the treated groups than the Control group, thought the difference was not statistically significant. Crude fat content was significantly higher in the Control group (2.23±0.34%) than in the treated groups (p<0.05). The addition of both Macsumsuk and herb mixtures into the diets of the pigs significantly reduced cooking loss of the pork compared to the Control (p<0.05). No statistically significant changes were observed in the shear force (average 5.87±0.54 kg/cm2), water holding capacity (average 54.59±3.16%), or CIE values of the pork, whereas cholesterol levels significantly decreased (p<0.01) in those fed Macsumsuk and/or the herb mixtures. No significant changes in fatty acid composition, total saturated fatty acid (SFA), total unsaturated fatty acid (UFA), or UFA/SFA ratios were observed by any of the treatments. In conclusion, the results obtained from this study suggest that the addition of Macsumsuk and/or herb mixtures into the diets of growing and fattening pigs improves the pork quality by reducing

Plant and bird diversity in natural forests and in native and exotic plantations in NW Portugal

NASA Astrophysics Data System (ADS)

Proença, Vânia M.; Pereira, Henrique M.; Guilherme, João; Vicente, Luís

2010-03-01

Forest ecosystems have been subjected to continuous dynamics between deforestation and forestation. Assessing the effects of these processes on biodiversity could be essential for conservation planning. We analyzed patterns of species richness, diversity and evenness of plants and birds in patches of natural forest of Quercus spp. and in stands of native Pinus pinaster and exotic Eucalyptus globulus in NW Portugal. We analyzed data of forest and non-forest species separately, at the intra-patch, patch and inter-patch scales. Forest plant richness, diversity and evenness were higher in oak forest than in pine and eucalypt plantations. In total, 52 species of forest plants were observed in oak forest, 33 in pine plantation and 28 in eucalypt plantation. Some forest species, such as Euphorbia dulcis, Omphalodes nitida and Eryngium juresianum, were exclusively or mostly observed in oak forest. Forest bird richness and diversity were higher in both oak and pine forests than in eucalypt forest; evenness did not differ among forests. In total, 16 species of forest birds were observed in oak forest, 18 in pine forest and 11 in eucalypt forest. Species such as Certhia brachydactyla, Sitta europaea and Dendrocopos major were common in oak and/or pine patches but were absent from eucalypt stands. Species-area relationships of forest plants and forest birds in oak patches had consistently a higher slope, at both the intra and inter-patch scales, than species-area relationships of forest species in plantations and non-forest species in oak forest. These findings demonstrate the importance of oak forest for the conservation of forest species diversity, pointing the need to conserve large areas of oak forest due to the apparent vulnerability of forest species to area loss. Additionally, diversity patterns in pine forest were intermediate between oak forest and eucalypt forest, suggesting that forest species patterns may be affected by forest naturalness.

Ecoinformatics Can Infer Causal Effects of Crop Variety on Insect Attack by Capitalizing on 'Pseudoexperiments' Created When Different Crop Varieties Are Interspersed: A Case Study in Almonds.

PubMed

Rosenheim, Jay A; Higbee, Bradley S; Ackerman, Jonathan D; Meisner, Matthew H

2017-12-05

Capturing the complementary strengths of observational and experimental research methods usually requires the researcher to gather separate experimental and observational data sets. In some cases, however, commercial agricultural practices produce the spatial and temporal mixing of 'treatments' independently of other possibly covarying factors that is normally achieved only with formal experimentation. The resulting 'pseudoexperiments' can provide strong evidence for causal relationships. Here, we analyze a large observational data set that creates a series of such pseudoexperiments to assess the effect of different commercial varieties of almond, Prunus dulcis (Mill.) on the impact of two key lepidopteran pests, the navel orangeworm Amyelois transitella (Walker) (Lepidoptera: Pyralidae), and the peach twig borer Anarsia lineatella Zeller (Lepidoptera: Gelechiidae). Almonds are universally planted as polycultures of different varieties to obtain efficient cross-pollination. We find substantial differences across almond varieties in the rates of infestation of almond hulls and nutmeats by the two pests. We find no support for the hypothesis that earlier-maturing varieties sustain higher attack; for A. transitella, later-maturing varieties instead had more frequent infestation. On many almond varieties, A. lineatella reaches high infestation levels by feeding almost exclusively on the hulls, rather than nutmeats. Given the importance of these pests in directly destroying almond nuts and in promoting aflatoxin-producing Aspergillus sp. fungal infections of almonds, further work exploring the impact of these pests is warranted. Because many crops requiring cross-pollination are planted as mixtures of different varieties, commercial agricultural production data hold great potential for studying within-crop variation in susceptibility to insect attack. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights

Metabolic engineering of geranic acid in maize to achieve fungal resistance is compromised by novel glycosylation patterns.

PubMed

Yang, Ting; Stoopen, Geert; Yalpani, Nasser; Vervoort, Jacques; de Vos, Ric; Voster, Alessandra; Verstappen, Francel W A; Bouwmeester, Harro J; Jongsma, Maarten A

2011-07-01

Many terpenoids are known to have antifungal properties and overexpression of these compounds in crops is a potential tool in disease control. In this study, 15 different mono- and sesquiterpenoids were tested in vitro against two major pathogenic fungi of maize (Zea mays), Colletotrichum graminicola and Fusarium graminearum. Among all tested terpenoids, geranic acid showed very strong inhibitory activity against both fungi (MIC<46 μM). To evaluate the possibility of enhancing fungal resistance in maize by overexpressing geranic acid, we generated transgenic plants with the geraniol synthase gene cloned from Lippia dulcis under the control of a ubiquitin promoter. The volatile and non-volatile metabolite profiles of leaves from transgenic and control lines were compared. The headspaces collected from intact seedlings of transgenic and control plants were not significantly different, although detached leaves of transgenic plants emitted 5-fold more geranyl acetate compared to control plants. Non-targeted LC-MS profiling and LC-MS-MS identification of extracts from maize leaves revealed that the major significantly different non-volatile compounds were 2 geranic acid derivatives, a geraniol dihexose and 4 different types of hydroxyl-geranic acid-hexoses. A geranic acid glycoside was the most abundant, and identified by NMR as geranoyl-6-O-malonyl-β-d-glucopyranoside with an average concentration of 45μM. Fungal bioassays with C. graminicola and F. graminearum did not reveal an effect of these changes in secondary metabolite composition on plant resistance to either fungus. The results demonstrate that metabolic engineering of geraniol into geranic acid can rely on the existing default pathway, but branching glycosylation pathways must be controlled to achieve accumulation of the aglycones. Copyright © 2011 Elsevier Inc. All rights reserved.

Construction of an almond linkage map in an Australian population Nonpareil × Lauranne

PubMed Central

2010-01-01

Background Despite a high genetic similarity to peach, almonds (Prunus dulcis) have a fleshless fruit and edible kernel, produced as a crop for human consumption. While the release of peach genome v1.0 provides an excellent opportunity for almond genetic and genomic studies, well-assessed segregating populations and the respective saturated genetic linkage maps lay the foundation for such studies to be completed in almond. Results Using an almond intraspecific cross between 'Nonpareil' and 'Lauranne' (N × L), we constructed a moderately saturated map with SSRs, SNPs, ISSRs and RAPDs. The N × L map covered 591.4 cM of the genome with 157 loci. The average marker distance of the map was 4.0 cM. The map displayed high synteny and colinearity with the Prunus T × E reference map in all eight linkage groups (G1-G8). The positions of 14 mapped gene-anchored SNPs corresponded approximately with the positions of homologous sequences in the peach genome v1.0. Analysis of Mendelian segregation ratios showed that 17.9% of markers had significantly skewed genotype ratios at the level of P < 0.05. Due to the large number of skewed markers in the linkage group 7, the potential existence of deleterious gene(s) was assessed in the group. Integrated maps produced by two different mapping methods using JoinMap® 3 were compared, and their high degree of similarity was evident despite the positional inconsistency of a few markers. Conclusions We presented a moderately saturated Australian almond map, which is highly syntenic and collinear with the Prunus reference map and peach genome V1.0. Therefore, the well-assessed almond population reported here can be used to investigate the traits of interest under Australian growing conditions, and provides more information on the almond genome for the international community. PMID:20932335

Cloning, Expression, and Characterization of Sorbitol Transporters from Developing Sour Cherry Fruit and Leaf Sink Tissues1

PubMed Central

Gao, Zhifang; Maurousset, Laurence; Lemoine, Remi; Yoo, Sang-Dong; van Nocker, Steven; Loescher, Wayne

2003-01-01

The acyclic polyol sorbitol is a primary photosynthetic product and the principal photosynthetic transport substance in many economically important members of the family Rosaceace (e.g. almond [Prunus dulcis (P. Mill.) D.A. Webber], apple [Malus pumila P. Mill.], cherry [Prunus spp.], peach [Prunus persica L. Batsch], and pear [Pyrus communis]). To understand key steps in long-distance transport and particularly partitioning and accumulation of sorbitol in sink tissues, we have cloned two sorbitol transporter genes (PcSOT1 and PcSOT2) from sour cherry (Prunus cerasus) fruit tissues that accumulate large quantities of sorbitol. Sorbitol uptake activities and other characteristics were measured by heterologous expression of PcSOT1 and PcSOT2 in yeast (Saccharomyces cerevisiae). Both genes encode proton-dependent, sorbitol-specific transporters with similar affinities (Km sorbitol of 0.81 mm for PcSOT1 and 0.64 mm for PcSOT2). Analyses of gene expression of these transporters, however, suggest different roles during leaf and fruit development. PcSOT1 is expressed throughout fruit development, but especially when growth and sorbitol accumulation rates are highest. In leaves, PcSOT1 expression is highest in young, expanding tissues, but substantially less in mature leaves. In contrast, PcSOT2 is mainly expressed only early in fruit development and not in leaves. Compositional analyses suggest that transport mediated by PcSOT1 and PcSOT2 plays a major role in sorbitol and dry matter accumulation in sour cherry fruits. Presence of these transporters and the high fruit sorbitol concentrations suggest that there is an apoplastic step during phloem unloading and accumulation in these sink tissues. Expression of PcSOT1 in young leaves before completion of the transition from sink to source is further evidence for a role in determining sink activity. PMID:12692316

Using Perls Staining to Trace the Iron Uptake Pathway in Leaves of a Prunus Rootstock Treated with Iron Foliar Fertilizers

PubMed Central

Rios, Juan J.; Carrasco-Gil, Sandra; Abadía, Anunciación; Abadía, Javier

2016-01-01

The aim of this study was to trace the Fe uptake pathway in leaves of Prunus rootstock (GF 677; Prunus dulcis × Prunus persica) plants treated with foliar Fe compounds using the Perls blue method, which detects labile Fe pools. Young expanded leaves of Fe-deficient plants grown in nutrient solution were treated with Fe-compounds using a brush. Iron compounds used were the ferrous salt FeSO4, the ferric salts Fe2(SO4)3 and FeCl3, and the chelate Fe(III)-EDTA, all of them at concentrations of 9 mM Fe. Leaf Fe concentration increases were measured at 30, 60, 90 min, and 24 h, and 70 μm-thick leaf transversal sections were obtained with a vibrating microtome and stained with Perls blue. In vitro results show that the Perls blue method is a good tool to trace the Fe uptake pathway in leaves when using Fe salts, but is not sensitive enough when using synthetic Fe(III)-chelates such as Fe(III)-EDTA and Fe(III)-IDHA. Foliar Fe fertilization increased leaf Fe concentrations with all Fe compounds used, with inorganic Fe salts causing larger leaf Fe concentration increases than Fe(III)-EDTA. Results show that Perls blue stain appeared within 30 min in the stomatal areas, indicating that Fe applied as inorganic salts was taken up rapidly via stomata. In the case of using FeSO4 a progression of the stain was seen with time toward vascular areas in the leaf blade and the central vein, whereas in the case of Fe(III) salts the stain mainly remained in the stomatal areas. Perls stain was never observed in the mesophyll areas, possibly due to the low concentration of labile Fe pools. PMID:27446123

Functionality of Varroa-resistant honey bees (Hymenoptera: Apidae) when used in migratory beekeeping for crop pollination.

PubMed

Danka, Robert G; De Guzman, Lilia I; Rinderer, Thomas E; Sylvester, H Allen; Wagener, Christine M; Bourgeois, A Lelania; Harris, Jeffrey W; Villa, José D

2012-04-01

Two types of honey bees, Apis mellifera L. (Hymenoptera: Apidae), bred for resistance to Varroa destructor Anderson & Trueman were evaluated for performance when used in migratory crop pollination. Colonies of Russian honey bees (RHB) and outcrossed bees with Varroa-sensitive hygiene (VSH) were managed without miticide treatments and compared with colonies of Italian honey bees that served as controls. Control colonies were managed as groups which either were treated twice each year against V. destructor (CT) or kept untreated (CU). Totals of 240 and 247 colonies were established initially for trials in 2008 and 2009, respectively. RHB and VSH colonies generally had adult and brood populations similar to those of the standard CT group regarding pollination requirements. For pollination of almonds [Prunus dulcis (Mill.) D.A.Webb] in February, percentages of colonies meeting the required six or more frames of adult bees were 57% (VSH), 56% (CT), 39% (RHB), and 34% (CU). RHB are known to have small colonies in early spring, but this can be overcome with appropriate feeding. For later pollination requirements in May to July, 94-100% of colonies in the four groups met pollination size requirements for apples (Malus domestica Borkh.), cranberries (Vaccinium macrocarpon Aiton), and lowbush blueberries (Vaccinium angustifolium Aiton). Infestations with V. destructor usually were lowest in CT colonies and tended to be lower in VSH colonies than in RHB and CU colonies. This study demonstrates that bees with the VSH trait and pure RHB offer alternatives for beekeepers to use for commercial crop pollination while reducing reliance on miticides. The high frequency of queen loss (only approximately one fourth of original queens survived each year) suggests that frequent requeening is necessary to maintain desired genetics.

Phytophthora niederhauserii sp. nov., a polyphagous species associated with ornamentals, fruit trees and native plants in 13 countries.

PubMed

Abad, Z Gloria; Abad, Jorge A; Cacciola, Santa Olga; Pane, Antonella; Faedda, Roberto; Moralejo, Eduardo; Pérez-Sierra, Ana; Abad-Campos, Paloma; Alvarez-Bernaola, Luis A; Bakonyi, József; Józsa, András; Herrero, Maria Luz; Burgess, Treena I; Cunnington, James H; Smith, Ian W; Balci, Yilmaz; Blomquist, Cheryl; Henricot, Béatrice; Denton, Geoffrey; Spies, Chris; Mcleod, Adele; Belbahri, Lassaad; Cooke, David; Kageyama, Koji; Uematsu, Seiji; Kurbetli, Ilker; Değirmenci, Kemal

2014-01-01

A non-papillate, heterothallic Phytophthora species first isolated in 2001 and subsequently from symptomatic roots, crowns and stems of 33 plant species in 25 unrelated botanical families from 13 countries is formally described here as a new species. Symptoms on various hosts included crown and stem rot, chlorosis, wilting, leaf blight, cankers and gumming. This species was isolated from Australia, Hungary, Israel, Italy, Japan, the Netherlands, Norway, South Africa, Spain, Taiwan, Turkey, the United Kingdom and United States in association with shrubs and herbaceous ornamentals grown mainly in greenhouses. The most prevalent hosts are English ivy (Hedera helix) and Cistus (Cistus salvifolius). The association of the species with acorn banksia (Banksia prionotes) plants in natural ecosystems in Australia, in affected vineyards (Vitis vinifera) in South Africa and almond (Prunus dulcis) trees in Spain and Turkey in addition to infection of shrubs and herbaceous ornamentals in a broad range of unrelated families are a sign of a wide ecological adaptation of the species and its potential threat to agricultural and natural ecosystems. The morphology of the persistent non-papillate ellipsoid sporangia, unique toruloid lobate hyphal swellings and amphigynous antheridia does not match any of the described species. Phylogenetic analysis based on sequences of the ITS rDNA, EF-1α, and β-tub supported that this organism is a hitherto unknown species. It is closely related to species in ITS clade 7b with the most closely related species being P. sojae. The name Phytophthora niederhauserii has been used in previous studies without the formal description of the holotype. This name is validated in this manuscript with the formal description of Phytophthora niederhauserii Z.G. Abad et J.A. Abad, sp. nov. The name is coined to honor Dr John S. Niederhauser, a notable plant pathologist and the 1990 World Food Prize laureate. © 2014 by The Mycological Society of America.

Impact of Pesticide Resistance on Toxicity and Tolerance of Hostplant Phytochemicals in Amyelois Transitella (Lepidoptera: Pyralidae).

PubMed

Bagchi, Vikram A; Siegel, Joel P; Demkovich, Mark R; Zehr, Luke N; Berenbaum, May R

2016-01-01

For some polyphagous insects, adaptation to phytochemically novel plants can enhance resistance to certain pesticides, but whether pesticide resistance expands tolerance to phytochemicals has not been examined. Amyelois transitella Walker (navel orangeworm) is an important polyphagous pest of nut and fruit tree crops in California. Bifenthrin resistance, partially attributable to enhanced cytochrome P450 (P450)-mediated detoxification, has been reported in an almond-infesting population exposed to intense pesticide selection. We compared the toxicity of bifenthrin and three phytochemicals-chlorogenic acid, and the furanocoumarins xanthotoxin and bergapten-to three strains of A. transitella: pyrethroid-resistant R347 (maintained in the laboratory for ∼10 generations), fig-derived FIG (in the laboratory for ∼25 generations), and CPQ-a laboratory strain derived from almonds ∼40 years ago). Whereas both Ficus carica (fig) and Prunus dulcis (almond) contain chlorogenic acid, furanocoumarins occur only in figs. Both R347 and FIG exhibited 2-fold greater resistance to the three phytochemicals compared with CPQ; surprisingly, bifenthrin resistance was highest in FIG. Piperonyl butoxide, a P450 synergist, increased toxicity of all three phytochemicals only in CPQ, implicating alternate tolerance mechanisms in R347 and FIG. To test the ability of the strains to utilize novel hostplants directly, we compared survival on diets containing seeds of Wisteria sinensis and Prosopis pallida, two non-host Fabaceae species; survival of FIG was highest and survival of R347 was lowest. Our results suggest that, while P450-mediated pesticide resistance enhances tolerance of certain phytochemicals in this species, it is only one of multiple biochemical adaptations associated with acquiring novel hostplants. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Relationship between endogenous hormonal content and somatic organogenesis in callus of peach (Prunus persica L. Batsch) cultivars and Prunus persica×Prunus dulcis rootstocks.

PubMed

Pérez-Jiménez, Margarita; Cantero-Navarro, Elena; Pérez-Alfocea, Francisco; Le-Disquet, Isabel; Guivarc'h, Anne; Cos-Terrer, José

2014-05-01

The relationship between endogenous hormones content and the induction of somatic peach plant was studied. To induce multiple shoots from callus derived from the base of stem explants of the scion cultivars 'UFO-3', 'Flariba' and 'Alice Bigi', and the peach×almond rootstocks 'Garnem' and 'GF677', propagated plants were cultured on Murashige and Skoog salts augmented with 0.1mgL(-1) of indolebutyric acid, 1mgL(-1) of 6-benzylaminopurine and 3% sucrose. The highest regeneration rate was obtained with the peach×almond rootstocks. Endogenous levels of abscisic acid (ABA), indole-3-acetic acid (IAA), zeatin (Z), zeatin riboside (ZR), ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC), salicylic acid (SA), and jasmonic acid (JA) were analyzed in the organogenic callus. Lower levels of several hormones, namely Z, ZR, ABA, and ACC were found in the peach×almond rootstock compared to peach cultivars, while IAA and SA presented inconclusive returns. These results suggest that the difference in somatic organogenesis capacity observed in peach and peach×almond hybrids is markedly affected by the endogenous hormonal content of the studied genotypes. Copyright © 2014 Elsevier GmbH. All rights reserved.

Anti-osteoarthritic effects of ChondroT in a rat model of collagenase-induced osteoarthritis.

PubMed

Jeong, Jiwon; Bae, Kiljoon; Kim, Sun-Gil; Kwak, Dongwook; Moon, Young-Joo; Choi, Chan-Hun; Kim, Young-Ran; Na, Chang-Su; Kim, Seon-Jong

2018-04-19

Previously, we reported that ChondorT showed significant anti-arthritis and anti-inflammatory effects. ChondroT, a new herbal medication, consists of the water extracts of Osterici Radix, Lonicerae Folium, Angelicae Gigantis Radix, Clematidis Radix, and Phellodendri Cortex (6:4:4:4:3). The objective of this study was to investigate the effects of ChondroT in collagenase-induced osteoarthritis rat model. Osteoarthritis was induced by the injection of collagenase into the right knee joint cavity of rats. The samples were divided into seven groups [intact (n = 6), control (n = 6), indomethacin (n = 6), Joins tab (n = 6), ChondroT50 (n = 6), ChondroT100 (n = 6), and ChondroT200 (n = 6)]. The control group was administered normal saline, indomethacin group was administered indomethacin (2 mg/kg), and Joins tab group was administered Joins Tab (20 mg/kg). The ChondroT50, ChondroT100, and ChondroT200 groups were administered 50, 100, and 200 mg/kg of ChondroT, respectively. All oral administrations were initiated 7 days after the induction of arthritis and were continued for a total of 12 days. At the end of the experiment, serum aminotransferase, albumin, blood urea nitrogen, creatinine, leukocyte, and inflammatory cytokines [tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6] were analyzed. Hematoxylin and eosin (H&E) and safranin O-fast green staining of the articular structures of the knee joint were performed. TNF-α and IL-1β decreased in the ChondroT100 and ChondroT200 groups compared with those in the control group. IL-6 and aspartate aminotransferase decreased in the ChondroT50, ChondroT100, and ChondroT200 groups compared with that in the control group. Albumin, WBC and lymphocytes decreased in the ChondroT100 and ChondroT200 groups compared with those in the control group. In H&E stain, synoviocytes, cartilage lacunae, and chondrocytes were well preserved in the ChondroT100 and ChondroT200 groups, and safranin O

Cerebellar nodulectomy impairs spatial memory of vestibular and optokinetic stimulation in rabbits.

PubMed

Barmack, N H; Errico, P; Ferraresi, A; Fushiki, H; Pettorossi, V E; Yakhnitsa, V

2002-02-01

Natural vestibular and optokinetic stimulation were used to investigate the possible role of the cerebellar nodulus in the regulation and modification of reflexive eye movements in rabbits. The nodulus and folium 9d of the uvula were destroyed by surgical aspiration. Before and after nodulectomy the vertical and horizontal vestibuloocular reflexes (VVOR, HVOR) were measured during sinusoidal vestibular stimulation about the longitudinal (roll) and vertical (yaw) axes. Although the gain of the HVOR (G(HVOR) = peak eye movement velocity/peak head velocity) was not affected by the nodulectomy, the gain of the VVOR (G(VVOR)) was reduced. The gains of the vertical and horizontal optokinetic reflexes (G(VOKR), G(HOKR)) were measured during monocular, sinusoidal optokinetic stimulation (OKS) about the longitudinal and vertical axes. Following nodulectomy, there was no reduction in G(VOKR) or G(HOKR). Long-term binocular OKS was used to generate optokinetic afternystagmus, OKAN II, that lasts for hours. After OKAN II was induced, rabbits were subjected to static pitch and roll, to determine how the plane and velocity of OKAN II is influenced by a changing vestibular environment. During static pitch, OKAN II slow phase remained aligned with earth-horizontal. This was true for normal and nodulectomized rabbits. During static roll, OKAN II remained aligned with earth-horizontal in normal rabbits. During static roll in nodulectomized rabbits, OKAN II slow phase developed a centripetal vertical drift. We examined the suppression and recovery of G(VVOR) following exposure to conflicting vertical OKS for 10-30 min. This vestibular-optokinetic conflict reduced G(VVOR) in both normal and nodulectomized rabbits. The time course of recovery of G(VVOR) after conflicting OKS was the same before and after nodulectomy. In normal rabbits, the head pitch angle, at which peak OKAN II velocity occurred, corresponded to the head pitch angle maintained during long-term OKS. If the head was

Phytohormone Signaling of the Resistance to Plum pox virus (PPV, Sharka Disease) Induced by Almond (Prunus dulcis (Miller) Webb) Grafting to Peach (P. persica L. Batsch).

PubMed

Dehkordi, Azam Nikbakht; Rubio, Manuel; Babaeian, Nadali; Albacete, Alfonso; Martínez-Gómez, Pedro

2018-05-03

Plum pox virus (PPV, sharka) is a limiting factor for peach production, and no natural sources of resistance have been described. Recent studies, however, have demonstrated that grafting the almond cultivar "Garrigues" onto the "GF305" peach infected with Dideron-type (PPV-D) isolates progressively reduces disease symptoms and virus accumulation. Furthermore, grafting "Garrigues" onto "GF305" prior to PPV-D inoculation has been found to completely prevent virus infection, showing that resistance is constitutive and not induced by the virus. To unravel the phytohormone signaling of this mechanism, we analyzed the following phytohormones belonging to the principal hormone classes: the growth-related phytohormones cytokinin trans-zeatin (tZ) and the gibberellins GA₃ and GA₄; and the stress-related phytohormones ethylene acid precursor 1-aminocyclopropane-1-carboxylic acid (ACC), abscisic acid (ABA), salicylic acid (SA), and jasmonic acid (JA). PPV inoculation produced a significant increase in GA₃ and ABA in peach, and these imbalances were related to the presence of chlorosis symptoms. However, grafting "Garrigues" almond onto the PPV-inoculated "GF305" peach produced the opposite effect, reducing GA₃ and ABA contents in parallel to the elimination of symptoms. Our results showed the significant implication of SA in this induced resistance in peach with an additional effect on tZ and JA concentrations. This SA-induced resistance based in the decrease in symptoms seems to be different from Systemic Acquired Resistance (SAR) and Induced Systemic Resistance (ISR), which are based in other reactions producing necrosis. Further studies are necessary, however, to validate these results against PPV-D isolates in the more aggressive Marcus-type (PPV-M) isolates.

Medicinal plants of Papua New Guinea's Miu speaking population and a focus on their use of plant-slaked lime mixtures.

PubMed

Prescott, Thomas A K; Briggs, Marie; Kiapranis, Robert; Simmonds, Monique S J

2015-11-04

Here we present the results of an ethnobotanical survey of the medicinal plants used by the Miu, a virtually unresearched ethnolinguistic group who live in the mountainous interior of Papua New Guinea's West New Britain Province. We compare the findings for those previously reported for the neighbouring inland Kaulong speaking population. Three species, Trema orientalis, Spondias dulcis and Ficus botryocarpa are used in combination with locally prepared slaked lime to produce intensely coloured mixtures which are applied to dermatological infections. Their effects on dermal fibroblast viability with and without slaked lime are examined. The sap of F. botryocarpa which is used to treat tropical ulcers was examined further with assays relevant to wound healing. Focus groups and semi-structured interviews were used to acquire information on the uses of plants, vouchers of which were collected and identified by comparison with authentic herbarium specimens. LC-MS and NMR were used to identify chemical components. Cell viability assays were used to examine the effects of added slaked lime on dermal fibroblasts. For the sap of F. botryocarpa, fibroblast stimulation assays and antibacterial growth inhibition with Bacillus subtilis were carried out. The survey identified 33 plants and one fungal species, and clear differences with the inland Kaulong group despite their close proximity. Added slaked lime does not greatly increase the cytotoxicity of plant material towards dermal fibroblasts. The sap of F. botryocarpa contains the alkaloid ficuseptine as a single major component and displays antibacterial activity. The results demonstrate the potential for variation in medicinal plant use amongst Papua New Guinea's numerous language groups. The addition of slaked lime to plant material does not appear to present a concern for wound healing in the amounts used. The sap of F. botryocarpa displays antibacterial activity at concentrations that would occur at the wound surface

Medicinal plants used to treat snakebite in Central America: Review and assessment of scientific evidence.

PubMed

Giovannini, Peter; Howes, Melanie-Jayne R

2017-03-06

Every year between 1.2 and 5.5 million people worldwide are victims of snakebites, with about 400,000 left permanently injured. In Central America an estimated 5500 snakebite cases are reported by health centres, but this is likely to be an underestimate due to unreported cases in rural regions. The aim of this study is to review the medicinal plants used traditionally to treat snakebites in seven Central American countries: Belize, Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua and Panama. A literature search was performed on published primary data on medicinal plants of Central America and those specifically pertaining to use against snakebites. Plant use reports for traditional snakebite remedies identified in primary sources were extracted and entered in a database, with data analysed in terms of the most frequent numbers of use reports. The scientific evidence that might support the local uses of the most frequently reported species was also examined. A total of 260 independent plant use reports were recorded in the 34 sources included in this review, encompassing 208 species used to treat snakebite in Central America. Only nine species were reported in at least three studies: Cissampelos pareira L., Piper amalago L., Aristolochia trilobata L., Sansevieria hyacinthoides (L.) Druce, Strychnos panamensis Seem., Dorstenia contrajerva L., Scoparia dulcis L., Hamelia patens Jacq., and Simaba cedron Planch. Genera with the highest number of species used to treat snakebite were Piper, Aristolochia, Hamelia, Ipomoea, Passiflora and Peperomia. The extent of the scientific evidence available to understand any pharmacological basis for their use against snakebites varied between different plant species. At least 208 plant species are traditionally used to treat snakebite in Central America but there is a lack of clinical research to evaluate their efficacy and safety. Available pharmacological data suggest different plant species may target different symptoms of

Quantitative Ethnobotany of Medicinal Plants Used by Indigenous Communities in the Bandarban District of Bangladesh.

PubMed

Faruque, Mohammad O; Uddin, Shaikh B; Barlow, James W; Hu, Sheng; Dong, Shuang; Cai, Qian; Li, Xiaohua; Hu, Xuebo

2018-01-01

This study documents information on significant ethnomedicinal plants, which was collected from the traditional healers of three indigenous communities of Bangladesh. The documented data were quantitatively analyzed for the first time in this area. The information was obtained through open-ended, semi-structured questionnaires. The benefits, importance and coverage of ethnomedicine were expressed through several quantitative indices including Informant Consensus Factor (ICF), Use Value (UV), Frequency of Citation (FC), Relative Frequency of Citation (RFC) and Relative Importance Index (RI). The agreement of homogeneity between the present and previous studies and among the indigenous communities was evaluated using the Jaccard Index (JI). A total of 159 ethnomedicinal plant species, which were distributed in 132 genera under 62 families, were documented from 174 informants. Of these, 128 plants were native and 31 were exotic. Of a majority of documented species, herbs and leaves were the most utilized plant parts for the preparation of ethnomedicines (45.28%) whereas pastes (63.03%) were the most popular formulations. Among the documented species, the dominant families were the Asteraceae (14 species) and the Lamiaceae (12 species). The highest ICF value was 0.77 for digestive system disorders. Based on UVs, the five most commonly used ethnomedicinal plant species in the study area were Duabanga grandiflora (0.43), Zingiber officinale (0.41), Congea tomentosa (0.40), Matricaria chamomilla (0.33) and Engelhardtia spicata (0.28). The highest RFC was recorded for Rauvolfia serpentina (0.25). The highest RI value was calculated for both Scoparia dulcis and Leucas aspera (0.83). Importantly, 16 species were reported with new therapeutic uses and to our knowledge, 7 species described herein have never been ethnobotanically and pharmacologically studied, viz: Agastache urticifolia, Asarum cordifolium, C. tomentosa, E. spicata, Hypserpa nitida, Merremia vitifolia and

Predicting unsaturated zone nitrogen mass balances in agricultural settings of the United States

USGS Publications Warehouse

Nolan, Bernard T.; Puckett, Larry J.; Ma, Liwang; Green, Christopher T.; Bayless, E. Randall; Malone, Robert W.

2009-01-01

Unsaturated zone N fate and transport were evaluated at four sites to identify the predominant pathways of N cycling: an almond [Prunus dulcis (Mill.) D.A. Webb] orchard and cornfield (Zea mays L.) in the lower Merced River study basin, California; and corn–soybean [Glycine max (L.) Merr.] rotations in study basins at Maple Creek, Nebraska, and at Morgan Creek, Maryland. We used inverse modeling with a new version of the Root Zone Water Quality Model (RZWQM2) to estimate soil hydraulic and nitrogen transformation parameters throughout the unsaturated zone; previous versions were limited to 3-m depth and relied on manual calibration. The overall goal of the modeling was to derive unsaturated zone N mass balances for the four sites. RZWQM2 showed promise for deeper simulation profiles. Relative root mean square error (RRMSE) values for predicted and observed nitrate concentrations in lysimeters were 0.40 and 0.52 for California (6.5 m depth) and Nebraska (10 m), respectively, and index of agreement (d) values were 0.60 and 0.71 (d varies between 0 and 1, with higher values indicating better agreement). For the shallow simulation profile (1 m) in Maryland, RRMSE and d for nitrate were 0.22 and 0.86, respectively. Except for Nebraska, predictions of average nitrate concentration at the bottom of the simulation profile agreed reasonably well with measured concentrations in monitoring wells. The largest additions of N were predicted to come from inorganic fertilizer (153–195 kg N ha−1 yr−1 in California) and N fixation (99 and 131 kg N ha−1 yr−1 in Maryland and Nebraska, respectively). Predicted N losses occurred primarily through plant uptake (144–237 kg N ha−1 yr−1) and deep seepage out of the profile (56–102 kg N ha−1 yr−1). Large reservoirs of organic N (up to 17,500 kg N ha−1 m−1 at Nebraska) were predicted to reside in the unsaturated zone, which has implications for potential future transfer of nitrate to groundwater.

Quantitative Ethnobotany of Medicinal Plants Used by Indigenous Communities in the Bandarban District of Bangladesh

PubMed Central

Faruque, Mohammad O.; Uddin, Shaikh B.; Barlow, James W.; Hu, Sheng; Dong, Shuang; Cai, Qian; Li, Xiaohua; Hu, Xuebo

2018-01-01

This study documents information on significant ethnomedicinal plants, which was collected from the traditional healers of three indigenous communities of Bangladesh. The documented data were quantitatively analyzed for the first time in this area. The information was obtained through open-ended, semi-structured questionnaires. The benefits, importance and coverage of ethnomedicine were expressed through several quantitative indices including Informant Consensus Factor (ICF), Use Value (UV), Frequency of Citation (FC), Relative Frequency of Citation (RFC) and Relative Importance Index (RI). The agreement of homogeneity between the present and previous studies and among the indigenous communities was evaluated using the Jaccard Index (JI). A total of 159 ethnomedicinal plant species, which were distributed in 132 genera under 62 families, were documented from 174 informants. Of these, 128 plants were native and 31 were exotic. Of a majority of documented species, herbs and leaves were the most utilized plant parts for the preparation of ethnomedicines (45.28%) whereas pastes (63.03%) were the most popular formulations. Among the documented species, the dominant families were the Asteraceae (14 species) and the Lamiaceae (12 species). The highest ICF value was 0.77 for digestive system disorders. Based on UVs, the five most commonly used ethnomedicinal plant species in the study area were Duabanga grandiflora (0.43), Zingiber officinale (0.41), Congea tomentosa (0.40), Matricaria chamomilla (0.33) and Engelhardtia spicata (0.28). The highest RFC was recorded for Rauvolfia serpentina (0.25). The highest RI value was calculated for both Scoparia dulcis and Leucas aspera (0.83). Importantly, 16 species were reported with new therapeutic uses and to our knowledge, 7 species described herein have never been ethnobotanically and pharmacologically studied, viz: Agastache urticifolia, Asarum cordifolium, C. tomentosa, E. spicata, Hypserpa nitida, Merremia vitifolia and

Ethnomedicines used in Trinidad and Tobago for urinary problems and diabetes mellitus.

PubMed

Lans, Cheryl A

2006-10-13

This paper is based on ethnobotanical interviews conducted from 1996-2000 in Trinidad and Tobago with thirty male and female respondents. A non-experimental validation was conducted on the plants used for urinary problems and diabetes mellitus: This is a preliminary step to establish that the plants used are safe or effective, to help direct clinical trials, and to inform Caribbean physicians of the plants' known properties to avoid counter-prescribing. The following plants are used to treat diabetes: Antigonon leptopus, Bidens alba, Bidens pilosa, Bixa orellana, Bontia daphnoides, Carica papaya, Catharanthus roseus, Cocos nucifera, Gomphrena globosa, Laportea aestuans, Momordica charantia, Morus alba, Phyllanthus urinaria and Spiranthes acaulis. Apium graviolens is used as a heart tonic and for low blood pressure. Bixa orellana, Bontia daphnoides, Cuscuta americana and Gomphrena globosa are used for jaundice. The following plants are used for hypertension: Aloe vera, Annona muricata, Artocarpus altilis, Bixa orellana, Bidens alba, Bidens pilosa, Bonta daphnoides, Carica papaya, Cecropia peltata, Citrus paradisi, Cola nitida, Crescentia cujete, Gomphrena globosa, Hibiscus sabdariffa, Kalanchoe pinnata, Morus alba, Nopalea cochinellifera, Ocimum campechianum, Passiflora quadrangularis, Persea americana and Tamarindus indicus. The plants used for kidney problems are Theobroma cacao, Chamaesyce hirta, Flemingia strobilifera, Peperomia rotundifolia, Petiveria alliacea, Nopalea cochinellifera, Apium graveolens, Cynodon dactylon, Eleusine indica, Gomphrena globosa, Pityrogramma calomelanos and Vetiveria zizanioides. Plants are also used for gall stones and for cooling. Chamaesyce hirta, Cissus verticillata, Kalanchoe pinnata, Peperomia spp., Portulaca oleraceae, Scoparia dulcis, and Zea mays have sufficient evidence to support their traditional use for urinary problems, "cooling" and high cholesterol. Eggplant extract as a hypocholesterolemic agent has some support but

Anomalous, extreme weather disrupts obligate seed dispersal mutualism: snow in a subtropical forest ecosystem.

PubMed

Zhou, Youbing; Newman, Chris; Chen, Jin; Xie, Zongqiang; Macdonald, David W

2013-09-01

Ongoing global climate change is predicted to increase the frequency and magnitude of extreme weather events, impacting population dynamics and community structure. There is, however, a critical lack of case studies considering how climatic perturbations affect biotic interactions. Here, we document how an obligate seed dispersal mutualism was disrupted by a temporally anomalous and meteorologically extreme interlude of unseasonably frigid weather, with accompanying snowstorms, in subtropical China, during January-February 2008. Based on the analysis of 5892 fecal samples (representing six mammalian seed dispersers), this event caused a substantial disruption to the relative seed dispersal function for the raisin tree Hovenia dulcis from prestorm 6.29 (2006) and 11.47 (2007), down to 0.35 during the storm (2008). Crucially, this was due to impacts on mammalian seed dispersers and not due to a paucity of fruit, where 4.63 fruit per branch were available in January 2008, vs. 3.73 in 2006 and 3.58 in 2007. An induced dietary shift occurred among omnivorous carnivores during this event, from the consumption fruit to small mammals and birds, reducing their role in seed dispersal substantially. Induced range shift extinguished the functionality of herbivorous mammals completely, however, seed dispersal function was compensated in part by three omnivorous carnivores during poststorm years, and thus while the mutualism remained intact it was enacted by a narrower assemblage of species, rendering the system more vulnerable to extrinsic perturbations. The storm's extended effects also had anthropogenic corollaries - migrating ungulates becoming exposed to heightened levels of illegal hunting - causing long-term modification to the seed dispersal community and mutualism dynamics. Furthermore, degraded forests proved especially vulnerable to the storm's effects. Considering increasing climate variability and anthropogenic disturbance, the impacts of such massive, aberrant

DNA transposons have colonized the genome of the giant virus Pandoravirus salinus.

PubMed

Sun, Cheng; Feschotte, Cédric; Wu, Zhiqiang; Mueller, Rachel Lockridge

2015-06-12

Transposable elements are mobile DNA sequences that are widely distributed in prokaryotic and eukaryotic genomes, where they represent a major force in genome evolution. However, transposable elements have rarely been documented in viruses, and their contribution to viral genome evolution remains largely unexplored. Pandoraviruses are recently described DNA viruses with genome sizes that exceed those of some prokaryotes, rivaling parasitic eukaryotes. These large genomes appear to include substantial noncoding intergenic spaces, which provide potential locations for transposable element insertions. However, no mobile genetic elements have yet been reported in pandoravirus genomes. Here, we report a family of miniature inverted-repeat transposable elements (MITEs) in the Pandoravirus salinus genome, representing the first description of a virus populated with a canonical transposable element family that proliferated by transposition within the viral genome. The MITE family, which we name Submariner, includes 30 copies with all the hallmarks of MITEs: short length, terminal inverted repeats, TA target site duplication, and no coding capacity. Submariner elements show signs of transposition and are undetectable in the genome of Pandoravirus dulcis, the closest known relative Pandoravirus salinus. We identified a DNA transposon related to Submariner in the genome of Acanthamoeba castellanii, a species thought to host pandoraviruses, which contains remnants of coding sequence for a Tc1/mariner transposase. These observations suggest that the Submariner MITEs of P. salinus belong to the widespread Tc1/mariner superfamily and may have been mobilized by an amoebozoan host. Ten of the 30 MITEs in the P. salinus genome are located within coding regions of predicted genes, while others are close to genes, suggesting that these transposons may have contributed to viral genetic novelty. Our discovery highlights the remarkable ability of DNA transposons to colonize and shape

Effect of irradiation, active and modified atmosphere packaging, container oxygen barrier and storage conditions on the physicochemical and sensory properties of raw unpeeled almond kernels (Prunus dulcis).

PubMed

Mexis, Stamatios F; Riganakos, Kyriakos A; Kontominas, Michael G

2011-03-15

The present study investigated the effect of irradiation, active and modified atmosphere packaging, and storage conditions on quality retention of raw, whole, unpeeled almonds. Almond kernels were packaged in barrier and high-barrier pouches, under N(2) or with an O(2) absorber and stored either under fluorescent lighting or in the dark at 20 °C for 12 months. Quality parameters monitored were peroxide value, hexanal content, colour, fatty acid composition and volatile compounds. Of the sensory attributes colour, texture, odour and taste were evaluated. Peroxide value and hexanal increased with dose of irradiation and storage time. Irradiation resulted in a decrease of polyunsaturated and monounsaturated fatty acids during storage with a parallel increase of saturated fatty acids. Volatile compounds were not affected by irradiation but increased with storage time indicating enhanced lipid oxidation. Colour parameters of samples remained unaffected immediately after irradiation. For samples packaged under a N(2) , atmosphere L and b values decreased during storage with a parallel increase of value a resulting to gradual product darkening especially in irradiated samples. Non-irradiated almonds retained acceptable quality for ca. 12 months stored at 20 °C with the O(2) absorber irrespective of lighting conditions and packaging material oxygen barrier. The respective shelf life for samples irradiated at 1.0 kGy was 12 months packaged in PET-SiOx//LDPE irrespective of lighting conditions and 12 months for samples irradiated at 3 kGy packaged in PET-SiOx//LDPE stored in the dark. Copyright © 2010 Society of Chemical Industry.

Anti-diabetic properties of rice-based herbal porridges in diabetic Wistar rats.

PubMed

Senadheera, Senadheera Pathirannehelage Anuruddhika Subhashinie; Ekanayake, Sagarika; Wanigatunge, Chandanie

2014-10-01

The present study aims to investigate anti-hyperglycaemic, anti-hyperlipidaemic and toxic effects of long-term consumption of selected green leafy porridges in a streptozotocin-induced diabetic Wistar rat model. Porridges made with Asparagus racemosus Willd. (AR), Hemidesmus indicus (L) R. Br. W. T. Aiton (HI), Scoparia dulcis L. (SD) and coconut milk porridge (CM) were incorporated into diets of diabetic Wistar rats. Diabetic control (DM) and normal control groups (NC) were provided with standard rat diet. Fasting blood glucose (FBG), HbA1c , C reactive protein (CRP), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), liver enzymes and creatinine were measured. Feed and water intake among diabetic groups were significantly high when compared with those of NC (p < 0.05). All rats in SD (mean = 39 ± 19 g) and NC (mean = 114 ± 7 g) groups gained weight, whereas most rats in other diabetic groups lost weight. Among the diabetic groups, SD group had the lowest mean FBG, FBG increment percentage (45%) and HbA1c (5.8 ± 2.1). FBG increment percentage and HbA1c of SD group were not significantly different to those of NC (38%; 4.7 ± 0.7) (p > 0.05). Among the diabetic groups, lowest TC (119 ± 20.6 mg/dL) and highest HDL-C (33 ± 6.3 mg/dL) were also detected in SD group. Alanine transaminase and creatinine were not significantly different (p > 0.05) among diabetic groups but significant when compared with those of NC. When compared with those of NC, aspartate transaminase levels were significantly (p < 0.05) high in SD, CM and DM groups. Body weight : liver weight and body weight : pancreas weight ratios and CRP were not significantly different among all groups. The study proved that SD porridge reduced weight loss, elicited hypoglycaemic and hypolipidaemic properties, and caused no toxicity in diabetes-induced Wistar rats. Copyright © 2014 John Wiley & Sons, Ltd.

Version VI of the ESTree db: an improved tool for peach transcriptome analysis

PubMed Central

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Merelli, Ivan; Barale, Francesca; Milanesi, Luciano; Stella, Alessandra; Pozzi, Carlo

2008-01-01

Background The ESTree database (db) is a collection of Prunus persica and Prunus dulcis EST sequences that in its current version encompasses 75,404 sequences from 3 almond and 19 peach libraries. Nine peach genotypes and four peach tissues are represented, from four fruit developmental stages. The aim of this work was to implement the already existing ESTree db by adding new sequences and analysis programs. Particular care was given to the implementation of the web interface, that allows querying each of the database features. Results A Perl modular pipeline is the backbone of sequence analysis in the ESTree db project. Outputs obtained during the pipeline steps are automatically arrayed into the fields of a MySQL database. Apart from standard clustering and annotation analyses, version VI of the ESTree db encompasses new tools for tandem repeat identification, annotation against genomic Rosaceae sequences, and positioning on the database of oligomer sequences that were used in a peach microarray study. Furthermore, known protein patterns and motifs were identified by comparison to PROSITE. Based on data retrieved from sequence annotation against the UniProtKB database, a script was prepared to track positions of homologous hits on the GO tree and build statistics on the ontologies distribution in GO functional categories. EST mapping data were also integrated in the database. The PHP-based web interface was upgraded and extended. The aim of the authors was to enable querying the database according to all the biological aspects that can be investigated from the analysis of data available in the ESTree db. This is achieved by allowing multiple searches on logical subsets of sequences that represent different biological situations or features. Conclusions The version VI of ESTree db offers a broad overview on peach gene expression. Sequence analyses results contained in the database, extensively linked to external related resources, represent a large amount of

Environment- and activity-dependent dopamine neurotransmitter plasticity in the adult substantia nigra.

PubMed

Aumann, Tim D

2016-04-01

The ability of neurons to change the amount or type of neurotransmitter they use, or 'neurotransmitter plasticity', is an emerging new form of adult brain plasticity. For example, it has recently been shown that neurons in the adult rat hypothalamus up- or down-regulate dopamine (DA) neurotransmission in response to the amount of light the animal receives (photoperiod), and that this in turn affects anxiety- and depressive-like behaviors (Dulcis et al., 2013). In this Chapter I consolidate recent evidence from my laboratory suggesting neurons in the adult mouse substantia nigra pars compacta (SNc) also undergo DA neurotransmitter plasticity in response to persistent changes in their electrical activity, including that driven by the mouse's environment or behavior. Specifically, we have shown that the amounts of tyrosine hydroxylase (TH, the rate-limiting enzyme in DA synthesis) gene promoter activity, TH mRNA and TH protein in SNc neurons increases or decreases after ∼20h of altered electrical activity. Also, infusion of ion-channel agonists or antagonists into the midbrain for 2 weeks results in ∼10% (∼500 neurons) more or fewer TH immunoreactive (TH+) SNc neurons, with no change in the total number of SNc neurons (TH+ and TH-). Targeting ion-channels mediating cell-autonomous pacemaker activity in, or synaptic input and afferent pathways to, SNc neurons are equally effective in this regard. In addition, exposing mice to different environments (sex pairing or environment enrichment) for 1-2 weeks induces ∼10% more or fewer TH+ SNc (and ventral tegmental area or VTA) neurons and this is abolished by concurrent blockade of synaptic transmission in midbrain. Although further research is required to establish SNc (and VTA) DA neurotransmitter plasticity, and to determine whether it alters brain function and behavior, it is an exciting prospect because: (1) It may play important roles in movement, motor learning, reward, motivation, memory and cognition; and (2

Ethnomedicines used in Trinidad and Tobago for urinary problems and diabetes mellitus

PubMed Central

Lans, Cheryl A

2006-01-01

Background This paper is based on ethnobotanical interviews conducted from 1996–2000 in Trinidad and Tobago with thirty male and female respondents. Methods A non-experimental validation was conducted on the plants used for urinary problems and diabetes mellitus: This is a preliminary step to establish that the plants used are safe or effective, to help direct clinical trials, and to inform Caribbean physicians of the plants' known properties to avoid counter-prescribing. Results The following plants are used to treat diabetes: Antigonon leptopus, Bidens alba, Bidens pilosa, Bixa orellana, Bontia daphnoides, Carica papaya, Catharanthus roseus, Cocos nucifera, Gomphrena globosa, Laportea aestuans, Momordica charantia, Morus alba, Phyllanthus urinaria and Spiranthes acaulis. Apium graviolens is used as a heart tonic and for low blood pressure. Bixa orellana, Bontia daphnoides, Cuscuta americana and Gomphrena globosa are used for jaundice. The following plants are used for hypertension: Aloe vera, Annona muricata, Artocarpus altilis, Bixa orellana, Bidens alba, Bidens pilosa, Bonta daphnoides, Carica papaya, Cecropia peltata, Citrus paradisi, Cola nitida, Crescentia cujete, Gomphrena globosa, Hibiscus sabdariffa, Kalanchoe pinnata, Morus alba, Nopalea cochinellifera, Ocimum campechianum, Passiflora quadrangularis, Persea americana and Tamarindus indicus. The plants used for kidney problems are Theobroma cacao, Chamaesyce hirta, Flemingia strobilifera, Peperomia rotundifolia, Petiveria alliacea, Nopalea cochinellifera, Apium graveolens, Cynodon dactylon, Eleusine indica, Gomphrena globosa, Pityrogramma calomelanos and Vetiveria zizanioides. Plants are also used for gall stones and for cooling. Conclusion Chamaesyce hirta, Cissus verticillata, Kalanchoe pinnata, Peperomia spp., Portulaca oleraceae, Scoparia dulcis, and Zea mays have sufficient evidence to support their traditional use for urinary problems, "cooling" and high cholesterol. Eggplant extract as a

Ethnomedicines used in Trinidad and Tobago for reproductive problems.

PubMed

Lans, Cheryl

2007-03-15

Throughout history women have tried to control or enhance their fertility using herbal remedies, with various levels of societal support. Caribbean folk medicine has been influenced by European folk medicine, either through the early Spanish and French settlers or through the continuous immigration of Spanish-speaking peoples from Venezuela. Some folk uses are ancient and were documented by Galen and Pliny the Elder. Thirty respondents, ten of whom were male were interviewed from September 1996 to September 2000. The respondents were obtained by snowball sampling, and were found in thirteen different sites, 12 in Trinidad (Paramin, Talparo, Sangre Grande, Mayaro, Carapichaima, Kernahan, Newlands, Todd's Road, Arima, Guayaguayare, Santa Cruz, Port of Spain and Siparia) and one in Tobago (Mason Hall). Snowball sampling was used because there was no other means of identifying respondents and to cover the entire islands. The validation of the remedies was conducted with a non-experimental method. Plants are used for specific problems of both genders. Clusea rosea, Urena sinuata and Catharanthus roseus are used for unspecified male problems. Richeria grandis and Parinari campestris are used for erectile dysfunction. Ageratum conyzoides, Scoparia dulcis, Cucurbita pepo, Cucurbita maxima, Gomphrena globosa and Justicia pectoralis are used for prostate problems. The following plants are used for childbirth and infertility: Mimosa pudica, Ruta graveolens, Abelmoschus moschatus, Chamaesyce hirta, Cola nitida, Ambrosia cumanenesis, Pilea microphylla, Eryngium foetidum, Aristolochia rugosa, Aristolochia trilobata, Coleus aromaticus, Laportea aestuans and Vetiveria zizanioides. The following plants are used for menstrual pain and unspecified female complaints: Achyranthes indica, Artemisia absinthium, Brownea latifolia, Eleutherine bulbosa, Hibiscus rosa-sinensis, Eupatorium macrophyllum, Justicia secunda, Parthenium hysterophorus, Wedelia trilobata, Abelmoschus moschatus

Lipidomic fingerprint of almonds (Prunus dulcis L. cv Nonpareil) using TiO₂ nanoparticle based matrix solid-phase dispersion and MALDI-TOF/MS and its potential in geographical origin verification.

PubMed

Shen, Qing; Dong, Wei; Yang, Mei; Li, Linqiu; Cheung, Hon-Yeung; Zhang, Zhifeng

2013-08-14

A matrix solid-phase dispersion (MSPD) procedure with titanium dioxide (TiO2) nanoparticles (NP) as sorbent was developed for the selective extraction of phospholipids from almond samples, and matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF/MS) was employed for analysis. A remarkable increase in the signals of phospholipid accompanied by a decrease in those of triacylglycerols and diacylglycerols was observed in the relevant mass spectra. The proposed method was applied to five batches of almonds originating from four geographical areas, whereas principal component analysis (PCA) was utilized to normalize the relative amounts of the identified phospholipid species. The results indicated that the lipidomic fingerprint of almonds was successfully established by the negative ion mode spectrum, and the ratio of m/z 833.6 to 835.6 as well as m/z 821.6 could be introduced as potential markers for the differentiation of the tested almonds with different geographical origins. The whole method is of great promise for selective separation of phospholipids from nonphospholipids, especially the glycerides, and superior in fast screening and characterization of phospholipids in almond samples.

A massive update of non-indigenous species records in Mediterranean marinas

PubMed Central

Bandi, Ada; Bertolino, Marco; Bogi, Cesare; Chatzigeorgiou, Giorgos; Çiçek, Burak Ali; Deidun, Alan; Ramos-Esplá, Alfonso; Koçak, Cengiz; Lorenti, Maurizio; Merlo, Guenda; Scribano, Giovanni

2017-01-01

The Mediterranean Sea is home to over 2/3 of the world’s charter boat traffic and hosts an estimated 1.5 million recreational boats. Studies elsewhere have demonstrated marinas as important hubs for the stepping-stone transfer of non-indigenous species (NIS), but these unique anthropogenic, and typically artificial habitats have largely gone overlooked in the Mediterranean as sources of NIS hot-spots. From April 2015 to November 2016, 34 marinas were sampled across the following Mediterranean countries: Spain, France, Italy, Malta, Greece, Turkey and Cyprus to investigate the NIS presence and richness in the specialized hard substrate material of these marina habitats. All macroinvertebrate taxa were collected and identified. Additionally, fouling samples were collected from approximately 600 boat-hulls from 25 of these marinas to determine if boats host diverse NIS not present in the marina. Here, we present data revealing that Mediterranean marinas indeed act as major hubs for the transfer of marine NIS, and we also provide evidence that recreational boats act as effective vectors of spread. From this wide-ranging geographical study, we report here numerous new NIS records at the basin, subregional, country and locality level. At the basin level, we report three NIS new to the Mediterranean Sea (Achelia sawayai sensu lato, Aorides longimerus, Cymodoce aff. fuscina), and the re-appearance of two NIS previously known but currently considered extinct in the Mediterranean (Bemlos leptocheirus, Saccostrea glomerata). We also compellingly update the distributions of many NIS in the Mediterranean Sea showing some recent spreading; we provide details for 11 new subregional records for NIS (Watersipora arcuata, Hydroides brachyacantha sensu lato and Saccostrea glomerata now present in the Western Mediterranean; Symplegma brakenhielmi, Stenothoe georgiana, Spirobranchus tertaceros sensu lato, Dendostrea folium sensu lato and Parasmittina egyptiaca now present in the

Effects of kaolin application on light absorption and distribution, radiation use efficiency and photosynthesis of almond and walnut canopies.

PubMed

Rosati, Adolfo; Metcalf, Samuel G; Buchner, Richard P; Fulton, Allan E; Lampinen, Bruce D

2007-02-01

Kaolin applied as a suspension to plant canopies forms a film on leaves that increases reflection and reduces absorption of light. Photosynthesis of individual leaves is decreased while the photosynthesis of the whole canopy remains unaffected or even increases. This may result from a better distribution of light within the canopy following kaolin application, but this explanation has not been tested. The objective of this work was to study the effects of kaolin application on light distribution and absorption within tree canopies and, ultimately, on canopy photosynthesis and radiation use efficiency. Photosynthetically active radiation (PAR) incident on individual leaves within the canopy of almond (Prunus dulcis) and walnut (Juglans regia) trees was measured before and after kaolin application in order to study PAR distribution within the canopy. The PAR incident on, and reflected and transmitted by, the canopy was measured on the same day for kaolin-sprayed and control trees in order to calculate canopy PAR absorption. These data were then used to model canopy photosynthesis and radiation use efficiency by a simple method proposed in previous work, based on the photosynthetic response to incident PAR of a top-canopy leaf. Kaolin increased incident PAR on surfaces of inner-canopy leaves, although there was an estimated 20 % loss in PAR reaching the photosynthetic apparatus, due to increased reflection. Assuming a 20 % loss of PAR, modelled photosynthesis and photosynthetic radiation use efficiency (PRUE) of kaolin-coated leaves decreased by only 6.3 %. This was due to (1) more beneficial PAR distribution within the kaolin-sprayed canopy, and (2) with decreasing PAR, leaf photosynthesis decreases less than proportionally, due to the curvature of the photosynthesis response-curve to PAR. The relatively small loss in canopy PRUE (per unit of incident PAR), coupled with the increased incident PAR on the leaf surface on inner-canopy leaves, resulted in an estimated

Cinnamyl Alcohol, the Bioactive Component of Chestnut Flower Absolute, Inhibits Adipocyte Differentiation in 3T3-L1 Cells by Downregulating Adipogenic Transcription Factors.

PubMed

Hwang, Dae Il; Won, Kyung-Jong; Kim, Do-Yoon; Kim, Bokyung; Lee, Hwan Myung

2017-01-01

The extract of chestnut (Castanea crenata var. dulcis) flower (CCDF) has antioxidant and antimelanogenic properties, but its anti-obesity properties have not been previously examined. In this study, we tested the effect of CCDF absolute on adipocyte differentiation by using 3T3-L1 cells and determining the bioactive component of CCDF absolute in 3T3-L1 cell differentiation. CCDF absolute (0.1-100[Formula: see text][Formula: see text]g/mL) did not change 3T3-L1 cell viability. At 50[Formula: see text][Formula: see text]g/mL and 100[Formula: see text][Formula: see text]g/mL, the absolute significantly reduced the accumulation of lipid droplets in 3T3-L1 cells that were induced by culture in medium containing 3-isobutyl-1-methylxanthine/dexamethasone/insulin (MDI). GC/MS analysis showed that CCDF absolute contains 10 compounds. Among these compounds, cinnamyl alcohol (3-phenyl-2-propene-1-ol) dose-dependently inhibited the increased accumulation of lipid droplets in MDI-contained medium-cultured 3T3-L1 cells at a concentration range of 0.1[Formula: see text][Formula: see text]g/mL to 10[Formula: see text][Formula: see text]g/mL that did not cause cytotoxicity in 3T3-L1 cells. The inhibitory effect was significant at 5[Formula: see text][Formula: see text]g/mL ([Formula: see text] of response in MDI alone-treated state, [Formula: see text]) and 10[Formula: see text][Formula: see text]g/mL ([Formula: see text] of response in MDI alone-treated state, [Formula: see text]). Moreover, the enhanced expression of obesity-related proteins (PPAR[Formula: see text], C/EBP[Formula: see text], SREBP-1c, and FAS) in MDI medium-cultivated 3T3-L1 cells was significantly attenuated by the addition of cinnamyl alcohol at 5[Formula: see text][Formula: see text]g/mL and 10[Formula: see text][Formula: see text]g/mL. These findings demonstrate that cinnamyl alcohol suppresses 3T3-L1 cell differentiation by inhibiting anti-adipogenesis-related proteins, and it may be a main bioactive

The Phenological Network of Catalonia: an historical perspective

NASA Astrophysics Data System (ADS)

Busto, Montserrat; Cunillera, Jordi; de Yzaguirre, Xavier

2017-04-01

The Meteorological Service of Catalonia (SMC) began systematic phenological observation in 1932. Forty-four observers registered the phenophases of 45 plant species, the first or last sighting of six bird species and the first sighting of one species of butterfly. The study First results of phenological observation in Catalonia was published in 1936, showing the different behaviour of the vegetal species and birds according to geographical location. The SMC worked against the military fascist uprising during the Spanish Civil War (1936-1939). Therefore, once the war was finished, the organisation was quickly closed by the Franco dictatorship and the National Meteorological Service became the official institution in Spain. This organization created the Spanish Phenological Network in 1943 following similar standards to the former Catalan network. The reintroduction of democracy and the return of the Catalan self-government structures (1977) allowed the re-foundation of the SMC in 1996. The Climatology Department needed phenological data to complement the study of climatic indicators and realised the fragile situation of phenology observations in Catalonia, with very few operational series. Following a preliminary analysis of the different systems of recording and saving data, the Phenological network of Catalonia (Fenocat) was re-established in 2013. Fenocat is an active partner of the Pan European Phenology Database (PEP725) that uses BBCH-scale coding and the USA National Phenology Network observation system. It is an example of citizen science. As at December 2016, Fenocat had recorded more than 450,000 data. The extension of summer climatic conditions in the Western Mediterranean region has resulted in repetition of phenopases in the same year, such as the second flowering of the holm oak (Quercus ilex), almond tree (Prunus dulcis) and sweet cherry tree (Prunus avium), or the delay in the departure data of the swallow (Hirundo rustica) and hoopoe (Upupa epops

Ethnomedicines used in Trinidad and Tobago for reproductive problems

PubMed Central

Lans, Cheryl

2007-01-01

Background Throughout history women have tried to control or enhance their fertility using herbal remedies, with various levels of societal support. Caribbean folk medicine has been influenced by European folk medicine, either through the early Spanish and French settlers or through the continuous immigration of Spanish-speaking peoples from Venezuela. Some folk uses are ancient and were documented by Galen and Pliny the Elder. Methods Thirty respondents, ten of whom were male were interviewed from September 1996 to September 2000. The respondents were obtained by snowball sampling, and were found in thirteen different sites, 12 in Trinidad (Paramin, Talparo, Sangre Grande, Mayaro, Carapichaima, Kernahan, Newlands, Todd's Road, Arima, Guayaguayare, Santa Cruz, Port of Spain and Siparia) and one in Tobago (Mason Hall). Snowball sampling was used because there was no other means of identifying respondents and to cover the entire islands. The validation of the remedies was conducted with a non-experimental method. Results Plants are used for specific problems of both genders. Clusea rosea, Urena sinuata and Catharanthus roseus are used for unspecified male problems. Richeria grandis and Parinari campestris are used for erectile dysfunction. Ageratum conyzoides, Scoparia dulcis, Cucurbita pepo, Cucurbita maxima, Gomphrena globosa and Justicia pectoralis are used for prostate problems. The following plants are used for childbirth and infertility: Mimosa pudica, Ruta graveolens, Abelmoschus moschatus, Chamaesyce hirta, Cola nitida, Ambrosia cumanenesis, Pilea microphylla, Eryngium foetidum, Aristolochia rugosa, Aristolochia trilobata, Coleus aromaticus, Laportea aestuans and Vetiveria zizanioides. The following plants are used for menstrual pain and unspecified female complaints: Achyranthes indica, Artemisia absinthium, Brownea latifolia, Eleutherine bulbosa, Hibiscus rosa-sinensis, Eupatorium macrophyllum, Justicia secunda, Parthenium hysterophorus, Wedelia trilobata

Effects of regulated deficit irrigation during the pre-harvest period on gas exchange, leaf development and crop yield of mature almond trees.

PubMed

Romero, Pascual; Navarro, Josefa Maria; García, Francisco; Botía Ordaz, Pablo

2004-03-01

We investigated the effects of regulated deficit irrigation (RDI) during the pre-harvest period (kernel-filling stage) on water relations, leaf development and crop yield in mature almond (Prunus dulcis (Mill.) D.A. Webb cv. Cartagenera) trees during a 2-year field experiment. Trees were either irrigated at full-crop evapotranspiration (ETc=100%) (well-irrigated control treatment) or subjected to an RDI treatment that consisted of full irrigation for the full season, except from early June to early August (kernel-filling stage), when 20% ETc was applied. The severity of water stress was characterized by measurements of soil water content, predawn leaf water potential (Psipd) and relative water content (RWC). Stomatal conductance (gs), net CO2 assimilation rate (A), transpiration rate (E), leaf abscission, leaf expansion rate and crop yield were also measured. In both years, Psipd and RWC of well-irrigated trees were maintained above -1.0 MPa and 92%, respectively, whereas the corresponding values for trees in the RDI treatment were -2.37 MPa and 82%. Long-term water stress led to a progressive decline in gs, A and E, with significant reductions after 21 days in the RDI treatment. At the time of maximum stress (48 days after commencement of RDI), A, gs and E were 64, 67 and 56% lower than control values, respectively. High correlations between A, E and gs were observed. Plant water status recovered within 15 days after the resumption of irrigation and was associated with recovery of soil water content. A relatively rapid and complete recovery of A and gs was also observed, although the recovery was slower than for Psipd and RWC. Severe water stress during the kernel-filling stage resulted in premature defoliation (caused by increased leaf abscission) and a reduction in leaf growth rate, which decreased tree leaf area. Although kernel yield was correlated with leaf water potential, RDI caused a nonsignificant 7% reduction in kernel yield and had no effect on kernel

Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

PubMed

Röder, Martin; Vieths, Stefan; Holzhauser, Thomas

2011-01-24

Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals. Copyright © 2010 Elsevier B.V. All rights reserved.

Physiological Effects of Kaolin Applications in Well-irrigated and Water-stressed Walnut and Almond Trees

PubMed Central

ROSATI, A.; METCALF, S. G.; BUCHNER, R. P.; FULTON, A. E.; LAMPINEN, B. D.

2006-01-01

• Background and Aims Kaolin applications have been used to mitigate the negative effects of water and heat stress on plant physiology and productivity with variable results, ranging from increased to decreased yields and photosynthetic rates. The mechanisms of action of kaolin applications are not clear: although the increased albedo reduces leaf temperature and the consequent heat stress, it also reduces the light available for photosynthesis, possibly offsetting benefits of lower temperature. The objective of this study was to investigate which of these effects are prevalent and under which conditions. • Methods A 6 % kaolin suspension was applied on well-irrigated and water-stressed walnut (Juglans regia) and almond (Prunus dulcis) trees. Water status (i.e. stem water potential, Ψs), gas exchange (i.e. light-saturated CO2 assimilation rate, Amax; stomatal conductance, gs), leaf temperature (Tl) and physiological relationships in treated and control trees were then measured and compared. • Key Results In both species, kaolin did not affect the daily course of Ψs whereas it reduced Amax by 1–4 μmol CO2 m–2 s–1 throughout the day in all combinations of species and irrigation treatments. Kaolin did not reduce gs in any situation. Consequently, intercellular CO2 concentration (Ci) was always greater in treated trees than in controls, suggesting that the reduction of Amax with kaolin was not due to stomatal limitations. Kaolin reduced leaf temperature (Tl) by about 1–3 °C and leaf-to-air vapour pressure difference (VPDl) by about 0·1–0·7 kPa. Amax was lower at all values of gs, Tl and VPDl in kaolin-treated trees. Kaolin affected the photosynthetic response to the photosynthetically active radiation (PAR) in almond leaves: kaolin-coated leaves had similar dark respiration rates and light-saturated photosynthesis, but a higher light compensation point and lower apparent quantum yield, while the photosynthetic light-response curve saturated at

A Simple Method to Estimate Photosynthetic Radiation Use Efficiency of Canopies

PubMed Central

ROSATI, A.; METCALF, S. G.; LAMPINEN, B. D.

2004-01-01

• Background and Aims Photosynthetic radiation use efficiency (PhRUE) over the course of a day has been shown to be constant for leaves throughout a general canopy where nitrogen content (and thus photosynthetic properties) of leaves is distributed in relation to the light gradient. It has been suggested that this daily PhRUE can be calculated simply from the photosynthetic properties of a leaf at the top of the canopy and from the PAR incident on the canopy, which can be obtained from weather‐station data. The objective of this study was to investigate whether this simple method allows estimation of PhRUE of different crops and with different daily incident PAR, and also during the growing season. • Methods The PhRUE calculated with this simple method was compared with that calculated with a more detailed model, for different days in May, June and July in California, on almond (Prunus dulcis) and walnut (Juglans regia) trees. Daily net photosynthesis of 50 individual leaves was calculated as the daylight integral of the instantaneous photosynthesis. The latter was estimated for each leaf from its photosynthetic response to PAR and from the PAR incident on the leaf during the day. • Key Results Daily photosynthesis of individual leaves of both species was linearly related to the daily PAR incident on the leaves (which implies constant PhRUE throughout the canopy), but the slope (i.e. the PhRUE) differed between the species, over the growing season due to changes in photosynthetic properties of the leaves, and with differences in daily incident PAR. When PhRUE was estimated from the photosynthetic light response curve of a leaf at the top of the canopy and from the incident radiation above the canopy, obtained from weather‐station data, the values were within 5 % of those calculated with the more detailed model, except in five out of 34 cases. • Conclusions The simple method of estimating PhRUE is valuable as it simplifies calculation of canopy

Effects of Kaolin Application on Light Absorption and Distribution, Radiation Use Efficiency and Photosynthesis of Almond and Walnut Canopies

PubMed Central

Rosati, Adolfo; Metcalf, Samuel G.; Buchner, Richard P.; Fulton, Allan E.; Lampinen, Bruce D.

2007-01-01

Background and Aims Kaolin applied as a suspension to plant canopies forms a film on leaves that increases reflection and reduces absorption of light. Photosynthesis of individual leaves is decreased while the photosynthesis of the whole canopy remains unaffected or even increases. This may result from a better distribution of light within the canopy following kaolin application, but this explanation has not been tested. The objective of this work was to study the effects of kaolin application on light distribution and absorption within tree canopies and, ultimately, on canopy photosynthesis and radiation use efficiency. Methods Photosynthetically active radiation (PAR) incident on individual leaves within the canopy of almond (Prunus dulcis) and walnut (Juglans regia) trees was measured before and after kaolin application in order to study PAR distribution within the canopy. The PAR incident on, and reflected and transmitted by, the canopy was measured on the same day for kaolin-sprayed and control trees in order to calculate canopy PAR absorption. These data were then used to model canopy photosynthesis and radiation use efficiency by a simple method proposed in previous work, based on the photosynthetic response to incident PAR of a top-canopy leaf. Key Results Kaolin increased incident PAR on surfaces of inner-canopy leaves, although there was an estimated 20 % loss in PAR reaching the photosynthetic apparatus, due to increased reflection. Assuming a 20 % loss of PAR, modelled photosynthesis and photosynthetic radiation use efficiency (PRUE) of kaolin-coated leaves decreased by only 6·3 %. This was due to (1) more beneficial PAR distribution within the kaolin-sprayed canopy, and (2) with decreasing PAR, leaf photosynthesis decreases less than proportionally, due to the curvature of the photosynthesis response-curve to PAR. The relatively small loss in canopy PRUE (per unit of incident PAR), coupled with the increased incident PAR on the leaf surface on

Reduced tillage and cover crops as a strategy for mitigating atmospheric CO2 increase through soil organic carbon sequestration in dry Mediterranean agroecosystems.

NASA Astrophysics Data System (ADS)

Almagro, María; Garcia-Franco, Noelia; de Vente, Joris; Boix-Fayos, Carolina; Díaz-Pereira, Elvira; Martínez-Mena, María

2016-04-01

The implementation of sustainable land management (SLM) practices in semiarid Mediterranean agroecosystems can be beneficial to maintain or enhance levels of soil organic carbon and mitigate current atmospheric CO2 increase. In this study, we assess the effects of different tillage treatments (conventional tillage (CT), reduced tillage (RT), reduced tillage combined with green manure (RTG), and no tillage (NT)) on soil CO2 efflux, aggregation and organic carbon stabilization in two semiarid organic rainfed almond (Prunus dulcis Mill., var. Ferragnes) orchards located in SE Spain Soil CO2 efflux, temperature and moisture were measured monthly between May 2012 and December 2014 (site 1), and between February 2013 and December 2014 (site 2). In site 1, soil CO2 efflux rates were also measured immediately following winter and spring tillage operations. Aboveground biomass inputs were estimated at the end of the growing season in each tillage treatment. Soil samples (0-15 cm) were collected in the rows between the trees (n=4) in October 2012. Four aggregate size classes were distinguished by sieving (large and small macroaggregates, free microaggregates, and free silt plus clay fraction), and the microaggregates occluded within macroaggregates (SMm) were isolated. Soil CO2efflux rates in all tillage treatments varied significantly during the year, following changes during the autumn, winter and early spring, or changes in soil moisture during late spring and summer. Repeated measures analyses of variance revealed that there were no significant differences in soil CO2 efflux between tillage treatments throughout the study period at both sites. Average annual values of C lost by soil respiration were slightly but not significantly higher under RT and RTG treatments (492 g C-CO2 m-2 yr-1) than under NT treatment (405 g C-CO2 m-2 yr-1) in site 1, while slightly but not significantly lower values were observed under RT and RTG treatments (468 and 439 g C-CO2 m-2 yr-1

Ibmdbpy-spatial : An Open-source implementation of in-database geospatial analytics in Python

NASA Astrophysics Data System (ADS)

Roy, Avipsa; Fouché, Edouard; Rodriguez Morales, Rafael; Moehler, Gregor

2017-04-01

ODBC or JDBC respectively, 2) an instance to represent the spatial data stored in the database as a dataframe in Python, called the IdaGeoDataFrame, with a specific geometry attribute which recognises a planar geometry column in dashDB and 3) Python wrappers for spatial functions like within, distance, area, buffer} and more which dashDB currently supports to make the querying process from Python much simpler for the users. The spatial functions translate well-known geopandas-like syntax into SQL queries utilising the database connection to perform spatial operations in-database and can operate on single geometries as well two different geometries from different IdaGeoDataFrames. The in-database queries strictly follow the standards of OpenGIS Implementation Specification for Geographic information - Simple feature access for SQL. The results of the operations obtained can thereby be accessed dynamically via interactive Jupyter notebooks from any system which supports Python, without any additional dependencies and can also be combined with other open source libraries such as matplotlib and folium in-built within Jupyter notebooks for visualization purposes. We built a use case to analyse crime hotspots in New York city to validate our implementation and visualized the results as a choropleth map for each borough.

Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

PubMed Central

Chen, Lin; Zhang, Shuiming; Illa, Eudald; Song, Lijuan; Wu, Shandong; Howad, Werner; Arús, Pere; Weg, Eric van de; Chen, Kunsong; Gao, Zhongshan

2008-01-01

Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4) have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica), these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcis)Pru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica). Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1). Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B) were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03) containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02) were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach/almond allergen genes have

Effect of sustainable land management practices on soil aggregation and stabilization of organic carbon in semiarid mediterranean ecosystems

NASA Astrophysics Data System (ADS)

Garcia-Franco, Noelia; Albaladejo, Juan; Almagro, María; Wiesmeier, Martin; Martínez-Mena, María

2016-04-01

Arid and semiarid regions represent about 47% of the total land area of the world (UNEP, 1992). At present, there is a priority interest for carbon (C) sequestration in drylands. These areas are considered as very fragile ecosystems with low organic carbon (OC) saturation, and potentially, high capacity for soil OC sequestration. In addition, the restoration of these areas is one of the major challenges for scientists, who will be able to identify and recommended the best land uses and sustainable land management (SLM) practices for soil conservation and mitigation of climate change in these environments. In this regard, in semiarid Mediterranean ecosystems there is an urgent need for the implementation of SLM practices regardless of land-use type (forest, agricultural and shrubland) to maintain acceptable levels of soil organic matter (SOM) and the physico-chemical protection of the OC. Long- and short-term effects of SLM practices on soil aggregation and SOC stabilization were studied in two land uses. The long-term experiment was conducted in a reforestation area with Pinus halepensis Mill., where two afforestation techniques were implemented 20 years ago: a) mechanical terracing with a single application of organic waste of urban soil refuse, and b) mechanical terracing without organic amendment. An adjacent shrubland was considered as the reference plot. The short-term experiment was conducted in a rain-fed almond (Prunus dulcis Mill., var. Ferragnes) orchard where two SLM practices were introduced 4 years ago: a) reduced tillage plus green manure, and b) no tillage. Reduced tillage was considered as the reference plot given that it is the habitual management practice. Four aggregate size classes were differentiated by sieving (large and small macroaggregates, microaggregates, and the silt plus clay fraction), and the microaggregates occluded within small macroaggregates (SMm) were isolated. In addition, different organic C fractions corresponding with active

New Apigenin Glycoside, Polyphenolic Constituents, Anti-inflammatory and Hepatoprotective Activities of Gaillardia grandiflora and Gaillardia pulchella Aerial Parts.

PubMed

Moharram, Fatma A; El Dib, Rabab Abd El Moneim; Marzouk, Mohamed S; El-Shenawy, Siham M; Ibrahim, Haitham A

2017-07-01

to the isolation of twelve compoundsThe new compound 8-hydroxyapigenin 6- O -β-D-apiofuranosyl-(1''''→6'')- C -β-D-4C1-glucopyranoside was isolated from G. grandiflora for the first time in natureSchaftoside, luteolin 6- C -β-D-4C1-glucopyranoside 8-methyl ether, apigenin 6- C -β-D-4C1-glucopyranoside 8-methyl ether, isoorientin, isovitexin, 6-methoxyluteolin and hispidulin were isolated from G. grandiflora Vicenin-2, vitexin, luteolin, apigenin and 6-methoxyluteolin were isolated from G. pulchella The extracts of both species were nontoxic to mice up to 5 g/kg body weightBoth extracts exhibited significant anti-inflammatory and hepatoprotective activities in dose dependent manner Abbreviations used: ALP: Alkaline phosphatase; ALT: Alanine aminotransferase; AME: The 80% aqueous methanol extract of G. grandiflora or G. pulchella aerial parts; AST: Aspartate aminotransferase; br d: Broad doublet; Comp-PC: Comparative paper chromatography; d: Doublet; 2D-PC: Two-dimensional paper chromatography; DMSO-d6: Deuterated dimethyl sulfoxide; G.: Gaillardia ; GPx: Glutathione peroxidase; GRd: Glutathione reductase; GSH: glutathione; GST: Glutathione-S-transferase; J : Nuclear spin-spin coupling constant; m: Multiplet; [M-H]-: Molecular ion peak; MDA: Malondialdehyde; m / z : Mass/charge ratio; NO: Nitric oxide; p: Probability; PC: Paper chromatography; Rf: Retention flow; rpm: Rotation per minute; s: Singlet; SDE: The ethanol extract of Scoparia dulcis ; SE: Standard error; SOD: Superoxide dismutase; TMS: Tetramethylsilane; λmax: Maximum fluorescence emission wavelength.

Inverse modeling with RZWQM2 to predict water quality

USGS Publications Warehouse

Nolan, Bernard T.; Malone, Robert W.; Ma, Liwang; Green, Christopher T.; Fienen, Michael N.; Jaynes, Dan B.

2011-01-01

This chapter presents guidelines for autocalibration of the Root Zone Water Quality Model (RZWQM2) by inverse modeling using PEST parameter estimation software (Doherty, 2010). Two sites with diverse climate and management were considered for simulation of N losses by leaching and in drain flow: an almond [Prunus dulcis (Mill.) D.A. Webb] orchard in the San Joaquin Valley, California and the Walnut Creek watershed in central Iowa, which is predominantly in corn (Zea mays L.)–soybean [Glycine max (L.) Merr.] rotation. Inverse modeling provides an objective statistical basis for calibration that involves simultaneous adjustment of model parameters and yields parameter confidence intervals and sensitivities. We describe operation of PEST in both parameter estimation and predictive analysis modes. The goal of parameter estimation is to identify a unique set of parameters that minimize a weighted least squares objective function, and the goal of predictive analysis is to construct a nonlinear confidence interval for a prediction of interest by finding a set of parameters that maximizes or minimizes the prediction while maintaining the model in a calibrated state. We also describe PEST utilities (PAR2PAR, TSPROC) for maintaining ordered relations among model parameters (e.g., soil root growth factor) and for post-processing of RZWQM2 outputs representing different cropping practices at the Iowa site. Inverse modeling provided reasonable fits to observed water and N fluxes and directly benefitted the modeling through: (i) simultaneous adjustment of multiple parameters versus one-at-a-time adjustment in manual approaches; (ii) clear indication by convergence criteria of when calibration is complete; (iii) straightforward detection of nonunique and insensitive parameters, which can affect the stability of PEST and RZWQM2; and (iv) generation of confidence intervals for uncertainty analysis of parameters and model predictions. Composite scaled sensitivities, which

Advances in X-ray Mapping for Characterization of Microstructures: Silicon Drift Detectors, Microcalorimeters, X-ray Spectrum Imaging, and Data Mining

NASA Astrophysics Data System (ADS)

Newbury, D. E.

2006-05-01

) Data mining: In the XSI mode, data is captured at the rate of 100 Mbytes per XSI database or more. Efficient software tools have been developed that enable the analyst to quickly recognize major and minor constituent features in this datacube, and even to detect rare unexpected features that occur at only one pixel in a large map [6]. Advanced image cube data reduction can be achieved with tools based on statistical methods, such as principal component analysis, that quickly establishes correlations between different elements, such as distinct phases [7]. 1. Goldstein, J., Newbury, D., Joy, D., Lyman, C., Echlin, P., Lifshin, E., Sawyer, L., and Michael, J., Scanning Electron Microscopy and X-ray Microanalysis, 3rd edition (Kluwer Academic Plenum Press, New York, 2003). 2. Cosslett, E. and P. Duncumb, Nature, 177 (1956) 1172. 3. Struder, L., Fiorini, C., Gatti, E., Hartmann, R., Holl, P., Krause, N., Lechner, P., Longoni, A., Lutz, G., Kemmer, J., Meidinger, N., Popp, M., Soltau, H., and van Zanthier, C., High resolution non dispersive x-ray spectroscopy with state of the art silicon detectors, Mikrochim. Acta, Suppl, 15 (1998) 11 4. Newbury, D. SCANNING, 27 (2005) 227. 5. Wollman, D., Irwin, K., Hilton, G., Dulcie, L., Newbury, D., and Martinis, J., J. Micros. 188 (1997) 196. 6. Newbury, D. and Bright, D., SCANNING, 27 (2005) 15. 7. Kotula, P. Keenan, M., and Michael J., Micros. Microanal. 9 (2003) 1

New Apigenin Glycoside, Polyphenolic Constituents, Anti-inflammatory and Hepatoprotective Activities of Gaillardia grandiflora and Gaillardia pulchella Aerial Parts

PubMed Central

Moharram, Fatma A.; El Dib, Rabab Abd El Moneim; Marzouk, Mohamed S.; El-Shenawy, Siham M.; Ibrahim, Haitham A.

2017-01-01

Gaillardia pulchella 80% aqueous methanol extracts of the aerial parts led to the isolation of twelve compoundsThe new compound 8-hydroxyapigenin 6-O-β-D-apiofuranosyl-(1’’’’→6’’)-C-β-D-4C1-glucopyranoside was isolated from G. grandiflora for the first time in natureSchaftoside, luteolin 6-C-β-D-4C1-glucopyranoside 8-methyl ether, apigenin 6-C-β-D-4C1-glucopyranoside 8-methyl ether, isoorientin, isovitexin, 6-methoxyluteolin and hispidulin were isolated from G. grandifloraVicenin-2, vitexin, luteolin, apigenin and 6-methoxyluteolin were isolated from G. pulchellaThe extracts of both species were nontoxic to mice up to 5 g/kg body weightBoth extracts exhibited significant anti-inflammatory and hepatoprotective activities in dose dependent manner Abbreviations used: ALP: Alkaline phosphatase; ALT: Alanine aminotransferase; AME: The 80% aqueous methanol extract of G. grandiflora or G. pulchella aerial parts; AST: Aspartate aminotransferase; br d: Broad doublet; Comp-PC: Comparative paper chromatography; d: Doublet; 2D-PC: Two-dimensional paper chromatography; DMSO-d6: Deuterated dimethyl sulfoxide; G.: Gaillardia; GPx: Glutathione peroxidase; GRd: Glutathione reductase; GSH: glutathione; GST: Glutathione-S-transferase; J: Nuclear spin-spin coupling constant; m: Multiplet; [M-H]−: Molecular ion peak; MDA: Malondialdehyde; m/z: Mass/charge ratio; NO: Nitric oxide; p: Probability; PC: Paper chromatography; Rf: Retention flow; rpm: Rotation per minute; s: Singlet; SDE: The ethanol extract of Scoparia dulcis; SE: Standard error; SOD: Superoxide dismutase; TMS: Tetramethylsilane; λmax: Maximum fluorescence emission wavelength. PMID:28808387

Influence of crop load on almond tree water status and its importance in irrigation scheduling

NASA Astrophysics Data System (ADS)

Puerto Conesa, Pablo; Domingo Miguel, Rafael; Torres Sánchez, Roque; Pérez Pastor, Alejandro

2014-05-01

In the Mediterranean area water is the main factor limiting crop production and therefore irrigation is essential to achieve economically viable yields. One of the fundamental techniques to ensure that irrigation water is managed efficiently with maximum productivity and minimum environmental impact is irrigation scheduling. The fact that the plant water status integrates atmospheric demand and soil water content conditions encourages the use of plant-based water status indicators. Some researchers have successfully scheduled irrigation in certain fruit trees by maintaining the maximum daily trunk diameter shrinkage (MDS) signal intensity at threshold values to generate (or not) water stress. However MDS not only depends on the climate and soil water content, but may be affected by tree factors such as age, size, phenological stage and fruit load. There is therefore a need to quantify the influence of these factors on MDS. The main objective of this work was to study the effects of crop load on tree water relations for scheduling purposes. We particularly focused on MDS vs VPD10-15 (mean air vapor pressure deficit during the period 10.00-15.00 h solar time) for different loads and phenological phases under non-limiting soil water conditions. The experiment was carried out in 2011 in a 1 ha plot in SE Spain with almond trees (Prunus dulcis (Mill.) D.A. Webb cv. 'Marta'). Three crop load treatments were studied according to three crop load levels, i) T100, high crop load, characteristic crop load, ii) T50, medium crop load, in which 50% of the fruits were removed and iii) T0, practically without fruits. Fruits were manually thinned. Each treatment, randomly distributed in blocks, was run in triplicate. Plant water status was assessed from midday stem water potential (Ψs), MDS, daily trunk growth rate (TGR), leaf turgor potential Ψp, fruit water potential (Ψf), stomatal conductance (gs) and photosynthesis (Pn) and transpiration rates (E). Yield, pruning weights and

Lipid-lowering and antioxidant activities of Jiang-Zhi-Ning in Traditional Chinese Medicine.

PubMed

Chen, Jianxin; Zhao, Huihui; Yang, Ying; Liu, Bing; Ni, Jian; Wang, Wei

2011-04-12

Jiang-Zhi-Ning (JZN) is composed of four Chinese herbs, i.e., Fleeceflower Root, Fructus Crataegi, Folium Nelumbinis and Semen Cassiae. It was used to strengthen blood circulation of coronary artery, arrhythmia and hyperlipidemia. The main objective of this paper is to evaluate lipid-lowering and antioxidant activities of extract and effective fraction of JZN by using in vitro experiments on hyperlipidemic rats. Moreover, in vivo experiments on cells were performed to investigate lipid-lowering and antioxidant activities of effective fraction and active constituents of JZN. Wistar rats with high fat diet-induced hyperlipidemia were used as in vitro models to study biological effects of lipid-lowering and antioxidant activities of extract and effective fraction of JZN. Serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), Coronary Index and Atherogenic Index were investigated to evaluate lipid-lowering effects of extract and effective fraction of JZN. Serum total nitric oxide synthase (NOS), nitric oxide (NO), endothelin-1 (ET-1), malondialdehyde (MDA), superoxide dismutase (SOD) and total antioxidant capacity (T-AOC) were detected to measure antioxidant effects of extract and effective fraction of JZN. Furthermore, oxidized low-density lipoprotein (Ox-LDL) injured human umbilical vein endothelial cell (HUVEC) model was employed as in vivo experiment to study lipid-lowering and antioxidant effects of effective fraction and active constituents of JZN. NO, ET-1, MDA SOD and T-AOC in HUVECs or culture media were investigated to evaluate antioxidant activity of effective fraction and active constituents of JZN. Using human hepatoma cell line Bel-7402, reverse transcription polymerase chain reaction (RT-PCR) technology was performed to investigate cholesterol metabolism effects of effective fraction and active constituents of JZN. Expressions of low density lipoprotein receptor (LDL