Martínková, Ludmila; Chmátal, Martin
2016-10-01
The aim of this study was to design an effective method for the bioremediation of coking wastewaters, specifically for the concurrent elimination of their highly toxic components - cyanide and phenols. Almost full degradation of free cyanide (0.32-20 mM; 8.3-520 mg L(-1)) in the model and the real coking wastewaters was achieved by using a recombinant cyanide hydratase in the first step. The removal of cyanide, a strong inhibitor of tyrosinase, enabled an effective degradation of phenols by this enzyme in the second step. Phenol (16.5 mM, 1,552 mg L(-1)) was completely removed from a real coking wastewater within 20 h and cresols (5.0 mM, 540 mg L(-1)) were removed by 66% under the same conditions. The integration of cyanide hydratase and tyrosinase open up new possibilities for the bioremediation of wastewaters with complex pollution. Copyright © 2016 Elsevier Ltd. All rights reserved.
Taskinen, Jukka P; Kiema, Tiila R; Hiltunen, J Kalervo; Wierenga, Rik K
2006-01-27
The 1.9 A structure of the C-terminal dehydrogenase part of the rat peroxisomal monomeric multifunctional enzyme type 1 (MFE-1) has been determined. In this construct (residues 260-722 and referred to as MFE1-DH) the N-terminal hydratase part of MFE-1 has been deleted. The structure of MFE1-DH shows that it consists of an N-terminal helix, followed by a Rossmann-fold domain (domain C), followed by two tightly associated helical domains (domains D and E), which have similar topology. The structure of MFE1-DH is compared with the two known homologous structures: human mitochondrial 3-hydroxyacyl-CoA dehydrogenase (HAD; sequence identity is 33%) (which is dimeric and monofunctional) and with the dimeric multifunctional alpha-chain (alphaFOM; sequence identity is 28%) of the bacterial fatty acid beta-oxidation alpha2beta2-multienzyme complex. Like MFE-1, alphaFOM has an N-terminal hydratase part and a C-terminal dehydrogenase part, and the structure comparisons show that the N-terminal helix of MFE1-DH corresponds to the alphaFOM linker helix, located between its hydratase and dehydrogenase part. It is also shown that this helix corresponds to the C-terminal helix-10 of the hydratase/isomerase superfamily, suggesting that functionally it belongs to the N-terminal hydratase part of MFE-1.
Lalwani, N D; Reddy, M K; Mangkornkanok-Mark, M; Reddy, J K
1981-07-15
The hypolipidaemic drugs methyl clofenapate, BR-931, Wy-14643 and procetofen induced a marked proliferation of peroxisomes in the parenchymal cells of liver and the proximal-convoluted-tubular epithelium of mouse kidney. The proliferation of peroxisomes was associated with 6-12-fold increase in the peroxisomal palmitoyl-CoA oxidizing capacity of the mouse liver. Enhanced activity of the peroxisomal palmitoyl-CoA oxidation system was also found in the renal-cortical homogenates of hypolipidaemic-drug-treated mice. The activity of enoyl-CoA hydratase in the mouse liver increased 30-50-fold and in the kidney cortex 3-5-fold with hypolipidaemic-drug-induced peroxisome proliferation in these tissues, and over 95% of this induced activity was found to be heat-labile peroxisomal enzyme in both organs. Sodium dodecyl sulphate/polyacrylamide-gel-electrophoretic analysis of large-particle and microsomal fractions obtained from the liver and kidney cortex of mice treated with hypolipidaemic peroxisome proliferators demonstrated a substantial increase in the quantity of an 80000-mol.wt. peroxisome-proliferation-associated polypeptide (polypeptide PPA-80). The heat-labile peroxisomal enoyl-CoA hydratase was purified from the livers of mice treated with the hypolipidaemic drug methyl clofenapate; the antibodies raised against this electrophoretically homogeneous protein yielded a single immunoprecipitin band with purified mouse liver enoyl-CoA hydratase and with liver and kidney cortical extracts of normal and hypolipidaemic-drug-treated mice. These anti-(mouse liver enoyl-CoA hydratase) antibodies also cross-reacted with purified rat liver enoyl-CoA hydratase and with the polypeptide PPA-80 obtained from rat and mouse liver. Immunofluorescence studies with anti-(polypeptide PPA-80) and anti-(peroxisomal enoyl-CoA hydratase) provided visual evidence for the localization and induction of polypeptide PPA-80 and peroxisomal enoyl-CoA hydratase in the liver and kidney respectively of normal and hypolipidaemic-drug-treated mice. In the kidney, the distribution of these two proteins is identical and limited exclusively to the cytoplasm of proximal-convoluted-tubular epithelium. The immunofluorescence studies clearly complement the biochemical and ultrastructural observations of peroxisome induction in the liver and kidney cortex of mice fed on hypolipidaemic drugs. In addition, preliminary ultrastructural studies with the protein-A-gold-complex technique demonstrate that the heat-labile hepatic enoyl-CoA hydratase is localized in the peroxisome matrix.
Kushwaha, Madhulika; Kumar, Virender; Mahajan, Rishi; Bhalla, Tek Chand; Chatterjee, Subhankar; Akhter, Yusuf
2018-05-09
The present study provides molecular insights into the activity and mechanism of cyanide hydratase enzyme associated with degradation of cyanide compounds, using Serratia marcescens RL2b as a model organism. Resting cells harvested after 20 h achieved complete degradation of 12 mmol l - 1 cyanide in approximately 10 h. High-performance liquid chromatography analysis of reaction samples revealed formation of formamide as the only end product, which confirmed the presence of cyanide hydratase activity in S. marcescens RL2b. Comparative structural analysis with the other nitrilase family proteins, which was carried out using a sequence of cyanide hydratase from a phylogenetically related strain S. marcescens WW4, also revealed subtle but significant differences in amino acid residues of the substrate-binding pocket and catalytic triad (Cys-Lys-Glu).
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition.
Sciacovelli, Marco; Gonçalves, Emanuel; Johnson, Timothy Isaac; Zecchini, Vincent Roberto; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Drubbel, Alizee Vercauteren; Theobald, Sebastian Julian; Abbo, Sandra Riekje; Tran, Maxine Gia Binh; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Maher, Eamonn Richard; Maxwell, Patrick Henry; Saez-Rodriguez, Julio; Frezza, Christian
2016-08-31
Mutations of the tricarboxylic acid cycle enzyme fumarate hydratase cause hereditary leiomyomatosis and renal cell cancer. Fumarate hydratase-deficient renal cancers are highly aggressive and metastasize even when small, leading to a very poor clinical outcome. Fumarate, a small molecule metabolite that accumulates in fumarate hydratase-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite. Fumarate has been shown to inhibit α-ketoglutarate-dependent dioxygenases that are involved in DNA and histone demethylation. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of fumarate hydratase and the subsequent accumulation of fumarate in mouse and human cells elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster mir-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of fumarate hydratase-proficient cells with cell-permeable fumarate. Loss of fumarate hydratase is associated with suppression of miR-200 and the EMT signature in renal cancer and is associated with poor clinical outcome. These results imply that loss of fumarate hydratase and fumarate accumulation contribute to the aggressive features of fumarate hydratase-deficient tumours.
Is the tungsten(IV) complex (NEt4)2[WO(mnt)2] a functional analogue of acetylene hydratase?
Schreyer, Matthias
2017-01-01
The tungsten(IV) complex (Et4N)2[W(O)(mnt)2] (1; mnt = maleonitriledithiolate) was proposed (Sarkar et al., J. Am. Chem. Soc. 1997, 119, 4315) to be a functional analogue of the active center of the enzyme acetylene hydratase from Pelobacter acetylenicus, which hydrates acetylene (ethyne; 2) to acetaldehyde (ethanal; 3). In the absence of a satisfactory mechanistic proposal for the hydration reaction, we considered the possibility of a metal–vinylidene type activation mode, as it is well established for ruthenium-based alkyne hydration catalysts with anti-Markovnikov regioselectivity. To validate the hypothesis, the regioselectivity of tungsten-catalyzed alkyne hydration of a terminal, higher alkyne had to be determined. However, complex 1 was not a competent catalyst for the hydration of 1-octyne under the conditions tested. Furthermore, we could not observe the earlier reported hydration activity of complex 1 towards acetylene. A critical assessment of, and a possible explanation for the earlier reported results are offered. The title question is answered with "no". PMID:29181113
Degradation of the metal-cyano complex tetracyanonickelate (II) by Fusarium oxysporum N-10.
Yanase, H; Sakamoto, A; Okamoto, K; Kita, K; Sato, Y
2000-03-01
A fungus with the ability to utilize a metalcyano compound, tetracyanonickelate (II) ¿K2[Ni (CN)4]; TCN¿, as its sole source of nitrogen was isolated from soil and identified as Fusarium oxysporum N-10. Both intact mycelia and cell-free extract of the strain catalyzed hydrolysis of TCN to formate and ammonia and produced formamide as an intermediate, thereby indicating that a hydratase and an amidase sequentially participated in the degradation of TCN. The enzyme catalyzing the hydration of TCN was purified approximately ten-fold from the cell-free extract of strain N-10 with a yield of 29%. The molecular mass of the active enzyme was estimated to be 160 kDa. The enzyme appears to exist as a homotetramer, each subunit having a molecular mass of 40 kDa. The enzyme also catalyzed the hydration of KCN, with a cyanide-hydrating activity 2 x 10(4) times greater than for TCN. The kinetic parameters for TCN and KCN indicated that hydratase isolated from F. oxysporum was a cyanide hydratase able to utilize a broad range of cyano compounds and nitriles as substrates.
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-08-17
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in Bacillus subtilis designated YwhB. All of the compounds were potent competitive inhibitors of 4-OT with the monocarboxylated 2E-fluoro-2,4-pentadienoate and the dicarboxylated 2E-fluoro-2-en-4-ynoate being the most potent. Despite the close mechanistic and structural similarities between 4-OT and YwhB, these compounds were significantly less potent inhibitors of YwhB with K(i) values ranging from 5- to 633-fold lower than those determined for 4-OT. The study of VPH is complicated by the fact that the enzyme is only active as a complex with the metal-dependent 4-oxalocrotonate decarboxylase (4-OD), the enzyme following 4-OT in the catechol meta-fission pathway. A structure-based sequence analysis identified 4-OD as a member of the fumarylacetoacetate hydrolase (FAH) superfamily and implicated Glu-109 and Glu-111 as potential metal-binding ligands. Changing these residues to a glutamine verified their importance for enzymatic activity and enabled the production of soluble E109Q4-OD/VPH or E111Q4-OD/VPH complexes, which retained full hydratase activity but had little decarboxylase activity. Subsequent incubation of the E109Q4-OD/VPH complex with the substrate analogues identified the 2E and 2Z isomers of the monocarboxylated 2-fluoropent-2-en-4-ynoate as competitive inhibitors. The combined results set the stage for crystallographic studies of 4-OT, YwhB, and VPH using these inhibitors as ligands.
Kim, Kyoung-Rok; Oh, Hye-Jin; Park, Chul-Soon; Hong, Seung-Hye; Park, Ji-Young; Oh, Deok-Kun
2015-11-01
The aim of this study is the first time demonstration of cis-12 regio-selective linoleate double-bond hydratase. Hydroxylation of fatty acids, abundant feedstock in nature, is an emerging alternative route for many petroleum replaceable products thorough hydroxy fatty acids, carboxylic acids, and lactones. However, chemical route for selective hydroxylation is still quite challenging owing to low selectivity and many environmental concerns. Hydroxylation of fatty acids by hydroxy fatty acid forming enzymes is an important route for selective biocatalytic oxyfunctionalization of fatty acids. Therefore, novel fatty acid hydroxylation enzymes should be discovered. The two hydratase genes of Lactobacillus acidophilus were identified by genomic analysis, and the expressed two recombinant hydratases were identified as cis-9 and cis-12 double-bond selective linoleate hydratases by in vitro functional validation, including the identification of products and the determination of regio-selectivity, substrate specificity, and kinetic parameters. The two different linoleate hydratases were the involved enzymes in the 10,13-dihydroxyoctadecanoic acid biosynthesis. Linoleate 13-hydratase (LHT-13) selectively converted 10 mM linoleic acid to 13S-hydroxy-9(Z)-octadecenoic acid with high titer (8.1 mM) and yield (81%). Our study will expand knowledge for microbial fatty acid-hydroxylation enzymes and facilitate the designed production of the regio-selective hydroxy fatty acids for useful chemicals from polyunsaturated fatty acid feedstocks. © 2015 Wiley Periodicals, Inc.
Duca, Daiana; Rose, David R; Glick, Bernard R
2014-08-01
Indole-3-acetic acid (IAA) is a fundamental phytohormone with the ability to control many aspects of plant growth and development. Pseudomonas sp. strain UW4 is a rhizospheric plant growth-promoting bacterium that produces and secretes IAA. While several putative IAA biosynthetic genes have been reported in this bacterium, the pathways leading to the production of IAA in strain UW4 are unclear. Here, the presence of the indole-3-acetamide (IAM) and indole-3-acetaldoxime/indole-3-acetonitrile (IAOx/IAN) pathways of IAA biosynthesis is described, and the specific role of two of the enzymes (nitrilase and nitrile hydratase) that mediate these pathways is assessed. The genes encoding these two enzymes were expressed in Escherichia coli, and the enzymes were isolated and characterized. Substrate-feeding assays indicate that the nitrilase produces both IAM and IAA from the IAN substrate, while the nitrile hydratase only produces IAM. The two nitrile-hydrolyzing enzymes have very different temperature and pH optimums. Nitrilase prefers a temperature of 50°C and a pH of 6, while nitrile hydratase prefers 4°C and a pH of 7.5. Based on multiple sequence alignments and motif analyses, physicochemical properties and enzyme assays, it is concluded that the UW4 nitrilase has an aromatic substrate specificity. The nitrile hydratase is identified as an iron-type metalloenzyme that does not require the help of a P47K activator protein to be active. These data are interpreted in terms of a preliminary model for the biosynthesis of IAA in this bacterium.
NASA Astrophysics Data System (ADS)
Kung, Irene Yuk Man
Part I. A series of novel cobalt dithiolate complexes with mixed imine/amine ligand systems is presented here as electronic and structural models for the active site in the bacterial enzyme class, nitrile hydratase (NHase). Pentadentate cobalt(II) complexes with S2N 3 ligand environments are first studied as precursors to the more relevant cobalt(III) complexes. Adjustment of the backbone length by removal of a methylene group increases the reactivity of the system; whereas reduction of the two backbone imine bonds to allow free rotation about those bonds may decrease reactivity. Reactivity change due to the replacement of the backbone amine proton with a more sterically challenging methyl group is not yet clear. Upon oxidation, the monocationic pentadentate cobalt(III) complex, 1b, shows promising reactivity similar to that of NHase. The metal's open coordination site allows reversible binding of the endogenous, monoanionic ligands, N 3- and NCS-. Oxygenation of the thiolate sulfur atoms by exposure to O2 and H2O 2 produces sulfenate and sulfinate ligands in complex 8, which resembles the crystal structure of "deactivated" Fe NHase. However, its lack of reactivity argues against the oxygenated enzyme structure as the active form. Six-coordinate cobalt(III) complexes with S2N4 amine/amine ligand systems are also presented as analogues of previously reported iron(III) compounds, which mimic the spectroscopic properties of Fe NHase. The cobalt complexes do not seem to similarly model Co NHase. However, the S = 0 cobalt(III) center can be spectroscopically silent and difficult to detect, making comparison with synthetic models using common techniques hard. Part II. Dodecameric Escherichia coli glutamine synthetase mutant, E165C, stacks along its six-fold axis to produce tubular nanostructures in the presence of some divalent metal ions, as does the wild type enzyme. The centrally located, engineered Cys-165 residues appear to bind to various species and may serve as scaffolding for inorganic mineralization. US nanoclusters of discreet size seem to grow in the presence of E165C in aqueous solution spontaneously. Commercially available mono(maleimido)undecagold seem to bind only to E165C through the reactive cysteine side chains. Reduction of Au3+ to elemental gold in solution with E165C, generates long, linear structures of approximately 100-nm diameter.
Stereochemical Consequences of Vinylpyruvate Hydratase-Catalyzed Reactions.
Johnson, William H; Stack, Tyler M M; Taylor, Stephanie M; Burks, Elizabeth A; Whitman, Christian P
2016-07-26
A stereochemical analysis has been carried out on two vinylpyruvate hydratases (VPH), which convert 2-hydroxy-2,4-pentadienoate to 2-keto-4S-hydroxypentanoate in meta-fission pathways. Bacterial strains with this pathway can use aromatic compounds as sole sources of energy and carbon. The analysis was carried out using the 5-methyl and 5-chloro derivatives of 2-hydroxy-2,4-pentadienoate with the enzymes from Pseudomonas putida mt-2 (Pp) and Leptothrix cholodnii SP-6 (Lc). In both organisms, VPH is in a complex with the preceding enzyme in the pathway, 4-oxalocrotonate decarboxylase (4-OD). In D2O, a deuteron is incorporated stereospecifically at the C-3 and C-5 positions of product by both Pp and Lc enzymes. Accordingly, the complexes generate (3S,5S)-3,5-[di-D]-2-keto-4S-hydroxyhexanoate and (3S,5R)-3,5-[di-D]-2-keto-4R-hydroxy-5-chloropentanoate (4R and 5R due to a priority numbering change). The substitution at C-5 (CH3 or Cl) or the source of the enzyme (Pp or Lc) does not change the stereochemical outcome. One mechanism that can account for the results is the ketonization of the 5-substituted dienol to the α,β-unsaturated ketone (placing a deuteron at C-5 in D2O), followed by the conjugate addition of water (placing a deuteron at C-3). The stereochemical outcome for VPH (from Pp and Lc) is the same as that reported for a related enzyme, 2-oxo-hept-4-ene-1,7-dioate hydratase, from Escherichia coli C. The combined observations suggest similar mechanisms for these three enzymes that could possibly be common to this group of enzymes.
Genetics Home Reference: 3-methylglutaconyl-CoA hydratase deficiency
... down a protein building block ( amino acid ) called leucine to provide energy for cells. This amino acid ... activity. Without any functional 3-methylglutaconyl-CoA hydratase, leucine is not properly broken down, which leads to ...
Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo
2013-01-01
Polyhydroxyalkanoates (PHAs) have attracted increasing attention as "green plastic" due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs.
2006-09-05
NA NA no yes BMAA1128 ABC Transporter 3 GGGAAACGCGAAAC 6 5 yes no BMAA1873 Hypothetical protein 4 No (-C) NA NA no yes BMAA1868 Aconitate hydratase 5...no yes BMAA1868 Aconitate hydratase 3 GTGCTGTC 21 22 no yes BMAA0375 Transcriptional regulator Human Blood 1 TTGGCGC 111 109 no no BMAA1866 Conserved...NA NA no yes BMAA1128 ABC transporter 5 No (-C) NA NA no yes BMAA1868 Aconitate hydratase NA: Not applicable.Page 3 of 11 (page number not for
Gorbenko, M V; Popova, T N; Shul'gin, K K; Popov, S S; Agarkov, A A
2014-01-01
The influence of melaxen and valdoxan on the biochemiluminescence parameters, aconitate hydratase activity and citrate level in rats heart and liver during development of experimental hyperthyroidism has been investigated. Administration of these substances promoted a decrease of biochemiluminescence parameters, which had been increased in tissues of rats in response to the development of oxidative stress under hyperthyroidism. Aconitate hydratase activity and citrate concentration in rats liver and heart, growing at pathological conditions, changed towards control value after administration of the drugs correcting melatonin level. The results indicate the positive effect of valdoxan and melaxen on oxidative status of the organism under the development of experimental hyperthyroidism that is associated with antioxidant action of melatonin.
Neumann, Jennifer; Pawlik, Magdalena; Bryniok, Dieter; Thöming, Jorg; Stolte, Stefan
2014-01-01
Biodegradation tests with bacteria from activated sludge revealed the probable persistence of cyano-based ionic liquid anions when these leave waste water treatment plants. A possible biological treatment using bacteria capable of biodegrading similar compounds, namely cyanide and cyano-complexes, was therefore examined. With these bacteria from the genera Cupriavidus, the ionic liquid anions B(CN)₄(-), C(CN)₃(-), N(CN)₂(-) combined with alkaline cations were tested in different growth media using ion chromatography for the examination of their primary biodegradability. However, no enhanced biodegradability of the tested cyano-based ionic liquids was observed. Therefore, an in vitro enzymatic hydrolysis test was additionally run showing that all tested ionic liquid (IL) anions can be hydrolysed to their corresponding amides by nitrile hydratase, but not by nitrilase under the experimental conditions. The biological stability of the cyano-based anions is an advantage in technological application, but the occurrence of enzymes that are able to hydrolyse the parent compound gives a new perspective on future cyano-based IL anion treatment.
A Nitrile Hydratase in the Eukaryote Monosiga brevicollis
Foerstner, Konrad U.; Doerks, Tobias; Muller, Jean; Raes, Jeroen; Bork, Peer
2008-01-01
Bacterial nitrile hydratase (NHases) are important industrial catalysts and waste water remediation tools. In a global computational screening of conventional and metagenomic sequence data for NHases, we detected the two usually separated NHase subunits fused in one protein of the choanoflagellate Monosiga brevicollis, a recently sequenced unicellular model organism from the closest sister group of Metazoa. This is the first time that an NHase is found in eukaryotes and the first time it is observed as a fusion protein. The presence of an intron, subunit fusion and expressed sequence tags covering parts of the gene exclude contamination and suggest a functional gene. Phylogenetic analyses and genomic context imply a probable ancient horizontal gene transfer (HGT) from proteobacteria. The newly discovered NHase might open biotechnological routes due to its unconventional structure, its new type of host and its apparent integration into eukaryotic protein networks. PMID:19096720
Hüller, Cornelia; Grunow, Norbert; Nadler, Torsten; Bär, Michael
2011-01-01
We report on an exceedingly rare case of cutaneous and uterine leiomyomatosis in a 58-year-old Caucasian woman associated with ovarian cystadenoma and complete deletion of the fumarate hydratase gene. All patients and their family members with verified mutation have to be regularly screened for associated neoplasms, in particular papillary renal cell carcinoma (HLRCC, hereditary leiomyomatosis and renal cell cancer). PMID:24396716
Hirata, Akiko; Kishino, Shigenobu; Park, Si-Bum; Takeuchi, Michiki; Kitamura, Nahoko; Ogawa, Jun
2015-01-01
Hydroxy FAs, one of the gut microbial metabolites of PUFAs, have attracted much attention because of their various bioactivities. The purpose of this study was to identify lactic acid bacteria with the ability to convert linoleic acid (LA) to hydroxy FAs. A screening process revealed that a gut bacterium, Lactobacillus acidophilus NTV001, converts LA mainly into 13-hydroxy-cis-9-octadecenoic acid and resulted in the identification of the hydratase responsible, fatty acid hydratase 1 (FA-HY1). Recombinant FA-HY1 was purified, and its enzymatic characteristics were investigated. FA-HY1 could convert not only C18 PUFAs but also C20 and C22 PUFAs. C18 PUFAs with a cis carbon-carbon double bond at the Δ12 position were converted into the corresponding 13-hydroxy FAs. Arachidonic acid and DHA were converted into the corresponding 15-hydroxy FA and 14-hydroxy FA, respectively. To the best of our knowledge, this is the first report of a bacterial FA hydratase that can convert C20 and C22 PUFAs into the corresponding hydroxy FAs. These novel hydroxy FAs produced by using FA-HY1 should contribute to elucidating the bioactivities of hydroxy FAs. PMID:25966711
Expression and stereochemical and isotope effect studies of active 4-oxalocrotonate decarboxylase.
Stanley, T M; Johnson, W H; Burks, E A; Whitman, C P; Hwang, C C; Cook, P F
2000-02-01
4-Oxalocrotonate decarboxylase (4-OD) and vinylpyruvate hydratase (VPH) from Pseudomonas putida mt-2 form a complex that converts 2-oxo-3-hexenedioate to 2-oxo-4-hydroxypentanoate in the catechol meta fission pathway. To facilitate mechanistic and structural studies of the complex, the two enzymes have been coexpressed and the complex has been purified to homogeneity. In addition, Glu-106, a potential catalytic residue in VPH, has been changed to glutamine, and the resulting E106QVPH mutant has been coexpressed with 4-OD and purified to homogeneity. The 4-OD/E106QVPH complex retains full decarboxylase activity, with comparable kinetic parameters to those observed for 4-OD in the wild-type complex, but is devoid of any detectable hydratase activity. Decarboxylation of (5S)-2-oxo-3-[5-D]hexenedioate by either the 4-OD/VPH complex or the mutant complex generates 2-hydroxy-2,4E-[5-D]pentadienoate in D(2)O. Ketonization of 2-hydroxy-2,4-pentadienoate by the wild-type complex is highly stereoselective and results in the formation of 2-oxo-(3S)-[3-D]-4-pentenoate, while the mutant complex generates a racemic mixture. These results indicate that 2-hydroxy-2, 4-pentadienoate is the product of 4-OD and that 2-oxo-4-pentenoate results from a VPH-catalyzed process. On this basis, the previously proposed hypothesis for the conversion of 2-oxo-3-hexenedioate to 2-oxo-4-hydroxypentanoate has been revised [Lian, H., and Whitman, C. P. (1994) J. Am. Chem. Soc. 116, 10403-10411]. Finally, the observed (13)C kinetic isotope effect on the decarboxylation of 2-oxo-3-hexenedioate by the 4-OD/VPH complex suggests that the decarboxylation step is nearly rate-limiting. Because the value is not sensitive to either magnesium or manganese, it is likely that the transition state for carbon-carbon bond cleavage is late and that the metal positions the substrate and polarizes the carbonyl group, analogous to its role in oxalacetate decarboxylase.
Structure of the non-redox-active tungsten/[4Fe:4S] enzyme acetylene hydratase.
Seiffert, Grazyna B; Ullmann, G Matthias; Messerschmidt, Albrecht; Schink, Bernhard; Kroneck, Peter M H; Einsle, Oliver
2007-02-27
The tungsten-iron-sulfur enzyme acetylene hydratase stands out from its class because it catalyzes a nonredox reaction, the hydration of acetylene to acetaldehyde. Sequence comparisons group the protein into the dimethyl sulfoxide reductase family, and it contains a bis-molybdopterin guanine dinucleotide-ligated tungsten atom and a cubane-type [4Fe:4S] cluster. The crystal structure of acetylene hydratase at 1.26 A now shows that the tungsten center binds a water molecule that is activated by an adjacent aspartate residue, enabling it to attack acetylene bound in a distinct, hydrophobic pocket. This mechanism requires a strong shift of pK(a) of the aspartate, caused by a nearby low-potential [4Fe:4S] cluster. To access this previously unrecognized W-Asp active site, the protein evolved a new substrate channel distant from where it is found in other molybdenum and tungsten enzymes.
Identification of enzymes involved in oxidation of phenylbutyrate.
Palir, Neža; Ruiter, Jos P N; Wanders, Ronald J A; Houtkooper, Riekelt H
2017-05-01
In recent years the short-chain fatty acid, 4-phenylbutyrate (PB), has emerged as a promising drug for various clinical conditions. In fact, PB has been Food and Drug Administration-approved for urea cycle disorders since 1996. PB is more potent and less toxic than its metabolite, phenylacetate (PA), and is not just a pro-drug for PA, as was initially assumed. The metabolic pathway of PB, however, has remained unclear. Therefore, we set out to identify the enzymes involved in the β-oxidation of PB. We used cells deficient in specific steps of fatty acid β-oxidation and ultra-HPLC to measure which enzymes were able to convert PB or its downstream products. We show that the first step in PB oxidation is catalyzed solely by the enzyme, medium-chain acyl-CoA dehydrogenase. The second (hydration) step can be catalyzed by all three mitochondrial enoyl-CoA hydratase enzymes, i.e., short-chain enoyl-CoA hydratase, long-chain enoyl-CoA hydratase, and 3-methylglutaconyl-CoA hydratase. Enzymes involved in the third step include both short- and long-chain 3-hydroxyacyl-CoA dehydrogenase. The oxidation of PB is completed by only one enzyme, i.e., long-chain 3-ketoacyl-CoA thiolase. Taken together, the enzymatic characteristics of the PB degradative pathway may lead to better dose finding and limiting the toxicity of this drug. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Park, Ji-Young; Lee, Seon-Hwa; Kim, Kyoung-Rok; Park, Jin-Byung; Oh, Deok-Kun
2015-08-20
Linoleate 13-hydratase from Lactobacillus acidophilus LMG 11470 converted linoleic acid to hydroxyl fatty acid, which was identified as 13S-hydroxy-9(Z)-octadecenoic acid (13-HOD) by GC-MS and NMR. The expression of linoleate 13-hydratase gene in Escherichia coli was maximized by using pACYC plasmid and super optimal broth with catabolite repression (SOC) medium containing 40mM Mg(2+). To optimize induction conditions, recombinant cells were cultivated at 37°C, 1mM isopropyl-β-d-thiogalactopyranoside was added at 2h, and the culture was further incubated at 16°C for 18h. Recombinant cells expressing linoleate 13-hydratase from L. acidophilus were obtained under the optimized expression conditions and used for 13-HOD production from linoleic acid. The optimal reaction conditions were pH 6.0, 40°C, 0.25% (v/v) Tween 40, 25gl(-1) cells, and 100gl(-1) linoleic acid, and under these conditions, whole recombinant cells produced 79gl(-1) 13-HOD for 3h with a conversion yield of 79% (w/w), a volumetric productivity of 26.3gl(-1)h(-1), and a specific productivity of 1.05g g-cells(-1)h(-1). To the best of our knowledge, the recombinant cells produced hydroxy fatty acid with the highest concentration and productivity reported so far. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.
Kumar, Pravin; Ghosh Sachan, Shashwati; Poddar, Raju
2017-10-01
Improving the industrial enzyme for better yield of the product is important and a challenging task. One of such important industrial enzymes is microbial Hydroxycinnamoyl-CoA hydratase-lyase (HCHL). It converts feruloyl-CoA to vanillin. We place our efforts towards the improvement of its catalytic activity with comprehensive computational investigation. Catalytic core of the HCHL was explored with molecular modeling and docking approaches. Site-directed mutations were introduced in the catalytic site of HCHL in a sequential manner to generate different mutants of HCHL. Basis of mutation is to increase the interaction between HCHL and substrate feruloyl-CoA through interatomic forces and hydrogen bond formation. A rigorous molecular dynamics (MD) simulation was performed to check the stability of mutant's structure. Root mean square deviation (RMSD), root mean square fluctuation (RMSF), dynamic cross correlation (DCCM) and principal component analysis (PCA) were also performed to analyze flexibility and stability of structures. Docking studies were carried out between different mutants of HCHL and feruloyl-CoA. Investigation of the different binding sites and the interactions with mutant HCHLs and substrate allowed us to highlight the improved performance of mutants than wild type HCHL. This was further validated with MD simulation of complex consisting of different mutants and substrate. It further confirms all the structures are stable. However, mutant-2 showed better affinity towards substrate by forming hydrogen bond between active site and feruloyl-CoA. We propose that increase in hydrogen bond formation might facilitate in dissociation of vanillin from feruloyl-CoA. The current work may be useful for the future development of 'tailor-made' enzymes for better yield of vanillin. Copyright © 2017 Elsevier Inc. All rights reserved.
Popov, S S; Pashkov, A N; Popova, T N; Zoloedov, V I; Semenikhina, A V; Rakhmanova, T I
2007-08-01
Biochemiluminescence increased, while aconitate hydratase activity and citrate accumulation in tissues of the liver and heart and blood decreased in rats with experimental hyperthyroidism. These changes reflect activation of free radical oxidation, damage to enzyme molecules with reactive oxygen species, and impaired utilization of citrate under pathological conditions. Melatonin treatment during hyperthyroidism normalized aconitate hydratase activity and citrate concentration. Biochemiluminescence study showed that the effect of melatonin is related to antioxidant activity of this hormone, inhibition of free radical oxidation, and suppression of reactive oxygen species generation.
Yang, Fu-Chun; Chen, Yi-Lung; Tang, Sen-Lin; Yu, Chang-Ping; Wang, Po-Hsiang; Ismail, Wael; Wang, Chia-Hsiang; Ding, Jiun-Yan; Yang, Cheng-Yu; Yang, Chia-Ying; Chiang, Yin-Ru
2016-01-01
Steroid hormones, such as androgens, are common surface-water contaminants. However, literature on the ecophysiological relevance of steroid-degrading organisms in the environment, particularly in anoxic ecosystems, is extremely limited. We previously reported that Steroidobacter denitrificans anaerobically degrades androgens through the 2,3-seco pathway. In this study, the genome of Sdo. denitrificans was completely sequenced. Transcriptomic data revealed gene clusters that were distinctly expressed during anaerobic growth on testosterone. We isolated and characterized the bifunctional 1-testosterone hydratase/dehydrogenase, which is essential for anaerobic degradation of steroid A-ring. Because of apparent substrate preference of this molybdoenzyme, corresponding genes, along with the signature metabolites of the 2,3-seco pathway, were used as biomarkers to investigate androgen biodegradation in the largest sewage treatment plant in Taipei, Taiwan. Androgen metabolite analysis indicated that denitrifying bacteria in anoxic sewage use the 2,3-seco pathway to degrade androgens. Metagenomic analysis and PCR-based functional assays showed androgen degradation in anoxic sewage by Thauera spp. through the action of 1-testosterone hydratase/dehydrogenase. Our integrative ‘omics' approach can be used for culture-independent investigations of the microbial degradation of structurally complex compounds where isotope-labeled substrates are not easily available. PMID:26872041
Addabbo, Francesco; Ratliff, Brian; Park, Hyeong-Cheon; Kuo, Mei-Chuan; Ungvari, Zoltan; Csiszar, Anna; Ciszar, Anna; Krasnikov, Boris; Krasnikof, Boris; Sodhi, Komal; Zhang, Fung; Nasjletti, Alberto; Goligorsky, Michael S
2009-01-01
Endothelial cell dysfunction is associated with bioavailable nitric oxide deficiency and an excessive generation of reactive oxygen species. We modeled this condition by chronically inhibiting nitric oxide generation with subpressor doses of N(G)-monomethyl-L-arginine (L-NMMA) in C57B6 and Tie-2/green fluorescent protein mouse strains. L-NMMA-treated mice exhibited a slight reduction in vasorelaxation ability, as well as detectable abnormalities in soluble adhesion molecules (soluble intercellular adhesion molecule-1 and vascular cellular adhesion molecule-1, and matrix metalloproteinase 9), which represent surrogate indicators of endothelial dysfunction. Proteomic analysis of the isolated microvasculature using 2-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy revealed abnormal expression of a cluster of mitochondrial enzymes, which was confirmed using immunodetection. Aconitase-2 and enoyl-CoA-hydratase-1 expression levels were decreased in L-NMMA-treated animals; this phenotype was absent in nitric oxide synthase-1 and -3 knockout mice. Depletion of aconitase-2 and enoyl-CoA-hydratase-1 resulted in the inhibition of the Krebs cycle and enhanced pyruvate shunting toward the glycolytic pathway. To assess mitochondrial mass in vivo, co-localization of green fluorescent protein and MitoTracker fluorescence was detected by intravital microscopy. Quantitative analysis of fluorescence intensity showed that L-NMMA-treated animals exhibited lower fluorescence of MitoTracker in microvascular endothelia as a result of reduced mitochondrial mass. These findings provide conclusive and unbiased evidence that mitochondriopathy represents an early manifestation of endothelial dysfunction, shifting cell metabolism toward "metabolic hypoxia" through the selective depletion of both aconitase-2 and enoyl-CoA-hydratase-1. These findings may contribute to an early preclinical diagnosis of endothelial dysfunction.
Mechanism of tungsten-dependent acetylene hydratase from quantum chemical calculations.
Liao, Rong-Zhen; Yu, Jian-Guo; Himo, Fahmi
2010-12-28
Acetylene hydratase is a tungsten-dependent enzyme that catalyzes the nonredox hydration of acetylene to acetaldehyde. Density functional theory calculations are used to elucidate the reaction mechanism of this enzyme with a large model of the active site devised on the basis of the native X-ray crystal structure. Based on the calculations, we propose a new mechanism in which the acetylene substrate first displaces the W-coordinated water molecule, and then undergoes a nucleophilic attack by the water molecule assisted by an ionized Asp13 residue at the active site. This is followed by proton transfer from Asp13 to the newly formed vinyl anion intermediate. In the subsequent isomerization, Asp13 shuttles a proton from the hydroxyl group of the vinyl alcohol to the α-carbon. Asp13 is thus a key player in the mechanism, but also W is directly involved in the reaction by binding and activating acetylene and providing electrostatic stabilization to the transition states and intermediates. Several other mechanisms are also considered but the energetic barriers are found to be very high, ruling out these possibilities.
Kumar, Davinder; Nguyen, Tho N; Grapperhaus, Craig A
2014-12-01
Kinetic investigations inspired by the metalloenzyme nitrile hydratase were performed on a series of ruthenium(II) complexes to determine the effect of sulfur oxidation on catalytic nitrile hydration. The rate of benzonitrile hydration was quantified as a function of catalyst, nitrile, and water concentrations. Precatalysts L(n)RuPPh3 (n = 1-3; L(1) = 4,7-bis(2'-methyl-2'-mercapto-propyl)-1-thia-4,7-diazacyclononane; L(2) = 4-(2'-methyl-2'-sulfinatopropyl)-7-(2'-methyl-2'-mercapto-propyl)-1-thia-4,7-diazacyclononane; L(3) = 4-(2'-methyl-2'-sulfinatopropyl)-7-(2'-methyl-2'-sulfenato-propyl)-1-thia-4,7-diazacyclononane) were activated by substitution of triphenylphosphine with substrate in hot dimethylformamide solution. Rate measurements are consistent with a dynamic equilibrium between inactive aqua (L(n)Ru-OH2) and active nitrile (L(n)Ru-NCR) derivatives with K = 21 ± 1, 9 ± 0.9, and 23 ± 3 for L(1) to L(3), respectively. Subsequent hydration of the L(n)Ru-NCR intermediate yields the amide product with measured hydration rate constants (k's) of 0.37 ± 0.01, 0.82 ± 0.07, and 1.59 ± 0.12 M(-1) h(-1) for L(1) to L(3), respectively. Temperature dependent studies reveal that sulfur oxidation lowers the enthalpic barrier by 27 kJ/mol, but increases the entropic barrier by 65 J/(mol K). Density functional theory (DFT) calculations (B3LYP/LanL2DZ (Ru); 6-31G(d) (all other atoms)) support a nitrile bound catalytic cycle with lowering of the reaction barrier as a consequence of sulfur oxidation through enhanced nitrile binding and attack of the water nucleophile through a highly organized transition state.
Bedoyan, Jirair K; Yang, Samuel P; Ferdinandusse, Sacha; Jack, Rhona M; Miron, Alexander; Grahame, George; DeBrosse, Suzanne D; Hoppel, Charles L; Kerr, Douglas S; Wanders, Ronald J A
2017-04-01
Mutations in ECHS1 result in short-chain enoyl-CoA hydratase (SCEH) deficiency which mainly affects the catabolism of various amino acids, particularly valine. We describe a case compound heterozygous for ECHS1 mutations c.836T>C (novel) and c.8C>A identified by whole exome sequencing of proband and parents. SCEH deficiency was confirmed with very low SCEH activity in fibroblasts and nearly absent immunoreactivity of SCEH. The patient had a severe neonatal course with elevated blood and cerebrospinal fluid lactate and pyruvate concentrations, high plasma alanine and slightly low plasma cystine. 2-Methyl-2,3-dihydroxybutyric acid was markedly elevated as were metabolites of the three branched-chain α-ketoacids on urine organic acids analysis. These urine metabolites notably decreased when lactic acidosis decreased in blood. Lymphocyte pyruvate dehydrogenase complex (PDC) activity was deficient, but PDC and α-ketoglutarate dehydrogenase complex activities in cultured fibroblasts were normal. Oxidative phosphorylation analysis on intact digitonin-permeabilized fibroblasts was suggestive of slightly reduced PDC activity relative to control range in mitochondria. We reviewed 16 other cases with mutations in ECHS1 where PDC activity was also assayed in order to determine how common and generalized secondary PDC deficiency is associated with primary SCEH deficiency. For reasons that remain unexplained, we find that about half of cases with primary SCEH deficiency also exhibit secondary PDC deficiency. The patient died on day-of-life 39, prior to establishing his diagnosis, highlighting the importance of early and rapid neonatal diagnosis because of possible adverse effects of certain therapeutic interventions, such as administration of ketogenic diet, in this disorder. There is a need for better understanding of the pathogenic mechanisms and phenotypic variability in this relatively recently discovered disorder. Copyright © 2017 Elsevier Inc. All rights reserved.
Ntougias, Spyridon; Lapidus, Alla; Han, James; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Klenk, Hans-Peter; Woyke, Tanja; Fasseas, Constantinos; Kyrpides, Nikos C.; Zervakis, Georgios I.
2014-01-01
Olivibacter sitiensis Ntougias et al. 2007 is a member of the family Sphingobacteriaceae, phylum Bacteroidetes. Members of the genus Olivibacter are phylogenetically diverse and of significant interest. They occur in diverse habitats, such as rhizosphere and contaminated soils, viscous wastes, composts, biofilter clean-up facilities on contaminated sites and cave environments, and they are involved in the degradation of complex and toxic compounds. Here we describe the features of O. sitiensis AW-6T, together with the permanent-draft genome sequence and annotation. The organism was sequenced under the Genomic Encyclopedia for Bacteria and Archaea (GEBA) project at the DOE Joint Genome Institute and is the first genome sequence of a species within the genus Olivibacter. The genome is 5,053,571 bp long and is comprised of 110 scaffolds with an average GC content of 44.61%. Of the 4,565 genes predicted, 4,501 were protein-coding genes and 64 were RNA genes. Most protein-coding genes (68.52%) were assigned to a putative function. The identification of 2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase-coding genes indicates involvement of this organism in the catechol catabolic pathway. In addition, genes encoding for β-1,4-xylanases and β-1,4-xylosidases reveal the xylanolytic action of O. sitiensis. PMID:25197463
Oremland, Ronald S; Voytek, Mary A
2008-02-01
Acetylene occurs, by photolysis of methane, in the atmospheres of jovian planets and Titan. In contrast, acetylene is only a trace component of Earth's current atmosphere. Nonetheless, a methane-rich atmosphere has been hypothesized for early Earth; this atmosphere would also have been rich in acetylene. This poses a paradox, because acetylene is a potent inhibitor of many key anaerobic microbial processes, including methanogenesis, anaerobic methane oxidation, nitrogen fixation, and hydrogen oxidation. Fermentation of acetylene was discovered approximately 25 years ago, and Pelobacter acetylenicus was shown to grow on acetylene by virtue of acetylene hydratase, which results in the formation of acetaldehyde. Acetaldehyde subsequently dismutates to ethanol and acetate (plus some hydrogen). However, acetylene hydratase is specific for acetylene and does not react with any analogous compounds. We hypothesize that microbes with acetylene hydratase played a key role in the evolution of Earth's early biosphere by exploiting an available source of carbon from the atmosphere and in so doing formed protective niches that allowed for other microbial processes to flourish. Furthermore, the presence of acetylene in the atmosphere of a planet or planetoid could possibly represent evidence for an extraterrestrial anaerobic ecosystem.
Rosberg-Cody, Eva; Liavonchanka, Alena; Göbel, Cornelia; Ross, R Paul; O'Sullivan, Orla; Fitzgerald, Gerald F; Feussner, Ivo; Stanton, Catherine
2011-02-17
The aim of this study was to determine the catalytic activity and physiological role of myosin-cross-reactive antigen (MCRA) from Bifidobacterium breve NCIMB 702258. MCRA from B. breve NCIMB 702258 was cloned, sequenced and expressed in heterologous hosts (Lactococcus and Corynebacterium) and the recombinant proteins assessed for enzymatic activity against fatty acid substrates. MCRA catalysed the conversion of palmitoleic, oleic and linoleic acids to the corresponding 10-hydroxy fatty acids, but shorter chain fatty acids were not used as substrates, while the presence of trans-double bonds and double bonds beyond the position C12 abolished hydratase activity. The hydroxy fatty acids produced were not metabolised further. We also found that heterologous Lactococcus and Corynebacterium expressing MCRA accumulated increasing amounts of 10-HOA and 10-HOE in the culture medium. Furthermore, the heterologous cultures exhibited less sensitivity to heat and solvent stresses compared to corresponding controls. MCRA protein in B. breve can be classified as a FAD-containing double bond hydratase, within the carbon-oxygen lyase family, which may be catalysing the first step in conjugated linoleic acid (CLA) production, and this protein has an additional function in bacterial stress protection.
Oremland, R.S.; Voytek, M.A.
2008-01-01
Acetylene occurs, by photolysis of methane, in the atmospheres of jovian planets and Titan. In contrast, acetylene is only a trace component of Earth's current atmosphere. Nonetheless, a methane-rich atmosphere has been hypothesized for early Earth; this atmosphere would also have been rich in acetylene. This poses a paradox, because acetylene is a potent inhibitor of many key anaerobic microbial processes, including methanogenesis, anaerobic methane oxidation, nitrogen fixation, and hydrogen oxidation. Fermentation of acetylene was discovered 25 years ago, and Pelobacter acetylenicus was shown to grow on acetylene by virtue of acetylene hydratase, which results in the formation of acetaldehyde. Acetaldehyde subsequently dismutates to ethanol and acetate (plus some hydrogen). However, acetylene hydratase is specific for acetylene and does not react with any analogous compounds. We hypothesize that microbes with acetylene hydratase played a key role in the evolution of Earth's early biosphere by exploiting an available source of carbon from the atmosphere and in so doing formed protective niches that allowed for other microbial processes to flourish. Furthermore, the presence of acetylene in the atmosphere of a planet or planetoid could possibly represent evidence for an extraterrestrial anaerobic ecosystem. ?? Mary Ann Liebert, Inc.
Bahnson, Brian J; Anderson, Vernon E; Petsko, Gregory A
2002-02-26
We have determined the crystal structure of the enzyme enoyl-CoA hydratase (ECH) from rat liver with the bound substrate 4-(N,N-dimethylamino)cinnamoyl-CoA using X-ray diffraction data to a resolution of 2.3 A. In addition to the thiolester substrate, the catalytic water, which is added in the hydration reaction, has been modeled into well-defined electron density in each of the six active sites of the physiological hexamer within the crystallographic asymmetric unit. The catalytic water bridges Glu(144) and Glu(164) of the enzyme and has a lone pair of electrons poised to react with C(3) of the enzyme-bound alpha,beta-unsaturated thiolester. The water molecule, which bridges two glutamate residues, is reminiscent of the enolase active site. However, unlike enolase, which has a lysine available to donate a proton, there are no other sources of protons available from other active site residues in ECH. Furthermore, an analysis of the hydrogen-bonding network of the active site suggests that both Glu(144) and Glu(164) are ionized and carry a negative charge with no reasonable place to have a protonated carboxylate. This lack of hydrogen-bonding acceptors that could accommodate a source of a proton, other than from the water molecule, leads to a hypothesis that the three atoms from a single water molecule are added across the double bond to form the hydrated product. The structural results are discussed in connection with details of the mechanism, which have been elucidated from kinetics, site-directed mutagenesis, and spectroscopy of enzyme-substrate species, in presenting an atomic-resolution mechanism of the reaction. Contrary to the previous interpretation, the structure of the E-S complex together with previously determined kinetic isotope effects is consistent with either a concerted mechanism or an E1cb stepwise mechanism.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection. PMID:23851389
Latimer, Scott; Li, Yubing; Nguyen, Thuong T H; Soubeyrand, Eric; Fatihi, Abdelhak; Elowsky, Christian G; Block, Anna; Pichersky, Eran; Basset, Gilles J
2018-05-09
The proteinogenic branched-chain amino acids (BCAAs) leucine, isoleucine and valine are essential nutrients for mammals. In plants, BCAAs double as alternative energy sources when carbohydrates become limiting, the catabolism of BCAAs providing electrons to the respiratory chain and intermediates to the tricarboxylic acid cycle. Yet, the actual architecture of the degradation pathways of BCAAs is not well understood. In this study, gene network modeling in Arabidopsis and rice, and plant-prokaryote comparative genomics detected candidates for 3-methylglutaconyl-CoA hydratase (4.2.1.18), one of the missing plant enzymes of leucine catabolism. Alignments of these protein candidates sampled from various spermatophytes revealed non-homologous N-terminal extensions that are lacking in their bacterial counterparts, and green fluorescent protein-fusion experiments demonstrated that the Arabidopsis protein, product of gene At4g16800, is targeted to mitochondria. Recombinant At4g16800 catalyzed the dehydration of 3-hydroxymethylglutaryl-CoA into 3-methylglutaconyl-CoA, and displayed kinetic features similar to those of its prokaryotic homolog. When at4g16800 knockout plants were subjected to dark-induced carbon starvation, their rosette leaves displayed accelerated senescence as compared with control plants, and this phenotype was paralleled by a marked increase in the accumulation of free and total leucine, isoleucine and valine. The seeds of the at4g16800 mutant showed a similar accumulation of free BCAAs. These data suggest that 3-methylglutaconyl-CoA hydratase is not solely involved in the degradation of leucine, but is also a significant contributor to that of isoleucine and valine. Furthermore, evidence is shown that unlike the situation observed in Trypanosomatidae, leucine catabolism does not contribute to the formation of the terpenoid precursor mevalonate. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Agaimy, Abbas; Amin, Mahul B; Gill, Anthony J; Popp, Bernt; Reis, André; Berney, Daniel M; Magi-Galluzzi, Cristina; Sibony, Mathilde; Smith, Steven C; Suster, Saul; Trpkov, Kiril; Hes, Ondřej; Hartmann, Arndt
2018-04-21
Fumarate hydratase-deficient renal cell carcinoma (FH-RCC) is a rare, aggressive RCC type, originally described in the setting of hereditary leiomyomatosis and renal cell carcinoma (HLRCC) syndrome which is defined by germline FH gene inactivation. Inactivation of components of the SWI/SNF chromatin remodelling complex is involved in renal medullary carcinoma (SMARCB1/INI1 loss), clear cell RCC (PBRM1 loss) and in subsets of dedifferentiated RCC of clear cell, chromophobe and papillary types (loss of different SWI/SNF components). FH-RCC and SWI/SNF-deficient RCC share anaplastic nuclear features and highly aggressive course. We analysed 32 FH-RCCs from 28 patients using seven commercially available SWI/SNF antibodies (SMARCB1/INI1, SMARCA2, SMARCA4, SMARCC1, SMARCC2, PBRM1 and ARID1A). Variable loss of SMARCB1, ARID1A and SMARCC1 was observed in 1/31, 2/31 and 1/29 evaluable cases, respectively; three of these four SWI/SNF-deficient tumors had confirmed FH mutations. No correlation of SWI/SNF loss with solid or sarcomatoid features was observed. Two tumors with SMARCB1 and ARID1A deficiency had available SWI/SNF molecular data; both lacked SMARCB1 and ARID1A mutations. The remaining five SWI/SNF components were intact in all cases. Especially PBRM1 seems not to be involved in the pathogenesis or progression of FH-deficient RCC. Our data showed that, a subset of FH-RCC (12%) have a variable loss of SWI/SNF complex subunits, likely as secondary genetic events. This should not be confused with SWI/SNF-deficient RCC of other types. Evaluation of FH and SWI/SNF together with comprehensive molecular-genetic profiling is needed to explore possible prognostic implications of FH/SWI-SNF double deficiency and to better understand the somatic mutation landscape in high-grade RCC. Copyright © 2018. Published by Elsevier Inc.
2010-01-01
Background A new family of natural products has been described in which cysteine, serine and threonine from ribosomally-produced peptides are converted to thiazoles, oxazoles and methyloxazoles, respectively. These metabolites and their biosynthetic gene clusters are now referred to as thiazole/oxazole-modified microcins (TOMM). As exemplified by microcin B17 and streptolysin S, TOMM precursors contain an N-terminal leader sequence and C-terminal core peptide. The leader sequence contains binding sites for the posttranslational modifying enzymes which subsequently act upon the core peptide. TOMM peptides are small and highly variable, frequently missed by gene-finders and occasionally situated far from the thiazole/oxazole forming genes. Thus, locating a substrate for a particular TOMM pathway can be a challenging endeavor. Results Examination of candidate TOMM precursors has revealed a subclass with an uncharacteristically long leader sequence closely related to the enzyme nitrile hydratase. Members of this nitrile hydratase leader peptide (NHLP) family lack the metal-binding residues required for catalysis. Instead, NHLP sequences display the classic Gly-Gly cleavage motif and have C-terminal regions rich in heterocyclizable residues. The NHLP family exhibits a correlated species distribution and local clustering with an ABC transport system. This study also provides evidence that a separate family, annotated as Nif11 nitrogen-fixing proteins, can serve as natural product precursors (N11P), but not always of the TOMM variety. Indeed, a number of cyanobacterial genomes show extensive N11P paralogous expansion, such as Nostoc, Prochlorococcus and Cyanothece, which replace the TOMM cluster with lanthionine biosynthetic machinery. Conclusions This study has united numerous TOMM gene clusters with their cognate substrates. These results suggest that two large protein families, the nitrile hydratases and Nif11, have been retailored for secondary metabolism. Precursors for TOMMs and lanthionine-containing peptides derived from larger proteins to which other functions are attributed, may be widespread. The functions of these natural products have yet to be elucidated, but it is probable that some will display valuable industrial or medical activities. PMID:20500830
Borjian, Farshad; Johnsen, Ulrike; Schönheit, Peter; Berg, Ivan A
2017-01-01
Growth on acetate or other acetyl-CoA-generating substrates as a sole source of carbon requires an anaplerotic pathway for the conversion of acetyl-CoA into cellular building blocks. Haloarchaea (class Halobacteria ) possess two different anaplerotic pathways, the classical glyoxylate cycle and the novel methylaspartate cycle. The methylaspartate cycle was discovered in Haloarcula spp. and operates in ∼40% of sequenced haloarchaea. In this cycle, condensation of one molecule of acetyl-CoA with oxaloacetate gives rise to citrate, which is further converted to 2-oxoglutarate and then to glutamate. The following glutamate rearrangement and deamination lead to mesaconate (methylfumarate) that needs to be activated to mesaconyl-C1-CoA and hydrated to β-methylmalyl-CoA. The cleavage of β-methylmalyl-CoA results in the formation of propionyl-CoA and glyoxylate. The carboxylation of propionyl-CoA and the condensation of glyoxylate with another acetyl-CoA molecule give rise to two C 4 -dicarboxylic acids, thus regenerating the initial acetyl-CoA acceptor and forming malate, its final product. Here we studied two enzymes of the methylaspartate cycle from Haloarcula hispanica , succinyl-CoA:mesaconate CoA-transferase (mesaconate CoA-transferase, Hah_1336) and mesaconyl-CoA hydratase (Hah_1340). Their genes were heterologously expressed in Haloferax volcanii , and the corresponding enzymes were purified and characterized. Mesaconate CoA-transferase was specific for its physiological substrates, mesaconate and succinyl-CoA, and produced only mesaconyl-C1-CoA and no mesaconyl-C4-CoA. Mesaconyl-CoA hydratase had a 3.5-fold bias for the physiological substrate, mesaconyl-C1-CoA, compared to mesaconyl-C4-CoA, and virtually no activity with other tested enoyl-CoA/3-hydroxyacyl-CoA compounds. Our results further prove the functioning of the methylaspartate cycle in haloarchaea and suggest that mesaconate CoA-transferase and mesaconyl-CoA hydratase can be regarded as characteristic enzymes of this cycle.
Kihara, Takahiro; Hiroe, Ayaka; Ishii-Hyakutake, Manami; Mizuno, Kouhei; Tsuge, Takeharu
2017-08-01
Bacillus cereus and Bacillus megaterium both accumulate polyhydroxyalkanoate (PHA) but their PHA biosynthetic gene (pha) clusters that code for proteins involved in PHA biosynthesis are different. Namely, a gene encoding MaoC-like protein exists in the B. cereus-type pha cluster but not in the B. megaterium-type pha cluster. MaoC-like protein has an R-specific enoyl-CoA hydratase (R-hydratase) activity and is referred to as PhaJ when involved in PHA metabolism. In this study, the pha cluster of B. cereus YB-4 was characterized in terms of PhaJ's function. In an in vitro assay, PhaJ from B. cereus YB-4 (PhaJ YB4 ) exhibited hydration activity toward crotonyl-CoA. In an in vivo assay using Escherichia coli as a host for PHA accumulation, the recombinant strain expressing PhaJ YB4 and PHA synthase led to increased PHA accumulation, suggesting that PhaJ YB4 functioned as a monomer supplier. The monomer composition of the accumulated PHA reflected the substrate specificity of PhaJ YB4 , which appeared to prefer short chain-length substrates. The pha cluster from B. cereus YB-4 functioned to accumulate PHA in E. coli; however, it did not function when the phaJ YB4 gene was deleted. The B. cereus-type pha cluster represents a new example of a pha cluster that contains the gene encoding PhaJ.
Cheng, Zhongyi; Peplowski, Lukasz; Cui, Wenjing; Xia, Yuanyuan; Liu, Zhongmei; Zhang, Jialei; Kobayashi, Michihiko; Zhou, Zhemin
2018-03-01
Optically pure compounds are important in the synthesis of fine chemicals. Using directed evolution of enzymes to obtain biocatalysts that can selectively produce high-value chiral chemicals is often time-, money-, and resource-intensive; traditional semi-rational designs based on structural data and docking experiments are still limited due to the lack of accurate selection of hot-spot residues. In this study, through ligand-protein collision counts based on steered molecular dynamics simulation, we accurately identified four residues related to improving nitrile hydratase stereoselectivity toward rac-mandelonitrile (MAN). All the four selected residues had numerous collisions with rac-MAN. Five mutants significantly shifting stereoselectivity towards (S)-MAN were obtained from site-saturation mutagenesis, one of them, at position βPhe37, exhibiting efficient production of (S)-MAN with 96.8% ee p , was isolated and further analyzed. The increased pulling force observed during SMD simulation was found to be in good coincidence with the formation of hydrogen bonds between (R)-MAN and residue βHis37. (R)-MAN had to break these barriers to enter the active site of nitrile hydratase and S selectivity was thus improved. The results indicated that combining steered molecular dynamics simulation with a traditional semi-rational design significantly reduced the select range of hot-spot residues for the evolution of NHase stereoselectivity, which could serve as an alternative for the modulation of enzyme stereoselectivity. © 2017 Wiley Periodicals, Inc.
Hernáez, M J; Floriano, B; Ríos, J J; Santero, E
2002-10-01
Two new genes whose products are involved in biodegradation of the organic solvent tetralin were identified. These genes, designated thnE and thnF, are located downstream of the previously identified thnD gene and code for a hydratase and an aldolase, respectively. A sequence comparison of enzymes similar to ThnE showed the significant similarity of hydratases involved in biodegradation pathways to 4-oxalocrotonate decarboxylases and established four separate groups of related enzymes. Consistent with the sequence information, characterization of the reaction catalyzed by ThnE showed that it hydrated a 10-carbon dicarboxylic acid. The only reaction product detected was the enol tautomer, 2,4-dihydroxydec-2-ene-1,10-dioic acid. The aldolase ThnF showed significant similarity to aldolases involved in different catabolic pathways whose substrates are dihydroxylated dicarboxylic acids and which yield pyruvate and a semialdehyde. The reaction products of the aldol cleavage reaction catalyzed by ThnF were identified as pyruvate and the seven-carbon acid pimelic semialdehyde. ThnF and similar aldolases showed conservation of the active site residues identified by the crystal structure of 2-dehydro-3-deoxy-galactarate aldolase, a class II aldolase with a novel reaction mechanism, suggesting that these similar enzymes are class II aldolases. In contrast, ThnF did not show similarity to 4-hydroxy-2-oxovalerate aldolases of other biodegradation pathways, which are significantly larger and apparently are class I aldolases.
Ashrafian, Houman; O'Flaherty, Linda; Adam, Julie; Steeples, Violetta; Chung, Yuen-Li; East, Phil; Vanharanta, Sakari; Lehtonen, Heli; Nye, Emma; Hatipoglu, Emine; Miranda, Melroy; Howarth, Kimberley; Shukla, Deepa; Troy, Helen; Griffiths, John; Spencer-Dene, Bradley; Yusuf, Mohammed; Volpi, Emanuela; Maxwell, Patrick H; Stamp, Gordon; Poulsom, Richard; Pugh, Christopher W; Costa, Barbara; Bardella, Chiara; Di Renzo, Maria Flavia; Kotlikoff, Michael I; Launonen, Virpi; Aaltonen, Lauri; El-Bahrawy, Mona; Tomlinson, Ian; Pollard, Patrick J
2010-11-15
Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is caused by mutations in the Krebs cycle enzyme fumarate hydratase (FH). It has been proposed that "pseudohypoxic" stabilization of hypoxia-inducible factor-α (HIF-α) by fumarate accumulation contributes to tumorigenesis in HLRCC. We hypothesized that an additional direct consequence of FH deficiency is the establishment of a biosynthetic milieu. To investigate this hypothesis, we isolated primary mouse embryonic fibroblast (MEF) lines from Fh1-deficient mice. As predicted, these MEFs upregulated Hif-1α and HIF target genes directly as a result of FH deficiency. In addition, detailed metabolic assessment of these MEFs confirmed their dependence on glycolysis, and an elevated rate of lactate efflux, associated with the upregulation of glycolytic enzymes known to be associated with tumorigenesis. Correspondingly, Fh1-deficient benign murine renal cysts and an advanced human HLRCC-related renal cell carcinoma manifested a prominent and progressive increase in the expression of HIF-α target genes and in genes known to be relevant to tumorigenesis and metastasis. In accord with our hypothesis, in a variety of different FH-deficient tissues, including a novel murine model of Fh1-deficient smooth muscle, we show a striking and progressive upregulation of a tumorigenic metabolic profile, as manifested by increased PKM2 and LDHA protein. Based on the models assessed herein, we infer that that FH deficiency compels cells to adopt an early, reversible, and progressive protumorigenic metabolic milieu that is reminiscent of that driving the Warburg effect. Targets identified in these novel and diverse FH-deficient models represent excellent potential candidates for further mechanistic investigation and therapeutic metabolic manipulation in tumors. Copyright © 2010 AACR.
A Role for Cytosolic Fumarate Hydratase in Urea Cycle Metabolism and Renal Neoplasia
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O’Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A.; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J.; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J.
2013-01-01
Summary The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. PMID:23643539
A role for cytosolic fumarate hydratase in urea cycle metabolism and renal neoplasia.
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O'Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J
2013-05-30
The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Gilbert, Stephanie; Hood, LaChae; Seah, Stephen Y K
2018-01-15
The heteromeric acyl coenzyme A (acyl-CoA) dehydrogenase FadE28-FadE29 and the enoyl-CoA hydratase ChsH1-ChsH2, encoded by genes within the intracellular growth ( igr ) operon of Mycobacterium tuberculosis , catalyze the dehydrogenation of the cholesterol metabolite 3-oxo-4-pregnene-20-carboxyl-CoA (3-OPC-CoA), with a 3-carbon side chain, and subsequent hydration of the product 3-oxo-4,17-pregnadiene-20-carboxyl-CoA (3-OPDC-CoA) to form 17-hydroxy-3-oxo-4-pregnene-20-carboxyl-CoA (17-HOPC-CoA). The gene downstream of chsH2 , i.e., ltp2 , was expressed in recombinant Rhodococcus jostii RHA1 in combination with other genes within the igr operon. His-tagged Ltp2 copurified with untagged ChsH1-ChsH2, ChsH2, or the C-terminal domain of ChsH2, which contains a domain of unknown function (DUF35). Ltp2 in association with ChsH1-ChsH2 or just the DUF35 domain of ChsH2 was shown to catalyze the retroaldol cleavage of 17-HOPC-CoA to form androst-4-ene-3,17-dione and propionyl-CoA. Steady-state kinetic analysis using the Ltp2-DUF35 complex showed that the aldolase had optimal activity at pH 7.5, with a K m of 6.54 ± 0.90 μM and a k cat of 159 ± 8.50 s -1 ChsH1-ChsH2 could hydrate only about 30% of 3-OPDC-CoA, but this unfavorable equilibrium could be overcome when the aldolase was present to remove the hydrated product, providing a rationale for the close association of the aldolase with the hydratase. Homologs of ChsH1, ChsH2, and Ltp2 are found in steroid-degrading Gram-positive and Gram-negative bacteria, suggesting that side chains of diverse steroids may be cleaved by aldolases in the bacteria. IMPORTANCE The C-C bond cleavage of the D-ring side chain of cholesterol was shown to be catalyzed by an aldolase. The aldolase associates with the hydratase that catalyzes the preceding reaction in the cholesterol side chain degradation pathway. These enzymes are encoded by genes within the intracellular growth ( igr ) operon of M. tuberculosis , and the operon was demonstrated previously to be linked to the pathogenicity and persistence of the bacteria in macrophages and in mice. Copyright © 2017 American Society for Microbiology.
Rosner, B M; Schink, B
1995-10-01
Acetylene hydratase of the mesophilic fermenting bacterium Pelobacter acetylenicus catalyzes the hydration of acetylene to acetaldehyde. Growth of P. acetylenicus with acetylene and specific acetylene hydratase activity depended on tungstate or, to a lower degree, molybdate supply in the medium. The specific enzyme activity in cell extract was highest after growth in the presence of tungstate. Enzyme activity was stable even after prolonged storage of the cell extract or of the purified protein under air. However, enzyme activity could be measured only in the presence of a strong reducing agent such as titanium(III) citrate or dithionite. The enzyme was purified 240-fold by ammonium sulfate precipitation, anion-exchange chromatography, size exclusion chromatography, and a second anion-exchange chromatography step, with a yield of 36%. The protein was a monomer with an apparent molecular mass of 73 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isoelectric point was at pH 4.2. Per mol of enzyme, 4.8 mol of iron, 3.9 mol of acid-labile sulfur, and 0.4 mol of tungsten, but no molybdenum, were detected. The Km for acetylene as assayed in a coupled photometric test with yeast alcohol dehydrogenase and NADH was 14 microM, and the Vmax was 69 mumol.min-1.mg of protein-1. The optimum temperature for activity was 50 degrees C, and the apparent pH optimum was 6.0 to 6.5. The N-terminal amino acid sequence gave no indication of resemblance to any enzyme protein described so far.
Rosner, B M; Schink, B
1995-01-01
Acetylene hydratase of the mesophilic fermenting bacterium Pelobacter acetylenicus catalyzes the hydration of acetylene to acetaldehyde. Growth of P. acetylenicus with acetylene and specific acetylene hydratase activity depended on tungstate or, to a lower degree, molybdate supply in the medium. The specific enzyme activity in cell extract was highest after growth in the presence of tungstate. Enzyme activity was stable even after prolonged storage of the cell extract or of the purified protein under air. However, enzyme activity could be measured only in the presence of a strong reducing agent such as titanium(III) citrate or dithionite. The enzyme was purified 240-fold by ammonium sulfate precipitation, anion-exchange chromatography, size exclusion chromatography, and a second anion-exchange chromatography step, with a yield of 36%. The protein was a monomer with an apparent molecular mass of 73 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isoelectric point was at pH 4.2. Per mol of enzyme, 4.8 mol of iron, 3.9 mol of acid-labile sulfur, and 0.4 mol of tungsten, but no molybdenum, were detected. The Km for acetylene as assayed in a coupled photometric test with yeast alcohol dehydrogenase and NADH was 14 microM, and the Vmax was 69 mumol.min-1.mg of protein-1. The optimum temperature for activity was 50 degrees C, and the apparent pH optimum was 6.0 to 6.5. The N-terminal amino acid sequence gave no indication of resemblance to any enzyme protein described so far. PMID:7592321
Subasri, S; Chaudhary, Santosh Kumar; Sekar, K; Kesherwani, Manish; Velmurugan, D
2017-12-01
Fumarase catalyzes the reversible, stereospecific hydration/dehydration of fumarate to L-malate during the Kreb's cycle. In the crystal structure of the tetrameric fumarase, it was found that some of the active site residues S145, T147, N188 G364 and H235 had water-mediated hydrogen bonding interactions with pyromellitic acid and citrate which help to the protonation state for the conversion of fumarate to malate. When His 235 is mutated with Asn (H235N), water-mediated interactions were lost due to the shifting of active site water molecule by 0.7 Å away. Molecular dynamics (MD) simulations were also carried out by NAMD and analyzed using Assisted Model Building with Energy Refinement (AMBER) program to better understand the conformational stability and other aspects during the binding of pyromellitic acid and citrate with native and mutant FH. The role of hydrogen bonds and hydrophobic interactions was also analyzed. The present study confirms that the H235N mutation has a major effect on the catalytic activity of fumarase which is evident from the biochemical studies.
Liu, Yi; Liu, Ping; Lin, Lu; Zhao, Yueqin; Zhong, Wenjuan; Wu, Lunjie; Zhou, Zhemin; Sun, Weifeng
2016-09-01
The maturation mechanism of nitrile hydratase (NHase) of Pseudomonas putida NRRL-18668 was discovered and named as "self-subunit swapping." Since the NHase of Bordetella petrii DSM 12804 is similar to that of P. putida, the NHase maturation of B. petrii is proposed to be the same as that of P. putida. However, there is no further information on the application of NHase according to these findings. We successfully rapidly purified NHase and its activator through affinity his tag, and found that the cell extracts of NHase possessed multiple types of protein ingredients including α, β, α2β2, and α(P14K)2 who were in a state of chemical equilibrium. Furthermore, the activity was significantly enhanced through adding extra α(P14K)2 to the cell extracts of NHase according to the chemical equilibrium. Our findings are useful for the activity enhancement of multiple-subunit enzyme and for the first time significantly increased the NHase activity according to the chemical equilibrium.
Kobayashi, M; Suzuki, T; Fujita, T; Masuda, M; Shimizu, S
1995-01-01
The occurrence of a hitherto unknown pathway involving the action of two enzymes, a nitrile hydratase and an amidase for the biosynthesis of indole-3-acetic acid was discovered in phytopathogenic bacteria Agrobacterium tumefaciens and in leguminous bacteria Rhizobium. The nitrile hydratase acting on indole-3-acetonitrile was purified to homogeneity through only two steps from the cell-free extract of A. tumefaciens. The molecular mass of the purified enzyme estimated by HPLC was about 102 kDa, and the enzyme consisted of four subunits identical in molecular mass. The enzyme exhibited a broad absorption spectrum in the visible range with absorption maxima at 408 nm and 705 nm, and it contained cobalt and iron. The enzyme stoichiometrically catalyzed the hydration of indole-3-acetonitrile into indole-3-acetamide with a specific activity of 13.7 mol per min per mg and a Km of 7.9 microM. Images Fig. 1 PMID:11607511
Feliciano, Patricia R; Drennan, Catherine L; Nonato, M Cristina
2016-08-30
Fumarate hydratases (FHs) are essential metabolic enzymes grouped into two classes. Here, we present the crystal structure of a class I FH, the cytosolic FH from Leishmania major, which reveals a previously undiscovered protein fold that coordinates a catalytically essential [4Fe-4S] cluster. Our 2.05 Å resolution data further reveal a dimeric architecture for this FH that resembles a heart, with each lobe comprised of two domains that are arranged around the active site. Besides the active site, where the substrate S-malate is bound bidentate to the unique iron of the [4Fe-4S] cluster, other binding pockets are found near the dimeric enzyme interface, some of which are occupied by malonate, shown here to be a weak inhibitor of this enzyme. Taken together, these data provide a framework both for investigations of the class I FH catalytic mechanism and for drug design aimed at fighting neglected tropical diseases.
Altintop, Mehlika Dilek; Ozdemir, Ahmet; Kucukoglu, Kaan; Turan-Zitouni, Gulhan; Nadaroglu, Hayrunnisa; Kaplancikli, Zafer Asim
2015-02-01
2-[[5-(2,4-Difluoro/dichlorophenylamino)-1,3,4-thiadiazol-2-yl]thio] acetophenone derivatives (3a--s) were designed as human carbonic anhydrase isozymes (hCA-I and hCA-II) inhibitors and synthesized. hCA-I and hCA-II were purified from erythrocyte cells by the affinity chromatography. The inhibitory effects of 18 newly synthesized acetophenones on hydratase activity of these isoenzymes were studied in vitro. The average IC50 values of the new compounds for hydratase activity ranged from 0.033 to 0.14 μM for hCA-I and from 0.030 to 0.11 μM for hCA-II. Among the newly synthesized compounds, 2-[[5-(2,4-dichlorophenylamino)-1,3,4-thiadiazol-2-yl]thio]-4'-bromoacetophenone (3n) can be considered as a promising hCA-II inhibitor owing to its selective and potent inhibitory effect on hCA-II.
Functional characterization of the role of rpfA in Xylella fastidiosa
USDA-ARS?s Scientific Manuscript database
Xylella fastidiosa coordinates virulence in grapevines via quorum sensing signal molecules that are regulated and synthesized by the rpf gene cluster (regulation of pathogenicity factors). rpfA encodes aconitate hydratase and could play a regulator role involved in virulence. To elucidate the role o...
Analysis of a MULE-cyanide hydratase gene fusion in Verticillium dahliae
USDA-ARS?s Scientific Manuscript database
The genome of the phytopathogenic fungus Verticillium dahliae encodes numerous Class II “cut-and-paste” transposable elements, including those of a small group of MULE transposons. We have previously identified a fusion event between a MULE transposon sequence and sequence encoding a cyanide hydrata...
Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A
2018-06-01
Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.
Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe
2014-02-03
Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.
USDA-ARS?s Scientific Manuscript database
The proteinogenic branched-chain amino acids (BCAAs) leucine, isoleucine, and valine are essential nutrients for mammals. In plants, they double as alternative energy sources when carbohydrates become limiting, the catabolism of BCAAs providing electrons to the respiratory chain and intermediates...
Prediction of distal residue participation in enzyme catalysis
Brodkin, Heather R; DeLateur, Nicholas A; Somarowthu, Srinivas; Mills, Caitlyn L; Novak, Walter R; Beuning, Penny J; Ringe, Dagmar; Ondrechen, Mary Jo
2015-01-01
A scoring method for the prediction of catalytically important residues in enzyme structures is presented and used to examine the participation of distal residues in enzyme catalysis. Scores are based on the Partial Order Optimum Likelihood (POOL) machine learning method, using computed electrostatic properties, surface geometric features, and information obtained from the phylogenetic tree as input features. Predictions of distal residue participation in catalysis are compared with experimental kinetics data from the literature on variants of the featured enzymes; some additional kinetics measurements are reported for variants of Pseudomonas putida nitrile hydratase (ppNH) and for Escherichia coli alkaline phosphatase (AP). The multilayer active sites of P. putida nitrile hydratase and of human phosphoglucose isomerase are predicted by the POOL log ZP scores, as is the single-layer active site of P. putida ketosteroid isomerase. The log ZP score cutoff utilized here results in over-prediction of distal residue involvement in E. coli alkaline phosphatase. While fewer experimental data points are available for P. putida mandelate racemase and for human carbonic anhydrase II, the POOL log ZP scores properly predict the previously reported participation of distal residues. PMID:25627867
Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.
Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R
2017-03-06
Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.
An efficient fermentation method for the degradation of cyanogenic glycosides in flaxseed.
Wu, C-F; Xu, X-M; Huang, S-H; Deng, M-C; Feng, A-J; Peng, J; Yuan, J-P; Wang, J-H
2012-01-01
Recently, flaxseed has become increasingly popular in the health food market because it contains a considerable amount of specific beneficial nutrients such as lignans and omega-3 fatty acids. However, the presence of cyanogenic glycosides (CGs) in flaxseed severely limits the exploitation of its health benefits and nutritive value. We, therefore, developed an effective fermentation method, optimised by response surface methodology (RSM), for degrading CGs with an enzymatic preparation that includes 12.5% β-glucosidase and 8.9% cyanide hydratase. These optimised conditions resulted in a maximum CG degradation level of 99.3%, reducing the concentration of cyanide in the flaxseed power from 1.156 to 0.015 mg g(-1) after 48 h of fermentation. The avoidance of steam heat to evaporate hydrocyanic acid (HCN) results in lower energy consumption and no environmental pollution. In addition, the detoxified flaxseed retained the beneficial nutrients, lignans and fatty acids at the same level as untreated flaxseed, and this method could provide a new means of removing CGs from other edible plants, such as cassava, almond and sorghum by simultaneously expressing cyanide hydratase and β-glucosidase.
Wortmann, S; Rodenburg, R J T; Huizing, M; Loupatty, F J; de Koning, T; Kluijtmans, L A J; Engelke, U; Wevers, R; Smeitink, J A M; Morava, E
2006-05-01
In this paper, we describe a distinct clinical subtype of 3-methylglutaconic aciduria. 3-Methylglutaconic aciduria is a group of different metabolic disorders biochemically characterized by increased urinary excretion of 3-methylglutaconic acid. We performed biochemical and genetic investigations, including urine organic acid analysis, NMR spectroscopy, measurement of 3-methylglutaconyl-CoA hydratase activity, cardiolipin levels, OPA3 gene analysis and measurement of the oxidative phosphorylation in four female patients with 3-methylglutaconic aciduria. 3-Methylglutaconic aciduria type I, Barth syndrome, and Costeff syndrome were excluded as the activity of 3-methylglutaconyl-CoA hydratase, the cardiolipin levels, and molecular analysis of the OPA3 gene, respectively, showed no abnormalities. The children presented with characteristic association of hearing loss and the neuro-radiological evidence of Leigh disease. They also had neonatal hypotonia, recurrent lactic acidemia, episodes with hypoglycemia and severe recurrent infections, feeding difficulties, failure to thrive, developmental delay, and progressive spasticity with extrapyramidal symptoms. Our patients were further biochemically characterized by a mitochondrial dysfunction and persistent urinary excretion of 3-methylglutaconic acid.
Study of the Glutaminase Inhibitor CB-839 in Solid Tumors
2016-08-18
Solid Tumors; Triple-Negative Breast Cancer; Non Small Cell Lung Cancer; Renal Cell Carcinoma; Mesothelioma; Fumarate Hydratase (FH)-Deficient Tumors; Succinate Dehydrogenase (SDH)-Deficient Gastrointestinal Stromal Tumors (GIST); Succinate Dehydrogenase (SDH)-Deficient Non-gastrointestinal Stromal Tumors; Tumors Harboring Isocitrate Dehydrogenase-1 (IDH1) and IDH2 Mutations; Tumors Harboring Amplifications in the cMyc Gene
Qin, Y M; Marttila, M S; Haapalainen, A M; Siivari, K M; Glumoff, T; Hiltunen, J K
1999-10-01
The yeast peroxisomal (3R)-hydroxyacyl-CoA dehydrogenase/2-enoyl-CoA hydratase 2 (multifunctional enzyme type 2; MFE-2) has two N-terminal domains belonging to the short chain alcohol dehydrogenase/reductase superfamily. To investigate the physiological roles of these domains, here called A and B, Saccharomyces cerevisiae fox-2 cells (devoid of Sc MFE-2) were taken as a model system. Gly(16) and Gly(329) of the S. cerevisiae A and B domains, corresponding to Gly(16), which is mutated in the human MFE-2 deficiency, were mutated to serine and cloned into the yeast expression plasmid pYE352. In oleic acid medium, fox-2 cells transformed with pYE352:: ScMFE-2(aDelta) and pYE352::ScMFE-2(bDelta) grew slower than cells transformed with pYE352::ScMFE-2, whereas cells transformed with pYE352::ScMFE-2(aDeltabDelta) failed to grow. Candida tropicalis MFE-2 with a deleted hydratase 2 domain (Ct MFE- 2(h2Delta)) and mutational variants of the A and B domains (Ct MFE- 2(h2DeltaaDelta), Ct MFE- 2(h2DeltabDelta), and Ct MFE- 2(h2DeltaaDeltabDelta)) were overexpressed and characterized. All proteins were dimers with similar secondary structure elements. Both wild type domains were enzymatically active, with the B domain showing the highest activity with short chain and the A domain with medium and long chain (3R)-hydroxyacyl-CoA substrates. The data show that the dehydrogenase domains of yeast MFE-2 have different substrate specificities required to allow the yeast to propagate optimally on fatty acids as the carbon source.
Prediction of distal residue participation in enzyme catalysis.
Brodkin, Heather R; DeLateur, Nicholas A; Somarowthu, Srinivas; Mills, Caitlyn L; Novak, Walter R; Beuning, Penny J; Ringe, Dagmar; Ondrechen, Mary Jo
2015-05-01
A scoring method for the prediction of catalytically important residues in enzyme structures is presented and used to examine the participation of distal residues in enzyme catalysis. Scores are based on the Partial Order Optimum Likelihood (POOL) machine learning method, using computed electrostatic properties, surface geometric features, and information obtained from the phylogenetic tree as input features. Predictions of distal residue participation in catalysis are compared with experimental kinetics data from the literature on variants of the featured enzymes; some additional kinetics measurements are reported for variants of Pseudomonas putida nitrile hydratase (ppNH) and for Escherichia coli alkaline phosphatase (AP). The multilayer active sites of P. putida nitrile hydratase and of human phosphoglucose isomerase are predicted by the POOL log ZP scores, as is the single-layer active site of P. putida ketosteroid isomerase. The log ZP score cutoff utilized here results in over-prediction of distal residue involvement in E. coli alkaline phosphatase. While fewer experimental data points are available for P. putida mandelate racemase and for human carbonic anhydrase II, the POOL log ZP scores properly predict the previously reported participation of distal residues. 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen
2011-01-01
Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.
Boros, László G; D'Agostino, Dominic P; Katz, Howard E; Roth, Justine P; Meuillet, Emmanuelle J; Somlyai, Gábor
2016-02-01
The naturally occurring isotope of hydrogen ((1)H), deuterium ((2)H), could have an important biological role. Deuterium depleted water delays tumor progression in mice, dogs, cats and humans. Hydratase enzymes of the tricarboxylic acid (TCA) cycle control cell growth and deplete deuterium from redox cofactors, fatty acids and DNA, which undergo hydride ion and hydrogen atom transfer reactions. A model is proposed that emphasizes the terminal complex of mitochondrial electron transport chain reducing molecular oxygen to deuterium depleted water (DDW); this affects gluconeogenesis as well as fatty acid oxidation. In the former, the DDW is thought to diminish the deuteration of sugar-phosphates in the DNA backbone, helping to preserve stability of hydrogen bond networks, possibly protecting against aneuploidy and resisting strand breaks, occurring upon exposure to radiation and certain anticancer chemotherapeutics. DDW is proposed here to link cancer prevention and treatment using natural ketogenic diets, low deuterium drinking water, as well as DDW production as the mitochondrial downstream mechanism of targeted anti-cancer drugs such as Avastin and Glivec. The role of (2)H in biology is a potential missing link to the elusive cancer puzzle seemingly correlated with cancer epidemiology in western populations as a result of excessive (2)H loading from processed carbohydrate intake in place of natural fat consumption. Published by Elsevier Ltd.
Phylogenomic reconstruction of archaeal fatty acid metabolism
Dibrova, Daria V.; Galperin, Michael Y.; Mulkidjanian, Armen Y.
2014-01-01
While certain archaea appear to synthesize and/or metabolize fatty acids, the respective pathways still remain obscure. By analyzing the genomic distribution of the key lipid-related enzymes, we were able to identify the likely components of the archaeal pathway of fatty acid metabolism, namely, a combination of the enzymes of bacterial-type β-oxidation of fatty acids (acyl-CoA-dehydrogenase, enoyl-CoA hydratase, and 3-hydroxyacyl-CoA dehydrogenase) with paralogs of the archaeal acetyl-CoA C-acetyltransferase, an enzyme of the mevalonate biosynthesis pathway. These three β-oxidation enzymes working in the reverse direction could potentially catalyze biosynthesis of fatty acids, with paralogs of acetyl-CoA C-acetyltransferase performing addition of C2 fragments. The presence in archaea of the genes for energy-transducing membrane enzyme complexes, such as cytochrome bc complex, cytochrome c oxidase, and diverse rhodopsins, was found to correlate with the presence of the proposed system of fatty acid biosynthesis. We speculate that because these membrane complexes functionally depend on fatty acid chains, their genes could have been acquired via lateral gene transfer from bacteria only by those archaea that already possessed a system of fatty acid biosynthesis. The proposed pathway of archaeal fatty acid metabolism operates in extreme conditions and therefore might be of interest in the context of biofuel production and other industrial applications. PMID:24818264
Kawashima, Yui; Cheng, Wen; Mifune, Jun; Orita, Izumi; Nakamura, Satoshi
2012-01-01
A genome survey of polyhydroxyalkanoate (PHA)-producing Ralstonia eutropha H16 detected the presence of 16 orthologs of R-specific enoyl coenzyme A (enoyl-CoA) hydratase, among which three proteins shared high homologies with the enzyme specific to enoyl-CoAs of medium chain length encoded by phaJ4 from Pseudomonas aeruginosa (phaJ4Pa). The recombinant forms of the three proteins, termed PhaJ4aRe to PhaJ4cRe, actually showed enoyl-CoA hydratase activity with R specificity, and the catalytic efficiencies were elevated as the substrate chain length increased from C4 to C8. PhaJ4aRe and PhaJ4bRe showed >10-fold-higher catalytic efficiency than PhaJ4cRe. The functions of the new PhaJ4 proteins were investigated using previously engineered R. eutropha strains as host strains; these strains are capable of synthesizing poly((R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate) [P(3HB-co-3HHx)] from soybean oil. Deletion of phaJ4aRe from the chromosome resulted in significant decrease of 3HHx composition in the accumulated copolyester, whereas no change was observed with deletion of phaJ4bRe or phaJ4cRe, indicating that only PhaJ4aRe was one of the major enzymes supplying the (R)-3HHx-CoA monomer through β-oxidation. Introduction of phaJ4aRe or phaJ4bRe into the R. eutropha strains using a broad-host-range vector enhanced the 3HHx composition of the copolyesters, but the introduction of phaJ4cRe did not. The two genes were then inserted into the pha operon on chromosome 1 of the engineered R. eutropha by homologous recombination. These modifications enabled the biosynthesis of P(3HB-co-3HHx) composed of a larger 3HHx fraction without a negative impact on cell growth and PHA production on soybean oil, especially when phaJ4aRe or phaJ4bRe was tandemly introduced with phaJAc from Aeromonas caviae. PMID:22081565
Westover, J B; Goodman, S I; Frerman, F E
2001-11-20
Glutaconyl-coenzyme A (CoA) is the presumed enzyme-bound intermediate in the oxidative decarboxylation of glutaryl-CoA that is catalyzed by glutaryl-CoA dehydrogenase. We demonstrated glutaconyl-CoA bound to glutaryl-CoA dehydrogenase after anaerobic reduction of the dehydrogenase with glutaryl-CoA. Glutaryl-CoA dehydrogenase also has intrinsic enoyl-CoA hydratase activity, a property of other members of the acyl-CoA dehydrogenase family. The enzyme rapidly hydrates glutaconyl-CoA at pH 7.6 with a k(cat) of 2.7 s(-1). The k(cat) in the overall oxidation-decarboxylation reaction at pH 7.6 is about 9 s(-1). The binding of glutaconyl-CoA was quantitatively assessed from the K(m) in the hydratase reaction, 3 microM, and the K(i), 1.0 microM, as a competitive inhibitor of the dehydrogenase. These values compare with K(m) and K(i) of 4.0 and 12.9 microM, respectively, for crotonyl-CoA. Glu370 is the general base catalyst in the dehydrogenase that abstracts an alpha-proton of the substrate to initiate the catalytic pathway. The mutant dehydrogenase, Glu370Gln, is inactive in the dehydrogenation and the hydratase reactions. However, this mutant dehydrogenase decarboxylates glutaconyl-CoA to crotonyl-CoA without oxidation-reduction reactions of the dehydrogenase flavin. Addition of glutaconyl-CoA to this mutant dehydrogenase results in a rapid, transient increase in long-wavelength absorbance (lambda(max) approximately 725 nm), and crotonyl-CoA is found as the sole product. We propose that this 725 nm-absorbing species is the delocalized crotonyl-CoA anion that follows decarboxylation and that the decay is the result of slow protonation of the anion in the absence of the general acid catalyst, Glu370(H(+)). In the absence of detectable oxidation-reduction, the data indicate that oxidation-reduction of the dehydrogenase flavin is not essential for decarboxylation of glutaconyl-CoA.
Llamas-Velasco, Mar; Requena, Luis; Adam, Julie; Frizzell, Norma; Hartmann, Arndt; Mentzel, Thomas
2016-12-01
Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is an autosomal dominant disorder caused by heterozygotic germline mutations in fumarate hydratase (FH) with incomplete penetrance, and clinically challenging to diagnose. Immunohistochemical stainings may favor an earlier diagnosis. The authors have tested 31 smooth muscle neoplasms. Ten of the 13 lesions from patients with HLRCC syndrome showed negative FH staining. Most sporadic piloleiomyomas presented strongly positive FH staining although 5 cases were negative. Sensitivity of FH staining in our series is 83.3% but specificity is 75%. Anti-S-(2-succino)-cysteine (2SC) showed the opposite intensity staining pattern and showed great correlation with anti-FH (rho spearman = -0.797). Anti-2SC staining increased the diagnostic accuracy in 19% of the cases. The main limitation of this study is the lack additional clinical data to further classify the cases as the case inclusion was histopathological. Negative FH staining could indicate a high risk of HLRCC but it could also suggest the presence of a syndrome in up to 25% of sporadic cases. Thus, when there is a doubtful case, anti-2SC may be added to exclude the syndrome if a negative staining is found.
Serafín-López, J.; Talavera-Paulin, M.; Amador-Molina, J. C.; Alvarado-Riverón, M.; Vilchis-Landeros, M. M.; Méndez-Ortega, P.; Fafutis-Morris, M.; Paredes-Cervantes, V.; López-Santiago, R.; León, C. I.; Guerrero, M. I.; Ribas-Aparicio, R. M.; Mendoza-Hernández, G.; Carreño-Martínez, C.; Estrada-Parra, S.; Estrada-García, I.
2011-01-01
Leprosy is an infectious disease caused by Mycobacterium leprae, which is a noncultivable bacterium. One of the principal goals of leprosy research is to develop serological tests that will allow identification and early treatment of leprosy patients. M. habana is a cultivable nonpathogenic mycobacterium and candidate vaccine for leprosy, and several antigens that cross-react between M. leprae and M. habana have been discovered. The aim of the present study was to extend the identification of cross-reactive antigens by identifying M. habana proteins that reacted by immunoblotting with antibodies in serum samples from leprosy patients but not with antibodies in sera from tuberculosis (TB) patients or healthy donors (HDs). A 28-kDa antigen that specifically reacted with sera from leprosy patients was identified. To further characterize this antigen, protein spots were aligned in two-dimensional polyacrylamide gels and Western blots. Spots cut out from the gels were then analyzed by mass spectrometry. Two proteins were identified: enoyl-coenzyme A hydratase (lipid metabolism; ML2498) and antigen 85B (Ag85B; mycolyltransferase; ML2028). These proteins represent promising candidates for the design of a reliable tool for the serodiagnosis of lepromatous leprosy, which is the most frequent form in Mexico. PMID:21613461
Martínková, Ludmila; Veselá, Alicja Barbara; Rinágelová, Anna; Chmátal, Martin
2015-11-01
The purpose of this study is to summarize the current knowledge of the enzymes which are involved in the hydrolysis of cyanide, i.e., cyanide hydratases (CHTs; EC 4.2.1.66) and cyanide dihydratases (CynD; EC 3.5.5.1). CHTs are probably exclusively produced by filamentous fungi and widely occur in these organisms; in contrast, CynDs were only found in a few bacterial genera. CHTs differ from CynDs in their reaction products (formamide vs. formic acid and ammonia, respectively). Several CHTs were also found to transform nitriles but with lower relative activities compared to HCN. Mutants of CynDs and CHTs were constructed to study the structure-activity relationships in these enzymes or to improve their catalytic properties. The effect of the C-terminal part of the protein on the enzyme activity was determined by constructing the corresponding deletion mutants. CynDs are less active at alkaline pH than CHTs. To improve its bioremediation potential, CynD from Bacillus pumilus was engineered by directed evolution combined with site-directed mutagenesis, and its operation at pH 10 was thus enabled. Some of the enzymes have been tested for their potential to eliminate cyanide from cyanide-containing wastewaters. CynDs were also used to construct cyanide biosensors.
Arakawa, Takatoshi; Kawano, Yoshiaki; Kataoka, Shingo; Katayama, Yoko; Kamiya, Nobuo; Yohda, Masafumi; Odaka, Masafumi
2007-03-09
Thiocyanate hydrolase (SCNase) of Thiobacillus thioparus THI115 is a cobalt(III)-containing enzyme catalyzing the degradation of thiocyanate to carbonyl sulfide and ammonia. We determined the crystal structures of the apo- and native SCNases at a resolution of 2.0 A. SCNases in both forms had a conserved hetero-dodecameric structure, (alphabetagamma)(4). Four alphabetagamma hetero-trimers were structurally equivalent. One alphabetagamma hetero-trimer was composed of the core domain and the betaN domain, which was located at the center of the molecule and linked the hetero-trimers with novel quaternary interfaces. In both the apo- and native SCNases, the core domain was structurally conserved between those of iron and cobalt-types of nitrile hydratase (NHase). Native SCNase possessed the post-translationally modified cysteine ligands, gammaCys131-SO(2)H and gammaCys133-SOH like NHases. However, the low-spin cobalt(III) was found to be in the distorted square-pyramidal geometry, which had not been reported before in any protein. The size as well as the electrostatic properties of the substrate-binding pocket was totally different from NHases with respect to the charge distribution and the substrate accessibility, which rationally explains the differences in the substrate preference between SCNase and NHase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pfleger, Brian F.; Youngquist, Tyler J.
Recombinant cells and methods for improved yield of fatty alcohols. The recombinant cells harbor a recombinant thioesterase gene, a recombinant acyl-CoA synthetase gene, and a recombinant acyl-CoA reductase gene. In addition, a gene product from one or more of an acyl-CoA dehydrogenase gene, an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase gene, and a 3-ketoacyl-CoA thiolase gene in the recombinant cells is functionally deleted. Culturing the recombinant cells produces fatty alcohols at high yields.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoefler, G.; Forstner, M.; Hulla, W.
1994-01-01
Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Boll, Matthias; Einsle, Oliver; Ermler, Ulrich; Kroneck, Peter M H; Ullmann, G Matthias
2016-01-01
In biology, tungsten (W) is exclusively found in microbial enzymes bound to a bis-pyranopterin cofactor (bis-WPT). Previously known W enzymes catalyze redox oxo/hydroxyl transfer reactions by directly coordinating their substrates or products to the metal. They comprise the W-containing formate/formylmethanofuran dehydrogenases belonging to the dimethyl sulfoxide reductase (DMSOR) family and the aldehyde:ferredoxin oxidoreductase (AOR) families, which form a separate enzyme family within the Mo/W enzymes. In the last decade, initial insights into the structure and function of two unprecedented W enzymes were obtained: the acetaldehyde forming acetylene hydratase (ACH) belongs to the DMSOR and the class II benzoyl-coenzyme A (CoA) reductase (BCR) to the AOR family. The latter catalyzes the reductive dearomatization of benzoyl-CoA to a cyclic diene. Both are key enzymes in the degradation of acetylene (ACH) or aromatic compounds (BCR) in strictly anaerobic bacteria. They are unusual in either catalyzing a nonredox reaction (ACH) or a redox reaction without coordinating the substrate or product to the metal (BCR). In organic chemical synthesis, analogous reactions require totally nonphysiological conditions depending on Hg2+ (acetylene hydration) or alkali metals (benzene ring reduction). The structural insights obtained pave the way for biological or biomimetic approaches to basic reactions in organic chemistry. © 2016 S. Karger AG, Basel.
Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P
1992-01-01
Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166
Enoyl-CoA hydratase mediates polyhydroxyalkanoate mobilization in Haloferax mediterranei
Liu, Guiming; Cai, Shuangfeng; Hou, Jing; Zhao, Dahe; Han, Jing; Zhou, Jian; Xiang, Hua
2016-01-01
Although polyhydroxyalkanoate (PHA) accumulation and mobilization are one of the most general mechanisms for haloarchaea to adapt to the hypersaline environments with changeable carbon sources, the PHA mobilization pathways are still not clear for any haloarchaea. In this study, the functions of five putative (R)-specific enoyl-CoA hydratases (R-ECHs) in Haloferax mediterranei, named PhaJ1 to PhaJ5, respectively, were thoroughly investigated. Through gene deletion and complementation, we demonstrated that only certain of these ECHs had a slight contribution to poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) biosynthesis. But significantly, PhaJ1, the only R-ECH that is associated with PHA granules, was shown to be involved in PHA mobilization in this haloarchaeon. PhaJ1 catalyzes the dehydration of (R)-3-hydroxyacyl-CoA, the common product of PHA degradation, to enoyl-CoA, the intermediate of the β-oxidation cycle, thus could link PHA mobilization to β-oxidation pathway in H. mediterranei. This linkage was further indicated from the up-regulation of the key genes of β-oxidation under the PHA mobilization condition, as well as the obvious inhibition of PHA degradation upon inhibition of the β-oxidation pathway. Interestingly, 96% of phaJ-containing haloarchaeal species possess both phaC (encoding PHA synthase) and the full set genes of β-oxidation, implying that the mobilization of carbon storage in PHA through the β-oxidation cycle would be general in haloarchaea. PMID:27052994
Enoyl-CoA hydratase mediates polyhydroxyalkanoate mobilization in Haloferax mediterranei.
Liu, Guiming; Cai, Shuangfeng; Hou, Jing; Zhao, Dahe; Han, Jing; Zhou, Jian; Xiang, Hua
2016-04-07
Although polyhydroxyalkanoate (PHA) accumulation and mobilization are one of the most general mechanisms for haloarchaea to adapt to the hypersaline environments with changeable carbon sources, the PHA mobilization pathways are still not clear for any haloarchaea. In this study, the functions of five putative (R)-specific enoyl-CoA hydratases (R-ECHs) in Haloferax mediterranei, named PhaJ1 to PhaJ5, respectively, were thoroughly investigated. Through gene deletion and complementation, we demonstrated that only certain of these ECHs had a slight contribution to poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) biosynthesis. But significantly, PhaJ1, the only R-ECH that is associated with PHA granules, was shown to be involved in PHA mobilization in this haloarchaeon. PhaJ1 catalyzes the dehydration of (R)-3-hydroxyacyl-CoA, the common product of PHA degradation, to enoyl-CoA, the intermediate of the β-oxidation cycle, thus could link PHA mobilization to β-oxidation pathway in H. mediterranei. This linkage was further indicated from the up-regulation of the key genes of β-oxidation under the PHA mobilization condition, as well as the obvious inhibition of PHA degradation upon inhibition of the β-oxidation pathway. Interestingly, 96% of phaJ-containing haloarchaeal species possess both phaC (encoding PHA synthase) and the full set genes of β-oxidation, implying that the mobilization of carbon storage in PHA through the β-oxidation cycle would be general in haloarchaea.
Takeuchi, M; Kishino, S; Park, S-B; Hirata, A; Kitamura, N; Saika, A; Ogawa, J
2016-05-01
This study aims to produce hydroxy fatty acids efficiently. Escherichia coli overexpressing linoleic acid Δ9 hydratase from Lactobacillus plantarum AKU 1009a was employed to produce hydroxy fatty acids with industrial potential. We found that 280 g l(-1) of linoleic acid (1 mol l(-1)) was converted into (S)-10-hydoxy-cis-12-octadecenoic acid (HYA) with a high conversion rate of 98% (mol/mol) and more than 99·9% enantiomeric excess (e.e.) by recombinant E. coli cells in the presence of FAD and NADH. In the same way, many kinds of C18 unsaturated fatty acids with Δ9 carbon double bond (280 g l(-1)) were converted into corresponding 10-hydroxy fatty acids with the conversion rates over 95% (mol/mol). We also produced HYA at a high rate of accumulation (289 g l(-1) ) with a high yield (97 mol%) in a reaction mixture that contained glucose instead of NADH. We developed a process for producing several types of hydroxy fatty acids with high accumulation rates and high yields. Hydroxy fatty acids are important materials for the chemical, food, cosmetic and pharmaceutical industries, and thus they have recently attracted much interest in a variety of research fields. However, the mass production of hydroxy fatty acids has been limited. This method of hydroxy fatty acids production will facilitate the widespread application of hydroxy fatty acids in various industries. © 2016 The Society for Applied Microbiology.
Nagata, Reiko; Kawaji, Satoko; Mori, Yasuyuki
2013-10-01
Johne's disease (JD), caused by Mycobacterium avium subspecies paratuberculosis (MAP), remains difficult to control because of the lack of specific and sensitive diagnostic tests. In order to improve the specificity of sero-diagnosis for JD, the phage display library derived from genomic DNA of MAP was immunoscreened to identify novel antigenic targets. We selected a clone using antibodies from MAP experimentally infected cattle, and annotated its coding sequence as MAP1197 in the MAP genome, which encoded "echA12_2" in the MAP protein (Map-echA) belonging to Enoyl-CoA hydratase, known as a crotonase enzyme. The Map-echA was expressed in Esherichia coli and purified as a histidine-tag recombinant protein (rMap-echA), and the diagnostic potential of the protein was further evaluated by enzyme-linked immunosorbent assays (ELISA). Antibody responses to rMap-echA were higher in MAP-infected cattle than in uninfected cattle. The specificity of the Map-echA ELISA was also confirmed by evaluation with hyper-immune sera against various kinds of Mycobacterium species. Furthermore, in all experimentally infected cattle the antibody against rMap-echA was detected 2-7months earlier than by a commercially available ELISA kit. These results suggested that Map-echA can be used as a specific and sensitive serological diagnostic antigen for the detection of MAP infection. Copyright © 2013 Elsevier B.V. All rights reserved.
The aconitate hydratase family from Citrus
2010-01-01
Background Research on citrus fruit ripening has received considerable attention because of the importance of citrus fruits for the human diet. Organic acids are among the main determinants of taste and organoleptic quality of fruits and hence the control of fruit acidity loss has a strong economical relevance. In citrus, organic acids accumulate in the juice sac cells of developing fruits and are catabolized thereafter during ripening. Aconitase, that transforms citrate to isocitrate, is the first step of citric acid catabolism and a major component of the citrate utilization machinery. In this work, the citrus aconitase gene family was first characterized and a phylogenetic analysis was then carried out in order to understand the evolutionary history of this family in plants. Gene expression analyses of the citrus aconitase family were subsequently performed in several acidic and acidless genotypes to elucidate their involvement in acid homeostasis. Results Analysis of 460,000 citrus ESTs, followed by sequencing of complete cDNA clones, identified in citrus 3 transcription units coding for putatively active aconitate hydratase proteins, named as CcAco1, CcAco2 and CcAco3. A phylogenetic study carried on the Aco family in 14 plant species, shows the presence of 5 Aco subfamilies, and that the ancestor of monocot and dicot species shared at least one Aco gene. Real-time RT-PCR expression analyses of the three aconitase citrus genes were performed in pulp tissues along fruit development in acidic and acidless citrus varieties such as mandarins, oranges and lemons. While CcAco3 expression was always low, CcAco1 and CcAco2 genes were generally induced during the rapid phase of fruit growth along with the maximum in acidity and the beginning of the acid reduction. Two exceptions to this general pattern were found: 1) Clemenules mandarin failed inducing CcAco2 although acid levels were rapidly reduced; and 2) the acidless "Sucreña" orange showed unusually high levels of expression of both aconitases, an observation correlating with the acidless phenotype. However, in the acidless "Dulce" lemon aconitase expression was normal suggesting that the acidless trait in this variety is not dependent upon aconitases. Conclusions Phylogenetic studies showed the occurrence of five different subfamilies of aconitate hydratase in plants and sequence analyses indentified three active genes in citrus. The pattern of expression of two of these genes, CcAco1 and CcAco2, was normally associated with the timing of acid content reduction in most genotypes. Two exceptions to this general observation suggest the occurrence of additional regulatory steps of citrate homeostasis in citrus. PMID:20958971
Mercimek-Mahmutoglu, Saadet; Tucker, Tracy; Casey, Brett
2011-11-01
We describe two siblings with 3-methylglutaconic aciduria type I with phenotypic heterogeneity. The index case was a 14-year-old female with learning disability, attention deficit-hyperactivity and early onset subclinical leukoencephalopathy. Her 9-year-old brother had severe expressive speech delay and delay in speech sound development with normal cognitive functions. The diagnosis was confirmed by a demonstration of 3-methylglutaconyl-CoA hydratase enzyme deficiency in the cultured skin fibroblasts and homozygous deletion of exons 1-3 within the AUH gene. Copyright © 2011. Published by Elsevier Inc.
ECHS1 mutations cause combined respiratory chain deficiency resulting in Leigh syndrome.
Sakai, Chika; Yamaguchi, Seiji; Sasaki, Masayuki; Miyamoto, Yusaku; Matsushima, Yuichi; Goto, Yu-ichi
2015-02-01
The human ECHS1 gene encodes the short-chain enoyl coenzyme A hydratase, the enzyme that catalyzes the second step of β-oxidation of fatty acids in the mitochondrial matrix. We report on a boy with ECHS1 deficiency who was diagnosed with Leigh syndrome at 21 months of age. The patient presented with hypotonia, metabolic acidosis, and developmental delay. A combined respiratory chain deficiency was also observed. Targeted exome sequencing of 776 mitochondria-associated genes encoded by nuclear DNA identified compound heterozygous mutations in ECHS1. ECHS1 protein expression was severely depleted in the patient's skeletal muscle and patient-derived myoblasts; a marked decrease in enzyme activity was also evident in patient-derived myoblasts. Immortalized patient-derived myoblasts that expressed exogenous wild-type ECHS1 exhibited the recovery of the ECHS1 activity, indicating that the gene defect was pathogenic. Mitochondrial respiratory complex activity was also mostly restored in these cells, suggesting that there was an unidentified link between deficiency of ECHS1 and respiratory chain. Here, we describe the patient with ECHS1 deficiency; these findings will advance our understanding not only the pathology of mitochondrial fatty acid β-oxidation disorders, but also the regulation of mitochondrial metabolism. © 2014 WILEY PERIODICALS, INC.
Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L
2016-01-01
Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments. PMID:27676445
Acetylene hydratase: a non-redox enzyme with tungsten and iron-sulfur centers at the active site.
Kroneck, Peter M H
2016-03-01
In living systems, tungsten is exclusively found in microbial enzymes coordinated by the pyranopterin cofactor, with additional metal coordination provided by oxygen and/or sulfur, and/or selenium atoms in diverse arrangements. Prominent examples are formate dehydrogenase, formylmethanofuran dehydrogenase, and aldehyde oxidoreductase all of which catalyze redox reactions. The bacterial enzyme acetylene hydratase (AH) stands out of its class as it catalyzes the conversion of acetylene to acetaldehyde, clearly a non-redox reaction and a reaction distinct from the reduction of acetylene to ethylene by nitrogenase. AH harbors two pyranopterins bound to W, and a [4Fe-4S] cluster. W is coordinated by four dithiolene sulfur atoms, one cysteine sulfur, and one oxygen ligand. AH activity requires a strong reductant suggesting W(IV) as the active oxidation state. Two different types of reaction pathways have been proposed. The 1.26 Å structure reveals a water molecule coordinated to W which could gain a partially positive net charge by the adjacent protonated Asp-13, enabling a direct attack of C2H2. To access the W-Asp site, a substrate channel was evolved distant from where it is found in other members of the DMSOR family. Computational studies of this second shell mechanism led to unrealistically high energy barriers, and alternative pathways were proposed where C2H2 binds directly to W. The architecture of the catalytic cavity, the specificity for C2H2 and the results from site-directed mutagenesis do not support this first shell mechanism. More investigations including structural information on the binding of C2H2 are needed to present a conclusive answer.
NASA Astrophysics Data System (ADS)
Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand
Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing enzymes of yeasts.
XIE, WEI-DONG; WANG, HUA; ZHANG, JIN-FANG; LI, JIAN-NA; CAN, YI; QING, LV; KUNG, HSIANG-FU; ZHANG, YA-OU
2011-01-01
This study aimed to investigate the potential mechanisms of natural resistance to high-fat diet-induced obesity. Four-week-old C57BL/6 mice were fed a high-fat diet for 6 weeks and were then designated as high-fat diet-fed obesity-prone (HOP) and obesity-resistant (HOR) animals. Their blood biochemistry was evaluated, and visceral adipose tissue samples were subjected to proteomic, Western blot and quantitative real-time PCR (q-PCR) analyses. The HOR mice showed reduced visceral fat weight and size, as well as lowered serum lipid and leptin levels. Proteomic analysis showed that enoyl coenzyme A hydratase 1, peroxisomal (Ech1) expression was significantly increased in their visceral adipose tissues. Moreover, other proteins, such as α-tropomyosin, myosin light chain, urine-nucleoside phosphorylase and transgelin, were also significantly increased. Furthermore, q-PCR analysis showed that the expression of acyl-CoA oxidase 1 palmitoyl, enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase and 3-oxoacyl-CoA thiolase responsible for peroxisomal β-oxidation was also up-regulated in the visceral adipose tissues of the HOR mice. The expression of peroxisome proliferator-activated receptor α (PPARα) was increased in the HOR mice as shown by Western blot analysis. Obesity-resistant animals show enhanced peroxisomal β-oxidation metabolism and reduced fat accumulation in visceral adipose tissues by up-regulating the expression of Ech1, peroxisomal or other related peroxisomal β-oxidation marker genes, which may be driven or enhanced by the up-regulation of the expression of PPARα. However, further validation in future studies is required. PMID:22977503
Carbohydrates as efficient catalysts for the hydration of α-amino nitriles.
Chitale, Sampada; Derasp, Joshua S; Hussain, Bashir; Tanveer, Kashif; Beauchemin, André M
2016-11-01
Directed hydration of α-amino nitriles was achieved under mild conditions using simple carbohydrates as catalysts exploiting temporary intramolecularity. A broadly applicable procedure using both formaldehyde and NaOH as catalysts efficiently hydrated a variety of primary and secondary susbtrates, and allowed the hydration of enantiopure substrates to proceed without racemization. This work also provides a rare comparison of the catalytic activity of carbohydrates, and shows that the simple aldehydes at the basis of chemical evolution are efficient organocatalysts mimicking the function of hydratase enzymes. Optimal catalytic efficiency was observed with destabilized aldehydes, and with difficult substrates only simple carbohydrates such as formaldehyde and glycolaldehyde proved reliable.
Evidence for Formation of a Radical-Mediated Flavin-N5 Covalent Intermediate.
Dai, Yumin; Valentino, Hannah R; Sobrado, Pablo
2018-05-18
The redox-neutral reaction catalyzed by 2-haloacrylate hydratase (2-HAH) leads to the conversion of 2-chloroacrylate to pyruvate. Previous mechanistic studies demonstrated formation of a flavin-iminium ion as an important intermediate in the 2-HAH catalytic cycle. Time-resolved flavin absorbance studies were performed in this study and the data showed that the enzyme is capable of stabilizing both anionic and neutral flavin semiquinone species. The presence of a radical scavenger decreases the activity in a concentration-dependent manner. These data are consistent with the flavin iminium intermediate occurring via radical recombination. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fang, B; Zhang, M; Ge, K S; Xing, H Z; Ren, F Z
2018-06-01
Previous studies have demonstrated that the anti-tumor α-lactalbumin-oleic acid complex (α-LA-OA) may target the glycolysis of tumor cells. However, few data are available regarding the effects of α-LA-OA on energy metabolism. In this study, we measured glycolysis and mitochondrial functions in HeLa cells in response to α-LA-OA using the XF flux analyzer (Seahorse Bioscience, North Billerica, MA). The gene expression of enzymes involved in glycolysis, tricarboxylic acid cycle, electron transfer chain, and ATP synthesis were also evaluated. Our results show that α-LA-OA significantly enhanced the basal glycolysis and glycolytic capacity. Mitochondrial oxidative phosphorylation, including the basal respiration, maximal respiration, spare respiratory capacity and ATP production were also improved in response to α-LA-OA. The enhanced mitochondrial functions maybe partly due to the increased capacity of utilizing fatty acids and glutamine as the substrate. However, the gene expressions of pyruvate kinase M2, lactate dehydrogenase A, aconitate hydratase, and isocitrate dehydrogenase 1 were inhibited, suggesting an insufficient ability for the glycolysis process and the tricarboxylic acid cycle. The increased expression of acetyl-coenzyme A acyltransferase 2, a central enzyme involved in the β-oxidation of fatty acids, would enhance the unbalance due to the decreased expression of electron transfer flavoprotein β subunit, which acts as the electron acceptor. These results indicated that α-LA-OA may induce oxidative stress due to conditions in which the ATP production is exceeding the energy demand. Our results may help clarify the mechanism of apoptosis induced by reactive oxygen species and mitochondrial destruction. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Peng, Mengling; Han, Jing; Li, Longlong; Ma, Haitian
2016-01-01
(-)-Hydroxycitric acid (HCA) suppresses fatty acid synthesis in animals, but its biochemical mechanism in poultry is unclear. This study identified the key proteins associated with fat metabolism and elucidated the biochemical mechanism of (-)-HCA in broiler chickens. Four groups (n = 30 each) received a diet supplemented with 0, 1000, 2000 or 3000 mg/kg (-)-HCA for 4 weeks. Of the differentially expressed liver proteins, 40 and 26 were identified in the mitochondrial and cytoplasm respectively. Pyruvate dehydrogenase E1 components (PDHA1 and PDHB), dihydrolipoyl dehydrogenase (DLD), aconitase (ACO2), a-ketoglutarate dehydrogenase complex (DLST), enoyl-CoA hydratase (ECHS1) and phosphoglycerate kinase (PGK) were upregulated, while NADP-dependent malic enzyme (ME1) was downregulated. Biological network analysis showed that the identified proteins were involved in glycometabolism and lipid metabolism, whereas PDHA1, PDHB, ECHS1, and ME1 were identified in the canonical pathway by Ingenuity Pathway Analysis. The data indicated that (-)-HCA inhibited fatty acid synthesis by reducing the acetyl-CoA supply, via promotion of the tricarboxylic acid cycle (upregulation of PDHA1, PDHB, ACO2, and DLST expression) and inhibition of ME1 expression. Moreover, (-)-HCA promoted fatty acid beta-oxidation by upregulating ECHS1 expression. These results reflect a biochemically relevant mechanism of fat reduction by (-)-HCA in broiler chickens. PMID:27586962
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Teng, Chih-Chuan; Chronic Diseases and Health Promotion Research Center, CGUST, Taiwan; Institute of Basic Medicine Science, National Cheng Kung University, Tainan, Taiwan
CIL-102 (1-[4-(furo[2,3-b]quinolin-4-ylamino)phenyl]ethanone), the major active agent of the alkaloid derivative, has been demonstrated to exert anticancer effects. Herein, we present an investigation focused on the identification of the target(s) of CIL-102's action and the mechanism of its action in apoptotic and anti-invasive pathways. Proteomic approaches were used to purify and identify the protein substrates using 2D difference gel electrophoresis (2D SDS-PAGE) to assess changes in the expression of relevant protein treatment with CIL-102 that resulted in the inhibition of viability and invasion. Our results demonstrate that CIL-102 treatment of U87 cells decreased cell proliferation and invasiveness. CIL-102 dose-dependent induction ofmore » apoptosis and inhibitory invasiveness were accompanied by sustained phosphorylation of JNK1/2 and p70S6K as well as generation of the reactive oxygen species. In addition, differential proteins displayed between CIL-102-treated and untreated U87 were determined and validated. There were 11 differentially expressed proteins between the CIL-102-treated and untreated groups. Furthermore, we demonstrated that CIL-102 inhibited cancer cell proliferation and reduced anti-invasion properties by up-regulating the levels of FUMH (Fumarate hydratase). The investigation demonstrated that there was an increase in the cellular levels of FUMH in the CIL-102 reduction in viability and invasion via the activation of JNK1/2 and mTOR signaling modules. NAC administration and shRNA FUMH conferred resistance to CIL-102-inhibited HIF1α and MMP-2 levels via inhibition of JNK1/2 and mTOR activation. We concluded that CIL-102-induced an apoptosis cascade and decreased aggressiveness in astrocytoma cells by modulation of mitochondria function, providing a new mechanism for CIL-102 treatment. - Highlights: • We found the effect of CIL-102 on neuroblastoma cells. • Fumarate hydratase as a CIL-102's target by proteomic differential displays. • CIL-102 regulated-FUMH stimulates apoptosis-related protein and inactivation HIF1.« less
Acute high-altitude hypoxic brain injury: Identification of ten differential proteins
Li, Jianyu; Qi, Yuting; Liu, Hui; Cui, Ying; Zhang, Li; Gong, Haiying; Li, Yaxiao; Li, Lingzhi; Zhang, Yongliang
2013-01-01
Hypobaric hypoxia can cause severe brain damage and mitochondrial dysfunction, and is involved in hypoxic brain injury. However, little is currently known about the mechanisms responsible for mitochondrial dysfunction in hypobaric hypoxic brain damage. In this study, a rat model of hypobaric hypoxic brain injury was established to investigate the molecular mechanisms associated with mitochondrial dysfunction. As revealed by two-dimensional electrophoresis analysis, 16, 21, and 36 differential protein spots in cerebral mitochondria were observed at 6, 12, and 24 hours post-hypobaric hypoxia, respectively. Furthermore, ten protein spots selected from each hypobaric hypoxia subgroup were similarly regulated and were identified by mass spectrometry. These detected proteins included dihydropyrimidinase-related protein 2, creatine kinase B-type, isovaleryl-CoA dehydrogenase, elongation factor Ts, ATP synthase beta-subunit, 3-mercaptopyruvate sulfurtransferase, electron transfer flavoprotein alpha-subunit, Chain A of 2-enoyl-CoA hydratase, NADH dehydrogenase iron-sulfur protein 8 and tropomyosin beta chain. These ten proteins are all involved in the electron transport chain and the function of ATP synthase. Our findings indicate that hypobaric hypoxia can induce the differential expression of several cerebral mitochondrial proteins, which are involved in the regulation of mitochondrial energy production. PMID:25206614
Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru
2014-01-01
We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603
Schaefer, Inga-Marie; Hornick, Jason L; Bovée, Judith V M G
2018-04-01
The discovery of mutations in genes encoding the metabolic enzymes isocitrate dehydrogenase (IDH), succinate dehydrogenase (SDH), and fumarate hydratase (FH) has expanded our understanding not only of altered metabolic pathways but also epigenetic dysregulation in cancer. IDH1/2 mutations occur in enchondromas and chondrosarcomas in patients with the non-hereditary enchondromatosis syndromes Ollier disease and Maffucci syndrome and in sporadic tumors. IDH1/2 mutations result in excess production of the oncometabolite (D)-2-hydroxyglutarate. In contrast, SDH and FH act as tumor suppressors and genomic inactivation results in succinate and fumarate accumulation, respectively. SDH deficiency may result from germline SDHA, SDHB, SDHC, or SDHD mutations and is found in autosomal-dominant familial paraganglioma/pheochromocytoma and Carney-Stratakis syndrome, describing the combination of paraganglioma and gastrointestinal stromal tumor (GIST). In contrast, patients with the non-hereditary Carney triad, including paraganglioma, GIST, and pulmonary chondroma, usually lack germline SDH mutations and instead show epigenetic SDH complex inactivation through SDHC promoter methylation. Inactivating FH germline mutations are found in patients with hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome comprising benign cutaneous/uterine leiomyomas and renal cell carcinoma. Mutant IDH, SDH, and FH share common inhibition of α-ketoglutarate-dependent oxygenases such as the TET family of 5-methylcytosine hydroxylases preventing DNA demethylation, and Jumonji domain histone demethylases increasing histone methylation, which together inhibit cell differentiation. Ongoing studies aim to better characterize these complex alterations in cancer, the different clinical phenotypes, and variable penetrance of inherited and sporadic cancer predisposition syndromes. A better understanding of the roles of metabolic enzymes in cancer may foster the development of therapies that specifically target functional alterations in tumor cells in the future. Here, the physiologic functions of these metabolic enzymes, the mutational spectrum, and associated functional alterations will be discussed, with a focus on mesenchymal tumor predisposition syndromes.
A novel MVA-mediated pathway for isoprene production in engineered E. coli.
Yang, Jianming; Nie, Qingjuan; Liu, Hui; Xian, Mo; Liu, Huizhou
2016-01-20
To deal with the increasingly severe energy crisis and environmental consequences, biofuels and biochemicals generated from renewable resources could serve as a promising alternative for replacing petroleum as a source of fuel and chemicals, among which isoprene (2-methyl-1,3-butadiene) in particular is of great significance in that it is an important platform chemical, which has been used in industrial production of synthetic rubber for tires and coatings or aviation fuel. We firstly introduced fatty acid decarboxylase (OleTJE) from Jeotgalicoccus species into E. coli to directly convert MVA(mevalonate) into 3-methy-3-buten-1-ol. And then to transform 3-methy-3-buten-1-ol to isoprene, oleate hydratase (OhyAEM) from Elizabethkingia meningoseptica was overexpressed in E. coli. A novel biosynthetic pathway of isoprene in E. coli was established by co-expressing the heterologous mvaE gene encoding acetyl-CoA acetyltransferase/HMG-CoA reductase and mvaS gene encoding HMG-CoA synthase from Enterococcus faecalis, fatty acid decarboxylase (OleTJE) and oleate hydratase (OhyAEM). Furthermore, to enhance isoprene production, a further optimization of expression level of OleTJE, OhyAEM was carried out by using different promoters and copy numbers of plasmids. Thereafter, the fermentation process was also optimized to improve the production of isoprene. The final engineered strain, YJM33, bearing the innovative biosynthetic pathway of isoprene, was found to produce isoprene up to 2.2 mg/L and 620 mg/L under flask and fed-batch fermentation conditions, respectively. In this study, by using metabolic engineering techniques, the novel MVA-mediated biosynthetic pathway of isoprene was successfully assembled in E. coli BL21(DE3) with the heterologous MVA upper pathway, OleTJE from Jeotgalicoccus species and OhyAEM from Elizabethkingia meningoseptica. Compared with traditional MVA pathway, the novel pathway is shortened by 3 steps. In addition, this is the first report on the reaction of converting MVA into 3-methy-3-buten-1-ol by fatty acid decarboxylase (OleTJE) from Jeotgalicoccus species. In brief, this study provided an alternative method for isoprene biosynthesis, which is largely different from the well-developed MEP pathway or MVA pathway.
Ohe, Chisato; Smith, Steven C; Sirohi, Deepika; Divatia, Mukul; de Peralta-Venturina, Mariza; Paner, Gladell P; Agaimy, Abbas; Amin, Mitual B; Argani, Pedram; Chen, Ying-Bei; Cheng, Liang; Colecchia, Maurizio; Compérat, Eva; Werneck da Cunha, Isabela; Epstein, Jonathan I; Gill, Anthony J; Hes, Ondřej; Hirsch, Michelle S; Jochum, Wolfram; Kunju, Lakshmi P; Maclean, Fiona; Magi-Galluzzi, Cristina; McKenney, Jesse K; Mehra, Rohit; Nesi, Gabriella; Osunkoya, Adeboye O; Picken, Maria M; Rao, Priya; Reuter, Victor E; de Oliveira Salles, Paulo Guilherme; Schultz, Luciana; Tickoo, Satish K; Tomlins, Scott A; Trpkov, Kiril; Amin, Mahul B
2018-03-01
Renal medullary carcinomas (RMCs) and collecting duct carcinomas (CDCs) are rare subsets of lethal high-stage, high-grade distal nephron-related adenocarcinomas with a predilection for the renal medullary region. Recent findings have established an emerging group of fumarate hydratase (FH)-deficient tumors related to hereditary leiomyomatosis and renal cell carcinoma (HLRCC-RCCs) syndrome within this morphologic spectrum. Recently developed, reliable ancillary testing has enabled consistent separation between these tumor types. Here, we present the clinicopathologic features and differences in the morphologic patterns between RMC, CDC, and FH-deficient RCC in consequence of these recent developments. This study included a total of 100 cases classified using contemporary criteria and ancillary tests. Thirty-three RMCs (SMARCB1/INI1-deficient, hemoglobinopathy), 38 CDCs (SMARCB1/INI1-retained), and 29 RCCs defined by the FH-deficient phenotype (FH/2SC or FH/2SC with FH mutation, regardless of HLRCC syndromic stigmata/history) were selected. The spectrum of morphologic patterns was critically evaluated, and the differences between the morphologic patterns present in the 3 groups were analyzed statistically. Twenty-five percent of cases initially diagnosed as CDC were reclassified as FH-deficient RCC on the basis of our contemporary diagnostic approach. Among the different overlapping morphologic patterns, sieve-like/cribriform and reticular/yolk sac tumor-like patterns favored RMCs, whereas intracystic papillary and tubulocystic patterns favored FH-deficient RCC. The tubulopapillary pattern favored both CDCs and FH-deficient RCCs, and the multinodular infiltrating papillary pattern favored CDCs. Infiltrating glandular and solid sheets/cords/nested patterns were not statistically different among the 3 groups. Viral inclusion-like macronucleoli, considered as a hallmark of HLRCC-RCCs, were observed significantly more frequently in FH-deficient RCCs. Despite the overlapping morphology found among these clinically aggressive infiltrating high-grade adenocarcinomas of the kidney, reproducible differences in morphology emerged between these categories after rigorous characterization. Finally, we recommend that definitive diagnosis of CDC should only be made if RMC and FH-deficient RCC are excluded.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hawkins, AB; Adams, MWW; Kelly, RM
2014-03-25
The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73 degrees C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cyclemore » and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA beta-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula.« less
Dai, Yumin; Kizjakina, Karina; Campbell, Ashley C; Korasick, David A; Tanner, John J; Sobrado, Pablo
2018-01-04
The flavin-dependent enzyme 2-haloacrylate hydratase (2-HAH) catalyzes the conversion of 2-chloroacrylate, a major component in the manufacture of acrylic polymers, to pyruvate. The enzyme was expressed in Escherichia coli, purified, and characterized. 2-HAH was shown to be monomeric in solution and contained a non-covalent, yet tightly bound, flavin adenine dinucleotide (FAD). Although the catalyzed reaction was redox-neutral, 2-HAH was active only in the reduced state. A covalent flavin-substrate intermediate, consistent with the flavin-acrylate iminium ion, was trapped with cyanoborohydride and characterized by mass spectrometry. Small-angle X-ray scattering was consistent with 2-HAH belonging to the succinate dehydrogenase/fumarate reductase family of flavoproteins. These studies establish 2-HAH as a novel noncanonical flavoenzyme. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cdyl: a new transcriptional co-repressor
Caron, Cécile; Pivot-Pajot, Christophe; van Grunsven, Leo A.; Col, Edwige; Lestrat, Cécile; Rousseaux, Sophie; Khochbin, Saadi
2003-01-01
Cdyl (chromodomain-Y-like) is a chromodomain-containing protein that is predominantly expressed during mouse spermiogenesis. In its carboxy-terminal portion, there is a domain with homology to the coenzyme A (CoA) pocket of the enoyl-CoA hydratase/isomerase, which is shown here to be able to bind CoA and histone deacetylases (HDACs). It also efficiently represses transcription. Moreover, the binding of Hdac1 represses the ability of Cdyl to bind CoA, and a Cdyl–CoA interaction only occurs in the absence of HDACs. These data suggest that Cdyl is primarily a transcriptional co-repressor. However, the degradation of cellular Hdac1 and Hdac2, as observed here in the elongating spermatids, may provide an HDAC-free environment in which Cdyl could bind CoA and participate in the global chromatin remodelling that occurs in these cells. PMID:12947414
Piccoli, Stefano; Andreolli, Marco; Giorgetti, Alejandro; Zordan, Fabio; Lampis, Silvia; Vallini, Giovanni
2014-05-01
Burkholderia fungorum DBT1, first isolated from settling particulate matter of an oil refinery wastewater, is a bacterial strain which has been shown capable of utilizing several polycyclic aromatic hydrocarbons (PAHs) including dibenzothiophene (DBT). In particular, this microbe is able to efficiently degrade DBT through the Kodama pathway. Previous investigations have lead to the identification of six genes, on a total of eight, required for DBT degradation. In the present study, a combined experimental/computational approach was adopted to identify and in silico characterize the two missing genes, namely a ferredoxin reductase and a hydratase-aldolase. Thus, the finding of all enzymatic components of the Kodama pathway in B. fungorum DBT1 makes this bacterial strain amenable for possible exploitation in soil bioremediation protocols. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kılıcaslan, Soner; Arslan, Mustafa; Ruya, Zeynep; Bilen, Çigdem; Ergün, Adem; Gençer, Nahit; Arslan, Oktay
2016-12-01
Sulfonamide-bearing thiazole compounds were synthesized and their inhibitory effects on the activity of purified human carbonic anhydrase I and II were evaluated. Human carbonic anhydrase isoenzymes (hCA-I and hCA-II) were purified from erythrocyte cells by affinity chromatography. The inhibitory effects of the 12 synthesized sulfonamide (5a-l) on the hydratase and esterase activities of these isoenzymes (hCA-I and hCA-II) were studied in vitro. In relation to these activities, the inhibition equilibrium constants (Ki) were determined. The results showed that all the synthesized compounds inhibited the CA isoenzyme activity. Among them 5b was found to be the most active (IC50 = 0.35 μM; Ki: 0.33 μM) for hCA I and hCA II.
Shahrokhi, Mahdiyeh; Shafiei, Mohammad; Galehdari, Hamid; Shariati, Gholamreza
2017-01-01
Mitochondrial trifunctional protein (MTP) is a hetero-octamer composed of eight parts (subunits): four α-subunits containing LCEH (long-chain 2,3-enoyl-CoA hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and four β-subunits that possess LCKT (long-chain 3-ketoacyl-CoA thiolase) activity which catalyzes three out of four steps in β-oxidation spiral of long-chain fatty acid. Its deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases. A blood spot was collected from the patient's original newborn screening card with parental informed consent. A newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS were performed. After isolation of DNA and Amplification of all exons of the HADHA and HADHB, directly Sequence analyses of all exons and the flanking introns both of genes were performed. Here, we report a novel mutation in a patient with MTP deficiency diagnosed with newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS and then confirmed by enzyme analysis in cultured fibroblasts and direct sequencing of the HADHA and HADHB genes. Molecular analysis of causative genes showed a missense mutation (p.Q385P) c.1154A > C in exon 14 of HADHB gene. Since this mutation was not found in 50 normal control cases; so it was concluded that c.1154A > C mutation was a causative mutation. Phenotype analysis of this mutation predicted pathogenesis which reduces the stability of the MTP protein complex.
Moraes, Eduardo C; Alvarez, Thabata M; Persinoti, Gabriela F; Tomazetto, Geizecler; Brenelli, Livia B; Paixão, Douglas A A; Ematsu, Gabriela C; Aricetti, Juliana A; Caldana, Camila; Dixon, Neil; Bugg, Timothy D H; Squina, Fabio M
2018-01-01
Lignin is a heterogeneous polymer representing a renewable source of aromatic and phenolic bio-derived products for the chemical industry. However, the inherent structural complexity and recalcitrance of lignin makes its conversion into valuable chemicals a challenge. Natural microbial communities produce biocatalysts derived from a large number of microorganisms, including those considered unculturable, which operate synergistically to perform a variety of bioconversion processes. Thus, metagenomic approaches are a powerful tool to reveal novel optimized metabolic pathways for lignin conversion and valorization. The lignin-degrading consortium (LigMet) was obtained from a sugarcane plantation soil sample. The LigMet taxonomical analyses (based on 16S rRNA) indicated prevalence of Proteobacteria , Actinobacteria and Firmicutes members, including the Alcaligenaceae and Micrococcaceae families, which were enriched in the LigMet compared to sugarcane soil. Analysis of global DNA sequencing revealed around 240,000 gene models, and 65 draft bacterial genomes were predicted. Along with depicting several peroxidases, dye-decolorizing peroxidases, laccases, carbohydrate esterases, and lignocellulosic auxiliary (redox) activities, the major pathways related to aromatic degradation were identified, including benzoate (or methylbenzoate) degradation to catechol (or methylcatechol), catechol ortho-cleavage, catechol meta-cleavage, and phthalate degradation. A novel Paenarthrobacter strain harboring eight gene clusters related to aromatic degradation was isolated from LigMet and was able to grow on lignin as major carbon source. Furthermore, a recombinant pathway for vanillin production was designed based on novel gene sequences coding for a feruloyl-CoA synthetase and an enoyl-CoA hydratase/aldolase retrieved from the metagenomic data set. The enrichment protocol described in the present study was successful for a microbial consortium establishment towards the lignin and aromatic metabolism, providing pathways and enzyme sets for synthetic biology engineering approaches. This work represents a pioneering study on lignin conversion and valorization strategies based on metagenomics, revealing several novel lignin conversion enzymes, aromatic-degrading bacterial genomes, and a novel bacterial strain of potential biotechnological interest. The validation of a biosynthetic route for vanillin synthesis confirmed the applicability of the targeted metagenome discovery approach for lignin valorization strategies.
Pollard, Patrick J; Spencer-Dene, Bradley; Shukla, Deepa; Howarth, Kimberley; Nye, Emma; El-Bahrawy, Mona; Deheragoda, Maesha; Joannou, Maria; McDonald, Stuart; Martin, Alison; Igarashi, Peter; Varsani-Brown, Sunita; Rosewell, Ian; Poulsom, Richard; Maxwell, Patrick; Stamp, Gordon W; Tomlinson, Ian P M
2007-04-01
Germline mutations in the fumarate hydratase (FH) tumor suppressor gene predispose to leiomyomatosis, renal cysts, and renal cell cancer (HLRCC). HLRCC tumors overexpress HIF1alpha and hypoxia pathway genes. We conditionally inactivated mouse Fh1 in the kidney. Fh1 mutants developed multiple clonal renal cysts that overexpressed Hif1alpha and Hif2alpha. Hif targets, such as Glut1 and Vegf, were upregulated. We found that Fh1-deficient murine embryonic stem cells and renal carcinomas from HLRCC showed similar overexpression of HIF and hypoxia pathway components to the mouse cysts. Our data have shown in vivo that pseudohypoxic drive, resulting from HIF1alpha (and HIF2alpha) overexpression, is a direct consequence of Fh1 inactivation. Our mouse may be useful for testing therapeutic interventions that target angiogenesis and HIF-prolyl hydroxylation.
[Molecular biology of renal cancer: bases for genetic directed therapy in advanced disease].
Maroto Rey, José Pablo; Cillán Narvaez, Elena
2013-06-01
There has been expansion of therapeutic options in the management of metastatic renal cell carcinoma due to a better knowledge of the molecular biology of kidney cancers. There are different tumors grouped under the term renal cell carcinoma, being clear cell cancer the most frequent and accounting for 80% of kidney tumors. Mutations in the Von Hippel-Lindau gene can be identified in up to 80% of sporadic clear cell cancer, linking a genetically inheritable disease where vascular tumors are frequent, with renal cell cancer. Other histologic types present specific alterations in molecular pathways, like c-MET in papillary type I tumors, and Fumarase Hydratase in papillary type II tumors. Identification of the molecular alteration for a specific tumor may offer an opportunity for treatment selection based on biomarkers, and, in the future, for developing an engineering designed genetic treatment.
Kocyigit, Umit M; Taşkıran, Ahmet Şevki; Taslimi, Parham; Yokuş, Ahmet; Temel, Yusuf; Gulçin, İlhami
2017-11-01
The aim of this study was to investigate the effects of oxytocin (OT), atosiban, which is an OT receptor antagonist, and OT-atosiban chemicals injected to rats on the activities of carbonic anhydrase (CA) and acetylcholinesterase (AChE) enzymes in liver and kidney tissues of rats. For this purpose, four different groups, each consisting of six rats (n = 6), were formed (control group, OT administered group, atosiban administered group, and both OT and atosiban administered group). The rats were necropsied 60 min after intraperitoneal injection of chemicals into the rats. Liver tissues of rats were extracted. CA and AChE enzyme activities were measured for each tissue by using hydratase, esterase, and acetylcholiniodide methods. Activity values for each enzyme obtained were statistically calculated. © 2017 Wiley Periodicals, Inc.
Biochemical changes in rat liver after 18.5 days of spaceflight (41566)
NASA Technical Reports Server (NTRS)
Abraham, S.; Lin, C.Y.; Volkmann, C. M.; Klein, H. P.
1983-01-01
The effect of weightlessness on liver metabolism was investigated using tissue from rats flown in earth orbit for 18.5 days on the Soviet Cosmos 936 biosatellite and the changes in the activities of 28 carbohydrate and lipid enzymes were determined. The activities of two enzymes, palmitoyl-CoA desaturase and lactate dehydrogenase, increased, while the activities of five, glycogen phosphorylase, 6-phosphogluconate dehydrogenase, both acyltransferases which act on alpha-glycerolphosphate and diglycerides, and and aconitate hydratase decreased. The other enzyme activities were found to be unchanged. In addition, increased levels of liver glycogen and palmitoleate were detected which probably resulted from the lowered glycogen phosphorylase and increased palmitoyl-CoA desaturase activities, respectively, in those animals that experienced weightlessness. All of the changes observed in the rats after 18.5 days of spaceflight disappear by 25 days after the flight.
Hontecillas, Raquel; Diguardo, Maggie; Duran, Elisa; Orpi, Marcel; Bassaganya-Riera, Josep
2008-10-01
Catalpic acid (CAT) is a conjugated linolenic acid (CLN) isomer containing trans-9, trans-11, cis-13 double bonds in an 18-carbon chain and it is found primarily in the seed oil of ornamental and medicinal trees and shrubs of the family Bignoniaceae. The objective of this study was to investigate whether CAT decreases obesity and ameliorates insulin sensitivity and glucose tolerance in mice fed high-fat diets. To test the efficacy of CAT in decreasing obesity and diabetes we used both a model of diet-induced obesity (DIO) and a genetic model of obesity (i.e., mice lacking the leptin receptor). Blood was collected on days 0, 7, 14, 21 and 28 for determining fasting glucose and insulin concentrations in plasma. In addition, a glucose tolerance test was administered on day 28. We found that dietary CAT (1g/100g) decreased fasting plasma glucose and insulin concentrations, ameliorated the glucose normalizing ability following glucose challenge and decreased abdominal white adipose tissue accumulation. In white adipose tissue (WAT), CAT upregulated peroxisome proliferator-activated receptor (PPAR) alpha and its responsive genes [i.e., stearoyl-coenzyme A desaturase (SCD1) and enoyl-coenzyme A hydratase (ECH)], increased concentrations of high-density lipoprotein (HDL) cholesterol and decreased plasma triglyceride (TG) levels. CAT decreased abdominal fat deposition, increased HDL cholesterol, decreased TG concentrations, decreased glucose and insulin homeostasis and modulated WAT gene expression in a manner reminiscent of the actions of the PPAR alpha-activating fibrate class of lipid-lowering drugs.
Potential genetic anticipation in hereditary leiomyomatosis-renal cell cancer (HLRCC).
Wong, Mei Hua; Tan, Chuen Seng; Lee, Soo Chin; Yong, Yvonne; Ooi, Aik Seng; Ngeow, Joanne; Tan, Min Han
2014-06-01
Hereditary leiomyomatosis-renal cell cancer (HLRCC) is an autosomal dominant disorder characterised by cutaneous leiomyomas, symptomatic uterine leiomyomas and aggressive type II papillary renal cell carcinoma. It is caused by heterozygous mutations in the fumarate hydratase (FH) gene on chromosome 1q43. We present evidence of genetic anticipation in HLRCC syndrome. A comprehensive literature review was performed to determine the potential for genetic anticipation in HLRCC syndrome. The normal random effects model was used to evaluate for genetic anticipation to ensure reduction in bias. A total of 11 FH kindreds with available multi-generational data were identified for analysis. The mean difference in age at diagnosis of RCC between the first and second generation was -18.6 years (95 % CI -26.6 to -10.6, p < 0.001). The mean difference in age at diagnosis of RCC between the first and third generation was -36.2 years (95 % CI -47.0 to -25.4, p < 0.001). No evidence of anticipation for uterine leiomyomas was observed (p = 0.349). We report preliminary evidence of genetic anticipation of RCC in HLRCC syndrome. Additional clinical validation is important to confirm this observation, which may have practical implications on counseling and timing of surveillance initiation. Exploration of the underlying mechanisms of anticipation in HLRCC would be of considerable biological interest.
Li, Xupeng; Meng, Xianhong; Luo, Kun; Luan, Sheng; Cao, Baoxiang; Kong, Jie
2017-04-01
In the present study a cDNA encoding a phosphopyruvate hydratase (enolase) was cloned from the muscle of the Chinese shrimp (Fenneropenaeus chinensis) and named as FcEnolase. The cDNA of FcEnolase encoded a protein of 434 amino acid residues with a molecular mass 47.22 kDa. The residues 342-355 constituted the signature motif "LLLKVNQIGSVTES". A SNP locus (C96T) in the ORF at 96 bp was identified. The results showed that the FcEnolase was a conserved gene. In the normal F. chinensis, the mRNA level in the muscle was much higher (P < 0.05) than the mRNA level in the gill and hepatopancreas. To verify the mRNA level of FcEnolase in the F. chinensis post WSSV infection, a real-time RT-PCR was performed. In the WSSV-infected F. chinensis, the FcEnolase mRNA level was significantly (P < 0.05) up-regulated in the muscle at 12 and 24 h post challenge (hpc) to approximately 2.7-fold and 2.7-fold the mRNA level in the controls, respectively. The FcEnolase mRNA level in the gill was significantly (P < 0.05) down-regulated at 6 hpc to approximately 0.3-fold the mRNA level in the control, followed by a significant (P < 0.05) up-regulation at 12 hpc to approximately 2.8-fold the mRNA level in the control. There was no obvious change of FcEnolase mRNA level in the hepatopancreas during the infection process. The expression profile coincided with the fact that WSSV primarily infects the tissues of muscle and gill, but hardly infects hepatopancreas. To verify the protein level of FcEnolase post WSSV infection, a Western blot was performed. The FcEnolase protein level in the muscle at 24 hpc significantly (P < 0.05) increased to approximately 2.1-fold the level in the control. These results showed the characterization of FcEnolase and suggested that the FcEnolase might be involved in the response of F. chinensis to WSSV infection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Smith, Steven C; Trpkov, Kiril; Chen, Ying-Bei; Mehra, Rohit; Sirohi, Deepika; Ohe, Chisato; Cani, Andi K; Hovelson, Daniel H; Omata, Kei; McHugh, Jonathan B; Jochum, Wolfram; Colecchia, Maurizio; Amin, Mitual; Divatia, Mukul K; Hes, Ondřej; Menon, Santosh; da Cunha, Isabela Werneck; Tripodi, Sergio; Brimo, Fadi; Gill, Anthony J; Osunkoya, Adeboye O; Magi-Galluzzi, Cristina; Sibony, Mathilde; Williamson, Sean R; Nesi, Gabriella; Picken, Maria M; Maclean, Fiona; Agaimy, Abbas; Cheng, Liang; Epstein, Jonathan I; Reuter, Victor E; Tickoo, Satish K; Tomlins, Scott A; Amin, Mahul B
2017-01-01
An emerging group of high grade renal cell carcinomas (RCCs), particularly carcinomas arising in the hereditary leiomyomatosis renal cell carcinoma syndrome (HLRCC), show fumarate hydratase (FH) gene mutation and loss of function. Based on similar cytomorphology and clinicopathologic features between these tumors and cases described as tubulocystic carcinomas with poorly differentiated foci of infiltrative adenocarcinoma (TC-PD), we hypothesized a relationship between these entities. First, 29 RCCs with morphology of TC-PD were identified retrospectively and assessed for FH expression and aberrant succination (2SC) by immunohistochemistry (IHC), with targeted next generation sequencing (NGS) of 409 genes—including FH—performed on a subset. The 29 TC-PD RCCs included 21 males and 8 females, aged 16-86 years (median 46), with tumors measuring 3-21 cm (median 9) arising in the right (n=16) and left (n=13) kidneys. Family history or stigmata of HLRCC were identified in only 3 (12%). These tumors were aggressive, with 79% showing perinephric extension, nodal involvement in 41%, and metastasis in 86%. Of these, 16 (55%) demonstrated loss of FH by IHC (14/14 with positive 2SC). In contrast, 5 (17%) showed a wild type immunoprofile of FH+/2SC-. An intriguing group of 8 (28%) showed variable FH± positivity, but with strong/diffuse 2SC+. NGS revealed 8 cases with FH mutations, including 5 FH-/2SC+ and 3 FH±/2SC+ cases, but none in FH+/2SC- cases. Secondly, we retrospectively reviewed the morphology of two well-characterized cohorts of RCCs with FH-deficiency determined by IHC or sequencing (n=23 and n=9), unselected for TC-PD pattern, identifying the TC-PD morphology in 10 (31%). We conclude that RCCs with TC-PD morphology are enriched for FH deficiency, and we recommend additional work up, including referral to genetic counseling, for prospective cases. Additionally, based on these and other observations, we propose the term “FH-deficient RCC” as a provisional term for tumors with a combination of suggestive morphology and immunophenotype but where genetic confirmation is unavailable upon diagnosis. This term will serve as a provisional nomenclature that will enable triage of individual cases for genetic counseling and testing, while designating these cases for prospective studies of their relationship to HLRCC. PMID:27635946
Guimarães, Samuel L; Coitinho, Juliana B; Costa, Débora M A; Araújo, Simara S; Whitman, Christian P; Nagem, Ronaldo A P
2016-05-10
The enzymes in the catechol meta-fission pathway have been studied for more than 50 years in several species of bacteria capable of degrading a number of aromatic compounds. In a related pathway, naphthalene, a toxic polycyclic aromatic hydrocarbon, is fully degraded to intermediates of the tricarboxylic acid cycle by the soil bacteria Pseudomonas putida G7. In this organism, the 83 kb NAH7 plasmid carries several genes involved in this biotransformation process. One enzyme in this route, NahK, a 4-oxalocrotonate decarboxylase (4-OD), converts 2-oxo-3-hexenedioate to 2-hydroxy-2,4-pentadienoate using Mg(2+) as a cofactor. Efforts to study how 4-OD catalyzes this decarboxylation have been hampered because 4-OD is present in a complex with vinylpyruvate hydratase (VPH), which is the next enzyme in the same pathway. For the first time, a monomeric, stable, and active 4-OD has been expressed and purified in the absence of VPH. Crystal structures for NahK in the apo form and bonded with five substrate analogues were obtained using two distinct crystallization conditions. Analysis of the crystal structures implicates a lid domain in substrate binding and suggests roles for specific residues in a proposed reaction mechanism. In addition, we assign a possible function for the NahK N-terminal domain, which differs from most of the other members of the fumarylacetoacetate hydrolase superfamily. Although the structural basis for metal-dependent β-keto acid decarboxylases has been reported, this is the first structural report for that of a vinylogous β-keto acid decarboxylase and the first crystal structure of a 4-OD.
Detection of diazotrophy in the acetylene-fermenting anaerobe Pelobacter sp. strain SFB93
Akob, Denise M.; Baesman, Shaun; Sutton, John M.; Fierst, Janna L.; Mumford, Adam; Shrestha, Yesha; Poret-Peterson, Amisha T.; Bennett, Stacy; Dunlap, Darren S.; Haase, Karl B.; Oremland, Ronald S.
2017-01-01
Acetylene (C2H2) is a trace constituent of the present Earth's oxidizing atmosphere, reflecting a mixture of terrestrial and marine emissions from anthropogenic, biomass-burning, and unidentified biogenic sources. Fermentation of acetylene was serendipitously discovered during C2H2 block assays of N2O reductase, and Pelobacter acetylenicus was shown to grow on C2H2 via acetylene hydratase (AH). AH is a W-containing, catabolic, low-redox-potential enzyme that, unlike nitrogenase (N2ase), is specific for acetylene. Acetylene fermentation is a rare metabolic process that is well characterized only in P. acetylenicus DSM3246 and DSM3247 and Pelobacter sp. strain SFB93. To better understand the genetic controls for AH activity, we sequenced the genomes of the three acetylene-fermenting Pelobacter strains. Genome assembly and annotation produced three novel genomes containing gene sequences for AH, with two copies being present in SFB93. In addition, gene sequences for all five compulsory genes for iron-molybdenum N2ase were also present in the three genomes, indicating the cooccurrence of two acetylene transformation pathways. Nitrogen fixation growth assays showed that DSM3426 could ferment acetylene in the absence of ammonium, but no ethylene was produced. However, SFB93 degraded acetylene and, in the absence of ammonium, produced ethylene, indicating an active N2ase. Diazotrophic growth was observed under N2 but not in experimental controls incubated under argon. SFB93 exhibits acetylene fermentation and nitrogen fixation, the only known biochemical mechanisms for acetylene transformation. Our results indicate complex interactions between N2ase and AH and suggest novel evolutionary pathways for these relic enzymes from early Earth to modern days.
Sacoman, Juliana L.; Dagda, Raul Y.; Burnham-Marusich, Amanda R.; Dagda, Ruben K.; Berninsone, Patricia M.
2017-01-01
O-Linked N-acetylglucosamine transferase (OGT) catalyzes O-GlcNAcylation of target proteins and regulates numerous biological processes. OGT is encoded by a single gene that yields nucleocytosolic and mitochondrial isoforms. To date, the role of the mitochondrial isoform of OGT (mOGT) remains largely unknown. Using high throughput proteomics, we identified 84 candidate mitochondrial glycoproteins, of which 44 are novel. Notably, two of the candidate glycoproteins identified (cytochrome oxidase 2 (COX2) and NADH:ubiquinone oxidoreductase core subunit 4 (MT-ND4)) are encoded by mitochondrial DNA. Using siRNA in HeLa cells, we found that reducing endogenous mOGT expression leads to alterations in mitochondrial structure and function, including Drp1-dependent mitochondrial fragmentation, reduction in mitochondrial membrane potential, and a significant loss of mitochondrial content in the absence of mitochondrial ROS. These defects are associated with a compensatory increase in oxidative phosphorylation per mitochondrion. mOGT is also critical for cell survival; siRNA-mediated knockdown of endogenous mOGT protected cells against toxicity mediated by rotenone, a complex I inhibitor. Conversely, reduced expression of both nucleocytoplasmic (ncOGT) and mitochondrial (mOGT) OGT isoforms is associated with increased mitochondrial respiration and elevated glycolysis, suggesting that ncOGT is a negative regulator of cellular bioenergetics. Last, we determined that mOGT is probably involved in the glycosylation of a restricted set of mitochondrial targets. We identified four proteins implicated in mitochondrial biogenesis and metabolism regulation as candidate substrates of mOGT, including leucine-rich PPR-containing protein and mitochondrial aconitate hydratase. Our findings suggest that mOGT is catalytically active in vivo and supports mitochondrial structure, health, and survival, whereas ncOGT predominantly regulates cellular bioenergetics. PMID:28100784
Li, Jiahui; Chen, Jie; Wang, Yujun; Luo, Guangsheng; Yu, Huimin
2014-10-01
In this work, a membrane dispersion microreactor was utilized for the hydration of acrylonitrile to produce acrylamide. Through observation using a microscopy, it was found that the acrylonitrile was dispersed into the continuous phase (the aqueous phase contains nitrile hydratase (NHase)) as droplets with a diameter ranged from 25 to 35 μm, hence the mass transfer specific surface area was significantly increased, and the concentration of acrylamide reached 52.5 wt% within 50 min. By contrast, in stirred tanks, the concentration of acrylamide only got 39.5 wt% within 245 min. Moreover, only a few amounts of acrylonitrile were accumulated in this microreactor system. Through optimizing the flow rate, the concentration of acrylamide reached 45.8 wt% within 35 min, the short reaction time greatly weakened the inhibition of acrylonitrile and acrylamide on the enzyme activity, which is suitable for prolonging the life of free cell. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Xusheng; Pandey, Ashutosh K.; Mulligan, Megan K.
Phenome-wide association is a novel reverse genetic strategy to analyze genome-to-phenome relations in human clinical cohorts. Here we test this approach using a large murine population segregating for ~5 million sequence variants, and we compare our results to those extracted from a matched analysis of gene variants in a large human cohort. For the mouse cohort, we amassed a deep and broad open-access phenome consisting of ~4,500 metabolic, physiological, pharmacological and behavioural traits, and more than 90 independent expression quantitative trait locus (QTL), transcriptome, proteome, metagenome and metabolome data sets-by far the largest coherent phenome for any experimental cohort (www.genenetwork.org).more » Here, we tested downstream effects of subsets of variants and discovered several novel associations, including a missense mutation in fumarate hydratase that controls variation in the mitochondrial unfolded protein response in both mouse and Caenorhabditis elegans, and missense mutations in Col6a5 that underlies variation in bone mineral density in both mouse and human.« less
Joint mouse–human phenome-wide association to test gene function and disease risk
Wang, Xusheng; Pandey, Ashutosh K.; Mulligan, Megan K.; ...
2016-02-02
Phenome-wide association is a novel reverse genetic strategy to analyze genome-to-phenome relations in human clinical cohorts. Here we test this approach using a large murine population segregating for ~5 million sequence variants, and we compare our results to those extracted from a matched analysis of gene variants in a large human cohort. For the mouse cohort, we amassed a deep and broad open-access phenome consisting of ~4,500 metabolic, physiological, pharmacological and behavioural traits, and more than 90 independent expression quantitative trait locus (QTL), transcriptome, proteome, metagenome and metabolome data sets-by far the largest coherent phenome for any experimental cohort (www.genenetwork.org).more » Here, we tested downstream effects of subsets of variants and discovered several novel associations, including a missense mutation in fumarate hydratase that controls variation in the mitochondrial unfolded protein response in both mouse and Caenorhabditis elegans, and missense mutations in Col6a5 that underlies variation in bone mineral density in both mouse and human.« less
Kang, Seog Jin; Cho, Yong Il; Kim, Ki Hyun; Cho, Eun Seok
2016-05-01
Silver ions act as a powerful, broad-spectrum antimicrobial agent and are known to kill over 650 different kinds of pathogens. We investigated the protein expression pattern and identity after silver ion treatment in Escherichia coli and Staphylococcus aureus, which are primarily responsible for the majority of bovine mastitis cases using proteomics. Two-dimensional electrophoresis showed that silver ion treatment significantly reduced 5 spot's density in E. coli and S. aureus, respectively. We identified 10 proteins (alkyl hydroperoxide reductase C22 subunit, phosphoglucomutase, fructose-1-phosphate kinase, putative carbamoyl transferase, alpha-galactosidase, carbamate kinase, ornithine transcarbamoylase, fumarate hydratase class II, alcohol dehydrogenase, and conserved hypothetical protein) by matrix-assisted laser desorption ionization time of flight (MALDI-TOF). These results demonstrated that silver ions have bactericidal effects through energy deprivation, inhibition of DNA replication, and accumulation of oxidants in bovine mastitis pathogens and suggested that silver ions can be applied for the treatment of bovine mastitis.
Winger, A M; Heazlewood, J L; Chan, L J G; Petzold, C J; Permaul, K; Singh, S
2014-11-01
Thermomyces lanuginosus is a thermophilic fungus known for its ability to produce industrially important enzymes including large amounts of xylanase, the key enzyme in hemicellulose hydrolysis. The secretome of T. lanuginosus SSBP was profiled by shotgun proteomics to elucidate important enzymes involved in hemicellulose saccharification and to characterise the presence of other industrially interesting enzymes. This study reproducibly identified a total of 74 proteins in the supernatant following growth on corn cobs. An analysis of proteins revealed nine glycoside hydrolase (GH) enzymes including xylanase GH11, β-xylosidase GH43, β-glucosidase GH3, α-galactosidase GH36 and trehalose hydrolase GH65. Two commercially produced Thermomyces enzymes, lipase and amylase, were also identified. In addition, other industrially relevant enzymes not currently explored in Thermomyces were identified including glutaminase, fructose-bisphosphate aldolase and cyanate hydratase. Overall, these data provide insight into the novel ability of a cellulase-free fungus to utilise lignocellulosic material, ultimately producing a number of enzymes important to various industrial processes.
Origin of Bacteriochlorophyll a and the Early Diversification of Photosynthesis.
Cardona, Tanai
2016-01-01
Photosynthesis originated in the domain Bacteria billions of years ago; however, the identity of the last common ancestor to all phototrophic bacteria remains undetermined and speculative. Here I present the evolution of BchF or 3-vinyl-bacteriochlorophyll hydratase, an enzyme exclusively found in bacteria capable of synthetizing bacteriochlorophyll a. I show that BchF exists in two forms originating from an early divergence, one found in the phylum Chlorobi, including its paralogue BchV, and a second form that was ancestral to the enzyme found in the remaining anoxygenic phototrophic bacteria. The phylogeny of BchF is consistent with bacteriochlorophyll a evolving in an ancestral phototrophic bacterium that lived before the radiation event that gave rise to the phylum Chloroflexi, Chlorobi, Acidobacteria, Proteobacteria, and Gemmatimonadetes, but only after the divergence of Type I and Type II reaction centers. Consequently, it is suggested that the lack of phototrophy in many groups of extant bacteria is a derived trait.
Haataja, Tatu J K; Koski, M Kristian; Hiltunen, J Kalervo; Glumoff, Tuomo
2011-05-01
All of the peroxisomal β-oxidation pathways characterized thus far house at least one MFE (multifunctional enzyme) catalysing two out of four reactions of the spiral. MFE type 2 proteins from various species display great variation in domain composition and predicted substrate preference. The gene CG3415 encodes for Drosophila melanogaster MFE-2 (DmMFE-2), complements the Saccharomyces cerevisiae MFE-2 deletion strain, and the recombinant protein displays both MFE-2 enzymatic activities in vitro. The resolved crystal structure is the first one for a full-length MFE-2 revealing the assembly of domains, and the data can also be transferred to structure-function studies for other MFE-2 proteins. The structure explains the necessity of dimerization. The lack of substrate channelling is proposed based on both the structural features, as well as by the fact that hydration and dehydrogenation activities of MFE-2, if produced as separate enzymes, are equally efficient in catalysis as the full-length MFE-2.
Yu, Yadong; Li, Tao; Wu, Na; Ren, Lujing; Jiang, Ling; Ji, Xiaojun; Huang, He
2016-11-30
Arachidonic acid (ARA) is an important polyunsaturated fatty acid having various beneficial physiological effects on the human body. The aging of Mortierella alpina has long been known to significantly improve ARA yield, but the exact mechanism is still elusive. Herein, multiple approaches including large-scale label-free comparative proteomics were employed to systematically investigate the mechanism mentioned above. Upon ultrastructural observation, abnormal mitochondria were found to aggregate around shrunken lipid droplets. Proteomics analysis revealed a total of 171 proteins with significant alterations of expression during aging. Pathway analysis suggested that reactive oxygen species (ROS) were accumulated and stimulated the activation of the malate/pyruvate cycle and isocitrate dehydrogenase, which might provide additional NADPH for ARA synthesis. EC 4.2.1.17-hydratase might be a key player in ARA accumulation during aging. These findings provide a valuable resource for efforts to further improve the ARA content in the oil produced by aging M. alpina.
Candida albicans Utilizes a Modified β-Oxidation Pathway for the Degradation of Toxic Propionyl-CoA*
Otzen, Christian; Bardl, Bettina; Jacobsen, Ilse D.; Nett, Markus; Brock, Matthias
2014-01-01
Propionyl-CoA arises as a metabolic intermediate from the degradation of propionate, odd-chain fatty acids, and some amino acids. Thus, pathways for catabolism of this intermediate have evolved in all kingdoms of life, preventing the accumulation of toxic propionyl-CoA concentrations. Previous studies have shown that fungi generally use the methyl citrate cycle for propionyl-CoA degradation. Here, we show that this is not the case for the pathogenic fungus Candida albicans despite its ability to use propionate and valerate as carbon sources. Comparative proteome analyses suggested the presence of a modified β-oxidation pathway with the key intermediate 3-hydroxypropionate. Gene deletion analyses confirmed that the enoyl-CoA hydratase/dehydrogenase Fox2p, the putative 3-hydroxypropionyl-CoA hydrolase Ehd3p, the 3-hydroxypropionate dehydrogenase Hpd1p, and the putative malonate semialdehyde dehydrogenase Ald6p essentially contribute to propionyl-CoA degradation and its conversion to acetyl-CoA. The function of Hpd1p was further supported by the detection of accumulating 3-hydroxypropionate in the hpd1 mutant on propionyl-CoA-generating nutrients. Substrate specificity of Hpd1p was determined from recombinant purified enzyme, which revealed a preference for 3-hydroxypropionate, although serine and 3-hydroxyisobutyrate could also serve as substrates. Finally, virulence studies in a murine sepsis model revealed attenuated virulence of the hpd1 mutant, which indicates generation of propionyl-CoA from host-provided nutrients during infection. PMID:24497638
Metal-Assisted Oxo Atom Addition to an Fe(III) Thiolate.
Villar-Acevedo, Gloria; Lugo-Mas, Priscilla; Blakely, Maike N; Rees, Julian A; Ganas, Abbie S; Hanada, Erin M; Kaminsky, Werner; Kovacs, Julie A
2017-01-11
Cysteinate oxygenation is intimately tied to the function of both cysteine dioxygenases (CDOs) and nitrile hydratases (NHases), and yet the mechanisms by which sulfurs are oxidized by these enzymes are unknown, in part because intermediates have yet to be observed. Herein, we report a five-coordinate bis-thiolate ligated Fe(III) complex, [Fe III (S 2 Me2 N 3 (Pr,Pr))] + (2), that reacts with oxo atom donors (PhIO, IBX-ester, and H 2 O 2 ) to afford a rare example of a singly oxygenated sulfenate, [Fe III (η 2 -S Me2 O)(S Me2 )N 3 (Pr,Pr)] + (5), resembling both a proposed intermediate in the CDO catalytic cycle and the essential NHase Fe-S(O) Cys114 proposed to be intimately involved in nitrile hydrolysis. Comparison of the reactivity of 2 with that of a more electron-rich, crystallographically characterized derivative, [Fe III S 2 Me2 N Me N 2 amide (Pr,Pr)] - (8), shows that oxo atom donor reactivity correlates with the metal ion's ability to bind exogenous ligands. Density functional theory calculations suggest that the mechanism of S-oxygenation does not proceed via direct attack at the thiolate sulfurs; the average spin-density on the thiolate sulfurs is approximately the same for 2 and 8, and Mulliken charges on the sulfurs of 8 are roughly twice those of 2, implying that 8 should be more susceptible to sulfur oxidation. Carboxamide-ligated 8 is shown to be unreactive towards oxo atom donors, in contrast to imine-ligated 2. Azide (N 3 - ) is shown to inhibit sulfur oxidation with 2, and a green intermediate is observed, which then slowly converts to sulfenate-ligated 5. This suggests that the mechanism of sulfur oxidation involves initial coordination of the oxo atom donor to the metal ion. Whether the green intermediate is an oxo atom donor adduct, Fe-O═I-Ph, or an Fe(V)═O remains to be determined.
Unique presentation of cutis laxa with Leigh-like syndrome due to ECHS1 deficiency.
Balasubramaniam, S; Riley, L G; Bratkovic, D; Ketteridge, D; Manton, N; Cowley, M J; Gayevskiy, V; Roscioli, T; Mohamed, M; Gardeitchik, T; Morava, E; Christodoulou, J
2017-09-01
Clinical finding of cutis laxa, characterized by wrinkled, redundant, sagging, nonelastic skin, is of growing significance due to its occurrence in several different inborn errors of metabolism (IEM). Metabolic cutis laxa results from Menkes syndrome, caused by a defect in the ATPase copper transporting alpha (ATP7A) gene; congenital disorders of glycosylation due to mutations in subunit 7 of the component of oligomeric Golgi (COG7)-congenital disorders of glycosylation (CDG) complex; combined disorder of N- and O-linked glycosylation, due to mutations in ATPase H+ transporting V0 subunit a2 (ATP6VOA2) gene; pyrroline-5-carboxylate reductase 1 deficiency; pyrroline-5-carboxylate synthase deficiency; macrocephaly, alopecia, cutis laxa, and scoliosis (MACS) syndrome, due to Ras and Rab interactor 2 (RIN2) mutations; transaldolase deficiency caused by mutations in the transaldolase 1 (TALDO1) gene; Gerodermia osteodysplastica due to mutations in the golgin, RAB6-interacting (GORAB or SCYL1BP1) gene; and mitogen-activated pathway (MAP) kinase defects, caused by mutations in several genes [protein tyrosine phosphatase, non-receptor-type 11 (PTPN11), RAF, NF, HRas proto-oncogene, GTPase (HRAS), B-Raf proto-oncogene, serine/threonine kinase (BRAF), MEK1/2, KRAS proto-oncogene, GTPase (KRAS), SOS Ras/Rho guanine nucleotide exchange factor 2 (SOS2), leucine rich repeat scaffold protein (SHOC2), NRAS proto-oncogene, GTPase (NRAS), and Raf-1 proto-oncogene, serine/threonine kinase (RAF1)], which regulate the Ras-MAPK cascade. Here, we further expand the list of inborn errors of metabolism associated with cutis laxa by describing the clinical presentation of a 17-month-old girl with Leigh-like syndrome due to enoyl coenzyme A hydratase, short chain, 1, mitochondria (ECHS1) deficiency, a mitochondrial matrix enzyme that catalyzes the second step of the beta-oxidation spiral of fatty acids and plays an important role in amino acid catabolism, particularly valine.
Thrush, A B; Antoun, G; Nikpay, M; Patten, D A; DeVlugt, C; Mauger, J-F; Beauchamp, B L; Lau, P; Reshke, R; Doucet, É; Imbeault, P; Boushel, R; Gibbings, D; Hager, J; Valsesia, A; Slack, R S; Al-Dirbashi, O Y; Dent, R; McPherson, R; Harper, M-E
2018-01-01
Background/Objectives: Inter-individual variability in weight loss during obesity treatment is complex and poorly understood. Here we use whole body and tissue approaches to investigate fuel oxidation characteristics in skeletal muscle fibers, cells and distinct circulating protein biomarkers before and after a high fat meal (HFM) challenge in those who lost the most (obese diet-sensitive; ODS) vs the least (obese diet-resistant; ODR) amount of weight in a highly controlled weight management program. Subjects/Methods: In 20 weight stable-matched ODS and ODR women who previously completed a standardized clinical weight loss program, we analyzed whole-body energetics and metabolic parameters in vastus lateralis biopsies and plasma samples that were obtained in the fasting state and 6 h after a defined HFM, equivalent to 35% of total daily energy requirements. Results: At baseline (fasting) and post-HFM, muscle fatty acid oxidation and maximal oxidative phosphorylation were significantly greater in ODS vs ODR, as was reactive oxygen species emission. Plasma proteomics of 1130 proteins pre and 1, 2, 5 and 6 h after the HFM demonstrated distinct group and interaction differences. Group differences identified S-formyl glutathione hydratase, heat shock 70 kDA protein 1A/B (HSP72), and eukaryotic translation initiation factor 5 (eIF5) to be higher in ODS vs ODR. Group-time differences included aryl hydrocarbon interacting protein (AIP), peptidylpropyl isomerase D (PPID) and tyrosine protein-kinase Fgr, which increased in ODR vs ODS over time. HSP72 levels correlated with muscle oxidation and citrate synthase activity. These proteins circulate in exosomes; exosomes isolated from ODS plasma increased resting, leak and maximal respiration rates in C2C12 myotubes by 58%, 21% and 51%, respectively, vs those isolated from ODR plasma. Conclusions: Findings demonstrate distinct muscle metabolism and plasma proteomics in fasting and post-HFM states corresponding in diet-sensitive vs diet-resistant obese women. PMID:29151592
Advances in the diagnosis of hereditary kidney cancer: Initial results of a multigene panel test.
Nguyen, Kevin A; Syed, Jamil S; Espenschied, Carin R; LaDuca, Holly; Bhagat, Ansh M; Suarez-Sarmiento, Alfredo; O'Rourke, Timothy K; Brierley, Karina L; Hofstatter, Erin W; Shuch, Brian
2017-11-15
Panel testing has been recently introduced to evaluate hereditary cancer; however, limited information is available regarding its use in kidney cancer. The authors retrospectively reviewed test results and clinical data from patients who underwent targeted multigene panel testing of up to 19 genes associated with hereditary kidney cancer from 2013 to 2016. The frequency of positive (mutation/variant likely pathogenic), inconclusive (variant of unknown significance), and negative results was evaluated. A logistic regression analysis evaluated predictive factors for a positive test. Patients (n = 1235) had a median age at diagnosis of 46 years, which was significantly younger than the US population of individuals with kidney cancer (P < .0001). Overall, 6.1%, 75.5%, and 18.4% of individuals had positive, negative, and inconclusive results, respectively. The most commonly altered genes included folliculin (FLCN) and fumarate hydratase (FH), which were altered in 1.8% and 1.3% of patients, respectively. Tuberous Sclerosis Complex 2 (TSC2), mesenchymal epithelial transition factor proto-oncogene (MET), and PMS1 homolog 2 (PMS2) had the highest rates of variants of unknown significance, which were identified in 2.7%, 2.2%, and 1.7% of patients, respectively. Early age of onset was the only factor that was identified as predictive of a positive test on multivariate analysis (odds ratio, 0.975; P = .0052) and may be the only identifying characteristic of low-penetrant syndromes, such as those associated with MITF (melanogenesis-associated transcription factor) mutations, which do not have singular histology or a family history of kidney cancer. Panel tests may be particularly useful for patients who lack distinguishing clinical characteristics of known hereditary kidney cancer syndromes. The current results support the use of early age of onset for genetic counseling and/or testing. Cancer 2017;123:4363-71. © 2017 American Cancer Society. © 2017 American Cancer Society.
Gosling, J. P.; Duggan, P. F.
1971-01-01
Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595
Chakraborty, Debkumar; Gupta, Gaganjot; Kaur, Baljinder
2016-12-01
Metabolic engineering and construction of recombinant Escherichia coli strains carrying feruloyl-CoA synthetase and enoyl-CoA hydratase genes for the bioconversion of ferulic acid to vanillin offers an alternative way to produce vanillin. Isolation and designing of fcs and ech genes was carried out using computer assisted protocol and the designed vanillin biosynthetic gene cassette was cloned in pCCIBAC expression vector for introduction in E. coli top 10. Recombinant strain was implemented for the statistical optimization of process parameters influencing F A to vanillin biotransformation. CCD matrix constituted of process variables like FA concentration, time, temperature and biomass with intracellular, extracellular and total vanillin productions as responses. Production was scaled up and 68 mg/L of vanillin was recovered from 10 mg/L of FA using cell extracts from 1 mg biomass within 30 min. Kinetic activity of enzymes were characterized. From LCMS-ESI analysis a metabolic pathway of FA degradation and vanillin production was predicted. Copyright © 2016 Elsevier Inc. All rights reserved.
2012-01-01
Background The role of n-3 fatty acids in prevention of breast cancer is well recognized, but the underlying molecular mechanisms are still unclear. In view of the growing need for early detection of breast cancer, Graham et al. (2010) studied the microarray gene expression in histologically normal epithelium of subjects with or without breast cancer. We conducted a secondary analysis of this dataset with a focus on the genes (n = 47) involved in fat and lipid metabolism. We used stepwise multivariate logistic regression analyses, volcano plots and false discovery rates for association analyses. We also conducted meta-analyses of other microarray studies using random effects models for three outcomes--risk of breast cancer (380 breast cancer patients and 240 normal subjects), risk of metastasis (430 metastatic compared to 1104 non-metastatic breast cancers) and risk of recurrence (484 recurring versus 890 non-recurring breast cancers). Results The HADHA gene [hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit] was significantly under-expressed in breast cancer; more so in those with estrogen receptor-negative status. Our meta-analysis showed an 18.4%-26% reduction in HADHA expression in breast cancer. Also, there was an inconclusive but consistent under-expression of HADHA in subjects with metastatic and recurring breast cancers. Conclusions Involvement of mitochondria and the mitochondrial trifunctional protein (encoded by HADHA gene) in breast carcinogenesis is known. Our results lend additional support to the possibility of this involvement. Further, our results suggest that targeted subset analysis of large genome-based datasets can provide interesting association signals. PMID:22240105
Toledo, Rodrigo Almeida
2017-09-01
Two recent independent studies published in Nature show robust responses of clear cell renal cell carcinoma (ccRCC) cell lines, preclinical ccRCC xenograft models and, remarkably, a patient with progressive ccRCC despite receiving multiple lines of treatment, to the long-awaited, recently developed inhibitors of hypoxia-inducible factor 2-alpha (HIF2α). This commentary published in Endocrine-Related Cancer is based on the recognition of similar molecular drivers in ccRCC and the endocrine neoplasias pheochromocytomas and paragangliomas (PPGLs), ultimately leading to stabilization of HIFs. HIF-stabilizing mutations have been detected in the von Hippel-Lindau (VHL) gene, as well as in other genes, such as succinate dehydrogenase (SDHx), fumarate hydratase (FH) and transcription elongation factor B subunit 1 (TCEB1), as well as the gene that encodes HIF2α itself: EPAS1 HIF2α Importantly, the recent discovery of EPAS1 mutations in PPGLs and the results of comprehensive in vitro and in vivo studies revealing their oncogenic roles characterized a hitherto unknown direct mechanism of HIF2α activation in human cancer. The now available therapeutic opportunity to successfully inhibit HIF2α pharmacologically with PT2385 and PT2399 will certainly spearhead a series of investigations in several types of cancers, including patients with SDHB -related metastatic PPGL for whom limited therapeutic options are currently available. Future studies will determine the efficacy of these promising drugs against the hotspot EPAS1 mutations affecting HIF2α amino acids 529-532 (in PPGLs) and amino acids 533-540 (in erythrocytosis type 4), as well as against HIF2α protein activated by VHL , SDHx and FH mutations in PPGL-derived chromatin cells. © 2017 Society for Endocrinology.
Pérez-Ortiz, José Manuel; Galiana-Simal, Adrian; Salas, Elisabet; González-Martín, Carmen; García-Rojo, Marcial; Alguacil, Luis F
2017-07-01
A mouse model has been developed to study the effect of dietary fat combined with food deprivation periods on palatable food seeking and on the expression of three potential addiction biomarkers in the nucleus accumbens: fumarate hydratase (FH), ATP synthase subunit alpha (ATP5a1) and transketolase (TKT). Forty C57BL/6 J male mice, four-week old, were fed either with a high-fat (HF) diet or standard diet along the experiment. After 3 weeks of differential feeding, animals underwent a two-week training period of two daily sessions where visual cues were paired either to palatable food (chocolate cereals) or no food at all. This training was prolonged one more week with similar, one daily sessions preceded by 12 hours of food deprivation. A behavioural test was finally conducted where mice were confined for 30 minutes either in food unpaired compartments or in compartments previously paired with cereals, but now with empty food trays. Total activity during this behavioural test and serum corticosterone levels right after it were similar in all experimental groups. Mice tested in food-paired compartments showed a marked preference for the empty food tray that gradually disappeared in standard diet-fed individuals but persisted in HF-fed mice. HF-fed mice also overexpressed FH, ATP5a1 and TKT, which positively correlated with the persistence of preference for the empty food tray. It is suggested that HF diets combined with food deprivation may enhance food seeking behaviours while upregulating FH/ATP5a1/TKT, which are further envisaged as biomarkers of addiction. © 2016 Society for the Study of Addiction.
Application of recombinant Pediococcus acidilactici BD16 (fcs⁺/ech⁺) in malolactic fermentation.
Kaur, Baljinder; Kumar, Balvir; Kaur, Gaganjot; Chakraborty, Debkumar; Kaur, Kiranjeet
2015-04-01
This study was conducted to enhance flavor characteristics of wine by malolactic fermentation using recombinant Pediococcus acidilactici BD16 (fcs (+)/ech (+)) encoding synthetic genes of feruloyl-CoA synthetase and enoyl-CoA hydratase. After malolactic fermentation, wine phenolics were characterized using LCMS-ESI technique and a significant improvement in the antioxidant activity and flavor characteristics of wine was observed due to increased concentration of cinnamic acid derivatives. This proof of concept study highlights the role of recombinant P. acidilactici BD16 (fcs (+)/ech (+)) in improving flavor as well as aroma of wine due to production of several phenolic derivatives during secondary fermentation. A novel metabolic pathway was predicted from mass spectral analysis data that indicates biotransformation of cinnamic acid and derivatives into apigenin, catechin, coniferyl aldehyde, cyanidin, hydroxybenzoic acids, laricitrin, luteolin, malvidin 3-glucoside, myricetin, naringenin, pelargonin, piceatannol, querecitin, and vanillin that not only increased the overall consumer appreciation but also improved nutritional and probably the therapeutic properties of wines. This is a first evidence-based study where role of recombinant P. acidilactici BD16 (fcs (+)/ech (+)) in the wine secondary fermentation has been elucidated.
Maggio-Hall, Lori A.; Lyne, Paul; Wolff, Jon A.; Keller, Nancy P.
2010-01-01
An acyl-CoA dehydrogenase has been identified as part of the mitochondrial β-oxidation pathway in the ascomycete fungus Aspergillus nidulans. Disruption of the scdA gene prevented use of butyric acid (C4) and hexanoic acid (C6) as carbon sources and reduced cellular butyryl-CoA dehydrogenase activity by 7.5-fold. While the mutant strain exhibited wild-type levels of growth on erucic acid (C22:1) and oleic acid (C18:1), some reduction in growth was observed with myristic acid (C14). The ΔscdA mutation was found to be epistatic to a mutation downstream in the β-oxidation pathway (disruption of enoyl-CoA hydratase). The ΔscdA mutant was also unable to use isoleucine or valine as a carbon source. Transcription of scdA was observed in the presence of either fatty acids or amino acids. When the mutant was grown in medium containing either isoleucine or valine, organic acid analysis of culture supernatants showed accumulation of 2-oxo acid intermediates of branched chain amino acid catabolism, suggesting feedback inhibition of the upstream branched-chain α-keto acid dehydrogenase. PMID:17656140
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.
Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-06-19
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme
Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-01-01
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968
Ethylene and 1-MCP regulate major volatile biosynthetic pathways in apple fruit.
Yang, Xiaotang; Song, Jun; Du, Lina; Forney, Charles; Campbell-Palmer, Leslie; Fillmore, Sherry; Wismer, Paul; Zhang, Zhaoqi
2016-03-01
The effects of ethylene and 1-methylcyclopropene (1-MCP) on apple fruit volatile biosynthesis and gene expression were investigated. Statistical analysis identified 17 genes that changed significantly in response to ethylene and 1-MCP treatments. Genes encoding branched-chain amino acid aminotransferase (BCAT), aromatic amino acid aminotransferase (ArAT) and amino acid decarboxylases (AADC) were up-regulated during ripening and further enhanced by ethylene treatment. Genes related to fatty acid synthesis and metabolism, including acyl-carrier-proteins (ACPs), malonyl-CoA:ACP transacylase (MCAT), acyl-ACP-desaturase (ACPD), lipoxygenase (LOX), hydroperoxide lyase (HPL), alcohol dehydrogenase (ADH), pyruvate decarboxylase (PDC2), β-oxidation, acyl-CoA synthetase (ACS), enoyl-CoA hydratase (ECHD), acyl-CoA dehydrogenase (ACAD), and alcohol acyltransferases (AATs) also increased during ripening and in response to ethylene treatment. Allene oxide synthase (AOS), alcohol dehydrogenase 1 (ADH1), 3-ketoacyl-CoA thiolase and branched-chain amino acid aminotransferase 2 (BCAT2) decreased in ethylene-treated fruit. Treatment with 1-MCP and ethylene generally produced opposite effects on related genes, which provides evidence that regulation of these genes is ethylene dependent. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ness, Gene C., E-mail: gness@hsc.usf.edu; Edelman, Jeffrey L.; Brooks, Patricia A.
2012-03-30
Highlights: Black-Right-Pointing-Pointer siRNAs to tristetraprolin blocks transcription of HMGR in vivo in rat liver. Black-Right-Pointing-Pointer siRNAs to tristetraprolin inhibits insulin activation of HMGR transcription. Black-Right-Pointing-Pointer Insulin acts to rapidly increase tristetraprolin in liver nuclear extracts. -- Abstract: Several AU-rich RNA binding element (ARE) proteins were investigated for their possible effects on transcription of hepatic 3-hydroxy-3-methyglutaryl coenzyme A reductase (HMGR) in normal rats. Using in vivo electroporation, four different siRNAs to each ARE protein were introduced together with HMGR promoter (-325 to +20) luciferase construct and compared to saline controls. All four siRNAs to tristetraprolin (TTP) completely eliminated transcription from themore » HMGR promoter construct. Since insulin acts to rapidly increase hepatic HMGR transcription, the effect of TTP siRNA on induction by insulin was tested. The 3-fold stimulation by insulin was eliminated by this treatment. In comparison, siRNA to AU RNA binding protein/enoyl coenzyme A hydratase (AUH) had no effect. These findings indicate a role for TTP in the insulin-mediated activation of hepatic HMGR transcription.« less
Li, Chunyan; Sun, Yueling; Yue, Zhenlei; Huang, Mingyan; Wang, Jinming; Chen, Xi; An, Xuejiao; Zang, Hailian; Li, Dapeng; Hou, Ning
2018-04-10
The immobilization of organonitrile-degrading bacteria via the addition of biofilm-forming bacteria represents a promising technology for the treatment of organonitrile-containing wastewater, but biofilm-forming bacteria simply mixed with degrading bacteria may reduce the biodegradation efficiency. Nitrile hydratase and amidase genes, which play critical roles in organonitriles degradation, were cloned and transformed into the biofilm-forming bacterium Bacillus subtilis N4 to construct a recombinant bacterium B. subtilis N4/pHTnha-ami. Modified polyethylene carriers with positive charge was applied to promote bacterial adherence and biofilm formation. The immobilized B. subtilis N4/pHTnha-ami was resistant to organonitriles loading shocks and could remove organic cyanide ion with a initial concentration of 392.6 mg/L for 24 h in a moving bed biofilm reactor. The imputed quorum-sensing signal and the high-throughput sequencing analysis of the biofilm indicated that B. subtilis N4/pHTnha-ami was successfully immobilized and became dominant. The successful application of the immobilized recombinant bacterium offers a novel strategy for the biodegradation of recalcitrant compounds. Copyright © 2018 Elsevier B.V. All rights reserved.
Li, Huei-Jiun; Li, Xiaokai; Liu, Nina; Zhang, Huaning; Truglio, James J; Mishra, Shambhavi; Kisker, Caroline; Garcia-Diaz, Miguel; Tonge, Peter J
2011-11-08
MenB, the 1,4-dihydroxy-2-naphthoyl-CoA synthase from the bacterial menaquinone biosynthesis pathway, catalyzes an intramolecular Claisen condensation (Dieckmann reaction) in which the electrophile is an unactivated carboxylic acid. Mechanistic studies on this crotonase family member have been hindered by partial active site disorder in existing MenB X-ray structures. In the current work the 2.0 Å structure of O-succinylbenzoyl-aminoCoA (OSB-NCoA) bound to the MenB from Escherichia coli provides important insight into the catalytic mechanism by revealing the position of all active site residues. This has been accomplished by the use of a stable analogue of the O-succinylbenzoyl-CoA (OSB-CoA) substrate in which the CoA thiol has been replaced by an amine. The resulting OSB-NCoA is stable, and the X-ray structure of this molecule bound to MenB reveals the structure of the enzyme-substrate complex poised for carbon-carbon bond formation. The structural data support a mechanism in which two conserved active site Tyr residues, Y97 and Y258, participate directly in the intramolecular transfer of the substrate α-proton to the benzylic carboxylate of the substrate, leading to protonation of the electrophile and formation of the required carbanion. Y97 and Y258 are also ideally positioned to function as the second oxyanion hole required for stabilization of the tetrahedral intermediate formed during carbon-carbon bond formation. In contrast, D163, which is structurally homologous to the acid-base catalyst E144 in crotonase (enoyl-CoA hydratase), is not directly involved in carbanion formation and may instead play a structural role by stabilizing the loop that carries Y97. When similar studies were performed on the MenB from Mycobacterium tuberculosis, a twisted hexamer was unexpectedly observed, demonstrating the flexibility of the interfacial loops that are involved in the generation of the novel tertiary and quaternary structures found in the crotonase superfamily. This work reinforces the utility of using a stable substrate analogue as a mechanistic probe in which only one atom has been altered leading to a decrease in α-proton acidity.
Muller, Marie; Guillaud-Bataille, Marine; Salleron, Julia; Genestie, Catherine; Deveaux, Sophie; Slama, Abdelhamid; de Paillerets, Brigitte Bressac; Richard, Stéphane; Benusiglio, Patrick R; Ferlicot, Sophie
2018-02-06
Hereditary leiomyomatosis and renal cell carcinoma syndrome is characterized by an increased risk of agressive renal cell carcinoma, often of type 2 papillary histology, and is caused by FH germline mutations. A prominent eosinophilic macronucleolus with a perinucleolar clear halo is distinctive of hereditary leiomyomatosis and renal cell carcinoma syndrome-associated renal cell carcinoma according to the 2012 ISUP and 2016 WHO kidney tumor classification. From an immunohistochemistry perspective, tumors are often FH-negative and S-(2-succino)-cysteine (2SC) positive. We performed a pathology review of 24 renal tumors in 23 FH mutation carriers, and compared them to 12 type 2 papillary renal cell carcinomas from FH wild-type patients. Prominent eosinophilic nucleoli with perinucleolar halos were present in almost all FH-deficient renal cell carcinomas (23/24). Unexpectedly, they were also present in 58% of type 2 papillary renal cell carcinomas from wild-type patients. Renal cell carcinoma in mutation carriers displayed a complex architecture with multiple patterns, typically papillary, tubulopapillary, and tubulocystic, but also sarcomatoid and rhabdoid. Such pattern diversity was not seen in non-carriers. FH/2SC immunohistochemistry was informative as all hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas were either FH- or 2SC+. For FH and 2SC immunohistochemistries taken separately, sensitivity of negative anti-FH immunohistochemistry was 87.5% and specificity was 100%. For positive anti-2SC immunohistochemistry, sensitivity, and specificity were 91.7% and 91.7%, respectively. All FH wild-type renal cell carcinoma were FH-positive, and all but one were 2SC-negative. In conclusion, multiplicity of architectural patterns, rhabdoid/sarcomatoid components and combined FH/2SC staining, but not prominent eosinophilic nucleoli with perinucleolar halos, differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinoma from type 2 papillary renal cell carcinoma with efficient FH gene. Our findings are crucial in identifying who should be referred to Cancer Genetics clinics for genetic counseling and testing.
2010-01-01
Background Fumarase catalyzes the reversible hydration of fumarate to L-malate and is a key enzyme in the tricarboxylic acid (TCA) cycle and in amino acid metabolism. Fumarase is also used for the industrial production of L-malate from the substrate fumarate. Thermostable and high-activity fumarases from organisms that inhabit extreme environments may have great potential in industry, biotechnology, and basic research. The marine environment is highly complex and considered one of the main reservoirs of microbial diversity on the planet. However, most of the microorganisms are inaccessible in nature and are not easily cultivated in the laboratory. Metagenomic approaches provide a powerful tool to isolate and identify enzymes with novel biocatalytic activities for various biotechnological applications. Results A plasmid metagenomic library was constructed from uncultivated marine microorganisms within marine water samples. Through sequence-based screening of the DNA library, a gene encoding a novel fumarase (named FumF) was isolated. Amino acid sequence analysis revealed that the FumF protein shared the greatest homology with Class II fumarate hydratases from Bacteroides sp. 2_1_33B and Parabacteroides distasonis ATCC 8503 (26% identical and 43% similar). The putative fumarase gene was subcloned into pETBlue-2 vector and expressed in E. coli BL21(DE3)pLysS. The recombinant protein was purified to homogeneity. Functional characterization by high performance liquid chromatography confirmed that the recombinant FumF protein catalyzed the hydration of fumarate to form L-malate. The maximum activity for FumF protein occurred at pH 8.5 and 55°C in 5 mM Mg2+. The enzyme showed higher affinity and catalytic efficiency under optimal reaction conditions: Km= 0.48 mM, Vmax = 827 μM/min/mg, and kcat/Km = 1900 mM/s. Conclusions We isolated a novel fumarase gene, fumF, from a sequence-based screen of a plasmid metagenomic library from uncultivated marine microorganisms. The properties of FumF protein may be ideal for the industrial production of L-malate under higher temperature conditions. The identification of FumF underscores the potential of marine metagenome screening for novel biomolecules. PMID:21092234
Lochmeyer, C; Koch, J; Fuchs, G
1992-01-01
The enzymes catalyzing the initial reactions in the anaerobic degradation of 2-aminobenzoic acid (anthranilic acid) were studied with a denitrifying Pseudomonas sp. anaerobically grown with 2-aminobenzoate and nitrate as the sole carbon and energy sources. Cells grown on 2-aminobenzoate are simultaneously adapted to growth with benzoate, whereas cells grown on benzoate degrade 2-aminobenzoate several times less efficiently than benzoate. Evidence for a new reductive pathway of aromatic metabolism and for four enzymes catalyzing the initial steps is presented. The organism contains 2-aminobenzoate-coenzyme A ligase (2-aminobenzoate-CoA ligase), which forms 2-aminobenzoyl-CoA. 2-Aminobenzoyl-CoA is then reductively deaminated to benzoyl-CoA by an oxygen-sensitive enzyme, 2-aminobenzoyl-CoA reductase (deaminating), which requires a low potential reductant [Ti(III)]. The specific activity is 15 nmol of 2-aminobenzoyl-CoA reduced min-1 mg-1 of protein at an optimal pH of 7. The two enzymes are induced by the substrate under anaerobic conditions only. Benzoyl-CoA is further converted in vitro by reduction with Ti(III) to six products; the same products are formed when benzoyl-CoA or 2-aminobenzoyl-CoA is incubated under reducing conditions. Two of them were identified preliminarily. One product is cyclohex-1-enecarboxyl-CoA, the other is trans-2-hydroxycyclohexane-carboxyl-CoA. The complex transformation of benzoyl-CoA is ascribed to at least two enzymes, benzoyl-CoA reductase (aromatic ring reducing) and cyclohex-1-enecarboxyl-CoA hydratase. The reduction of benzoyl-CoA to alicyclic compounds is catalyzed by extracts from cells grown anaerobically on either 2-aminobenzoate or benzoate at almost the same rate (10 to 15 nmol min-1 mg-1 of protein). In contrast, extracts from cells grown anaerobically on acetate or grown aerobically on benzoate or 2-aminobenzoate are inactive. This suggests a sequential induction of the enzymes. Images PMID:1592816
Lochmeyer, C; Koch, J; Fuchs, G
1992-06-01
The enzymes catalyzing the initial reactions in the anaerobic degradation of 2-aminobenzoic acid (anthranilic acid) were studied with a denitrifying Pseudomonas sp. anaerobically grown with 2-aminobenzoate and nitrate as the sole carbon and energy sources. Cells grown on 2-aminobenzoate are simultaneously adapted to growth with benzoate, whereas cells grown on benzoate degrade 2-aminobenzoate several times less efficiently than benzoate. Evidence for a new reductive pathway of aromatic metabolism and for four enzymes catalyzing the initial steps is presented. The organism contains 2-aminobenzoate-coenzyme A ligase (2-aminobenzoate-CoA ligase), which forms 2-aminobenzoyl-CoA. 2-Aminobenzoyl-CoA is then reductively deaminated to benzoyl-CoA by an oxygen-sensitive enzyme, 2-aminobenzoyl-CoA reductase (deaminating), which requires a low potential reductant [Ti(III)]. The specific activity is 15 nmol of 2-aminobenzoyl-CoA reduced min-1 mg-1 of protein at an optimal pH of 7. The two enzymes are induced by the substrate under anaerobic conditions only. Benzoyl-CoA is further converted in vitro by reduction with Ti(III) to six products; the same products are formed when benzoyl-CoA or 2-aminobenzoyl-CoA is incubated under reducing conditions. Two of them were identified preliminarily. One product is cyclohex-1-enecarboxyl-CoA, the other is trans-2-hydroxycyclohexane-carboxyl-CoA. The complex transformation of benzoyl-CoA is ascribed to at least two enzymes, benzoyl-CoA reductase (aromatic ring reducing) and cyclohex-1-enecarboxyl-CoA hydratase. The reduction of benzoyl-CoA to alicyclic compounds is catalyzed by extracts from cells grown anaerobically on either 2-aminobenzoate or benzoate at almost the same rate (10 to 15 nmol min-1 mg-1 of protein). In contrast, extracts from cells grown anaerobically on acetate or grown aerobically on benzoate or 2-aminobenzoate are inactive. This suggests a sequential induction of the enzymes.
Bhopale, Kamlesh K; Amer, Samir M; Kaphalia, Lata; Soman, Kizhake V; Wiktorowicz, John E; Shakeel Ansari, Ghulam A; Kaphalia, Bhupendra S
2017-10-01
Chronic alcohol abuse, a major risk factor for such diseases as hepatitis and cirrhosis, impairs hepatic alcohol dehydrogenase (ADH; key ethanol [EtOH]-metabolizing enzyme). Therefore, differentially altered hepatic and plasma proteomes were identified in chronic EtOH feeding model of hepatic ADH-deficient (ADH - ) deer mice to understand the metabolic basis of alcoholic liver disease (ALD). ADH - deer mice were fed 3.5 g% EtOH via Lieber-DeCarli liquid diet daily for 3 months and histology of the liver assessed. Liver and plasma proteins were separated by 2-dimensional gel electrophoresis. The proteins differentially expressed were identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry. Histology of the liver showed panlobular steatosis and infiltration of T lymphocytes. Using the criteria of ≥1.5 for fold change (p-value ≤0.05) with expectation value (E ≤10 -3 ) and protein score (≥64), 18 proteins in the livers and 5 in the plasma of EtOH-fed mice were differentially expressed and identified. Prolyl 4-hydroxylase, cytochrome b-5, endo A cytokeratin, ATP synthase, heat-shock 70 kD proteins, enoyl CoA hydratase, stress-70 protein, peroxiredoxin 1, and ornithine carbamoyl transferase were up-regulated in the livers. However, carbonic anhydrase 3, mitochondrial ATP synthase, aldolase 2, actin γ, laminin receptor, and carbamoyl phosphate synthase were down-regulated. Contrary to the increased expression of creatine kinase M-type, a decreased expression of serine protease inhibitor A3A precursor, sulfated glycoprotein-2 (clusterin), and apolipoprotein E isoforms were found in the plasma of EtOH group. Chronic EtOH feeding in ADH - deer mice causes steatosis and infiltration of T lymphocytes in the livers along with increased expression of proteins involved in endoplasmic reticulum (ER) stress, fibrosis, fatty acid β oxidation and biogenesis, and decreased expression of proteins involved in ATP synthesis, carbohydrate metabolism, in cell regulation and architecture. Reduced expression of various carrier proteins as found in the plasma of EtOH group has a biomarker potential. Copyright © 2017 by the Research Society on Alcoholism.
Lu, Xiao-Ming; Chen, Chang; Zheng, Tian-Ling
2017-05-01
Pyrosequencing and metagenomic profiling were used to assess the phylogenetic and functional characteristics of microbial communities residing in sediments collected from the estuaries of Rivers Oujiang (OS) and Jiaojiang (JS) in the western region of the East China Sea. Another sediment sample was obtained from near the shore far from estuaries, used for contrast (CS). Characterization of estuary sediment bacterial communities showed that toxic chemicals potentially reduced the natural variability in microbial communities, while they increased the microbial metabolic enzymes and pathways. Polycyclic aromatic hydrocarbons (PAHs) and nitrobenzene were negatively correlated with the bacterial community variation. The dominant class in the sediments was Gammaproteobacteria. According to Kyoto Encyclopedia of Genes and Genomes (KEGG) enzyme profiles, dominant enzymes were found in estuarine sediments, which increased greatly, such as 2-oxoglutarate synthase, acetolactate synthase, inorganic diphosphatase, and aconitate hydratase. In KEGG pathway profiles, most of the pathways were also dominated by specific metabolism in these sediments and showed a marked increase, for instance alanine, aspartate, and glutamate metabolism, carbon fixation pathways in prokaryotes, and aminoacyl-tRNA biosynthesis. The estuarine sediment bacterial diversity varied with the polluted river water inputs. In the estuary receiving river water from the more seriously polluted River Oujiang, the sediment bacterial community function was more severely affected.
Wan, Rui; Chen, Yinguang; Zheng, Xiong; Su, Yinglong; Huang, Haining
2018-06-15
The potential effect of CO 2 on environmental microbes has drawn much attention recently. As an important section of the nitrogen cycle, biological denitrification requires electron donor to reduce nitrogen oxide. Nicotinamide adenine dinucleotide (NADH), which is formed during carbon source metabolism, is a widely reported electron donor for denitrification. Here we studied the effect of CO 2 on NADH production and carbon source utilization in the denitrifying microbe Paracoccus denitrificans. We observed that NADH level was decreased by 45.5% with the increase of CO 2 concentration from 0 to 30,000ppm, which was attributed to the significantly decreased utilization of carbon source (i.e., acetate). Further study showed that CO 2 inhibited carbon source utilization because of multiple negative influences: (1) suppressing the growth and viability of denitrifier cells, (2) weakening the driving force for carbon source transport by decreasing bacterial membrane potential, and (3) downregulating the expression of genes encoding key enzymes involved in intracellular carbon metabolism, such as citrate synthase, aconitate hydratase, isocitrate dehydrogenase, succinate dehydrogenase, and fumarate reductase. This study suggests that the inhibitory effect of CO 2 on NADH production in denitrifiers might deteriorate the denitrification performance in an elevated CO 2 climate scenario. Copyright © 2018 Elsevier B.V. All rights reserved.
The Succinated Proteome of FH-Mutant Tumours
Yang, Ming; Ternette, Nicola; Su, Huizhong; Dabiri, Raliat; Kessler, Benedikt M.; Adam, Julie; Teh, Bin Tean; Pollard, Patrick J.
2014-01-01
Inherited mutations in the Krebs cycle enzyme fumarate hydratase (FH) predispose to hereditary leiomyomatosis and renal cell cancer (HLRCC). Loss of FH activity in HLRCC tumours causes accumulation of the Krebs cycle intermediate fumarate to high levels, which may act as an oncometabolite through various, but not necessarily mutually exclusive, mechanisms. One such mechanism, succination, is an irreversible non-enzymatic modification of cysteine residues by fumarate, to form S-(2-succino)cysteine (2SC). Previous studies have demonstrated that succination of proteins including glyceraldehyde 3-phosphate dehydrogenase (GAPDH), kelch-like ECH-associated protein 1 (KEAP1) and mitochondrial aconitase (ACO2) can have profound effects on cellular metabolism. Furthermore, immunostaining for 2SC is a sensitive and specific biomarker for HLRCC tumours. Here, we performed a proteomic screen on an FH-mutant tumour and two HLRCC-derived cancer cell lines and identified 60 proteins where one or more cysteine residues were succinated; 10 of which were succinated at cysteine residues either predicted, or experimentally proven, to be functionally significant. Bioinformatic enrichment analyses identified most succinated targets to be involved in redox signaling. To our knowledge, this is the first proteomic-based succination screen performed in human tumours and cancer-derived cells and has identified novel 2SC targets that may be relevant to the pathogenesis of HLRCC. PMID:25105836
Takahashi, Megumi; Wolf, Alexander M; Watari, Eiji; Norose, Yoshihiko; Ohta, Shigeo; Takahashi, Hidemi
2013-09-01
Measles virus (MV) is known for its ability to cause an acute infection with a potential of development of persistent infection. However, knowledge of how viral genes and cellular factors interact to cause or maintain the persistent infection has remained unclear. We have previously reported the possible involvement of mitochondrial short chain enoyl-CoA hydratase (ECHS), which is localized at mitochondria, in the regulation of MV replication. In this study we found increased functions of mitochondria in MV-persistently infected cells compared with uninfected or acutely infected cells. Furthermore, impairment of mitochondrial functions by treatment with mitochondrial inhibitors such as ethidium bromide (EtBr) or carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) induced the cytopathic effects of extensive syncytial formation in persistently infected cells. These findings suggest that mitochondria are one of the subcellular organelles contributing to regulate persistent infection of MV. Recent studies showed mitochondria provide an integral platform for retinoic acid-inducible protein (RIG-I)-like cytosolic receptors (RLRs) signaling and participate in cellular innate antiviral immunity. Our findings not only reveal a role of mitochondria in RLR mediated antiviral signaling but also suggest that mitochondria contribute to the regulation of persistent viral infection. Copyright © 2013 Elsevier B.V. All rights reserved.
On the Way to Appropriate Model Complexity
NASA Astrophysics Data System (ADS)
Höge, M.
2016-12-01
When statistical models are used to represent natural phenomena they are often too simple or too complex - this is known. But what exactly is model complexity? Among many other definitions, the complexity of a model can be conceptualized as a measure of statistical dependence between observations and parameters (Van der Linde, 2014). However, several issues remain when working with model complexity: A unique definition for model complexity is missing. Assuming a definition is accepted, how can model complexity be quantified? How can we use a quantified complexity to the better of modeling? Generally defined, "complexity is a measure of the information needed to specify the relationships between the elements of organized systems" (Bawden & Robinson, 2015). The complexity of a system changes as the knowledge about the system changes. For models this means that complexity is not a static concept: With more data or higher spatio-temporal resolution of parameters, the complexity of a model changes. There are essentially three categories into which all commonly used complexity measures can be classified: (1) An explicit representation of model complexity as "Degrees of freedom" of a model, e.g. effective number of parameters. (2) Model complexity as code length, a.k.a. "Kolmogorov complexity": The longer the shortest model code, the higher its complexity (e.g. in bits). (3) Complexity defined via information entropy of parametric or predictive uncertainty. Preliminary results show that Bayes theorem allows for incorporating all parts of the non-static concept of model complexity like data quality and quantity or parametric uncertainty. Therefore, we test how different approaches for measuring model complexity perform in comparison to a fully Bayesian model selection procedure. Ultimately, we want to find a measure that helps to assess the most appropriate model.
Zhang, Peng; Sun, Hongwen; Min, Lujuan; Ren, Chao
2018-05-01
One interest of using biochar as soil amendment is to reduce pesticide adverse effects. In this paper, the sorption and degradation of thiacloprid (THI) in a black soil amended by various biochars were systematically investigated, and the mechanisms therein were explored by analyzing the changes in soil physicochemical properties, degrading enzymes and genes and microorganism community. Biochar amendment increased THI sorption in soil, which was associated with an increase in organic carbon and surface area and a decrease in H/C. Amendments of 300-PT (pyrolyzing temperature) biochar promoted the biodegradation of THI by increasing the microbe abundance and improving nitrile hydratase (NHase) activity. In contrast, 500- and 700-PT biochar amendments inhibited biodegradation by reducing THI availability and changing NHase activity and THI-degradative nth gene abundance, and instead promoted chemical degradation mainly through elevated pH, active groups on mineral surface and generation of •OH and other free radicals. Furthermore, THI shifted the soil microbial community, stimulated the NHase activity and elevated nth gene abundance. Biochar amendments also changed soil bacterial community by modulating soil pH, dissolved organic matter and nitrogen and phosphorus levels, which further influenced THI biodegradation. Therefore, the impact of biochars on the fate of a pesticide in soil depends greatly on their type and properties, which should be comprehensively examined when applying biochar to soil. Copyright © 2018 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Widner, B.; Fuchsman, C. A.; Babbin, A. R.; Ji, Q.; Mulholland, M. R.
2016-02-01
Urea and cyanate are reduced nitrogen compounds that can serve as nitrogen and carbon sources for marine microbes, and cyanate forms from decomposition of urea. Some marine bacteria, including cyanobacteria, possess genes encoding an ABC-type cyanate transporter and an intracellular cyanate hydratase, and genes for urea uptake and assimilation are widespread. To investigate cyanate distribution and availability in the ocean, we recently developed a nanomolar cyanate assay specific to seawater. In an oxygenated water column, urea and cyanate concentrations are generally low in surface waters and exhibit a concentration maximum near the base of the euphotic zone likely due to production from organic matter degradation. Below the euphotic zone, urea and cyanate concentrations decrease, likely due to oxidation reactions. It has been suggested that simple organic nitrogen compounds may support anaerobic ammonium oxidation (anammox) in oxygen deficient zones (ODZs). We mapped urea and cyanate distributions and used stable isotope-labeled urea and cyanate to measure their potential support of anammox and their uptake within the Eastern Tropical North and South Pacific ODZs. We also employed metagenomic techniques to determine the abundance and distribution of genes for the uptake and assimilation of urea and cyanate. The combined data indicate that, in ODZs, urea is used primarily as a nitrogen source while cyanate is used as both a nitrogen source and to generate energy.
Schmidt, Annika; Hammerbacher, Anna Silke; Bastian, Mike; Nieken, Karen Jule; Klockgether, Jens; Merighi, Massimo; Lapouge, Karine; Poschgan, Claudia; Kölle, Julia; Acharya, K Ravi; Ulrich, Martina; Tümmler, Burkhard; Unden, Gottfried; Kaever, Volkhard; Lory, Stephen; Haas, Dieter; Schwarz, Sandra; Döring, Gerd
2016-10-01
Pseudomonas aeruginosa produces increased levels of alginate in response to oxygen-deprived conditions. The regulatory pathway(s) that links oxygen limitation to increased synthesis of alginate has remained elusive. In the present study, using immunofluorescence microscopy, we show that anaerobiosis-induced alginate production by planktonic PAO1 requires the diguanylate cyclase (DGC) SadC, previously identified as a regulator of surface-associated lifestyles. Furthermore, we found that the gene products of PA4330 and PA4331, located in a predicted operon with sadC, have a major impact on alginate production: deletion of PA4330 (odaA, for oxygen-dependent alginate synthesis activator) caused an alginate production defect under anaerobic conditions, whereas a PA4331 (odaI, for oxygen-dependent alginate synthesis inhibitor) deletion mutant produced alginate also in the presence of oxygen, which would normally inhibit alginate synthesis. Based on their sequence, OdaA and OdaI have predicted hydratase and dioxygenase reductase activities, respectively. Enzymatic assays using purified protein showed that unlike OdaA, which did not significantly affect DGC activity of SadC, OdaI inhibited c-di-GMP production by SadC. Our data indicate that SadC, OdaA and OdaI are components of a novel response pathway of P. aeruginosa that regulates alginate synthesis in an oxygen-dependent manner. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni
2014-01-01
Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623
Byrne, Cillian; Houlihan, Kate M; Devi, Prarthana; Jensen, Paul; Rutledge, Peter J
2014-12-12
Nitrile hydratase (NHase, EC 4.2.1.84) is a metalloenzyme which catalyses the conversion of nitriles to amides. The high efficiency and broad substrate range of NHase have led to the successful application of this enzyme as a biocatalyst in the industrial syntheses of acrylamide and nicotinamide and in the bioremediation of nitrile waste. Crystal structures of both cobalt(III)- and iron(III)-dependent NHases reveal an unusual metal binding motif made up from six sequential amino acids and comprising two amide nitrogens from the peptide backbone and three cysteine-derived sulfur ligands, each at a different oxidation state (thiolate, sulfenate and sulfinate). Based on the active site geometry revealed by these crystal structures, we have designed a series of small-molecule ligands which integrate essential features of the NHase metal binding motif into a readily accessible peptide environment. We report the synthesis of ligands based on a pyridine-2,6-dicarboxylic acid scaffold and L-cysteine, L-S-methylcysteine, L-methionine or L-penicillamine. These ligands have been combined with cobalt(III) and iron(III) and tested as catalysts for biomimetic nitrile hydration. The highest levels of activity are observed with the L-penicillamine ligand which, in combination with cobalt(III), converts acetonitrile to acetamide at 1.25 turnovers and benzonitrile to benzamide at 1.20 turnovers.
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition
Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian
2016-01-01
Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029
Fluoranthene metabolism and associated proteins in Mycobacterium sp. JS14.
Lee, Sung-Eun; Seo, Jong-Su; Keum, Young-Soo; Lee, Kwang-Jun; Li, Qing X
2007-06-01
Fluoranthene is a polycyclic aromatic hydrocarbon (PAH) commonly present in PAH-contaminated soils. We studied fluoranthene catabolism and associated proteins in Mycobacterium sp. JS14, a bacterium isolated from a PAH-contaminated soil in Hilo (HI, USA). Fluoranthene degrades in at least three separated pathways via 1-indanone, 2',3'-dihydroxybiphenyl-2,3,-dicarboxylic acid, and naphthalene-1,8-dicarboxylic acid. Part of the diverse catabolism is converged into phthalate catabolism. An increased expression of 25 proteins related to fluoranthene catabolism is found with 1-D PAGE or 2-DE and nano-LC-MS/MS. Detection of fluoranthene catabolism associated proteins coincides well with its multiple degradation pathways that are mapped via metabolites identified. Among the up-regulated proteins, PAH ring-hydroxylating dioxygenase alpha-subunit and beta-subunit and 2,3-dihydroxybiphenyl 1,2-dioxygenase are notably induced. The up-regulation of trans-2-carboxybenzalpyruvate hydratase suggests that some of fluoranthene metabolites may be further degraded through aromatic dicarboxylic acid pathways. Catalase and superoxide dismutase were up-regulated to control unexpected oxidative stress during the fluoranthene catabolism. The up-regulation of chorismate synthase and nicotine-nucleotide phosphorylase may be necessary for sustaining shikimate pathway and pyrimidine biosynthesis, respectively. A fluoranthene degradation pathway for Mycobacterium sp. JS14 was proposed and confirmed by proteomic study by identifying almost all the enzymes required during the initial steps of fluoranthene degradation.
Pierce, G E; Drago, G K; Ganguly, S; Tucker, T-A M; Hooker, J W; Jones, S; Crow, S A
2011-09-01
Despite the use of refrigeration, improved packaging, adsorbents, and ethylene receptor blockers, on average, nearly 40% of all fruits and vegetables harvested in the US are not consumed. Many plant products, especially fruit, continue to ripen after harvesting, and as they do so, become increasingly susceptible to mechanical injury, resulting in increased rot. Other plant products during transportation and storage are susceptible to chill injury (CI). There is a real need for products that can delay ripening or mitigate the effects of CI, yet still permit full ripeness and quality to be achieved. Preliminary results are discussed where catalyst derived from cells of Rhodococcus rhodochrous DAP 96253, grown under conditions that induced high levels of nitrile hydratase, were able to extend the ripening and thus the shelf-life of selected climacteric fruits (banana, avocado, and peach). A catalyst, when placed in proximity to, but not touching, the test fruit delayed the ripening but did not alter the final ripeness of the fruit tested. Organoleptic evaluations conducted with control peaches and with peaches exposed to, but not in contact with, the catalyst showed that the catalyst-treated peaches achieved full, natural levels of ripeness with respect to aroma, flavor, sweetness, and juice content. Furthermore, the results of delayed ripening were achieved at ambient temperatures (without the need for refrigeration).
Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.
Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng
2016-09-01
Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus.
Elements of complexity in subsurface modeling, exemplified with three case studies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freedman, Vicky L.; Truex, Michael J.; Rockhold, Mark
2017-04-03
There are complexity elements to consider when applying subsurface flow and transport models to support environmental analyses. Modelers balance the benefits and costs of modeling along the spectrum of complexity, taking into account the attributes of more simple models (e.g., lower cost, faster execution, easier to explain, less mechanistic) and the attributes of more complex models (higher cost, slower execution, harder to explain, more mechanistic and technically defensible). In this paper, modeling complexity is examined with respect to considering this balance. The discussion of modeling complexity is organized into three primary elements: 1) modeling approach, 2) description of process, andmore » 3) description of heterogeneity. Three examples are used to examine these complexity elements. Two of the examples use simulations generated from a complex model to develop simpler models for efficient use in model applications. The first example is designed to support performance evaluation of soil vapor extraction remediation in terms of groundwater protection. The second example investigates the importance of simulating different categories of geochemical reactions for carbon sequestration and selecting appropriate simplifications for use in evaluating sequestration scenarios. In the third example, the modeling history for a uranium-contaminated site demonstrates that conservative parameter estimates were inadequate surrogates for complex, critical processes and there is discussion on the selection of more appropriate model complexity for this application. All three examples highlight how complexity considerations are essential to create scientifically defensible models that achieve a balance between model simplification and complexity.« less
Elements of complexity in subsurface modeling, exemplified with three case studies
NASA Astrophysics Data System (ADS)
Freedman, Vicky L.; Truex, Michael J.; Rockhold, Mark L.; Bacon, Diana H.; Freshley, Mark D.; Wellman, Dawn M.
2017-09-01
There are complexity elements to consider when applying subsurface flow and transport models to support environmental analyses. Modelers balance the benefits and costs of modeling along the spectrum of complexity, taking into account the attributes of more simple models (e.g., lower cost, faster execution, easier to explain, less mechanistic) and the attributes of more complex models (higher cost, slower execution, harder to explain, more mechanistic and technically defensible). In this report, modeling complexity is examined with respect to considering this balance. The discussion of modeling complexity is organized into three primary elements: (1) modeling approach, (2) description of process, and (3) description of heterogeneity. Three examples are used to examine these complexity elements. Two of the examples use simulations generated from a complex model to develop simpler models for efficient use in model applications. The first example is designed to support performance evaluation of soil-vapor-extraction remediation in terms of groundwater protection. The second example investigates the importance of simulating different categories of geochemical reactions for carbon sequestration and selecting appropriate simplifications for use in evaluating sequestration scenarios. In the third example, the modeling history for a uranium-contaminated site demonstrates that conservative parameter estimates were inadequate surrogates for complex, critical processes and there is discussion on the selection of more appropriate model complexity for this application. All three examples highlight how complexity considerations are essential to create scientifically defensible models that achieve a balance between model simplification and complexity.
Hydrological model parameter dimensionality is a weak measure of prediction uncertainty
NASA Astrophysics Data System (ADS)
Pande, S.; Arkesteijn, L.; Savenije, H.; Bastidas, L. A.
2015-04-01
This paper shows that instability of hydrological system representation in response to different pieces of information and associated prediction uncertainty is a function of model complexity. After demonstrating the connection between unstable model representation and model complexity, complexity is analyzed in a step by step manner. This is done measuring differences between simulations of a model under different realizations of input forcings. Algorithms are then suggested to estimate model complexity. Model complexities of the two model structures, SAC-SMA (Sacramento Soil Moisture Accounting) and its simplified version SIXPAR (Six Parameter Model), are computed on resampled input data sets from basins that span across the continental US. The model complexities for SIXPAR are estimated for various parameter ranges. It is shown that complexity of SIXPAR increases with lower storage capacity and/or higher recession coefficients. Thus it is argued that a conceptually simple model structure, such as SIXPAR, can be more complex than an intuitively more complex model structure, such as SAC-SMA for certain parameter ranges. We therefore contend that magnitudes of feasible model parameters influence the complexity of the model selection problem just as parameter dimensionality (number of parameters) does and that parameter dimensionality is an incomplete indicator of stability of hydrological model selection and prediction problems.
40 CFR 80.49 - Fuels to be used in augmenting the complex emission model through vehicle testing.
Code of Federal Regulations, 2014 CFR
2014-07-01
... complex emission model through vehicle testing. 80.49 Section 80.49 Protection of Environment... Reformulated Gasoline § 80.49 Fuels to be used in augmenting the complex emission model through vehicle testing... augmenting the complex emission model with a parameter not currently included in the complex emission model...
40 CFR 80.49 - Fuels to be used in augmenting the complex emission model through vehicle testing.
Code of Federal Regulations, 2013 CFR
2013-07-01
... complex emission model through vehicle testing. 80.49 Section 80.49 Protection of Environment... Reformulated Gasoline § 80.49 Fuels to be used in augmenting the complex emission model through vehicle testing... augmenting the complex emission model with a parameter not currently included in the complex emission model...
40 CFR 80.49 - Fuels to be used in augmenting the complex emission model through vehicle testing.
Code of Federal Regulations, 2011 CFR
2011-07-01
... complex emission model through vehicle testing. 80.49 Section 80.49 Protection of Environment... Reformulated Gasoline § 80.49 Fuels to be used in augmenting the complex emission model through vehicle testing... augmenting the complex emission model with a parameter not currently included in the complex emission model...
40 CFR 80.49 - Fuels to be used in augmenting the complex emission model through vehicle testing.
Code of Federal Regulations, 2012 CFR
2012-07-01
... complex emission model through vehicle testing. 80.49 Section 80.49 Protection of Environment... Reformulated Gasoline § 80.49 Fuels to be used in augmenting the complex emission model through vehicle testing... augmenting the complex emission model with a parameter not currently included in the complex emission model...
Clinical Complexity in Medicine: A Measurement Model of Task and Patient Complexity.
Islam, R; Weir, C; Del Fiol, G
2016-01-01
Complexity in medicine needs to be reduced to simple components in a way that is comprehensible to researchers and clinicians. Few studies in the current literature propose a measurement model that addresses both task and patient complexity in medicine. The objective of this paper is to develop an integrated approach to understand and measure clinical complexity by incorporating both task and patient complexity components focusing on the infectious disease domain. The measurement model was adapted and modified for the healthcare domain. Three clinical infectious disease teams were observed, audio-recorded and transcribed. Each team included an infectious diseases expert, one infectious diseases fellow, one physician assistant and one pharmacy resident fellow. The transcripts were parsed and the authors independently coded complexity attributes. This baseline measurement model of clinical complexity was modified in an initial set of coding processes and further validated in a consensus-based iterative process that included several meetings and email discussions by three clinical experts from diverse backgrounds from the Department of Biomedical Informatics at the University of Utah. Inter-rater reliability was calculated using Cohen's kappa. The proposed clinical complexity model consists of two separate components. The first is a clinical task complexity model with 13 clinical complexity-contributing factors and 7 dimensions. The second is the patient complexity model with 11 complexity-contributing factors and 5 dimensions. The measurement model for complexity encompassing both task and patient complexity will be a valuable resource for future researchers and industry to measure and understand complexity in healthcare.
Wenchi Jin; Hong S. He; Frank R. Thompson
2016-01-01
Process-based forest ecosystem models vary from simple physiological, complex physiological, to hybrid empirical-physiological models. Previous studies indicate that complex models provide the best prediction at plot scale with a temporal extent of less than 10 years, however, it is largely untested as to whether complex models outperform the other two types of models...
A Systematic Review of Conceptual Frameworks of Medical Complexity and New Model Development.
Zullig, Leah L; Whitson, Heather E; Hastings, Susan N; Beadles, Chris; Kravchenko, Julia; Akushevich, Igor; Maciejewski, Matthew L
2016-03-01
Patient complexity is often operationalized by counting multiple chronic conditions (MCC) without considering contextual factors that can affect patient risk for adverse outcomes. Our objective was to develop a conceptual model of complexity addressing gaps identified in a review of published conceptual models. We searched for English-language MEDLINE papers published between 1 January 2004 and 16 January 2014. Two reviewers independently evaluated abstracts and all authors contributed to the development of the conceptual model in an iterative process. From 1606 identified abstracts, six conceptual models were selected. One additional model was identified through reference review. Each model had strengths, but several constructs were not fully considered: 1) contextual factors; 2) dynamics of complexity; 3) patients' preferences; 4) acute health shocks; and 5) resilience. Our Cycle of Complexity model illustrates relationships between acute shocks and medical events, healthcare access and utilization, workload and capacity, and patient preferences in the context of interpersonal, organizational, and community factors. This model may inform studies on the etiology of and changes in complexity, the relationship between complexity and patient outcomes, and intervention development to improve modifiable elements of complex patients.
Exploring the Active Site of the Tungsten, Iron-Sulfur Enzyme Acetylene Hydratase▿ †
tenBrink, Felix; Schink, Bernhard; Kroneck, Peter M. H.
2011-01-01
The soluble tungsten, iron-sulfur enzyme acetylene hydratase (AH) from mesophilic Pelobacter acetylenicus is a member of the dimethyl sulfoxide (DMSO) reductase family. It stands out from its class as it catalyzes a nonredox reaction, the addition of H2O to acetylene (H—C☰C—H) to form acetaldehyde (CH3CHO). Caught in its active W(IV) state, the high-resolution three-dimensional structure of AH offers an excellent starting point to tackle its unique chemistry and to identify catalytic amino acid residues within the active site cavity: Asp13 close to W(IV) coordinated to two molybdopterin-guanosine-dinucleotide ligands, Lys48 which couples the [4Fe-4S] cluster to the W site, and Ile142 as part of a hydrophobic ring at the end of the substrate access channel designed to accommodate the substrate acetylene. A protocol was developed to express AH in Escherichia coli and to produce active-site variants which were characterized with regard to activity and occupancy of the tungsten and iron-sulfur centers. By this means, fusion of the N-terminal chaperone binding site of the E. coli nitrate reductase NarG to the AH gene improved the yield and activity of AH and its variants significantly. Results from site-directed mutagenesis of three key residues, Asp13, Lys48, and Ile142, document their important role in catalysis of this unusual tungsten enzyme. PMID:21193613
Dumestre, A.; Chone, T.; Portal, J.; Gerard, M.; Berthelin, J.
1997-01-01
Several cyanide-tolerant microorganisms have been selected from alkaline wastes and soils contaminated with cyanide. Among them, a fungus identified as Fusarium solani IHEM 8026 shows a good potential for cyanide biodegradation under alkaline conditions (pH 9.2 to 10.7). Results of K(sup14)CN biodegradation studies show that fungal metabolism seems to proceed by a two-step hydrolytic mechanism: (i) the first reaction involves the conversion of cyanide to formamide by a cyanide-hydrolyzing enzyme, cyanide hydratase (EC 4.2.1.66); and (ii) the second reaction consists of the conversion of formamide to formate, which is associated with fungal growth. No growth occurred during the first step of cyanide degradation, suggesting that cyanide is toxic to some degree even in cyanide-degrading microorganisms, such as F. solani. The presence of organic nutrients in the medium has a major influence on the occurrence of the second step. Addition of small amounts of yeast extract led to fungal growth, whereas no growth was observed in media containing cyanide as the sole source of carbon and nitrogen. The simple hydrolytic detoxification pathway identified in the present study could be used for the treatment of many industrial alkaline effluents and wastes containing free cyanide without a prior acidification step, thus limiting the risk of cyanhydric acid volatilization; this should be of great interest from an environmental and health point of view. PMID:16535647
Swit_4259, an acetoacetate decarboxylase-like enzyme from Sphingomonas wittichii RW1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mydy, Lisa S.; Mashhadi, Zahra; Knight, T. William
The Gram-negative bacteriumSphingomonas wittichiiRW1 is notable for its ability to metabolize a variety of aromatic hydrocarbons. Not surprisingly, theS. wittichiigenome contains a number of putative aromatic hydrocarbon-degrading gene clusters. One of these includes an enzyme of unknown function, Swit_4259, which belongs to the acetoacetate decarboxylase-like superfamily (ADCSF). Here, it is reported that Swit_4259 is a small (28.8 kDa) tetrameric ADCSF enzyme that, unlike the prototypical members of the superfamily, does not have acetoacetate decarboxylase activity. Structural characterization shows that the tertiary structure of Swit_4259 is nearly identical to that of the true decarboxylases, but there are important differences in themore » fine structure of the Swit_4259 active site that lead to a divergence in function. In addition, it is shown that while it is a poor substrate, Swit_4259 can catalyze the hydration of 2-oxo-hex-3-enedioate to yield 2-oxo-4-hydroxyhexanedioate. It is also demonstrated that Swit_4259 has pyruvate aldolase-dehydratase activity, a feature that is common to all of the family V ADCSF enzymes studied to date. The enzymatic activity, together with the genomic context, suggests that Swit_4259 may be a hydratase with a role in the metabolism of an as-yet-unknown hydrocarbon. These data have implications for engineering bioremediation pathways to degrade specific pollutants, as well as structure–function relationships within the ADCSF in general.« less
Fermentative production of isobutene.
van Leeuwen, Bianca N M; van der Wulp, Albertus M; Duijnstee, Isabelle; van Maris, Antonius J A; Straathof, Adrie J J
2012-02-01
Isobutene (2-methylpropene) is one of those chemicals for which bio-based production might replace the petrochemical production in the future. Currently, more than 10 million metric tons of isobutene are produced on a yearly basis. Even though bio-based production might also be achieved through chemocatalytic or thermochemical methods, this review focuses on fermentative routes from sugars. Although biological isobutene formation is known since the 1970s, extensive metabolic engineering is required to achieve economically viable yields and productivities. Two recent metabolic engineering developments may enable anaerobic production close to the theoretical stoichiometry of 1isobutene + 2CO(2) + 2H(2)O per mol of glucose. One relies on the conversion of 3-hydroxyisovalerate to isobutene as a side activity of mevalonate diphosphate decarboxylase and the other on isobutanol dehydration as a side activity of engineered oleate hydratase. The latter resembles the fermentative production of isobutanol followed by isobutanol recovery and chemocatalytic dehydration. The advantage of a completely biological route is that not isobutanol, but instead gaseous isobutene is recovered from the fermenter together with CO(2). The low aqueous solubility of isobutene might also minimize product toxicity to the microorganisms. Although developments are at their infancy, the potential of a large scale fermentative isobutene production process is assessed. The production costs estimate is 0.9 Euro kg(-1), which is reasonably competitive. About 70% of the production costs will be due to the costs of lignocellulose hydrolysate, which seems to be a preferred feedstock.
Genetic alterations in Krebs cycle and its impact on cancer pathogenesis.
Sajnani, Karishma; Islam, Farhadul; Smith, Robert Anthony; Gopalan, Vinod; Lam, Alfred King-Yin
2017-04-01
Cancer cells exhibit alterations in many cellular processes, including oxygen sensing and energy metabolism. Glycolysis in non-oxygen condition is the main energy production process in cancer rather than mitochondrial respiration as in benign cells. Genetic and epigenetic alterations of Krebs cycle enzymes favour the shift of cancer cells from oxidative phosphorylation to anaerobic glycolysis. Mutations in genes encoding aconitase, isocitrate dehydrogenase, succinate dehydrogenase, fumarate hydratase, and citrate synthase are noted in many cancers. Abnormalities of Krebs cycle enzymes cause ectopic production of Krebs cycle intermediates (oncometabolites) such as 2-hydroxyglutarate, and citrate. These oncometabolites stabilize hypoxia inducible factor 1 (HIF1), nuclear factor like 2 (Nrf2), inhibit p53 and prolyl hydroxylase 3 (PDH3) activities as well as regulate DNA/histone methylation, which in turn activate cell growth signalling. They also stimulate increased glutaminolysis, glycolysis and production of reactive oxygen species (ROS). Additionally, genetic alterations in Krebs cycle enzymes are involved with increased fatty acid β-oxidations and epithelial mesenchymal transition (EMT) induction. These altered phenomena in cancer could in turn promote carcinogenesis by stimulating cell proliferation and survival. Overall, epigenetic and genetic changes of Krebs cycle enzymes lead to the production of oncometabolite intermediates, which are important driving forces of cancer pathogenesis and progression. Understanding and applying the knowledge of these mechanisms opens new therapeutic options for patients with cancer. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
TXNIP regulates myocardial fatty acid oxidation via miR-33a signaling.
Chen, Junqin; Young, Martin E; Chatham, John C; Crossman, David K; Dell'Italia, Louis J; Shalev, Anath
2016-07-01
Myocardial fatty acid β-oxidation is critical for the maintenance of energy homeostasis and contractile function in the heart, but its regulation is still not fully understood. While thioredoxin-interacting protein (TXNIP) has recently been implicated in cardiac metabolism and mitochondrial function, its effects on β-oxidation have remained unexplored. Using a new cardiomyocyte-specific TXNIP knockout mouse and working heart perfusion studies, as well as loss- and gain-of-function experiments in rat H9C2 and human AC16 cardiomyocytes, we discovered that TXNIP deficiency promotes myocardial β-oxidation via signaling through a specific microRNA, miR-33a. TXNIP deficiency leads to increased binding of nuclear factor Y (NFYA) to the sterol regulatory element binding protein 2 (SREBP2) promoter, resulting in transcriptional inhibition of SREBP2 and its intronic miR-33a. This allows for increased translation of the miR-33a target genes and β-oxidation-promoting enzymes, carnitine octanoyl transferase (CROT), carnitine palmitoyl transferase 1 (CPT1), hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase-β (HADHB), and AMPKα and is associated with an increase in phospho-AMPKα and phosphorylation/inactivation of acetyl-CoA-carboxylase. Thus, we have identified a novel TXNIP-NFYA-SREBP2/miR-33a-AMPKα/CROT/CPT1/HADHB pathway that is conserved in mouse, rat, and human cardiomyocytes and regulates myocardial β-oxidation. Copyright © 2016 the American Physiological Society.
Onile, Olugbenga Samson; Calder, Bridget; Soares, Nelson C; Anumudu, Chiaka I; Blackburn, Jonathan M
2017-11-01
Schistosomiasis is a chronic neglected tropical disease that is characterized by continued inflammatory challenges to the exposed population and it has been established as a possible risk factor in the aetiology of bladder cancer. Improved diagnosis of schistosomiasis and its associated pathology is possible through mass spectrometry to identify biomarkers among the infected population, which will influence early detection of the disease and its subtle morbidity. A high-throughput proteomic approach was used to analyse human urine samples for 49 volunteers from Eggua, a schistosomiasis endemic community in South-West, Nigeria. The individuals were previously screened for Schistosoma haematobium and structural bladder pathologies via microscopy and ultrasonography respectively. Samples were categorised into schistosomiasis, schistosomiasis with bladder pathology, bladder pathology, and a normal healthy control group. These samples were analysed to identify potential protein biomarkers. A total of 1306 proteins and 9701 unique peptides were observed in this study (FDR = 0.01). Fifty-four human proteins were found to be potential biomarkers for schistosomiasis and bladder pathologies due to schistosomiasis by label-free quantitative comparison between groups. Thirty-six (36) parasite-derived potential biomarkers were also identified, which include some existing putative schistosomiasis biomarkers that have been previously reported. Some of these proteins include Elongation factor 1 alpha, phosphopyruvate hydratase, histone H4 and heat shock proteins (HSP 60, HSP 70). These findings provide an in-depth analysis of potential schistosoma and human host protein biomarkers for diagnosis of chronic schistosomiasis caused by Schistosoma haematobium and its pathogenesis.
Demir, N; Nadaroglu, H; Gungor, A A; Demir, Y
2015-01-01
The influence of prostatic acid phosphatase (PAP) and human chorionic gonadotropin (HCG), tumor markers have been investigated on human erythrocyte carbonic anhydrase (HCA-I and HCA-II) and bovine erythrocyte (BCA) and bovine lung carbonic anhydrase (CA-IV) in vitro. Tumor markers are substances that can often be detected in higher-than-normal amounts in the blood, urine, or body tissues of some patients with certain types of cancer. Tumor markers are produced either by the tumor itself or by the body in response to the presence of cancer or certain benign (noncancerous) conditions. In addition to their role in cancer diagnosis, some tumor marker levels are measured before treatment to help doctors plan appropriate therapy. All of the tumor markers were determined to have inhibition effect, on human CA-I, CA-II, bovine erythrocyte CA (BCA) and bovine lung CA-IV isoenzymes. The effect of each tumor marker on CA was investigated by Wilbur-Andersen method modified by Rickly et al Inhibition effects of two different tumor markers on human CA-I, CA-II, bovine erythrocyte CA (BCA) and bovine lung CA-IV isoenzymes were determined by using the CO2-Hydratase method by plotting activity % vs (tumor markers). I50 values of tumor markers exhibiting inhibition effects were found by means of these graphs (Tab.1, Fig. 2, Ref. 20).
Catabolism of the Last Two Steroid Rings in Mycobacterium tuberculosis and Other Bacteria
Crowe, Adam M.; Casabon, Israël; Brown, Kirstin L.; Liu, Jie; Lian, Jennifer; Rogalski, Jason C.; Hurst, Timothy E.; Snieckus, Victor; Foster, Leonard J.
2017-01-01
ABSTRACT Most mycolic acid-containing actinobacteria and some proteobacteria use steroids as growth substrates, but the catabolism of the last two steroid rings has yet to be elucidated. In Mycobacterium tuberculosis, this pathway includes virulence determinants and has been proposed to be encoded by the KstR2-regulated genes, which include a predicted coenzyme A (CoA) transferase gene (ipdAB) and an acyl-CoA reductase gene (ipdC). In the presence of cholesterol, ΔipdC and ΔipdAB mutants of either M. tuberculosis or Rhodococcus jostii strain RHA1 accumulated previously undescribed metabolites: 3aα-H-4α(carboxyl-CoA)-5-hydroxy-7aβ-methylhexahydro-1-indanone (5-OH HIC-CoA) and (R)-2-(2-carboxyethyl)-3-methyl-6-oxocyclohex-1-ene-1-carboxyl-CoA (COCHEA-CoA), respectively. A ΔfadE32 mutant of Mycobacterium smegmatis accumulated 4-methyl-5-oxo-octanedioic acid (MOODA). Incubation of synthetic 5-OH HIC-CoA with purified IpdF, IpdC, and enoyl-CoA hydratase 20 (EchA20), a crotonase superfamily member, yielded COCHEA-CoA and, upon further incubation with IpdAB and a CoA thiolase, yielded MOODA-CoA. Based on these studies, we propose a pathway for the final steps of steroid catabolism in which the 5-member ring is hydrolyzed by EchA20, followed by hydrolysis of the 6-member ring by IpdAB. Metabolites accumulated by ΔipdF and ΔechA20 mutants support the model. The conservation of these genes in known steroid-degrading bacteria suggests that the pathway is shared. This pathway further predicts that cholesterol catabolism yields four propionyl-CoAs, four acetyl-CoAs, one pyruvate, and one succinyl-CoA. Finally, a ΔipdAB M. tuberculosis mutant did not survive in macrophages and displayed severely depleted CoASH levels that correlated with a cholesterol-dependent toxicity. Our results together with the developed tools provide a basis for further elucidating bacterial steroid catabolism and virulence determinants in M. tuberculosis. PMID:28377529
What do we gain from simplicity versus complexity in species distribution models?
Merow, Cory; Smith, Matthew J.; Edwards, Thomas C.; Guisan, Antoine; McMahon, Sean M.; Normand, Signe; Thuiller, Wilfried; Wuest, Rafael O.; Zimmermann, Niklaus E.; Elith, Jane
2014-01-01
Species distribution models (SDMs) are widely used to explain and predict species ranges and environmental niches. They are most commonly constructed by inferring species' occurrence–environment relationships using statistical and machine-learning methods. The variety of methods that can be used to construct SDMs (e.g. generalized linear/additive models, tree-based models, maximum entropy, etc.), and the variety of ways that such models can be implemented, permits substantial flexibility in SDM complexity. Building models with an appropriate amount of complexity for the study objectives is critical for robust inference. We characterize complexity as the shape of the inferred occurrence–environment relationships and the number of parameters used to describe them, and search for insights into whether additional complexity is informative or superfluous. By building ‘under fit’ models, having insufficient flexibility to describe observed occurrence–environment relationships, we risk misunderstanding the factors shaping species distributions. By building ‘over fit’ models, with excessive flexibility, we risk inadvertently ascribing pattern to noise or building opaque models. However, model selection can be challenging, especially when comparing models constructed under different modeling approaches. Here we argue for a more pragmatic approach: researchers should constrain the complexity of their models based on study objective, attributes of the data, and an understanding of how these interact with the underlying biological processes. We discuss guidelines for balancing under fitting with over fitting and consequently how complexity affects decisions made during model building. Although some generalities are possible, our discussion reflects differences in opinions that favor simpler versus more complex models. We conclude that combining insights from both simple and complex SDM building approaches best advances our knowledge of current and future species ranges.
Draganski, Andrew; Tar, Moses T; Villegas, Guillermo; Friedman, Joel M; Davies, Kelvin P
2018-05-01
Curcumin, a naturally occurring anti-inflammatory compound, has shown promise in pre-clinical studies to treat erectile dysfunction (ED) associated with type-1 diabetes. However, poor bioavailability following oral administration limits its efficacy. The present study evaluated the potential of topical application of curcumin-loaded nanoparticles (curc-np) to treat ED in a rat model of type-2 diabetes (T2D). Determine if topical application of curc-np treats ED in a T2D rat model and modulates expression of inflammatory markers. Curc-np (4 mg curcumin) or blank nanoparticles were applied every 2 days for 2 weeks to the shaved abdomen of 20-week-old Zucker diabetic fatty male rats (N = 5 per group). Lean Zucker diabetic fatty male rat controls were treated with blank nanoparticles (N = 5). Penetration of nanoparticles and curcumin release were confirmed by 2-photon fluorescence microscopy and histology. Erectile function was determined by measuring intracorporal pressure (ICP) normalized to systemic blood pressure (ICP/BP) following cavernous nerve stimulation. Corporal tissue was excised and reverse transcription and quantitative polymerase chain reaction used to determine expression of the following markers: nuclear factor (NF)-κβ, NF-κβ-activating protein (Nkap), NF erythroid 2-related factor-2, Kelch-like enoyl-CoA hydratase-associated protein-1, heme oxygenase-1 (HO-1), variable coding sequence-A1, phosphodiesterase-5, endothelial and neuronal nitric oxide synthase, Ras homolog gene family member A, and Rho-associated coiled-coil containing protein kinases-1 and -2. Erectile function by determination of ICP/BP and expression of molecular markers in corporal tissue by RT-qPCR. Nanoparticles penetrated the abdominal epidermis and persisted in hair follicles for 24 hours. Curc-np-treated animals exhibited higher average ICP/BP than animals treated with blank nanoparticles at all levels of stimulation and this was statistically significant (P < .05) at 0.75 mA. In corporal tissue, Nkap expression decreased 60% and heme oxygenase-1 expression increased 60% in curc-np- compared to blank nanoparticle-treated animals. ICP/BP values inversely correlated with Nkap and directly correlated with HO-1 expression levels. These studies demonstrate the potential for topical application of curc-np as a treatment for ED in T2D patients. The T2D animal model of ED represents a more prevalent disease than the more commonly studied type-1 diabetes model. Although there is improved erectile response in curc-np-treated animals, only at the lower levels of stimulation (0.75 mA) was this significant compared to the blank nanoparticle-treated animals, suggesting more studies are needed to optimize protocols and evaluate toxicity. Topical application of curc-np to a rat model of T2D can systemically deliver curcumin, treat ED, and modulate corporal expression of inflammatory markers. Draganski A, Tar MT, Villegas G, et al. Topically Applied Curcumin-Loaded Nanoparticles Treat Erectile Dysfunction in a Rat Model of Type-2 Diabetes. J Sex Med 2018;15:645-653. Copyright © 2018 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.
Hu, Eric Y; Bouteiller, Jean-Marie C; Song, Dong; Baudry, Michel; Berger, Theodore W
2015-01-01
Chemical synapses are comprised of a wide collection of intricate signaling pathways involving complex dynamics. These mechanisms are often reduced to simple spikes or exponential representations in order to enable computer simulations at higher spatial levels of complexity. However, these representations cannot capture important nonlinear dynamics found in synaptic transmission. Here, we propose an input-output (IO) synapse model capable of generating complex nonlinear dynamics while maintaining low computational complexity. This IO synapse model is an extension of a detailed mechanistic glutamatergic synapse model capable of capturing the input-output relationships of the mechanistic model using the Volterra functional power series. We demonstrate that the IO synapse model is able to successfully track the nonlinear dynamics of the synapse up to the third order with high accuracy. We also evaluate the accuracy of the IO synapse model at different input frequencies and compared its performance with that of kinetic models in compartmental neuron models. Our results demonstrate that the IO synapse model is capable of efficiently replicating complex nonlinear dynamics that were represented in the original mechanistic model and provide a method to replicate complex and diverse synaptic transmission within neuron network simulations.
Hu, Eric Y.; Bouteiller, Jean-Marie C.; Song, Dong; Baudry, Michel; Berger, Theodore W.
2015-01-01
Chemical synapses are comprised of a wide collection of intricate signaling pathways involving complex dynamics. These mechanisms are often reduced to simple spikes or exponential representations in order to enable computer simulations at higher spatial levels of complexity. However, these representations cannot capture important nonlinear dynamics found in synaptic transmission. Here, we propose an input-output (IO) synapse model capable of generating complex nonlinear dynamics while maintaining low computational complexity. This IO synapse model is an extension of a detailed mechanistic glutamatergic synapse model capable of capturing the input-output relationships of the mechanistic model using the Volterra functional power series. We demonstrate that the IO synapse model is able to successfully track the nonlinear dynamics of the synapse up to the third order with high accuracy. We also evaluate the accuracy of the IO synapse model at different input frequencies and compared its performance with that of kinetic models in compartmental neuron models. Our results demonstrate that the IO synapse model is capable of efficiently replicating complex nonlinear dynamics that were represented in the original mechanistic model and provide a method to replicate complex and diverse synaptic transmission within neuron network simulations. PMID:26441622
A Novel BA Complex Network Model on Color Template Matching
Han, Risheng; Yue, Guangxue; Ding, Hui
2014-01-01
A novel BA complex network model of color space is proposed based on two fundamental rules of BA scale-free network model: growth and preferential attachment. The scale-free characteristic of color space is discovered by analyzing evolving process of template's color distribution. And then the template's BA complex network model can be used to select important color pixels which have much larger effects than other color pixels in matching process. The proposed BA complex network model of color space can be easily integrated into many traditional template matching algorithms, such as SSD based matching and SAD based matching. Experiments show the performance of color template matching results can be improved based on the proposed algorithm. To the best of our knowledge, this is the first study about how to model the color space of images using a proper complex network model and apply the complex network model to template matching. PMID:25243235
A novel BA complex network model on color template matching.
Han, Risheng; Shen, Shigen; Yue, Guangxue; Ding, Hui
2014-01-01
A novel BA complex network model of color space is proposed based on two fundamental rules of BA scale-free network model: growth and preferential attachment. The scale-free characteristic of color space is discovered by analyzing evolving process of template's color distribution. And then the template's BA complex network model can be used to select important color pixels which have much larger effects than other color pixels in matching process. The proposed BA complex network model of color space can be easily integrated into many traditional template matching algorithms, such as SSD based matching and SAD based matching. Experiments show the performance of color template matching results can be improved based on the proposed algorithm. To the best of our knowledge, this is the first study about how to model the color space of images using a proper complex network model and apply the complex network model to template matching.
Application of 3D Laser Scanning Technology in Complex Rock Foundation Design
NASA Astrophysics Data System (ADS)
Junjie, Ma; Dan, Lu; Zhilong, Liu
2017-12-01
Taking the complex landform of Tanxi Mountain Landscape Bridge as an example, the application of 3D laser scanning technology in the mapping of complex rock foundations is studied in this paper. A set of 3D laser scanning technologies are formed and several key engineering problems are solved. The first is 3D laser scanning technology of complex landforms. 3D laser scanning technology is used to obtain a complete 3D point cloud data model of the complex landform. The detailed and accurate results of the surveying and mapping decrease the measuring time and supplementary measuring times. The second is 3D collaborative modeling of the complex landform. A 3D model of the complex landform is established based on the 3D point cloud data model. The super-structural foundation model is introduced for 3D collaborative design. The optimal design plan is selected and the construction progress is accelerated. And the last is finite-element analysis technology of the complex landform foundation. A 3D model of the complex landform is introduced into ANSYS for building a finite element model to calculate anti-slide stability of the rock, and provides a basis for the landform foundation design and construction.
NASA Astrophysics Data System (ADS)
Lute, A. C.; Luce, Charles H.
2017-11-01
The related challenges of predictions in ungauged basins and predictions in ungauged climates point to the need to develop environmental models that are transferable across both space and time. Hydrologic modeling has historically focused on modelling one or only a few basins using highly parameterized conceptual or physically based models. However, model parameters and structures have been shown to change significantly when calibrated to new basins or time periods, suggesting that model complexity and model transferability may be antithetical. Empirical space-for-time models provide a framework within which to assess model transferability and any tradeoff with model complexity. Using 497 SNOTEL sites in the western U.S., we develop space-for-time models of April 1 SWE and Snow Residence Time based on mean winter temperature and cumulative winter precipitation. The transferability of the models to new conditions (in both space and time) is assessed using non-random cross-validation tests with consideration of the influence of model complexity on transferability. As others have noted, the algorithmic empirical models transfer best when minimal extrapolation in input variables is required. Temporal split-sample validations use pseudoreplicated samples, resulting in the selection of overly complex models, which has implications for the design of hydrologic model validation tests. Finally, we show that low to moderate complexity models transfer most successfully to new conditions in space and time, providing empirical confirmation of the parsimony principal.
Teacher Modeling Using Complex Informational Texts
ERIC Educational Resources Information Center
Fisher, Douglas; Frey, Nancy
2015-01-01
Modeling in complex texts requires that teachers analyze the text for factors of qualitative complexity and then design lessons that introduce students to that complexity. In addition, teachers can model the disciplinary nature of content area texts as well as word solving and comprehension strategies. Included is a planning guide for think aloud.
Dong, Yadong; Sun, Yongqi; Qin, Chao
2018-01-01
The existing protein complex detection methods can be broadly divided into two categories: unsupervised and supervised learning methods. Most of the unsupervised learning methods assume that protein complexes are in dense regions of protein-protein interaction (PPI) networks even though many true complexes are not dense subgraphs. Supervised learning methods utilize the informative properties of known complexes; they often extract features from existing complexes and then use the features to train a classification model. The trained model is used to guide the search process for new complexes. However, insufficient extracted features, noise in the PPI data and the incompleteness of complex data make the classification model imprecise. Consequently, the classification model is not sufficient for guiding the detection of complexes. Therefore, we propose a new robust score function that combines the classification model with local structural information. Based on the score function, we provide a search method that works both forwards and backwards. The results from experiments on six benchmark PPI datasets and three protein complex datasets show that our approach can achieve better performance compared with the state-of-the-art supervised, semi-supervised and unsupervised methods for protein complex detection, occasionally significantly outperforming such methods.
NASA Astrophysics Data System (ADS)
Faucci, Maria Teresa; Melani, Fabrizio; Mura, Paola
2002-06-01
Molecular modeling was used to investigate factors influencing complex formation between cyclodextrins and guest molecules and predict their stability through a theoretical model based on the search for a correlation between experimental stability constants ( Ks) and some theoretical parameters describing complexation (docking energy, host-guest contact surfaces, intermolecular interaction fields) calculated from complex structures at a minimum conformational energy, obtained through stochastic methods based on molecular dynamic simulations. Naproxen, ibuprofen, ketoprofen and ibuproxam were used as model drug molecules. Multiple Regression Analysis allowed identification of the significant factors for the complex stability. A mathematical model ( r=0.897) related log Ks with complex docking energy and lipophilic molecular fields of cyclodextrin and drug.
Research on complex 3D tree modeling based on L-system
NASA Astrophysics Data System (ADS)
Gang, Chen; Bin, Chen; Yuming, Liu; Hui, Li
2018-03-01
L-system as a fractal iterative system could simulate complex geometric patterns. Based on the field observation data of trees and knowledge of forestry experts, this paper extracted modeling constraint rules and obtained an L-system rules set. Using the self-developed L-system modeling software the L-system rule set was parsed to generate complex tree 3d models.The results showed that the geometrical modeling method based on l-system could be used to describe the morphological structure of complex trees and generate 3D tree models.
NASA Astrophysics Data System (ADS)
Takemura, Kazuhiro; Guo, Hao; Sakuraba, Shun; Matubayasi, Nobuyuki; Kitao, Akio
2012-12-01
We propose a method to evaluate binding free energy differences among distinct protein-protein complex model structures through all-atom molecular dynamics simulations in explicit water using the solution theory in the energy representation. Complex model structures are generated from a pair of monomeric structures using the rigid-body docking program ZDOCK. After structure refinement by side chain optimization and all-atom molecular dynamics simulations in explicit water, complex models are evaluated based on the sum of their conformational and solvation free energies, the latter calculated from the energy distribution functions obtained from relatively short molecular dynamics simulations of the complex in water and of pure water based on the solution theory in the energy representation. We examined protein-protein complex model structures of two protein-protein complex systems, bovine trypsin/CMTI-1 squash inhibitor (PDB ID: 1PPE) and RNase SA/barstar (PDB ID: 1AY7), for which both complex and monomer structures were determined experimentally. For each system, we calculated the energies for the crystal complex structure and twelve generated model structures including the model most similar to the crystal structure and very different from it. In both systems, the sum of the conformational and solvation free energies tended to be lower for the structure similar to the crystal. We concluded that our energy calculation method is useful for selecting low energy complex models similar to the crystal structure from among a set of generated models.
Takemura, Kazuhiro; Guo, Hao; Sakuraba, Shun; Matubayasi, Nobuyuki; Kitao, Akio
2012-12-07
We propose a method to evaluate binding free energy differences among distinct protein-protein complex model structures through all-atom molecular dynamics simulations in explicit water using the solution theory in the energy representation. Complex model structures are generated from a pair of monomeric structures using the rigid-body docking program ZDOCK. After structure refinement by side chain optimization and all-atom molecular dynamics simulations in explicit water, complex models are evaluated based on the sum of their conformational and solvation free energies, the latter calculated from the energy distribution functions obtained from relatively short molecular dynamics simulations of the complex in water and of pure water based on the solution theory in the energy representation. We examined protein-protein complex model structures of two protein-protein complex systems, bovine trypsin/CMTI-1 squash inhibitor (PDB ID: 1PPE) and RNase SA/barstar (PDB ID: 1AY7), for which both complex and monomer structures were determined experimentally. For each system, we calculated the energies for the crystal complex structure and twelve generated model structures including the model most similar to the crystal structure and very different from it. In both systems, the sum of the conformational and solvation free energies tended to be lower for the structure similar to the crystal. We concluded that our energy calculation method is useful for selecting low energy complex models similar to the crystal structure from among a set of generated models.
NASA Astrophysics Data System (ADS)
Henriot, abel; Blavoux, bernard; Travi, yves; Lachassagne, patrick; Beon, olivier; Dewandel, benoit; Ladouche, bernard
2013-04-01
The Evian Natural Mineral Water (NMW) aquifer is a highly heterogeneous Quaternary glacial deposits complex composed of three main units, from bottom to top: - The "Inferior Complex" mainly composed of basal and impermeable till lying on the Alpine rocks. It outcrops only at the higher altitudes but is known in depth through drilled holes. - The "Gavot Plateau Complex" is an interstratified complex of mainly basal and lateral till up to 400 m thick. It outcrops at heights above approximately 850 m a.m.s.l. and up to 1200 m a.m.s.l. over a 30 km² area. It is the main recharge area known for the hydromineral system. - The "Terminal Complex" from which the Evian NMW is emerging at 410 m a.m.s.l. It is composed of sand and gravel Kame terraces that allow water to flow from the deep "Gavot Plateau Complex" permeable layers to the "Terminal Complex". A thick and impermeable terminal till caps and seals the system. Aquifer is then confined at its downstream area. Because of heterogeneity and complexity of this hydrosystem, distributed modeling tools are difficult to implement at the whole system scale: important hypothesis would have to be made about geometry, hydraulic properties, boundary conditions for example and extrapolation would lead with no doubt to unacceptable errors. Consequently a modeling strategy is being developed and leads also to improve the conceptual model of the hydrosystem. Lumped models mainly based on tritium time series allow the whole hydrosystem to be modeled combining in series: an exponential model (superficial aquifers of the "Gavot Plateau Complex"), a dispersive model (Gavot Plateau interstratified complex) and a piston flow model (sand and gravel from the Kame terraces) respectively 8, 60 and 2.5 years of mean transit time. These models provide insight on the governing parameters for the whole mineral aquifer. They help improving the current conceptual model and are to be improved with other environmental tracers such as CFC, SF6. A deterministic approach (distributed model; flow and transport) is performed at the scale of the terminal complex. The geometry of the system is quite well known from drill holes and the aquifer properties from data processing of hydraulic heads and pumping tests interpretation. A multidisciplinary approach (hydrodynamic, hydrochemistry, geology, isotopes) for the recharge area (Gavot Plateau Complex) aims to provide better constraint for the upstream boundary of distributed model. More, perfect tracer modeling approach highly constrains fitting of this distributed model. The result is a high resolution conceptual model leading to a future operational management tool of the aquifer.
NASA Astrophysics Data System (ADS)
Nowak, W.; Schöniger, A.; Wöhling, T.; Illman, W. A.
2016-12-01
Model-based decision support requires justifiable models with good predictive capabilities. This, in turn, calls for a fine adjustment between predictive accuracy (small systematic model bias that can be achieved with rather complex models), and predictive precision (small predictive uncertainties that can be achieved with simpler models with fewer parameters). The implied complexity/simplicity trade-off depends on the availability of informative data for calibration. If not available, additional data collection can be planned through optimal experimental design. We present a model justifiability analysis that can compare models of vastly different complexity. It rests on Bayesian model averaging (BMA) to investigate the complexity/performance trade-off dependent on data availability. Then, we disentangle the complexity component from the performance component. We achieve this by replacing actually observed data by realizations of synthetic data predicted by the models. This results in a "model confusion matrix". Based on this matrix, the modeler can identify the maximum model complexity that can be justified by the available (or planned) amount and type of data. As a side product, the matrix quantifies model (dis-)similarity. We apply this analysis to aquifer characterization via hydraulic tomography, comparing four models with a vastly different number of parameters (from a homogeneous model to geostatistical random fields). As a testing scenario, we consider hydraulic tomography data. Using subsets of these data, we determine model justifiability as a function of data set size. The test case shows that geostatistical parameterization requires a substantial amount of hydraulic tomography data to be justified, while a zonation-based model can be justified with more limited data set sizes. The actual model performance (as opposed to model justifiability), however, depends strongly on the quality of prior geological information.
Complex systems as lenses on learning and teaching
NASA Astrophysics Data System (ADS)
Hurford, Andrew C.
From metaphors to mathematized models, the complexity sciences are changing the ways disciplines view their worlds, and ideas borrowed from complexity are increasingly being used to structure conversations and guide research on teaching and learning. The purpose of this corpus of research is to further those conversations and to extend complex systems ideas, theories, and modeling to curricula and to research on learning and teaching. A review of the literatures of learning and of complexity science and a discussion of the intersections between those disciplines are provided. The work reported represents an evolving model of learning qua complex system and that evolution is the result of iterative cycles of design research. One of the signatures of complex systems is the presence of scale invariance and this line of research furnishes empirical evidence of scale invariant behaviors in the activity of learners engaged in participatory simulations. The offered discussion of possible causes for these behaviors and chaotic phase transitions in human learning favors real-time optimization of decision-making as the means for producing such behaviors. Beyond theoretical development and modeling, this work includes the development of teaching activities intended to introduce pre-service mathematics and science teachers to complex systems. While some of the learning goals for this activity focused on the introduction of complex systems as a content area, we also used complex systems to frame perspectives on learning. Results of scoring rubrics and interview responses from students illustrate attributes of the proposed model of complex systems learning and also how these pre-service teachers made sense of the ideas. Correlations between established theories of learning and a complex adaptive systems model of learning are established and made explicit, and a means for using complex systems ideas for designing instruction is offered. It is a fundamental assumption of this research and researcher that complex systems ideas and understandings can be appropriated from more complexity-developed disciplines and put to use modeling and building increasingly productive understandings of learning and teaching.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Campbell, Philip LaRoche
At the end of his life, Stephen Jay Kline, longtime professor of mechanical engineering at Stanford University, completed a book on how to address complex systems. The title of the book is 'Conceptual Foundations of Multi-Disciplinary Thinking' (1995), but the topic of the book is systems. Kline first establishes certain limits that are characteristic of our conscious minds. Kline then establishes a complexity measure for systems and uses that complexity measure to develop a hierarchy of systems. Kline then argues that our minds, due to their characteristic limitations, are unable to model the complex systems in that hierarchy. Computers aremore » of no help to us here. Our attempts at modeling these complex systems are based on the way we successfully model some simple systems, in particular, 'inert, naturally-occurring' objects and processes, such as what is the focus of physics. But complex systems overwhelm such attempts. As a result, the best we can do in working with these complex systems is to use a heuristic, what Kline calls the 'Guideline for Complex Systems.' Kline documents the problems that have developed due to 'oversimple' system models and from the inappropriate application of a system model from one domain to another. One prominent such problem is the Procrustean attempt to make the disciplines that deal with complex systems be 'physics-like.' Physics deals with simple systems, not complex ones, using Kline's complexity measure. The models that physics has developed are inappropriate for complex systems. Kline documents a number of the wasteful and dangerous fallacies of this type.« less
On the dangers of model complexity without ecological justification in species distribution modeling
David M. Bell; Daniel R. Schlaepfer
2016-01-01
Although biogeographic patterns are the product of complex ecological processes, the increasing com-plexity of correlative species distribution models (SDMs) is not always motivated by ecological theory,but by model fit. The validity of model projections, such as shifts in a speciesâ climatic niche, becomesquestionable particularly during extrapolations, such as for...
NASA Astrophysics Data System (ADS)
Munoz-Carpena, R.; Muller, S. J.; Chu, M.; Kiker, G. A.; Perz, S. G.
2014-12-01
Model Model complexity resulting from the need to integrate environmental system components cannot be understated. In particular, additional emphasis is urgently needed on rational approaches to guide decision making through uncertainties surrounding the integrated system across decision-relevant scales. However, in spite of the difficulties that the consideration of modeling uncertainty represent for the decision process, it should not be avoided or the value and science behind the models will be undermined. These two issues; i.e., the need for coupled models that can answer the pertinent questions and the need for models that do so with sufficient certainty, are the key indicators of a model's relevance. Model relevance is inextricably linked with model complexity. Although model complexity has advanced greatly in recent years there has been little work to rigorously characterize the threshold of relevance in integrated and complex models. Formally assessing the relevance of the model in the face of increasing complexity would be valuable because there is growing unease among developers and users of complex models about the cumulative effects of various sources of uncertainty on model outputs. In particular, this issue has prompted doubt over whether the considerable effort going into further elaborating complex models will in fact yield the expected payback. New approaches have been proposed recently to evaluate the uncertainty-complexity-relevance modeling trilemma (Muller, Muñoz-Carpena and Kiker, 2011) by incorporating state-of-the-art global sensitivity and uncertainty analysis (GSA/UA) in every step of the model development so as to quantify not only the uncertainty introduced by the addition of new environmental components, but the effect that these new components have over existing components (interactions, non-linear responses). Outputs from the analysis can also be used to quantify system resilience (stability, alternative states, thresholds or tipping points) in the face of environmental and anthropogenic change (Perz, Muñoz-Carpena, Kiker and Holt, 2013), and through MonteCarlo mapping potential management activities over the most important factors or processes to influence the system towards behavioral (desirable) outcomes (Chu-Agor, Muñoz-Carpena et al., 2012).
Everyday value conflicts and integrative complexity of thought.
Myyry, Liisa
2002-12-01
This study examined the value pluralism model in everyday value conflicts, and the effect of issue context on complexity of thought. According to the cognitive manager model we hypothesized that respondents would obtain a higher level of integrative complexity on personal issues that on professional and general issues. We also explored the relations of integrative complexity to value priorities, measured by the Schwartz Value Survey, and to emotional empathy. The value pluralism model was not supported by the data collected from 126 university students from social science, business and technology. The cognitive manager model was partially confirmed by data from females but not from males. Concerning value priorities, more complex respondents had higher regard for self-transcendence values, and less complex respondents for self-enhancement values Emotional empathy was also significantly related to complexity score.
Green, Christopher T.; Zhang, Yong; Jurgens, Bryant C.; Starn, J. Jeffrey; Landon, Matthew K.
2014-01-01
Analytical models of the travel time distribution (TTD) from a source area to a sample location are often used to estimate groundwater ages and solute concentration trends. The accuracies of these models are not well known for geologically complex aquifers. In this study, synthetic datasets were used to quantify the accuracy of four analytical TTD models as affected by TTD complexity, observation errors, model selection, and tracer selection. Synthetic TTDs and tracer data were generated from existing numerical models with complex hydrofacies distributions for one public-supply well and 14 monitoring wells in the Central Valley, California. Analytical TTD models were calibrated to synthetic tracer data, and prediction errors were determined for estimates of TTDs and conservative tracer (NO3−) concentrations. Analytical models included a new, scale-dependent dispersivity model (SDM) for two-dimensional transport from the watertable to a well, and three other established analytical models. The relative influence of the error sources (TTD complexity, observation error, model selection, and tracer selection) depended on the type of prediction. Geological complexity gave rise to complex TTDs in monitoring wells that strongly affected errors of the estimated TTDs. However, prediction errors for NO3− and median age depended more on tracer concentration errors. The SDM tended to give the most accurate estimates of the vertical velocity and other predictions, although TTD model selection had minor effects overall. Adding tracers improved predictions if the new tracers had different input histories. Studies using TTD models should focus on the factors that most strongly affect the desired predictions.
Challenges in Developing Models Describing Complex Soil Systems
NASA Astrophysics Data System (ADS)
Simunek, J.; Jacques, D.
2014-12-01
Quantitative mechanistic models that consider basic physical, mechanical, chemical, and biological processes have the potential to be powerful tools to integrate our understanding of complex soil systems, and the soil science community has often called for models that would include a large number of these diverse processes. However, once attempts have been made to develop such models, the response from the community has not always been overwhelming, especially after it discovered that these models are consequently highly complex, requiring not only a large number of parameters, not all of which can be easily (or at all) measured and/or identified, and which are often associated with large uncertainties, but also requiring from their users deep knowledge of all/most of these implemented physical, mechanical, chemical and biological processes. Real, or perceived, complexity of these models then discourages users from using them even for relatively simple applications, for which they would be perfectly adequate. Due to the nonlinear nature and chemical/biological complexity of the soil systems, it is also virtually impossible to verify these types of models analytically, raising doubts about their applicability. Code inter-comparisons, which is then likely the most suitable method to assess code capabilities and model performance, requires existence of multiple models of similar/overlapping capabilities, which may not always exist. It is thus a challenge not only to developed models describing complex soil systems, but also to persuade the soil science community in using them. As a result, complex quantitative mechanistic models are still an underutilized tool in soil science research. We will demonstrate some of the challenges discussed above on our own efforts in developing quantitative mechanistic models (such as HP1/2) for complex soil systems.
Characterization of two Streptomyces enzymes that convert ferulic acid to vanillin.
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s(-1), and 78.2 U mg(-1), respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM(-1) s(-1) for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation.
Dana, S L; Hoener, P A; Bilakovics, J M; Crombie, D L; Ogilvie, K M; Kauffman, R F; Mukherjee, R; Paterniti, J R
2001-08-01
Fibrates and thiazolidinediones are used clinically to treat hypertriglyceridemia and hyperglycemia, respectively. Fibrates bind to the peroxisome proliferator-activated receptor (PPAR)-alpha, and thiazolidinediones are ligands of PPAR-gamma. These intracellular receptors form heterodimers with retinoid X receptor to modulate gene transcription. To elucidate the target genes regulated by these compounds, we treated Zucker diabetic fatty rats (ZDF) for 15 days with a PPAR-alpha-specific compound, fenofibrate, a PPAR-gamma-specific ligand, rosiglitazone, and a PPAR-alpha/-gamma coagonist, GW2331, and measured the levels of several messenger RNAs (mRNAs) in liver by real-time polymerase chain reaction. All 3 compounds decreased serum glucose and triglyceride levels. Fenofibrate and GW2331 induced expression of acyl-coenzyme A (CoA) oxidase and enoyl-CoA hydratase and reduced apolipoprotein C-III and phosphoenolpyruvate carboxykinase mRNAs. Rosiglitazone modestly increased apolipoprotein C-III mRNA and had no effect on expression of the other 2 genes in the liver but increased the expression of glucose transporter 4 and phosphoenolpyruvate carboxykinase in adipose tissue. We identified a novel target in liver, mitogen-activated phosphokinase phosphatase 1, whose down-regulation by PPAR-alpha agonists may improve insulin sensitivity in that tissue by prolonging insulin responses. The results of these studies suggest that activation of PPAR-alpha as well as PPAR-gamma in therapy for type 2 diabetes will enhance glucose and triglyceride control by combining actions in hepatic and peripheral tissues. Copyright 2001 by W.B. Saunders Company
Vilá-Héreter, Frances; Rivera-Mariani, Felix E.; Bolaños-Rosero, Benjamín
2017-01-01
Background The allergenic potential of Ganoderma applanatum basidiospores has been demonstrated previously in Puerto Rico. However, basidiomycete allergens are not available for inclusion in allergy diagnostic panels. Therefore, we sought to confirm allergic sensitization towards G. applanatum crude spore cytoplasmic extract (CSCE) through reactivity in serological assays and detection of IgE-binding polypeptides. Methods With an indirect ELISA, serological reactivity was compared between groups of individuals with different allergic profiles. Group 1 (n = 51) consisted of individuals with sIgE to allergens included in diagnostic panels; group 2 (n = 14) were individuals with no sIgE to the allergens tested; and group 3 (n = 22) were individuals with no allergic history. To visualize IgE-binding polypeptides, group 1 sera were examined with Western blot (WB). Polypeptide bands with the highest reactivity were analyzed by mass spectrometry (MS) for putative identification. Results Serological reactivity of group 1 was significantly higher than that of group 3 in indirect ELISA (p = 0.03). Sixty five percent of group 1 individuals showed reactivity to polypeptide bands in WB. Bands of 81 and 56 kDa had the highest reactivity proportions among the reactive sera, followed by a 45 kDa band. MS analysis of these three polypeptides suggests they are basidiomycete-derived enzymes with aconitate hydratase, catalase, and enolase functions. Conclusions G. applanatum spores have allergenic components recognized by Puerto Rican individuals, which could eventually be considered as markers in cases of fungal allergy and be included in diagnostic allergen panels in Puerto Rico and tropical regions. PMID:28380479
Changes in cardiac energy metabolic pathways in overweighed rats fed a high-fat diet.
Modrego, Javier; de las Heras, Natalia; Zamorano-León, Jose J; Mateos-Cáceres, Petra J; Martín-Fernández, Beatriz; Valero-Muñoz, Maria; Lahera, Vicente; López-Farré, Antonio J
2013-03-01
Heart produces ATP through long-chain fatty acids beta oxidation. To analyze whether in ventricular myocardium, high-fat diet may modify the expression of proteins associated with energy metabolism before myocardial function was affected. Wistar Kyoto rats were divided into two groups: (a) rats fed standard diet (control; n = 6) and (b) rats fed high-fat diet (HFD; n = 6). Proteins from left ventricles were analyzed by two-dimensional electrophoresis, mass spectrometry and Western blotting. Rats fed with HFD showed higher body weight, insulin, glucose, leptin and total cholesterol plasma levels as compared with those fed with standard diet. However, myocardial functional parameters were not different between them. The protein expression of 3-ketoacyl-CoA thiolase, acyl-CoA hydrolase mitochondrial precursor and enoyl-CoA hydratase, three long-chain fatty acid β-oxidation-related enzymes, and carnitine-O-palmitoyltransferase I was significantly higher in left ventricles from HFD rats. Protein expression of triosephosphate isomerase was higher in left ventricles from HFD rats than in those from control. Two α/β-enolase isotypes and glyceraldehyde-3-phosphate isomerase were significantly increased in HFD rats as compared with control. Pyruvate and lactate contents were similar in HFD and control groups. Expression of proteins associated with Krebs cycle and mitochondrial oxidative phosphorylation was higher in HFD rats. Expression of proteins involved in left ventricle metabolic energy was enhanced before myocardial functionality was affected in rats fed with HFD. These findings may probably indicate higher cardiac energy requirement due to weight increase by HFD.
Röhlen, Désirée L; Pilas, Johanna; Schöning, Michael J; Selmer, Thorsten
2017-10-01
Three amperometric biosensors have been developed for the detection of L-malic acid, fumaric acid, and L -aspartic acid, all based on the combination of a malate-specific dehydrogenase (MDH, EC 1.1.1.37) and diaphorase (DIA, EC 1.8.1.4). The stepwise expansion of the malate platform with the enzymes fumarate hydratase (FH, EC 4.2.1.2) and aspartate ammonia-lyase (ASPA, EC 4.3.1.1) resulted in multi-enzyme reaction cascades and, thus, augmentation of the substrate spectrum of the sensors. Electrochemical measurements were carried out in presence of the cofactor β-nicotinamide adenine dinucleotide (NAD + ) and the redox mediator hexacyanoferrate (III) (HCFIII). The amperometric detection is mediated by oxidation of hexacyanoferrate (II) (HCFII) at an applied potential of + 0.3 V vs. Ag/AgCl. For each biosensor, optimum working conditions were defined by adjustment of cofactor concentrations, buffer pH, and immobilization procedure. Under these improved conditions, amperometric responses were linear up to 3.0 mM for L-malate and fumarate, respectively, with a corresponding sensitivity of 0.7 μA mM -1 (L-malate biosensor) and 0.4 μA mM -1 (fumarate biosensor). The L-aspartate detection system displayed a linear range of 1.0-10.0 mM with a sensitivity of 0.09 μA mM -1 . The sensor characteristics suggest that the developed platform provides a promising method for the detection and differentiation of the three substrates.
Liu, Xiaoling; Wu, Ji'en; Lee, Jasmine; Chen, Shaohua; Cheng, Yingying; Zhang, Chunyan
2015-01-01
Plant pathogen Xanthomonas campestris pv. campestris produces cis-11-methyl-2-dodecenoic acid (diffusible signal factor [DSF]) as a cell-cell communication signal to regulate biofilm dispersal and virulence factor production. Previous studies have demonstrated that DSF biosynthesis is dependent on the presence of RpfF, an enoyl-coenzyme A (CoA) hydratase, but the DSF synthetic mechanism and the influence of the host plant on DSF biosynthesis are still not clear. We show here that exogenous addition of host plant juice or ethanol extract to the growth medium of X. campestris pv. campestris could significantly boost DSF family signal production. It was subsequently revealed that X. campestris pv. campestris produces not only DSF but also BDSF (cis-2-dodecenoic acid) and another novel DSF family signal, which was designated DSF-II. BDSF was originally identified in Burkholderia cenocepacia to be involved in regulation of motility, biofilm formation, and virulence in B. cenocepacia. Functional analysis suggested that DSF-II plays a role equal to that of DSF in regulation of biofilm dispersion and virulence factor production in X. campestris pv. campestris. Furthermore, chromatographic separation led to identification of glucose as a specific molecule stimulating DSF family signal biosynthesis in X. campestris pv. campestris. 13C-labeling experiments demonstrated that glucose acts as a substrate to provide a carbon element for DSF biosynthesis. The results of this study indicate that X. campestris pv. campestris could utilize a common metabolite of the host plant to enhance DSF family signal synthesis and therefore promote virulence. PMID:25681189
Characterization of Two Streptomyces Enzymes That Convert Ferulic Acid to Vanillin
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent K m, k cat, and V max values to be 0.35 mM, 67.7 s−1, and 78.2 U mg−1, respectively. The catalytic efficiency (k cat/K m) value of Fcs was 193.4 mM−1 s−1 for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation. PMID:23840666
Comprehensive Molecular Characterization of Papillary Renal Cell Carcinoma
Linehan, W. Marston; Spellman, Paul T.; Ricketts, Christopher J.; Creighton, Chad J.; Fei, Suzanne S.; Davis, Caleb; Wheeler, David A.; Murray, Bradley A.; Schmidt, Laura; Vocke, Cathy D.; Peto, Myron; Al Mamun, Abu Amar M.; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W. Kimryn; Brooks, Angela N.; Hoadley, Katherine A.; Robertson, A. Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J.; Bootwalla, Moiz; Baylin, Stephen B.; Laird, Peter W.; Cherniack, Andrew D.; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B.; Akbani, Rehan; Leiserson, Mark D.M.; Raphael, Benjamin J.; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K.; Czerniak, Bogdan; Godwin, Andrew K.; Hakimi, A. Ari; Ho, Thai; Hsieh, James; Ittmann, Michael; Kim, William Y.; Krishnan, Bhavani; Merino, Maria J.; Mills Shaw, Kenna R.; Reuter, Victor E.; Reznik, Ed; Shelley, Carl Simon; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D.; Penny, Robert J.; Shelton, Candace; Shelton, W. Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T.; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A.; Felau, Ina; Hutter, Carolyn M.; Sheth, Margi; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S.N.; Carlsen, Rebecca; Carter, Scott L.; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R.; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, HarshaVardhan; Drummond, Jennifer; Gabriel, Stacey B.; Gibbs, Richard A.; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D. Neil; Holt, Robert A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Steven J.M.; Jones, Corbin D.; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A.; Moore, Richard A.; Morton, Donna; Mose, Lisle E.; Mungall, Andrew J.; Muzny, Donna; Parker, Joel S.; Perou, Charles M.; Roach, Jeffrey; Schein, Jacqueline E.; Schumacher, Steven E.; Shi, Yan; Simons, Janae V.; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G.; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D.; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N.; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J. Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L.; Boice, Lori; Bollag, Roni J.; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C.; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K.; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L.; Slaton, Joel; Stanton, Melissa; Thompson, R. Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M.; Winemiller, Cythnia; Zach, Leigh Anne; Zuna, Rosemary
2016-01-01
Background Papillary renal cell carcinoma, accounting for 15% of renal cell carcinoma, is a heterogeneous disease consisting of different types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal cell carcinoma; no effective forms of therapy for advanced disease exist. Methods We performed comprehensive molecular characterization utilizing whole-exome sequencing, copy number, mRNA, microRNA, methylation and proteomic analyses of 161 primary papillary renal cell carcinomas. Results Type 1 and Type 2 papillary renal cell carcinomas were found to be different types of renal cancer characterized by specific genetic alterations, with Type 2 further classified into three individual subgroups based on molecular differences that influenced patient survival. MET alterations were associated with Type 1 tumors, whereas Type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-ARE pathway. A CpG island methylator phenotype (CIMP) was found in a distinct subset of Type 2 papillary renal cell carcinoma characterized by poor survival and mutation of the fumarate hydratase (FH) gene. Conclusions Type 1 and Type 2 papillary renal cell carcinomas are clinically and biologically distinct. Alterations in the MET pathway are associated with Type 1 and activation of the NRF2-ARE pathway with Type 2; CDKN2A loss and CIMP in Type 2 convey a poor prognosis. Furthermore, Type 2 papillary renal cell carcinoma consists of at least 3 subtypes based upon molecular and phenotypic features. PMID:26536169
NASA Astrophysics Data System (ADS)
Miller, L. G.; Baesman, S. M.; Oremland, R. S.
2014-12-01
The search for biosignatures of life on Earth includes measurement of the stable isotope fractionation of reactants and products attributed to enzymatic processes and comparison with the often smaller chemical (abiotic) fractionation. We propose that this approach might be applied to study the origin and fate of organic compounds contained in water vapor plumes emanating from Enceladus or other icy bodies, perhaps revealing information about the potential for biology occurring within a sub-surface "habitable" zone. Methanol and C2-hydrocarbons including ethylene, ethane and acetylene (C2H2) have been identified in the plumes of Enceladus. Biological degradation of acetylene proceeds by anaerobic fermentation via acetylene hydratase through acetaldehyde, with a second enzyme (acetaldehyde dismutase) forming acetate and ethanol. We found that incubation of cultures of acetylene-fermenting bacteria exhibit a kinetic isotope effect (KIE) associated with the net removal of C2H2. Consumption of acetylene by both growing and washed-cell cultures of bacteria closely related to Pelobacter acetylenicus (e.g, strain SFB93) was accompanied by a carbon isotopic fractionation of about 2 per mil (KIE = 1.8-2.7 ‰), a result we are examining with other cultures of acetylene fermenters. In addition, we are measuring the carbon isotopic composition of acetaldehyde, ethanol and acetate during fermentation to learn whether these products are fractionated sufficiently, relative to their substrate, to warrant measurement of their isotopic composition in Enceladus (or Europa) plumes to indicate enzymatic activity in liquid environments below the crust of these moons.
Liu, Zhong-Hua; Cao, Yu-Min; Zhou, Qian-Wen; Guo, Kun; Ge, Feng; Hou, Jun-Yi; Hu, Si-Yi; Yuan, Sheng; Dai, Yi-Jun
2013-11-01
Species of the genus Variovorax are often isolated from nitrile or amide-containing organic compound-contaminated soil. However, there have been few biological characterizations of Variovorax and their contaminant-degrading enzymes. Previously, we reported a new soil isolate, Variovorax boronicumulans CGMCC 4969, and its nitrile hydratase that transforms the neonicotinoid insecticide thiacloprid into an amide metabolite. In this study, we showed that CGMCC 4969 is able to degrade acrylamide, a neurotoxicant and carcinogen in animals, during cell growth in a mineral salt medium as well as in its resting state. Resting cells rapidly hydrolyzed 600 mg/L acrylamide to acrylic acid with a half-life of 2.5 min. In in vitro tests, CGMCC 4969 showed plant growth-promoting properties; it produced a siderophore, ammonia, hydrogen cyanide, and the phytohormone salicylic acid. Interestingly, in soil inoculated with this strain, 200 mg/L acrylamide was completely degraded in 4 days. Gene cloning and overexpression in the Escherichia coli strain Rosetta (DE3) pLysS resulted in the production of an aliphatic amidase of 345 amino acids that hydrolyzed acrylamide into acrylic acid. The amidase contained a conserved catalytic triad, Glu59, Lys 134, and Cys166, and an "MRHGDISSS" amino acid sequence at the N-terminal region. Variovorax boronicumulans CGMCC 4969, which is able to use acrylamide for cell growth and rapidly degrade acrylamide in soil, shows promising plant growth-promoting properties. As such, it has the potential to be developed into an effective Bioaugmentation strategy to promote growth of field crops in acrylamide-contaminated soil.
ECHS1 mutations in Leigh disease: a new inborn error of metabolism affecting valine metabolism.
Peters, Heidi; Buck, Nicole; Wanders, Ronald; Ruiter, Jos; Waterham, Hans; Koster, Janet; Yaplito-Lee, Joy; Ferdinandusse, Sacha; Pitt, James
2014-11-01
Two siblings with fatal Leigh disease had increased excretion of S-(2-carboxypropyl)cysteine and several other metabolites that are features of 3-hydroxyisobutyryl-CoA hydrolase (HIBCH) deficiency, a rare defect in the valine catabolic pathway associated with Leigh-like disease. However, this diagnosis was excluded by HIBCH sequencing and normal enzyme activity. In contrast to HIBCH deficiency, the excretion of 3-hydroxyisobutyryl-carnitine was normal in the children, suggesting deficiency of short-chain enoyl-CoA hydratase (ECHS1 gene). This mitochondrial enzyme is active in several metabolic pathways involving fatty acids and amino acids, including valine, and is immediately upstream of HIBCH in the valine pathway. Both children were compound heterozygous for a c.473C > A (p.A158D) missense mutation and a c.414+3G>C splicing mutation in ECHS1. ECHS1 activity was markedly decreased in cultured fibroblasts from both siblings, ECHS1 protein was undetectable by immunoblot analysis and transfection of patient cells with wild-type ECHS1 rescued ECHS1 activity. The highly reactive metabolites methacrylyl-CoA and acryloyl-CoA accumulate in deficiencies of both ECHS1 and HIBCH and are probably responsible for the brain pathology in both disorders. Deficiency of ECHS1 or HIBCH should be considered in children with Leigh disease. Urine metabolite testing can detect and distinguish between these two disorders. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
On the maximum-entropy/autoregressive modeling of time series
NASA Technical Reports Server (NTRS)
Chao, B. F.
1984-01-01
The autoregressive (AR) model of a random process is interpreted in the light of the Prony's relation which relates a complex conjugate pair of poles of the AR process in the z-plane (or the z domain) on the one hand, to the complex frequency of one complex harmonic function in the time domain on the other. Thus the AR model of a time series is one that models the time series as a linear combination of complex harmonic functions, which include pure sinusoids and real exponentials as special cases. An AR model is completely determined by its z-domain pole configuration. The maximum-entropy/autogressive (ME/AR) spectrum, defined on the unit circle of the z-plane (or the frequency domain), is nothing but a convenient, but ambiguous visual representation. It is asserted that the position and shape of a spectral peak is determined by the corresponding complex frequency, and the height of the spectral peak contains little information about the complex amplitude of the complex harmonic functions.
NASA Astrophysics Data System (ADS)
Zhang, Yali; Wang, Jun
2017-09-01
In an attempt to investigate the nonlinear complex evolution of financial dynamics, a new financial price model - the multitype range-intensity contact (MRIC) financial model, is developed based on the multitype range-intensity interacting contact system, in which the interaction and transmission of different types of investment attitudes in a stock market are simulated by viruses spreading. Two new random visibility graph (VG) based analyses and Lempel-Ziv complexity (LZC) are applied to study the complex behaviors of return time series and the corresponding random sorted series. The VG method is the complex network theory, and the LZC is a non-parametric measure of complexity reflecting the rate of new pattern generation of a series. In this work, the real stock market indices are considered to be comparatively studied with the simulation data of the proposed model. Further, the numerical empirical study shows the similar complexity behaviors between the model and the real markets, the research confirms that the financial model is reasonable to some extent.
Rainfall runoff modelling of the Upper Ganga and Brahmaputra basins using PERSiST.
Futter, M N; Whitehead, P G; Sarkar, S; Rodda, H; Crossman, J
2015-06-01
There are ongoing discussions about the appropriate level of complexity and sources of uncertainty in rainfall runoff models. Simulations for operational hydrology, flood forecasting or nutrient transport all warrant different levels of complexity in the modelling approach. More complex model structures are appropriate for simulations of land-cover dependent nutrient transport while more parsimonious model structures may be adequate for runoff simulation. The appropriate level of complexity is also dependent on data availability. Here, we use PERSiST; a simple, semi-distributed dynamic rainfall-runoff modelling toolkit to simulate flows in the Upper Ganges and Brahmaputra rivers. We present two sets of simulations driven by single time series of daily precipitation and temperature using simple (A) and complex (B) model structures based on uniform and hydrochemically relevant land covers respectively. Models were compared based on ensembles of Bayesian Information Criterion (BIC) statistics. Equifinality was observed for parameters but not for model structures. Model performance was better for the more complex (B) structural representations than for parsimonious model structures. The results show that structural uncertainty is more important than parameter uncertainty. The ensembles of BIC statistics suggested that neither structural representation was preferable in a statistical sense. Simulations presented here confirm that relatively simple models with limited data requirements can be used to credibly simulate flows and water balance components needed for nutrient flux modelling in large, data-poor basins.
ERIC Educational Resources Information Center
Stålne, Kristian; Kjellström, Sofia; Utriainen, Jukka
2016-01-01
An important aspect of higher education is to educate students who can manage complex relationships and solve complex problems. Teachers need to be able to evaluate course content with regard to complexity, as well as evaluate students' ability to assimilate complex content and express it in the form of a learning outcome. One model for evaluating…
Multifaceted Modelling of Complex Business Enterprises
2015-01-01
We formalise and present a new generic multifaceted complex system approach for modelling complex business enterprises. Our method has a strong focus on integrating the various data types available in an enterprise which represent the diverse perspectives of various stakeholders. We explain the challenges faced and define a novel approach to converting diverse data types into usable Bayesian probability forms. The data types that can be integrated include historic data, survey data, and management planning data, expert knowledge and incomplete data. The structural complexities of the complex system modelling process, based on various decision contexts, are also explained along with a solution. This new application of complex system models as a management tool for decision making is demonstrated using a railway transport case study. The case study demonstrates how the new approach can be utilised to develop a customised decision support model for a specific enterprise. Various decision scenarios are also provided to illustrate the versatility of the decision model at different phases of enterprise operations such as planning and control. PMID:26247591
Multifaceted Modelling of Complex Business Enterprises.
Chakraborty, Subrata; Mengersen, Kerrie; Fidge, Colin; Ma, Lin; Lassen, David
2015-01-01
We formalise and present a new generic multifaceted complex system approach for modelling complex business enterprises. Our method has a strong focus on integrating the various data types available in an enterprise which represent the diverse perspectives of various stakeholders. We explain the challenges faced and define a novel approach to converting diverse data types into usable Bayesian probability forms. The data types that can be integrated include historic data, survey data, and management planning data, expert knowledge and incomplete data. The structural complexities of the complex system modelling process, based on various decision contexts, are also explained along with a solution. This new application of complex system models as a management tool for decision making is demonstrated using a railway transport case study. The case study demonstrates how the new approach can be utilised to develop a customised decision support model for a specific enterprise. Various decision scenarios are also provided to illustrate the versatility of the decision model at different phases of enterprise operations such as planning and control.
Nonlinear complexity behaviors of agent-based 3D Potts financial dynamics with random environments
NASA Astrophysics Data System (ADS)
Xing, Yani; Wang, Jun
2018-02-01
A new microscopic 3D Potts interaction financial price model is established in this work, to investigate the nonlinear complexity behaviors of stock markets. 3D Potts model, which extends the 2D Potts model to three-dimensional, is a cubic lattice model to explain the interaction behavior among the agents. In order to explore the complexity of real financial markets and the 3D Potts financial model, a new random coarse-grained Lempel-Ziv complexity is proposed to certain series, such as the price returns, the price volatilities, and the random time d-returns. Then the composite multiscale entropy (CMSE) method is applied to the intrinsic mode functions (IMFs) and the corresponding shuffled data to study the complexity behaviors. The empirical results indicate that the 3D financial model is feasible.
Syntactic Complexity as an Aspect of Text Complexity
ERIC Educational Resources Information Center
Frantz, Roger S.; Starr, Laura E.; Bailey, Alison L.
2015-01-01
Students' ability to read complex texts is emphasized in the Common Core State Standards (CCSS) for English Language Arts and Literacy. The standards propose a three-part model for measuring text complexity. Although the model presents a robust means for determining text complexity based on a variety of features inherent to a text as well as…
Shippee, Nathan D; Shah, Nilay D; May, Carl R; Mair, Frances S; Montori, Victor M
2012-10-01
To design a functional, patient-centered model of patient complexity with practical applicability to analytic design and clinical practice. Existing literature on patient complexity has mainly identified its components descriptively and in isolation, lacking clarity as to their combined functions in disrupting care or to how complexity changes over time. The authors developed a cumulative complexity model, which integrates existing literature and emphasizes how clinical and social factors accumulate and interact to complicate patient care. A narrative literature review is used to explicate the model. The model emphasizes a core, patient-level mechanism whereby complicating factors impact care and outcomes: the balance between patient workload of demands and patient capacity to address demands. Workload encompasses the demands on the patient's time and energy, including demands of treatment, self-care, and life in general. Capacity concerns ability to handle work (e.g., functional morbidity, financial/social resources, literacy). Workload-capacity imbalances comprise the mechanism driving patient complexity. Treatment and illness burdens serve as feedback loops, linking negative outcomes to further imbalances, such that complexity may accumulate over time. With its components largely supported by existing literature, the model has implications for analytic design, clinical epidemiology, and clinical practice. Copyright © 2012 Elsevier Inc. All rights reserved.
Reassessing Geophysical Models of the Bushveld Complex in 3D
NASA Astrophysics Data System (ADS)
Cole, J.; Webb, S. J.; Finn, C.
2012-12-01
Conceptual geophysical models of the Bushveld Igneous Complex show three possible geometries for its mafic component: 1) Separate intrusions with vertical feeders for the eastern and western lobes (Cousins, 1959) 2) Separate dipping sheets for the two lobes (Du Plessis and Kleywegt, 1987) 3) A single saucer-shaped unit connected at depth in the central part between the two lobes (Cawthorn et al, 1998) Model three incorporates isostatic adjustment of the crust in response to the weight of the dense mafic material. The model was corroborated by results of a broadband seismic array over southern Africa, known as the Southern African Seismic Experiment (SASE) (Nguuri, et al, 2001; Webb et al, 2004). This new information about the crustal thickness only became available in the last decade and could not be considered in the earlier models. Nevertheless, there is still on-going debate as to which model is correct. All of the models published up to now have been done in 2 or 2.5 dimensions. This is not well suited to modelling the complex geometry of the Bushveld intrusion. 3D modelling takes into account effects of variations in geometry and geophysical properties of lithologies in a full three dimensional sense and therefore affects the shape and amplitude of calculated fields. The main question is how the new knowledge of the increased crustal thickness, as well as the complexity of the Bushveld Complex, will impact on the gravity fields calculated for the existing conceptual models, when modelling in 3D. The three published geophysical models were remodelled using full 3Dl potential field modelling software, and including crustal thickness obtained from the SASE. The aim was not to construct very detailed models, but to test the existing conceptual models in an equally conceptual way. Firstly a specific 2D model was recreated in 3D, without crustal thickening, to establish the difference between 2D and 3D results. Then the thicker crust was added. Including the less dense, thicker crust underneath the Bushveld Complex necessitates the presence of dense material in the central area between the eastern and western lobes. The simplest way to achieve this is to model the mafic component of the Bushveld Complex as a single intrusion. This is similar to what the first students of the Bushveld Complex suggested. Conceptual models are by definition simplified versions of the real situation, and the geometry of the Bushveld Complex is expected to be much more intricate. References Cawthorn, R.G., Cooper, G.R.J., Webb, S.J. (1998). Connectivity between the western and eastern limbs of the Bushveld Complex. S Afr J Geol, 101, 291-298. Cousins, C.A. (1959). The structure of the mafic portion of the Bushveld Igneous Complex. Trans Geol Soc S Afr, 62, 179-189. Du Plessis, A., Kleywegt, R.J. (1987). A dipping sheet model for the mafic lobes of the Bushveld Complex. S Afr J Geol, 90, 1-6. Nguuri, T.K., Gore, J., James, D.E., Webb, S.J., Wright, C., Zengeni, T.G., Gwavava, O., Snoke, J.A. and Kaapvaal Seismic Group. (2001). Crustal structure beneath southern Africa and its implications for the formation and evolution of the Kaapvaal and Zimbabwe cratons. Geoph Res Lett, 28, 2501-2504. Webb, S.J., Cawthorn, R.G., Nguuri, T., James, D. (2004). Gravity modelling of Bushveld Complex connectivity supported by Southern African Seismic Experiment results, S Afr J Geol, 107, 207-218.
A simple model clarifies the complicated relationships of complex networks
Zheng, Bojin; Wu, Hongrun; Kuang, Li; Qin, Jun; Du, Wenhua; Wang, Jianmin; Li, Deyi
2014-01-01
Real-world networks such as the Internet and WWW have many common traits. Until now, hundreds of models were proposed to characterize these traits for understanding the networks. Because different models used very different mechanisms, it is widely believed that these traits origin from different causes. However, we find that a simple model based on optimisation can produce many traits, including scale-free, small-world, ultra small-world, Delta-distribution, compact, fractal, regular and random networks. Moreover, by revising the proposed model, the community-structure networks are generated. By this model and the revised versions, the complicated relationships of complex networks are illustrated. The model brings a new universal perspective to the understanding of complex networks and provide a universal method to model complex networks from the viewpoint of optimisation. PMID:25160506
Pattern-oriented modeling of agent-based complex systems: Lessons from ecology
Grimm, Volker; Revilla, Eloy; Berger, Uta; Jeltsch, Florian; Mooij, Wolf M.; Railsback, Steven F.; Thulke, Hans-Hermann; Weiner, Jacob; Wiegand, Thorsten; DeAngelis, Donald L.
2005-01-01
Agent-based complex systems are dynamic networks of many interacting agents; examples include ecosystems, financial markets, and cities. The search for general principles underlying the internal organization of such systems often uses bottom-up simulation models such as cellular automata and agent-based models. No general framework for designing, testing, and analyzing bottom-up models has yet been established, but recent advances in ecological modeling have come together in a general strategy we call pattern-oriented modeling. This strategy provides a unifying framework for decoding the internal organization of agent-based complex systems and may lead toward unifying algorithmic theories of the relation between adaptive behavior and system complexity.
Pattern-Oriented Modeling of Agent-Based Complex Systems: Lessons from Ecology
NASA Astrophysics Data System (ADS)
Grimm, Volker; Revilla, Eloy; Berger, Uta; Jeltsch, Florian; Mooij, Wolf M.; Railsback, Steven F.; Thulke, Hans-Hermann; Weiner, Jacob; Wiegand, Thorsten; DeAngelis, Donald L.
2005-11-01
Agent-based complex systems are dynamic networks of many interacting agents; examples include ecosystems, financial markets, and cities. The search for general principles underlying the internal organization of such systems often uses bottom-up simulation models such as cellular automata and agent-based models. No general framework for designing, testing, and analyzing bottom-up models has yet been established, but recent advances in ecological modeling have come together in a general strategy we call pattern-oriented modeling. This strategy provides a unifying framework for decoding the internal organization of agent-based complex systems and may lead toward unifying algorithmic theories of the relation between adaptive behavior and system complexity.
Epidemic threshold of the susceptible-infected-susceptible model on complex networks
NASA Astrophysics Data System (ADS)
Lee, Hyun Keun; Shim, Pyoung-Seop; Noh, Jae Dong
2013-06-01
We demonstrate that the susceptible-infected-susceptible (SIS) model on complex networks can have an inactive Griffiths phase characterized by a slow relaxation dynamics. It contrasts with the mean-field theoretical prediction that the SIS model on complex networks is active at any nonzero infection rate. The dynamic fluctuation of infected nodes, ignored in the mean field approach, is responsible for the inactive phase. It is proposed that the question whether the epidemic threshold of the SIS model on complex networks is zero or not can be resolved by the percolation threshold in a model where nodes are occupied in degree-descending order. Our arguments are supported by the numerical studies on scale-free network models.
Greek, Ray; Hansen, Lawrence A
2013-11-01
We surveyed the scientific literature regarding amyotrophic lateral sclerosis, the SOD1 mouse model, complex adaptive systems, evolution, drug development, animal models, and philosophy of science in an attempt to analyze the SOD1 mouse model of amyotrophic lateral sclerosis in the context of evolved complex adaptive systems. Humans and animals are examples of evolved complex adaptive systems. It is difficult to predict the outcome from perturbations to such systems because of the characteristics of complex systems. Modeling even one complex adaptive system in order to predict outcomes from perturbations is difficult. Predicting outcomes to one evolved complex adaptive system based on outcomes from a second, especially when the perturbation occurs at higher levels of organization, is even more problematic. Using animal models to predict human outcomes to perturbations such as disease and drugs should have a very low predictive value. We present empirical evidence confirming this and suggest a theory to explain this phenomenon. We analyze the SOD1 mouse model of amyotrophic lateral sclerosis in order to illustrate this position. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Modelling the evolution of complex conductivity during calcite precipitation on glass beads
NASA Astrophysics Data System (ADS)
Leroy, Philippe; Li, Shuai; Jougnot, Damien; Revil, André; Wu, Yuxin
2017-04-01
When pH and alkalinity increase, calcite frequently precipitates and hence modifies the petrophysical properties of porous media. The complex conductivity method can be used to directly monitor calcite precipitation in porous media because it is sensitive to the evolution of the mineralogy, pore structure and its connectivity. We have developed a mechanistic grain polarization model considering the electrochemical polarization of the Stern and diffuse layers surrounding calcite particles. Our complex conductivity model depends on the surface charge density of the Stern layer and on the electrical potential at the onset of the diffuse layer, which are computed using a basic Stern model of the calcite/water interface. The complex conductivity measurements of Wu et al. on a column packed with glass beads where calcite precipitation occurs are reproduced by our surface complexation and complex conductivity models. The evolution of the size and shape of calcite particles during the calcite precipitation experiment is estimated by our complex conductivity model. At the early stage of the calcite precipitation experiment, modelled particles sizes increase and calcite particles flatten with time because calcite crystals nucleate at the surface of glass beads and grow into larger calcite grains. At the later stage of the calcite precipitation experiment, modelled sizes and cementation exponents of calcite particles decrease with time because large calcite grains aggregate over multiple glass beads and only small calcite crystals polarize.
Musculoskeletal modelling of human ankle complex: Estimation of ankle joint moments.
Jamwal, Prashant K; Hussain, Shahid; Tsoi, Yun Ho; Ghayesh, Mergen H; Xie, Sheng Quan
2017-05-01
A musculoskeletal model for the ankle complex is vital in order to enhance the understanding of neuro-mechanical control of ankle motions, diagnose ankle disorders and assess subsequent treatments. Motions at the human ankle and foot, however, are complex due to simultaneous movements at the two joints namely, the ankle joint and the subtalar joint. The musculoskeletal elements at the ankle complex, such as ligaments, muscles and tendons, have intricate arrangements and exhibit transient and nonlinear behaviour. This paper develops a musculoskeletal model of the ankle complex considering the biaxial ankle structure. The model provides estimates of overall mechanical characteristics (motion and moments) of ankle complex through consideration of forces applied along ligaments and muscle-tendon units. The dynamics of the ankle complex and its surrounding ligaments and muscle-tendon units is modelled and formulated into a state space model to facilitate simulations. A graphical user interface is also developed during this research in order to include the visual anatomical information by converting it to quantitative information on coordinates. Validation of the ankle model was carried out by comparing its outputs with those published in literature as well as with experimental data obtained from an existing parallel ankle rehabilitation robot. Qualitative agreement was observed between the model and measured data for both, the passive and active ankle motions during trials in terms of displacements and moments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Impact of gastrectomy procedural complexity on surgical outcomes and hospital comparisons.
Mohanty, Sanjay; Paruch, Jennifer; Bilimoria, Karl Y; Cohen, Mark; Strong, Vivian E; Weber, Sharon M
2015-08-01
Most risk adjustment approaches adjust for patient comorbidities and the primary procedure. However, procedures done at the same time as the index case may increase operative risk and merit inclusion in adjustment models for fair hospital comparisons. Our objectives were to evaluate the impact of surgical complexity on postoperative outcomes and hospital comparisons in gastric cancer surgery. Patients who underwent gastric resection for cancer were identified from a large clinical dataset. Procedure complexity was characterized using secondary procedure CPT codes and work relative value units (RVUs). Regression models were developed to evaluate the association between complexity variables and outcomes. The impact of complexity adjustment on model performance and hospital comparisons was examined. Among 3,467 patients who underwent gastrectomy for adenocarcinoma, 2,171 operations were distal and 1,296 total. A secondary procedure was reported for 33% of distal gastrectomies and 59% of total gastrectomies. Six of 10 secondary procedures were associated with adverse outcomes. For example, patients who underwent a synchronous bowel resection had a higher risk of mortality (odds ratio [OR], 2.14; 95% CI, 1.07-4.29) and reoperation (OR, 2.09; 95% CI, 1.26-3.47). Model performance was slightly better for nearly all outcomes with complexity adjustment (mortality c-statistics: standard model, 0.853; secondary procedure model, 0.858; RVU model, 0.855). Hospital ranking did not change substantially after complexity adjustment. Surgical complexity variables are associated with adverse outcomes in gastrectomy, but complexity adjustment does not affect hospital rankings appreciably. Copyright © 2015 Elsevier Inc. All rights reserved.
Calibration of Complex Subsurface Reaction Models Using a Surrogate-Model Approach
Application of model assessment techniques to complex subsurface reaction models involves numerous difficulties, including non-trivial model selection, parameter non-uniqueness, and excessive computational burden. To overcome these difficulties, this study introduces SAMM (Simult...
Foundations for Streaming Model Transformations by Complex Event Processing.
Dávid, István; Ráth, István; Varró, Dániel
2018-01-01
Streaming model transformations represent a novel class of transformations to manipulate models whose elements are continuously produced or modified in high volume and with rapid rate of change. Executing streaming transformations requires efficient techniques to recognize activated transformation rules over a live model and a potentially infinite stream of events. In this paper, we propose foundations of streaming model transformations by innovatively integrating incremental model query, complex event processing (CEP) and reactive (event-driven) transformation techniques. Complex event processing allows to identify relevant patterns and sequences of events over an event stream. Our approach enables event streams to include model change events which are automatically and continuously populated by incremental model queries. Furthermore, a reactive rule engine carries out transformations on identified complex event patterns. We provide an integrated domain-specific language with precise semantics for capturing complex event patterns and streaming transformations together with an execution engine, all of which is now part of the Viatra reactive transformation framework. We demonstrate the feasibility of our approach with two case studies: one in an advanced model engineering workflow; and one in the context of on-the-fly gesture recognition.
The effects of numerical-model complexity and observation type on estimated porosity values
Starn, Jeffrey; Bagtzoglou, Amvrossios C.; Green, Christopher T.
2015-01-01
The relative merits of model complexity and types of observations employed in model calibration are compared. An existing groundwater flow model coupled with an advective transport simulation of the Salt Lake Valley, Utah (USA), is adapted for advective transport, and effective porosity is adjusted until simulated tritium concentrations match concentrations in samples from wells. Two calibration approaches are used: a “complex” highly parameterized porosity field and a “simple” parsimonious model of porosity distribution. The use of an atmospheric tracer (tritium in this case) and apparent ages (from tritium/helium) in model calibration also are discussed. Of the models tested, the complex model (with tritium concentrations and tritium/helium apparent ages) performs best. Although tritium breakthrough curves simulated by complex and simple models are very generally similar, and there is value in the simple model, the complex model is supported by a more realistic porosity distribution and a greater number of estimable parameters. Culling the best quality data did not lead to better calibration, possibly because of processes and aquifer characteristics that are not simulated. Despite many factors that contribute to shortcomings of both the models and the data, useful information is obtained from all the models evaluated. Although any particular prediction of tritium breakthrough may have large errors, overall, the models mimic observed trends.
Application of surface complexation models to anion adsorption by natural materials
USDA-ARS?s Scientific Manuscript database
Various chemical models of ion adsorption will be presented and discussed. Chemical models, such as surface complexation models, provide a molecular description of anion adsorption reactions using an equilibrium approach. Two such models, the constant capacitance model and the triple layer model w...
Modeling of protein binary complexes using structural mass spectrometry data
Kamal, J.K. Amisha; Chance, Mark R.
2008-01-01
In this article, we describe a general approach to modeling the structure of binary protein complexes using structural mass spectrometry data combined with molecular docking. In the first step, hydroxyl radical mediated oxidative protein footprinting is used to identify residues that experience conformational reorganization due to binding or participate in the binding interface. In the second step, a three-dimensional atomic structure of the complex is derived by computational modeling. Homology modeling approaches are used to define the structures of the individual proteins if footprinting detects significant conformational reorganization as a function of complex formation. A three-dimensional model of the complex is constructed from these binary partners using the ClusPro program, which is composed of docking, energy filtering, and clustering steps. Footprinting data are used to incorporate constraints—positive and/or negative—in the docking step and are also used to decide the type of energy filter—electrostatics or desolvation—in the successive energy-filtering step. By using this approach, we examine the structure of a number of binary complexes of monomeric actin and compare the results to crystallographic data. Based on docking alone, a number of competing models with widely varying structures are observed, one of which is likely to agree with crystallographic data. When the docking steps are guided by footprinting data, accurate models emerge as top scoring. We demonstrate this method with the actin/gelsolin segment-1 complex. We also provide a structural model for the actin/cofilin complex using this approach which does not have a crystal or NMR structure. PMID:18042684
Drewes, Rich; Zou, Quan; Goodman, Philip H
2009-01-01
Neuroscience modeling experiments often involve multiple complex neural network and cell model variants, complex input stimuli and input protocols, followed by complex data analysis. Coordinating all this complexity becomes a central difficulty for the experimenter. The Python programming language, along with its extensive library packages, has emerged as a leading "glue" tool for managing all sorts of complex programmatic tasks. This paper describes a toolkit called Brainlab, written in Python, that leverages Python's strengths for the task of managing the general complexity of neuroscience modeling experiments. Brainlab was also designed to overcome the major difficulties of working with the NCS (NeoCortical Simulator) environment in particular. Brainlab is an integrated model-building, experimentation, and data analysis environment for the powerful parallel spiking neural network simulator system NCS.
Drewes, Rich; Zou, Quan; Goodman, Philip H.
2008-01-01
Neuroscience modeling experiments often involve multiple complex neural network and cell model variants, complex input stimuli and input protocols, followed by complex data analysis. Coordinating all this complexity becomes a central difficulty for the experimenter. The Python programming language, along with its extensive library packages, has emerged as a leading “glue” tool for managing all sorts of complex programmatic tasks. This paper describes a toolkit called Brainlab, written in Python, that leverages Python's strengths for the task of managing the general complexity of neuroscience modeling experiments. Brainlab was also designed to overcome the major difficulties of working with the NCS (NeoCortical Simulator) environment in particular. Brainlab is an integrated model-building, experimentation, and data analysis environment for the powerful parallel spiking neural network simulator system NCS. PMID:19506707
Stochastic simulation of multiscale complex systems with PISKaS: A rule-based approach.
Perez-Acle, Tomas; Fuenzalida, Ignacio; Martin, Alberto J M; Santibañez, Rodrigo; Avaria, Rodrigo; Bernardin, Alejandro; Bustos, Alvaro M; Garrido, Daniel; Dushoff, Jonathan; Liu, James H
2018-03-29
Computational simulation is a widely employed methodology to study the dynamic behavior of complex systems. Although common approaches are based either on ordinary differential equations or stochastic differential equations, these techniques make several assumptions which, when it comes to biological processes, could often lead to unrealistic models. Among others, model approaches based on differential equations entangle kinetics and causality, failing when complexity increases, separating knowledge from models, and assuming that the average behavior of the population encompasses any individual deviation. To overcome these limitations, simulations based on the Stochastic Simulation Algorithm (SSA) appear as a suitable approach to model complex biological systems. In this work, we review three different models executed in PISKaS: a rule-based framework to produce multiscale stochastic simulations of complex systems. These models span multiple time and spatial scales ranging from gene regulation up to Game Theory. In the first example, we describe a model of the core regulatory network of gene expression in Escherichia coli highlighting the continuous model improvement capacities of PISKaS. The second example describes a hypothetical outbreak of the Ebola virus occurring in a compartmentalized environment resembling cities and highways. Finally, in the last example, we illustrate a stochastic model for the prisoner's dilemma; a common approach from social sciences describing complex interactions involving trust within human populations. As whole, these models demonstrate the capabilities of PISKaS providing fertile scenarios where to explore the dynamics of complex systems. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
A multi-element cosmological model with a complex space-time topology
NASA Astrophysics Data System (ADS)
Kardashev, N. S.; Lipatova, L. N.; Novikov, I. D.; Shatskiy, A. A.
2015-02-01
Wormhole models with a complex topology having one entrance and two exits into the same space-time of another universe are considered, as well as models with two entrances from the same space-time and one exit to another universe. These models are used to build a model of a multi-sheeted universe (a multi-element model of the "Multiverse") with a complex topology. Spherical symmetry is assumed in all the models. A Reissner-Norström black-hole model having no singularity beyond the horizon is constructed. The strength of the central singularity of the black hole is analyzed.
Andrianakis, I; Vernon, I; McCreesh, N; McKinley, T J; Oakley, J E; Nsubuga, R N; Goldstein, M; White, R G
2017-08-01
Complex stochastic models are commonplace in epidemiology, but their utility depends on their calibration to empirical data. History matching is a (pre)calibration method that has been applied successfully to complex deterministic models. In this work, we adapt history matching to stochastic models, by emulating the variance in the model outputs, and therefore accounting for its dependence on the model's input values. The method proposed is applied to a real complex epidemiological model of human immunodeficiency virus in Uganda with 22 inputs and 18 outputs, and is found to increase the efficiency of history matching, requiring 70% of the time and 43% fewer simulator evaluations compared with a previous variant of the method. The insight gained into the structure of the human immunodeficiency virus model, and the constraints placed on it, are then discussed.
Acquisition of Complex Systemic Thinking: Mental Models of Evolution
ERIC Educational Resources Information Center
d'Apollonia, Sylvia T.; Charles, Elizabeth S.; Boyd, Gary M.
2004-01-01
We investigated the impact of introducing college students to complex adaptive systems on their subsequent mental models of evolution compared to those of students taught in the same manner but with no reference to complex systems. The students' mental models (derived from similarity ratings of 12 evolutionary terms using the pathfinder algorithm)…
Designing an Educational Game with Ten Steps to Complex Learning
ERIC Educational Resources Information Center
Enfield, Jacob
2012-01-01
Few instructional design (ID) models exist which are specific for developing educational games. Moreover, those extant ID models have not been rigorously evaluated. No ID models were found which focus on educational games with complex learning objectives. "Ten Steps to Complex Learning" (TSCL) is based on the four component instructional…
Designing novel cellulase systems through agent-based modeling and global sensitivity analysis.
Apte, Advait A; Senger, Ryan S; Fong, Stephen S
2014-01-01
Experimental techniques allow engineering of biological systems to modify functionality; however, there still remains a need to develop tools to prioritize targets for modification. In this study, agent-based modeling (ABM) was used to build stochastic models of complexed and non-complexed cellulose hydrolysis, including enzymatic mechanisms for endoglucanase, exoglucanase, and β-glucosidase activity. Modeling results were consistent with experimental observations of higher efficiency in complexed systems than non-complexed systems and established relationships between specific cellulolytic mechanisms and overall efficiency. Global sensitivity analysis (GSA) of model results identified key parameters for improving overall cellulose hydrolysis efficiency including: (1) the cellulase half-life, (2) the exoglucanase activity, and (3) the cellulase composition. Overall, the following parameters were found to significantly influence cellulose consumption in a consolidated bioprocess (CBP): (1) the glucose uptake rate of the culture, (2) the bacterial cell concentration, and (3) the nature of the cellulase enzyme system (complexed or non-complexed). Broadly, these results demonstrate the utility of combining modeling and sensitivity analysis to identify key parameters and/or targets for experimental improvement.
Designing novel cellulase systems through agent-based modeling and global sensitivity analysis
Apte, Advait A; Senger, Ryan S; Fong, Stephen S
2014-01-01
Experimental techniques allow engineering of biological systems to modify functionality; however, there still remains a need to develop tools to prioritize targets for modification. In this study, agent-based modeling (ABM) was used to build stochastic models of complexed and non-complexed cellulose hydrolysis, including enzymatic mechanisms for endoglucanase, exoglucanase, and β-glucosidase activity. Modeling results were consistent with experimental observations of higher efficiency in complexed systems than non-complexed systems and established relationships between specific cellulolytic mechanisms and overall efficiency. Global sensitivity analysis (GSA) of model results identified key parameters for improving overall cellulose hydrolysis efficiency including: (1) the cellulase half-life, (2) the exoglucanase activity, and (3) the cellulase composition. Overall, the following parameters were found to significantly influence cellulose consumption in a consolidated bioprocess (CBP): (1) the glucose uptake rate of the culture, (2) the bacterial cell concentration, and (3) the nature of the cellulase enzyme system (complexed or non-complexed). Broadly, these results demonstrate the utility of combining modeling and sensitivity analysis to identify key parameters and/or targets for experimental improvement. PMID:24830736
Tuca, Albert; Gómez-Martínez, Mónica; Prat, Aleix
2018-01-01
Model of early palliative care (PC) integrated in oncology is based on shared care from the diagnosis to the end of life and is mainly focused on patients with greater complexity. However, there is no definition or tools to evaluate PC complexity. The objectives of the study were to identify the factors influencing level determination of complexity, propose predictive models, and build a complexity scale of PC. We performed a prospective, observational, multicenter study in a cohort of advanced cancer patients with an estimated prognosis ≤ 6 months. An ad hoc structured evaluation including socio-demographic and clinical data, symptom burden, functional and cognitive status, psychosocial problems, and existential-ethic dilemmas was recorded systematically. According to this multidimensional evaluation, investigator classified patients as high, medium, or low palliative complexity, associated to need of basic or specialized PC. Logistic regression was used to identify the variables influencing determination of level of PC complexity and explore predictive models. We included 324 patients; 41% were classified as having high PC complexity and 42.9% as medium, both levels being associated with specialized PC. Variables influencing determination of PC complexity were as follows: high symptom burden (OR 3.19 95%CI: 1.72-6.17), difficult pain (OR 2.81 95%CI:1.64-4.9), functional status (OR 0.99 95%CI:0.98-0.9), and social-ethical existential risk factors (OR 3.11 95%CI:1.73-5.77). Logistic analysis of variables allowed construct a complexity model and structured scales (PALCOM 1 and 2) with high predictive value (AUC ROC 76%). This study provides a new model and tools to assess complexity in palliative care, which may be very useful to manage referral to specialized PC services, and agree intensity of their intervention in a model of early-shared care integrated in oncology.
On Using Meta-Modeling and Multi-Modeling to Address Complex Problems
ERIC Educational Resources Information Center
Abu Jbara, Ahmed
2013-01-01
Models, created using different modeling techniques, usually serve different purposes and provide unique insights. While each modeling technique might be capable of answering specific questions, complex problems require multiple models interoperating to complement/supplement each other; we call this Multi-Modeling. To address the syntactic and…
Bursting Transition Dynamics Within the Pre-Bötzinger Complex
NASA Astrophysics Data System (ADS)
Duan, Lixia; Chen, Xi; Tang, Xuhui; Su, Jianzhong
The pre-Bötzinger complex of the mammalian brain stem plays a crucial role in the respiratory rhythms generation. Neurons within the pre-Bötzinger complex have been found experimentally to yield different firing activities. In this paper, we study the spiking and bursting activities related to the respiratory rhythms in the pre-Bötzinger complex based on a mathematical model proposed by Butera. Using the one-dimensional first recurrence map induced by dynamics, we investigate the different bursting patterns and their transition of the pre-Bötzinger complex neurons based on the Butera model, after we derived a one-dimensional map from the dynamical characters of the differential equations, and we obtained conditions for the transition of different bursting patterns. These analytical results were verified through numerical simulations. We conclude that the one-dimensional map contains similar rhythmic patterns as the Butera model and can be used as a simpler modeling tool to study fast-slow models like pre-Bötzinger complex neural circuit.
Template-based structure modeling of protein-protein interactions
Szilagyi, Andras; Zhang, Yang
2014-01-01
The structure of protein-protein complexes can be constructed by using the known structure of other protein complexes as a template. The complex structure templates are generally detected either by homology-based sequence alignments or, given the structure of monomer components, by structure-based comparisons. Critical improvements have been made in recent years by utilizing interface recognition and by recombining monomer and complex template libraries. Encouraging progress has also been witnessed in genome-wide applications of template-based modeling, with modeling accuracy comparable to high-throughput experimental data. Nevertheless, bottlenecks exist due to the incompleteness of the proteinprotein complex structure library and the lack of methods for distant homologous template identification and full-length complex structure refinement. PMID:24721449
NASA Astrophysics Data System (ADS)
Rocha, Alby D.; Groen, Thomas A.; Skidmore, Andrew K.; Darvishzadeh, Roshanak; Willemen, Louise
2017-11-01
The growing number of narrow spectral bands in hyperspectral remote sensing improves the capacity to describe and predict biological processes in ecosystems. But it also poses a challenge to fit empirical models based on such high dimensional data, which often contain correlated and noisy predictors. As sample sizes, to train and validate empirical models, seem not to be increasing at the same rate, overfitting has become a serious concern. Overly complex models lead to overfitting by capturing more than the underlying relationship, and also through fitting random noise in the data. Many regression techniques claim to overcome these problems by using different strategies to constrain complexity, such as limiting the number of terms in the model, by creating latent variables or by shrinking parameter coefficients. This paper is proposing a new method, named Naïve Overfitting Index Selection (NOIS), which makes use of artificially generated spectra, to quantify the relative model overfitting and to select an optimal model complexity supported by the data. The robustness of this new method is assessed by comparing it to a traditional model selection based on cross-validation. The optimal model complexity is determined for seven different regression techniques, such as partial least squares regression, support vector machine, artificial neural network and tree-based regressions using five hyperspectral datasets. The NOIS method selects less complex models, which present accuracies similar to the cross-validation method. The NOIS method reduces the chance of overfitting, thereby avoiding models that present accurate predictions that are only valid for the data used, and too complex to make inferences about the underlying process.
Laghari, Samreen; Niazi, Muaz A
2016-01-01
Computer Networks have a tendency to grow at an unprecedented scale. Modern networks involve not only computers but also a wide variety of other interconnected devices ranging from mobile phones to other household items fitted with sensors. This vision of the "Internet of Things" (IoT) implies an inherent difficulty in modeling problems. It is practically impossible to implement and test all scenarios for large-scale and complex adaptive communication networks as part of Complex Adaptive Communication Networks and Environments (CACOONS). The goal of this study is to explore the use of Agent-based Modeling as part of the Cognitive Agent-based Computing (CABC) framework to model a Complex communication network problem. We use Exploratory Agent-based Modeling (EABM), as part of the CABC framework, to develop an autonomous multi-agent architecture for managing carbon footprint in a corporate network. To evaluate the application of complexity in practical scenarios, we have also introduced a company-defined computer usage policy. The conducted experiments demonstrated two important results: Primarily CABC-based modeling approach such as using Agent-based Modeling can be an effective approach to modeling complex problems in the domain of IoT. Secondly, the specific problem of managing the Carbon footprint can be solved using a multiagent system approach.
Modeling and complexity of stochastic interacting Lévy type financial price dynamics
NASA Astrophysics Data System (ADS)
Wang, Yiduan; Zheng, Shenzhou; Zhang, Wei; Wang, Jun; Wang, Guochao
2018-06-01
In attempt to reproduce and investigate nonlinear dynamics of security markets, a novel nonlinear random interacting price dynamics, which is considered as a Lévy type process, is developed and investigated by the combination of lattice oriented percolation and Potts dynamics, which concerns with the instinctive random fluctuation and the fluctuation caused by the spread of the investors' trading attitudes, respectively. To better understand the fluctuation complexity properties of the proposed model, the complexity analyses of random logarithmic price return and corresponding volatility series are preformed, including power-law distribution, Lempel-Ziv complexity and fractional sample entropy. In order to verify the rationality of the proposed model, the corresponding studies of actual security market datasets are also implemented for comparison. The empirical results reveal that this financial price model can reproduce some important complexity features of actual security markets to some extent. The complexity of returns decreases with the increase of parameters γ1 and β respectively, furthermore, the volatility series exhibit lower complexity than the return series
Regulation of the protein-conducting channel by a bound ribosome
Gumbart, James; Trabuco, Leonardo G.; Schreiner, Eduard; Villa, Elizabeth; Schulten, Klaus
2009-01-01
Summary During protein synthesis, it is often necessary for the ribosome to form a complex with a membrane-bound channel, the SecY/Sec61 complex, in order to translocate nascent proteins across a cellular membrane. Structural data on the ribosome-channel complex are currently limited to low-resolution cryo-electron microscopy maps, including one showing a bacterial ribosome bound to a monomeric SecY complex. Using that map along with available atomic-level models of the ribosome and SecY, we have determined, through molecular dynamics flexible fitting (MDFF), an atomic-resolution model of the ribosome-channel complex. We characterized computationally the sites of ribosome-SecY interaction within the complex and determined the effect of ribosome binding on the SecY channel. We also constructed a model of a ribosome in complex with a SecY dimer by adding a second copy of SecY to the MDFF-derived model. The study involved 2.7-million-atom simulations over altogether nearly 50 ns. PMID:19913480
NASA Astrophysics Data System (ADS)
Jackson-Blake, L. A.; Sample, J. E.; Wade, A. J.; Helliwell, R. C.; Skeffington, R. A.
2017-07-01
Catchment-scale water quality models are increasingly popular tools for exploring the potential effects of land management, land use change and climate change on water quality. However, the dynamic, catchment-scale nutrient models in common usage are complex, with many uncertain parameters requiring calibration, limiting their usability and robustness. A key question is whether this complexity is justified. To explore this, we developed a parsimonious phosphorus model, SimplyP, incorporating a rainfall-runoff model and a biogeochemical model able to simulate daily streamflow, suspended sediment, and particulate and dissolved phosphorus dynamics. The model's complexity was compared to one popular nutrient model, INCA-P, and the performance of the two models was compared in a small rural catchment in northeast Scotland. For three land use classes, less than six SimplyP parameters must be determined through calibration, the rest may be based on measurements, while INCA-P has around 40 unmeasurable parameters. Despite substantially simpler process-representation, SimplyP performed comparably to INCA-P in both calibration and validation and produced similar long-term projections in response to changes in land management. Results support the hypothesis that INCA-P is overly complex for the study catchment. We hope our findings will help prompt wider model comparison exercises, as well as debate among the water quality modeling community as to whether today's models are fit for purpose. Simpler models such as SimplyP have the potential to be useful management and research tools, building blocks for future model development (prototype code is freely available), or benchmarks against which more complex models could be evaluated.
2.5D complex resistivity modeling and inversion using unstructured grids
NASA Astrophysics Data System (ADS)
Xu, Kaijun; Sun, Jie
2016-04-01
The characteristic of complex resistivity on rock and ore has been recognized by people for a long time. Generally we have used the Cole-Cole Model(CCM) to describe complex resistivity. It has been proved that the electrical anomaly of geologic body can be quantitative estimated by CCM parameters such as direct resistivity(ρ0), chargeability(m), time constant(τ) and frequency dependence(c). Thus it is very important to obtain the complex parameters of geologic body. It is difficult to approximate complex structures and terrain using traditional rectangular grid. In order to enhance the numerical accuracy and rationality of modeling and inversion, we use an adaptive finite-element algorithm for forward modeling of the frequency-domain 2.5D complex resistivity and implement the conjugate gradient algorithm in the inversion of 2.5D complex resistivity. An adaptive finite element method is applied for solving the 2.5D complex resistivity forward modeling of horizontal electric dipole source. First of all, the CCM is introduced into the Maxwell's equations to calculate the complex resistivity electromagnetic fields. Next, the pseudo delta function is used to distribute electric dipole source. Then the electromagnetic fields can be expressed in terms of the primary fields caused by layered structure and the secondary fields caused by inhomogeneities anomalous conductivity. At last, we calculated the electromagnetic fields response of complex geoelectric structures such as anticline, syncline, fault. The modeling results show that adaptive finite-element methods can automatically improve mesh generation and simulate complex geoelectric models using unstructured grids. The 2.5D complex resistivity invertion is implemented based the conjugate gradient algorithm.The conjugate gradient algorithm doesn't need to compute the sensitivity matrix but directly computes the sensitivity matrix or its transpose multiplying vector. In addition, the inversion target zones are segmented with fine grids and the background zones are segmented with big grid, the method can reduce the grid amounts of inversion, it is very helpful to improve the computational efficiency. The inversion results verify the validity and stability of conjugate gradient inversion algorithm. The results of theoretical calculation indicate that the modeling and inversion of 2.5D complex resistivity using unstructured grids are feasible. Using unstructured grids can improve the accuracy of modeling, but the large number of grids inversion is extremely time-consuming, so the parallel computation for the inversion is necessary. Acknowledgments: We thank to the support of the National Natural Science Foundation of China(41304094).
NASA Astrophysics Data System (ADS)
Li, Chunguang; Maini, Philip K.
2005-10-01
The Penna bit-string model successfully encompasses many phenomena of population evolution, including inheritance, mutation, evolution, and aging. If we consider social interactions among individuals in the Penna model, the population will form a complex network. In this paper, we first modify the Verhulst factor to control only the birth rate, and introduce activity-based preferential reproduction of offspring in the Penna model. The social interactions among individuals are generated by both inheritance and activity-based preferential increase. Then we study the properties of the complex network generated by the modified Penna model. We find that the resulting complex network has a small-world effect and the assortative mixing property.
ERIC Educational Resources Information Center
Wu, Jiun-Yu; Kwok, Oi-man
2012-01-01
Both ad-hoc robust sandwich standard error estimators (design-based approach) and multilevel analysis (model-based approach) are commonly used for analyzing complex survey data with nonindependent observations. Although these 2 approaches perform equally well on analyzing complex survey data with equal between- and within-level model structures…
ERIC Educational Resources Information Center
Northrup, Jessie Bolz
2017-01-01
The present article proposes a new developmental model of how young infants adapt and respond to complex contingencies in their environment, and how this influences development. The model proposes that typically developing infants adjust to an increasingly complex environment in ways that make it easier for them to allocate limited attentional…
NASA Astrophysics Data System (ADS)
Bezruchko, Konstantin; Davidov, Albert
2009-01-01
In the given article scientific and technical complex for modeling, researching and testing of rocket-space vehicles' power installations which was created in Power Source Laboratory of National Aerospace University "KhAI" is described. This scientific and technical complex gives the opportunity to replace the full-sized tests on model tests and to reduce financial and temporary inputs at modeling, researching and testing of rocket-space vehicles' power installations. Using the given complex it is possible to solve the problems of designing and researching of rocket-space vehicles' power installations efficiently, and also to provide experimental researches of physical processes and tests of solar and chemical batteries of rocket-space complexes and space vehicles. Scientific and technical complex also allows providing accelerated tests, diagnostics, life-time control and restoring of chemical accumulators for rocket-space vehicles' power supply systems.
Food-web complexity emerging from ecological dynamics on adaptive networks.
Garcia-Domingo, Josep L; Saldaña, Joan
2007-08-21
Food webs are complex networks describing trophic interactions in ecological communities. Since Robert May's seminal work on random structured food webs, the complexity-stability debate is a central issue in ecology: does network complexity increase or decrease food-web persistence? A multi-species predator-prey model incorporating adaptive predation shows that the action of ecological dynamics on the topology of a food web (whose initial configuration is generated either by the cascade model or by the niche model) render, when a significant fraction of adaptive predators is present, similar hyperbolic complexity-persistence relationships as those observed in empirical food webs. It is also shown that the apparent positive relation between complexity and persistence in food webs generated under the cascade model, which has been pointed out in previous papers, disappears when the final connection is used instead of the initial one to explain species persistence.
NASA Astrophysics Data System (ADS)
Wang, Guanghui; Wang, Yufei; Liu, Yijun; Chi, Yuxue
2018-05-01
As the transmission of public opinion on the Internet in the “We the Media” era tends to be supraterritorial, concealed and complex, the traditional “point-to-surface” transmission of information has been transformed into “point-to-point” reciprocal transmission. A foundation for studies of the evolution of public opinion and its transmission on the Internet in the “We the Media” era can be laid by converting the massive amounts of fragmented information on public opinion that exists on “We the Media” platforms into structurally complex networks of information. This paper describes studies of structurally complex network-based modeling of public opinion on the Internet in the “We the Media” era from the perspective of the development and evolution of complex networks. The progress that has been made in research projects relevant to the structural modeling of public opinion on the Internet is comprehensively summarized. The review considers aspects such as regular grid-based modeling of the rules that describe the propagation of public opinion on the Internet in the “We the Media” era, social network modeling, dynamic network modeling, and supernetwork modeling. Moreover, an outlook for future studies that address complex network-based modeling of public opinion on the Internet is put forward as a summary from the perspective of modeling conducted using the techniques mentioned above.
Using iMCFA to Perform the CFA, Multilevel CFA, and Maximum Model for Analyzing Complex Survey Data.
Wu, Jiun-Yu; Lee, Yuan-Hsuan; Lin, John J H
2018-01-01
To construct CFA, MCFA, and maximum MCFA with LISREL v.8 and below, we provide iMCFA (integrated Multilevel Confirmatory Analysis) to examine the potential multilevel factorial structure in the complex survey data. Modeling multilevel structure for complex survey data is complicated because building a multilevel model is not an infallible statistical strategy unless the hypothesized model is close to the real data structure. Methodologists have suggested using different modeling techniques to investigate potential multilevel structure of survey data. Using iMCFA, researchers can visually set the between- and within-level factorial structure to fit MCFA, CFA and/or MAX MCFA models for complex survey data. iMCFA can then yield between- and within-level variance-covariance matrices, calculate intraclass correlations, perform the analyses and generate the outputs for respective models. The summary of the analytical outputs from LISREL is gathered and tabulated for further model comparison and interpretation. iMCFA also provides LISREL syntax of different models for researchers' future use. An empirical and a simulated multilevel dataset with complex and simple structures in the within or between level was used to illustrate the usability and the effectiveness of the iMCFA procedure on analyzing complex survey data. The analytic results of iMCFA using Muthen's limited information estimator were compared with those of Mplus using Full Information Maximum Likelihood regarding the effectiveness of different estimation methods.
2015-07-14
AFRL-OSR-VA-TR-2015-0202 Robust Decision Making: The Cognitive and Computational Modeling of Team Problem Solving for Decision Making under Complex...Computational Modeling of Team Problem Solving for Decision Making Under Complex and Dynamic Conditions 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA9550-12-1...functioning as they solve complex problems, and propose the means to improve the performance of teams, under changing or adversarial conditions. By
USDA-ARS?s Scientific Manuscript database
Adsorption-desorption reactions are important processes that affect the transport of contaminants in the environment. Surface complexation models are chemical models that can account for the effects of variable chemical conditions, such as pH, on adsorption reactions. These models define specific ...
Research on application of intelligent computation based LUCC model in urbanization process
NASA Astrophysics Data System (ADS)
Chen, Zemin
2007-06-01
Global change study is an interdisciplinary and comprehensive research activity with international cooperation, arising in 1980s, with the largest scopes. The interaction between land use and cover change, as a research field with the crossing of natural science and social science, has become one of core subjects of global change study as well as the front edge and hot point of it. It is necessary to develop research on land use and cover change in urbanization process and build an analog model of urbanization to carry out description, simulation and analysis on dynamic behaviors in urban development change as well as to understand basic characteristics and rules of urbanization process. This has positive practical and theoretical significance for formulating urban and regional sustainable development strategy. The effect of urbanization on land use and cover change is mainly embodied in the change of quantity structure and space structure of urban space, and LUCC model in urbanization process has been an important research subject of urban geography and urban planning. In this paper, based upon previous research achievements, the writer systematically analyzes the research on land use/cover change in urbanization process with the theories of complexity science research and intelligent computation; builds a model for simulating and forecasting dynamic evolution of urban land use and cover change, on the basis of cellular automation model of complexity science research method and multi-agent theory; expands Markov model, traditional CA model and Agent model, introduces complexity science research theory and intelligent computation theory into LUCC research model to build intelligent computation-based LUCC model for analog research on land use and cover change in urbanization research, and performs case research. The concrete contents are as follows: 1. Complexity of LUCC research in urbanization process. Analyze urbanization process in combination with the contents of complexity science research and the conception of complexity feature to reveal the complexity features of LUCC research in urbanization process. Urban space system is a complex economic and cultural phenomenon as well as a social process, is the comprehensive characterization of urban society, economy and culture, and is a complex space system formed by society, economy and nature. It has dissipative structure characteristics, such as opening, dynamics, self-organization, non-balance etc. Traditional model cannot simulate these social, economic and natural driving forces of LUCC including main feedback relation from LUCC to driving force. 2. Establishment of Markov extended model of LUCC analog research in urbanization process. Firstly, use traditional LUCC research model to compute change speed of regional land use through calculating dynamic degree, exploitation degree and consumption degree of land use; use the theory of fuzzy set to rewrite the traditional Markov model, establish structure transfer matrix of land use, forecast and analyze dynamic change and development trend of land use, and present noticeable problems and corresponding measures in urbanization process according to research results. 3. Application of intelligent computation research and complexity science research method in LUCC analog model in urbanization process. On the basis of detailed elaboration of the theory and the model of LUCC research in urbanization process, analyze the problems of existing model used in LUCC research (namely, difficult to resolve many complexity phenomena in complex urban space system), discuss possible structure realization forms of LUCC analog research in combination with the theories of intelligent computation and complexity science research. Perform application analysis on BP artificial neural network and genetic algorithms of intelligent computation and CA model and MAS technology of complexity science research, discuss their theoretical origins and their own characteristics in detail, elaborate the feasibility of them in LUCC analog research, and bring forward improvement methods and measures on existing problems of this kind of model. 4. Establishment of LUCC analog model in urbanization process based on theories of intelligent computation and complexity science. Based on the research on abovementioned BP artificial neural network, genetic algorithms, CA model and multi-agent technology, put forward improvement methods and application assumption towards their expansion on geography, build LUCC analog model in urbanization process based on CA model and Agent model, realize the combination of learning mechanism of BP artificial neural network and fuzzy logic reasoning, express the regulation with explicit formula, and amend the initial regulation through self study; optimize network structure of LUCC analog model and methods and procedures of model parameters with genetic algorithms. In this paper, I introduce research theory and methods of complexity science into LUCC analog research and presents LUCC analog model based upon CA model and MAS theory. Meanwhile, I carry out corresponding expansion on traditional Markov model and introduce the theory of fuzzy set into data screening and parameter amendment of improved model to improve the accuracy and feasibility of Markov model in the research on land use/cover change.
A Primer for Model Selection: The Decisive Role of Model Complexity
NASA Astrophysics Data System (ADS)
Höge, Marvin; Wöhling, Thomas; Nowak, Wolfgang
2018-03-01
Selecting a "best" model among several competing candidate models poses an often encountered problem in water resources modeling (and other disciplines which employ models). For a modeler, the best model fulfills a certain purpose best (e.g., flood prediction), which is typically assessed by comparing model simulations to data (e.g., stream flow). Model selection methods find the "best" trade-off between good fit with data and model complexity. In this context, the interpretations of model complexity implied by different model selection methods are crucial, because they represent different underlying goals of modeling. Over the last decades, numerous model selection criteria have been proposed, but modelers who primarily want to apply a model selection criterion often face a lack of guidance for choosing the right criterion that matches their goal. We propose a classification scheme for model selection criteria that helps to find the right criterion for a specific goal, i.e., which employs the correct complexity interpretation. We identify four model selection classes which seek to achieve high predictive density, low predictive error, high model probability, or shortest compression of data. These goals can be achieved by following either nonconsistent or consistent model selection and by either incorporating a Bayesian parameter prior or not. We allocate commonly used criteria to these four classes, analyze how they represent model complexity and what this means for the model selection task. Finally, we provide guidance on choosing the right type of criteria for specific model selection tasks. (A quick guide through all key points is given at the end of the introduction.)
NASA Astrophysics Data System (ADS)
Hrachowitz, M.; Fovet, O.; Ruiz, L.; Euser, T.; Gharari, S.; Nijzink, R.; Freer, J.; Savenije, H. H. G.; Gascuel-Odoux, C.
2014-09-01
Hydrological models frequently suffer from limited predictive power despite adequate calibration performances. This can indicate insufficient representations of the underlying processes. Thus, ways are sought to increase model consistency while satisfying the contrasting priorities of increased model complexity and limited equifinality. In this study, the value of a systematic use of hydrological signatures and expert knowledge for increasing model consistency was tested. It was found that a simple conceptual model, constrained by four calibration objective functions, was able to adequately reproduce the hydrograph in the calibration period. The model, however, could not reproduce a suite of hydrological signatures, indicating a lack of model consistency. Subsequently, testing 11 models, model complexity was increased in a stepwise way and counter-balanced by "prior constraints," inferred from expert knowledge to ensure a model which behaves well with respect to the modeler's perception of the system. We showed that, in spite of unchanged calibration performance, the most complex model setup exhibited increased performance in the independent test period and skill to better reproduce all tested signatures, indicating a better system representation. The results suggest that a model may be inadequate despite good performance with respect to multiple calibration objectives and that increasing model complexity, if counter-balanced by prior constraints, can significantly increase predictive performance of a model and its skill to reproduce hydrological signatures. The results strongly illustrate the need to balance automated model calibration with a more expert-knowledge-driven strategy of constraining models.
Statistical Techniques Complement UML When Developing Domain Models of Complex Dynamical Biosystems.
Williams, Richard A; Timmis, Jon; Qwarnstrom, Eva E
2016-01-01
Computational modelling and simulation is increasingly being used to complement traditional wet-lab techniques when investigating the mechanistic behaviours of complex biological systems. In order to ensure computational models are fit for purpose, it is essential that the abstracted view of biology captured in the computational model, is clearly and unambiguously defined within a conceptual model of the biological domain (a domain model), that acts to accurately represent the biological system and to document the functional requirements for the resultant computational model. We present a domain model of the IL-1 stimulated NF-κB signalling pathway, which unambiguously defines the spatial, temporal and stochastic requirements for our future computational model. Through the development of this model, we observe that, in isolation, UML is not sufficient for the purpose of creating a domain model, and that a number of descriptive and multivariate statistical techniques provide complementary perspectives, in particular when modelling the heterogeneity of dynamics at the single-cell level. We believe this approach of using UML to define the structure and interactions within a complex system, along with statistics to define the stochastic and dynamic nature of complex systems, is crucial for ensuring that conceptual models of complex dynamical biosystems, which are developed using UML, are fit for purpose, and unambiguously define the functional requirements for the resultant computational model.
Statistical Techniques Complement UML When Developing Domain Models of Complex Dynamical Biosystems
Timmis, Jon; Qwarnstrom, Eva E.
2016-01-01
Computational modelling and simulation is increasingly being used to complement traditional wet-lab techniques when investigating the mechanistic behaviours of complex biological systems. In order to ensure computational models are fit for purpose, it is essential that the abstracted view of biology captured in the computational model, is clearly and unambiguously defined within a conceptual model of the biological domain (a domain model), that acts to accurately represent the biological system and to document the functional requirements for the resultant computational model. We present a domain model of the IL-1 stimulated NF-κB signalling pathway, which unambiguously defines the spatial, temporal and stochastic requirements for our future computational model. Through the development of this model, we observe that, in isolation, UML is not sufficient for the purpose of creating a domain model, and that a number of descriptive and multivariate statistical techniques provide complementary perspectives, in particular when modelling the heterogeneity of dynamics at the single-cell level. We believe this approach of using UML to define the structure and interactions within a complex system, along with statistics to define the stochastic and dynamic nature of complex systems, is crucial for ensuring that conceptual models of complex dynamical biosystems, which are developed using UML, are fit for purpose, and unambiguously define the functional requirements for the resultant computational model. PMID:27571414
Network model of bilateral power markets based on complex networks
NASA Astrophysics Data System (ADS)
Wu, Yang; Liu, Junyong; Li, Furong; Yan, Zhanxin; Zhang, Li
2014-06-01
The bilateral power transaction (BPT) mode becomes a typical market organization with the restructuring of electric power industry, the proper model which could capture its characteristics is in urgent need. However, the model is lacking because of this market organization's complexity. As a promising approach to modeling complex systems, complex networks could provide a sound theoretical framework for developing proper simulation model. In this paper, a complex network model of the BPT market is proposed. In this model, price advantage mechanism is a precondition. Unlike other general commodity transactions, both of the financial layer and the physical layer are considered in the model. Through simulation analysis, the feasibility and validity of the model are verified. At same time, some typical statistical features of BPT network are identified. Namely, the degree distribution follows the power law, the clustering coefficient is low and the average path length is a bit long. Moreover, the topological stability of the BPT network is tested. The results show that the network displays a topological robustness to random market member's failures while it is fragile against deliberate attacks, and the network could resist cascading failure to some extent. These features are helpful for making decisions and risk management in BPT markets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonitemore » edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites (‘spillover’ effect).« less
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.; ...
2017-10-06
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonitemore » edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites (‘spillover’ effect).« less
NASA Astrophysics Data System (ADS)
Muhammad, Ario; Goda, Katsuichiro
2018-03-01
This study investigates the impact of model complexity in source characterization and digital elevation model (DEM) resolution on the accuracy of tsunami hazard assessment and fatality estimation through a case study in Padang, Indonesia. Two types of earthquake source models, i.e. complex and uniform slip models, are adopted by considering three resolutions of DEMs, i.e. 150 m, 50 m, and 10 m. For each of the three grid resolutions, 300 complex source models are generated using new statistical prediction models of earthquake source parameters developed from extensive finite-fault models of past subduction earthquakes, whilst 100 uniform slip models are constructed with variable fault geometry without slip heterogeneity. The results highlight that significant changes to tsunami hazard and fatality estimates are observed with regard to earthquake source complexity and grid resolution. Coarse resolution (i.e. 150 m) leads to inaccurate tsunami hazard prediction and fatality estimation, whilst 50-m and 10-m resolutions produce similar results. However, velocity and momentum flux are sensitive to the grid resolution and hence, at least 10-m grid resolution needs to be implemented when considering flow-based parameters for tsunami hazard and risk assessments. In addition, the results indicate that the tsunami hazard parameters and fatality number are more sensitive to the complexity of earthquake source characterization than the grid resolution. Thus, the uniform models are not recommended for probabilistic tsunami hazard and risk assessments. Finally, the findings confirm that uncertainties of tsunami hazard level and fatality in terms of depth, velocity and momentum flux can be captured and visualized through the complex source modeling approach. From tsunami risk management perspectives, this indeed creates big data, which are useful for making effective and robust decisions.
Sparkle model for AM1 calculation of lanthanide complexes: improved parameters for europium.
Rocha, Gerd B; Freire, Ricardo O; Da Costa, Nivan B; De Sá, Gilberto F; Simas, Alfredo M
2004-04-05
In the present work, we sought to improve our sparkle model for the calculation of lanthanide complexes, SMLC,in various ways: (i) inclusion of the europium atomic mass, (ii) reparametrization of the model within AM1 from a new response function including all distances of the coordination polyhedron for tris(acetylacetonate)(1,10-phenanthroline) europium(III), (iii) implementation of the model in the software package MOPAC93r2, and (iv) inclusion of spherical Gaussian functions in the expression which computes the core-core repulsion energy. The parametrization results indicate that SMLC II is superior to the previous version of the model because Gaussian functions proved essential if one requires a better description of the geometries of the complexes. In order to validate our parametrization, we carried out calculations on 96 europium(III) complexes, selected from Cambridge Structural Database 2003, and compared our predicted ground state geometries with the experimental ones. Our results show that this new parametrization of the SMLC model, with the inclusion of spherical Gaussian functions in the core-core repulsion energy, is better capable of predicting the Eu-ligand distances than the previous version. The unsigned mean error for all interatomic distances Eu-L, in all 96 complexes, which, for the original SMLC is 0.3564 A, is lowered to 0.1993 A when the model was parametrized with the inclusion of two Gaussian functions. Our results also indicate that this model is more applicable to europium complexes with beta-diketone ligands. As such, we conclude that this improved model can be considered a powerful tool for the study of lanthanide complexes and their applications, such as the modeling of light conversion molecular devices.
The practical use of simplicity in developing ground water models
Hill, M.C.
2006-01-01
The advantages of starting with simple models and building complexity slowly can be significant in the development of ground water models. In many circumstances, simpler models are characterized by fewer defined parameters and shorter execution times. In this work, the number of parameters is used as the primary measure of simplicity and complexity; the advantages of shorter execution times also are considered. The ideas are presented in the context of constructing ground water models but are applicable to many fields. Simplicity first is put in perspective as part of the entire modeling process using 14 guidelines for effective model calibration. It is noted that neither very simple nor very complex models generally produce the most accurate predictions and that determining the appropriate level of complexity is an ill-defined process. It is suggested that a thorough evaluation of observation errors is essential to model development. Finally, specific ways are discussed to design useful ground water models that have fewer parameters and shorter execution times.
Complexity and demographic explanations of cumulative culture.
Querbes, Adrien; Vaesen, Krist; Houkes, Wybo
2014-01-01
Formal models have linked prehistoric and historical instances of technological change (e.g., the Upper Paleolithic transition, cultural loss in Holocene Tasmania, scientific progress since the late nineteenth century) to demographic change. According to these models, cumulation of technological complexity is inhibited by decreasing--while favoured by increasing--population levels. Here we show that these findings are contingent on how complexity is defined: demography plays a much more limited role in sustaining cumulative culture in case formal models deploy Herbert Simon's definition of complexity rather than the particular definitions of complexity hitherto assumed. Given that currently available empirical evidence doesn't afford discriminating proper from improper definitions of complexity, our robustness analyses put into question the force of recent demographic explanations of particular episodes of cultural change.
Simunovic, Vesna; Müller, Rolf
2007-07-23
It has been proposed that two acyl carrier proteins (ACPs)-TaB and TaE--and two 3-hydroxy-3-methylglutaryl synthases (HMGSs)--TaC and TaF--could constitute two functional ACP-HMGS pairs (TaB/TaC and TaE/TaF) responsible for the incorporation of acetate and propionate units into the myxovirescin A scaffold, leading to the formation of beta-methyl and beta-ethyl groups, respectively. It has been suggested that three more proteins--TaX and TaY, which are members of the superfamily of enoyl-CoA hydratases (ECHs), and a variant ketosynthase (KS) TaK--are shared between two ACP-HMGS pairs, to give the complete set of enzymes required to perform the beta-alkylations. The beta-methyl branch is presumably further hydroxylated (by TaH) and methylated to produce the methoxymethyl group observed in myxovirescin A. To substantiate this hypothesis, a series of gene-deletion mutants were created, and the effects of these mutations on myxovirescin production were examined. As predicted, DeltataB and DeltataE ACP mutants revealed similar phenotypes to their associated HMGS mutants DeltataC and DeltataF, respectively, thus providing direct evidence for the role of TaE/TaF in the formation of the beta-ethyl branch and implying a role for TaB/TaC in the formation of the beta-methyl group. Production of myxovirescin A was dramatically reduced in a DeltataK mutant and abolished in both the DeltataX and the DeltataY mutant backgrounds. Analysis of a DeltataH mutant confirmed the role of the cytochrome P450 TaH in hydroxylation of the beta-methyl group. Taken together, these experiments support a model in which the discrete ACPs TaB and TaE are compatible only with their associated HMGSs TaC and TaF, respectively, and function in a substrate-specific manner. Both TaB and TaC are essential for myxovirescin production, and the TaB/TaC pair can rescue antibiotic production in the absence of either TaE or TaF. Finally, the reduced level of myxovirescin production in the DeltataE mutant, relative to the DeltataF strain, suggests an additional function of the TaE ACP.
Statistical Analysis of Complexity Generators for Cost Estimation
NASA Technical Reports Server (NTRS)
Rowell, Ginger Holmes
1999-01-01
Predicting the cost of cutting edge new technologies involved with spacecraft hardware can be quite complicated. A new feature of the NASA Air Force Cost Model (NAFCOM), called the Complexity Generator, is being developed to model the complexity factors that drive the cost of space hardware. This parametric approach is also designed to account for the differences in cost, based on factors that are unique to each system and subsystem. The cost driver categories included in this model are weight, inheritance from previous missions, technical complexity, and management factors. This paper explains the Complexity Generator framework, the statistical methods used to select the best model within this framework, and the procedures used to find the region of predictability and the prediction intervals for the cost of a mission.
NASA Astrophysics Data System (ADS)
Pajusalu, Mihkel; Kunz, Ralf; Rätsep, Margus; Timpmann, Kõu; Köhler, Jürgen; Freiberg, Arvi
2015-11-01
Bacterial light-harvesting pigment-protein complexes are very efficient at converting photons into excitons and transferring them to reaction centers, where the energy is stored in a chemical form. Optical properties of the complexes are known to change significantly in time and also vary from one complex to another; therefore, a detailed understanding of the variations on the level of single complexes and how they accumulate into effects that can be seen on the macroscopic scale is required. While experimental and theoretical methods exist to study the spectral properties of light-harvesting complexes on both individual complex and bulk ensemble levels, they have been developed largely independently of each other. To fill this gap, we simultaneously analyze experimental low-temperature single-complex and bulk ensemble optical spectra of the light-harvesting complex-2 (LH2) chromoproteins from the photosynthetic bacterium Rhodopseudomonas acidophila in order to find a unique theoretical model consistent with both experimental situations. The model, which satisfies most of the observations, combines strong exciton-phonon coupling with significant disorder, characteristic of the proteins. We establish a detailed disorder model that, in addition to containing a C2-symmetrical modulation of the site energies, distinguishes between static intercomplex and slow conformational intracomplex disorders. The model evaluations also verify that, despite best efforts, the single-LH2-complex measurements performed so far may be biased toward complexes with higher Huang-Rhys factors.
Pajusalu, Mihkel; Kunz, Ralf; Rätsep, Margus; Timpmann, Kõu; Köhler, Jürgen; Freiberg, Arvi
2015-01-01
Bacterial light-harvesting pigment-protein complexes are very efficient at converting photons into excitons and transferring them to reaction centers, where the energy is stored in a chemical form. Optical properties of the complexes are known to change significantly in time and also vary from one complex to another; therefore, a detailed understanding of the variations on the level of single complexes and how they accumulate into effects that can be seen on the macroscopic scale is required. While experimental and theoretical methods exist to study the spectral properties of light-harvesting complexes on both individual complex and bulk ensemble levels, they have been developed largely independently of each other. To fill this gap, we simultaneously analyze experimental low-temperature single-complex and bulk ensemble optical spectra of the light-harvesting complex-2 (LH2) chromoproteins from the photosynthetic bacterium Rhodopseudomonas acidophila in order to find a unique theoretical model consistent with both experimental situations. The model, which satisfies most of the observations, combines strong exciton-phonon coupling with significant disorder, characteristic of the proteins. We establish a detailed disorder model that, in addition to containing a C_{2}-symmetrical modulation of the site energies, distinguishes between static intercomplex and slow conformational intracomplex disorders. The model evaluations also verify that, despite best efforts, the single-LH2-complex measurements performed so far may be biased toward complexes with higher Huang-Rhys factors.
Cui, Yiqian; Shi, Junyou; Wang, Zili
2015-11-01
Quantum Neural Networks (QNN) models have attracted great attention since it innovates a new neural computing manner based on quantum entanglement. However, the existing QNN models are mainly based on the real quantum operations, and the potential of quantum entanglement is not fully exploited. In this paper, we proposes a novel quantum neuron model called Complex Quantum Neuron (CQN) that realizes a deep quantum entanglement. Also, a novel hybrid networks model Complex Rotation Quantum Dynamic Neural Networks (CRQDNN) is proposed based on Complex Quantum Neuron (CQN). CRQDNN is a three layer model with both CQN and classical neurons. An infinite impulse response (IIR) filter is embedded in the Networks model to enable the memory function to process time series inputs. The Levenberg-Marquardt (LM) algorithm is used for fast parameter learning. The networks model is developed to conduct time series predictions. Two application studies are done in this paper, including the chaotic time series prediction and electronic remaining useful life (RUL) prediction. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Befrui, Bizhan A.
1995-01-01
This viewgraph presentation discusses the following: STAR-CD computational features; STAR-CD turbulence models; common features of industrial complex flows; industry-specific CFD development requirements; applications and experiences of industrial complex flows, including flow in rotating disc cavities, diffusion hole film cooling, internal blade cooling, and external car aerodynamics; and conclusions on turbulence modeling needs.
Variable Complexity Optimization of Composite Structures
NASA Technical Reports Server (NTRS)
Haftka, Raphael T.
2002-01-01
The use of several levels of modeling in design has been dubbed variable complexity modeling. The work under the grant focused on developing variable complexity modeling strategies with emphasis on response surface techniques. Applications included design of stiffened composite plates for improved damage tolerance, the use of response surfaces for fitting weights obtained by structural optimization, and design against uncertainty using response surface techniques.
Bim Automation: Advanced Modeling Generative Process for Complex Structures
NASA Astrophysics Data System (ADS)
Banfi, F.; Fai, S.; Brumana, R.
2017-08-01
The new paradigm of the complexity of modern and historic structures, which are characterised by complex forms, morphological and typological variables, is one of the greatest challenges for building information modelling (BIM). Generation of complex parametric models needs new scientific knowledge concerning new digital technologies. These elements are helpful to store a vast quantity of information during the life cycle of buildings (LCB). The latest developments of parametric applications do not provide advanced tools, resulting in time-consuming work for the generation of models. This paper presents a method capable of processing and creating complex parametric Building Information Models (BIM) with Non-Uniform to NURBS) with multiple levels of details (Mixed and ReverseLoD) based on accurate 3D photogrammetric and laser scanning surveys. Complex 3D elements are converted into parametric BIM software and finite element applications (BIM to FEA) using specific exchange formats and new modelling tools. The proposed approach has been applied to different case studies: the BIM of modern structure for the courtyard of West Block on Parliament Hill in Ottawa (Ontario) and the BIM of Masegra Castel in Sondrio (Italy), encouraging the dissemination and interaction of scientific results without losing information during the generative process.
Balancing model complexity and measurements in hydrology
NASA Astrophysics Data System (ADS)
Van De Giesen, N.; Schoups, G.; Weijs, S. V.
2012-12-01
The Data Processing Inequality implies that hydrological modeling can only reduce, and never increase, the amount of information available in the original data used to formulate and calibrate hydrological models: I(X;Z(Y)) ≤ I(X;Y). Still, hydrologists around the world seem quite content building models for "their" watersheds to move our discipline forward. Hydrological models tend to have a hybrid character with respect to underlying physics. Most models make use of some well established physical principles, such as mass and energy balances. One could argue that such principles are based on many observations, and therefore add data. These physical principles, however, are applied to hydrological models that often contain concepts that have no direct counterpart in the observable physical universe, such as "buckets" or "reservoirs" that fill up and empty out over time. These not-so-physical concepts are more like the Artificial Neural Networks and Support Vector Machines of the Artificial Intelligence (AI) community. Within AI, one quickly came to the realization that by increasing model complexity, one could basically fit any dataset but that complexity should be controlled in order to be able to predict unseen events. The more data are available to train or calibrate the model, the more complex it can be. Many complexity control approaches exist in AI, with Solomonoff inductive inference being one of the first formal approaches, the Akaike Information Criterion the most popular, and Statistical Learning Theory arguably being the most comprehensive practical approach. In hydrology, complexity control has hardly been used so far. There are a number of reasons for that lack of interest, the more valid ones of which will be presented during the presentation. For starters, there are no readily available complexity measures for our models. Second, some unrealistic simplifications of the underlying complex physics tend to have a smoothing effect on possible model outcomes, thereby preventing the most obvious results of over-fitting. Thirdly, dependence within and between time series poses an additional analytical problem. Finally, there are arguments to be made that the often discussed "equifinality" in hydrological models is simply a different manifestation of the lack of complexity control. In turn, this points toward a general idea, which is actually quite popular in sciences other than hydrology, that additional data gathering is a good way to increase the information content of our descriptions of hydrological reality.
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Almeida, J.C.M.
1990-01-01
A detailed analysis is made of two stereochemical models commonly used in lanthanide and actinide coordination and organometallic chemistry. Li Xing-fu's Cone Packing Model and K. N. Raymond's Ionic Model. Corrections are introduced in the first model as a basis to discuss the stability and structure of known complexes. A Steric Coordination Number is defined for the second model, based on the solid angle to correlate metal-ligand distances in complexes with the ionic radii of the elements and to assign effective radii to the ligands, related to the donating power of the coordinating atoms. As an application of the models,more » the syntheses and characterizations of thorium(IV) complexes with polypyrazolylborates. (HBPz3) {sup -1} and (HB(3.5-Me2Pz)3) {sup -1}, and alkoxides, aryloxides, carboxylates, amides, thiolates, alkyls and cyclopentadienyl are described and their stabilities discussed. The geometries of the complexes in the solid and in solution are discussed and a mechanism is proposed to explain the fluxionality in solution of the complexes with (HBPz3) {sup -1}.« less
Routine Discovery of Complex Genetic Models using Genetic Algorithms
Moore, Jason H.; Hahn, Lance W.; Ritchie, Marylyn D.; Thornton, Tricia A.; White, Bill C.
2010-01-01
Simulation studies are useful in various disciplines for a number of reasons including the development and evaluation of new computational and statistical methods. This is particularly true in human genetics and genetic epidemiology where new analytical methods are needed for the detection and characterization of disease susceptibility genes whose effects are complex, nonlinear, and partially or solely dependent on the effects of other genes (i.e. epistasis or gene-gene interaction). Despite this need, the development of complex genetic models that can be used to simulate data is not always intuitive. In fact, only a few such models have been published. We have previously developed a genetic algorithm approach to discovering complex genetic models in which two single nucleotide polymorphisms (SNPs) influence disease risk solely through nonlinear interactions. In this paper, we extend this approach for the discovery of high-order epistasis models involving three to five SNPs. We demonstrate that the genetic algorithm is capable of routinely discovering interesting high-order epistasis models in which each SNP influences risk of disease only through interactions with the other SNPs in the model. This study opens the door for routine simulation of complex gene-gene interactions among SNPs for the development and evaluation of new statistical and computational approaches for identifying common, complex multifactorial disease susceptibility genes. PMID:20948983
Post-closure biosphere assessment modelling: comparison of complex and more stylised approaches.
Walke, Russell C; Kirchner, Gerald; Xu, Shulan; Dverstorp, Björn
2015-10-01
Geological disposal facilities are the preferred option for high-level radioactive waste, due to their potential to provide isolation from the surface environment (biosphere) on very long timescales. Assessments need to strike a balance between stylised models and more complex approaches that draw more extensively on site-specific information. This paper explores the relative merits of complex versus more stylised biosphere models in the context of a site-specific assessment. The more complex biosphere modelling approach was developed by the Swedish Nuclear Fuel and Waste Management Co (SKB) for the Formark candidate site for a spent nuclear fuel repository in Sweden. SKB's approach is built on a landscape development model, whereby radionuclide releases to distinct hydrological basins/sub-catchments (termed 'objects') are represented as they evolve through land rise and climate change. Each of seventeen of these objects is represented with more than 80 site specific parameters, with about 22 that are time-dependent and result in over 5000 input values per object. The more stylised biosphere models developed for this study represent releases to individual ecosystems without environmental change and include the most plausible transport processes. In the context of regulatory review of the landscape modelling approach adopted in the SR-Site assessment in Sweden, the more stylised representation has helped to build understanding in the more complex modelling approaches by providing bounding results, checking the reasonableness of the more complex modelling, highlighting uncertainties introduced through conceptual assumptions and helping to quantify the conservatisms involved. The more stylised biosphere models are also shown capable of reproducing the results of more complex approaches. A major recommendation is that biosphere assessments need to justify the degree of complexity in modelling approaches as well as simplifying and conservative assumptions. In light of the uncertainties concerning the biosphere on very long timescales, stylised biosphere models are shown to provide a useful point of reference in themselves and remain a valuable tool for nuclear waste disposal licencing procedures. Copyright © 2015 Elsevier Ltd. All rights reserved.
Managing Complex Interoperability Solutions using Model-Driven Architecture
2011-06-01
such as Oracle or MySQL . Each data model for a specific RDBMS is a distinct PSM. Or the system may want to exchange information with other C2...reduced number of transformations, e.g., from an RDBMS physical schema to the corresponding SQL script needed to instantiate the tables in a relational...tance of models. In engineering, a model serves several purposes: 1. It presents an abstract view of a complex system or of a complex information
2016-01-01
Background Computer Networks have a tendency to grow at an unprecedented scale. Modern networks involve not only computers but also a wide variety of other interconnected devices ranging from mobile phones to other household items fitted with sensors. This vision of the "Internet of Things" (IoT) implies an inherent difficulty in modeling problems. Purpose It is practically impossible to implement and test all scenarios for large-scale and complex adaptive communication networks as part of Complex Adaptive Communication Networks and Environments (CACOONS). The goal of this study is to explore the use of Agent-based Modeling as part of the Cognitive Agent-based Computing (CABC) framework to model a Complex communication network problem. Method We use Exploratory Agent-based Modeling (EABM), as part of the CABC framework, to develop an autonomous multi-agent architecture for managing carbon footprint in a corporate network. To evaluate the application of complexity in practical scenarios, we have also introduced a company-defined computer usage policy. Results The conducted experiments demonstrated two important results: Primarily CABC-based modeling approach such as using Agent-based Modeling can be an effective approach to modeling complex problems in the domain of IoT. Secondly, the specific problem of managing the Carbon footprint can be solved using a multiagent system approach. PMID:26812235
Complexity reduction of biochemical rate expressions.
Schmidt, Henning; Madsen, Mads F; Danø, Sune; Cedersund, Gunnar
2008-03-15
The current trend in dynamical modelling of biochemical systems is to construct more and more mechanistically detailed and thus complex models. The complexity is reflected in the number of dynamic state variables and parameters, as well as in the complexity of the kinetic rate expressions. However, a greater level of complexity, or level of detail, does not necessarily imply better models, or a better understanding of the underlying processes. Data often does not contain enough information to discriminate between different model hypotheses, and such overparameterization makes it hard to establish the validity of the various parts of the model. Consequently, there is an increasing demand for model reduction methods. We present a new reduction method that reduces complex rational rate expressions, such as those often used to describe enzymatic reactions. The method is a novel term-based identifiability analysis, which is easy to use and allows for user-specified reductions of individual rate expressions in complete models. The method is one of the first methods to meet the classical engineering objective of improved parameter identifiability without losing the systems biology demand of preserved biochemical interpretation. The method has been implemented in the Systems Biology Toolbox 2 for MATLAB, which is freely available from http://www.sbtoolbox2.org. The Supplementary Material contains scripts that show how to use it by applying the method to the example models, discussed in this article.
Ellis, Alicia M.; Garcia, Andres J.; Focks, Dana A.; Morrison, Amy C.; Scott, Thomas W.
2011-01-01
Models can be useful tools for understanding the dynamics and control of mosquito-borne disease. More detailed models may be more realistic and better suited for understanding local disease dynamics; however, evaluating model suitability, accuracy, and performance becomes increasingly difficult with greater model complexity. Sensitivity analysis is a technique that permits exploration of complex models by evaluating the sensitivity of the model to changes in parameters. Here, we present results of sensitivity analyses of two interrelated complex simulation models of mosquito population dynamics and dengue transmission. We found that dengue transmission may be influenced most by survival in each life stage of the mosquito, mosquito biting behavior, and duration of the infectious period in humans. The importance of these biological processes for vector-borne disease models and the overwhelming lack of knowledge about them make acquisition of relevant field data on these biological processes a top research priority. PMID:21813844
Simplified process model discovery based on role-oriented genetic mining.
Zhao, Weidong; Liu, Xi; Dai, Weihui
2014-01-01
Process mining is automated acquisition of process models from event logs. Although many process mining techniques have been developed, most of them are based on control flow. Meanwhile, the existing role-oriented process mining methods focus on correctness and integrity of roles while ignoring role complexity of the process model, which directly impacts understandability and quality of the model. To address these problems, we propose a genetic programming approach to mine the simplified process model. Using a new metric of process complexity in terms of roles as the fitness function, we can find simpler process models. The new role complexity metric of process models is designed from role cohesion and coupling, and applied to discover roles in process models. Moreover, the higher fitness derived from role complexity metric also provides a guideline for redesigning process models. Finally, we conduct case study and experiments to show that the proposed method is more effective for streamlining the process by comparing with related studies.
Schryver, Jack; Nutaro, James; Shankar, Mallikarjun
2015-10-30
An agent-based simulation model hierarchy emulating disease states and behaviors critical to progression of diabetes type 2 was designed and implemented in the DEVS framework. The models are translations of basic elements of an established system dynamics model of diabetes. In this model hierarchy, which mimics diabetes progression over an aggregated U.S. population, was dis-aggregated and reconstructed bottom-up at the individual (agent) level. Four levels of model complexity were defined in order to systematically evaluate which parameters are needed to mimic outputs of the system dynamics model. Moreover, the four estimated models attempted to replicate stock counts representing disease statesmore » in the system dynamics model, while estimating impacts of an elderliness factor, obesity factor and health-related behavioral parameters. Health-related behavior was modeled as a simple realization of the Theory of Planned Behavior, a joint function of individual attitude and diffusion of social norms that spread over each agent s social network. Although the most complex agent-based simulation model contained 31 adjustable parameters, all models were considerably less complex than the system dynamics model which required numerous time series inputs to make its predictions. In all three elaborations of the baseline model provided significantly improved fits to the output of the system dynamics model. The performances of the baseline agent-based model and its extensions illustrate a promising approach to translate complex system dynamics models into agent-based model alternatives that are both conceptually simpler and capable of capturing main effects of complex local agent-agent interactions.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schryver, Jack; Nutaro, James; Shankar, Mallikarjun
An agent-based simulation model hierarchy emulating disease states and behaviors critical to progression of diabetes type 2 was designed and implemented in the DEVS framework. The models are translations of basic elements of an established system dynamics model of diabetes. In this model hierarchy, which mimics diabetes progression over an aggregated U.S. population, was dis-aggregated and reconstructed bottom-up at the individual (agent) level. Four levels of model complexity were defined in order to systematically evaluate which parameters are needed to mimic outputs of the system dynamics model. Moreover, the four estimated models attempted to replicate stock counts representing disease statesmore » in the system dynamics model, while estimating impacts of an elderliness factor, obesity factor and health-related behavioral parameters. Health-related behavior was modeled as a simple realization of the Theory of Planned Behavior, a joint function of individual attitude and diffusion of social norms that spread over each agent s social network. Although the most complex agent-based simulation model contained 31 adjustable parameters, all models were considerably less complex than the system dynamics model which required numerous time series inputs to make its predictions. In all three elaborations of the baseline model provided significantly improved fits to the output of the system dynamics model. The performances of the baseline agent-based model and its extensions illustrate a promising approach to translate complex system dynamics models into agent-based model alternatives that are both conceptually simpler and capable of capturing main effects of complex local agent-agent interactions.« less
Comparing an annual and daily time-step model for predicting field-scale phosphorus loss
USDA-ARS?s Scientific Manuscript database
Numerous models exist for describing phosphorus (P) losses from agricultural fields. The complexity of these models varies considerably ranging from simple empirically-based annual time-step models to more complex process-based daily time step models. While better accuracy is often assumed with more...
Updating the debate on model complexity
Simmons, Craig T.; Hunt, Randall J.
2012-01-01
As scientists who are trying to understand a complex natural world that cannot be fully characterized in the field, how can we best inform the society in which we live? This founding context was addressed in a special session, “Complexity in Modeling: How Much is Too Much?” convened at the 2011 Geological Society of America Annual Meeting. The session had a variety of thought-provoking presentations—ranging from philosophy to cost-benefit analyses—and provided some areas of broad agreement that were not evident in discussions of the topic in 1998 (Hunt and Zheng, 1999). The session began with a short introduction during which model complexity was framed borrowing from an economic concept, the Law of Diminishing Returns, and an example of enjoyment derived by eating ice cream. Initially, there is increasing satisfaction gained from eating more ice cream, to a point where the gain in satisfaction starts to decrease, ending at a point when the eater sees no value in eating more ice cream. A traditional view of model complexity is similar—understanding gained from modeling can actually decrease if models become unnecessarily complex. However, oversimplified models—those that omit important aspects of the problem needed to make a good prediction—can also limit and confound our understanding. Thus, the goal of all modeling is to find the “sweet spot” of model sophistication—regardless of whether complexity was added sequentially to an overly simple model or collapsed from an initial highly parameterized framework that uses mathematics and statistics to attain an optimum (e.g., Hunt et al., 2007). Thus, holistic parsimony is attained, incorporating “as simple as possible,” as well as the equally important corollary “but no simpler.”
ADAM: analysis of discrete models of biological systems using computer algebra.
Hinkelmann, Franziska; Brandon, Madison; Guang, Bonny; McNeill, Rustin; Blekherman, Grigoriy; Veliz-Cuba, Alan; Laubenbacher, Reinhard
2011-07-20
Many biological systems are modeled qualitatively with discrete models, such as probabilistic Boolean networks, logical models, Petri nets, and agent-based models, to gain a better understanding of them. The computational complexity to analyze the complete dynamics of these models grows exponentially in the number of variables, which impedes working with complex models. There exist software tools to analyze discrete models, but they either lack the algorithmic functionality to analyze complex models deterministically or they are inaccessible to many users as they require understanding the underlying algorithm and implementation, do not have a graphical user interface, or are hard to install. Efficient analysis methods that are accessible to modelers and easy to use are needed. We propose a method for efficiently identifying attractors and introduce the web-based tool Analysis of Dynamic Algebraic Models (ADAM), which provides this and other analysis methods for discrete models. ADAM converts several discrete model types automatically into polynomial dynamical systems and analyzes their dynamics using tools from computer algebra. Specifically, we propose a method to identify attractors of a discrete model that is equivalent to solving a system of polynomial equations, a long-studied problem in computer algebra. Based on extensive experimentation with both discrete models arising in systems biology and randomly generated networks, we found that the algebraic algorithms presented in this manuscript are fast for systems with the structure maintained by most biological systems, namely sparseness and robustness. For a large set of published complex discrete models, ADAM identified the attractors in less than one second. Discrete modeling techniques are a useful tool for analyzing complex biological systems and there is a need in the biological community for accessible efficient analysis tools. ADAM provides analysis methods based on mathematical algorithms as a web-based tool for several different input formats, and it makes analysis of complex models accessible to a larger community, as it is platform independent as a web-service and does not require understanding of the underlying mathematics.
Moving alcohol prevention research forward-Part I: introducing a complex systems paradigm.
Apostolopoulos, Yorghos; Lemke, Michael K; Barry, Adam E; Lich, Kristen Hassmiller
2018-02-01
The drinking environment is a complex system consisting of a number of heterogeneous, evolving and interacting components, which exhibit circular causality and emergent properties. These characteristics reduce the efficacy of commonly used research approaches, which typically do not account for the underlying dynamic complexity of alcohol consumption and the interdependent nature of diverse factors influencing misuse over time. We use alcohol misuse among college students in the United States as an example for framing our argument for a complex systems paradigm. A complex systems paradigm, grounded in socio-ecological and complex systems theories and computational modeling and simulation, is introduced. Theoretical, conceptual, methodological and analytical underpinnings of this paradigm are described in the context of college drinking prevention research. The proposed complex systems paradigm can transcend limitations of traditional approaches, thereby fostering new directions in alcohol prevention research. By conceptualizing student alcohol misuse as a complex adaptive system, computational modeling and simulation methodologies and analytical techniques can be used. Moreover, use of participatory model-building approaches to generate simulation models can further increase stakeholder buy-in, understanding and policymaking. A complex systems paradigm for research into alcohol misuse can provide a holistic understanding of the underlying drinking environment and its long-term trajectory, which can elucidate high-leverage preventive interventions. © 2017 Society for the Study of Addiction.
ONC201 kills breast cancer cells in vitro by targeting mitochondria.
Greer, Yoshimi Endo; Porat-Shliom, Natalie; Nagashima, Kunio; Stuelten, Christina; Crooks, Dan; Koparde, Vishal N; Gilbert, Samuel F; Islam, Celia; Ubaldini, Ashley; Ji, Yun; Gattinoni, Luca; Soheilian, Ferri; Wang, Xiantao; Hafner, Markus; Shetty, Jyoti; Tran, Bao; Jailwala, Parthav; Cam, Maggie; Lang, Martin; Voeller, Donna; Reinhold, William C; Rajapakse, Vinodh; Pommier, Yves; Weigert, Roberto; Linehan, W Marston; Lipkowitz, Stanley
2018-04-06
We report a novel mechanism of action of ONC201 as a mitochondria-targeting drug in cancer cells. ONC201 was originally identified as a small molecule that induces transcription of TNF-related apoptosis-inducing ligand (TRAIL) and subsequently kills cancer cells by activating TRAIL death receptors. In this study, we examined ONC201 toxicity on multiple human breast and endometrial cancer cell lines. ONC201 attenuated cell viability in all cancer cell lines tested. Unexpectedly, ONC201 toxicity was not dependent on either TRAIL receptors nor caspases. Time-lapse live cell imaging revealed that ONC201 induces cell membrane ballooning followed by rupture, distinct from the morphology of cells undergoing apoptosis. Further investigation found that ONC201 induces phosphorylation of AMP-dependent kinase and ATP loss. Cytotoxicity and ATP depletion were significantly enhanced in the absence of glucose, suggesting that ONC201 targets mitochondrial respiration. Further analysis indicated that ONC201 indirectly inhibits mitochondrial respiration. Confocal and electron microscopic analysis demonstrated that ONC201 triggers mitochondrial structural damage and functional impairment. Moreover, ONC201 decreased mitochondrial DNA (mtDNA). RNAseq analysis revealed that ONC201 suppresses expression of multiple mtDNA-encoded genes and nuclear-encoded mitochondrial genes involved in oxidative phosphorylation and other mitochondrial functions. Importantly, fumarate hydratase deficient cancer cells and multiple cancer cell lines with reduced amounts of mtDNA were resistant to ONC201. These results indicate that cells not dependent on mitochondrial respiration are ONC201-resistant. Our data demonstrate that ONC201 kills cancer cells by disrupting mitochondrial function and further suggests that cancer cells that are dependent on glycolysis will be resistant to ONC201.
ONC201 kills breast cancer cells in vitro by targeting mitochondria
Greer, Yoshimi Endo; Porat-Shliom, Natalie; Nagashima, Kunio; Stuelten, Christina; Crooks, Dan; Koparde, Vishal N.; Gilbert, Samuel F.; Islam, Celia; Ubaldini, Ashley; Ji, Yun; Gattinoni, Luca; Soheilian, Ferri; Wang, Xiantao; Hafner, Markus; Shetty, Jyoti; Tran, Bao; Jailwala, Parthav; Cam, Maggie; Lang, Martin; Voeller, Donna; Reinhold, William C.; Rajapakse, Vinodh; Pommier, Yves; Weigert, Roberto; Linehan, W. Marston; Lipkowitz, Stanley
2018-01-01
We report a novel mechanism of action of ONC201 as a mitochondria-targeting drug in cancer cells. ONC201 was originally identified as a small molecule that induces transcription of TNF-related apoptosis-inducing ligand (TRAIL) and subsequently kills cancer cells by activating TRAIL death receptors. In this study, we examined ONC201 toxicity on multiple human breast and endometrial cancer cell lines. ONC201 attenuated cell viability in all cancer cell lines tested. Unexpectedly, ONC201 toxicity was not dependent on either TRAIL receptors nor caspases. Time-lapse live cell imaging revealed that ONC201 induces cell membrane ballooning followed by rupture, distinct from the morphology of cells undergoing apoptosis. Further investigation found that ONC201 induces phosphorylation of AMP-dependent kinase and ATP loss. Cytotoxicity and ATP depletion were significantly enhanced in the absence of glucose, suggesting that ONC201 targets mitochondrial respiration. Further analysis indicated that ONC201 indirectly inhibits mitochondrial respiration. Confocal and electron microscopic analysis demonstrated that ONC201 triggers mitochondrial structural damage and functional impairment. Moreover, ONC201 decreased mitochondrial DNA (mtDNA). RNAseq analysis revealed that ONC201 suppresses expression of multiple mtDNA-encoded genes and nuclear-encoded mitochondrial genes involved in oxidative phosphorylation and other mitochondrial functions. Importantly, fumarate hydratase deficient cancer cells and multiple cancer cell lines with reduced amounts of mtDNA were resistant to ONC201. These results indicate that cells not dependent on mitochondrial respiration are ONC201-resistant. Our data demonstrate that ONC201 kills cancer cells by disrupting mitochondrial function and further suggests that cancer cells that are dependent on glycolysis will be resistant to ONC201. PMID:29719618
Kukor, J J; Olsen, R H
1991-01-01
Plasmid pRO1957 contains a 26.5-kb BamHI restriction endonuclease-cleaved DNA fragment cloned from the chromosome of Pseudomonas pickettii PKO1 that allows P. aeruginosa PAO1c to grow on toluene, benzene, phenol, or m-cresol as the sole carbon source. The genes encoding enzymes for meta cleavage of catechol or 3-methylcatechol, derived from catabolism of these substrates, were subcloned from pRO1957 and were shown to be organized into a single operon with the promoter proximal to tbuE. Deletion and analysis of subclones demonstrated that the order of genes in the meta cleavage operon was tbuEFGKIHJ, which encoded catechol 2,3-dioxygenase, 2-hydroxymuconate semialdehyde hydrolase, 2-hydroxymuconate semialdehyde dehydrogenase, 4-hydroxy-2-oxovalerate aldolase, 4-oxalocrotonate decarboxylase, 4-oxalocrotonate isomerase, and 2-hydroxypent-2,4-dienoate hydratase, respectively. The regulatory gene for the tbuEFGKIHJ operon, designated tbuS, was subcloned into vector plasmid pRO2317 from pRO1957 as a 1.3-kb PstI fragment, designated pRO2345. When tbuS was not present, meta pathway enzyme expression was partially derepressed, but these activity levels could not be fully induced. However, when tbuS was present in trans with tbuEFGKIHJ, meta pathway enzymes were repressed in the absence of an effector and were fully induced when an effector was present. This behavior suggests that the gene product of tbuS acts as both a repressor and an activator. Phenol and m-cresol were inducers of meta pathway enzymatic activity. Catechol, 3-methylcatechol, 4-methylcatechol, o-cresol, and p-cresol were not inducers but could be metabolized by cells previously induced by phenol or m-cresol. PMID:1856161
Merali, Zara; Mayer, Melinda J; Parker, Mary L; Michael, Anthony J; Smith, Andrew C; Waldron, Keith W
2012-06-01
Tobacco plants (Nicotiana tabacum cv XHFD 8) were genetically modified to express a bacterial 4-hydroxycinnamoyl-CoA hydratase/lyase (HCHL) enzyme which is active with intermediates of the phenylpropanoid pathway. We have previously shown that HCHL expression in tobacco stem resulted in various pleiotropic effects, indicative of a reduction in the carbon flux through the phenylpropanoid pathway, accompanied by an abnormal phenotype. Here, we report that in addition to the reduction in lignin and phenolic biosynthesis, HCHL expression also resulted in several gross morphological changes in poorly lignified tissue, such as abnormal mesophyll and palisade. The effect of HCHL expression was also noted in lignin-free single cells, with suspension cultures displaying an altered shape and different growth patterns. Poorly/non-lignified cell walls also exhibited a greater ease of alkaline extractability of simple phenolics and increased levels of incorporation of vanillin and vanillic acid. However, HCHL expression had no significant effect on the cell wall carbohydrate chemistry of these tissues. Evidence from this study suggests that changes in the transgenic lines result from a reduction in phenolic intermediates which have an essential role in maintaining structural integrity of low-lignin or lignin-deprived cell walls. These results emphasize the importance of the intermediates and products of phenylpropanoid pathway in modulating aspects of normal growth and development of tobacco. Analysis of these transgenic plants also shows the plasticity of the lignification process and reveals the potential to bioengineer plants with reduced phenolics (without deleterious effects) which could enhance the bioconversion of lignocellulose for industrial applications. Copyright © Physiologia Plantarum 2012.
Differential proteome and gene expression for testis of mice exposed to carbon ion radiation
NASA Astrophysics Data System (ADS)
Zhang, Hong; Li, Hongyan
Objective To investigate the effect and mechanism of high linear energy transfer (LET) carbon ion irradiation (CIR) on reproduction in the testis of male Swiss Webster mice, and assess the risk associated with space environment. Methods Male mice underwent whole-body irradiation with CIR (0.5, 1 and 4Gy), and matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF) analysis was used to determine the alteration in protein expression in 2-DE (two-dimensional gel electrophoresis) gels of testes caused by irradiation after 7, 14 days. Results 15 differentially expressed proteins, such as glucose-regulated protein(GRP78), aconitate hydratase-mitochondrial precursor (ACO), pyruvate kinase isozymes M1/M2 (PKM1/M2), glutathione-S-transferaseA3 (GSTA3), glutathione S-transferase Pi 1 (GSTP1), Cu/Zn super-oxide dismutase (SOD1), Peptidyl-prolyl cis-trans isomerase (Pin1) and Heat shock 70 kDa protein 4L (HSPa4L), were identified and these proteins were mainly involved in energy supply, the endoplasmic reticulum, cell proliferation, cell cycle, antioxidant capacity and mitochondrial respiration, which play important roles in the inhibition of testicular function in response to CIR. Furthermore, we confirmed the relationship between transcription of mRNA and the abundance of proteins. Conclusion The findings of the present study demonstrated that these proteins may lead to new insights into the molecular mechanism of CIR toxicity, and suggested that the gene expression response to CIR involves diverse regulatory mechanisms from transcription of mRNA to the formation of functional proteins. These data also may provide a scientific basis for protecting astronauts and space traveler’s health and safety.
Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg; Breuil, Colette
2014-08-01
To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals.
Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg
2014-01-01
To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals. PMID:24837377
Hsiao, Hui-Pin; Kirschner, Lawrence S.; Bourdeau, Isabelle; Keil, Margaret F.; Boikos, Sosipatros A.; Verma, Somya; Robinson-White, Audrey J.; Nesterova, Maria; Lacroix, André; Stratakis, Constantine A.
2009-01-01
Objective: ACTH-independent macronodular adrenal hyperplasia (AIMAH) is often associated with subclinical cortisol secretion or atypical Cushing’s syndrome (CS). We characterized a large series of patients of AIMAH and compared them with patients with other adrenocortical tumors. Design and Patients: We recruited 82 subjects with: 1) AIMAH (n = 16); 2) adrenocortical cortisol-producing adenoma with CS (n = 15); 3) aldosterone-producing adenoma (n = 19); and 4) single adenomas with clinically nonsignificant cortisol secretion (n = 32). Methods: Urinary free cortisol (UFC) and 17-hydroxycorticosteroid (17OHS) were collected at baseline and during dexamethasone testing; aberrant receptor responses was also sought by clinical testing and confirmed molecularly. Peripheral and/or tumor DNA was sequenced for candidate genes. Results: AIMAH patients had the highest 17OHS excretion, even when UFCs were within or close to the normal range. Aberrant receptor expression was highly prevalent. Histology showed at least two subtypes of AIMAH. For three patients with AIMAH, there was family history of CS; germline mutations were identified in three other patients in the genes for menin (one), fumarate hydratase (one), and adenomatosis polyposis coli (APC) (one); a PDE11A gene variant was found in another. One patient had a GNAS mutation in adrenal nodules only. There were no mutations in any of the tested genes in the patients of the other groups. Conclusions: AIMAH is a clinically and genetically heterogeneous disorder that can be associated with various genetic defects and aberrant hormone receptors. It is frequently associated with atypical CS and increased 17OHS; UFCs and other measures of adrenocortical activity can be misleadingly normal. PMID:19509103
Zarzycki, Jan; Brecht, Volker; Müller, Michael; Fuchs, Georg
2009-12-15
The phototrophic bacterium Chloroflexus aurantiacus uses a yet unsolved 3-hydroxypropionate cycle for autotrophic CO(2) fixation. It starts from acetyl-CoA, with acetyl-CoA and propionyl-CoA carboxylases acting as carboxylating enzymes. In a first cycle, (S)-malyl-CoA is formed from acetyl-CoA and 2 molecules of bicarbonate. (S)-Malyl-CoA cleavage releases the CO(2) fixation product glyoxylate and regenerates the starting molecule acetyl-CoA. Here we complete the missing steps devoted to glyoxylate assimilation. In a second cycle, glyoxylate is combined with propionyl-CoA, an intermediate of the first cycle, to form beta-methylmalyl-CoA. This condensation is followed by dehydration to mesaconyl-C1-CoA. An unprecedented CoA transferase catalyzes the intramolecular transfer of the CoA moiety to the C4 carboxyl group of mesaconate. Mesaconyl-C4-CoA then is hydrated by an enoyl-CoA hydratase to (S)-citramalyl-CoA. (S)-Citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by a tri-functional lyase, which previously cleaved (S)-malyl-CoA and formed beta-methylmalyl-CoA. Thus, the enigmatic disproportionation of glyoxylate and propionyl-CoA into acetyl-CoA and pyruvate is solved in an elegant and economic way requiring only 3 additional enzymes. The whole bicyclic pathway results in pyruvate formation from 3 molecules of bicarbonate and involves 19 steps but only 13 enzymes. Elements of the 3-hydroxypropionate cycle may be used for the assimilation of small organic molecules. The 3-hydroxypropionate cycle is compared with the Calvin-Benson-Bassham cycle and other autotrophic pathways.
Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.
Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg
2010-10-01
Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.
Proteomic and metabolomic analysis of H2O2-induced premature senescent human mesenchymal stem cells.
Kim, Ji-Soo; Kim, Eui-Jin; Kim, Hyun-Jung; Yang, Ji-Young; Hwang, Geum-Sook; Kim, Chan-Wha
2011-06-01
Stress induced premature senescence (SIPS) occurs after exposure to many different sublethal stresses including H(2)O(2), hyperoxia, or tert-butylhydroperoxide. Human mesenchymal stem cells (hMSCs) exhibit limited proliferative potential in vitro, the so-called Hayflick limit. According to the free-radical theory, reactive oxygen species (ROS) might be the candidates responsible for senescence and age-related diseases. H(2)O(2) may be responsible for the production of high levels of ROS, in which the redox balance is disturbed and the cells shift into a state of oxidative stress, which subsequently leads to premature senescence with shortening telomeres. H(2)O(2) has been the most commonly used inducer of SIPS, which shares features of replicative senescence (RS) including a similar morphology, senescence-associated β-galactosidase activity, cell cycle regulation, etc. Therefore, in this study, the senescence of hMSC during SIPS was confirmed using a range of different analytical methods. In addition, we determined five differentially expressed spots in the 2-DE map, which were identified as Annexin A2 (ANXA2), myosin light chain 2 (MLC2), peroxisomal enoyl-CoA hydratase 1 (ECH1), prosomal protein P30-33K (PSMA1) and mutant β-actin by ESI-Q-TOF MS/MS. Also, proton ((1)H) nuclear magnetic resonance spectroscopy (NMR) was used to elucidate the difference between metabolites in the control and hMSCs treated with H(2)O(2). Among these metabolites, choline and leucine were identified by (1)H-NMR as up-regulated metabolites and glycine and proline were identified as down-regulated metabolites. Copyright © 2011 Elsevier Inc. All rights reserved.
Jiao, Song; Yu, Huimin; Shen, Zhongyao
2018-09-25
To satisfy the urgent demand for promoter engineering that can accurately regulate the metabolic circuits and expression of specific genes in the Rhodococcus microbial platform, a promoter-ribosome binding site (RBS) coupled mini-pool with fine-tuning of different activity levels was successfully established. Transcriptome analyses of R. ruber TH revealed several representative promoters with different activity levels, e.g., Pami, Pcs, Pnh, P50sl36, PcbiM, PgroE and Pniami. β-Galactosidase (LacZ) reporter measurement demonstrated that different gene expression levels could be obtained with these natural promoters combined with an optimal RBS of ami. Further use of these promoters to overexpress the nitrile hydratase (NHase) gene with RBSami in R. ruber THdAdN produced different expression levels consistent with the transcription analyses. The -35 and -10 core elements of different promoters were further analyzed, and the conserved sequences were revealed to be TTGNNN and (T/C)GNNA(A/C)AAT. By mutating the core elements of the strong promoters, Pnh and Pami, into the above consensus sequence, two even stronger promoters, PnhM and PamiM, were obtained with 2.2-fold and 7.7-fold improvements in transcription, respectively. Integrating several strategies, including transcriptome promoter screening, -35 and -10 core element identification, core element point-mutation, RBS optimization and diverse reporter verification, a fine-tuning promoter-RBS combination mini-pool with different activity levels in Rhodococcus strains was successfully established. This development is significant for broad applications of the Rhodococcus genus as a microbial platform. Copyright © 2018 Elsevier B.V. All rights reserved.
Deng, Yinyue; Liu, Xiaoling; Wu, Ji'en; Lee, Jasmine; Chen, Shaohua; Cheng, Yingying; Zhang, Chunyan; Zhang, Lian-Hui
2015-04-01
Plant pathogen Xanthomonas campestris pv. campestris produces cis-11-methyl-2-dodecenoic acid (diffusible signal factor [DSF]) as a cell-cell communication signal to regulate biofilm dispersal and virulence factor production. Previous studies have demonstrated that DSF biosynthesis is dependent on the presence of RpfF, an enoyl-coenzyme A (CoA) hydratase, but the DSF synthetic mechanism and the influence of the host plant on DSF biosynthesis are still not clear. We show here that exogenous addition of host plant juice or ethanol extract to the growth medium of X. campestris pv. campestris could significantly boost DSF family signal production. It was subsequently revealed that X. campestris pv. campestris produces not only DSF but also BDSF (cis-2-dodecenoic acid) and another novel DSF family signal, which was designated DSF-II. BDSF was originally identified in Burkholderia cenocepacia to be involved in regulation of motility, biofilm formation, and virulence in B. cenocepacia. Functional analysis suggested that DSF-II plays a role equal to that of DSF in regulation of biofilm dispersion and virulence factor production in X. campestris pv. campestris. Furthermore, chromatographic separation led to identification of glucose as a specific molecule stimulating DSF family signal biosynthesis in X. campestris pv. campestris. (13)C-labeling experiments demonstrated that glucose acts as a substrate to provide a carbon element for DSF biosynthesis. The results of this study indicate that X. campestris pv. campestris could utilize a common metabolite of the host plant to enhance DSF family signal synthesis and therefore promote virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Wu, Shiwei; Yu, Lujun; Fu, Xiaozhe; Yan, Xi; Lin, Qiang; Liu, Lihui; Liang, Hongru; Li, Ningqiu
2018-05-04
Infectious spleen and kidney necrosis virus (ISKNV) has caused significant losses in the cultured mandarin fish (Siniperca chuatsi) industry. The molecular mechanisms that underlie interaction between ISKNV and hosts are not fully understood. In this study, the proteomic profile of CPB cells at progressive time points after ISKNV infection was analyzed by isobaric tags for relative and absolute quantitation (iTRAQ). A total of 2731 proteins corresponding to 6363 novel peptides (false discovery rate <0.01) were identified. In the samples harvested 24 h (early-stage) and 72 h (late-stage) post-infection, 232 and 199 differentially expressed proteins were identified comparing with mock-infected cells, respectively. Western-blotting analysis of several proteins as G6PDH, β-tubulin and RPL11 were done to validate iTRAQ data. Among those differentially expressed proteins, several glucose metabolism-related enzymes, including glucose-6-phosphate dehydrogenase (G6PDH), pyruvate dehydrogenase phosphatase (PDP) and fumarate hydratase (FH), were up-regulated, while pyruvate dehydrogenase kinase (PDK) and enolase (ENO) were down-regulated at 24 h poi, suggesting that ISKNV enhanced glucose metabolism in CPB cells in early-stage infection. Simultaneously, expression of apoptosis-related proteins including Caspase 8, phosphoinositide 3-kinases (PI3Ks), and regulatory-associated protein of mTOR-like isoform X3 changed upon ISKNV infection, indicating that ISKNV induced apoptosis of CPB cells. Autophagy-related proteins including LC3 and PI3Ks were up-regulated at 24 h poi, indicating that ISKNV induced autophagy of CPB cells in early-stage infection. These findings may improve the understanding of ISKNV and host interaction and help clarify its pathogenesis mechanisms. Copyright © 2018. Published by Elsevier Ltd.
Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.
Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi
2017-03-01
Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Comprehensive Molecular Characterization of Papillary Renal-Cell Carcinoma.
Linehan, W Marston; Spellman, Paul T; Ricketts, Christopher J; Creighton, Chad J; Fei, Suzanne S; Davis, Caleb; Wheeler, David A; Murray, Bradley A; Schmidt, Laura; Vocke, Cathy D; Peto, Myron; Al Mamun, Abu Amar M; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W Kimryn; Brooks, Angela N; Hoadley, Katherine A; Robertson, A Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J; Bootwalla, Moiz; Baylin, Stephen B; Laird, Peter W; Cherniack, Andrew D; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B; Akbani, Rehan; Leiserson, Mark D M; Raphael, Benjamin J; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K; Czerniak, Bogdan; Godwin, Andrew K; Hakimi, A Ari; Ho, Thai H; Hsieh, James; Ittmann, Michael; Kim, William Y; Krishnan, Bhavani; Merino, Maria J; Mills Shaw, Kenna R; Reuter, Victor E; Reznik, Ed; Shelley, Carl S; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D; Penny, Robert J; Shelton, Candace; Shelton, W Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T; Bowen, Jay; Gastier-Foster, Julie M; Gerken, Mark; Leraas, Kristen M; Lichtenberg, Tara M; Ramirez, Nilsa C; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A; Felau, Ina; Hutter, Carolyn M; Sheth, Margi; Sofia, Heidi J; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C; Zhang, Jiashan; Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S N; Carlsen, Rebecca; Carter, Scott L; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, Harsha V; Drummond, Jennifer A; Gabriel, Stacey B; Gibbs, Richard A; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D Neil; Holt, Robert A; Hoyle, Alan P; Jefferys, Stuart R; Jones, Steven J M; Jones, Corbin D; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A; Moore, Richard A; Morton, Donna; Mose, Lisle E; Mungall, Andrew J; Muzny, Donna; Parker, Joel S; Perou, Charles M; Roach, Jeffrey; Schein, Jacqueline E; Schumacher, Steven E; Shi, Yan; Simons, Janae V; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L; Boice, Lori; Bollag, Roni J; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L; Slaton, Joel; Stanton, Melissa; Thompson, R Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M; Winemiller, Cynthia; Zach, Leigh Anne; Zuna, Rosemary
2016-01-14
Papillary renal-cell carcinoma, which accounts for 15 to 20% of renal-cell carcinomas, is a heterogeneous disease that consists of various types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal-cell carcinoma, and no effective forms of therapy for advanced disease exist. We performed comprehensive molecular characterization of 161 primary papillary renal-cell carcinomas, using whole-exome sequencing, copy-number analysis, messenger RNA and microRNA sequencing, DNA-methylation analysis, and proteomic analysis. Type 1 and type 2 papillary renal-cell carcinomas were shown to be different types of renal cancer characterized by specific genetic alterations, with type 2 further classified into three individual subgroups on the basis of molecular differences associated with patient survival. Type 1 tumors were associated with MET alterations, whereas type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-antioxidant response element (ARE) pathway. A CpG island methylator phenotype (CIMP) was observed in a distinct subgroup of type 2 papillary renal-cell carcinomas that was characterized by poor survival and mutation of the gene encoding fumarate hydratase (FH). Type 1 and type 2 papillary renal-cell carcinomas were shown to be clinically and biologically distinct. Alterations in the MET pathway were associated with type 1, and activation of the NRF2-ARE pathway was associated with type 2; CDKN2A loss and CIMP in type 2 conveyed a poor prognosis. Furthermore, type 2 papillary renal-cell carcinoma consisted of at least three subtypes based on molecular and phenotypic features. (Funded by the National Institutes of Health.).
Metabolism of β-valine via a CoA-dependent ammonia lyase pathway.
Otzen, Marleen; Crismaru, Ciprian G; Postema, Christiaan P; Wijma, Hein J; Heberling, Matthew M; Szymanski, Wiktor; de Wildeman, Stefaan; Janssen, Dick B
2015-11-01
Pseudomonas species strain SBV1 can rapidly grow on medium containing β-valine as a sole nitrogen source. The tertiary amine feature of β-valine prevents direct deamination reactions catalyzed by aminotransferases, amino acid dehydrogenases, and amino acid oxidases. However, lyase- or aminomutase-mediated conversions would be possible. To identify enzymes involved in the degradation of β-valine, a PsSBV1 gene library was prepared and used to complement the β-valine growth deficiency of a closely related Pseudomonas strain. This resulted in the identification of a gene encoding β-valinyl-coenzyme A ligase (BvaA) and two genes encoding β-valinyl-CoA ammonia lyases (BvaB1 and BvaB2). The BvaA protein demonstrated high sequence identity to several known phenylacetate CoA ligases. Purified BvaA enzyme did not convert phenyl acetic acid but was able to activate β-valine in an adenosine triphosphate (ATP)- and CoA-dependent manner. The substrate range of the enzyme appears to be narrow, converting only β-valine and to a lesser extent, 3-aminobutyrate and β-alanine. Characterization of BvaB1 and BvaB2 revealed that both enzymes were able to deaminate β-valinyl-CoA to produce 3-methylcrotonyl-CoA, a common intermediate in the leucine degradation pathway. Interestingly, BvaB1 and BvaB2 demonstrated no significant sequence identity to known CoA-dependent ammonia lyases, suggesting they belong to a new family of enzymes. BLAST searches revealed that BvaB1 and BvaB2 show high sequence identity to each other and to several enoyl-CoA hydratases, a class of enzymes that catalyze a similar reaction with water instead of amine as the leaving group.
Stereochemistry of 1,2-elimination and proton-transfer reactions: toward a unified understanding.
Mohrig, Jerry R
2013-07-16
Many mechanistic and stereochemical studies have focused on the breaking of the C-H bond through base-catalyzed elimination reactions. When we began our research, however, chemists knew almost nothing about the stereospecificity of addition-elimination reactions involving conjugated acyclic carbonyl compounds, even though the carbonyl group is a pivotal functional group in organic chemistry. Over the last 25 years, we have studied the addition-elimination reactions of β-substituted acyclic esters, thioesters, and ketones in order to reach a comprehensive understanding of how electronic effects influence their stereochemistry. This Account brings together our understanding of the stereochemistry of 1,2-elimination and proton-transfer reactions, describing how each study has built upon previous work and contributed to our understanding of this field. When we began, chemists thought that anti stereospecificity in base-catalyzed 1,2-elimination reactions occurred via concerted E2 mechanisms, which provide a smooth path for anti elimination. Unexpectedly, we discovered that some E1cBirrev reactions produce the same anti stereospecificity as E2 reactions even though they proceed through diffusionally equilibrated, "free" enolate-anion intermediates. This result calls into question the conventional wisdom that anti stereochemistry must result from a concerted mechanism. While carrying out our research, we developed insights ranging from the role of historical contingency in the evolution of hydratase-dehydratase enzymes to the influence of buffers on the stereochemistry of H/D exchange in D2O. Negative hyperconjugation is the most important concept for understanding our results. This idea provides a unifying view for the largely anti stereochemistry in E1cBirrev elimination reactions and a basis for understanding the stereoelectronic influence of electron-withdrawing β-substituents on proton-transfer reactions.
Vilá-Héreter, Frances; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín
2017-01-01
The allergenic potential of Ganoderma applanatum basidiospores has been demonstrated previously in Puerto Rico. However, basidiomycete allergens are not available for inclusion in allergy diagnostic panels. Therefore, we sought to confirm allergic sensitization to G. applanatum crude spore cytoplasmic extract through reactivity in serological assays and detection of immunoglobulin E (IgE)-binding polypeptides. Via an indirect ELISA, serological reactivity was compared between groups of individuals with different allergic profiles. Group 1 (n = 51) consisted of individuals with sIgE to the allergens included in the diagnostic panels; group 2 (n = 14) comprised individuals with no sIgE to the allergens tested; and group 3 (n = 22) included individuals with no allergic history. To visualize IgE-binding polypeptides, group 1 sera were examined via Western blotting (WB). Polypeptide bands with the highest reactivity were analyzed by mass spectrometry (MS) for putative identification. The serological reactivity of group 1 was significantly higher than that of group 3 in an indirect ELISA (p = 0.03). Sixty-five percent of group 1 individuals showed reactivity to polypeptide bands in WB. Bands of 81 and 56 kDa had the highest reactivity proportions among the reactive sera, followed by a 45-kDa band. MS analysis of these 3 polypeptides suggests that they are basidiomycete-derived enzymes with aconitate hydratase, catalase, and enolase functions. G. applanatum spores have allergenic components recognized by Puerto Rican individuals, which could eventually be considered as markers in cases of fungal allergy and be included in diagnostic allergen panels in Puerto Rico and tropical regions. © 2017 S. Karger AG, Basel.
Miller, Laurence G.; Baesman, Shaun M.; Kirshtein, Julie; Voytek, Mary A.; Oremland, Ronald S.
2013-01-01
Anoxic samples (sediment and groundwater) from 13 chemically diverse field sites were assayed for their ability to consume acetylene (C2H2). Over incubation periods ranging from ˜ 10 to 80 days, selected samples from 7 of the 13 tested sites displayed significant C2H2 removal. No significant formation of ethylene was noted in these incubations; therefore, C2H2 consumption could be attributed to acetylene hydratase (AH) rather than nitrogenase activity. This putative AH (PAH) activity was observed in only 21% of the total of assayed samples, while amplification of AH genes from extracted DNA using degenerate primers derived from Pelobacter acetylenicus occurred in even fewer (9.8%) samples. Acetylene-fermenting bacteria were isolated as a pure culture from the sediments of a tidal mudflat in San Francisco Bay (SFB93) and as an enrichment culture from freshwater Searsville Lake (SV7). Comparison of 16S rDNA clone libraries revealed that SFB93 was closely related to P. carbolinicus, while SV7 consisted of several unrelated bacteria. AH gene was amplified from SFB93 but not SV7. The inability of the primers to generate amplicons in the SV7 enrichment, as well as from several of the environmental samples that displayed PAH activity, implied that either the primers were too highly constrained in their specificity or that there was a different type of AH gene in these environmental samples than occurs in P. acetylenicus. The significance of this work with regard to the search for life in the outer Solar System, where C2HL2 is abundant, is discussed.
Identification and characterization of microRNAs in the pancreatic fluke Eurytrema pancreaticum.
Xu, Min-Jun; Wang, Chun-Ren; Huang, Si-Yang; Fu, Jing-Hua; Zhou, Dong-Hui; Chang, Qiao-Cheng; Zheng, Xu; Zhu, Xing-Quan
2013-01-25
Eurytrema pancreaticum is one of the most common flukes, which mainly infects ruminants globally and infects human beings accidentally; causing eurytremiasis that has high veterinary and economic importance. MicroRNAs (miRNAs) are small non-coding RNAs and are now considered as a key mechanism of gene regulation at the post-transcription level. We investigated the global miRNA expression profile of E. pancreaticum adults using next-generation sequencing technology combined with real-time quantitative PCR. By using the genome of the closely-related species Schistosoma japonicum as reference, we obtained 27 miRNA candidates out of 16.45 million raw sequencing reads, with 13 of them found as known miRNAs in S. japonicum and/or S. mansoni, and the remaining 14 miRNAs were considered as novel. Five out of the 13 known miRNAs coming from one family named as sja-miR-2, including family members from miR-2a to miR-2e. Targets of 19 miRNAs were successfully predicated out of the 17401 mRNA and EST non-redundant sequences of S. japonicum. It was found that a significant high number of targets were related to "chch domain-containing protein mitochondrial precursor" (n = 29), "small subunit ribosomal protein s30e" (n = 21), and "insulin-induced gene 1 protein" (n = 9). Besides, "egg protein cp3842" (n = 2), "fumarate hydratase" (n = 2), "ubiquitin-conjugating enzyme" (n = 2), and "sperm-associated antigen 6" (n = 1) were also found as targets of the miRNAs of E. pancreaticum. The present study represents the first global characterization of E. pancreaticum miRNAs, which provides novel resources for a better understanding of the parasite, which, in turn, has implications for the effective control of the disease it causes.
Antimicrobial activity of yeasts against some pathogenic bacteria
Younis, Gamal; Awad, Amal; Dawod, Rehab E.; Yousef, Nehal E.
2017-01-01
Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR) for detection of khs (kievitone hydratase) and pelA (pectate degrading enzyme)genes. Results: The recovery rate of yeasts from sausage was 20% (2/10) followed by kareish cheese, processed cheese, and butter 10% (1/10) each as well as raw milk 9% (9/100), and fruit yoghurt 30% (6/20). Different yeast species were recovered, namely, Candida kefyr (5 isolates), Saccharomyces cerevisiae (4 isolates), Candida intermedia (3 isolates), Candida tropicalis (2 isolates), Candida lusitaniae (2 isolates), and Candida krusei (1 isolate). khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food. PMID:28919693
Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.
Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun
2016-06-01
To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.
NASA Astrophysics Data System (ADS)
Brown, Alexander; Eviston, Connor
2017-02-01
Multiple FEM models of complex eddy current coil geometries were created and validated to calculate the change of impedance due to the presence of a notch. Capable realistic simulations of eddy current inspections are required for model assisted probability of detection (MAPOD) studies, inversion algorithms, experimental verification, and tailored probe design for NDE applications. An FEM solver was chosen to model complex real world situations including varying probe dimensions and orientations along with complex probe geometries. This will also enable creation of a probe model library database with variable parameters. Verification and validation was performed using other commercially available eddy current modeling software as well as experimentally collected benchmark data. Data analysis and comparison showed that the created models were able to correctly model the probe and conductor interactions and accurately calculate the change in impedance of several experimental scenarios with acceptable error. The promising results of the models enabled the start of an eddy current probe model library to give experimenters easy access to powerful parameter based eddy current models for alternate project applications.
Complexity and Demographic Explanations of Cumulative Culture
Querbes, Adrien; Vaesen, Krist; Houkes, Wybo
2014-01-01
Formal models have linked prehistoric and historical instances of technological change (e.g., the Upper Paleolithic transition, cultural loss in Holocene Tasmania, scientific progress since the late nineteenth century) to demographic change. According to these models, cumulation of technological complexity is inhibited by decreasing— while favoured by increasing—population levels. Here we show that these findings are contingent on how complexity is defined: demography plays a much more limited role in sustaining cumulative culture in case formal models deploy Herbert Simon's definition of complexity rather than the particular definitions of complexity hitherto assumed. Given that currently available empirical evidence doesn't afford discriminating proper from improper definitions of complexity, our robustness analyses put into question the force of recent demographic explanations of particular episodes of cultural change. PMID:25048625
Measuring case-mix complexity of tertiary care hospitals using DRGs.
Park, Hayoung; Shin, Youngsoo
2004-02-01
The objectives of the study were to develop a model that measures and evaluates case-mix complexity of tertiary care hospitals, and to examine the characteristics of such a model. Physician panels defined three classes of case complexity and assigned disease categories represented by Adjacent Diagnosis Related Groups (ADRGs) to one of three case complexity classes. Three types of scores, indicating proportions of inpatients in each case complexity class standardized by the proportions at the national level, were defined to measure the case-mix complexity of a hospital. Discharge information for about 10% of inpatient episodes at 85 hospitals with bed size larger than 400 and their input structure and research and education activity were used to evaluate the case-mix complexity model. Results show its power to predict hospitals with the expected functions of tertiary care hospitals, i.e. resource intensive care, expensive input structure, and high levels of research and education activities.
Theoretical Modeling and Electromagnetic Response of Complex Metamaterials
2017-03-06
AFRL-AFOSR-VA-TR-2017-0042 Theoretical Modeling and Electromagnetic Response of Complex Metamaterials Andrea Alu UNIVERSITY OF TEXAS AT AUSTIN Final...Nov 2016 4. TITLE AND SUBTITLE Theoretical Modeling and Electromagnetic Response of Complex Metamaterials 5a. CONTRACT NUMBER 5b. GRANT NUMBER...based on parity-time symmetric metasurfaces, and various advances in electromagnetic and acoustic theory and applications. Our findings have opened
NASA Astrophysics Data System (ADS)
Salman Shahid, Syed; Bikson, Marom; Salman, Humaira; Wen, Peng; Ahfock, Tony
2014-06-01
Objectives. Computational methods are increasingly used to optimize transcranial direct current stimulation (tDCS) dose strategies and yet complexities of existing approaches limit their clinical access. Since predictive modelling indicates the relevance of subject/pathology based data and hence the need for subject specific modelling, the incremental clinical value of increasingly complex modelling methods must be balanced against the computational and clinical time and costs. For example, the incorporation of multiple tissue layers and measured diffusion tensor (DTI) based conductivity estimates increase model precision but at the cost of clinical and computational resources. Costs related to such complexities aggregate when considering individual optimization and the myriad of potential montages. Here, rather than considering if additional details change current-flow prediction, we consider when added complexities influence clinical decisions. Approach. Towards developing quantitative and qualitative metrics of value/cost associated with computational model complexity, we considered field distributions generated by two 4 × 1 high-definition montages (m1 = 4 × 1 HD montage with anode at C3 and m2 = 4 × 1 HD montage with anode at C1) and a single conventional (m3 = C3-Fp2) tDCS electrode montage. We evaluated statistical methods, including residual error (RE) and relative difference measure (RDM), to consider the clinical impact and utility of increased complexities, namely the influence of skull, muscle and brain anisotropic conductivities in a volume conductor model. Main results. Anisotropy modulated current-flow in a montage and region dependent manner. However, significant statistical changes, produced within montage by anisotropy, did not change qualitative peak and topographic comparisons across montages. Thus for the examples analysed, clinical decision on which dose to select would not be altered by the omission of anisotropic brain conductivity. Significance. Results illustrate the need to rationally balance the role of model complexity, such as anisotropy in detailed current flow analysis versus value in clinical dose design. However, when extending our analysis to include axonal polarization, the results provide presumably clinically meaningful information. Hence the importance of model complexity may be more relevant with cellular level predictions of neuromodulation.
Quantifying uncertainty in high-resolution coupled hydrodynamic-ecosystem models
NASA Astrophysics Data System (ADS)
Allen, J. I.; Somerfield, P. J.; Gilbert, F. J.
2007-01-01
Marine ecosystem models are becoming increasingly complex and sophisticated, and are being used to estimate the effects of future changes in the earth system with a view to informing important policy decisions. Despite their potential importance, far too little attention has been, and is generally, paid to model errors and the extent to which model outputs actually relate to real-world processes. With the increasing complexity of the models themselves comes an increasing complexity among model results. If we are to develop useful modelling tools for the marine environment we need to be able to understand and quantify the uncertainties inherent in the simulations. Analysing errors within highly multivariate model outputs, and relating them to even more complex and multivariate observational data, are not trivial tasks. Here we describe the application of a series of techniques, including a 2-stage self-organising map (SOM), non-parametric multivariate analysis, and error statistics, to a complex spatio-temporal model run for the period 1988-1989 in the Southern North Sea, coinciding with the North Sea Project which collected a wealth of observational data. We use model output, large spatio-temporally resolved data sets and a combination of methodologies (SOM, MDS, uncertainty metrics) to simplify the problem and to provide tractable information on model performance. The use of a SOM as a clustering tool allows us to simplify the dimensions of the problem while the use of MDS on independent data grouped according to the SOM classification allows us to validate the SOM. The combination of classification and uncertainty metrics allows us to pinpoint the variables and associated processes which require attention in each region. We recommend the use of this combination of techniques for simplifying complex comparisons of model outputs with real data, and analysis of error distributions.
Evidence for complex contagion models of social contagion from observational data
Sprague, Daniel A.
2017-01-01
Social influence can lead to behavioural ‘fads’ that are briefly popular and quickly die out. Various models have been proposed for these phenomena, but empirical evidence of their accuracy as real-world predictive tools has so far been absent. Here we find that a ‘complex contagion’ model accurately describes the spread of behaviours driven by online sharing. We found that standard, ‘simple’, contagion often fails to capture both the rapid spread and the long tails of popularity seen in real fads, where our complex contagion model succeeds. Complex contagion also has predictive power: it successfully predicted the peak time and duration of the ALS Icebucket Challenge. The fast spread and longer duration of fads driven by complex contagion has important implications for activities such as publicity campaigns and charity drives. PMID:28686719
Blinov, Michael L.; Moraru, Ion I.
2011-01-01
Multi-state molecules and multi-component complexes are commonly involved in cellular signaling. Accounting for molecules that have multiple potential states, such as a protein that may be phosphorylated on multiple residues, and molecules that combine to form heterogeneous complexes located among multiple compartments, generates an effect of combinatorial complexity. Models involving relatively few signaling molecules can include thousands of distinct chemical species. Several software tools (StochSim, BioNetGen) are already available to deal with combinatorial complexity. Such tools need information standards if models are to be shared, jointly evaluated and developed. Here we discuss XML conventions that can be adopted for modeling biochemical reaction networks described by user-specified reaction rules. These could form a basis for possible future extensions of the Systems Biology Markup Language (SBML). PMID:21464833
FLAME: A platform for high performance computing of complex systems, applied for three case studies
Kiran, Mariam; Bicak, Mesude; Maleki-Dizaji, Saeedeh; ...
2011-01-01
FLAME allows complex models to be automatically parallelised on High Performance Computing (HPC) grids enabling large number of agents to be simulated over short periods of time. Modellers are hindered by complexities of porting models on parallel platforms and time taken to run large simulations on a single machine, which FLAME overcomes. Three case studies from different disciplines were modelled using FLAME, and are presented along with their performance results on a grid.
A Complex Systems Model Approach to Quantified Mineral Resource Appraisal
Gettings, M.E.; Bultman, M.W.; Fisher, F.S.
2004-01-01
For federal and state land management agencies, mineral resource appraisal has evolved from value-based to outcome-based procedures wherein the consequences of resource development are compared with those of other management options. Complex systems modeling is proposed as a general framework in which to build models that can evaluate outcomes. Three frequently used methods of mineral resource appraisal (subjective probabilistic estimates, weights of evidence modeling, and fuzzy logic modeling) are discussed to obtain insight into methods of incorporating complexity into mineral resource appraisal models. Fuzzy logic and weights of evidence are most easily utilized in complex systems models. A fundamental product of new appraisals is the production of reusable, accessible databases and methodologies so that appraisals can easily be repeated with new or refined data. The data are representations of complex systems and must be so regarded if all of their information content is to be utilized. The proposed generalized model framework is applicable to mineral assessment and other geoscience problems. We begin with a (fuzzy) cognitive map using (+1,0,-1) values for the links and evaluate the map for various scenarios to obtain a ranking of the importance of various links. Fieldwork and modeling studies identify important links and help identify unanticipated links. Next, the links are given membership functions in accordance with the data. Finally, processes are associated with the links; ideally, the controlling physical and chemical events and equations are found for each link. After calibration and testing, this complex systems model is used for predictions under various scenarios.
Turbulence spectra in the noise source regions of the flow around complex surfaces
NASA Technical Reports Server (NTRS)
Olsen, W. A.; Boldman, D. R.
1983-01-01
The complex turbulent flow around three complex surfaces was measured in detail with a hot wire. The measured data include extensive spatial surveys of the mean velocity and turbulence intensity and measurements of the turbulence spectra and scale length at many locations. The publication of the turbulence data is completed by reporting a summary of the turbulence spectra that were measured within the noise source locations of the flow. The results suggest some useful simplifications in modeling the very complex turbulent flow around complex surfaces for aeroacoustic predictive models. The turbulence spectra also show that noise data from scale models of moderate size can be accurately scaled up to full size.
Effect of shoulder model complexity in upper-body kinematics analysis of the golf swing.
Bourgain, M; Hybois, S; Thoreux, P; Rouillon, O; Rouch, P; Sauret, C
2018-06-25
The golf swing is a complex full body movement during which the spine and shoulders are highly involved. In order to determine shoulder kinematics during this movement, multibody kinematics optimization (MKO) can be recommended to limit the effect of the soft tissue artifact and to avoid joint dislocations or bone penetration in reconstructed kinematics. Classically, in golf biomechanics research, the shoulder is represented by a 3 degrees-of-freedom model representing the glenohumeral joint. More complex and physiological models are already provided in the scientific literature. Particularly, the model used in this study was a full body model and also described motions of clavicles and scapulae. This study aimed at quantifying the effect of utilizing a more complex and physiological shoulder model when studying the golf swing. Results obtained on 20 golfers showed that a more complex and physiologically-accurate model can more efficiently track experimental markers, which resulted in differences in joint kinematics. Hence, the model with 3 degrees-of-freedom between the humerus and the thorax may be inadequate when combined with MKO and a more physiological model would be beneficial. Finally, results would also be improved through a subject-specific approach for the determination of the segment lengths. Copyright © 2018 Elsevier Ltd. All rights reserved.
Abstraction and model evaluation in category learning.
Vanpaemel, Wolf; Storms, Gert
2010-05-01
Thirty previously published data sets, from seminal category learning tasks, are reanalyzed using the varying abstraction model (VAM). Unlike a prototype-versus-exemplar analysis, which focuses on extreme levels of abstraction only, a VAM analysis also considers the possibility of partial abstraction. Whereas most data sets support no abstraction when only the extreme possibilities are considered, we show that evidence for abstraction can be provided using the broader view on abstraction provided by the VAM. The present results generalize earlier demonstrations of partial abstraction (Vanpaemel & Storms, 2008), in which only a small number of data sets was analyzed. Following the dominant modus operandi in category learning research, Vanpaemel and Storms evaluated the models on their best fit, a practice known to ignore the complexity of the models under consideration. In the present study, in contrast, model evaluation not only relies on the maximal likelihood, but also on the marginal likelihood, which is sensitive to model complexity. Finally, using a large recovery study, it is demonstrated that, across the 30 data sets, complexity differences between the models in the VAM family are small. This indicates that a (computationally challenging) complexity-sensitive model evaluation method is uncalled for, and that the use of a (computationally straightforward) complexity-insensitive model evaluation method is justified.
Li, Zhenping; Zhang, Xiang-Sun; Wang, Rui-Sheng; Liu, Hongwei; Zhang, Shihua
2013-01-01
Identification of communities in complex networks is an important topic and issue in many fields such as sociology, biology, and computer science. Communities are often defined as groups of related nodes or links that correspond to functional subunits in the corresponding complex systems. While most conventional approaches have focused on discovering communities of nodes, some recent studies start partitioning links to find overlapping communities straightforwardly. In this paper, we propose a new quantity function for link community identification in complex networks. Based on this quantity function we formulate the link community partition problem into an integer programming model which allows us to partition a complex network into overlapping communities. We further propose a genetic algorithm for link community detection which can partition a network into overlapping communities without knowing the number of communities. We test our model and algorithm on both artificial networks and real-world networks. The results demonstrate that the model and algorithm are efficient in detecting overlapping community structure in complex networks. PMID:24386268
The Effect of Sensor Performance on Safe Minefield Transit
2002-12-01
the results of the simpler model are not good approximations of the results obtained with the more complex model, suggesting that even greater complexity in maneuver modeling may be desirable for some purposes.
Some Approaches to Modeling Complex Information Systems.
ERIC Educational Resources Information Center
Rao, V. Venkata; Zunde, Pranas
1982-01-01
Brief discussion of state-of-the-art of modeling complex information systems distinguishes between macrolevel and microlevel modeling of such systems. Network layout and hierarchical system models, simulation, information acquisition and dissemination, databases and information storage, and operating systems are described and assessed. Thirty-four…
Development of structural model of adaptive training complex in ergatic systems for professional use
NASA Astrophysics Data System (ADS)
Obukhov, A. D.; Dedov, D. L.; Arkhipov, A. E.
2018-03-01
The article considers the structural model of the adaptive training complex (ATC), which reflects the interrelations between the hardware, software and mathematical model of ATC and describes the processes in this subject area. The description of the main components of software and hardware complex, their interaction and functioning within the common system are given. Also the article scrutinizers a brief description of mathematical models of personnel activity, a technical system and influences, the interactions of which formalize the regularities of ATC functioning. The studies of main objects of training complexes and connections between them will make it possible to realize practical implementation of ATC in ergatic systems for professional use.
Assessment of wear dependence parameters in complex model of cutting tool wear
NASA Astrophysics Data System (ADS)
Antsev, A. V.; Pasko, N. I.; Antseva, N. V.
2018-03-01
This paper addresses wear dependence of the generic efficient life period of cutting tools taken as an aggregate of the law of tool wear rate distribution and dependence of parameters of this law's on the cutting mode, factoring in the random factor as exemplified by the complex model of wear. The complex model of wear takes into account the variance of cutting properties within one batch of tools, variance in machinability within one batch of workpieces, and the stochastic nature of the wear process itself. A technique of assessment of wear dependence parameters in a complex model of cutting tool wear is provided. The technique is supported by a numerical example.
An egalitarian network model for the emergence of simple and complex cells in visual cortex
Tao, Louis; Shelley, Michael; McLaughlin, David; Shapley, Robert
2004-01-01
We explain how simple and complex cells arise in a large-scale neuronal network model of the primary visual cortex of the macaque. Our model consists of ≈4,000 integrate-and-fire, conductance-based point neurons, representing the cells in a small, 1-mm2 patch of an input layer of the primary visual cortex. In the model the local connections are isotropic and nonspecific, and convergent input from the lateral geniculate nucleus confers cortical cells with orientation and spatial phase preference. The balance between lateral connections and lateral geniculate nucleus drive determines whether individual neurons in this recurrent circuit are simple or complex. The model reproduces qualitatively the experimentally observed distributions of both extracellular and intracellular measures of simple and complex response. PMID:14695891
Comparing an annual and daily time-step model for predicting field-scale P loss
USDA-ARS?s Scientific Manuscript database
Several models with varying degrees of complexity are available for describing P movement through the landscape. The complexity of these models is dependent on the amount of data required by the model, the number of model parameters needed to be estimated, the theoretical rigor of the governing equa...
A General Linear Model (GLM) was used to evaluate the deviation of predicted values from expected values for a complex environmental model. For this demonstration, we used the default level interface of the Regional Mercury Cycling Model (R-MCM) to simulate epilimnetic total mer...
Modeling complexity in engineered infrastructure system: Water distribution network as an example
NASA Astrophysics Data System (ADS)
Zeng, Fang; Li, Xiang; Li, Ke
2017-02-01
The complex topology and adaptive behavior of infrastructure systems are driven by both self-organization of the demand and rigid engineering solutions. Therefore, engineering complex systems requires a method balancing holism and reductionism. To model the growth of water distribution networks, a complex network model was developed following the combination of local optimization rules and engineering considerations. The demand node generation is dynamic and follows the scaling law of urban growth. The proposed model can generate a water distribution network (WDN) similar to reported real-world WDNs on some structural properties. Comparison with different modeling approaches indicates that a realistic demand node distribution and co-evolvement of demand node and network are important for the simulation of real complex networks. The simulation results indicate that the efficiency of water distribution networks is exponentially affected by the urban growth pattern. On the contrary, the improvement of efficiency by engineering optimization is limited and relatively insignificant. The redundancy and robustness, on another aspect, can be significantly improved through engineering methods.
Building a pseudo-atomic model of the anaphase-promoting complex.
Kulkarni, Kiran; Zhang, Ziguo; Chang, Leifu; Yang, Jing; da Fonseca, Paula C A; Barford, David
2013-11-01
The anaphase-promoting complex (APC/C) is a large E3 ubiquitin ligase that regulates progression through specific stages of the cell cycle by coordinating the ubiquitin-dependent degradation of cell-cycle regulatory proteins. Depending on the species, the active form of the APC/C consists of 14-15 different proteins that assemble into a 20-subunit complex with a mass of approximately 1.3 MDa. A hybrid approach of single-particle electron microscopy and protein crystallography of individual APC/C subunits has been applied to generate pseudo-atomic models of various functional states of the complex. Three approaches for assigning regions of the EM-derived APC/C density map to specific APC/C subunits are described. This information was used to dock atomic models of APC/C subunits, determined either by protein crystallography or homology modelling, to specific regions of the APC/C EM map, allowing the generation of a pseudo-atomic model corresponding to 80% of the entire complex.
A musculoskeletal model of the elbow joint complex
NASA Technical Reports Server (NTRS)
Gonzalez, Roger V.; Barr, Ronald E.; Abraham, Lawrence D.
1993-01-01
This paper describes a musculoskeletal model that represents human elbow flexion-extension and forearm pronation-supination. Musculotendon parameters and the skeletal geometry were determined for the musculoskeletal model in the analysis of ballistic elbow joint complex movements. The key objective was to develop a computational model, guided by optimal control, to investigate the relationship among patterns of muscle excitation, individual muscle forces, and movement kinematics. The model was verified using experimental kinematic, torque, and electromyographic data from volunteer subjects performing both isometric and ballistic elbow joint complex movements. In general, the model predicted kinematic and muscle excitation patterns similar to what was experimentally measured.
Geometric modeling of subcellular structures, organelles, and multiprotein complexes
Feng, Xin; Xia, Kelin; Tong, Yiying; Wei, Guo-Wei
2013-01-01
SUMMARY Recently, the structure, function, stability, and dynamics of subcellular structures, organelles, and multi-protein complexes have emerged as a leading interest in structural biology. Geometric modeling not only provides visualizations of shapes for large biomolecular complexes but also fills the gap between structural information and theoretical modeling, and enables the understanding of function, stability, and dynamics. This paper introduces a suite of computational tools for volumetric data processing, information extraction, surface mesh rendering, geometric measurement, and curvature estimation of biomolecular complexes. Particular emphasis is given to the modeling of cryo-electron microscopy data. Lagrangian-triangle meshes are employed for the surface presentation. On the basis of this representation, algorithms are developed for surface area and surface-enclosed volume calculation, and curvature estimation. Methods for volumetric meshing have also been presented. Because the technological development in computer science and mathematics has led to multiple choices at each stage of the geometric modeling, we discuss the rationales in the design and selection of various algorithms. Analytical models are designed to test the computational accuracy and convergence of proposed algorithms. Finally, we select a set of six cryo-electron microscopy data representing typical subcellular complexes to demonstrate the efficacy of the proposed algorithms in handling biomolecular surfaces and explore their capability of geometric characterization of binding targets. This paper offers a comprehensive protocol for the geometric modeling of subcellular structures, organelles, and multiprotein complexes. PMID:23212797
Emulator-assisted data assimilation in complex models
NASA Astrophysics Data System (ADS)
Margvelashvili, Nugzar Yu; Herzfeld, Mike; Rizwi, Farhan; Mongin, Mathieu; Baird, Mark E.; Jones, Emlyn; Schaffelke, Britta; King, Edward; Schroeder, Thomas
2016-09-01
Emulators are surrogates of complex models that run orders of magnitude faster than the original model. The utility of emulators for the data assimilation into ocean models is still not well understood. High complexity of ocean models translates into high uncertainty of the corresponding emulators which may undermine the quality of the assimilation schemes based on such emulators. Numerical experiments with a chaotic Lorenz-95 model are conducted to illustrate this point and suggest a strategy to alleviate this problem through the localization of the emulation and data assimilation procedures. Insights gained through these experiments are used to design and implement data assimilation scenario for a 3D fine-resolution sediment transport model of the Great Barrier Reef (GBR), Australia.
NASA Astrophysics Data System (ADS)
Svoray, Tal; Assouline, Shmuel; Katul, Gabriel
2015-11-01
Current literature provides large number of publications about ecohydrological processes and their effect on the biota in drylands. Given the limited laboratory and field experiments in such systems, many of these publications are based on mathematical models of varying complexity. The underlying implicit assumption is that the data set used to evaluate these models covers the parameter space of conditions that characterize drylands and that the models represent the actual processes with acceptable certainty. However, a question raised is to what extent these mathematical models are valid when confronted with observed ecosystem complexity? This Introduction reviews the 16 papers that comprise the Special Section on Eco-hydrology of Semiarid Environments: Confronting Mathematical Models with Ecosystem Complexity. The subjects studied in these papers include rainfall regime, infiltration and preferential flow, evaporation and evapotranspiration, annual net primary production, dispersal and invasion, and vegetation greening. The findings in the papers published in this Special Section show that innovative mathematical modeling approaches can represent actual field measurements. Hence, there are strong grounds for suggesting that mathematical models can contribute to greater understanding of ecosystem complexity through characterization of space-time dynamics of biomass and water storage as well as their multiscale interactions. However, the generality of the models and their low-dimensional representation of many processes may also be a "curse" that results in failures when particulars of an ecosystem are required. It is envisaged that the search for a unifying "general" model, while seductive, may remain elusive in the foreseeable future. It is for this reason that improving the merger between experiments and models of various degrees of complexity continues to shape the future research agenda.
Mathematical Models to Determine Stable Behavior of Complex Systems
NASA Astrophysics Data System (ADS)
Sumin, V. I.; Dushkin, A. V.; Smolentseva, T. E.
2018-05-01
The paper analyzes a possibility to predict functioning of a complex dynamic system with a significant amount of circulating information and a large number of random factors impacting its functioning. Functioning of the complex dynamic system is described as a chaotic state, self-organized criticality and bifurcation. This problem may be resolved by modeling such systems as dynamic ones, without applying stochastic models and taking into account strange attractors.
Tracer transport in soils and shallow groundwater: model abstraction with modern tools
USDA-ARS?s Scientific Manuscript database
Vadose zone controls contaminant transport from the surface to groundwater, and modeling transport in vadose zone has become a burgeoning field. Exceedingly complex models of subsurface contaminant transport are often inefficient. Model abstraction is the methodology for reducing the complexity of a...
Fast computation of derivative based sensitivities of PSHA models via algorithmic differentiation
NASA Astrophysics Data System (ADS)
Leövey, Hernan; Molkenthin, Christian; Scherbaum, Frank; Griewank, Andreas; Kuehn, Nicolas; Stafford, Peter
2015-04-01
Probabilistic seismic hazard analysis (PSHA) is the preferred tool for estimation of potential ground-shaking hazard due to future earthquakes at a site of interest. A modern PSHA represents a complex framework which combines different models with possible many inputs. Sensitivity analysis is a valuable tool for quantifying changes of a model output as inputs are perturbed, identifying critical input parameters and obtaining insight in the model behavior. Differential sensitivity analysis relies on calculating first-order partial derivatives of the model output with respect to its inputs. Moreover, derivative based global sensitivity measures (Sobol' & Kucherenko '09) can be practically used to detect non-essential inputs of the models, thus restricting the focus of attention to a possible much smaller set of inputs. Nevertheless, obtaining first-order partial derivatives of complex models with traditional approaches can be very challenging, and usually increases the computation complexity linearly with the number of inputs appearing in the models. In this study we show how Algorithmic Differentiation (AD) tools can be used in a complex framework such as PSHA to successfully estimate derivative based sensitivities, as is the case in various other domains such as meteorology or aerodynamics, without no significant increase in the computation complexity required for the original computations. First we demonstrate the feasibility of the AD methodology by comparing AD derived sensitivities to analytically derived sensitivities for a basic case of PSHA using a simple ground-motion prediction equation. In a second step, we derive sensitivities via AD for a more complex PSHA study using a ground motion attenuation relation based on a stochastic method to simulate strong motion. The presented approach is general enough to accommodate more advanced PSHA studies of higher complexity.
Hou, Chang-Yu; Feng, Ling; Seleznev, Nikita; Freed, Denise E
2018-09-01
In this work, we establish an effective medium model to describe the low-frequency complex dielectric (conductivity) dispersion of dilute clay suspensions. We use previously obtained low-frequency polarization coefficients for a charged oblate spheroidal particle immersed in an electrolyte as the building block for the Maxwell Garnett mixing formula to model the dilute clay suspension. The complex conductivity phase dispersion exhibits a near-resonance peak when the clay grains have a narrow size distribution. The peak frequency is associated with the size distribution as well as the shape of clay grains and is often referred to as the characteristic frequency. In contrast, if the size of the clay grains has a broad distribution, the phase peak is broadened and can disappear into the background of the canonical phase response of the brine. To benchmark our model, the low-frequency dispersion of the complex conductivity of dilute clay suspensions is measured using a four-point impedance measurement, which can be reliably calibrated in the frequency range between 0.1 Hz and 10 kHz. By using a minimal number of fitting parameters when reliable information is available as input for the model and carefully examining the issue of potential over-fitting, we found that our model can be used to fit the measured dispersion of the complex conductivity with reasonable parameters. The good match between the modeled and experimental complex conductivity dispersion allows us to argue that our simplified model captures the essential physics for describing the low-frequency dispersion of the complex conductivity of dilute clay suspensions. Copyright © 2018 Elsevier Inc. All rights reserved.
Risk Modeling of Interdependent Complex Systems of Systems: Theory and Practice.
Haimes, Yacov Y
2018-01-01
The emergence of the complexity characterizing our systems of systems (SoS) requires a reevaluation of the way we model, assess, manage, communicate, and analyze the risk thereto. Current models for risk analysis of emergent complex SoS are insufficient because too often they rely on the same risk functions and models used for single systems. These models commonly fail to incorporate the complexity derived from the networks of interdependencies and interconnectedness (I-I) characterizing SoS. There is a need to reevaluate currently practiced risk analysis to respond to this reality by examining, and thus comprehending, what makes emergent SoS complex. The key to evaluating the risk to SoS lies in understanding the genesis of characterizing I-I of systems manifested through shared states and other essential entities within and among the systems that constitute SoS. The term "essential entities" includes shared decisions, resources, functions, policies, decisionmakers, stakeholders, organizational setups, and others. This undertaking can be accomplished by building on state-space theory, which is fundamental to systems engineering and process control. This article presents a theoretical and analytical framework for modeling the risk to SoS with two case studies performed with the MITRE Corporation and demonstrates the pivotal contributions made by shared states and other essential entities to modeling and analysis of the risk to complex SoS. A third case study highlights the multifarious representations of SoS, which require harmonizing the risk analysis process currently applied to single systems when applied to complex SoS. © 2017 Society for Risk Analysis.
Modeling of Wall-Bounded Complex Flows and Free Shear Flows
NASA Technical Reports Server (NTRS)
Shih, Tsan-Hsing; Zhu, Jiang; Lumley, John L.
1994-01-01
Various wall-bounded flows with complex geometries and free shear flows have been studied with a newly developed realizable Reynolds stress algebraic equation model. The model development is based on the invariant theory in continuum mechanics. This theory enables us to formulate a general constitutive relation for the Reynolds stresses. Pope was the first to introduce this kind of constitutive relation to turbulence modeling. In our study, realizability is imposed on the truncated constitutive relation to determine the coefficients so that, unlike the standard k-E eddy viscosity model, the present model will not produce negative normal stresses in any situations of rapid distortion. The calculations based on the present model have shown an encouraging success in modeling complex turbulent flows.
NASA Astrophysics Data System (ADS)
McDonald, Karlie; Mika, Sarah; Kolbe, Tamara; Abbott, Ben; Ciocca, Francesco; Marruedo, Amaia; Hannah, David; Schmidt, Christian; Fleckenstein, Jan; Karuse, Stefan
2016-04-01
Sub-surface hydrologic processes are highly dynamic, varying spatially and temporally with strong links to the geomorphology and hydrogeologic properties of an area. This spatial and temporal complexity is a critical regulator of biogeochemical and ecological processes within the interface groundwater - surface water (GW-SW) ecohydrological interface and adjacent ecosystems. Many GW-SW models have attempted to capture this spatial and temporal complexity with varying degrees of success. The incorporation of spatial and temporal complexity within GW-SW model configuration is important to investigate interactions with transient storage and subsurface geology, infiltration and recharge, and mass balance of exchange fluxes at the GW-SW ecohydrological interface. Additionally, characterising spatial and temporal complexity in GW-SW models is essential to derive predictions using realistic environmental conditions. In this paper we conduct a systematic Web of Science meta-analysis of conceptual, hydrodynamic, and reactive and heat transport models of the GW-SW ecohydrological interface since 2004 to explore how these models handled spatial and temporal complexity. The freshwater - groundwater ecohydrological interface was the most commonly represented in publications between 2004 and 2014 with 91% of papers followed by marine 6% and estuarine systems with 3% of papers. Of the GW-SW models published since 2004, the 52% have focused on hydrodynamic processes and <15% covered more than one process (e.g. heat and reactive transport). Within the hydrodynamic subset, 25% of models focused on a vertical depth of <5m. The primary scientific and technological limitations of incorporating spatial and temporal variability into GW-SW models are identified as the inclusion of woody debris, carbon sources, subsurface geological structures and bioclogging into model parameterization. The technological limitations influence the types of models applied, such as hydrostatic coupled models and fully intrinsic saturated and unsaturated models, and the assumptions or simplifications scientists apply to investigate the GW-SW ecohydrological interface. We investigated the type of modelling approaches applied across different scales (site, reach, catchment, nested catchments) and assessed the simplifications in environmental conditions and complexity that are commonly made in model configuration. Understanding the theoretical concepts that underpin these current modelling approaches is critical for scientists to develop measures to derive predictions from realistic environmental conditions at management relevant scales and establish best-practice modelling approaches for improving the scientific understanding and management of the GW-SW interface. Additionally, the assessment of current modelling approaches informs our proposed framework for the progress of GW-SW models in the future. The framework presented aims to increase future scientific, technological and management integration and the identification of research priorities to allow spatial and temporal complexity to be better incorporated into GW-SW models.
Application of surface complexation models to anion adsorption by natural materials.
Goldberg, Sabine
2014-10-01
Various chemical models of ion adsorption are presented and discussed. Chemical models, such as surface complexation models, provide a molecular description of anion adsorption reactions using an equilibrium approach. Two such models, the constant capacitance model and the triple layer model, are described in the present study. Characteristics common to all the surface complexation models are equilibrium constant expressions, mass and charge balances, and surface activity coefficient electrostatic potential terms. Methods for determining parameter values for surface site density, capacitances, and surface complexation constants also are discussed. Spectroscopic experimental methods of establishing ion adsorption mechanisms include vibrational spectroscopy, nuclear magnetic resonance spectroscopy, electron spin resonance spectroscopy, X-ray absorption spectroscopy, and X-ray reflectivity. Experimental determinations of point of zero charge shifts and ionic strength dependence of adsorption results and molecular modeling calculations also can be used to deduce adsorption mechanisms. Applications of the surface complexation models to heterogeneous natural materials, such as soils, using the component additivity and the generalized composite approaches are described. Emphasis is on the generalized composite approach for predicting anion adsorption by soils. Continuing research is needed to develop consistent and realistic protocols for describing ion adsorption reactions on soil minerals and soils. The availability of standardized model parameter databases for use in chemical speciation-transport models is critical. Published 2014 Wiley Periodicals Inc. on behalf of SETAC. This article is a US Government work and as such, is in the public domain in the in the United States of America.
Filho, Manoel A. M.; Dutra, José Diogo L.; Rocha, Gerd B.; Simas, Alfredo M.; Freire, Ricardo O.
2014-01-01
Complexes of dysprosium, holmium, and erbium find many applications as single-molecule magnets, as contrast agents for magnetic resonance imaging, as anti-cancer agents, in optical telecommunications, etc. Therefore, the development of tools that can be proven helpful to complex design is presently an active area of research. In this article, we advance a major improvement to the semiempirical description of lanthanide complexes: the Recife Model 1, RM1, model for the lanthanides, parameterized for the trications of Dy, Ho, and Er. By representing such lanthanide in the RM1 calculation as a three-electron atom with a set of 5 d, 6 s, and 6 p semiempirical orbitals, the accuracy of the previous sparkle models, mainly concentrated on lanthanide-oxygen and lanthanide-nitrogen distances, is extended to other types of bonds in the trication complexes’ coordination polyhedra, such as lanthanide-carbon, lanthanide-chlorine, etc. This is even more important as, for example, lanthanide-carbon atom distances in the coordination polyhedra of the complexes comprise about 30% of all distances for all complexes of Dy, Ho, and Er considered. Our results indicate that the average unsigned mean error for the lanthanide-carbon distances dropped from an average of 0.30 Å, for the sparkle models, to 0.04 Å for the RM1 model for the lanthanides; for a total of 509 such distances for the set of all Dy, Ho, and Er complexes considered. A similar behavior took place for the other distances as well, such as lanthanide-chlorine, lanthanide-bromine, lanthanide, phosphorus and lanthanide-sulfur. Thus, the RM1 model for the lanthanides, being advanced in this article, broadens the range of application of semiempirical models to lanthanide complexes by including comprehensively many other types of bonds not adequately described by the previous models. PMID:24497945
Rule-based modeling and simulations of the inner kinetochore structure.
Tschernyschkow, Sergej; Herda, Sabine; Gruenert, Gerd; Döring, Volker; Görlich, Dennis; Hofmeister, Antje; Hoischen, Christian; Dittrich, Peter; Diekmann, Stephan; Ibrahim, Bashar
2013-09-01
Combinatorial complexity is a central problem when modeling biochemical reaction networks, since the association of a few components can give rise to a large variation of protein complexes. Available classical modeling approaches are often insufficient for the analysis of very large and complex networks in detail. Recently, we developed a new rule-based modeling approach that facilitates the analysis of spatial and combinatorially complex problems. Here, we explore for the first time how this approach can be applied to a specific biological system, the human kinetochore, which is a multi-protein complex involving over 100 proteins. Applying our freely available SRSim software to a large data set on kinetochore proteins in human cells, we construct a spatial rule-based simulation model of the human inner kinetochore. The model generates an estimation of the probability distribution of the inner kinetochore 3D architecture and we show how to analyze this distribution using information theory. In our model, the formation of a bridge between CenpA and an H3 containing nucleosome only occurs efficiently for higher protein concentration realized during S-phase but may be not in G1. Above a certain nucleosome distance the protein bridge barely formed pointing towards the importance of chromatin structure for kinetochore complex formation. We define a metric for the distance between structures that allow us to identify structural clusters. Using this modeling technique, we explore different hypothetical chromatin layouts. Applying a rule-based network analysis to the spatial kinetochore complex geometry allowed us to integrate experimental data on kinetochore proteins, suggesting a 3D model of the human inner kinetochore architecture that is governed by a combinatorial algebraic reaction network. This reaction network can serve as bridge between multiple scales of modeling. Our approach can be applied to other systems beyond kinetochores. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
D'Urzo, Annalisa; Konijnenberg, Albert; Rossetti, Giulia; Habchi, Johnny; Li, Jinyu; Carloni, Paolo; Sobott, Frank; Longhi, Sonia; Grandori, Rita
2015-03-01
Intrinsically disordered proteins (IDPs) form biologically active complexes that can retain a high degree of conformational disorder, escaping structural characterization by conventional approaches. An example is offered by the complex between the intrinsically disordered NTAIL domain and the phosphoprotein X domain (PXD) from measles virus (MeV). Here, distinct conformers of the complex are detected by electrospray ionization-mass spectrometry (ESI-MS) and ion mobility (IM) techniques yielding estimates for the solvent-accessible surface area (SASA) in solution and the average collision cross-section (CCS) in the gas phase. Computational modeling of the complex in solution, based on experimental constraints, provides atomic-resolution structural models featuring different levels of compactness. The resulting models indicate high structural heterogeneity. The intermolecular interactions are predominantly hydrophobic, not only in the ordered core of the complex, but also in the dynamic, disordered regions. Electrostatic interactions become involved in the more compact states. This system represents an illustrative example of a hydrophobic complex that could be directly detected in the gas phase by native mass spectrometry. This work represents the first attempt to modeling the entire NTAIL domain bound to PXD at atomic resolution.
NASA Astrophysics Data System (ADS)
Luo, Yan; Zhang, Lifeng; Li, Ming; Sridhar, Seetharaman
2018-06-01
A complex nitride of Al x Mg(1- x)N was observed in silicon steels. A thermodynamic model was developed to predict the ferrite/nitride equilibrium in the Fe-Al-Mg-N alloy system, using published binary solubility products for stoichiometric phases. The model was used to estimate the solubility product of nitride compound, equilibrium ferrite, and nitride compositions, and the amounts of each phase, as a function of steel composition and temperature. In the current model, the molar ratio Al/(Al + Mg) in the complex nitride was great due to the low dissolved magnesium in steel. For a steel containing 0.52 wt pct Als, 10 ppm T.Mg., and 20 ppm T.N. at 1100 K (827 °C), the complex nitride was expressed by Al0.99496Mg0.00504N and the solubility product of this complex nitride was 2.95 × 10-7. In addition, the solution temperature of the complex nitride increased with increasing the nitrogen and aluminum in steel. The good agreement between the prediction and the detected precipitate compositions validated the current model.
NASA Technical Reports Server (NTRS)
Adler, David S.; Roberts, William W., Jr.
1992-01-01
Techniques which use longitude-velocity diagrams to identify molecular cloud complexes in the disk of the Galaxy are investigated by means of model Galactic disks generated from N-body cloud-particle simulations. A procedure similar to the method used to reduce the low-level emission in Galactic l-v diagrams is employed to isolate complexes of emission in the model l-v diagram (LVCs) from the 'background'clouds. The LVCs produced in this manner yield a size-line-width relationship with a slope of 0.58 and a mass spectrum with a slope of 1.55, consistent with Galactic observations. It is demonstrated that associations identified as LVCs are often chance superpositions of clouds spread out along the line of sight in the disk of the model system. This indicates that the l-v diagram cannot be used to unambiguously determine the location of molecular cloud complexes in the model Galactic disk. The modeling results also indicate that the existence of a size-line-width relationship is not a reliable indicator of the physical nature of cloud complexes, in particular, whether the complexes are gravitationally bound objects.
Complex fuzzy soft expert sets
NASA Astrophysics Data System (ADS)
Selvachandran, Ganeshsree; Hafeed, Nisren A.; Salleh, Abdul Razak
2017-04-01
Complex fuzzy sets and its accompanying theory although at its infancy, has proven to be superior to classical type-1 fuzzy sets, due its ability in representing time-periodic problem parameters and capturing the seasonality of the fuzziness that exists in the elements of a set. These are important characteristics that are pervasive in most real world problems. However, there are two major problems that are inherent in complex fuzzy sets: it lacks a sufficient parameterization tool and it does not have a mechanism to validate the values assigned to the membership functions of the elements in a set. To overcome these problems, we propose the notion of complex fuzzy soft expert sets which is a hybrid model of complex fuzzy sets and soft expert sets. This model incorporates the advantages of complex fuzzy sets and soft sets, besides having the added advantage of allowing the users to know the opinion of all the experts in a single model without the need for any additional cumbersome operations. As such, this model effectively improves the accuracy of representation of problem parameters that are periodic in nature, besides having a higher level of computational efficiency compared to similar models in literature.
Application of Complex Adaptive Systems in Portfolio Management
ERIC Educational Resources Information Center
Su, Zheyuan
2017-01-01
Simulation-based methods are becoming a promising research tool in financial markets. A general Complex Adaptive System can be tailored to different application scenarios. Based on the current research, we built two models that would benefit portfolio management by utilizing Complex Adaptive Systems (CAS) in Agent-based Modeling (ABM) approach.…
Rethinking Validation in Complex High-Stakes Assessment Contexts
ERIC Educational Resources Information Center
Koch, Martha J.; DeLuca, Christopher
2012-01-01
In this article we rethink validation within the complex contexts of high-stakes assessment. We begin by considering the utility of existing models for validation and argue that these models tend to overlook some of the complexities inherent to assessment use, including the multiple interpretations of assessment purposes and the potential…
Elementary Teachers' Selection and Use of Visual Models
ERIC Educational Resources Information Center
Lee, Tammy D.; Jones, M. Gail
2018-01-01
As science grows in complexity, science teachers face an increasing challenge of helping students interpret models that represent complex science systems. Little is known about how teachers select and use models when planning lessons. This mixed methods study investigated the pedagogical approaches and visual models used by elementary in-service…
Developing and Modeling Complex Social Interventions: Introducing the Connecting People Intervention
ERIC Educational Resources Information Center
Webber, Martin; Reidy, Hannah; Ansari, David; Stevens, Martin; Morris, David
2016-01-01
Objectives: Modeling the processes involved in complex social interventions is important in social work practice, as it facilitates their implementation and translation into different contexts. This article reports the process of developing and modeling the connecting people intervention (CPI), a model of practice that supports people with mental…
Modeling Bivariate Longitudinal Hormone Profiles by Hierarchical State Space Models
Liu, Ziyue; Cappola, Anne R.; Crofford, Leslie J.; Guo, Wensheng
2013-01-01
The hypothalamic-pituitary-adrenal (HPA) axis is crucial in coping with stress and maintaining homeostasis. Hormones produced by the HPA axis exhibit both complex univariate longitudinal profiles and complex relationships among different hormones. Consequently, modeling these multivariate longitudinal hormone profiles is a challenging task. In this paper, we propose a bivariate hierarchical state space model, in which each hormone profile is modeled by a hierarchical state space model, with both population-average and subject-specific components. The bivariate model is constructed by concatenating the univariate models based on the hypothesized relationship. Because of the flexible framework of state space form, the resultant models not only can handle complex individual profiles, but also can incorporate complex relationships between two hormones, including both concurrent and feedback relationship. Estimation and inference are based on marginal likelihood and posterior means and variances. Computationally efficient Kalman filtering and smoothing algorithms are used for implementation. Application of the proposed method to a study of chronic fatigue syndrome and fibromyalgia reveals that the relationships between adrenocorticotropic hormone and cortisol in the patient group are weaker than in healthy controls. PMID:24729646
Modeling Bivariate Longitudinal Hormone Profiles by Hierarchical State Space Models.
Liu, Ziyue; Cappola, Anne R; Crofford, Leslie J; Guo, Wensheng
2014-01-01
The hypothalamic-pituitary-adrenal (HPA) axis is crucial in coping with stress and maintaining homeostasis. Hormones produced by the HPA axis exhibit both complex univariate longitudinal profiles and complex relationships among different hormones. Consequently, modeling these multivariate longitudinal hormone profiles is a challenging task. In this paper, we propose a bivariate hierarchical state space model, in which each hormone profile is modeled by a hierarchical state space model, with both population-average and subject-specific components. The bivariate model is constructed by concatenating the univariate models based on the hypothesized relationship. Because of the flexible framework of state space form, the resultant models not only can handle complex individual profiles, but also can incorporate complex relationships between two hormones, including both concurrent and feedback relationship. Estimation and inference are based on marginal likelihood and posterior means and variances. Computationally efficient Kalman filtering and smoothing algorithms are used for implementation. Application of the proposed method to a study of chronic fatigue syndrome and fibromyalgia reveals that the relationships between adrenocorticotropic hormone and cortisol in the patient group are weaker than in healthy controls.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christensen, J.B.; Christensen, T.H.
1999-11-01
Complexation of cadmium (Cd), nickel (Ni), and zinc (Zn) by dissolved organic carbon (DOC) in leachate-polluted groundwater was measured using a resin equilibrium method and an aquifer material sorption technique. The first method is commonly used in complexation studies, while the second method better represents aquifer conditions. The two approaches gave similar results. Metal-DOC complexation was measured over a range of DOC concentrations using the resin equilibrium method, and the results were compared to simulations made by two speciation models containing default databases on metal-DOC complexes (WHAM and MINTEQA2). The WHAM model gave reasonable estimates of Cd and Ni complexationmore » by DOC for both leachate-polluted groundwater samples. The estimated effect of complexation differed less than 50% from the experimental values corresponding to a deviation on the activity of the free metal ion of a factor of 2.5. The effect of DOC complexation for Zn was largely overestimated by the WHAM model, and it was found that using a binding constant of 1.7 instead of the default value of 1.3 would improve the fit between the simulations and experimental data. The MINTEQA2 model gave reasonable predictions of the complexation of Cd and Zn by DOC, whereas deviations in the estimated activity of the free Ni{sup 2+} ion as compared to experimental results are up to a factor of 5.« less
Westö, Johan; May, Patrick J C
2018-05-02
Receptive field (RF) models are an important tool for deciphering neural responses to sensory stimuli. The two currently popular RF models are multi-filter linear-nonlinear (LN) models and context models. Models are, however, never correct and they rely on assumptions to keep them simple enough to be interpretable. As a consequence, different models describe different stimulus-response mappings, which may or may not be good approximations of real neural behavior. In the current study, we take up two tasks: First, we introduce new ways to estimate context models with realistic nonlinearities, that is, with logistic and exponential functions. Second, we evaluate context models and multi-filter LN models in terms of how well they describe recorded data from complex cells in cat primary visual cortex. Our results, based on single-spike information and correlation coefficients, indicate that context models outperform corresponding multi-filter LN models of equal complexity (measured in terms of number of parameters), with the best increase in performance being achieved by the novel context models. Consequently, our results suggest that the multi-filter LN-model framework is suboptimal for describing the behavior of complex cells: the context-model framework is clearly superior while still providing interpretable quantizations of neural behavior.
Using multi-criteria analysis of simulation models to understand complex biological systems
Maureen C. Kennedy; E. David Ford
2011-01-01
Scientists frequently use computer-simulation models to help solve complex biological problems. Typically, such models are highly integrated, they produce multiple outputs, and standard methods of model analysis are ill suited for evaluating them. We show how multi-criteria optimization with Pareto optimality allows for model outputs to be compared to multiple system...
Analysis of Immune Complex Structure by Statistical Mechanics and Light Scattering Techniques.
NASA Astrophysics Data System (ADS)
Busch, Nathan Adams
1995-01-01
The size and structure of immune complexes determine their behavior in the immune system. The chemical physics of the complex formation is not well understood; this is due in part to inadequate characterization of the proteins involved, and in part by lack of sufficiently well developed theoretical techniques. Understanding the complex formation will permit rational design of strategies for inhibiting tissue deposition of the complexes. A statistical mechanical model of the proteins based upon the theory of associating fluids was developed. The multipole electrostatic potential for each protein used in this study was characterized for net protein charge, dipole moment magnitude, and dipole moment direction. The binding sites, between the model antigen and antibodies, were characterized for their net surface area, energy, and position relative to the dipole moment of the protein. The equilibrium binding graphs generated with the protein statistical mechanical model compares favorably with experimental data obtained from radioimmunoassay results. The isothermal compressibility predicted by the model agrees with results obtained from dynamic light scattering. The statistical mechanics model was used to investigate association between the model antigen and selected pairs of antibodies. It was found that, in accordance to expectations from thermodynamic arguments, the highest total binding energy yielded complex distributions which were skewed to higher complex size. From examination of the simulated formation of ring structures from linear chain complexes, and from the joint shape probability surfaces, it was found that ring configurations were formed by the "folding" of linear chains until the ends are within binding distance. By comparing the single antigen/two antibody system which differ only in their respective binding site locations, it was found that binding site location influences complex size and shape distributions only when ring formation occurs. The internal potential energy of a ring complex is considerably less than that of the non-associating system; therefore the ring complexes are quite stable and show no evidence of breaking, and collapsing into smaller complexes. The ring formation will occur only in systems where the total free energy of each complex may be minimized. Thus, ring formation will occur even though entropically unfavorable conformations result if the total free energy can be minimized by doing so.
González, Janneth; Gálvez, Angela; Morales, Ludis; Barreto, George E.; Capani, Francisco; Sierra, Omar; Torres, Yolima
2013-01-01
Three-dimensional models of the alpha- and beta-1 subunits of the calcium-activated potassium channel (BK) were predicted by threading modeling. A recursive approach comprising of sequence alignment and model building based on three templates was used to build these models, with the refinement of non-conserved regions carried out using threading techniques. The complex formed by the subunits was studied by means of docking techniques, using 3D models of the two subunits, and an approach based on rigid-body structures. Structural effects of the complex were analyzed with respect to hydrogen-bond interactions and binding-energy calculations. Potential interaction sites of the complex were determined by referencing a study of the difference accessible surface area (DASA) of the protein subunits in the complex. PMID:23492851
Improving a regional model using reduced complexity and parameter estimation
Kelson, Victor A.; Hunt, Randall J.; Haitjema, Henk M.
2002-01-01
The availability of powerful desktop computers and graphical user interfaces for ground water flow models makes possible the construction of ever more complex models. A proposed copper-zinc sulfide mine in northern Wisconsin offers a unique case in which the same hydrologic system has been modeled using a variety of techniques covering a wide range of sophistication and complexity. Early in the permitting process, simple numerical models were used to evaluate the necessary amount of water to be pumped from the mine, reductions in streamflow, and the drawdowns in the regional aquifer. More complex models have subsequently been used in an attempt to refine the predictions. Even after so much modeling effort, questions regarding the accuracy and reliability of the predictions remain. We have performed a new analysis of the proposed mine using the two-dimensional analytic element code GFLOW coupled with the nonlinear parameter estimation code UCODE. The new model is parsimonious, containing fewer than 10 parameters, and covers a region several times larger in areal extent than any of the previous models. The model demonstrates the suitability of analytic element codes for use with parameter estimation codes. The simplified model results are similar to the more complex models; predicted mine inflows and UCODE-derived 95% confidence intervals are consistent with the previous predictions. More important, the large areal extent of the model allowed us to examine hydrological features not included in the previous models, resulting in new insights about the effects that far-field boundary conditions can have on near-field model calibration and parameterization. In this case, the addition of surface water runoff into a lake in the headwaters of a stream while holding recharge constant moved a regional ground watershed divide and resulted in some of the added water being captured by the adjoining basin. Finally, a simple analytical solution was used to clarify the GFLOW model's prediction that, for a model that is properly calibrated for heads, regional drawdowns are relatively unaffected by the choice of aquifer properties, but that mine inflows are strongly affected. Paradoxically, by reducing model complexity, we have increased the understanding gained from the modeling effort.
Improving a regional model using reduced complexity and parameter estimation.
Kelson, Victor A; Hunt, Randall J; Haitjema, Henk M
2002-01-01
The availability of powerful desktop computers and graphical user interfaces for ground water flow models makes possible the construction of ever more complex models. A proposed copper-zinc sulfide mine in northern Wisconsin offers a unique case in which the same hydrologic system has been modeled using a variety of techniques covering a wide range of sophistication and complexity. Early in the permitting process, simple numerical models were used to evaluate the necessary amount of water to be pumped from the mine, reductions in streamflow, and the drawdowns in the regional aquifer. More complex models have subsequently been used in an attempt to refine the predictions. Even after so much modeling effort, questions regarding the accuracy and reliability of the predictions remain. We have performed a new analysis of the proposed mine using the two-dimensional analytic element code GFLOW coupled with the nonlinear parameter estimation code UCODE. The new model is parsimonious, containing fewer than 10 parameters, and covers a region several times larger in areal extent than any of the previous models. The model demonstrates the suitability of analytic element codes for use with parameter estimation codes. The simplified model results are similar to the more complex models; predicted mine inflows and UCODE-derived 95% confidence intervals are consistent with the previous predictions. More important, the large areal extent of the model allowed us to examine hydrological features not included in the previous models, resulting in new insights about the effects that far-field boundary conditions can have on near-field model calibration and parameterization. In this case, the addition of surface water runoff into a lake in the headwaters of a stream while holding recharge constant moved a regional ground watershed divide and resulted in some of the added water being captured by the adjoining basin. Finally, a simple analytical solution was used to clarify the GFLOW model's prediction that, for a model that is properly calibrated for heads, regional drawdowns are relatively unaffected by the choice of aquifer properties, but that mine inflows are strongly affected. Paradoxically, by reducing model complexity, we have increased the understanding gained from the modeling effort.
Research Area 3: Mathematics (3.1 Modeling of Complex Systems)
2017-10-31
RESEARCH AREA 3: MATHEMATICS (3.1 Modeling of Complex Systems). Proposal should be directed to Dr. John Lavery The views, opinions and/or findings...so designated by other documentation. 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS (ES) U.S. Army Research Office P.O. Box 12211 Research ...Title: RESEARCH AREA 3: MATHEMATICS (3.1 Modeling of Complex Systems). Proposal should be directed to Dr. John Lavery Report Term: 0-Other Email
Stock, Kristin; Estrada, Marta F; Vidic, Suzana; Gjerde, Kjersti; Rudisch, Albin; Santo, Vítor E; Barbier, Michaël; Blom, Sami; Arundkar, Sharath C; Selvam, Irwin; Osswald, Annika; Stein, Yan; Gruenewald, Sylvia; Brito, Catarina; van Weerden, Wytske; Rotter, Varda; Boghaert, Erwin; Oren, Moshe; Sommergruber, Wolfgang; Chong, Yolanda; de Hoogt, Ronald; Graeser, Ralph
2016-07-01
Two-dimensional (2D) cell cultures growing on plastic do not recapitulate the three dimensional (3D) architecture and complexity of human tumors. More representative models are required for drug discovery and validation. Here, 2D culture and 3D mono- and stromal co-culture models of increasing complexity have been established and cross-comparisons made using three standard cell carcinoma lines: MCF7, LNCaP, NCI-H1437. Fluorescence-based growth curves, 3D image analysis, immunohistochemistry and treatment responses showed that end points differed according to cell type, stromal co-culture and culture format. The adaptable methodologies described here should guide the choice of appropriate simple and complex in vitro models.
Stock, Kristin; Estrada, Marta F.; Vidic, Suzana; Gjerde, Kjersti; Rudisch, Albin; Santo, Vítor E.; Barbier, Michaël; Blom, Sami; Arundkar, Sharath C.; Selvam, Irwin; Osswald, Annika; Stein, Yan; Gruenewald, Sylvia; Brito, Catarina; van Weerden, Wytske; Rotter, Varda; Boghaert, Erwin; Oren, Moshe; Sommergruber, Wolfgang; Chong, Yolanda; de Hoogt, Ronald; Graeser, Ralph
2016-01-01
Two-dimensional (2D) cell cultures growing on plastic do not recapitulate the three dimensional (3D) architecture and complexity of human tumors. More representative models are required for drug discovery and validation. Here, 2D culture and 3D mono- and stromal co-culture models of increasing complexity have been established and cross-comparisons made using three standard cell carcinoma lines: MCF7, LNCaP, NCI-H1437. Fluorescence-based growth curves, 3D image analysis, immunohistochemistry and treatment responses showed that end points differed according to cell type, stromal co-culture and culture format. The adaptable methodologies described here should guide the choice of appropriate simple and complex in vitro models. PMID:27364600
Qualitative models and experimental investigation of chaotic NOR gates and set/reset flip-flops
NASA Astrophysics Data System (ADS)
Rahman, Aminur; Jordan, Ian; Blackmore, Denis
2018-01-01
It has been observed through experiments and SPICE simulations that logical circuits based upon Chua's circuit exhibit complex dynamical behaviour. This behaviour can be used to design analogues of more complex logic families and some properties can be exploited for electronics applications. Some of these circuits have been modelled as systems of ordinary differential equations. However, as the number of components in newer circuits increases so does the complexity. This renders continuous dynamical systems models impractical and necessitates new modelling techniques. In recent years, some discrete dynamical models have been developed using various simplifying assumptions. To create a robust modelling framework for chaotic logical circuits, we developed both deterministic and stochastic discrete dynamical models, which exploit the natural recurrence behaviour, for two chaotic NOR gates and a chaotic set/reset flip-flop. This work presents a complete applied mathematical investigation of logical circuits. Experiments on our own designs of the above circuits are modelled and the models are rigorously analysed and simulated showing surprisingly close qualitative agreement with the experiments. Furthermore, the models are designed to accommodate dynamics of similarly designed circuits. This will allow researchers to develop ever more complex chaotic logical circuits with a simple modelling framework.
Qualitative models and experimental investigation of chaotic NOR gates and set/reset flip-flops.
Rahman, Aminur; Jordan, Ian; Blackmore, Denis
2018-01-01
It has been observed through experiments and SPICE simulations that logical circuits based upon Chua's circuit exhibit complex dynamical behaviour. This behaviour can be used to design analogues of more complex logic families and some properties can be exploited for electronics applications. Some of these circuits have been modelled as systems of ordinary differential equations. However, as the number of components in newer circuits increases so does the complexity. This renders continuous dynamical systems models impractical and necessitates new modelling techniques. In recent years, some discrete dynamical models have been developed using various simplifying assumptions. To create a robust modelling framework for chaotic logical circuits, we developed both deterministic and stochastic discrete dynamical models, which exploit the natural recurrence behaviour, for two chaotic NOR gates and a chaotic set/reset flip-flop. This work presents a complete applied mathematical investigation of logical circuits. Experiments on our own designs of the above circuits are modelled and the models are rigorously analysed and simulated showing surprisingly close qualitative agreement with the experiments. Furthermore, the models are designed to accommodate dynamics of similarly designed circuits. This will allow researchers to develop ever more complex chaotic logical circuits with a simple modelling framework.
NASA Astrophysics Data System (ADS)
Kissinger, Alexander; Noack, Vera; Knopf, Stefan; Konrad, Wilfried; Scheer, Dirk; Class, Holger
2017-06-01
Saltwater intrusion into potential drinking water aquifers due to the injection of CO2 into deep saline aquifers is one of the hazards associated with the geological storage of CO2. Thus, in a site-specific risk assessment, models for predicting the fate of the displaced brine are required. Practical simulation of brine displacement involves decisions regarding the complexity of the model. The choice of an appropriate level of model complexity depends on multiple criteria: the target variable of interest, the relevant physical processes, the computational demand, the availability of data, and the data uncertainty. In this study, we set up a regional-scale geological model for a realistic (but not real) onshore site in the North German Basin with characteristic geological features for that region. A major aim of this work is to identify the relevant parameters controlling saltwater intrusion in a complex structural setting and to test the applicability of different model simplifications. The model that is used to identify relevant parameters fully couples flow in shallow freshwater aquifers and deep saline aquifers. This model also includes variable-density transport of salt and realistically incorporates surface boundary conditions with groundwater recharge. The complexity of this model is then reduced in several steps, by neglecting physical processes (two-phase flow near the injection well, variable-density flow) and by simplifying the complex geometry of the geological model. The results indicate that the initial salt distribution prior to the injection of CO2 is one of the key parameters controlling shallow aquifer salinization. However, determining the initial salt distribution involves large uncertainties in the regional-scale hydrogeological parameterization and requires complex and computationally demanding models (regional-scale variable-density salt transport). In order to evaluate strategies for minimizing leakage into shallow aquifers, other target variables can be considered, such as the volumetric leakage rate into shallow aquifers or the pressure buildup in the injection horizon. Our results show that simplified models, which neglect variable-density salt transport, can reach an acceptable agreement with more complex models.
Behavior of the gypsy moth life system model and development of synoptic model formulations
J. J. Colbert; Xu Rumei
1991-01-01
Aims of the research: The gypsy moth life system model (GMLSM) is a complex model which incorporates numerous components (both biotic and abiotic) and ecological processes. It is a detailed simulation model which has much biological reality. However, it has not yet been tested with life system data. For such complex models, evaluation and testing cannot be adequately...
ADAM: Analysis of Discrete Models of Biological Systems Using Computer Algebra
2011-01-01
Background Many biological systems are modeled qualitatively with discrete models, such as probabilistic Boolean networks, logical models, Petri nets, and agent-based models, to gain a better understanding of them. The computational complexity to analyze the complete dynamics of these models grows exponentially in the number of variables, which impedes working with complex models. There exist software tools to analyze discrete models, but they either lack the algorithmic functionality to analyze complex models deterministically or they are inaccessible to many users as they require understanding the underlying algorithm and implementation, do not have a graphical user interface, or are hard to install. Efficient analysis methods that are accessible to modelers and easy to use are needed. Results We propose a method for efficiently identifying attractors and introduce the web-based tool Analysis of Dynamic Algebraic Models (ADAM), which provides this and other analysis methods for discrete models. ADAM converts several discrete model types automatically into polynomial dynamical systems and analyzes their dynamics using tools from computer algebra. Specifically, we propose a method to identify attractors of a discrete model that is equivalent to solving a system of polynomial equations, a long-studied problem in computer algebra. Based on extensive experimentation with both discrete models arising in systems biology and randomly generated networks, we found that the algebraic algorithms presented in this manuscript are fast for systems with the structure maintained by most biological systems, namely sparseness and robustness. For a large set of published complex discrete models, ADAM identified the attractors in less than one second. Conclusions Discrete modeling techniques are a useful tool for analyzing complex biological systems and there is a need in the biological community for accessible efficient analysis tools. ADAM provides analysis methods based on mathematical algorithms as a web-based tool for several different input formats, and it makes analysis of complex models accessible to a larger community, as it is platform independent as a web-service and does not require understanding of the underlying mathematics. PMID:21774817
Groundwater modelling in decision support: reflections on a unified conceptual framework
NASA Astrophysics Data System (ADS)
Doherty, John; Simmons, Craig T.
2013-11-01
Groundwater models are commonly used as basis for environmental decision-making. There has been discussion and debate in recent times regarding the issue of model simplicity and complexity. This paper contributes to this ongoing discourse. The selection of an appropriate level of model structural and parameterization complexity is not a simple matter. Although the metrics on which such selection should be based are simple, there are many competing, and often unquantifiable, considerations which must be taken into account as these metrics are applied. A unified conceptual framework is introduced and described which is intended to underpin groundwater modelling in decision support with a direct focus on matters regarding model simplicity and complexity.
Modeling the chemistry of complex petroleum mixtures.
Quann, R J
1998-01-01
Determining the complete molecular composition of petroleum and its refined products is not feasible with current analytical techniques because of the astronomical number of molecular components. Modeling the composition and behavior of such complex mixtures in refinery processes has accordingly evolved along a simplifying concept called lumping. Lumping reduces the complexity of the problem to a manageable form by grouping the entire set of molecular components into a handful of lumps. This traditional approach does not have a molecular basis and therefore excludes important aspects of process chemistry and molecular property fundamentals from the model's formulation. A new approach called structure-oriented lumping has been developed to model the composition and chemistry of complex mixtures at a molecular level. The central concept is to represent an individual molecular or a set of closely related isomers as a mathematical construct of certain specific and repeating structural groups. A complex mixture such as petroleum can then be represented as thousands of distinct molecular components, each having a mathematical identity. This enables the automated construction of large complex reaction networks with tens of thousands of specific reactions for simulating the chemistry of complex mixtures. Further, the method provides a convenient framework for incorporating molecular physical property correlations, existing group contribution methods, molecular thermodynamic properties, and the structure--activity relationships of chemical kinetics in the development of models. PMID:9860903
How rare is complex life in the Milky Way?
Bounama, Christine; von Bloh, Werner; Franck, Siegfried
2007-10-01
An integrated Earth system model was applied to calculate the number of habitable Earth-analog planets that are likely to have developed primitive (unicellular) and complex (multicellular) life in extrasolar planetary systems. The model is based on the global carbon cycle mediated by life and driven by increasing stellar luminosity and plate tectonics. We assumed that the hypothetical primitive and complex life forms differed in their temperature limits and CO(2) tolerances. Though complex life would be more vulnerable to environmental stress, its presence would amplify weathering processes on a terrestrial planet. The model allowed us to calculate the average number of Earth-analog planets that may harbor such life by using the formation rate of Earth-like planets in the Milky Way as well as the size of a habitable zone that could support primitive and complex life forms. The number of planets predicted to bear complex life was found to be approximately 2 orders of magnitude lower than the number predicted for primitive life forms. Our model predicted a maximum abundance of such planets around 1.8 Ga ago and allowed us to calculate the average distance between potentially habitable planets in the Milky Way. If the model predictions are accurate, the future missions DARWIN (up to a probability of 65%) and TPF (up to 20%) are likely to detect at least one planet with a biosphere composed of complex life.
Influence of dissolved organic matter on the complexation of mercury under sulfidic conditions.
Miller, Carrie L; Mason, Robert P; Gilmour, Cynthia C; Heyes, Andrew
2007-04-01
The complexation of Hg under sulfidic conditions influences its bioavailability for microbial methylation. Neutral dissolved Hg-sulfide complexes are readily available to Hg-methylating bacteria in culture, and thermodynamic models predict that inorganic Hg-sulfide complexes dominate dissolved Hg speciation under natural sulfidic conditions. However, these models have not been validated in the field. To examine the complexation of Hg in natural sulfidic waters, octanol/water partitioning methods were modified for use under environmentally relevant conditions, and a centrifuge ultrafiltration technique was developed. These techniques demonstrated much lower concentrations of dissolved Hg-sulfide complexes than predicted. Furthermore, the study revealed an interaction between Hg, dissolved organic matter (DOM), and sulfide that is not captured by current thermodynamic models. Whereas Hg forms strong complexes with DOM under oxic conditions, these complexes had not been expected to form in the presence of sulfide because of the stronger affinity of Hg for sulfide relative to its affinity for DOM. The observed interaction between Hg and DOM in the presence of sulfide likely involves the formation of a DOM-Hg-sulfide complex or results from the hydrophobic partitioning of neutral Hg-sulfide complexes into the higher-molecular-weight DOM. An understanding of the mechanism of this interaction and determination of complexation coefficients for the Hg-sulfide-DOM complex are needed to adequately assess how our new finding affects Hg bioavailability, sorption, and flux.
Leder, Helmut
2017-01-01
Visual complexity is relevant for many areas ranging from improving usability of technical displays or websites up to understanding aesthetic experiences. Therefore, many attempts have been made to relate objective properties of images to perceived complexity in artworks and other images. It has been argued that visual complexity is a multidimensional construct mainly consisting of two dimensions: A quantitative dimension that increases complexity through number of elements, and a structural dimension representing order negatively related to complexity. The objective of this work is to study human perception of visual complexity utilizing two large independent sets of abstract patterns. A wide range of computational measures of complexity was calculated, further combined using linear models as well as machine learning (random forests), and compared with data from human evaluations. Our results confirm the adequacy of existing two-factor models of perceived visual complexity consisting of a quantitative and a structural factor (in our case mirror symmetry) for both of our stimulus sets. In addition, a non-linear transformation of mirror symmetry giving more influence to small deviations from symmetry greatly increased explained variance. Thus, we again demonstrate the multidimensional nature of human complexity perception and present comprehensive quantitative models of the visual complexity of abstract patterns, which might be useful for future experiments and applications. PMID:29099832
NASA Astrophysics Data System (ADS)
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.; Davis, J. A.
2018-01-01
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonite edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites ('spillover' effect). A series of U(VI) - Na-montmorillonite batch adsorption experiments was conducted as a function of pH, with variable U(VI), Ca, and dissolved carbonate concentrations. Based on the experimental data, a new type of surface complexation model (SCM) was developed for montmorillonite, that specifically accounts for the spillover effect using the edge surface speciation model by Tournassat et al. (2016a). The SCM allows for a prediction of U(VI) adsorption under varying chemical conditions with a minimum number of fitting parameters, not only for our own experimental results, but also for a number of published data sets. The model agreed well with many of these datasets without introducing a second site type or including the formation of ternary U(VI)-carbonato surface complexes. The model predictions were greatly impacted by utilizing analytical measurements of dissolved inorganic carbon (DIC) concentrations in individual sample solutions rather than assuming solution equilibration with a specific partial pressure of CO2, even when the gas phase was laboratory air. Because of strong aqueous U(VI)-carbonate solution complexes, the measurement of DIC concentrations was even important for systems set up in the 'absence' of CO2, due to low levels of CO2 contamination during the experiment.
NASA Astrophysics Data System (ADS)
Li, Shu-Bin; Cao, Dan-Ni; Dang, Wen-Xiu; Zhang, Lin
As a new cross-discipline, the complexity science has penetrated into every field of economy and society. With the arrival of big data, the research of the complexity science has reached its summit again. In recent years, it offers a new perspective for traffic control by using complex networks theory. The interaction course of various kinds of information in traffic system forms a huge complex system. A new mesoscopic traffic flow model is improved with variable speed limit (VSL), and the simulation process is designed, which is based on the complex networks theory combined with the proposed model. This paper studies effect of VSL on the dynamic traffic flow, and then analyzes the optimal control strategy of VSL in different network topologies. The conclusion of this research is meaningful to put forward some reasonable transportation plan and develop effective traffic management and control measures to help the department of traffic management.
The Skilled Counselor Training Model: Skills Acquisition, Self-Assessment, and Cognitive Complexity
ERIC Educational Resources Information Center
Little, Cassandra; Packman, Jill; Smaby, Marlowe H.; Maddux, Cleborne D.
2005-01-01
The authors evaluated the effectiveness of the Skilled Counselor Training Model (SCTM; M. H. Smaby, C. D. Maddux, E. Torres-Rivera, & R. Zimmick, 1999) in teaching counseling skills and in fostering counselor cognitive complexity. Counselor trainees who completed the SCTM had better counseling skills and higher levels of cognitive complexity than…
Classrooms as Complex Adaptive Systems: A Relational Model
ERIC Educational Resources Information Center
Burns, Anne; Knox, John S.
2011-01-01
In this article, we describe and model the language classroom as a complex adaptive system (see Logan & Schumann, 2005). We argue that linear, categorical descriptions of classroom processes and interactions do not sufficiently explain the complex nature of classrooms, and cannot account for how classroom change occurs (or does not occur), over…
Small-time Scale Network Traffic Prediction Based on Complex-valued Neural Network
NASA Astrophysics Data System (ADS)
Yang, Bin
2017-07-01
Accurate models play an important role in capturing the significant characteristics of the network traffic, analyzing the network dynamic, and improving the forecasting accuracy for system dynamics. In this study, complex-valued neural network (CVNN) model is proposed to further improve the accuracy of small-time scale network traffic forecasting. Artificial bee colony (ABC) algorithm is proposed to optimize the complex-valued and real-valued parameters of CVNN model. Small-scale traffic measurements data namely the TCP traffic data is used to test the performance of CVNN model. Experimental results reveal that CVNN model forecasts the small-time scale network traffic measurement data very accurately
ERIC Educational Resources Information Center
Dagne, Getachew A.; Brown, C. Hendricks; Howe, George W.
2007-01-01
This article presents new methods for modeling the strength of association between multiple behaviors in a behavioral sequence, particularly those involving substantively important interaction patterns. Modeling and identifying such interaction patterns becomes more complex when behaviors are assigned to more than two categories, as is the case…
Calibration of an Unsteady Groundwater Flow Model for a Complex, Strongly Heterogeneous Aquifer
NASA Astrophysics Data System (ADS)
Curtis, Z. K.; Liao, H.; Li, S. G.; Phanikumar, M. S.; Lusch, D.
2016-12-01
Modeling of groundwater systems characterized by complex three-dimensional structure and heterogeneity remains a significant challenge. Most of today's groundwater models are developed based on relatively simple conceptual representations in favor of model calibratibility. As more complexities are modeled, e.g., by adding more layers and/or zones, or introducing transient processes, more parameters have to be estimated and issues related to ill-posed groundwater problems and non-unique calibration arise. Here, we explore the use of an alternative conceptual representation for groundwater modeling that is fully three-dimensional and can capture complex 3D heterogeneity (both systematic and "random") without over-parameterizing the aquifer system. In particular, we apply Transition Probability (TP) geostatistics on high resolution borehole data from a water well database to characterize the complex 3D geology. Different aquifer material classes, e.g., `AQ' (aquifer material), `MAQ' (marginal aquifer material'), `PCM' (partially confining material), and `CM' (confining material), are simulated, with the hydraulic properties of each material type as tuning parameters during calibration. The TP-based approach is applied to simulate unsteady groundwater flow in a large, complex, and strongly heterogeneous glacial aquifer system in Michigan across multiple spatial and temporal scales. The resulting model is calibrated to observed static water level data over a time span of 50 years. The results show that the TP-based conceptualization enables much more accurate and robust calibration/simulation than that based on conventional deterministic layer/zone based conceptual representations.
Dynamic pathway modeling of signal transduction networks: a domain-oriented approach.
Conzelmann, Holger; Gilles, Ernst-Dieter
2008-01-01
Mathematical models of biological processes become more and more important in biology. The aim is a holistic understanding of how processes such as cellular communication, cell division, regulation, homeostasis, or adaptation work, how they are regulated, and how they react to perturbations. The great complexity of most of these processes necessitates the generation of mathematical models in order to address these questions. In this chapter we provide an introduction to basic principles of dynamic modeling and highlight both problems and chances of dynamic modeling in biology. The main focus will be on modeling of s transduction pathways, which requires the application of a special modeling approach. A common pattern, especially in eukaryotic signaling systems, is the formation of multi protein signaling complexes. Even for a small number of interacting proteins the number of distinguishable molecular species can be extremely high. This combinatorial complexity is due to the great number of distinct binding domains of many receptors and scaffold proteins involved in signal transduction. However, these problems can be overcome using a new domain-oriented modeling approach, which makes it possible to handle complex and branched signaling pathways.
A framework for modelling the complexities of food and water security under globalisation
NASA Astrophysics Data System (ADS)
Dermody, Brian J.; Sivapalan, Murugesu; Stehfest, Elke; van Vuuren, Detlef P.; Wassen, Martin J.; Bierkens, Marc F. P.; Dekker, Stefan C.
2018-01-01
We present a new framework for modelling the complexities of food and water security under globalisation. The framework sets out a method to capture regional and sectoral interdependencies and cross-scale feedbacks within the global food system that contribute to emergent water use patterns. The framework integrates aspects of existing models and approaches in the fields of hydrology and integrated assessment modelling. The core of the framework is a multi-agent network of city agents connected by infrastructural trade networks. Agents receive socio-economic and environmental constraint information from integrated assessment models and hydrological models respectively and simulate complex, socio-environmental dynamics that operate within those constraints. The emergent changes in food and water resources are aggregated and fed back to the original models with minimal modification of the structure of those models. It is our conviction that the framework presented can form the basis for a new wave of decision tools that capture complex socio-environmental change within our globalised world. In doing so they will contribute to illuminating pathways towards a sustainable future for humans, ecosystems and the water they share.
Complex versus simple models: ion-channel cardiac toxicity prediction.
Mistry, Hitesh B
2018-01-01
There is growing interest in applying detailed mathematical models of the heart for ion-channel related cardiac toxicity prediction. However, a debate as to whether such complex models are required exists. Here an assessment in the predictive performance between two established large-scale biophysical cardiac models and a simple linear model B net was conducted. Three ion-channel data-sets were extracted from literature. Each compound was designated a cardiac risk category using two different classification schemes based on information within CredibleMeds. The predictive performance of each model within each data-set for each classification scheme was assessed via a leave-one-out cross validation. Overall the B net model performed equally as well as the leading cardiac models in two of the data-sets and outperformed both cardiac models on the latest. These results highlight the importance of benchmarking complex versus simple models but also encourage the development of simple models.
On Convergence of Development Costs and Cost Models for Complex Spaceflight Instrument Electronics
NASA Technical Reports Server (NTRS)
Kizhner, Semion; Patel, Umeshkumar D.; Kasa, Robert L.; Hestnes, Phyllis; Brown, Tammy; Vootukuru, Madhavi
2008-01-01
Development costs of a few recent spaceflight instrument electrical and electronics subsystems have diverged from respective heritage cost model predictions. The cost models used are Grass Roots, Price-H and Parametric Model. These cost models originated in the military and industry around 1970 and were successfully adopted and patched by NASA on a mission-by-mission basis for years. However, the complexity of new instruments recently changed rapidly by orders of magnitude. This is most obvious in the complexity of representative spaceflight instrument electronics' data system. It is now required to perform intermediate processing of digitized data apart from conventional processing of science phenomenon signals from multiple detectors. This involves on-board instrument formatting of computational operands from row data for example, images), multi-million operations per second on large volumes of data in reconfigurable hardware (in addition to processing on a general purpose imbedded or standalone instrument flight computer), as well as making decisions for on-board system adaptation and resource reconfiguration. The instrument data system is now tasked to perform more functions, such as forming packets and instrument-level data compression of more than one data stream, which are traditionally performed by the spacecraft command and data handling system. It is furthermore required that the electronics box for new complex instruments is developed for one-digit watt power consumption, small size and that it is light-weight, and delivers super-computing capabilities. The conflict between the actual development cost of newer complex instruments and its electronics components' heritage cost model predictions seems to be irreconcilable. This conflict and an approach to its resolution are addressed in this paper by determining the complexity parameters, complexity index, and their use in enhanced cost model.
KRISSY: user's guide to modeling three-dimensional wind flow in complex terrain
Michael A. Fosberg; Michael L. Sestak
1986-01-01
KRISSY is a computer model for generating three-dimensional wind flows in complex terrain from data that were not or perhaps cannot be collected. The model is written in FORTRAN IV This guide describes data requirements, modeling, and output from an applications viewpoint rather than that of programming or theoretical modeling. KRISSY is designed to minimize...
Ranking streamflow model performance based on Information theory metrics
NASA Astrophysics Data System (ADS)
Martinez, Gonzalo; Pachepsky, Yakov; Pan, Feng; Wagener, Thorsten; Nicholson, Thomas
2016-04-01
The accuracy-based model performance metrics not necessarily reflect the qualitative correspondence between simulated and measured streamflow time series. The objective of this work was to use the information theory-based metrics to see whether they can be used as complementary tool for hydrologic model evaluation and selection. We simulated 10-year streamflow time series in five watersheds located in Texas, North Carolina, Mississippi, and West Virginia. Eight model of different complexity were applied. The information-theory based metrics were obtained after representing the time series as strings of symbols where different symbols corresponded to different quantiles of the probability distribution of streamflow. The symbol alphabet was used. Three metrics were computed for those strings - mean information gain that measures the randomness of the signal, effective measure complexity that characterizes predictability and fluctuation complexity that characterizes the presence of a pattern in the signal. The observed streamflow time series has smaller information content and larger complexity metrics than the precipitation time series. Watersheds served as information filters and and streamflow time series were less random and more complex than the ones of precipitation. This is reflected the fact that the watershed acts as the information filter in the hydrologic conversion process from precipitation to streamflow. The Nash Sutcliffe efficiency metric increased as the complexity of models increased, but in many cases several model had this efficiency values not statistically significant from each other. In such cases, ranking models by the closeness of the information-theory based parameters in simulated and measured streamflow time series can provide an additional criterion for the evaluation of hydrologic model performance.
Bhatla, Puneet; Tretter, Justin T; Ludomirsky, Achi; Argilla, Michael; Latson, Larry A; Chakravarti, Sujata; Barker, Piers C; Yoo, Shi-Joon; McElhinney, Doff B; Wake, Nicole; Mosca, Ralph S
2017-01-01
Rapid prototyping facilitates comprehension of complex cardiac anatomy. However, determining when this additional information proves instrumental in patient management remains a challenge. We describe our experience with patient-specific anatomic models created using rapid prototyping from various imaging modalities, suggesting their utility in surgical and interventional planning in congenital heart disease (CHD). Virtual and physical 3-dimensional (3D) models were generated from CT or MRI data, using commercially available software for patients with complex muscular ventricular septal defects (CMVSD) and double-outlet right ventricle (DORV). Six patients with complex anatomy and uncertainty of the optimal management strategy were included in this study. The models were subsequently used to guide management decisions, and the outcomes reviewed. 3D models clearly demonstrated the complex intra-cardiac anatomy in all six patients and were utilized to guide management decisions. In the three patients with CMVSD, one underwent successful endovascular device closure following a prior failed attempt at transcatheter closure, and the other two underwent successful primary surgical closure with the aid of 3D models. In all three cases of DORV, the models provided better anatomic delineation and additional information that altered or confirmed the surgical plan. Patient-specific 3D heart models show promise in accurately defining intra-cardiac anatomy in CHD, specifically CMVSD and DORV. We believe these models improve understanding of the complex anatomical spatial relationships in these defects and provide additional insight for pre/intra-interventional management and surgical planning.
2014-01-01
Background The Triatoma brasiliensis complex is a monophyletic group, comprising three species, one of which includes two subspecific taxa, distributed across 12 Brazilian states, in the caatinga and cerrado biomes. Members of the complex are diverse in terms of epidemiological importance, morphology, biology, ecology, and genetics. Triatoma b. brasiliensis is the most disease-relevant member of the complex in terms of epidemiology, extensive distribution, broad feeding preferences, broad ecological distribution, and high rates of infection with Trypanosoma cruzi; consequently, it is considered the principal vector of Chagas disease in northeastern Brazil. Methods We used ecological niche models to estimate potential distributions of all members of the complex, and evaluated the potential for suitable adjacent areas to be colonized; we also present first evaluations of potential for climate change-mediated distributional shifts. Models were developed using the GARP and Maxent algorithms. Results Models for three members of the complex (T. b. brasiliensis, N = 332; T. b. macromelasoma, N = 35; and T. juazeirensis, N = 78) had significant distributional predictivity; however, models for T. sherlocki and T. melanica, both with very small sample sizes (N = 7), did not yield predictions that performed better than random. Model projections onto future-climate scenarios indicated little broad-scale potential for change in the potential distribution of the complex through 2050. Conclusions This study suggests that T. b. brasiliensis is the member of the complex with the greatest distributional potential to colonize new areas: overall; however, the distribution of the complex appears relatively stable. These analyses offer key information to guide proactive monitoring and remediation activities to reduce risk of Chagas disease transmission. PMID:24886587
NASA Astrophysics Data System (ADS)
Le Maire, P.; Munschy, M.
2017-12-01
Interpretation of marine magnetic anomalies enable to perform accurate global kinematic models. Several methods have been proposed to compute the paleo-latitude of the oceanic crust as its formation. A model of the Earth's magnetic field is used to determine a relationship between the apparent inclination of the magnetization and the paleo-latitude. Usually, the estimation of the apparent inclination is qualitative, with the fit between magnetic data and forward models. We propose to apply a new method using complex algebra to obtain the apparent inclination of the magnetization of the oceanic crust. For two dimensional bodies, we rewrite Talwani's equations using complex algebra; the corresponding complex function of the complex variable, called CMA (complex magnetic anomaly) is easier to use for forward modelling and inversion of the magnetic data. This complex equation allows to visualize the data in the complex plane (Argand diagram) and offers a new way to interpret data (curves to the right of the figure (B), while the curves to the left represent the standard display of magnetic anomalies (A) for the model displayed (C) at the bottom of the figure). In the complex plane, the effect of the apparent inclination is to rotate the curves, while on the standard display the evolution of the shape of the anomaly is more complicated (figure). This innovative method gives the opportunity to study a set of magnetic profiles (provided by the Geological Survey of Norway) acquired in the Norwegian Sea, near the Jan Mayen fracture zone. In this area, the age of the oceanic crust ranges from 40 to 55 Ma and the apparent inclination of the magnetization is computed.
Derivative Free Optimization of Complex Systems with the Use of Statistical Machine Learning Models
2015-09-12
AFRL-AFOSR-VA-TR-2015-0278 DERIVATIVE FREE OPTIMIZATION OF COMPLEX SYSTEMS WITH THE USE OF STATISTICAL MACHINE LEARNING MODELS Katya Scheinberg...COMPLEX SYSTEMS WITH THE USE OF STATISTICAL MACHINE LEARNING MODELS 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA9550-11-1-0239 5c. PROGRAM ELEMENT...developed, which has been the focus of our research. 15. SUBJECT TERMS optimization, Derivative-Free Optimization, Statistical Machine Learning 16. SECURITY
Rivas, Elena; Lang, Raymond; Eddy, Sean R
2012-02-01
The standard approach for single-sequence RNA secondary structure prediction uses a nearest-neighbor thermodynamic model with several thousand experimentally determined energy parameters. An attractive alternative is to use statistical approaches with parameters estimated from growing databases of structural RNAs. Good results have been reported for discriminative statistical methods using complex nearest-neighbor models, including CONTRAfold, Simfold, and ContextFold. Little work has been reported on generative probabilistic models (stochastic context-free grammars [SCFGs]) of comparable complexity, although probabilistic models are generally easier to train and to use. To explore a range of probabilistic models of increasing complexity, and to directly compare probabilistic, thermodynamic, and discriminative approaches, we created TORNADO, a computational tool that can parse a wide spectrum of RNA grammar architectures (including the standard nearest-neighbor model and more) using a generalized super-grammar that can be parameterized with probabilities, energies, or arbitrary scores. By using TORNADO, we find that probabilistic nearest-neighbor models perform comparably to (but not significantly better than) discriminative methods. We find that complex statistical models are prone to overfitting RNA structure and that evaluations should use structurally nonhomologous training and test data sets. Overfitting has affected at least one published method (ContextFold). The most important barrier to improving statistical approaches for RNA secondary structure prediction is the lack of diversity of well-curated single-sequence RNA secondary structures in current RNA databases.
Rivas, Elena; Lang, Raymond; Eddy, Sean R.
2012-01-01
The standard approach for single-sequence RNA secondary structure prediction uses a nearest-neighbor thermodynamic model with several thousand experimentally determined energy parameters. An attractive alternative is to use statistical approaches with parameters estimated from growing databases of structural RNAs. Good results have been reported for discriminative statistical methods using complex nearest-neighbor models, including CONTRAfold, Simfold, and ContextFold. Little work has been reported on generative probabilistic models (stochastic context-free grammars [SCFGs]) of comparable complexity, although probabilistic models are generally easier to train and to use. To explore a range of probabilistic models of increasing complexity, and to directly compare probabilistic, thermodynamic, and discriminative approaches, we created TORNADO, a computational tool that can parse a wide spectrum of RNA grammar architectures (including the standard nearest-neighbor model and more) using a generalized super-grammar that can be parameterized with probabilities, energies, or arbitrary scores. By using TORNADO, we find that probabilistic nearest-neighbor models perform comparably to (but not significantly better than) discriminative methods. We find that complex statistical models are prone to overfitting RNA structure and that evaluations should use structurally nonhomologous training and test data sets. Overfitting has affected at least one published method (ContextFold). The most important barrier to improving statistical approaches for RNA secondary structure prediction is the lack of diversity of well-curated single-sequence RNA secondary structures in current RNA databases. PMID:22194308
Glavatskikh, Marta; Madzhidov, Timur; Solov'ev, Vitaly; Marcou, Gilles; Horvath, Dragos; Varnek, Alexandre
2016-12-01
In this work, we report QSPR modeling of the free energy ΔG of 1 : 1 hydrogen bond complexes of different H-bond acceptors and donors. The modeling was performed on a large and structurally diverse set of 3373 complexes featuring a single hydrogen bond, for which ΔG was measured at 298 K in CCl 4 . The models were prepared using Support Vector Machine and Multiple Linear Regression, with ISIDA fragment descriptors. The marked atoms strategy was applied at fragmentation stage, in order to capture the location of H-bond donor and acceptor centers. Different strategies of model validation have been suggested, including the targeted omission of individual H-bond acceptors and donors from the training set, in order to check whether the predictive ability of the model is not limited to the interpolation of H-bond strength between two already encountered partners. Successfully cross-validating individual models were combined into a consensus model, and challenged to predict external test sets of 629 and 12 complexes, in which donor and acceptor formed single and cooperative H-bonds, respectively. In all cases, SVM models outperform MLR. The SVM consensus model performs well both in 3-fold cross-validation (RMSE=1.50 kJ/mol), and on the external test sets containing complexes with single (RMSE=3.20 kJ/mol) and cooperative H-bonds (RMSE=1.63 kJ/mol). © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Kwiatkowski, L.; Yool, A.; Allen, J. I.; Anderson, T. R.; Barciela, R.; Buitenhuis, E. T.; Butenschön, M.; Enright, C.; Halloran, P. R.; Le Quéré, C.; de Mora, L.; Racault, M.-F.; Sinha, B.; Totterdell, I. J.; Cox, P. M.
2014-07-01
Ocean biogeochemistry (OBGC) models span a wide range of complexities from highly simplified, nutrient-restoring schemes, through nutrient-phytoplankton-zooplankton-detritus (NPZD) models that crudely represent the marine biota, through to models that represent a broader trophic structure by grouping organisms as plankton functional types (PFT) based on their biogeochemical role (Dynamic Green Ocean Models; DGOM) and ecosystem models which group organisms by ecological function and trait. OBGC models are now integral components of Earth System Models (ESMs), but they compete for computing resources with higher resolution dynamical setups and with other components such as atmospheric chemistry and terrestrial vegetation schemes. As such, the choice of OBGC in ESMs needs to balance model complexity and realism alongside relative computing cost. Here, we present an inter-comparison of six OBGC models that were candidates for implementation within the next UK Earth System Model (UKESM1). The models cover a large range of biological complexity (from 7 to 57 tracers) but all include representations of at least the nitrogen, carbon, alkalinity and oxygen cycles. Each OBGC model was coupled to the Nucleus for the European Modelling of the Ocean (NEMO) ocean general circulation model (GCM), and results from physically identical hindcast simulations were compared. Model skill was evaluated for biogeochemical metrics of global-scale bulk properties using conventional statistical techniques. The computing cost of each model was also measured in standardised tests run at two resource levels. No model is shown to consistently outperform or underperform all other models across all metrics. Nonetheless, the simpler models that are easier to tune are broadly closer to observations across a number of fields, and thus offer a high-efficiency option for ESMs that prioritise high resolution climate dynamics. However, simpler models provide limited insight into more complex marine biogeochemical processes and ecosystem pathways, and a parallel approach of low resolution climate dynamics and high complexity biogeochemistry is desirable in order to provide additional insights into biogeochemistry-climate interactions.
NASA Astrophysics Data System (ADS)
Kwiatkowski, L.; Yool, A.; Allen, J. I.; Anderson, T. R.; Barciela, R.; Buitenhuis, E. T.; Butenschön, M.; Enright, C.; Halloran, P. R.; Le Quéré, C.; de Mora, L.; Racault, M.-F.; Sinha, B.; Totterdell, I. J.; Cox, P. M.
2014-12-01
Ocean biogeochemistry (OBGC) models span a wide variety of complexities, including highly simplified nutrient-restoring schemes, nutrient-phytoplankton-zooplankton-detritus (NPZD) models that crudely represent the marine biota, models that represent a broader trophic structure by grouping organisms as plankton functional types (PFTs) based on their biogeochemical role (dynamic green ocean models) and ecosystem models that group organisms by ecological function and trait. OBGC models are now integral components of Earth system models (ESMs), but they compete for computing resources with higher resolution dynamical setups and with other components such as atmospheric chemistry and terrestrial vegetation schemes. As such, the choice of OBGC in ESMs needs to balance model complexity and realism alongside relative computing cost. Here we present an intercomparison of six OBGC models that were candidates for implementation within the next UK Earth system model (UKESM1). The models cover a large range of biological complexity (from 7 to 57 tracers) but all include representations of at least the nitrogen, carbon, alkalinity and oxygen cycles. Each OBGC model was coupled to the ocean general circulation model Nucleus for European Modelling of the Ocean (NEMO) and results from physically identical hindcast simulations were compared. Model skill was evaluated for biogeochemical metrics of global-scale bulk properties using conventional statistical techniques. The computing cost of each model was also measured in standardised tests run at two resource levels. No model is shown to consistently outperform all other models across all metrics. Nonetheless, the simpler models are broadly closer to observations across a number of fields and thus offer a high-efficiency option for ESMs that prioritise high-resolution climate dynamics. However, simpler models provide limited insight into more complex marine biogeochemical processes and ecosystem pathways, and a parallel approach of low-resolution climate dynamics and high-complexity biogeochemistry is desirable in order to provide additional insights into biogeochemistry-climate interactions.
NASA Astrophysics Data System (ADS)
Germer, S.; Bens, O.; Hüttl, R. F.
2008-12-01
The scepticism of non-scientific local stakeholders about results from complex physical based models is a major problem concerning the development and implementation of local climate change adaptation measures. This scepticism originates from the high complexity of such models. Local stakeholders perceive complex models as black-box models, as it is impossible to gasp all underlying assumptions and mathematically formulated processes at a glance. The use of physical based models is, however, indispensible to study complex underlying processes and to predict future environmental changes. The increase of climate change adaptation efforts following the release of the latest IPCC report indicates that the communication of facts about what has already changed is an appropriate tool to trigger climate change adaptation. Therefore we suggest increasing the practice of empirical data analysis in addition to modelling efforts. The analysis of time series can generate results that are easier to comprehend for non-scientific stakeholders. Temporal trends and seasonal patterns of selected hydrological parameters (precipitation, evapotranspiration, groundwater levels and river discharge) can be identified and the dependence of trends and seasonal patters to land use, topography and soil type can be highlighted. A discussion about lag times between the hydrological parameters can increase the awareness of local stakeholders for delayed environment responses.
Dense power-law networks and simplicial complexes
NASA Astrophysics Data System (ADS)
Courtney, Owen T.; Bianconi, Ginestra
2018-05-01
There is increasing evidence that dense networks occur in on-line social networks, recommendation networks and in the brain. In addition to being dense, these networks are often also scale-free, i.e., their degree distributions follow P (k ) ∝k-γ with γ ∈(1 ,2 ] . Models of growing networks have been successfully employed to produce scale-free networks using preferential attachment, however these models can only produce sparse networks as the numbers of links and nodes being added at each time step is constant. Here we present a modeling framework which produces networks that are both dense and scale-free. The mechanism by which the networks grow in this model is based on the Pitman-Yor process. Variations on the model are able to produce undirected scale-free networks with exponent γ =2 or directed networks with power-law out-degree distribution with tunable exponent γ ∈(1 ,2 ) . We also extend the model to that of directed two-dimensional simplicial complexes. Simplicial complexes are generalization of networks that can encode the many body interactions between the parts of a complex system and as such are becoming increasingly popular to characterize different data sets ranging from social interacting systems to the brain. Our model produces dense directed simplicial complexes with power-law distribution of the generalized out-degrees of the nodes.
Intelligent classifier for dynamic fault patterns based on hidden Markov model
NASA Astrophysics Data System (ADS)
Xu, Bo; Feng, Yuguang; Yu, Jinsong
2006-11-01
It's difficult to build precise mathematical models for complex engineering systems because of the complexity of the structure and dynamics characteristics. Intelligent fault diagnosis introduces artificial intelligence and works in a different way without building the analytical mathematical model of a diagnostic object, so it's a practical approach to solve diagnostic problems of complex systems. This paper presents an intelligent fault diagnosis method, an integrated fault-pattern classifier based on Hidden Markov Model (HMM). This classifier consists of dynamic time warping (DTW) algorithm, self-organizing feature mapping (SOFM) network and Hidden Markov Model. First, after dynamic observation vector in measuring space is processed by DTW, the error vector including the fault feature of being tested system is obtained. Then a SOFM network is used as a feature extractor and vector quantization processor. Finally, fault diagnosis is realized by fault patterns classifying with the Hidden Markov Model classifier. The importing of dynamic time warping solves the problem of feature extracting from dynamic process vectors of complex system such as aeroengine, and makes it come true to diagnose complex system by utilizing dynamic process information. Simulating experiments show that the diagnosis model is easy to extend, and the fault pattern classifier is efficient and is convenient to the detecting and diagnosing of new faults.
NASA Astrophysics Data System (ADS)
Yasami, Yasser; Safaei, Farshad
2018-02-01
The traditional complex network theory is particularly focused on network models in which all network constituents are dealt with equivalently, while fail to consider the supplementary information related to the dynamic properties of the network interactions. This is a main constraint leading to incorrect descriptions of some real-world phenomena or incomplete capturing the details of certain real-life problems. To cope with the problem, this paper addresses the multilayer aspects of dynamic complex networks by analyzing the properties of intrinsically multilayered co-authorship networks, DBLP and Astro Physics, and presenting a novel multilayer model of dynamic complex networks. The model examines the layers evolution (layers birth/death process and lifetime) throughout the network evolution. Particularly, this paper models the evolution of each node's membership in different layers by an Infinite Factorial Hidden Markov Model considering feature cascade, and thereby formulates the link generation process for intra-layer and inter-layer links. Although adjacency matrixes are useful to describe the traditional single-layer networks, such a representation is not sufficient to describe and analyze the multilayer dynamic networks. This paper also extends a generalized mathematical infrastructure to address the problems issued by multilayer complex networks. The model inference is performed using some Markov Chain Monte Carlo sampling strategies, given synthetic and real complex networks data. Experimental results indicate a tremendous improvement in the performance of the proposed multilayer model in terms of sensitivity, specificity, positive and negative predictive values, positive and negative likelihood ratios, F1-score, Matthews correlation coefficient, and accuracy for two important applications of missing link prediction and future link forecasting. The experimental results also indicate the strong predictivepower of the proposed model for the application of cascade prediction in terms of accuracy.
Formalizing the Role of Agent-Based Modeling in Causal Inference and Epidemiology
Marshall, Brandon D. L.; Galea, Sandro
2015-01-01
Calls for the adoption of complex systems approaches, including agent-based modeling, in the field of epidemiology have largely centered on the potential for such methods to examine complex disease etiologies, which are characterized by feedback behavior, interference, threshold dynamics, and multiple interacting causal effects. However, considerable theoretical and practical issues impede the capacity of agent-based methods to examine and evaluate causal effects and thus illuminate new areas for intervention. We build on this work by describing how agent-based models can be used to simulate counterfactual outcomes in the presence of complexity. We show that these models are of particular utility when the hypothesized causal mechanisms exhibit a high degree of interdependence between multiple causal effects and when interference (i.e., one person's exposure affects the outcome of others) is present and of intrinsic scientific interest. Although not without challenges, agent-based modeling (and complex systems methods broadly) represent a promising novel approach to identify and evaluate complex causal effects, and they are thus well suited to complement other modern epidemiologic methods of etiologic inquiry. PMID:25480821
Evolving Scale-Free Networks by Poisson Process: Modeling and Degree Distribution.
Feng, Minyu; Qu, Hong; Yi, Zhang; Xie, Xiurui; Kurths, Jurgen
2016-05-01
Since the great mathematician Leonhard Euler initiated the study of graph theory, the network has been one of the most significant research subject in multidisciplinary. In recent years, the proposition of the small-world and scale-free properties of complex networks in statistical physics made the network science intriguing again for many researchers. One of the challenges of the network science is to propose rational models for complex networks. In this paper, in order to reveal the influence of the vertex generating mechanism of complex networks, we propose three novel models based on the homogeneous Poisson, nonhomogeneous Poisson and birth death process, respectively, which can be regarded as typical scale-free networks and utilized to simulate practical networks. The degree distribution and exponent are analyzed and explained in mathematics by different approaches. In the simulation, we display the modeling process, the degree distribution of empirical data by statistical methods, and reliability of proposed networks, results show our models follow the features of typical complex networks. Finally, some future challenges for complex systems are discussed.
Castellazzi, Giovanni; D'Altri, Antonio Maria; Bitelli, Gabriele; Selvaggi, Ilenia; Lambertini, Alessandro
2015-07-28
In this paper, a new semi-automatic procedure to transform three-dimensional point clouds of complex objects to three-dimensional finite element models is presented and validated. The procedure conceives of the point cloud as a stacking of point sections. The complexity of the clouds is arbitrary, since the procedure is designed for terrestrial laser scanner surveys applied to buildings with irregular geometry, such as historical buildings. The procedure aims at solving the problems connected to the generation of finite element models of these complex structures by constructing a fine discretized geometry with a reduced amount of time and ready to be used with structural analysis. If the starting clouds represent the inner and outer surfaces of the structure, the resulting finite element model will accurately capture the whole three-dimensional structure, producing a complex solid made by voxel elements. A comparison analysis with a CAD-based model is carried out on a historical building damaged by a seismic event. The results indicate that the proposed procedure is effective and obtains comparable models in a shorter time, with an increased level of automation.
Molecular architecture of the yeast Mediator complex
Robinson, Philip J; Trnka, Michael J; Pellarin, Riccardo; Greenberg, Charles H; Bushnell, David A; Davis, Ralph; Burlingame, Alma L; Sali, Andrej; Kornberg, Roger D
2015-01-01
The 21-subunit Mediator complex transduces regulatory information from enhancers to promoters, and performs an essential role in the initiation of transcription in all eukaryotes. Structural information on two-thirds of the complex has been limited to coarse subunit mapping onto 2-D images from electron micrographs. We have performed chemical cross-linking and mass spectrometry, and combined the results with information from X-ray crystallography, homology modeling, and cryo-electron microscopy by an integrative modeling approach to determine a 3-D model of the entire Mediator complex. The approach is validated by the use of X-ray crystal structures as internal controls and by consistency with previous results from electron microscopy and yeast two-hybrid screens. The model shows the locations and orientations of all Mediator subunits, as well as subunit interfaces and some secondary structural elements. Segments of 20–40 amino acid residues are placed with an average precision of 20 Å. The model reveals roles of individual subunits in the organization of the complex. DOI: http://dx.doi.org/10.7554/eLife.08719.001 PMID:26402457
Surface complexation modeling of americium sorption onto volcanic tuff.
Ding, M; Kelkar, S; Meijer, A
2014-10-01
Results of a surface complexation model (SCM) for americium sorption on volcanic rocks (devitrified and zeolitic tuff) are presented. The model was developed using PHREEQC and based on laboratory data for americium sorption on quartz. Available data for sorption of americium on quartz as a function of pH in dilute groundwater can be modeled with two surface reactions involving an americium sulfate and an americium carbonate complex. It was assumed in applying the model to volcanic rocks from Yucca Mountain, that the surface properties of volcanic rocks can be represented by a quartz surface. Using groundwaters compositionally representative of Yucca Mountain, americium sorption distribution coefficient (Kd, L/Kg) values were calculated as function of pH. These Kd values are close to the experimentally determined Kd values for americium sorption on volcanic rocks, decreasing with increasing pH in the pH range from 7 to 9. The surface complexation constants, derived in this study, allow prediction of sorption of americium in a natural complex system, taking into account the inherent uncertainty associated with geochemical conditions that occur along transport pathways. Published by Elsevier Ltd.
Najafpour, Mohammad Mahdi
2011-01-01
The oxygen evolving complex in photosystem II which induces the oxidation of water to dioxygen in plants, algae and certain bacteria contains a cluster of one calcium and four manganese ions. It serves as a model to split water by sunlight. Reports on the mechanism and structure of photosystem II provide a more detailed architecture of the oxygen evolving complex and the surrounding amino acids. One challenge in this field is the development of artificial model compounds to study oxygen evolution reaction outside the complicated environment of the enzyme. Calcium-manganese oxides as structural and functional models for the active site of photosystem II are explained and reviewed in this paper. Because of related structures of these calcium-manganese oxides and the catalytic centers of active site of the oxygen evolving complex of photosystem II, the study may help to understand more about mechanism of oxygen evolution by the oxygen evolving complex of photosystem II. Copyright © 2010 Elsevier B.V. All rights reserved.
Reliability analysis in interdependent smart grid systems
NASA Astrophysics Data System (ADS)
Peng, Hao; Kan, Zhe; Zhao, Dandan; Han, Jianmin; Lu, Jianfeng; Hu, Zhaolong
2018-06-01
Complex network theory is a useful way to study many real complex systems. In this paper, a reliability analysis model based on complex network theory is introduced in interdependent smart grid systems. In this paper, we focus on understanding the structure of smart grid systems and studying the underlying network model, their interactions, and relationships and how cascading failures occur in the interdependent smart grid systems. We propose a practical model for interdependent smart grid systems using complex theory. Besides, based on percolation theory, we also study the effect of cascading failures effect and reveal detailed mathematical analysis of failure propagation in such systems. We analyze the reliability of our proposed model caused by random attacks or failures by calculating the size of giant functioning components in interdependent smart grid systems. Our simulation results also show that there exists a threshold for the proportion of faulty nodes, beyond which the smart grid systems collapse. Also we determine the critical values for different system parameters. In this way, the reliability analysis model based on complex network theory can be effectively utilized for anti-attack and protection purposes in interdependent smart grid systems.
Wang, Zimeng; Lee, Sung-Woo; Catalano, Jeffrey G; Lezama-Pacheco, Juan S; Bargar, John R; Tebo, Bradley M; Giammar, Daniel E
2013-01-15
The mobility of hexavalent uranium in soil and groundwater is strongly governed by adsorption to mineral surfaces. As strong naturally occurring adsorbents, manganese oxides may significantly influence the fate and transport of uranium. Models for U(VI) adsorption over a broad range of chemical conditions can improve predictive capabilities for uranium transport in the subsurface. This study integrated batch experiments of U(VI) adsorption to synthetic and biogenic MnO(2), surface complexation modeling, ζ-potential analysis, and molecular-scale characterization of adsorbed U(VI) with extended X-ray absorption fine structure (EXAFS) spectroscopy. The surface complexation model included inner-sphere monodentate and bidentate surface complexes and a ternary uranyl-carbonato surface complex, which was consistent with the EXAFS analysis. The model could successfully simulate adsorption results over a broad range of pH and dissolved inorganic carbon concentrations. U(VI) adsorption to synthetic δ-MnO(2) appears to be stronger than to biogenic MnO(2), and the differences in adsorption affinity and capacity are not associated with any substantial difference in U(VI) coordination.
Comparison of new generation low-complexity flood inundation mapping tools with a hydrodynamic model
NASA Astrophysics Data System (ADS)
Afshari, Shahab; Tavakoly, Ahmad A.; Rajib, Mohammad Adnan; Zheng, Xing; Follum, Michael L.; Omranian, Ehsan; Fekete, Balázs M.
2018-01-01
The objective of this study is to compare two new generation low-complexity tools, AutoRoute and Height Above the Nearest Drainage (HAND), with a two-dimensional hydrodynamic model (Hydrologic Engineering Center-River Analysis System, HEC-RAS 2D). The assessment was conducted on two hydrologically different and geographically distant test-cases in the United States, including the 16,900 km2 Cedar River (CR) watershed in Iowa and a 62 km2 domain along the Black Warrior River (BWR) in Alabama. For BWR, twelve different configurations were set up for each of the models, including four different terrain setups (e.g. with and without channel bathymetry and a levee), and three flooding conditions representing moderate to extreme hazards at 10-, 100-, and 500-year return periods. For the CR watershed, models were compared with a simplistic terrain setup (without bathymetry and any form of hydraulic controls) and one flooding condition (100-year return period). Input streamflow forcing data representing these hypothetical events were constructed by applying a new fusion approach on National Water Model outputs. Simulated inundation extent and depth from AutoRoute, HAND, and HEC-RAS 2D were compared with one another and with the corresponding FEMA reference estimates. Irrespective of the configurations, the low-complexity models were able to produce inundation extents similar to HEC-RAS 2D, with AutoRoute showing slightly higher accuracy than the HAND model. Among four terrain setups, the one including both levee and channel bathymetry showed lowest fitness score on the spatial agreement of inundation extent, due to the weak physical representation of low-complexity models compared to a hydrodynamic model. For inundation depth, the low-complexity models showed an overestimating tendency, especially in the deeper segments of the channel. Based on such reasonably good prediction skills, low-complexity flood models can be considered as a suitable alternative for fast predictions in large-scale hyper-resolution operational frameworks, without completely overriding hydrodynamic models' efficacy.
NASA Technical Reports Server (NTRS)
Kavi, K. M.
1984-01-01
There have been a number of simulation packages developed for the purpose of designing, testing and validating computer systems, digital systems and software systems. Complex analytical tools based on Markov and semi-Markov processes have been designed to estimate the reliability and performance of simulated systems. Petri nets have received wide acceptance for modeling complex and highly parallel computers. In this research data flow models for computer systems are investigated. Data flow models can be used to simulate both software and hardware in a uniform manner. Data flow simulation techniques provide the computer systems designer with a CAD environment which enables highly parallel complex systems to be defined, evaluated at all levels and finally implemented in either hardware or software. Inherent in data flow concept is the hierarchical handling of complex systems. In this paper we will describe how data flow can be used to model computer system.
Lim, Hooi Been; Baumann, Dirk; Li, Er-Ping
2011-03-01
Wireless body area network (WBAN) is a new enabling system with promising applications in areas such as remote health monitoring and interpersonal communication. Reliable and optimum design of a WBAN system relies on a good understanding and in-depth studies of the wave propagation around a human body. However, the human body is a very complex structure and is computationally demanding to model. This paper aims to investigate the effects of the numerical model's structure complexity and feature details on the simulation results. Depending on the application, a simplified numerical model that meets desired simulation accuracy can be employed for efficient simulations. Measurements of ultra wideband (UWB) signal propagation along a human arm are performed and compared to the simulation results obtained with numerical arm models of different complexity levels. The influence of the arm shape and size, as well as tissue composition and complexity is investigated.
Modeling Complex Cross-Systems Software Interfaces Using SysML
NASA Technical Reports Server (NTRS)
Mandutianu, Sanda; Morillo, Ron; Simpson, Kim; Liepack, Otfrid; Bonanne, Kevin
2013-01-01
The complex flight and ground systems for NASA human space exploration are designed, built, operated and managed as separate programs and projects. However, each system relies on one or more of the other systems in order to accomplish specific mission objectives, creating a complex, tightly coupled architecture. Thus, there is a fundamental need to understand how each system interacts with the other. To determine if a model-based system engineering approach could be utilized to assist with understanding the complex system interactions, the NASA Engineering and Safety Center (NESC) sponsored a task to develop an approach for performing cross-system behavior modeling. This paper presents the results of applying Model Based Systems Engineering (MBSE) principles using the System Modeling Language (SysML) to define cross-system behaviors and how they map to crosssystem software interfaces documented in system-level Interface Control Documents (ICDs).
Some Observations on the Current Status of Performing Finite Element Analyses
NASA Technical Reports Server (NTRS)
Raju, Ivatury S.; Knight, Norman F., Jr; Shivakumar, Kunigal N.
2015-01-01
Aerospace structures are complex high-performance structures. Advances in reliable and efficient computing and modeling tools are enabling analysts to consider complex configurations, build complex finite element models, and perform analysis rapidly. Many of the early career engineers of today are very proficient in the usage of modern computers, computing engines, complex software systems, and visualization tools. These young engineers are becoming increasingly efficient in building complex 3D models of complicated aerospace components. However, the current trends demonstrate blind acceptance of the results of the finite element analysis results. This paper is aimed at raising an awareness of this situation. Examples of the common encounters are presented. To overcome the current trends, some guidelines and suggestions for analysts, senior engineers, and educators are offered.
Lewis, Brian A
2010-01-15
The regulation of transcription and of many other cellular processes involves large multi-subunit protein complexes. In the context of transcription, it is known that these complexes serve as regulatory platforms that connect activator DNA-binding proteins to a target promoter. However, there is still a lack of understanding regarding the function of these complexes. Why do multi-subunit complexes exist? What is the molecular basis of the function of their constituent subunits, and how are these subunits organized within a complex? What is the reason for physical connections between certain subunits and not others? In this article, I address these issues through a model of network allostery and its application to the eukaryotic RNA polymerase II Mediator transcription complex. The multiple allosteric networks model (MANM) suggests that protein complexes such as Mediator exist not only as physical but also as functional networks of interconnected proteins through which information is transferred from subunit to subunit by the propagation of an allosteric state known as conformational spread. Additionally, there are multiple distinct sub-networks within the Mediator complex that can be defined by their connections to different subunits; these sub-networks have discrete functions that are activated when specific subunits interact with other activator proteins.
NASA Astrophysics Data System (ADS)
Chandra, Sulekh; Gautam, Seema; Rajor, Hament Kumar; Bhatia, Rohit
2015-02-01
Novel Schiff's base ligand, benzil bis(5-amino-1,3,4-thiadiazole-2-thiol) was synthesized by the condensation of benzil and 5-amino-1,3,4-thiadiazole-2-thiol in 1:2 ratio. The structure of ligand was determined on the basis of elemental analyses, IR, 1H NMR, mass, and molecular modeling studies. Synthesized ligand behaved as tetradentate and coordinated to metal ion through sulfur atoms of thiol ring and nitrogen atoms of imine group. Ni(II), and Cu(II) complexes were synthesized with this nitrogen-sulfur donor (N2S2) ligand. Metal complexes were characterized by elemental analyses, molar conductance, magnetic susceptibility measurements, IR, electronic spectra, EPR, thermal, and molecular modeling studies. All the complexes showed molar conductance corresponding to non-electrolytic nature, expect [Ni(L)](NO3)2 complex, which was 1:2 electrolyte in nature. [Cu(L)(SO4)] complex may possessed square pyramidal geometry, [Ni(L)](NO3)2 complex tetrahedral and rest of the complexes six coordinated octahedral/tetragonal geometry. Newly synthesized ligand and its metal complexes were examined against the opportunistic pathogens. Results suggested that metal complexes were more biological sensitive than free ligand.
NASA Astrophysics Data System (ADS)
Kirillova, Ariadna; Prytkova, Oksana O.
2018-03-01
The article is devoted to the features of the formation of the organizational and economic model of the construction of a socio-commercial multifunctional complex for high-rise construction. Authors have given examples of high-altitude multifunctional complexes in Moscow, analyzed the advantages and disadvantages in the implementation of multifunctional complexes, stressed the need for a holistic strategic approach, allowing to take into account the prospects for the development of the city and the creation of a comfortable living environment. Based on the analysis of multifunctional complexes features, a matrix of SWOT analysis was compiled. For the development of cities and improving the quality of life of the population, it is proposed to implement a new type of multifunctional complexes of a joint social and commercial direction, including, along with the implementation of office areas - schools, polyclinics, various sports facilities and cultural and leisure centers (theatrical, dance, studio, etc.). The approach proposed in the article for developing the model is based on a comparative evaluation of the multifunctional complex project of a social and commercial direction implemented at the expense of public-private partnership in the form of a concession agreement and a commercial multifunctional complex being built at the expense of the investor. It has been proved by calculations that the obtained indicators satisfy the conditions of expediency of the proposed organizational-economic model and the project of the social and commercial multifunctional complex is effective.
Darabi Sahneh, Faryad; Scoglio, Caterina; Riviere, Jim
2013-01-01
Nanoparticle-protein corona complex formation involves absorption of protein molecules onto nanoparticle surfaces in a physiological environment. Understanding the corona formation process is crucial in predicting nanoparticle behavior in biological systems, including applications of nanotoxicology and development of nano drug delivery platforms. This paper extends the modeling work in to derive a mathematical model describing the dynamics of nanoparticle corona complex formation from population balance equations. We apply nonlinear dynamics techniques to derive analytical results for the composition of nanoparticle-protein corona complex, and validate our results through numerical simulations. The model presented in this paper exhibits two phases of corona complex dynamics. In the first phase, proteins rapidly bind to the free surface of nanoparticles, leading to a metastable composition. During the second phase, continuous association and dissociation of protein molecules with nanoparticles slowly changes the composition of the corona complex. Given sufficient time, composition of the corona complex reaches an equilibrium state of stable composition. We find analytical approximate formulae for metastable and stable compositions of corona complex. Our formulae are very well-structured to clearly identify important parameters determining corona composition. The dynamics of biocorona formation constitute vital aspect of interactions between nanoparticles and living organisms. Our results further understanding of these dynamics through quantitation of experimental conditions, modeling results for in vitro systems to better predict behavior for in vivo systems. One potential application would involve a single cell culture medium related to a complex protein medium, such as blood or tissue fluid.
NASA Astrophysics Data System (ADS)
Ridley, Moira K.; Hiemstra, Tjisse; van Riemsdijk, Willem H.; Machesky, Michael L.
2009-04-01
Acid-base reactivity and ion-interaction between mineral surfaces and aqueous solutions is most frequently investigated at the macroscopic scale as a function of pH. Experimental data are then rationalized by a variety of surface complexation models. These models are thermodynamically based which in principle does not require a molecular picture. The models are typically calibrated to relatively simple solid-electrolyte solution pairs and may provide poor descriptions of complex multi-component mineral-aqueous solutions, including those found in natural environments. Surface complexation models may be improved by incorporating molecular-scale surface structural information to constrain the modeling efforts. Here, we apply a concise, molecularly-constrained surface complexation model to a diverse suite of surface titration data for rutile and thereby begin to address the complexity of multi-component systems. Primary surface charging curves in NaCl, KCl, and RbCl electrolyte media were fit simultaneously using a charge distribution (CD) and multisite complexation (MUSIC) model [Hiemstra T. and Van Riemsdijk W. H. (1996) A surface structural approach to ion adsorption: the charge distribution (CD) model. J. Colloid Interf. Sci. 179, 488-508], coupled with a Basic Stern layer description of the electric double layer. In addition, data for the specific interaction of Ca 2+ and Sr 2+ with rutile, in NaCl and RbCl media, were modeled. In recent developments, spectroscopy, quantum calculations, and molecular simulations have shown that electrolyte and divalent cations are principally adsorbed in various inner-sphere configurations on the rutile 1 1 0 surface [Zhang Z., Fenter P., Cheng L., Sturchio N. C., Bedzyk M. J., Předota M., Bandura A., Kubicki J., Lvov S. N., Cummings P. T., Chialvo A. A., Ridley M. K., Bénézeth P., Anovitz L., Palmer D. A., Machesky M. L. and Wesolowski D. J. (2004) Ion adsorption at the rutile-water interface: linking molecular and macroscopic properties. Langmuir20, 4954-4969]. Our CD modeling results are consistent with these adsorbed configurations provided adsorbed cation charge is allowed to be distributed between the surface (0-plane) and Stern plane (1-plane). Additionally, a complete description of our titration data required inclusion of outer-sphere binding, principally for Cl - which was common to all solutions, but also for Rb + and K +. These outer-sphere species were treated as point charges positioned at the Stern layer, and hence determined the Stern layer capacitance value. The modeling results demonstrate that a multi-component suite of experimental data can be successfully rationalized within a CD and MUSIC model using a Stern-based description of the EDL. Furthermore, the fitted CD values of the various inner-sphere complexes of the mono- and divalent ions can be linked to the microscopic structure of the surface complexes and other data found by spectroscopy as well as molecular dynamics (MD). For the Na + ion, the fitted CD value points to the presence of bidenate inner-sphere complexation as suggested by a recent MD study. Moreover, its MD dominance quantitatively agrees with the CD model prediction. For Rb +, the presence of a tetradentate complex, as found by spectroscopy, agreed well with the fitted CD and its predicted presence was quantitatively in very good agreement with the amount found by spectroscopy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ridley, Mora K.; Hiemstra, T; Van Riemsdijk, Willem H.
Acid base reactivity and ion-interaction between mineral surfaces and aqueous solutions is most frequently investigated at the macroscopic scale as a function of pH. Experimental data are then rationalized by a variety of surface complexation models. These models are thermodynamically based which in principle does not require a molecular picture. The models are typically calibrated to relatively simple solid-electrolyte solution pairs and may provide poor descriptions of complex multicomponent mineral aqueous solutions, including those found in natural environments. Surface complexation models may be improved by incorporating molecular-scale surface structural information to constrain the modeling efforts. Here, we apply a concise,more » molecularly-constrained surface complexation model to a diverse suite of surface titration data for rutile and thereby begin to address the complexity of multi-component systems. Primary surface charging curves in NaCl, KCl, and RbCl electrolyte media were fit simultaneously using a charge distribution (CD) and multisite complexation (MUSIC) model [Hiemstra T. and Van Riemsdijk W. H. (1996) A surface structural approach to ion adsorption: the charge distribution (CD) model. J. Colloid Interf. Sci. 179, 488 508], coupled with a Basic Stern layer description of the electric double layer. In addition, data for the specific interaction of Ca2+ and Sr2+ with rutile, in NaCl and RbCl media, were modeled. In recent developments, spectroscopy, quantum calculations, and molecular simulations have shown that electrolyte and divalent cations are principally adsorbed in various inner-sphere configurations on the rutile 110 surface [Zhang Z., Fenter P., Cheng L., Sturchio N. C., Bedzyk M. J., Pr edota M., Bandura A., Kubicki J., Lvov S. N., Cummings P. T., Chialvo A. A., Ridley M. K., Be ne zeth P., Anovitz L., Palmer D. A., Machesky M. L. and Wesolowski D. J. (2004) Ion adsorption at the rutile water interface: linking molecular and macroscopic properties. Langmuir 20, 4954 4969]. Our CD modeling results are consistent with these adsorbed configurations provided adsorbed cation charge is allowed to be distributed between the surface (0-plane) and Stern plane (1-plane). Additionally, a complete description of our titration data required inclusion of outer-sphere binding, principally for Cl which was common to all solutions, but also for Rb+ and K+. These outer-sphere species were treated as point charges positioned at the Stern layer, and hence determined the Stern layer capacitance value. The modeling results demonstrate that a multi-component suite of experimental data can be successfully rationalized within a CD and MUSIC model using a Stern-based description of the EDL. Furthermore, the fitted CD values of the various inner-sphere complexes of the mono- and divalent ions can be linked to the microscopic structure of the surface complexes and other data found by spectroscopy as well as molecular dynamics (MD). For the Na+ ion, the fitted CD value points to the presence of bidenate inner-sphere complexation as suggested by a recent MD study. Moreover, its MD dominance quantitatively agrees with the CD model prediction. For Rb+, the presence of a tetradentate complex, as found by spectroscopy, agreed well with the fitted CD and its predicted presence was quantitatively in very good agreement with the amount found by spectroscopy.« less
A probabilistic process model for pelagic marine ecosystems informed by Bayesian inverse analysis
Marine ecosystems are complex systems with multiple pathways that produce feedback cycles, which may lead to unanticipated effects. Models abstract this complexity and allow us to predict, understand, and hypothesize. In ecological models, however, the paucity of empirical data...
NASA Astrophysics Data System (ADS)
Carlsohn, Elisabet; Ångström, Jonas; Emmett, Mark R.; Marshall, Alan G.; Nilsson, Carol L.
2004-05-01
Chemical cross-linking of proteins is a well-established method for structural mapping of small protein complexes. When combined with mass spectrometry, cross-linking can reveal protein topology and identify contact sites between the peptide surfaces. When applied to surface-exposed proteins from pathogenic organisms, the method can reveal structural details that are useful in vaccine design. In order to investigate the possibilities of applying cross-linking on larger protein complexes, we selected the urease enzyme from Helicobacter pylori as a model. This membrane-associated protein complex consists of two subunits: [alpha] (26.5 kDa) and [beta] (61.7 kDa). Three ([alpha][beta]) heterodimers form a trimeric ([alpha][beta])3 assembly which further associates into a unique dodecameric 1.1 MDa complex composed of four ([alpha][beta])3 units. Cross-linked peptides from trypsin-digested urease complex were analyzed by Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) and molecular modeling. Two potential cross-linked peptides (present in the cross-linked sample but undetectable in [alpha], [beta], and native complex) were assigned. Molecular modeling of urease [alpha][beta] complex and trimeric urease units ([alpha][beta])3 revealed a linkage site between the [alpha]-subunit and the [beta]-subunit, and an internal cross-linkage in the [beta]-subunit.
Ceruloplasmin: Macromolecular Assemblies with Iron-Containing Acute Phase Proteins
Samygina, Valeriya R.; Sokolov, Alexey V.; Bourenkov, Gleb; Petoukhov, Maxim V.; Pulina, Maria O.; Zakharova, Elena T.; Vasilyev, Vadim B.; Bartunik, Hans; Svergun, Dmitri I.
2013-01-01
Copper-containing ferroxidase ceruloplasmin (Cp) forms binary and ternary complexes with cationic proteins lactoferrin (Lf) and myeloperoxidase (Mpo) during inflammation. We present an X-ray crystal structure of a 2Cp-Mpo complex at 4.7 Å resolution. This structure allows one to identify major protein–protein interaction areas and provides an explanation for a competitive inhibition of Mpo by Cp and for the activation of p-phenylenediamine oxidation by Mpo. Small angle X-ray scattering was employed to construct low-resolution models of the Cp-Lf complex and, for the first time, of the ternary 2Cp-2Lf-Mpo complex in solution. The SAXS-based model of Cp-Lf supports the predicted 1∶1 stoichiometry of the complex and demonstrates that both lobes of Lf contact domains 1 and 6 of Cp. The 2Cp-2Lf-Mpo SAXS model reveals the absence of interaction between Mpo and Lf in the ternary complex, so Cp can serve as a mediator of protein interactions in complex architecture. Mpo protects antioxidant properties of Cp by isolating its sensitive loop from proteases. The latter is important for incorporation of Fe3+ into Lf, which activates ferroxidase activity of Cp and precludes oxidation of Cp substrates. Our models provide the structural basis for possible regulatory role of these complexes in preventing iron-induced oxidative damage. PMID:23843990
Uranium(VI) adsorption to ferrihydrite: Application of a surface complexation model
Waite, T.D.; Davis, J.A.; Payne, T.E.; Waychunas, G.A.; Xu, N.
1994-01-01
A study of U(VI) adsorption by ferrihydrite was conducted over a wide range of U(VI) concentrations, pH, and at two partial pressures of carbon dioxide. A two-site (strong- and weak-affinity sites, FesOH and FewOH, respectively) surface complexation model was able to describe the experimental data well over a wide range of conditions, with only one species formed with each site type: an inner-sphere, mononuclear, bidentate complex of the type (FeO2)UO2. The existence of such a surface species was supported by results of uranium EXAFS spectroscopy performed on two samples with U(VI) adsorption density in the upper range observed in this study (10 and 18% occupancy of total surface sites). Adsorption data in the alkaline pH range suggested the existence of a second surface species, modeled as a ternary surface complex with UO2CO30 binding to a bidentate surface site. Previous surface complexation models for U(VI) adsorption have proposed surface species that are identical to the predominant aqueous species, e.g., multinuclear hydrolysis complexes or several U(VI)-carbonate complexes. The results demonstrate that the speciation of adsorbed U(VI) may be constrained by the coordination environment at the surface, giving rise to surface speciation for U(VI) that is significantly less complex than aqueous speciation.
Kiley, Erin M; Yakovlev, Vadim V; Ishizaki, Kotaro; Vaucher, Sebastien
2012-01-01
Microwave thermal processing of metal powders has recently been a topic of a substantial interest; however, experimental data on the physical properties of mixtures involving metal particles are often unavailable. In this paper, we perform a systematic analysis of classical and contemporary models of complex permittivity of mixtures and discuss the use of these models for determining effective permittivity of dielectric matrices with metal inclusions. Results from various mixture and core-shell mixture models are compared to experimental data for a titanium/stearic acid mixture and a boron nitride/graphite mixture (both obtained through the original measurements), and for a tungsten/Teflon mixture (from literature). We find that for certain experiments, the average error in determining the effective complex permittivity using Lichtenecker's, Maxwell Garnett's, Bruggeman's, Buchelnikov's, and Ignatenko's models is about 10%. This suggests that, for multiphysics computer models describing the processing of metal powder in the full temperature range, input data on effective complex permittivity obtained from direct measurement has, up to now, no substitute.
Urbina, Angel; Mahadevan, Sankaran; Paez, Thomas L.
2012-03-01
Here, performance assessment of complex systems is ideally accomplished through system-level testing, but because they are expensive, such tests are seldom performed. On the other hand, for economic reasons, data from tests on individual components that are parts of complex systems are more readily available. The lack of system-level data leads to a need to build computational models of systems and use them for performance prediction in lieu of experiments. Because their complexity, models are sometimes built in a hierarchical manner, starting with simple components, progressing to collections of components, and finally, to the full system. Quantification of uncertainty inmore » the predicted response of a system model is required in order to establish confidence in the representation of actual system behavior. This paper proposes a framework for the complex, but very practical problem of quantification of uncertainty in system-level model predictions. It is based on Bayes networks and uses the available data at multiple levels of complexity (i.e., components, subsystem, etc.). Because epistemic sources of uncertainty were shown to be secondary, in this application, aleatoric only uncertainty is included in the present uncertainty quantification. An example showing application of the techniques to uncertainty quantification of measures of response of a real, complex aerospace system is included.« less
Toward Modeling the Intrinsic Complexity of Test Problems
ERIC Educational Resources Information Center
Shoufan, Abdulhadi
2017-01-01
The concept of intrinsic complexity explains why different problems of the same type, tackled by the same problem solver, can require different times to solve and yield solutions of different quality. This paper proposes a general four-step approach that can be used to establish a model for the intrinsic complexity of a problem class in terms of…
[Take] and the ASL Verb Complex: An Autolexical Account
ERIC Educational Resources Information Center
Metlay, Donald S.
2012-01-01
This dissertation will show how linguistic description and an Autolexical account of the bound verb root [take] shed a light on the nature of complex verb constructions in American Sign Language (ASL). This is accomplished by creating a new ASL Verb Complex Model unifying all verbs into one category of VERB. This model also accounts for a variety…
As part of its continuing development and evaluation, the QUIC model (Quick Urban & Industrial Complex) was used to study flow and dispersion in complex terrain for two cases. First, for a small area of lower Manhattan near the World Trade Center site, comparisons were made bet...
As part of its continuing development and evaluation, the QUIC model (Quick Urban & Industrial Complex) was used to study flow and dispersion in complex terrain for two cases. First, for a small area of lower Manhattan near the World Trade Center site, comparisons were made bet...
Plant metabolic modeling: achieving new insight into metabolism and metabolic engineering.
Baghalian, Kambiz; Hajirezaei, Mohammad-Reza; Schreiber, Falk
2014-10-01
Models are used to represent aspects of the real world for specific purposes, and mathematical models have opened up new approaches in studying the behavior and complexity of biological systems. However, modeling is often time-consuming and requires significant computational resources for data development, data analysis, and simulation. Computational modeling has been successfully applied as an aid for metabolic engineering in microorganisms. But such model-based approaches have only recently been extended to plant metabolic engineering, mainly due to greater pathway complexity in plants and their highly compartmentalized cellular structure. Recent progress in plant systems biology and bioinformatics has begun to disentangle this complexity and facilitate the creation of efficient plant metabolic models. This review highlights several aspects of plant metabolic modeling in the context of understanding, predicting and modifying complex plant metabolism. We discuss opportunities for engineering photosynthetic carbon metabolism, sucrose synthesis, and the tricarboxylic acid cycle in leaves and oil synthesis in seeds and the application of metabolic modeling to the study of plant acclimation to the environment. The aim of the review is to offer a current perspective for plant biologists without requiring specialized knowledge of bioinformatics or systems biology. © 2014 American Society of Plant Biologists. All rights reserved.
Deterministic ripple-spreading model for complex networks.
Hu, Xiao-Bing; Wang, Ming; Leeson, Mark S; Hines, Evor L; Di Paolo, Ezequiel
2011-04-01
This paper proposes a deterministic complex network model, which is inspired by the natural ripple-spreading phenomenon. The motivations and main advantages of the model are the following: (i) The establishment of many real-world networks is a dynamic process, where it is often observed that the influence of a few local events spreads out through nodes, and then largely determines the final network topology. Obviously, this dynamic process involves many spatial and temporal factors. By simulating the natural ripple-spreading process, this paper reports a very natural way to set up a spatial and temporal model for such complex networks. (ii) Existing relevant network models are all stochastic models, i.e., with a given input, they cannot output a unique topology. Differently, the proposed ripple-spreading model can uniquely determine the final network topology, and at the same time, the stochastic feature of complex networks is captured by randomly initializing ripple-spreading related parameters. (iii) The proposed model can use an easily manageable number of ripple-spreading related parameters to precisely describe a network topology, which is more memory efficient when compared with traditional adjacency matrix or similar memory-expensive data structures. (iv) The ripple-spreading model has a very good potential for both extensions and applications.
Plant Metabolic Modeling: Achieving New Insight into Metabolism and Metabolic Engineering
Baghalian, Kambiz; Hajirezaei, Mohammad-Reza; Schreiber, Falk
2014-01-01
Models are used to represent aspects of the real world for specific purposes, and mathematical models have opened up new approaches in studying the behavior and complexity of biological systems. However, modeling is often time-consuming and requires significant computational resources for data development, data analysis, and simulation. Computational modeling has been successfully applied as an aid for metabolic engineering in microorganisms. But such model-based approaches have only recently been extended to plant metabolic engineering, mainly due to greater pathway complexity in plants and their highly compartmentalized cellular structure. Recent progress in plant systems biology and bioinformatics has begun to disentangle this complexity and facilitate the creation of efficient plant metabolic models. This review highlights several aspects of plant metabolic modeling in the context of understanding, predicting and modifying complex plant metabolism. We discuss opportunities for engineering photosynthetic carbon metabolism, sucrose synthesis, and the tricarboxylic acid cycle in leaves and oil synthesis in seeds and the application of metabolic modeling to the study of plant acclimation to the environment. The aim of the review is to offer a current perspective for plant biologists without requiring specialized knowledge of bioinformatics or systems biology. PMID:25344492
Coarse-grained molecular dynamics simulations for giant protein-DNA complexes
NASA Astrophysics Data System (ADS)
Takada, Shoji
Biomolecules are highly hierarchic and intrinsically flexible. Thus, computational modeling calls for multi-scale methodologies. We have been developing a coarse-grained biomolecular model where on-average 10-20 atoms are grouped into one coarse-grained (CG) particle. Interactions among CG particles are tuned based on atomistic interactions and the fluctuation matching algorithm. CG molecular dynamics methods enable us to simulate much longer time scale motions of much larger molecular systems than fully atomistic models. After broad sampling of structures with CG models, we can easily reconstruct atomistic models, from which one can continue conventional molecular dynamics simulations if desired. Here, we describe our CG modeling methodology for protein-DNA complexes, together with various biological applications, such as the DNA duplication initiation complex, model chromatins, and transcription factor dynamics on chromatin-like environment.
Sanjak, Jaleal S.; Long, Anthony D.; Thornton, Kevin R.
2017-01-01
The genetic component of complex disease risk in humans remains largely unexplained. A corollary is that the allelic spectrum of genetic variants contributing to complex disease risk is unknown. Theoretical models that relate population genetic processes to the maintenance of genetic variation for quantitative traits may suggest profitable avenues for future experimental design. Here we use forward simulation to model a genomic region evolving under a balance between recurrent deleterious mutation and Gaussian stabilizing selection. We consider multiple genetic and demographic models, and several different methods for identifying genomic regions harboring variants associated with complex disease risk. We demonstrate that the model of gene action, relating genotype to phenotype, has a qualitative effect on several relevant aspects of the population genetic architecture of a complex trait. In particular, the genetic model impacts genetic variance component partitioning across the allele frequency spectrum and the power of statistical tests. Models with partial recessivity closely match the minor allele frequency distribution of significant hits from empirical genome-wide association studies without requiring homozygous effect sizes to be small. We highlight a particular gene-based model of incomplete recessivity that is appealing from first principles. Under that model, deleterious mutations in a genomic region partially fail to complement one another. This model of gene-based recessivity predicts the empirically observed inconsistency between twin and SNP based estimated of dominance heritability. Furthermore, this model predicts considerable levels of unexplained variance associated with intralocus epistasis. Our results suggest a need for improved statistical tools for region based genetic association and heritability estimation. PMID:28103232
DOE Office of Scientific and Technical Information (OSTI.GOV)
Celia, Michael A.
This report documents the accomplishments achieved during the project titled “Model complexity and choice of model approaches for practical simulations of CO 2 injection,migration, leakage and long-term fate” funded by the US Department of Energy, Office of Fossil Energy. The objective of the project was to investigate modeling approaches of various levels of complexity relevant to geologic carbon storage (GCS) modeling with the goal to establish guidelines on choice of modeling approach.
Andrew Fall; B. Sturtevant; M.-J. Fortin; M. Papaik; F. Doyon; D. Morgan; K. Berninger; C. Messier
2010-01-01
The complexity and multi-scaled nature of forests poses significant challenges to understanding and management. Models can provide useful insights into process and their interactions, and implications of alternative management options. Most models, particularly scientific models, focus on a relatively small set of processes and are designed to operate within a...
ERIC Educational Resources Information Center
Sins, Patrick H. M.; Savelsbergh, Elwin R.; van Joolingen, Wouter R.
2005-01-01
Although computer modelling is widely advocated as a way to offer students a deeper understanding of complex phenomena, the process of modelling is rather complex itself and needs scaffolding. In order to offer adequate support, a thorough understanding of the reasoning processes students employ and of difficulties they encounter during a…
Turing instability in reaction-diffusion models on complex networks
NASA Astrophysics Data System (ADS)
Ide, Yusuke; Izuhara, Hirofumi; Machida, Takuya
2016-09-01
In this paper, the Turing instability in reaction-diffusion models defined on complex networks is studied. Here, we focus on three types of models which generate complex networks, i.e. the Erdős-Rényi, the Watts-Strogatz, and the threshold network models. From analysis of the Laplacian matrices of graphs generated by these models, we numerically reveal that stable and unstable regions of a homogeneous steady state on the parameter space of two diffusion coefficients completely differ, depending on the network architecture. In addition, we theoretically discuss the stable and unstable regions in the cases of regular enhanced ring lattices which include regular circles, and networks generated by the threshold network model when the number of vertices is large enough.
Blower, Sally; Go, Myong-Hyun
2011-07-19
Mathematical models are useful tools for understanding and predicting epidemics. A recent innovative modeling study by Stehle and colleagues addressed the issue of how complex models need to be to ensure accuracy. The authors collected data on face-to-face contacts during a two-day conference. They then constructed a series of dynamic social contact networks, each of which was used to model an epidemic generated by a fast-spreading airborne pathogen. Intriguingly, Stehle and colleagues found that increasing model complexity did not always increase accuracy. Specifically, the most detailed contact network and a simplified version of this network generated very similar results. These results are extremely interesting and require further exploration to determine their generalizability.
Virtual enterprise model for the electronic components business in the Nuclear Weapons Complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ferguson, T.J.; Long, K.S.; Sayre, J.A.
1994-08-01
The electronic components business within the Nuclear Weapons Complex spans organizational and Department of Energy contractor boundaries. An assessment of the current processes indicates a need for fundamentally changing the way electronic components are developed, procured, and manufactured. A model is provided based on a virtual enterprise that recognizes distinctive competencies within the Nuclear Weapons Complex and at the vendors. The model incorporates changes that reduce component delivery cycle time and improve cost effectiveness while delivering components of the appropriate quality.
Trends in modeling Biomedical Complex Systems
Milanesi, Luciano; Romano, Paolo; Castellani, Gastone; Remondini, Daniel; Liò, Petro
2009-01-01
In this paper we provide an introduction to the techniques for multi-scale complex biological systems, from the single bio-molecule to the cell, combining theoretical modeling, experiments, informatics tools and technologies suitable for biological and biomedical research, which are becoming increasingly multidisciplinary, multidimensional and information-driven. The most important concepts on mathematical modeling methodologies and statistical inference, bioinformatics and standards tools to investigate complex biomedical systems are discussed and the prominent literature useful to both the practitioner and the theoretician are presented. PMID:19828068
Gravitational orientation of the orbital complex, Salyut-6--Soyuz
NASA Technical Reports Server (NTRS)
Grecho, G. M.; Sarychev, V. A.; Legostayev, V. P.; Sazonov, V. V.; Gansvind, I. N.
1983-01-01
A simple mathematical model is proposed for the Salyut-6-Soyuz orbital complex motion with respect to the center of mass under the one-axis gravity-gradient orientation regime. This model was used for processing the measurements of the orbital complex motion parameters when the above orientation region was implemented. Some actual satellite motions are simulated and the satellite's aerodynamic parameters are determined. Estimates are obtained for the accuracy of measurements as well as that of the mathematical model.
On the robustness of complex heterogeneous gene expression networks.
Gómez-Gardeñes, Jesús; Moreno, Yamir; Floría, Luis M
2005-04-01
We analyze a continuous gene expression model on the underlying topology of a complex heterogeneous network. Numerical simulations aimed at studying the chaotic and periodic dynamics of the model are performed. The results clearly indicate that there is a region in which the dynamical and structural complexity of the system avoid chaotic attractors. However, contrary to what has been reported for Random Boolean Networks, the chaotic phase cannot be completely suppressed, which has important bearings on network robustness and gene expression modeling.
New approaches in agent-based modeling of complex financial systems
NASA Astrophysics Data System (ADS)
Chen, Ting-Ting; Zheng, Bo; Li, Yan; Jiang, Xiong-Fei
2017-12-01
Agent-based modeling is a powerful simulation technique to understand the collective behavior and microscopic interaction in complex financial systems. Recently, the concept for determining the key parameters of agent-based models from empirical data instead of setting them artificially was suggested. We first review several agent-based models and the new approaches to determine the key model parameters from historical market data. Based on the agents' behaviors with heterogeneous personal preferences and interactions, these models are successful in explaining the microscopic origination of the temporal and spatial correlations of financial markets. We then present a novel paradigm combining big-data analysis with agent-based modeling. Specifically, from internet query and stock market data, we extract the information driving forces and develop an agent-based model to simulate the dynamic behaviors of complex financial systems.
NASA Astrophysics Data System (ADS)
Nakagawa, Satoshi; Kurniawan, Isman; Kodama, Koichi; Arwansyah, Muhammad Saleh; Kawaguchi, Kazutomo; Nagao, Hidemi
2018-03-01
We present a simple coarse-grained model with the molecular crowding effect in solvent to investigate the structure and dynamics of protein complexes including association and/or dissociation processes and investigate some physical properties such as the structure and the reaction rate from the viewpoint of the hydrophobic intermolecular interactions of protein complex. In the present coarse-grained model, a function depending upon the density of hydrophobic amino acid residues in a binding area of the complex is introduced, and the function involves the molecular crowding effect for the intermolecular interactions of hydrophobic amino acid residues between proteins. We propose a hydrophobic intermolecular potential energy between proteins by using the density-dependent function. The present coarse-grained model is applied to the complex of cytochrome f and plastocyanin by using the Langevin dynamics simulation to investigate some physical properties such as the complex structure, the electron transfer reaction rate constant from plastocyanin to cytochrome f and so on. We find that for proceeding the electron transfer reaction, the distance between metals in their active sites is necessary within about 18 Å. We discuss some typical complex structures formed in the present simulation in relation to the molecular crowding effect on hydrophobic interactions.
Juckem, Paul F.; Clark, Brian R.; Feinstein, Daniel T.
2017-05-04
The U.S. Geological Survey, National Water-Quality Assessment seeks to map estimated intrinsic susceptibility of the glacial aquifer system of the conterminous United States. Improved understanding of the hydrogeologic characteristics that explain spatial patterns of intrinsic susceptibility, commonly inferred from estimates of groundwater age distributions, is sought so that methods used for the estimation process are properly equipped. An important step beyond identifying relevant hydrogeologic datasets, such as glacial geology maps, is to evaluate how incorporation of these resources into process-based models using differing levels of detail could affect resulting simulations of groundwater age distributions and, thus, estimates of intrinsic susceptibility.This report describes the construction and calibration of three groundwater-flow models of northeastern Wisconsin that were developed with differing levels of complexity to provide a framework for subsequent evaluations of the effects of process-based model complexity on estimations of groundwater age distributions for withdrawal wells and streams. Preliminary assessments, which focused on the effects of model complexity on simulated water levels and base flows in the glacial aquifer system, illustrate that simulation of vertical gradients using multiple model layers improves simulated heads more in low-permeability units than in high-permeability units. Moreover, simulation of heterogeneous hydraulic conductivity fields in coarse-grained and some fine-grained glacial materials produced a larger improvement in simulated water levels in the glacial aquifer system compared with simulation of uniform hydraulic conductivity within zones. The relation between base flows and model complexity was less clear; however, the relation generally seemed to follow a similar pattern as water levels. Although increased model complexity resulted in improved calibrations, future application of the models using simulated particle tracking is anticipated to evaluate if these model design considerations are similarly important for understanding the primary modeling objective - to simulate reasonable groundwater age distributions.
NASA Astrophysics Data System (ADS)
Golmohammadi, A.; Jafarpour, B.; M Khaninezhad, M. R.
2017-12-01
Calibration of heterogeneous subsurface flow models leads to ill-posed nonlinear inverse problems, where too many unknown parameters are estimated from limited response measurements. When the underlying parameters form complex (non-Gaussian) structured spatial connectivity patterns, classical variogram-based geostatistical techniques cannot describe the underlying connectivity patterns. Modern pattern-based geostatistical methods that incorporate higher-order spatial statistics are more suitable for describing such complex spatial patterns. Moreover, when the underlying unknown parameters are discrete (geologic facies distribution), conventional model calibration techniques that are designed for continuous parameters cannot be applied directly. In this paper, we introduce a novel pattern-based model calibration method to reconstruct discrete and spatially complex facies distributions from dynamic flow response data. To reproduce complex connectivity patterns during model calibration, we impose a feasibility constraint to ensure that the solution follows the expected higher-order spatial statistics. For model calibration, we adopt a regularized least-squares formulation, involving data mismatch, pattern connectivity, and feasibility constraint terms. Using an alternating directions optimization algorithm, the regularized objective function is divided into a continuous model calibration problem, followed by mapping the solution onto the feasible set. The feasibility constraint to honor the expected spatial statistics is implemented using a supervised machine learning algorithm. The two steps of the model calibration formulation are repeated until the convergence criterion is met. Several numerical examples are used to evaluate the performance of the developed method.
Why Bother to Calibrate? Model Consistency and the Value of Prior Information
NASA Astrophysics Data System (ADS)
Hrachowitz, Markus; Fovet, Ophelie; Ruiz, Laurent; Euser, Tanja; Gharari, Shervan; Nijzink, Remko; Savenije, Hubert; Gascuel-Odoux, Chantal
2015-04-01
Hydrological models frequently suffer from limited predictive power despite adequate calibration performances. This can indicate insufficient representations of the underlying processes. Thus ways are sought to increase model consistency while satisfying the contrasting priorities of increased model complexity and limited equifinality. In this study the value of a systematic use of hydrological signatures and expert knowledge for increasing model consistency was tested. It was found that a simple conceptual model, constrained by 4 calibration objective functions, was able to adequately reproduce the hydrograph in the calibration period. The model, however, could not reproduce 20 hydrological signatures, indicating a lack of model consistency. Subsequently, testing 11 models, model complexity was increased in a stepwise way and counter-balanced by using prior information about the system to impose "prior constraints", inferred from expert knowledge and to ensure a model which behaves well with respect to the modeller's perception of the system. We showed that, in spite of unchanged calibration performance, the most complex model set-up exhibited increased performance in the independent test period and skill to reproduce all 20 signatures, indicating a better system representation. The results suggest that a model may be inadequate despite good performance with respect to multiple calibration objectives and that increasing model complexity, if efficiently counter-balanced by available prior constraints, can increase predictive performance of a model and its skill to reproduce hydrological signatures. The results strongly illustrate the need to balance automated model calibration with a more expert-knowledge driven strategy of constraining models.
Why Bother and Calibrate? Model Consistency and the Value of Prior Information.
NASA Astrophysics Data System (ADS)
Hrachowitz, M.; Fovet, O.; Ruiz, L.; Euser, T.; Gharari, S.; Nijzink, R.; Freer, J. E.; Savenije, H.; Gascuel-Odoux, C.
2014-12-01
Hydrological models frequently suffer from limited predictive power despite adequate calibration performances. This can indicate insufficient representations of the underlying processes. Thus ways are sought to increase model consistency while satisfying the contrasting priorities of increased model complexity and limited equifinality. In this study the value of a systematic use of hydrological signatures and expert knowledge for increasing model consistency was tested. It was found that a simple conceptual model, constrained by 4 calibration objective functions, was able to adequately reproduce the hydrograph in the calibration period. The model, however, could not reproduce 20 hydrological signatures, indicating a lack of model consistency. Subsequently, testing 11 models, model complexity was increased in a stepwise way and counter-balanced by using prior information about the system to impose "prior constraints", inferred from expert knowledge and to ensure a model which behaves well with respect to the modeller's perception of the system. We showed that, in spite of unchanged calibration performance, the most complex model set-up exhibited increased performance in the independent test period and skill to reproduce all 20 signatures, indicating a better system representation. The results suggest that a model may be inadequate despite good performance with respect to multiple calibration objectives and that increasing model complexity, if efficiently counter-balanced by available prior constraints, can increase predictive performance of a model and its skill to reproduce hydrological signatures. The results strongly illustrate the need to balance automated model calibration with a more expert-knowledge driven strategy of constraining models.
Development of Maps of Simple and Complex Cells in the Primary Visual Cortex
Antolík, Ján; Bednar, James A.
2011-01-01
Hubel and Wiesel (1962) classified primary visual cortex (V1) neurons as either simple, with responses modulated by the spatial phase of a sine grating, or complex, i.e., largely phase invariant. Much progress has been made in understanding how simple-cells develop, and there are now detailed computational models establishing how they can form topographic maps ordered by orientation preference. There are also models of how complex cells can develop using outputs from simple cells with different phase preferences, but no model of how a topographic orientation map of complex cells could be formed based on the actual connectivity patterns found in V1. Addressing this question is important, because the majority of existing developmental models of simple-cell maps group neurons selective to similar spatial phases together, which is contrary to experimental evidence, and makes it difficult to construct complex cells. Overcoming this limitation is not trivial, because mechanisms responsible for map development drive receptive fields (RF) of nearby neurons to be highly correlated, while co-oriented RFs of opposite phases are anti-correlated. In this work, we model V1 as two topographically organized sheets representing cortical layer 4 and 2/3. Only layer 4 receives direct thalamic input. Both sheets are connected with narrow feed-forward and feedback connectivity. Only layer 2/3 contains strong long-range lateral connectivity, in line with current anatomical findings. Initially all weights in the model are random, and each is modified via a Hebbian learning rule. The model develops smooth, matching, orientation preference maps in both sheets. Layer 4 units become simple cells, with phase preference arranged randomly, while those in layer 2/3 are primarily complex cells. To our knowledge this model is the first explaining how simple cells can develop with random phase preference, and how maps of complex cells can develop, using only realistic patterns of connectivity. PMID:21559067
Food-web complexity, meta-community complexity and community stability.
Mougi, A; Kondoh, M
2016-04-13
What allows interacting, diverse species to coexist in nature has been a central question in ecology, ever since the theoretical prediction that a complex community should be inherently unstable. Although the role of spatiality in species coexistence has been recognized, its application to more complex systems has been less explored. Here, using a meta-community model of food web, we show that meta-community complexity, measured by the number of local food webs and their connectedness, elicits a self-regulating, negative-feedback mechanism and thus stabilizes food-web dynamics. Moreover, the presence of meta-community complexity can give rise to a positive food-web complexity-stability effect. Spatiality may play a more important role in stabilizing dynamics of complex, real food webs than expected from ecological theory based on the models of simpler food webs.
Genotypic Complexity of Fisher’s Geometric Model
Hwang, Sungmin; Park, Su-Chan; Krug, Joachim
2017-01-01
Fisher’s geometric model was originally introduced to argue that complex adaptations must occur in small steps because of pleiotropic constraints. When supplemented with the assumption of additivity of mutational effects on phenotypic traits, it provides a simple mechanism for the emergence of genotypic epistasis from the nonlinear mapping of phenotypes to fitness. Of particular interest is the occurrence of reciprocal sign epistasis, which is a necessary condition for multipeaked genotypic fitness landscapes. Here we compute the probability that a pair of randomly chosen mutations interacts sign epistatically, which is found to decrease with increasing phenotypic dimension n, and varies nonmonotonically with the distance from the phenotypic optimum. We then derive expressions for the mean number of fitness maxima in genotypic landscapes comprised of all combinations of L random mutations. This number increases exponentially with L, and the corresponding growth rate is used as a measure of the complexity of the landscape. The dependence of the complexity on the model parameters is found to be surprisingly rich, and three distinct phases characterized by different landscape structures are identified. Our analysis shows that the phenotypic dimension, which is often referred to as phenotypic complexity, does not generally correlate with the complexity of fitness landscapes and that even organisms with a single phenotypic trait can have complex landscapes. Our results further inform the interpretation of experiments where the parameters of Fisher’s model have been inferred from data, and help to elucidate which features of empirical fitness landscapes can be described by this model. PMID:28450460
GPU-accelerated depth map generation for X-ray simulations of complex CAD geometries
NASA Astrophysics Data System (ADS)
Grandin, Robert J.; Young, Gavin; Holland, Stephen D.; Krishnamurthy, Adarsh
2018-04-01
Interactive x-ray simulations of complex computer-aided design (CAD) models can provide valuable insights for better interpretation of the defect signatures such as porosity from x-ray CT images. Generating the depth map along a particular direction for the given CAD geometry is the most compute-intensive step in x-ray simulations. We have developed a GPU-accelerated method for real-time generation of depth maps of complex CAD geometries. We preprocess complex components designed using commercial CAD systems using a custom CAD module and convert them into a fine user-defined surface tessellation. Our CAD module can be used by different simulators as well as handle complex geometries, including those that arise from complex castings and composite structures. We then make use of a parallel algorithm that runs on a graphics processing unit (GPU) to convert the finely-tessellated CAD model to a voxelized representation. The voxelized representation can enable heterogeneous modeling of the volume enclosed by the CAD model by assigning heterogeneous material properties in specific regions. The depth maps are generated from this voxelized representation with the help of a GPU-accelerated ray-casting algorithm. The GPU-accelerated ray-casting method enables interactive (> 60 frames-per-second) generation of the depth maps of complex CAD geometries. This enables arbitrarily rotation and slicing of the CAD model, leading to better interpretation of the x-ray images by the user. In addition, the depth maps can be used to aid directly in CT reconstruction algorithms.
A Spatially Continuous Model of Carbohydrate Digestion and Transport Processes in the Colon
Moorthy, Arun S.; Brooks, Stephen P. J.; Kalmokoff, Martin; Eberl, Hermann J.
2015-01-01
A spatially continuous mathematical model of transport processes, anaerobic digestion and microbial complexity as would be expected in the human colon is presented. The model is a system of first-order partial differential equations with context determined number of dependent variables, and stiff, non-linear source terms. Numerical simulation of the model is used to elucidate information about the colon-microbiota complex. It is found that the composition of materials on outflow of the model does not well-describe the composition of material in other model locations, and inferences using outflow data varies according to model reactor representation. Additionally, increased microbial complexity allows the total microbial community to withstand major system perturbations in diet and community structure. However, distribution of strains and functional groups within the microbial community can be modified depending on perturbation length and microbial kinetic parameters. Preliminary model extensions and potential investigative opportunities using the computational model are discussed. PMID:26680208
Sensitivity of Precipitation in Coupled Land-Atmosphere Models
NASA Technical Reports Server (NTRS)
Neelin, David; Zeng, N.; Suarez, M.; Koster, R.
2004-01-01
The project objective was to understand mechanisms by which atmosphere-land-ocean processes impact precipitation in the mean climate and interannual variations, focusing on tropical and subtropical regions. A combination of modeling tools was used: an intermediate complexity land-atmosphere model developed at UCLA known as the QTCM and the NASA Seasonal-to-Interannual Prediction Program general circulation model (NSIPP GCM). The intermediate complexity model was used to develop hypotheses regarding the physical mechanisms and theory for the interplay of large-scale dynamics, convective heating, cloud radiative effects and land surface feedbacks. The theoretical developments were to be confronted with diagnostics from the more complex GCM to validate or modify the theory.
NASA Astrophysics Data System (ADS)
Gusev, Anatoly; Diansky, Nikolay; Zalesny, Vladimir
2010-05-01
The original program complex is proposed for the ocean circulation sigma-model, developed in the Institute of Numerical Mathematics (INM), Russian Academy of Sciences (RAS). The complex can be used in various curvilinear orthogonal coordinate systems. In addition to ocean circulation model, the complex contains a sea ice dynamics and thermodynamics model, as well as the original system of the atmospheric forcing implementation on the basis of both prescribed meteodata and atmospheric model results. This complex can be used as the oceanic block of Earth climate model as well as for solving the scientific and practical problems concerning the World ocean and its separate oceans and seas. The developed program complex can be effectively used on parallel shared memory computational systems and on contemporary personal computers. On the base of the complex proposed the ocean general circulation model (OGCM) was developed. The model is realized in the curvilinear orthogonal coordinate system obtained by the conformal transformation of the standard geographical grid that allowed us to locate the system singularities outside the integration domain. The horizontal resolution of the OGCM is 1 degree on longitude, 0.5 degree on latitude, and it has 40 non-uniform sigma-levels in depth. The model was integrated for 100 years starting from the Levitus January climatology using the realistic atmospheric annual cycle calculated on the base of CORE datasets. The experimental results showed us that the model adequately reproduces the basic characteristics of large-scale World Ocean dynamics, that is in good agreement with both observational data and results of the best climatic OGCMs. This OGCM is used as the oceanic component of the new version of climatic system model (CSM) developed in INM RAS. The latter is now ready for carrying out the new numerical experiments on climate and its change modelling according to IPCC (Intergovernmental Panel on Climate Change) scenarios in the scope of the CMIP-5 (Coupled Model Intercomparison Project). On the base of the complex proposed the Pacific Ocean circulation eddy-resolving model was realized. The integration domain covers the Pacific from Equator to Bering Strait. The model horizontal resolution is 0.125 degree and it has 20 non-uniform sigma-levels in depth. The model adequately reproduces circulation large-scale structure and its variability: Kuroshio meandering, ocean synoptic eddies, frontal zones, etc. Kuroshio high variability is shown. The distribution of contaminant was simulated that is admittedly wasted near Petropavlovsk-Kamchatsky. The results demonstrate contaminant distribution structure and provide us understanding of hydrological fields formation processes in the North-West Pacific.
Complexity growth in minimal massive 3D gravity
NASA Astrophysics Data System (ADS)
Qaemmaqami, Mohammad M.
2018-01-01
We study the complexity growth by using "complexity =action " (CA) proposal in the minimal massive 3D gravity (MMG) model which is proposed for resolving the bulk-boundary clash problem of topologically massive gravity (TMG). We observe that the rate of the complexity growth for Banados-Teitelboim-Zanelli (BTZ) black hole saturates the proposed bound by physical mass of the BTZ black hole in the MMG model, when the angular momentum parameter and the inner horizon of black hole goes to zero.
[Analysis of a three-dimensional finite element model of atlas and axis complex fracture].
Tang, X M; Liu, C; Huang, K; Zhu, G T; Sun, H L; Dai, J; Tian, J W
2018-05-22
Objective: To explored the clinical application of the three-dimensional finite element model of atlantoaxial complex fracture. Methods: A three-dimensional finite element model of cervical spine (FEM/intact) was established by software of Abaqus6.12.On the basis of this model, a three-dimensional finite element model of four types of atlantoaxial complex fracture was established: C(1) fracture (Jefferson)+ C(2) fracture (type Ⅱfracture), Jefferson+ C(2) fracture(type Ⅲfracture), Jefferson+ C(2) fracture(Hangman), Jefferson+ stable C(2) fracture (FEM/fracture). The range of motion under flexion, extension, lateral bending and axial rotation were measured and compared with the model of cervical spine. Results: The three-dimensional finite element model of four types of atlantoaxial complex fracture had the same similarity and profile.The range of motion (ROM) of different segments had different changes.Compared with those in the normal model, the ROM of C(0/1) and C(1/2) in C(1) combined Ⅱ odontoid fracture model in flexion/extension, lateral bending and rotation increased by 57.45%, 29.34%, 48.09% and 95.49%, 88.52%, 36.71%, respectively.The ROM of C(0/1) and C(1/2) in C(1) combined Ⅲodontoid fracture model in flexion/extension, lateral bending and rotation increased by 47.01%, 27.30%, 45.31% and 90.38%, 27.30%, 30.0%.The ROM of C(0/1) and C(1/2) in C(1) combined Hangman fracture model in flexion/extension, lateral bending and rotation increased by 32.68%, 79.34%, 77.62% and 60.53%, 81.20%, 21.48%, respectively.The ROM of C(0/1) and C(1/2) in C(1) combined axis fracture model in flexion/extension, lateral bending and rotation increased by 15.00%, 29.30%, 8.47% and 37.87%, 75.57%, 8.30%, respectively. Conclusions: The three-dimensional finite element model can be used to simulate the biomechanics of atlantoaxial complex fracture.The ROM of atlantoaxial complex fracture is larger than nomal model, which indicates that surgical treatment should be performed.
[Design of Complex Cavity Structure in Air Route System of Automated Peritoneal Dialysis Machine].
Quan, Xiaoliang
2017-07-30
This paper introduced problems about Automated Peritoneal Dialysis machine(APD) that the lack of technical issues such as the structural design of the complex cavities. To study the flow characteristics of this special structure, the application of ANSYS CFX software is used with k-ε turbulence model as the theoretical basis of fluid mechanics. The numerical simulation of flow field simulation result in the internal model can be gotten after the complex structure model is imported into ANSYS CFX module. Then, it will present the distribution of complex cavities inside the flow field and the flow characteristics parameter, which will provide an important reference design for APD design.
Primary Care Physician Insights Into a Typology of the Complex Patient in Primary Care
Loeb, Danielle F.; Binswanger, Ingrid A.; Candrian, Carey; Bayliss, Elizabeth A.
2015-01-01
PURPOSE Primary care physicians play unique roles caring for complex patients, often acting as the hub for their care and coordinating care among specialists. To inform the clinical application of new models of care for complex patients, we sought to understand how these physicians conceptualize patient complexity and to develop a corresponding typology. METHODS We conducted qualitative in-depth interviews with internal medicine primary care physicians from 5 clinics associated with a university hospital and a community health hospital. We used systematic nonprobabilistic sampling to achieve an even distribution of sex, years in practice, and type of practice. The interviews were analyzed using a team-based participatory general inductive approach. RESULTS The 15 physicians in this study endorsed a multidimensional concept of patient complexity. The physicians perceived patients to be complex if they had an exacerbating factor—a medical illness, mental illness, socioeconomic challenge, or behavior or trait (or some combination thereof)—that complicated care for chronic medical illnesses. CONCLUSION This perspective of primary care physicians caring for complex patients can help refine models of complexity to design interventions or models of care that improve outcomes for these patients. PMID:26371266
Primary care physician insights into a typology of the complex patient in primary care.
Loeb, Danielle F; Binswanger, Ingrid A; Candrian, Carey; Bayliss, Elizabeth A
2015-09-01
Primary care physicians play unique roles caring for complex patients, often acting as the hub for their care and coordinating care among specialists. To inform the clinical application of new models of care for complex patients, we sought to understand how these physicians conceptualize patient complexity and to develop a corresponding typology. We conducted qualitative in-depth interviews with internal medicine primary care physicians from 5 clinics associated with a university hospital and a community health hospital. We used systematic nonprobabilistic sampling to achieve an even distribution of sex, years in practice, and type of practice. The interviews were analyzed using a team-based participatory general inductive approach. The 15 physicians in this study endorsed a multidimensional concept of patient complexity. The physicians perceived patients to be complex if they had an exacerbating factor-a medical illness, mental illness, socioeconomic challenge, or behavior or trait (or some combination thereof)-that complicated care for chronic medical illnesses. This perspective of primary care physicians caring for complex patients can help refine models of complexity to design interventions or models of care that improve outcomes for these patients. © 2015 Annals of Family Medicine, Inc.
Scope Complexity Options Risks Excursions (SCORE) Version 3.0 Mathematical Description.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gearhart, Jared Lee; Samberson, Jonell Nicole; Shettigar, Subhasini
The purpose of the Scope, Complexity, Options, Risks, Excursions (SCORE) model is to estimate the relative complexity of design variants of future warhead options. The results of this model allow those considering these options to understand the complexity tradeoffs between proposed warhead options. The core idea of SCORE is to divide a warhead option into a well- defined set of scope elements and then estimate the complexity of each scope element against a well understood reference system. The uncertainty associated with estimates can also be captured. A weighted summation of the relative complexity of each scope element is used tomore » determine the total complexity of the proposed warhead option or portions of the warhead option (i.e., a National Work Breakdown Structure code). The SCORE analysis process is a growing multi-organizational Nuclear Security Enterprise (NSE) effort, under the management of the NA- 12 led Enterprise Modeling and Analysis Consortium (EMAC), that has provided the data elicitation, integration and computation needed to support the out-year Life Extension Program (LEP) cost estimates included in the Stockpile Stewardship Management Plan (SSMP).« less
Schlosser, Florian; Moskaleva, Lyudmila V; Kremleva, Alena; Krüger, Sven; Rösch, Notker
2010-06-28
With a relativistic all-electron density functional method, we studied two anionic uranium(VI) carbonate complexes that are important for uranium speciation and transport in aqueous medium, the mononuclear tris(carbonato) complex [UO(2)(CO(3))(3)](4-) and the trinuclear hexa(carbonato) complex [(UO(2))(3)(CO(3))(6)](6-). Focusing on the structures in solution, we applied for the first time a full solvation treatment to these complexes. We approximated short-range effects by explicit aqua ligands and described long-range electrostatic interactions via a polarizable continuum model. Structures and vibrational frequencies of "gas-phase" models with explicit aqua ligands agree best with experiment. This is accidental because the continuum model of the solvent to some extent overestimates the electrostatic interactions of these highly anionic systems with the bulk solvent. The calculated free energy change when three mono-nuclear complexes associate to the trinuclear complex, agrees well with experiment and supports the formation of the latter species upon acidification of a uranyl carbonate solution.
Unsilencing Critical Conversations in Social-Studies Teacher Education Using Agent-Based Modeling
ERIC Educational Resources Information Center
Hostetler, Andrew; Sengupta, Pratim; Hollett, Ty
2018-01-01
In this article, we argue that when complex sociopolitical issues such as ethnocentrism and racial segregation are represented as complex, emergent systems using agent-based computational models (in short agent-based models or ABMs), discourse about these representations can disrupt social studies teacher candidates' dispositions of teaching…
ERIC Educational Resources Information Center
Kartal, Ozgul; Dunya, Beyza Aksu; Diefes-Dux, Heidi A.; Zawojewski, Judith S.
2016-01-01
Critical to many science, technology, engineering, and mathematics (STEM) career paths is mathematical modeling--specifically, the creation and adaptation of mathematical models to solve problems in complex settings. Conventional standardized measures of mathematics achievement are not structured to directly assess this type of mathematical…
From Complex to Simple: Interdisciplinary Stochastic Models
ERIC Educational Resources Information Center
Mazilu, D. A.; Zamora, G.; Mazilu, I.
2012-01-01
We present two simple, one-dimensional, stochastic models that lead to a qualitative understanding of very complex systems from biology, nanoscience and social sciences. The first model explains the complicated dynamics of microtubules, stochastic cellular highways. Using the theory of random walks in one dimension, we find analytical expressions…
DOT National Transportation Integrated Search
2008-01-01
Computer simulations are often used in aviation studies. These simulation tools may require complex, high-fidelity aircraft models. Since many of the flight models used are third-party developed products, independent validation is desired prior to im...
Complex Instruction: A Model for Reaching Up--and Out
ERIC Educational Resources Information Center
Tomlinson, Carol Ann
2018-01-01
Complex Instruction is a multifaceted instructional model designed to provide highly challenging learning opportunities for students in heterogeneous classrooms. The model provides a rationale for and philosophy of creating equity of access to excellent curriculum and instruction for a broad range of learners, guidance for preparing students for…
A scalable plant-resolving radiative transfer model based on optimized GPU ray tracing
USDA-ARS?s Scientific Manuscript database
A new model for radiative transfer in participating media and its application to complex plant canopies is presented. The goal was to be able to efficiently solve complex canopy-scale radiative transfer problems while also representing sub-plant heterogeneity. In the model, individual leaf surfaces ...
MASS BALANCE MODELLING OF PCBS IN THE FOX RIVER/GREEN BAY COMPLEX
The USEPA Office of Research and Development developed and applies a multimedia, mass balance modeling approach to the Fox River/Green Bay complex to aid managers with remedial decision-making. The suite of models were applied to PCBs due to the long history of contamination and ...
NASA Astrophysics Data System (ADS)
Wagenbrenner, N. S.; Forthofer, J.; Butler, B.; Shannon, K.
2014-12-01
Near-surface wind predictions are important for a number of applications, including transport and dispersion, wind energy forecasting, and wildfire behavior. Researchers and forecasters would benefit from a wind model that could be readily applied to complex terrain for use in these various disciplines. Unfortunately, near-surface winds in complex terrain are not handled well by traditional modeling approaches. Numerical weather prediction models employ coarse horizontal resolutions which do not adequately resolve sub-grid terrain features important to the surface flow. Computational fluid dynamics (CFD) models are increasingly being applied to simulate atmospheric boundary layer (ABL) flows, especially in wind energy applications; however, the standard functionality provided in commercial CFD models is not suitable for ABL flows. Appropriate CFD modeling in the ABL requires modification of empirically-derived wall function parameters and boundary conditions to avoid erroneous streamwise gradients due to inconsistences between inlet profiles and specified boundary conditions. This work presents a new version of a near-surface wind model for complex terrain called WindNinja. The new version of WindNinja offers two options for flow simulations: 1) the native, fast-running mass-consistent method available in previous model versions and 2) a CFD approach based on the OpenFOAM modeling framework and optimized for ABL flows. The model is described and evaluations of predictions with surface wind data collected from two recent field campaigns in complex terrain are presented. A comparison of predictions from the native mass-consistent method and the new CFD method is also provided.
Dunham, Kylee; Grand, James B.
2016-01-01
We examined the effects of complexity and priors on the accuracy of models used to estimate ecological and observational processes, and to make predictions regarding population size and structure. State-space models are useful for estimating complex, unobservable population processes and making predictions about future populations based on limited data. To better understand the utility of state space models in evaluating population dynamics, we used them in a Bayesian framework and compared the accuracy of models with differing complexity, with and without informative priors using sequential importance sampling/resampling (SISR). Count data were simulated for 25 years using known parameters and observation process for each model. We used kernel smoothing to reduce the effect of particle depletion, which is common when estimating both states and parameters with SISR. Models using informative priors estimated parameter values and population size with greater accuracy than their non-informative counterparts. While the estimates of population size and trend did not suffer greatly in models using non-informative priors, the algorithm was unable to accurately estimate demographic parameters. This model framework provides reasonable estimates of population size when little to no information is available; however, when information on some vital rates is available, SISR can be used to obtain more precise estimates of population size and process. Incorporating model complexity such as that required by structured populations with stage-specific vital rates affects precision and accuracy when estimating latent population variables and predicting population dynamics. These results are important to consider when designing monitoring programs and conservation efforts requiring management of specific population segments.
Persistent model order reduction for complex dynamical systems using smooth orthogonal decomposition
NASA Astrophysics Data System (ADS)
Ilbeigi, Shahab; Chelidze, David
2017-11-01
Full-scale complex dynamic models are not effective for parametric studies due to the inherent constraints on available computational power and storage resources. A persistent reduced order model (ROM) that is robust, stable, and provides high-fidelity simulations for a relatively wide range of parameters and operating conditions can provide a solution to this problem. The fidelity of a new framework for persistent model order reduction of large and complex dynamical systems is investigated. The framework is validated using several numerical examples including a large linear system and two complex nonlinear systems with material and geometrical nonlinearities. While the framework is used for identifying the robust subspaces obtained from both proper and smooth orthogonal decompositions (POD and SOD, respectively), the results show that SOD outperforms POD in terms of stability, accuracy, and robustness.
McGovern, Eimear; Kelleher, Eoin; Snow, Aisling; Walsh, Kevin; Gadallah, Bassem; Kutty, Shelby; Redmond, John M; McMahon, Colin J
2017-09-01
In recent years, three-dimensional printing has demonstrated reliable reproducibility of several organs including hearts with complex congenital cardiac anomalies. This represents the next step in advanced image processing and can be used to plan surgical repair. In this study, we describe three children with complex univentricular hearts and abnormal systemic or pulmonary venous drainage, in whom three-dimensional printed models based on CT data assisted with preoperative planning. For two children, after group discussion and examination of the models, a decision was made not to proceed with surgery. We extend the current clinical experience with three-dimensional printed modelling and discuss the benefits of such models in the setting of managing complex surgical problems in children with univentricular circulation and abnormal systemic or pulmonary venous drainage.
A technique for evaluating black-footed ferret habitat
Biggins, Dean E.; Miller, Brian J.; Hanebury, Louis R.; Oakleaf, Bob; Farmer, Adrian H.; Crete, Ron; Dood, Arnold
1993-01-01
In this paper, we provide a model and step-by-step procedures for rating a prairie dog (Cynomys sp.) complex for the reintroduction of black-footed ferrets (Mustela nigripes). An important factor in the model is an estimate of the number of black-footed ferret families a prairie dog complex can support for a year; thus, the procedures prescribe how to estimate the size of a prairie dog complex and the density of prairie dogs. Other attributes of the model are qualitative: arrangement of colonies, potential for plague and canine distemper, potential for prairie dog expansion, abundance of predators, future resource conflicts and ownership stability, and public and landowner attitudes about prairie dogs and black-footed ferrets. Because of the qualitative attributes in the model, a team approach is recommended for ranking complexes of prairie dogs for black-footed ferret reintroduction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsao, Jeffrey Y.; Trucano, Timothy G.; Kleban, Stephen D.
This report contains the written footprint of a Sandia-hosted workshop held in Albuquerque, New Mexico, June 22-23, 2016 on “Complex Systems Models and Their Applications: Towards a New Science of Verification, Validation and Uncertainty Quantification,” as well as of pre-work that fed into the workshop. The workshop’s intent was to explore and begin articulating research opportunities at the intersection between two important Sandia communities: the complex systems (CS) modeling community, and the verification, validation and uncertainty quantification (VVUQ) community The overarching research opportunity (and challenge) that we ultimately hope to address is: how can we quantify the credibility of knowledgemore » gained from complex systems models, knowledge that is often incomplete and interim, but will nonetheless be used, sometimes in real-time, by decision makers?« less
ERIC Educational Resources Information Center
Brown, Callum
2008-01-01
Understanding the dynamic behaviour of organisations is challenging and this study uses a model of complex adaptive systems as a generative metaphor to address this challenge. The research question addressed is: How might a conceptual model of complex adaptive systems be used to assist in understanding the dynamic nature of organisations? Using an…
Cognitive Task Complexity and Written Output in Italian and French as a Foreign Language
ERIC Educational Resources Information Center
Kuiken, Folkert; Vedder, Ineke
2008-01-01
This paper reports on a study on the relationship between cognitive task complexity and linguistic performance in L2 writing. In the study, two models proposed to explain the influence of cognitive task complexity on linguistic performance in L2 are tested and compared: Skehan and Foster's Limited Attentional Capacity Model (Skehan, 1998; Skehan…