Lee, Ming-Fen; Liou, Tsan-Hon; Wang, Weu; Pan, Wen-Harn; Lee, Wei-Jei; Hsu, Chung-Tan; Wu, Suh-Fen; Chen, Hsin-Hung
2013-01-01
Hyperuricemia is closely associated with obesity and metabolic abnormalities, which is also an independent risk factor for cardiovascular diseases. The PPARγ gene, which is linked to obesity and metabolic abnormalities in Han Chinese, might be considered a top candidate gene that is involved in hyperuricemia. This study recruited 457 participants, aged 20-40 years old, to investigate the associations of the PPARγ gene and metabolic parameters with hyperuricemia. Three tag-single nucleotide polymorphisms, rs2292101, rs4684846, and rs1822825, of the PPARγ gene were selected to explore their association with hyperuricemia. Risk genotypes on rs1822825 of the PPARγ gene exhibited statistical significance with hyperuricemia (odds ratio: 1.9; 95% confidence interval: 1.05-3.57). Although gender, body mass index (BMI), serum total cholesterol concentration, or protein intake per day were statistically associated with hyperuricemia, the combination of BMI, gender, and rs1822825, rather than that of age, serum lipid profile, blood pressure, and protein intake per day, satisfied the predictability for hyperuricemia (sensitivity: 69.3%; specificity: 83.7%) in Taiwan-born obese Han Chinese. BMI, gender, and the rs1822825 polymorphism in the PPARγ gene appeared good biomarkers in hyperuricemia; therefore, these powerful indicators may be included in the prediction of hyperuricemia to increase the accuracy of the analysis.
Neck Circumference, a Novel Indicator for Hyperuricemia
Jiang, Jiajia; Cui, Jia; Yang, Xinghua; Wang, Anping; Mu, Yiming; Dong, Liguang; Wang, Shuyu; Gaisano, Herbert; Dou, Jingtao; He, Yan
2017-01-01
Background: Waist circumference has been correlated with the risk of hyperuricemia. Whether neck circumference is also associated with hyperuricemia has not been assessed. This study aimed to investigate whether neck circumference is associated with hyperuricemia. Methods: This study population from Beijing is part of the larger China-wide Risk Evaluation of Cancers in Chinese Diabetic Individuals: a lONgitudinal (REACTION) study. For this Beijing sub-center cross-sectional study, a total of 8971 subjects were recruited. Gender-specific multivariable-adjusted regression analyses were conducted to analyze the association of neck circumference and waist circumference with hyperuricemia and the association of neck circumference with serum uric acid levels in the non-hyperuricemia population. Results: After adjusting for confounding variables, regression analyses showed that neck circumference was positively associated with hyperuricemia [OR, 2.61 (1.86–3.67) for males and 3.27 (2.53–4.22) for females] in both genders; further, neck circumference was also positively associated with serum uric acid levels in non-hyperuricemia subjects [b, 2.58 (1.76–3.39) for males and 4.27 (3.70–4.84) for females] in both genders. Additionally, we demonstrated that neck circumference was similar to waist circumference in terms of the strength of association (OR, 3.03 for waist circumference vs. 2.61 for neck circumference in males, and 3.50 vs. 3.27 for females) with hyperuricemia and the ability to predict hyperuricemia (AUC, 0.63 for waist circumference vs. 0.61 for neck circumference in males, and 0.66 vs. 0.66 in females). Conclusion: Neck circumference is positively and independently associated with hyperuricemia in both genders and is also associated with serum uric acid levels in the non-hyperuricemia population. PMID:29238304
Liu, Cheng-Wei; Liao, Pen-Chih; Chen, Kuo-Chin; Chiu, Yu-Wei; Liu, Yuan-Hung; Ke, Shin-Rong; Wu, Yen-Wen
2017-01-01
There is conflicting information regarding the association between hyperuricemia and survival in STEMI patients. Our study examined the interaction between hyperuricemia and Killip class on mortality of STEMI patients. We analyzed 951 consecutive STEMI patients between February 2006 and September 2012. Hyperuricemia was defined as SUA of at least 7mg/dL in males and 6mg/dL in females. Killip class I patients were divided into hyperuricemia and normouricemia groups. The Killip class I hyperuricemia and normouricemia groups had similar baseline and procedural characteristics, but the hyperuricemia group had significantly greater BMI, serum creatinine, and SUA, and a lower TIMI risk score (2, IQR: 1-4 vs. 3, IQR: 2-4, p=0.019). The hyperuricemia group also had greater 30-day and 1-year mortality rates (2.9% vs. 0.3%, p=0.022; 6.5% vs. 1.1%, p=0.002, respectively). However, hyperuricemia was not associated with mortality of patients in Killip classes II-IV or in the overall study population. Hyperuricemia was associated with increased mortality in subgroups of patients who were at least 65years-old, male, had BMI of 25kg/m 2 or less, were in Killip class I, without diabetes, and who did not receive intra-aortic balloon pump support. Hyperuricemia interacted with Killip class I in increasing the risk for 1-year mortality (p for interaction=0.038). Hyperuricemia increased the 1-year mortality of STEMI patients in Killip class I, but not of patients in Killip classes II-IV. An interaction of hyperuricemia and Killip class significantly affects the mortality of STEMI patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Xiong, Z; Zhu, C; Qian, X; Zhu, J; Wu, Z; Chen, L
2013-01-01
To estimate the prevalence of hyperuricemia and lifestyle risk factors for hyperuricemia in elderly women. Cross-sectional study. The suburban area of Guangzhou, Guangdong province, China. The study included 856 Chinese women aged 60 to 102 years who received their annual health examinations in the suburban area of Guangzhou, south China in 2002. Information on anthropometric measurements and lifestyle factors were obtained via a questionnaire processed by the attending physicians or nurses. Blood biochemistry was performed after subjects fasted for 8-14 h. Unconditional logistic regression analysis was used to investigate associations between hyperuricemia, meat intake quintiles, physical activity quintiles, and alcohol intake quintiles. The prevalence of hyperuricemia in the studied population was 12.01%. Alcohol, meat and seafood consumption; being overweight or obese; hypertension; and abnormal triglyceride levels were strongly associated with a higher prevalence of hyperuricemia. Physical activity was inversely related to the prevalence of hyperuricemia. The odds ratios for hyperuricemia for quintiles of physical activity were 1.00, 0.74, 0.72, 0.63, and 0.55 (P<0.01). Our data suggest that the prevalence of hyperuricemia is high in elderly women in suburban Guangzhou in Guangdong province of South China. Obesity, meat and seafood intake and alcohol consumption are associated with a higher prevalence of hyperuricemia, whereas daily physical activity is inversely related to the prevalence of hyperuricemia.
Li, Xue; Song, Peige; Li, Junping; Wang, Peiyu; Li, Guowei
2015-12-01
Previous studies focusing on identification of dietary risk factors for hyperuricemia reported controversial findings. Moreover, evidence for relationship between hyperuricemia and eating and cooking habits remained scanty. The purpose of this study was to evaluate the associations between hyperuricemia and dietary risk factors. A cross-sectional study was conducted among 1583 participants in a Beijing community. Face-to-face interviews were conducted using questionnaires. Anthropometric measurements and biochemical tests were also performed. The prevalence of hyperuricemia was 14.1 % (20.2 % for males and 7.4 % for females). Among the 1372 subjects included for analysis, 720 (52.5 %) were males and the mean age was 37.7 years. For males, statistically significant associations between hyperuricemia and tea intake, breakfast and midnight snack consumption were found, with an odds ratio of 0.56 (high vs. low), 2.14 (often vs. always) and 0.52 (rarely vs. always), respectively. Smoking, fatty liver disease, triglyceride, low-density lipoprotein cholesterol and fasting blood glucose were significantly related to increased serum uric acid (SUA), with a coefficient of 20.06, 11.52, 7.29, 18.97 and 13.37 on SUA, respectively. For females, no statistically significant associations between hyperuricemia and dietary risk factors were observed. In summary, hyperuricemia is highly prevalent among the adult participants in this Chinese community, especially for men. High tea intake and consuming midnight snack rarely are significantly related to decreased risk of hyperuricemia, while often-eating breakfast is associated with increased risk of hyperuricemia compared with always-eating breakfast in males. Further prospective studies are needed to confirm the findings and to establish dietary recommendations for the prevention and treatment of hyperuricemia.
Yu, Shasha; Yang, Hongmei; Guo, Xiaofan; Zhang, Xingang; Zhou, Ying; Ou, Qiaoyun; Zheng, Liqiang; Sun, Yingxian
2016-05-01
The increasing trend of hyperuricemia in urban areas of China has been noted in the past decade. However, the prevalence of hyperuricemia in rural China has not been extensively investigated. We aimed to estimate the prevalence and risk factors of hyperuricemia and the associated comorbidities in rural Northeast China. This survey was conducted from July 2012 to August 2013. In this study, a total of 11,576 residents from the rural Northeast China were randomly selected and examined. Hyperuricemia was defined as serum uric acid ≥416 μmol/l in men and ≥357 μmol/l in women. Data regarding the demographic and lifestyle characteristics and the blood biochemical indexes of these participants were collected by well-trained personnel. The prevalence of hyperuricemia was 10.9 % and was more prevalent in men than in women (15.0 vs. 7.3 %, P < 0.001). Multivariate logistic regression models revealed that besides age, hyperuricemia in men was associated with ethnic minority [OR (95 %): 0.683 (0.472,0.989)], physical activity [moderate, OR (95 %): 0.716 (0.596,0.859); high, OR (95 %): 0.527 (0.354,0.786)], current smoking [OR(95 %):1.380 (1.179,1.616)], and current drinking [OR(95 %):0.705 (0.603,0.825)], while in women was only associated with ethnic minority [OR(95 %):0.485 (0.262,0.896)]. After adjusting for possible confounders, hyperuricemia was related to different subtypes of cardiometabolic comorbidities in both gender like abdominal obesity, general obesity, hypertriglyceridemia, hypertension, hypercholesterolemia, and low HDL-C. Besides, in women only, hyperuricemia was related to diabetes and high LDL-C. Hyperuricemia was common among residents living in rural Northeast China especially among men. Ethnic minority, physical activity, current smoking, and drinking contributed to hyperuricemia in this population.
Chao, Tze-Fan; Liu, Chia-Jen; Chen, Su-Jung; Wang, Kang-Ling; Lin, Yenn-Jiang; Chang, Shih-Lin; Lo, Li-Wei; Hu, Yu-Feng; Tuan, Ta-Chuan; Chen, Tzeng-Ji; Tsao, Hsuan-Ming; Chen, Shih-Ann
2014-01-01
Although hyperuricemia has been reported to be a risk factor of stroke, the relationship between hyperuricemia and stroke in patients with atrial fibrillation (AF) remains uncertain. The goal of the present study was to investigate whether hyperuricemia could potentially refine clinical risk stratification in AF. This study used the "National Health Insurance Research Database" in Taiwan. A total of 7601 AF patients who did not receive antiplatelet agents or oral anticoagulants were identified as the study population. Hyperuricemia was defined as having at least one episode of gout attack necessitating long-term treatment with uric acid-lowering agents. The association between hyperuricemia and ischemic stroke was analyzed. During the follow up of 3.0±2.7 years, 1116 patients (14.7%) experienced ischemic stroke with an annual rate of around 4.9%. Hyperuricemia significantly predicts stroke, with a hazard ratio (HR) of 1.280 after adjusting for CHA2DS2-VASc score and other comorbidities. Among the 376 patients with a CHA2DS2VASc score of 0, hyperuricemia can further stratify them into 2 groups with different stroke rates (7.1% versus 1.3%, p=0.020). The adjusted HR of hyperuricemia in predicting ischemic stroke diminished from 7.491 for patients with a CHA2DS2-VASc score of 0 to 1.659 for those with a score of 3, and became insignificant for patients with a score ≥4. Hyperuricemia was a significant risk factor of stroke which could potentially refine the clinical risk stratification in AF. It deserves a prospective trial to investigate whether it would change the current strategy for stroke preventions using oral anticoagulants. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
HOMA-IR and the risk of hyperuricemia: a prospective study in non-diabetic Japanese men.
Nakamura, Koshi; Sakurai, Masaru; Miura, Katsuyuki; Morikawa, Yuko; Nagasawa, Shin-Ya; Ishizaki, Masao; Kido, Teruhiko; Naruse, Yuchi; Nakashima, Motoko; Nogawa, Kazuhiro; Suwazono, Yasushi; Nakagawa, Hideaki
2014-10-01
To examine the relation of insulin resistant status determined by homeostasis model assessment of insulin resistance (HOMA-IR) with the risk of incident hyperuricemia. The study participants included 2071 Japanese men without hyperuricemia and diabetes, aged 35-54 years. The participants had undergone annual heath examinations for 6 years to compare incident hyperuricemia (serum uric acid >416.4μmol/L (7.0mg/dL) and/or taking medication for hyperuricemia) in four groups based on quartiles of baseline HOMA-IR. During follow-up there were 331 incident cases of hyperuricemia. The hazard ratios for hyperuricemia, compared with HOMA-IR ≤0.66, were 1.42 (95% confidence interval 1.02-1.98) for HOMA-IR 0.67-0.98, 1.20 (0.86-1.68) for HOMA-IR 0.99-1.49 and 1.44 (1.04-1.98) for HOMA-IR ≥1.50 after adjustment for baseline serum uric acid, creatinine, hypercholesterolemia and hypertension status, age, alcohol intake, and smoking and exercise habits. The hazard ratio associated with an increase of one standard deviation in lnHOMA-IR (1.85 as one geometric standard deviation of HOMA-IR) was 1.14 (1.03-1.28) (p for trend=0.02). Increased HOMA-IR independently predicted the subsequent development of hyperuricemia. Insulin resistance itself or compensatory hyperinsulinemia may contribute to the development of hyperuricemia. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
ABCG2 contributes to the development of gout and hyperuricemia in a genome-wide association study.
Chen, Chung-Jen; Tseng, Chia-Chun; Yen, Jeng-Hsien; Chang, Jan-Gowth; Chou, Wen-Cheng; Chu, Hou-Wei; Chang, Shun-Jen; Liao, Wei-Ting
2018-02-16
Although many genome-wide association studies (GWASs) of hyperuricemia or gout have been reported, the related genetic factors and the mechanisms from hyperuricemia to gouty attack remain unclear. This study aimed to identify genetic factors and pathogenesis of gout from hyperuricemia by genome-wide association study (GWAS). 747 gout patients, 747 hyperuricemia and 2071 age-matched controls were recruited and analyzed with Affymetrix 650 K chip to find the related genetic variants. The functions of the related genes were investigated in an endothelial cell (EC) with urate crystal stimulation. The GWAS results showed 36 SNPs to be strongly associated with gout compared to controls (all p-values < 10 -7 ). Whereas the rs2231142 in ABCG2 gene had significant associations between gout and controls, between gout and hyperuricemia, and between hyperuricemia and controls (all p-values < 10 -7 ), and the ORs were 4.34, 3.37 and 2.15 (all p-values < 0.001) after adjustment of potential confounders, respectively. The cell model showed significantly higher IL-8 release from EC combined with ABCG2 knockdown. We concluded that ABCG2 gene contributed to hyperuricemia but also gout, and that it was involved in the inflammation dysregulation via augmented IL-8 release in EC.
Sugar-sweetened soda consumption, hyperuricemia, and kidney disease
Bomback, Andrew S.; Derebail, Vimal K.; Shoham, David A.; Anderson, Cheryl A.; Steffen, Lyn M.; Rosamond, Wayne D.; Kshirsagar, Abhijit V.
2012-01-01
The metabolism of high-fructose corn syrup used to sweeten soda drinks may lead to elevations in uric acid levels. Here we determined whether soda drinking is associated with hyperuricemia and, as a potential consequence, reduced kidney function. At baseline, 15,745 patients in the Atherosclerosis Risk in Communities Study completed a dietary questionnaire and had measurements of their serum creatinine and uric acid. After 3 and 9 years of follow-up, multivariate odds ratios from logistic regressions for binary outcome of hyperuricemia and chronic kidney disease (eGFR less than 60 ml/min per 1.73 m2) were evaluated. Compared to participants who drank less, consumption of over one soda per day was associated with increased odds of prevalent hyperuricemia and chronic kidney disease. The odds ratio for chronic kidney disease significantly increased to 2.59 among participants who drank more than one soda per day and had a serum uric acid level over 9.0 mg/dl. In longitudinal analyses, however, drinking more than one soda per day was not associated with hyperuricemia or chronic kidney disease. Neither preexistent hyperuricemia nor development of hyperuricemia modified the lack of association between soda drinking and incident chronic kidney disease. Thus our study shows that high consumption of sugar-sweetened soda was associated with prevalent but not incident hyperuricemia and chronic kidney disease. PMID:20032963
Cristóbal-García, Magdalena; García-Arroyo, Fernando E.; Arellano-Buendía, Abraham S.; Madero, Magdalena; Rodríguez-Iturbe, Bernardo; Pedraza-Chaverrí, José; Zazueta, Cecilia; Johnson, Richard J.; Sánchez Lozada, Laura-Gabriela
2015-01-01
We addressed if oxidative stress in the renal cortex plays a role in the induction of hypertension and mitochondrial alterations in hyperuricemia. A second objective was to evaluate whether the long-term treatment with the antioxidant Tempol prevents renal oxidative stress, mitochondrial alterations, and systemic hypertension in this model. Long-term (11-12 weeks) and short-term (3 weeks) effects of oxonic acid induced hyperuricemia were studied in rats (OA, 750 mg/kg BW), OA+Allopurinol (AP, 150 mg/L drinking water), OA+Tempol (T, 15 mg/kg BW), or vehicle. Systolic blood pressure, renal blood flow, and vascular resistance were measured. Tubular damage (urine N-acetyl-β-D-glucosaminidase) and oxidative stress markers (lipid and protein oxidation) along with ATP levels were determined in kidney tissue. Oxygen consumption, aconitase activity, and uric acid were evaluated in isolated mitochondria from renal cortex. Short-term hyperuricemia resulted in hypertension without demonstrable renal oxidative stress or mitochondrial dysfunction. Long-term hyperuricemia induced hypertension, renal vasoconstriction, tubular damage, renal cortex oxidative stress, and mitochondrial dysfunction and decreased ATP levels. Treatments with Tempol and allopurinol prevented these alterations. Renal oxidative stress induced by hyperuricemia promoted mitochondrial functional disturbances and decreased ATP content, which represent an additional pathogenic mechanism induced by chronic hyperuricemia. Hyperuricemia-related hypertension occurs before these changes are evident. PMID:25918583
Relationship between lifestyle choices and hyperuricemia in Chinese men and women.
Liu, Li; Lou, Shanshan; Xu, Ke; Meng, Zhaowei; Zhang, Qing; Song, Kun
2013-02-01
We aimed to explore correlations between lifestyle choices and hyperuricemia in a large Chinese population, emphasizing the differences from opposite sex. Ten thousand four hundred fifty subjects were randomly recruited from Tianjin municipality in China. Hyperuricemia was defined as serum uric acid >420 μmol/L for men and >360 μmol/L for women. Demographic data, highest education degree, work type, commuting means, smoking and drinking status, exercise frequency, and quantitative assessments of dietary factors were collected. Anthropometric measurements and fasting blood tests were performed. Statistical analyses were conducted. Total hyperuricemic prevalence was 12.89 %, with male significantly higher than female. Body mass index, waist circumference, serum indices, and age displayed high correlation coefficients, and most lifestyle factors also showed significant correlations as well. Binary logistic regression models showed odds ratio of developing hyperuricemia were much greater in males than in females by eating habits. However, physical activity-related lifestyle choices tended to cast much greater influences on the likelihood of hyperuricemia in females. Lifestyle choices and hyperuricemia are closely related. For males, eating habits have greater influences on the likelihood of developing hyperuricemia. For females, lifestyle factors like work type, commuting method, and exercise have such effects.
Physiology of Hyperuricemia and Urate-Lowering Treatments.
Benn, Caroline L; Dua, Pinky; Gurrell, Rachel; Loudon, Peter; Pike, Andrew; Storer, R Ian; Vangjeli, Ciara
2018-01-01
Gout is the most common form of inflammatory arthritis and is a multifactorial disease typically characterized by hyperuricemia and monosodium urate crystal deposition predominantly in, but not limited to, the joints and the urinary tract. The prevalence of gout and hyperuricemia has increased in developed countries over the past two decades and research into the area has become progressively more active. We review the current field of knowledge with emphasis on active areas of hyperuricemia research including the underlying physiology, genetics and epidemiology, with a focus on studies which suggest association of hyperuricemia with common comorbidities including cardiovascular disease, renal insufficiency, metabolic syndrome and diabetes. Finally, we discuss current therapies and emerging drug discovery efforts aimed at delivering an optimized clinical treatment strategy.
[Relationship between hyperuricemia and primary nephrotic syndrome in children].
Xiao, Huijie; Li, Qian; Wang, Fang; Yao, Yong; Zhong, Xuhui
2014-11-01
To analyze the relationship between hyperuricemia and primary nephrotic syndrome in childhood. A retrospective study was carried out in 107 children with primary nephrotic syndrome. The clinical data were analyzed with statistical methods to identify the related factors with hyperuricemia. The morbidity of hyperuricemia in children with primary nephrotic syndrome was 45% (48/107). Compared to those in normal serum uric acid group, the incidence of hypertension (33%, 16/48), serum triglyceride [2.59(1.62-3.87) mmol/L], creatinine [43.85(33.38-56.38)mmol/L], urea [6.11(3.77-8.40)mmol/L] and blood uric acid/creatinine ratio [9.30(7.03-12.72)] increased while creatinine clearance rate [141.74(103.57-160.97)ml/(min·1.73 (2))] decreased in hyperuricemia group. Hyperuricemia in children with primary nephrotic syndrome correlated with the increase of serum creatinine, urea and blood uric acid/creatinine ratio, the decrease of creatinine clearance rate and the occurance of hypertension.
Aging, not menopause, is associated with higher prevalence of hyperuricemia among older women.
Krishnan, Eswar; Bennett, Mihoko; Chen, Linjun
2014-11-01
This work aims to study the associations, if any, of hyperuricemia, gout, and menopause status in the US population. Using multiyear data from the National Health and Nutrition Examination Survey, we performed unmatched comparisons and one to three age-matched comparisons of women aged 20 to 70 years with and without hyperuricemia (serum urate ≥6 mg/dL). Analyses were performed using survey-weighted multiple logistic regression and conditional logistic regression, respectively. Overall, there were 1,477 women with hyperuricemia. Age and serum urate were significantly correlated. In unmatched analyses (n = 9,573 controls), postmenopausal women were older, were heavier, and had higher prevalence of renal impairment, hypertension, diabetes, and hyperlipidemia. In multivariable regression, after accounting for age, body mass index, glomerular filtration rate, and diuretic use, menopause was associated with hyperuricemia (odds ratio, 1.36; 95% CI, 1.05-1.76; P = 0.002). In corresponding multivariable regression using age-matched data (n = 4,431 controls), the odds ratio for menopause was 0.94 (95% CI, 0.83-1.06). Current use of hormone therapy was not associated with prevalent hyperuricemia in both unmatched and matched analyses. Age is a better statistical explanation for the higher prevalence of hyperuricemia among older women than menopause status.
2014-01-01
Background The prevalence of hyperuricemia has doubled worldwide during the last few decades. The substantial increase in sweetened beverage (SB) consumption has also coincided with the secular trend of hyperuricemia. Recent studies do show that the consumption of SB can induce hyperuricemia. However, the association between SB and hyperuricemia remains unclear. The aim of this study was to evaluate the association between SB consumption and levels of uric acid in Mexican adults. Methods We performed a cross-sectional analysis of data from selected adults participating in the baseline assessment of the Health Workers Cohort Study. A total of 6,705 participants of both sexes between ages 18 and 70 years were included. SB intake was estimated using a validated semi-quantitative food frequency questionnaire. Biochemical and anthropometric information was collected using standard procedures. Hyperuricemia was defined as uric acid levels ≥ 7.0 mg/dL in men and ≥ 5.8 mg/dL in women. The association of interest was assessed by multiple logistic regression models. Results The odds ratios (OR) for hyperuricemia in men who consume 0.5-1 SB/day was 1.59 (95% CI; 1.05-2.40) and 2.29 (95% CI; 1.55-3.38) for those who consume ≥3 SB/day when compared to men who consume less than half a SB/day. In women, the OR for hyperuricemia for those who consume >1.0- < 3.0 SB/day was 1.33 (95% CI; 1.04-1.70) and 1.35 (95% CI; 1.04-1.75) for those who consume ≥3 SB/day when compared to women who consume less than half a SB/day, independent of other covariables. Men and women with high SB consumption and a body mass index (BMI) ≥ 25 Kg/m2 had greater risk for hyperuricemia than men and women with low SB consumption and normal BMI < 25 Kg/m2. Conclusions Our findings suggest that the consumption of SB is associated with an increased risk of hyperuricemia in Mexican adults. However, longitudinal research is needed to confirm the association between SB intake and hyperuricemia. PMID:24884821
Ren, Z; Huang, C; Momma, H; Cui, Y; Sugiyama, S; Niu, K; Nagatomi, R
2016-09-01
Fish consumption is a recognized risk factor for elevated serum uric acid (UA) levels, hyperuricemia, and gout. However, the relationship between the consumption of fish cooked by different methods and the risk of hyperuricemia is unclear. Therefore, we aimed to investigate the relationship between the consumption of fish cooked by different methods and the risk of hyperuricemia in Japanese adults. A 3-year follow-up study was conducted with 424 Japanese adults aged 29-74 years. Fish consumption was assessed using a validated self-administered dietary history questionnaire, and hyperuricemia was defined as serum UA ≥7 mg/dL in men and ≥6 mg/dL in women or the use of any anti-gout treatment. During the 3-year follow-up period, we documented 30 newly diagnosed cases of hyperuricemia. After adjusting for potential confounders, multivariate logistic regressions analysis revealed a significant positive relationship between the risk of hyperuricemia and raw (sashimi and sushi) or roasted fish consumption, but not boiled or fried fish consumption. The odds ratios (95% CI) for hyperuricemia with increasing raw fish consumption were 1.00 (reference), 2.51 (0.85, 7.39), and 3.46 (1.07, 11.14) (P for trend: 0.036). Similarly, the odds ratios (95% CI) with increasing roasted fish consumption were 1.00 (reference), 3.00 (0.75, 11.89), and 5.17 (1.30, 20.62) (P for trend: 0.018). This 3-year follow-up study showed that the consumption of raw or roasted fish, but not boiled or fried fish, was related with a higher risk of hyperuricemia in Japanese adults. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
Japanese guideline for the management of hyperuricemia and gout: second edition.
Yamanaka, Hisashi
2011-12-01
Gout is a urate deposition disease caused by persistent hyperuricemia. Because gout patients present with a variety of clinical symptoms, it is necessary to have a guideline for the standard management and care of gout and hyperuricemia. The Japanese Society of Gout and Nucleic Acid Metabolism, a scientific society committed to study nucleic acid metabolism and related diseases, established the first edition of the "Guideline for the Management of Hyperuricemia and Gout" in 2002, and published the revised version in January 2010. This second edition is not only evidence based on a search of systemic literature, but also includes consensus levels by a Delphi exercise to determine the strength of the recommendations. A draft version of this guideline was reviewed by internal and external reviewers as well as a patient. In this guideline, key messages from each chapter are listed as statements together with the evidence level, consensus level, and strength of the recommendation. In this proceeding, several selected chapters on the clinical management of gout and hyperuricemia are described. We hope this guideline is appropriately used for the standard management and care of patients with hyperuricemia and gout in daily practice.
Recent advances on uric acid transporters
Xu, Liuqing; Shi, Yingfeng; Zhuang, Shougang; Liu, Na
2017-01-01
Uric acid is the product of purine metabolism and its increased levels result in hyperuricemia. A number of epidemiological reports link hyperuricemia with multiple disorders, such as kidney diseases, cardiovascular diseases and diabetes. Recent studies also showed that expression and functional changes of urate transporters are associated with hyperuricemia. Uric acid transporters are divided into two categories: urate reabsorption transporters, including urate anion transporter 1 (URAT1), organic anion transporter 4 (OAT4) and glucose transporter 9 (GLUT9), and urate excretion transporetrs, including OAT1, OAT3, urate transporter (UAT), multidrug resistance protein 4 (MRP4/ABCC4), ABCG-2 and sodium-dependent phosphate transport protein. In the kidney, uric acid transporters decrease the reabsorption of urate and increase its secretion. These transporters’ dysfunction would lead to hyperuricemia. As the function of urate transporters is important to control the level of serum uric acid, studies on the functional role of uric acid transporter may provide a new strategy to treat hyperuricemia associated diseases, such as gout, chronic kidney disease, hyperlipidemia, hypertension, coronary heart disease, diabetes and other disorders. This review article summarizes the physiology of urate reabsorption and excretion transporters and highlights the recent advances on their roles in hyperuricemia and various diseases. PMID:29246027
Peng, D; Wang, S P; Zhao, D H; Fan, Q C; Shu, J; Liu, J H
2018-05-08
Objective: To explore the effect of hyperuricemia on prognosis in patients with heart failure of coronary heart disease (CHD) after revascularization. Methods: A single-center retrospective study of all subjects who underwent percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG) as revascularization for CHD at Beijing Anzhen Hospital, Capital Medical University, between January 2005 and December 2014 was performed.Patients were divided into two groups by with or without hyperuricemia.The average follow-up was 1 818 d. Results: The Logistic regression analysis revealed that hyperuricemia was independent risk factors of readmission of heart failure( P =0.018, OR =1.499, 95% CI 1.071-2.098). The Cox regression analysis revealed that hyperuricemia was independent risk factor of all-cause mortality( P =0.002, RR =1.520, 95% CI 1.166-1.982), cardiovascular ( CV ) mortality( P =0.001, RR =1.811, 95% CI 1.279-2.566), heart failure mortality( P =0.006, RR =2.151, 95% CI 1.247-3.711). Conclusions: There is negative correlation between level of uric acid and left ventricular ejection fraction (LVEF). The patients with heart failure of coronary heart disease complicated with hyperuricemia have high risk of readmission of heart failure, all-cause mortality, CV mortality andheart failure mortality than patients with normal uric acid level. Hyperuricemia is an independent risk factor for patients with heart failure of coronary heart disease after revascularization.
Cochlear dysfunction in hyperuricemia: otoacoustic emission analysis.
Hamed, Sherifa A; El-Attar, Amal M
2010-01-01
The objective of this study is to provide evidence that primary hyperuricemia is associated with cochlear dysfunction as other metabolic diseases that interfere with cell metabolism. Cochlear function was evaluated in 25 subjects with asymptomatic hyperuricemia using routine diagnostic audiometry along with transient evoked and distortion product otoacoustic emissions (TEOAE and DPOAE, respectively). To support the notion that vascular compromise was a significant underlying factor for such cochlear dysfunction, we assessed vascular anatomical and functional states through measuring the common carotid artery intima-media thickness and flow velocity of the basal intracranial vessels. Compared with control subjects, reduced response levels of TEOAEs (P < .01) and amplitudes of DPOAEs (P < .001) were detected at higher frequencies. The reduced DPOAE levels at 5 kHz and TEOAEs at 4 kHz correlated significantly with uric acid (P < .05; P < .01), patients' age (P < .06; P < .05), duration since diagnosis of hyperuricemia (P < .05; P < .001), common carotid artery intima-media thickness (P < .05), mean flow velocities of middle cerebral arteries (P < .05), and vertebral arteries (P < .01). Multivariate analysis showed that the abnormalities at higher frequencies were significantly correlated with the duration and degree of hyperuricemia. These data suggest that subclinical changes in cochlear function are associated with hyperuricemia. They support the usefulness of otoacoustic emissions in early detection of cochlear dysfunction. It is possible that hyperuricemia could be accompanied by increased stiffness and/or compromise of blood supply of the outer hair cells, which will impair their electromotile response. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Suwazono, Yasushi; Kobayashi, Etsuko; Uetani, Mirei; Miura, Katsuyuki; Morikawa, Yuko; Ishizaki, Masao; Kido, Teruhiko; Nakagawa, Hideaki; Nogawa, Koji
2006-06-01
The C825T variant of the G-protein beta3 subunit (GNB3) gene has attracted renewed attention as a candidate gene for obesity, hypertension and hyperuricemia. The main role of G-protein is to translate signals from the cell surface into a cellular response. The 825T allele is associated with a splice variant of GNB3 protein and enhanced G-protein activation. We examined the relationship between this variant and the risk of hyperuricemia in Japanese workers. The study subjects were 1,452 men and 1,169 women selected from 3,834 men and 2,591 women in 1997. On the basis of common clinical criteria, hyperuricemia I was defined as serum uric acid >or= 7.0 mg/dl in men and 6.0 mg/dl in women or taking antihyperuricemic medication. The hyperuricemia I group consisted of 186 men and 20 women and its control of 1,266 men and 1,149 women. Hyperuricemia II was defined as serum uric acid > 5.7 mg/dl (median) in men and 3.9 mg/dl (median) in women or taking antihyperuricemic medication. The hyperuricemic II group consisted of 684 men and 570 women and its control of 768 men and 599 women. To replicate previous significant results in young Caucasian men, we selected these criteria because the authors of the study in young Caucasian men adopted the median in their subjects as a cut-off. The statistical power was estimated as 99% based on the significant results in Caucasians. Genotype and allele distributions in men and women with hyperuricemia I and II were not significantly different from those in the corresponding control groups. Logistic regression analysis on hyperuricemia I and II, and multiple regression on serum uric acid level demonstrated no significant effect of the C825T genotype. Despite the sufficient statistical power, this study could not demonstrate the significant influence of C825T on hyperuricemia or serum uric acid. The targeting of this polymorphism is unlikely to be beneficial in the prevention of hyperuricemia in the general Japanese population.
Ranjith, Naresh; Myeni, Nomcebo N; Sartorius, Ben; Mayise, Chamsanqua
2017-02-01
To investigate the association between hyperuricemia and major adverse cardiac events (MACE) in patients with acute myocardial infarction (AMI). Consecutive patients admitted with AMI to the Coronary Care Unit at R. K. Khan Hospital (Durban, South Africa) between the years 2006 and 2014 were included. Demographic data, including clinical and biochemical information stored in an electronic database, were obtained from all patients. A total of 2683 patients were studied, of whom 65% were males. The mean age of the participants was 57.1 ± 11.5 years, with 79% presenting with ST elevation myocardial infarction. Sixty-one percent were smokers, 59% had diabetes mellitus, 52% had hypertension, and 58% presented with a family history of premature coronary artery disease. Twenty-six percent (n = 690) had hyperuricemia, were older (59 ± 12.1 vs. 56.5 ± 11.2 years) and more likely to present with hypertension (P < 0.001), lower ejection fraction (P < 0.001), and higher median creatinine levels (P < 0.001). A significantly greater proportion of patients with hyperuricemia experienced MACE (45% vs. 30%, P < 0.001). In both sexes, considerable heterogeneity for risk factors and clinical events was noted in individuals with hyperuricemia. Multivariable analyses for risk factors associated with mortality suggest that hyperuricemia conferred a significantly increased risk of mortality after adjustment [odds ratio (OR) 1.7 (95% confidence interval 1.0-2.8); P = 0.042]. A significant increasing risk trend for MACE was observed for increasing tertiles of serum uric acid concentrations above normal (P < 0.001), particularly for cardiac failure (P < 0.001) and death (P = 0.006). Hyperuricemia is significantly associated with hypertension, renal dysfunction, MACE, and independently confers a higher risk of mortality in patients with AMI. Significant heterogeneity was found by gender for risk factors and clinical events in individuals with hyperuricemia. A graded increase was demonstrated in the risk of MACE, particularly for cardiac failure and death, by increasing tertiles of hyperuricemia.
Sweetened beverages intake, hyperuricemia and metabolic syndrome: the Mexico City Diabetes Study.
López-Molina, Rubén; Parra-Cabrera, Socorro; López-Ridaura, Ruy; González-Villalpando, María E; Ferrannini, Ele; González-Villalpando, Clicerio
2013-12-01
OBJECTIVE. To determine prevalence of hyperuricemia and its relation with intake of sweetened beverages (SB) and metabolic syndrome (MS) in low income urban Mexican population. MATERIALS AND METHODS. A cross-sectional analysis of The Mexico City Diabetes Study, a prospective population-based investigation (1 173 participants) was performed. We used logistic regression, adjusted by pertinent variables. We determined prevalence of hyperuricemia and explored associations of uric acid levels with MS and intake of SB. RESULTS. Prevalence of hyperuricemia was 26.5 and 19.8% in males and females respectively. In an adjusted multivariate model, body mass index, waist circumference, and triglyceride were higher as uric acid quartiles increased (p<0.005-0.001). The odds ratio for MS was 1.48 for 3rd uric acid quartile and 2.03 for 4th quartile. Higher consumption of SB was associated with higher uric acid levels (p<0.001). CONCLUSION. Prevalence of hyperuricemia is high. Potential association with intake of SB, resulting in metabolic alterations should be considered.
Uric Acid, Hyperuricemia and Vascular Diseases
Jin, Ming; Yang, Fan; Yang, Irene; Yin, Ying; Luo, Jin Jun; Wang, Hong; Yang, Xiao-Feng
2011-01-01
Uric acid is the product of purine metabolism. It is known that hyperuricemia, defined as high levels of blood uric acid, is the major etiological factor of gout. A number of epidemiological reports have increasingly linked hyperuricemia with cardiovascular and neurological diseases. Studies highlighting the pathogenic mechanisms of uric acid point to an inflammatory response as the primary mechanism for inducing gout and possibly contributing to uric acid's vascular effects. Monosodium urate (MSU) crystals induce an inflammatory reaction, which are recognized by Toll-like receptors (TLRs). These TLRs then activate NALP3 inflammasome. MSU also triggers neutrophil activation and further produces immune mediators, which lead to a proinflammatory response. In addition, soluble uric acid can also mediate the generation of free radicals and function as a pro-oxidant. This review summarizes the epidemiological studies of hyperuricemia and cardiovascular disease, takes a brief look at hyperuricemia and its role in neurological diseases, and highlights the studies of the advanced pathological mechanisms of uric acid and inflammation. PMID:22201767
Moulin, Stephanie R; Baldo, Marcelo P; Souza, Juliana B; Luchi, Weverton M; Capingana, Daniel P; Magalhães, Pedro; Mill, José G
2017-01-01
Hyperuricemia is associated with cardiovascular disease and its prevalence is unknown in black Africans. This study reports hyperuricemia distribution and its association with cardiovascular risk factors in a selected Angolan population. A cross-sectional study in 585 black Africans was performed. Hyperuricemia was defined as uric acid >7.0 mg/dL in men or >5.7 mg/dL in women. Overall prevalence was 25%. Hyperuricemia was associated with hypertension (odds ratio [OR], 2.20; confidence interval [CI], 95% 1.41-3.47), high waist circumference (OR, 1.67; CI, 95% 1.05-2.65), and metabolic syndrome (OR, 1.66; CI, 95% 1.07-2.57). Compared to those with uric acid levels in the first quartile, individuals in the fourth quartile showed higher body mass index, waist circumference, systolic blood pressure, and plasma levels of creatinine and triglycerides. Hypertension, high waist circumference, and metabolic syndrome were the major cardiovascular risk factors associated with hyperuricemia. ©2016 Wiley Periodicals, Inc.
Tsuruta, Yuki; Kikuchi, Kan; Tsuruta, Yukio; Sasaki, Yuko; Moriyama, Takahito; Itabashi, Mitsuyo; Takei, Takashi; Uchida, Keiko; Akiba, Takashi; Tsuchiya, Ken; Nitta, Kosaku
2015-10-01
Endothelial dysfunction is often found in both hyperuricemia and hemodialysis patients. Recent studies have shown that treating hyperuricemia with allopurinol improves endothelial dysfunction. This study is performed to assess the effect of febuxostat on endothelial dysfunction in hemodialysis patients with hyperuricemia. We randomly assigned 53 hemodialysis patients with hyperuricemia to a febuxostat (10 mg daily) group and a control group and measured flow-mediated dilation, serum uric acid (UA) levels, systolic and diastolic blood pressure, malondialdehyde-modified low-density lipoprotein (MDA-LDL), and highly sensitive C-reactive protein (hsCRP) at baseline and at the end of a 4-week study period. Flow-mediated dilation increased from 5.3% ± 2.4% to 8.9% ± 3.6% in the febuxostat group but did not change significantly in the control group. Treatment with febuxostat resulted in a significant decrease in serum UA level and a significant decrease in MDA-LDL compared with baseline, but no significant difference was observed in hsCRP level or blood pressure. No significant differences were observed in the control group. Febuxostat improved endothelial dysfunction and reduced serum UA levels and oxidative stress in hemodialysis patients with hyperuricemia. © 2015 International Society for Hemodialysis.
Reis, Luiza N; Renner, Jane D P; Reuter, Cézane P; Horta, Jorge A; Paiva, Dulciane N; Valim, Andréia R de M; Sehn, Ana P; de Mello, Elza D; Burgos, Miria S
To evaluate the possible association between hyperuricemia and cardiorespiratory fitness levels/nutritional profile, grouped into a single variable, in schoolchildren. Cross-sectional study of 2335 students from Elementary schools, aged 7-17 years of both genders, stratified by conglomerates of a municipality in Southern Brazil. Body mass index (BMI) was calculated and cardiorespiratory fitness (CRF) was assessed by the 6-minute run/walk test. The BMI and CRF were grouped into a single variable, considering: (1) low and normal weight/fit; (2) low and normal weight/unfit; (3) overweight-obesity/fit; (4) overweight-obesity/unfit. The Poisson regression (prevalence ratio, PR) was used for the association between hyperuricemia and BMI/CRF ratio with 95% confidence intervals and differences were considered significant when p<0.05. There is an association, although subtle, between the presence of hyperuricemia with low levels of CRF and the presence of excess weight, when grouped into a single variable. Boys and girls with this condition have higher prevalence of hyperuricemia (PR: 1.07; p=0.007 for boys; PR: 1.10; p<0.001 for girls). Together, excess weight and low levels of cardiorespiratory fitness are associated with the presence of hyperuricemia in schoolchildren. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné
2018-03-08
Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age ( p -value < 10 -4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women ( p -value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m²; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes ( p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production.
Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné
2018-01-01
Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age (p-value < 10−4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women (p-value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m2; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes (p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production. PMID:29518007
[The relationship between smoking and hyperuricemia in Chinese residents].
Chen, H G; Sheng, L T; Wan, Z Z; Wang, X C; Lin, Y H; Wang, Y X; Pan, X F; Pan, A
2018-05-06
Objective: To explore the relationship between smoking and hyperuricemia in Chinese residents. Methods: Based on data from the China Health and Nutrition Survey (CHNS), residents with blood samples provided in the 2009 round (including information of socio-demographic factors, lifestyle behaviors, medical history, and laboratory examinations etc.) were selected as the participants in the current analysis. Unconditional logistic regression models were utilized to compute the ORs and corresponding 95% CIs for assessing the relationship between smoking and hyperuricemia. Results: Among the 8 785 subjects, 1 435 had hyperuricemia with a prevalence rate of 16.3%, consisting of 886 men and 549 women with prevalence rates of 21.6% (886/4 110) and 11.7% (549/4 675) , respectively. Compared with never smokers, the adjusted OR (95% CI ) for hyperuricemia was 0.83 (0.70-0.98) among current smokers, 0.77 (0.63-0.94) among current smokers with 20-39 years of smoking, and 0.79 (0.65-0.97) among current smokers with 11-20 cigarettes per day. When stratified by gender and compared with non-smoker, the adjusted OR (95% CI ) for hyperuricemia among current smokers compared with never smokers was 0.83 (0.70-0.98) among men, while no significant association was found in female current smokers ( OR= 0.73, 95% CI: 0.42-1.26, P= 0.260). Conclusion: In Chinese residents, there is an inverse association between smoking and hyperuricemia prevalence, and this association may be related to duration and intensity of smoking among current smokers. The findings need to be validated in large prospective cohort studies.
Shimizu, Yuji; Sato, Shimpei; Koyamatsu, Jun; Yamanashi, Hirotomo; Tamai, Mami; Kadota, Koichiro; Arima, Kazuhiko; Yamasaki, Hironori; Takamura, Noboru; Aoyagi, Kiyoshi; Maeda, Takahiro
2014-04-01
The influence of hyperuricemia on atherosclerosis is controversial. Subclinical carotid atherosclerosis can be defined in two ways in terms of mean and maximum carotid intima-media thickness (CIMT): one with mean CIMT≥1.1 mm and the other with maximum CIMT≥1.1 mm. However, no studies have been reported of the association between hyperuricemia and subclinical carotid atherosclerosis while taking the two different ways of classification into account. We conducted a cross-sectional study of 4133 subjects (1492 men and 2641 women) aged 30-89 years undergoing general health check-ups. For analysis of various associations, we calculated the multivariable odds ratios (ORs) for the two ways classifications of subclinical carotid atherosclerosis in relation to hyperuricemia. Hyperuricemia-related renal impairment constitutes a significant marker for subclinical carotid atherosclerosis with mean CIMT≥1.1 mm for both men and women, while hyperuricemia per se was found to be beneficially associated with risk of subclinical carotid atherosclerosis with maximum CIMT≥1.1 mm for men. The classical cardiovascular risk factors without adjustment for glomerular filtration rate (GFR) of ORs for subclinical carotid atherosclerosis (mean CIMT≥1.1 mm) and subclinical carotid atherosclerosis (maximum CIMT≥1.1 mm) were 2.20(1.10-4.22) and 0.84(0.63-1.13) for men and 2.12(1.02-4.38) and 0.92(0.66-1.27) for women. After further adjustment for GFR, the corresponding values were 1.54(0.74-3.20) and 0.67(0.49-0.92) for men and 1.32(0.61-2.88) and 0.80(0.57-1.12) for women. Hyperuricemia-related renal impairment is a significant marker for subclinical carotid atherosclerosis for both men and women, while hyperuricemia per se may be inversely associated with subclinical carotid atherosclerosis for men as seen in a rural community-dwelling Japanese population. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Zhang, Bei; Sun, Yuping; Li, Yuanyuan; Yu, Jiahui; Wang, Tingting; Xia, He; Li, Changgui; Liu, Shiguo; Yao, Hua
2015-01-01
To investigate whether functional variants of five interleukin genes (IL-1β, IL-10, IL-8, IL-18 and IL-18RAP) are associated with susceptibility to hyperuricemia among different nationalities (including Uygur, Kazak and Han populations) in the Xinjiang Autonomous Region of China. A total of 884 hyperuricemia patients and 1316 matched controls were recruited from the First Affiliated Hospital of Xinjiang Medical University in Urumqi. After genotyping of rs4073 in IL-8, rs16944 in IL-1, rs187238 in IL-18, rs1800871 in IL-10 and rs13015714 in IL-18RAP by TaqMan allele discrimination assays, an association analysis was performed using the χ2 test as well as a genotype-phenotype analysis. For the Uygur population, IL-8 rs4073, IL-18 rs187238 and IL-18RAP rs130154 polymorphisms were all associated with hyperuricemia (P<0.001 by genotype and P=0.008, OR 0.802 by allele for IL-8; P=0.01 by genotype and P=0.006, OR 1.332 by allele for IL-18 rs187238; P=0.007 by genotype and P=0.005, OR 1.27 by allele for IL-18RAP rs130154). For the Kazak population, only IL-18 rs187238 showed statistical significance with hyperuricemia (P=0.002 by genotype and P=0.007, OR 1.823 by allele). However, no differences were found between the five SNPs and hyperuricemia among the Han population. This study demonstrated genetic polymorphisms of different interleukin genes related to hyperuricemia vary in different nationalities in the Xinjiang Autonomous Region because of different geographical environments. IL-8, IL-1RL1 and IL-18 might be involved in the development of hyperuricemia in the Uygur population, whereas only IL-18 might be involved in the Kazak population. PMID:26722554
Tai, Tsai-Sung; Hsu, Chih-Cheng; Pai, Hsiang-Chu; Liu, Wen-Hsin; Hsu, Yueh-Han
2013-12-05
Studies have associated betel nut chewing with cancers, metabolic syndrome, cardiovascular disorders, chronic kidney disease, and proteinuria. This study investigated whether hyperuricemia is associated with betel nut chewing in men who participated in a health check-up program. From hospital records, we identified a total of 11,991 men who participated in the health check-up program from 2003 to 2009. They were divided into hyperuricemic group and non-hyperuricemic group. Laboratory tests, medical history, and status of cigarette smoking, alcohol consumption, and betel nut chewing were compared between the 2 groups. We calculated odds ratio (OR) and 95% confidence interval (CI) of hyperuricemia in association with betel nut consumption and other factors. Compared with the non-hyperuricemic group, the hyperuricemic group was slightly older (59.4 vs. 58.6 years) but less prevalent with betel nut use (11.8 vs. 13.6%, p = 0.003). Multivariable logistic regression analysis showed that hyperuricemia was negatively associated with betel nut chewing (OR 0.75, 95% CI 0.66-0.84), older age (OR 0.84, 95% CI 0.77-0.93), and diabetes mellitus (OR 0.57, 95% CI 0.50-0.64). On the other hand, hyperuricemia was positively associated with body mass index (OR 1.75, 95% CI 1.62-1.90), drinking (OR 1.36, 95% CI 1.25-1.49), hypertension (OR 1.41, 95% CI 1.30-1.52), mixed hyperlipidemia (OR 1.84, 95% CI 1.33-2.54), chronic kidney disease (OR 3.28, 95% CI 2.94-3.65), and proteinuria (OR 1.22, 95% CI 1.08-1.38). Smoking, hypercholesterolemia, and hypertriglyceridemia had no significant association with hyperuricemia. Our data suggest that betel nut chewing is negatively associated with hyperuricemia.
Physical Function, Hyperuricemia, and Gout in Older Adults.
Burke, Bridget Teevan; Köttgen, Anna; Law, Andrew; Windham, Beverly Gwen; Segev, Dorry; Baer, Alan N; Coresh, Josef; McAdams-DeMarco, Mara A
2015-12-01
Gout prevalence is high in older adults and those affected are at risk of physical disability, yet it is unclear whether they have worse physical function. We studied gout, hyperuricemia, and physical function in 5,819 older adults (age ≥65 years) attending the 2011-2013 Atherosclerosis Risk in Communities Study visit, a prospective US population-based cohort. Differences in lower extremity function (Short Physical Performance Battery [SPPB] and 4-meter walking speed) and upper extremity function (grip strength) by gout status and by hyperuricemia prevalence were estimated in adjusted ordinal logistic regression (SPPB) and linear regression (walking speed and grip strength) models. Lower scores or times signify worse function. The prevalence of poor physical performance (first quartile) by gout and hyperuricemia was estimated using adjusted modified Poisson regression. Ten percent of participants reported a history of gout and 21% had hyperuricemia. There was no difference in grip strength by history of gout (P = 0.77). Participants with gout performed worse on the SPPB test; they had 0.77 times (95% confidence interval [95% CI] 0.65, 0.90, P = 0.001) the prevalence odds of a 1-unit increase in SPPB score and were 1.18 times (95% CI 1.07, 1.32, P = 0.002) more likely to have poor SPPB performance. Participants with a history of gout had slower walking speed (mean difference -0.03; 95% CI -0.05, -0.01, P < 0.001) and were 1.19 times (95% CI 1.06, 1.34, P = 0.003) more likely to have poor walking speed. Similarly, SPPB score and walking speed, but not grip strength, were worse in participants with hyperuricemia. Older adults with gout and hyperuricemia are more likely to have worse lower extremity, but not upper extremity, function. © 2015, American College of Rheumatology.
Viggiano, Davide; Gigliotti, Giuseppe; Vallone, Gianfranco; Giammarino, Anna; Nigro, Michelangelo; Capasso, Giovambattista
2018-01-01
Current urate-lowering therapy (ULT) includes three direct acting drugs (allopurinol, febuxostat, Rasburicase) and at least four 'indirect' drugs with other important targets (canagliflozin, losartan, fenofibrate and sevelamer). Moreover, the alcalinization of urines using bicarbonate can be used to dissolve urate crystals and the clinician may discontinue several drugs are known to increase serum levels of uric acid, such as diuretics, aspirin, cyclosporine, theophylline, mycophenolate and ACE inhibitors. While there is a consensus to start ULT in cases of symptomatic hyperuricemia (gout, urate-nephrolithiasis), the very frequent conditions of asymptomatic hyperuricemia remains a major conundrum. The effect of asymptomatic hyperuricemia on kidney function has had fluctuating positions over decades. The conflicting results might indicate: (i) the presence of counterbalancing positive and negative effects on kidney function of both serum uric acid and urate-lowering agents, (ii) the presence of a subpopulation of patients, as yet unidentified, which could truly benefit from a urate-lowering therapy. Therefore, today the treatment of asymptomatic hyperuricemia is not recommended nor excluded by current guidelines. Here we suggest that a possible guide for the treatment of asymptomatic hyperuricemia might be the presence of urate crystals in the urine sediment and/or signs of asymptomatic articular damage by urates, identified by musculo-skeletal ultrasound. Moreover, a watchful analysis of the trend in creatinine/eGFR, proteinuria or urate levels might also guide the clinician. Initiation of ULT and follow-up in cases of asymptomatic hyperuricemia should consider urine sediment analysis, musculoskeletal ultrasound and trends in creatinine, proteinuria and serum urate levels. © 2018 The Author(s). Published by S. Karger AG, Basel.
Treating gout in kidney transplant recipients.
Baroletti, Steven; Bencivenga, Gina Ann; Gabardi, Steven
2004-06-01
To review the etiology, treatment, and preventive strategies of hyperuricemia and gout in kidney transplant recipients. Primary literature was obtained via Medline (1966-June 2003). Studies evaluating treatment and prevention of hyperuricemia and gout in kidney transplantation were considered for evaluation. English-language studies were selected for inclusion. Approximately 14,000 kidney transplantations were performed in the United States in 2003, and of those transplant recipients, nearly 13% will experience a new onset of gout. The prevalence of hyperuricemia is even greater. There are several mechanisms by which hyperuricemia and gout develop in kidney transplant recipients. Medication-induced hyperuricemia and renal dysfunction are 2 of the more common mechanisms. Prophylactic and treatment options include allopurinol, colchicine, corticosteroids, and, if absolutely necessary, nonsteroidal antiinflammatory drugs. It is generally recommended to decide whether the risks of prophylactic therapy and treatment outweigh the benefits. Often, the risk of adverse events associated with agents to treat these ailments tends to outweigh the benefits; therefore, treatment is usually reserved for symptomatic episodes of acute gout. Practitioners must also decide if changes in immunosuppressive regimens may be of benefit on a patient-by-patient basis.
Falsetti, Lorenzo; Capeci, William; Tarquinio, Nicola; Viticchi, Giovanna; Silvestrini, Mauro; Catozzo, Vania; Fioranelli, Agnese; Buratti, Laura; Pellegrini, Francesco
2017-01-01
Chronic kidney disease and hyperuricemia have been associated to an increased risk and a worse prognosis in acute ischemic stroke. Several mechanisms, including platelet dysfunction, coagulation disorders, endothelial dysfunction, inflammation, and an increased risk of atrial fibrillation could be implicated. The role of serum uric acid in this setting is still object of debate. We enrolled all the consecutive patients admitted to our department for acute ischemic stroke. Cox regression analysis was used to evaluate the risk of in-hospital death considering serum uric acid levels and all the comorbidities. In the overall sample, hyperuricemia was independently associated to an increased risk of in-hospital mortality. This effect was stronger in patients with chronic kidney disease while, in the group of patients with normal renal function, the relationship between hyperuricemia and increased stroke mortality was not confirmed. Hyperuricemia could be associated to higher in-hospital mortality for ischemic stroke among elderly patients when affected by kidney disease. Survival does not seem to be affected by hyperuricemia in patients with normal kidney function. PMID:28461885
Sakai, Hitomi; Matsuda, Masanori; Kadokura, Genmu; Katsumata, Noriyuki
2016-02-01
A 32 year-old man was diagnosed with retroperitoneal choriocarcinoma with metastasis to the lungs and liver. One cycle of modified BEP regimen did not sufficiently decrease the hCG. Therefore, we chose the GETUG 13 protocol of dose dense chemotherapy. After 6 days of cisplatin administration(3 cycles), he was diagnosed with acute hyperuricemia and kidney injury. He was treated with intravenous hydration and rasburicase. The hyperuricemia improved after a few days.
Woyesa, Shiferaw Bekele; Hirigo, Agete Tadewose; Wube, Temesgen Bizuayehu
2017-12-12
Metabolic syndrome is a cluster of the most dangerous heart attack risk factors such as diabetes and prediabetes, abdominal obesity, high cholesterol and high blood pressure. Hyperuricemia is a condition in which the serum uric acid concentration is greater than 5.5 mg per deciliter for child and greater than 7.2 and 6.0 mg per deciliters for male and female adults respectively. A cross-sectional study was conducted to determine the magnitude of hyperuricemia and associated factors among type 2 diabetes mellitus patients at Hawassa Comprehensive Specialized Hospital (HCSH) from February 28 to May 30 /2017. A random sampling technique was used to include 319 study subjects and a signed consent had been provided by each study subject before running any data collection. An interviewer administered structured questionnaire was used to collect socio-demographic and some clinically useful data. In addition to this, we reviewed the records of the study subjects to obtain other useful clinical data. Five milliliter blood specimen was collected from each study subjects after overnight fasting. A25TM Bio-System Random Access chemistry analyzer was used for blood sample analysis. All data were checked visually, coded and entered into epi-data version 3.4 and statistical analysis was performed using SPSS version 20.0 software. Bi-variate and multivariate logistic regressions were used to determine the association between explanatory and the outcome variables. The prevalence of hyperuricemia and metabolic syndrome among type 2 diabetic patients in the study area were 33.8%(n = 106) and 70.1% (n = 220) respectively. Having age greater or equal to 45 years (AOR: 1.9, CI: 1.-3.2, P value =0.015) and having metabolic syndrome (AOR: 2.6, CI: 1.5-4.7, P value = 0.001) were the determinant variables for hyperuricemia among type 2 diabetic patients. There was high prevalence of hyperuricemia among type 2 diabetic patients with high prevalence of metabolic syndrome. Therefore, regular health information about life style modification, early diagnosis and treatment for hyperuricemia and metabolic syndrome are essential to reduce hyperuricemia and metabolic syndrome in type 2 diabetic patients.
Zhang, Yi; Jin, Lijun; Liu, Jinchang; Wang, Wei; Yu, Haiyang; Li, Jian; Chen, Qian; Wang, Tao
2018-03-25
Dioscin, a spirostane glycoside, the rhizoma of Dioscorea septemloba (Diocoreacea) is used for diuresis, rheumatism, and joints pain. Given the poor solubility and stability of Dioscin, we proposed a hypothesis that Dioscin's metabolite(s) are the active substance(s) in vivo to contribute to the reducing effects on serum uric acid levels. The aim of this study is to identify the active metabolite(s) of Dioscin in vivo and to explore the mechanism of its antihyperuricemic activity. After oral administration of Dioscin in potassium oxonate (PO) induced hyperuricemia rats and adenine-PO induced hyperuricemia mice models, serum uric acid and creatinine levels, clearance of uric acid and creatinine, fractional excretion of uric acid, and renal pathological lesions were determined were used to evaluate the antihyperuricemic effects. Renal glucose transporter-9 (GLUT-9) and organic anion transporter-1 (OAT-1) expressions were analyzed by western blotting method. Renal uric acid excretion was evaluated using stably urate transporter-1 (URAT-1) transfected human epithelial kidney cell line. Intestinal uric acid excretion was evaluated by measuring the transcellular transport of uric acid in HCT116 cells. In hyperuricemia rats, both 25 and 50mg/kg of oral Dioscin decreased serum uric acid levels over 4h. In the hyperuricemia mice, two weeks treatment of Dioscin significantly decreased serum uric acid and creatinine levels, increased clearance of uric acid and creatinine, increased fractional excretion of uric acid, and reduced renal pathological lesions caused by hyperuricemia. In addition, renal GLUT -9 was significantly down-regulated and OAT-1 was up-regulated in Dioscin treated hyperuricemia mice. Dioscin's metabolite Tigogenin significantly inhibited uric acid re-absorption via URAT1 from 10 to 100μM. Diosgenin and Tigogenin increased uric acid excretion via ATP binding cassette subfamily G member 2 (ABCG2). Decreasing effect of Dioscin on serum uric acid level and enhancing effect on urate excretion were confirmed in hyperuricemia animal models. Tigogenin, a metabolite of Dioscin, was identified as an active substance with antihyperuricemic activity in vivo, through inhibition of URAT1 and promotion of ABCG2. Copyright © 2017 Elsevier B.V. All rights reserved.
[Advance in treatment of hyperuricemia by Chinese medicine based on uric acid transporterome].
Zhou, Qi; Liu, Shu-min
2015-11-01
With the development of the quality of life, the morbidity of hyperuricemia is increasing year by year. At the same time, it appears that this disease attacks the young people currently. As the study of pathogenesis of hyperuricemia advanced, a series of uric acid transporters were found during this process. Meanwhile, the definition of transporterome was proposed. They were divided into three groups according to the functions: reabsorption proteins, excretion proteins and skeleton proteins. At moment, the drugs for hyperuricmia mainly include uric acid composition inhibitors and uric acid excretion promoters. Since the excretion of uric acid plays a leading role during the process of attack of hyperurecimia, it makes sense to explore Chinese medicines with clear mechanism targeting the transporterome. Therefore, this paper would focus on transporterome and summarize the mechanisms of Chinese medicines in treating hyperuricemia.
2013-01-01
Background Increased serum urate levels are associated with poor outcomes including but not limited to gout. It is unclear whether serum urate levels are the sole predictor of incident hyperuricemia or whether demographic and clinical risk factors also predict the development of hyperuricemia. The goal of this study was to identify risk factors for incident hyperuricemia over 9 years in a population-based study, ARIC. Methods ARIC recruited individuals from 4 US communities; 8,342 participants who had urate levels <7.0 mg/dL were included in this analysis. Risk factors (including baseline, 3-year, and change in urate level over 3 years) for 9-year incident hyperuricemia (urate level of >7.0 g/dL) were identified using an AIC-based selection approach in a modified Poisson regression model. Results The 9-year cumulative incidence of hyperuricemia was 4%; men = 5%; women = 3%; African Americans = 6% and whites = 3%. The adjusted model included 9 predictors for incident hyperuricemia over 9 years: male sex (RR = 1.73 95% CI: 1.36-2.21), African-American race (RR = 1.79 95% CI: 1.37-2.33), smoking (RR = 1.27, 95% CI: 0.97-1.67),
Bae, Jisuk; Park, Pil Sook; Chun, Byung-Yeol; Choi, Bo Youl; Kim, Mi Kyung; Shin, Min-Ho; Lee, Young-Hoon; Shin, Dong Hoon; Kim, Seong-Kyu
2015-02-01
Caffeine, a commonly consumed food constituent, is known to exert beneficial physiological effects in humans. There is a lack of comprehensive population data for the effects of caffeine intake on urate metabolism. Therefore, the aim of this study was to determine whether coffee, tea, and caffeine intake influences serum uric acid and the risk of hyperuricemia in the Korean Multi-Rural Communities Cohort. We enrolled 9,400 participants in this study. An assessment of various dietary intake amounts of substances such as coffee and tea was performed using a food frequency questionnaire. The content of caffeine was calculated from coffee (74 mg/cup) and tea (15 mg/cup) intake information from the past year. Multivariate logistic regression models, multiple linear regression models, and analysis of covariance were applied to identify any association of dietary intake with serum uric acid levels or the risk of hyperuricemia. No trends for coffee, tea, or caffeine intake were found according to each quintile with serum uric acid in males, although there were weak, marginally significant trends between the content of coffee and caffeine intake and serum uric acid level in females (p = 0.07 for both). Tea intake in males and caffeine intake in females were significantly different between non-hyperuricemia and hyperuricemia (p = 0.04 and p = 0.04, respectively). In addition, a significant association of serum uric acid level with tea intake in males (β = 0.0006, p = 0.02) and with tea intake and caffeine intake in females (β = 0.0003, p = 0.04 and β = 0.0006, p = 0.02, respectively) was observed. There was no effect of coffee, tea, or caffeine intake on the risk of hyperuricemia in either males or females. This study suggests that caffeine consumption might have an effect on serum uric acid in females. However, coffee, tea, and caffeine intake amounts were not associated with the risk of hyperuricemia.
Beck, Bodo B.; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A.; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T.F.
2012-01-01
Homozygous or compound heterozygous Renin (REN) mutations cause renal tubular dysgenesis (RTD), which is characterized by death in utero due to renal failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia and chronic renal failure. So far, only three different heterozygous REN mutations were reported. We performed mutation analysis of the REN gene in 39 kindreds with hyperuricemia and chronic kidney disease (CKD) previously tested negative for mutations in the UMOD and HNF1β genes. We identified one kindred with a novel c.28T>C (p.W10R) REN mutation in the signal sequence, concluding that REN mutations are rare events in CKD patients. Affected individuals over four generations were identified carrying the novel REN mutation and were characterized by significant anemia, hyperuricemia and CKD. Anemia was severe and disproportional to the degree of renal impairment. Moreover all heterozygous REN mutations are localized in the signal sequence. Therefore, screening of the REN gene for CKD patients with hyperuricemia and anemia may be focusing on exon 1 sequencing, which encodes the signal peptide. PMID:21903317
Tojimbara, T; Nakajima, I; Yashima, J; Fuchinoue, S; Teraoka, S
2014-01-01
Febuxostat, a novel nonpurine selective inhibitor of xanthine oxidase, is a potential alternative to allopurinol for patients with hyperuricemia. In this study, we evaluated the efficacy and safety of febuxostat for the management of hyperuricemia in renal transplant recipients. Between June 2012 and January 2013, a total of 22 renal transplant recipients (56 ± 10 years old) with hyperuricemia were enrolled in this study. All patients underwent de novo kidney transplantation, except for 1 patient, who received a second kidney transplant. Ten patients receiving allopurinol and 3 patients receiving benzbromarone were converted to febuxostat at doses of 10-20 mg/d. In the remaining 9 patients, who did not have a history of other urate-lowering medications, febuxostat was initiated at a dose of 10 mg/d. Uric acid levels after initiation of febuxostat were significantly lower than before treatment (5.7 ± 0.7 mg/mL vs 8.0 ± 0.8 mg/mL; P < .001). At last follow-up visit, 16 of the 22 patients (73%) achieved uric acid levels of ≤ 6.0 mg/dL, despite the low dosage of febuxostat. All patients were maintained on febuxostat without serious adverse events, except for 1 patient, who discontinued febuxostat because of numbness in the arms. Low-dose febuxostat is a promising alternative to allopurinol or benzbromarone for the treatment of hyperuricemia in kidney transplant recipients. The long-term urate-lowering efficacy and safety of febuxostat with regard to renal function in kidney transplant recipients with hyperuricemia requires further investigation. Copyright © 2014 Elsevier Inc. All rights reserved.
[Hyperuricemia and gene mutations: a case report].
Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco
2017-06-01
Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.
Lin, Pei-Yi; Lin, Chun-Chen; Liu, Hsi-Che; Lee, Ming-Dar; Lee, Hung-Chang; Ho, Che-Sheng; Chiu, Nan-Chang; Peng, Chun-Chih; Huang, Fu-Yuan; Tsai, Jeng-Daw
2011-11-01
To report the successful use of rasburicase in two children with hyperuricemia secondary to severe rhabdomyolysis. : Case report. Pediatric intensive care unit in a freestanding quaternary hospital. Two pediatric patients with severe rhabdomyolysis and hyperuricemia caused by ecstasy intoxication and exertional heat stroke. Use of a single low dose (6 mg) of rasburicase, a urate oxidase enzyme. Rasburicase was administered on the first and second hospital days with a single low dose of 6 mg (0.086 mg/kg in patient A and 0.092 mg/kg in patient B). Within 24 hrs, the levels of serum uric acid in both patients decreased dramatically, and their creatinine levels decreased and urine output increased concurrently. Continuous improvements in the uric acid levels, creatinine levels, and urine output were noted during hospitalization. Rasburicase seems to be a safe and effective drug for improving hyperuricemia in patients with rhabdomyolysis and renal failure.
Febuxostat for hyperuricemia in patients with advanced chronic kidney disease.
Akimoto, Tetsu; Morishita, Yoshiyuki; Ito, Chiharu; Iimura, Osamu; Tsunematsu, Sadao; Watanabe, Yuko; Kusano, Eiji; Nagata, Daisuke
2014-01-01
Febuxostat is a nonpurine xanthine oxidase (XO) inhibitor, which recently received marketing approval. However, information regarding the experience with this agent among advanced chronic kidney disease (CKD) patients is limited. In the current study, we investigated the effects of oral febuxostat in patients with advanced CKD with asymptomatic hyperuricemia. We demonstrated, for the first time, that not only the serum levels of uric acid (UA) but also those of 8-hydroxydeoxyguanosine, an oxidative stress marker, were significantly reduced after six months of febuxostat treatment, with no adverse events. These results encouraged us to pursue further investigations regarding the clinical impact of lowering the serum UA levels with febuxostat in advanced CKD patients in terms of concomitantly reducing oxidative stress via the blockade of XO. More detailed studies with a larger number of subjects and assessments of the effects of multiple factors affecting hyperuricemia, such as age, sex, and dietary habits, would shed light on the therapeutic challenges of treating asymptomatic hyperuricemia in patients with various stages of CKD.
Jamnik, Joseph; Rehman, Sara; Blanco Mejia, Sonia; de Souza, Russell J; Khan, Tauseef A; Leiter, Lawrence A; Wolever, Thomas M S; Kendall, Cyril W C; Jenkins, David J A; Sievenpiper, John L
2016-10-03
The prevalence of hyperuricemia and gout has increased in recent decades. The role of dietary fructose in the development of these conditions remains unclear. To conduct a systematic review and meta-analysis of prospective cohort studies investigating the association fructose consumption with incident gout and hyperuricemia. MEDLINE, EMBASE and the Cochrane Library were searched (through September 2015). We included prospective cohort studies that assessed fructose consumption and incident gout or hyperuricemia. 2 independent reviewers extracted relevant data and assessed study quality using the Newcastle-Ottawa Scale. We pooled natural-log transformed risk ratios (RRs) using the generic inverse variance method. Interstudy heterogeneity was assessed (Cochran Q statistic) and quantified (I 2 statistic). The overall quality of the evidence was assessed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach. 2 studies involving 125 299 participants and 1533 cases of incident gout assessed the association between fructose consumption and incident gout over an average of 17 years of follow-up. No eligible studies assessed incident hyperuricemia as an outcome. Fructose consumption was associated with an increase in the risk of gout (RR=1.62, 95% CI 1.28 to 2.03, p<0.0001) with no evidence of interstudy heterogeneity (I 2 =0%, p=0.33) when comparing the highest (>11.8% to >11.9% total energy) and lowest (<6.9% to <7.5% total energy) quantiles of consumption. Despite a dose-response gradient, the overall quality of evidence as assessed by GRADE was low, due to indirectness. There were only two prospective cohort studies involving predominantly white health professionals that assessed incident gout, and none assessed hyperuricemia. Fructose consumption was associated with an increased risk of developing gout in predominantly white health professionals. More prospective studies are necessary to understand better the role of fructose and its food sources in the development of gout and hyperuricemia. NCT01608620. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Association of Serum Uric Acid Levels in Psoriasis
Li, Xin; Miao, Xiao; Wang, Hongshen; Wang, Yifei; Li, Fulun; Yang, Qiong; Cui, Rutao; Li, Bin
2016-01-01
Abstract High levels of serum uric acid (SUAC) are frequently detected in patients with psoriasis. However, the relationship between psoriasis and hyperuricemia remains unknown. Here we conducted a meta-analysis to identify the SUAC levels in subjects with psoriasis and to determine whether there is an associated risk between psoriasis and hyperuricemia. A comprehensive search of the literature from January 1980 to November 2014 across 7 databases (MEDLINE, Embase, Cochrane Central Register, and 4 Chinese databases) was conducted to determine whether there is an associated risk between psoriasis and hyperuricemia. Among the 170 identified reports, 14 observational studies were included in this meta-analysis. We found a significant higher SUAC level (MD 0.68, 95% CI 0.26–1.09; P = 0.002) in patients with psoriasis in Western Europe, but no significant differences were found between the East Asia and India subgroup (MD 1.22, 95% CI –0.13–2.56; P = 0.08) or the Middle East subgroup (MD 0.48, 95% CI –0.49–1.44; P = 0.33). Similar results were obtained from the meta-analysis of SUAC levels in subjects with severe psoriasis. Our meta-analysis showed that the correlation between psoriasis and hyperuricemia was either ethnicity- or region-dependent and that patients with psoriasis in Western Europe were more likely to have hyperuricemia. PMID:27175702
USDA-ARS?s Scientific Manuscript database
Reduced renal excretion of uric acid plays a significant role in the development of hyperuricemia and gout in adults. Hyperuricemia has been associated with chronic kidney disease and cardiovascular disease in children and adults. There are limited genome-wide association studies associating genetic...
Uric Acid Induces Renal Inflammation via Activating Tubular NF-κB Signaling Pathway
Zhou, Yang; Fang, Li; Jiang, Lei; Wen, Ping; Cao, Hongdi; He, Weichun; Dai, Chunsun; Yang, Junwei
2012-01-01
Inflammation is a pathologic feature of hyperuricemia in clinical settings. However, the underlying mechanism remains unknown. Here, infiltration of T cells and macrophages were significantly increased in hyperuricemia mice kidneys. This infiltration of inflammatory cells was accompanied by an up-regulation of TNF-α, MCP-1 and RANTES expression. Further, infiltration was largely located in tubular interstitial spaces, suggesting a role for tubular cells in hyperuricemia-induced inflammation. In cultured tubular epithelial cells (NRK-52E), uric acid, probably transported via urate transporter, induced TNF-α, MCP-1 and RANTES mRNA as well as RANTES protein expression. Culture media of NRK-52E cells incubated with uric acid showed a chemo-attractive ability to recruit macrophage. Moreover uric acid activated NF-κB signaling. The uric acid-induced up-regulation of RANTES was blocked by SN 50, a specific NF-κB inhibitor. Activation of NF-κB signaling was also observed in tubule of hyperuricemia mice. These results suggest that uric acid induces renal inflammation via activation of NF-κB signaling. PMID:22761883
Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori
2016-01-01
Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)–induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m3 for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. PMID:27021217
NASA Astrophysics Data System (ADS)
Li, Min; Hu, Xiaolan; Fan, Yingli; Li, Kun; Zhang, Xiaowei; Hou, Wenshang; Tang, Zhenyu
2016-01-01
Considerable controversy exists regarding the association between hyperuricemia and coronary heart disease (CHD). Therefore, we performed a systematic review and dose-response meta-analysis of prospective studies to examine the controversy. Prospective cohort studies with relative risks (RRs) and 95% confidence intervals (CIs) for CHD according to serum uric acid levels in adults were eligible. A random-effects model was used to compute the pooled risk estimate. The search yielded 29 prospective cohort studies (n = 958410 participants). Hyperuricemia was associated with increased risk of CHD morbidity (adjusted RR 1.13; 95% CI 1.05 to 1.21) and mortality (adjusted RR 1.27; 95% CI 1.16 to 1.39). For each increase of 1 mg/dl in uric acid level, the pooled multivariate RR of CHD mortality was 1.13 (95% CI 1.06 to 1.20). Dose-response analysis indicated that the combined RR of CHD mortality for an increase of 1 mg uric acid level per dl was 1.02 (95% CI 0.84 to 1.24) without heterogeneity among males (P = 0.879, I2 = 0%) and 2.44 (95% CI 1.69 to 3.54) without heterogeneity among females (P = 0.526, I2 = 0%). The increased risk of CHD associated with hyperuricemia was consistent across most subgroups. Hyperuricemia may increase the risk of CHD events, particularly CHD mortality in females.
Sezai, Akira; Obata, Kazuaki; Abe, Keisuke; Kanno, Sakie; Sekino, Hisakuni
2017-10-25
We previously reported that febuxostat was more effective for hyperuricemia than allopurinol. The efficacy, however, of topiroxostat (a novel xanthine oxidase reductase inhibitor similar to febuxostat), for hyperuricemia is unknown.Methods and Results:Patients with cardiovascular disease and hyperuricemia, in whom serum uric acid (s-UA) was controlled at ≤6 mg/dL, were eligible for enrollment. Fifty-five patients were randomized to receive either febuxostat or topiroxostat for 6 months and were switched to the other drug for the following 6 months. The primary endpoint was s-UA. Secondary endpoints included serum creatinine, estimated glomerular filtration rate, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, lipid biomarkers, high-sensitivity C-reactive protein and B-type natriuretic protein. Although s-UA level was similar for both drugs, significantly more patients required dose escalation during treatment with topiroxostat. There were no differences in renal function, inflammatory and lipid markers between the 2 drugs. A biomarker of oxidative stress was significantly lower after 3 months of febuxostat compared with topiroxostat. Febuxostat causes more marked and more rapid reduction of s-UA than topiroxostat. With regard to the antioxidant effect, febuxostat was superior to topiroxostat after 3 months. The renal protective and anti-inflammatory effects of both drugs were also similar after 6 months of treatment. Thus, both of these agents were similarly effective for hyperuricemia in patients with cardiovascular disease.
Nakatsu, Yusuke; Seno, Yasuyuki; Kushiyama, Akifumi; Sakoda, Hideyuki; Fujishiro, Midori; Katasako, Aya; Mori, Keiichi; Matsunaga, Yasuka; Fukushima, Toshiaki; Kanaoka, Ryuhei; Yamamotoya, Takeshi; Kamata, Hideaki; Asano, Tomoichiro
2015-07-01
Xanthine oxidase (XO) is an enzyme involved in the production of uric acid (UA) from purine nucleotides. Numerous recent studies have revealed the likelihood of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) or steatohepatitis (NASH) to be related to hyperuricemia. However, it remains unclear whether elevated serum UA during the development of NAFLD or NASH is a cause or a consequence of these diseases. In this study, the XO inhibitor febuxostat was administered to two types of NASH model mice. Febuxostat exerted a strong protective effect against NASH development induced by a high-fat diet containing trans fatty acid (HFDT). In contrast, methionine choline-deficient-diet-induced NASH development not accompanied by hyperuricemia showed no UA normalization, suggesting that the ameliorating effect of febuxostat occurs via the normalization of hyperuricemia itself and/or accompanying molecular mechanism(s) such as oxidative stress. In the HFDT-fed mice, hyperuricemia, elevated alanine aminotransferase, and increased Tunnel-positive cells in the liver were normalized by febuxostat administration. In addition, upregulation of fatty acid oxidation-related genes, fibrotic change, and increases in collagen deposition, inflammatory cytokine expressions, and lipid peroxidation in the HFDT-fed mice were also normalized by febuxostat administration. Taken together, these observations indicate that administration of febuxostat has a protective effect against HFDT-induced NASH development, suggesting the importance of XO in its pathogenesis. Thus XO inhibitors are potentially potent therapies for patients with NASH, particularly that associated with hyperuricemia. Copyright © 2015 the American Physiological Society.
Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model.
Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi
2015-01-01
To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Losartan can alleviate experimental atherosclerosis induced by hyperuricemia.
Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model
Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi
2015-01-01
Objective: To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Methods: Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. Results: After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Conclusions: Losartan can alleviate experimental atherosclerosis induced by hyperuricemia. PMID:26617751
Zheng, Zihe; Harman, Jane L; Coresh, Josef; Köttgen, Anna; McAdams-DeMarco, Mara A; Correa, Adolfo; Young, Bessie A; Katz, Ronit; Rebholz, Casey M
2018-03-01
A high fructose intake has been shown to be associated with increased serum urate concentration, whereas ascorbate (vitamin C) may lower serum urate by competing with urate for renal reabsorption. We assessed the combined association, as the fructose:vitamin C intake ratio, and the separate associations of dietary fructose and vitamin C intakes on prevalent hyperuricemia. We conducted cross-sectional analyses of dietary intakes of fructose and vitamin C and serum urate concentrations among Jackson Heart Study participants, a cohort of African Americans in Jackson, Mississippi, aged 21-91 y. In the analytic sample (n = 4576), multivariable logistic regression was used to examine the separate associations of dietary intakes of fructose and vitamin C and the fructose:vitamin C intake ratio with prevalent hyperuricemia (serum urate ≥7 mg/dL), after adjusting for age, sex, smoking, waist circumference, systolic blood pressure, estimated glomerular filtration rate, diuretic medication use, vitamin C supplement use, total energy intake, alcohol consumption, and dietary intake of animal protein. Analyses for individual dietary factors (vitamin C, fructose) were adjusted for the other dietary factor. In the fully adjusted model, there were 17% greater odds of hyperuricemia associated with a doubling of the fructose:vitamin C intake ratio (OR: 1.17; 95% CI: 1.08, 1.28), 20% greater odds associated with a doubling of fructose intake (OR: 1.20; 95% CI: 1.08, 1.34), and 13% lower odds associated with a doubling of vitamin C intake (OR: 0.87; 95% CI: 0.78, 0.97). Dietary fructose and the fructose:vitamin C intake ratio were more strongly associated with hyperuricemia among men than women (P-interaction ≤ 0.04). Dietary intakes of fructose and vitamin C are associated with prevalent hyperuricemia in a community-based population of African Americans.
Conen, D; Wietlisbach, V; Bovet, P; Shamlaye, C; Riesen, W; Paccaud, F; Burnier, M
2004-01-01
Background The prevalence of hyperuricemia has rarely been investigated in developing countries. The purpose of the present study was to investigate the prevalence of hyperuricemia and the association between uric acid levels and the various cardiovascular risk factors in a developing country with high average blood pressures (the Seychelles, Indian Ocean, population mainly of African origin). Methods This cross-sectional health examination survey was based on a population random sample from the Seychelles. It included 1011 subjects aged 25 to 64 years. Blood pressure (BP), body mass index (BMI), waist circumference, waist-to-hip ratio, total and HDL cholesterol, serum triglycerides and serum uric acid were measured. Data were analyzed using scatterplot smoothing techniques and gender-specific linear regression models. Results The prevalence of a serum uric acid level >420 μmol/L in men was 35.2% and the prevalence of a serum uric acid level >360 μmol/L was 8.7% in women. Serum uric acid was strongly related to serum triglycerides in men as well as in women (r = 0.73 in men and r = 0.59 in women, p < 0.001). Uric acid levels were also significantly associated but to a lesser degree with age, BMI, blood pressure, alcohol and the use of antihypertensive therapy. In a regression model, triglycerides, age, BMI, antihypertensive therapy and alcohol consumption accounted for about 50% (R2) of the serum uric acid variations in men as well as in women. Conclusions This study shows that the prevalence of hyperuricemia can be high in a developing country such as the Seychelles. Besides alcohol consumption and the use of antihypertensive therapy, mainly diuretics, serum uric acid is markedly associated with parameters of the metabolic syndrome, in particular serum triglycerides. Considering the growing incidence of obesity and metabolic syndrome worldwide and the potential link between hyperuricemia and cardiovascular complications, more emphasis should be put on the evolving prevalence of hyperuricemia in developing countries. PMID:15043756
Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J
2017-11-01
Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.
Zhang, Xiaojie; Lu, Qing; Zhang, Zhuojun; Chen, Yongle; Wang, Yanan; Wang, Youngshi; Li, Zheng; Jiang, Lindi
2018-05-22
To assess the value of three-dimensional speckle tracking echocardiography (3D STE) in evaluating the left ventricular (LV) function in hyperuricemia patients. We enrolled 15 healthy controls and 40 hyperuricemia patients and collected and analyzed full-volume 3D STE images of the left ventricle in the apical four-chamber heart view. Laboratory tests and 3D STE parameters, including left ventricular ejection fraction, left ventricular end-diastolic volume, left ventricular end-systolic volume, stroke volume (SV), global longitudinal strain (GLS), and global circumferential strain (GCS), were compared between hyperuricemia patients and healthy controls. Hyperuricemia patients exhibited higher body mass index (24.70 ± 2.9 vs. 21.83 ± 2.4 kg/m 2 , p = 0.001), C-reactive protein (5.82 ± 9.4 vs. 1.12 ± 1.8 g/L, p = 0.012), alanine transaminase (34.26 ± 26.6 vs. 17.60 ± 13.0 U/L, p = 0.011), aspartate transaminase (24.90 ± 11.3 vs. 17.70 ± 4.1 U/L, p = 0.001), blood urea nitrogen (5.11 ± 1.6 vs. 4.18 ± 0.6 mmol/L, p = 0.046), and serum creatinine (90.25 ± 14.6 vs. 77.93 ± 10.8 μmol/L, p = 0.006) levels, as well as a lower estimated glomerular filtration rate (87.87 ± 16.5 vs. 103.64 ± 11.3 mL/min/1.73m 2 , p = 0.002). The 3D STE parameters reflecting LV function, including SV (54.71 ± 9.6 vs. 61.92 ± 14.4 mL, p = 0.024), GLS (- 20.51 ± 4.0 vs. - 23.20 ± 4.0%, p = 0.019), and GCS (- 31.30 ± 5.0 vs. - 35.65 ± 2.5%, p = 0.000), were significantly decreased in hyperuricemia patients. Furthermore, GCS was significantly correlated with the serum uric acid (sUA) level even after adjustment of confounding variables like age, body mass index, and serum creatinine. 3D STE is a novel technique for recognizing the early decline in LV function, with GLS and GCS serving as reliable indicators, in hyperuricemia patients. Moreover, the degree of decline in LV function may be correlated with the sUA level in hyperuricemia patients.
Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam
2015-07-17
To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥ 6mg/dl for women and ≥ 7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.
Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam
To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥6mg/dl for women and ≥7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.
Beck, Bodo B; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T F
2011-11-01
Homozygous or compound heterozygous mutations in renin (REN) cause renal tubular dysgenesis, which is characterized by death in utero due to kidney failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia, and chronic kidney disease (CKD). To date, only 3 different heterozygous REN mutations have been published. We report mutation analysis of the REN gene in 39 kindreds with hyperuricemia and CKD who previously tested negative for mutations in the UMOD (uromodulin) and HNF1B (hepatocyte nuclear factor 1β) genes. We identified one kindred with a novel thymidine to cytosine mutation at position 28 in the REN complementary DNA, corresponding to a tryptophan to arginine substitution at amino acid 10, which is found within the signal sequence (c.28T>C; p.W10R). On this basis, we conclude that REN mutations are rare events in patients with CKD. Within the kindred, we found affected individuals over 4 generations who carried the novel REN mutation and were characterized by significant anemia, hyperuricemia, and CKD. Anemia was severe and disproportional to the degree of decreased kidney function. Because all heterozygous REN mutations that have been described are localized in the signal sequence, screening of the REN gene for patients with CKD with hyperuricemia and anemia may best be focused on sequencing of exon 1, which encodes the signal peptide. Published by Elsevier Inc.
Corella, D; Silla, J; Ordovás, J M; Sabater, A; Ruiz de la Fuente, S; Portolés, O; González, J I; Saiz, C
1999-12-01
Serum uric acid has been reported to be a risk factor for cardiovascular disease (CVD). The objective of the present work was to determine the prevalence of hyperuricemia in a large size sample of a healthy male population, as well as the association between uric acid and other cardiovascular risk factors. A cross-sectional study was conducted in a randomly selected sample of 1,564 healthy men in Valencia (Spain), aged 20-67 years, working in the automobile industry. Serum values of uric acid, cholesterol, and glucose were obtained, as well as blood pressure and body mass index measurements. An assessment was made of socio-economic data, drug therapy, and smoking. The overall prevalence of hyperuricemia was 5.10%; it increased with age. A marked increase (p < 0.01) of hyperuricemic individuals was observed with increased prevalence of other cardiovascular risk factors (from 1.8% with hyperuricemia alone up to 28% among individuals with four simultaneous risk factors). By means of a multivariate logistic regression analysis, the OR of hyperuricemia associated with each factor were calculated: increased serum glucose was the variable with a stronger association (OR: 2.69; 95%CI: 1.21-5.99), obesity ranking next (OR: 2.50; 95%CI: 1.42-4.49). Statistically significant associations were also observed for increased serum cholesterol, increased blood pressure, and smoking. The prevalence of hyperuricemia varies with the simultaneous presence of other classical cardiovascular risk factors. Even in this healthy mediterranean population, uric acid is significantly associated with several components in the plurimetabolic syndrome.
ERIC Educational Resources Information Center
Lin, Jin-Ding; Lin, Pei-Ying; Lin, Lan-Ping; Hsu, Shang-Wei; Yen, Chia-Feng; Fang, Wen-Hui; Wu, Sheng-Ru; Chien, Wu-Chien; Loh, Ching-Hui; Chu, Cordia M.
2009-01-01
The aims of the preset study were to describe the profile of serum uric acid, the prevalence of hyperuricemia and its risk factors among children and adolescents with intellectual disabilities. We conducted a cross-sectional study of 941 children and adolescents with intellectual disabilities (aged 4-18 years) who participated in annual health…
Genetics of hyperuricemia and gout: implications for the present and future.
George, Ronald L; Keenan, Robert T
2013-02-01
Gout is the most common inflammatory arthropathy and occurs in the setting of elevated serum urate levels. Gout is also known to be associated with multiple comorbidities including cardiovascular disease and the metabolic syndrome. Recent advances in research have increased our understanding and improved our knowledge of the pathophysiology of gout. Genome-wide association studies have permitted the identification of several new and common genetic factors that contribute to hyperuricemia and gout. Most of these are involved with the renal urate transport system (the uric acid transportasome), generally considered the most influential regulator of serum urate homeostasis. Thus far, SCL22A12, SCL2A9, and GLUT9 have been found to have the greatest variation and most influence on serum urate levels. However, genetics are only a part of the explanation in the development of hyperuricemia and gout. As results have been mixed, the role of known urate influential genes in gout's associated comorbidities remains unclear. Regardless, GWAS findings have expanded our understanding of the pathophysiology of hyperuricemia and gout, and will likely play a role in the development of future therapies and treatment of this ancient disease.
Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori
2016-06-01
Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)-induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m(3) for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Estevez-Garcia, Irving O; Gallegos-Nava, Selma; Vera-Pérez, Erika; Silveira, Luis H; Ventura-Ríos, Lucio; Vancini, Gonzalo; Hernández-Díaz, Cristina; Sánchez-Muñoz, Fausto; Ballinas-Verdugo, Martha A; Gutierrez, Marwin; Pineda, Carlos; Rodriguez-Henriquez, Pedro; Castillo-Martínez, Diana; Amezcua-Guerra, Luis M
2018-02-18
To assess potential associations among serum cytokines and microRNA (miR) levels with ultrasound (US) findings suggestive of urate deposits in chronic asymptomatic hyperuricemia and gout. All participants underwent musculoskeletal US and measurements of serum IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IFN-γ, TNF, MCP-1, and ENA-78, as well as miR-146a, miR-155, and miR-223 levels. Thirty individuals with asymptomatic hyperuricemia, 31 normouricemic controls, and 30 gouty patients were included. The frequency of synovitis and double contour sign using US was similar between asymptomatic hyperuricemia (67% and 27%, respectively) and gouty participants (77% and 27%), and each had a higher frequency than controls (45% and 0%). Serum IL-6 and IL-8 levels were similar between patients with asymptomatic hyperuricemia (69.7±73.4 and 18.5±25.6 pg/ml, respectively) and gout (75.8±47.6 and 24.4±31.7 pg/ml), and higher than controls (28.2±17.6 and 7.4±6.0 pg/ml). A similar distribution was observed for miR-155 levels (0.22±0.18, 0.20±0.14, and 0.08±0.04, respectively). Associations between morphostructural abnormalities suggestive of urate deposits (regardless of clinical diagnosis) and serum markers were assessed. Subjects with urate deposits had higher IL-6 (257.2 versus 47.0 pg/mL; P=0.005), IL-8 (73.2 versus 12.0 pg/mL; P=0.026), and miR-155 (0.21 versus 0.16; P=0.015) levels than those without deposition findings. In asymptomatic individuals with chronic hyperuricemia, the presence of synovitis and double contour sign by US may represent a subclinical manifestation of monosodium urate crystals nucleation, capable of triggering inflammatory pathways (IL-6 and IL-8) and mechanisms of intercellular communication (miR-155) similar to what is observed in gout. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Rodilla, Enrique; Pérez-Lahiguera, Francisco; Costa, José A; González, Carmen; Miralles, Amparo; Moral, Desamparados; Pascual, José María
2009-01-17
The aim of the study was to assess the association of serum uric acid levels with microalbuminuria -urinary albumin excretion (UAE)> or = 30mg/24h-. Cross-sectional study in 429 (220 women) hypertensive, non diabetic, never treated patients (mean age: 47 years) with glomerular filtration rate > or =60ml/min/1.73m(2). The prevalence of microalbuminuria was 20.5%; 18% had hyperuricemia and 47% fulfilled the criteria for metabolic syndrome (MS). Baseline UAE correlated in the unvaried analysis to diastolic blood pressure, waist circumference, high-density lipoprotein cholesterol and uric acid. In multiple linear regression models, only MS (beta=0.113; p=0.03), and serum uric acid values (beta=0.04; p=0.05) were independently associated with logUAE, after adjustment for age and sex. Hyperuricemia (serum uric acid level > or =7.0mg/dl for men and > or =6.5mg/dl for women; odds ratio=2.18; 95% confidence interval, 1.21-3.92; p=0.010), and MS (odds ratio=2.16; 95% confidence interval, 1.32-3.53; p=0.002) were independently associated with a higher risk of microalbuminuria in multiple logistic regression analyses. The prevalence of microalbuminuria was 45.8% in patients with coexistent MS and hyperuricemia, as compared to 13.6% in hypertensive patients without it (p<0.001). In patients with concomitant MS and hyperuricemia the probability of being microalbuminuric was 3.7 times higher than in patients without those factors. Serum uric acid level is associated with microalbuminuria. Coexistence of MS and hyperuricemia in hypertensive patients increases almost 4 times the odds of being microalbuminuric.
Management of Gout and Hyperuricemia in CKD.
Vargas-Santos, Ana Beatriz; Neogi, Tuhina
2017-09-01
Hyperuricemia and gout, the clinical manifestation of monosodium urate crystal deposition, are common in patients with chronic kidney disease (CKD). Although the presence of CKD poses additional challenges in gout management, effective urate lowering is possible for most patients with CKD. Initial doses of urate-lowering therapy are lower than in the non-CKD population, whereas incremental dose escalation is guided by regular monitoring of serum urate levels to reach the target level of <6mg/dL (or <5mg/dL for patients with tophi). Management of gout flares with presently available agents can be more challenging due to potential nephrotoxicity and/or contraindications in the setting of other common comorbid conditions. At present, asymptomatic hyperuricemia is not an indication for urate-lowering therapy, though emerging data may support a potential renoprotective effect. Copyright © 2017 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Effects of Pu-erh ripened tea on hyperuricemic mice studied by serum metabolomics.
Zhao, Ran; Chen, Dong; Wu, Hualing
2017-11-15
To evaluate effects of Pu-erh ripened tea in hyperuricemic mice, a mouse hyperuricemia model was developed by oral administration of potassium oxonate for 7 d. Serum metabolomics, based on gas chromatography-mass spectrometry, was used to generate metabolic profiles from normal control, hyperuricemic and allopurinol-treated hyperuricemic mice, as well as hyperuricemic mice given Pu-erh ripened tea at three doses. Pu-erh ripened tea significantly lowered serum uric acid levels. Twelve potential biomarkers associated with hyperuricemia were identified. Pu-erh ripened tea and allopurinol differed in their metabolic effects in the hyperuricemic mice. Levels of glutamic acid, indolelactate, L-allothreonine, nicotinoylglycine, isoleucine, l-cysteine and glycocyamine, all involved in amino acid metabolism, were significantly changed in hyperuricemic mice treated Pu-erh ripened tea. Thus, modulating amino acid metabolism might be the primary mechanism of anti-hyperuricemia by Pu-erh ripened tea. Copyright © 2017 Elsevier B.V. All rights reserved.
Wortmann, Robert L
2002-05-01
Gout continues to be a health problem around the world despite the availability of effective therapies. Although the prevalence is influenced by genetic factors, the associations of alcohol consumption, obesity, and hypertension appear to be partially responsible for the increased prevalence of gout and hyperuricemia in African and Oriental countries. The association between hyperuricemia and cardiovascular disease seems linked to insulin resistance. This relation, in part, explains the common coexistence of hyperlipidemia and glucose intolerance in patients with gout. Accordingly, it is recommended that one pay more attention to dietary manipulation in patients with gout in addition to managing hypertension, obesity, and other medical problems. Although acute gout attacks can be treated, eliminating gout requires effective removal of urate from the body. Allopurinol remains a dominant urate-lowering agent, however its use may be limited by allergic reactions. Uricosuric agents are also effective urate-lowering agents and provide an alternative to allopurinol. Strategies to treat patients who are sensitive to allopurinol continue to evolve.
Association of Kidney Function and Waist Circumference with Uric Acid Levels in South Africans.
Madala, Nomandla Daphne; Dubula, Thozama; Assounga, Alain Guy Honoré; Naicker, Saraladevi
2017-12-01
Recent evidence that hyperuricemia is associated with incident chronic kidney disease (CKD) provides a potential therapeutic target for CKD that has not been explored in Africans. With hyperuricemia and gout increasing globally, we sought to determine their prevalence in South Africans with varying kidney function levels. This was a cross-sectional study of ambulatory adult patients presenting at a General Internal Medicine Outpatients Clinic between September 2012 and March 2014. Demographic, clinical, and laboratory data collected were analyzed using STATA11. Odds ratios (ORs) and 95% confidence intervals were determined using multivariable logistic regression with bootstrapping. There were 225/261 (86.2%) black/Africans, 31/261 (11.9%) Indian South Africans, 3/261 (1.1%) Caucasians, and 2/261 (<1%) mixed ancestry South Africans. Mean age was 51.3 ± 14.5 years. Median (interquartile range) estimated glomerular filtration rate (eGFR) was 71 (38) mL/min/1.73 m 2 and 39.8% (104/261) of patients had CKD. Hyperuricemia prevalence was 43.7% (114/261) and increased from 16.7% in patients with eGFR ≥90 mL/min/1.73 m 2 to 74.2% with eGFR <30 mL/min/1.73 m 2 (P < 0.001). Gout prevalence was 5.4% (14/261), with equal distribution across eGFR categories (0.814). Factors independently associated with hyperuricemia were eGFR <90 [ORs 3.24 (1.15-9.14), 7.28 (2.26-23.49), and 7.88 (1.95-31.82) for eGFR 60-89.9, 30-60, and <30, respectively], albuminuria [2.32 (1.11-4.85)], and waist circumference [1.04 (1.01-1.06) per 1 cm increase]. In univariate and multivariable analysis, gout was positively associated with male gender and cardiovascular disease, while it was negatively associated with African ancestry, but none of these factors remained significant after bootstrapping; ORs 6.65 (0.64-69.24), 4.14 (0.61-28.07), and 0.18 (0.01-2.21), respectively. Hyperuricemia prevalence was high, with CKD and waist circumference being the strongest predictors. Gout was uncommon in black Africans. With population data lacking, screening high-risk individuals may provide insight into the burden of hyperuricemia and gout in South Africa.
Hiramitsu, Shinya; Ishiguro, Yoshiaki; Matsuyama, Hiroyuki; Yamada, Kenji; Kato, Kazuo; Noba, Manji; Uemura, Akihisa; Matsubara, Yoshirou; Yoshida, Satoshi; Kani, Atsushi; Tokuda, Mamoru; Kato, Hisashi; Hasegawa, Kazuo; Uchiyama, Tatsushi; Matsubara, Shiro; Mori, Kazuma; Kimura, Hisashi; Shino, Kenji; Kato, Yasuchika; Ishii, Junichi
2014-01-01
Hyperuricemia is increasing in prevalence and this is paralleled by an increased incidence of acute gout. In addition, there is growing evidence of an association between high serum levels of uric acid (sUA) and cardiovascular disease (CVD). In this preliminary report, we present 12-16 week results from a multicenter, general practice study in which we evaluated the usefulness of febuxostat in a cohort of untreated patients with hyperuricemia with a high prevalence of CVD. Febuxostat titrated from 10 mg/day up to 40 mg/day resulted in statistically significant and clinically relevant reductions in sUA after 12-16 weeks. A "responder" level of 6.0 mg/dL or lower was achieved in 95 of 100 (95%) patients. Significant reductions in sUA were achieved regardless of the presence/absence of coexisting diseases (e.g. CVD, renal insufficiency, diabetes and obesity) or the class of antihypertensive agent being used by the patient. No serious adverse reactions were noted with febuxostat. Although allopurinol has been used generally for hyperuricemia/gout, it is excreted fully via the kidneys, restricting its use in patients with reduced renal function, and its three-times-daily administration leads to poor adherence. Based on the results of this study, febuxostat may provide an easier option than allopurinol for clinicians specializing in CVDs.
The Epidemiology of Uric Acid and Fructose
Rho, Young Hee; Zhu, Yanyan; Choi, Hyon K.
2011-01-01
During the past few decades, the mean serum uric acid levels and the prevalence of hyperuricemia in the general population appear to have increased. Correspondingly, the prevalence and incidence of gout have doubled. Potential reasons behind these trends include the increasing prevalence of obesity and metabolic syndrome, western life-style factors, increased prevalence of medical conditions (e.g. renal conditions, hypertension, and cardiovascular disorders) and use of medications that increase uric acid levels (e.g. diuretics and low-dose aspirin). The substantial increase in sugar-sweetened soft drinks and associated fructose consumption has also coincided with the secular trend of hyperuricemia and gout. Recently, several large-scale epidemiologic studies have clarified a number of these long-suspected risk factors in relation with hyperuricemia and gout. Furthermore, recent studies have illuminated the substantial comorbidities of hyperuricemia and gout, particularly metabolic-cardiovascular-renal conditions. While many prospective studies have suggested an independent association between serum uric acid levels and the future risk of cardiovascular-metabolic morbidities and mortality, only a limited number of randomized clinical trials and observational studies have recently demonstrated that the use of allopurinol can be beneficial against these outcomes. As these data are scarce and the effects of allopurinol might not be limited to lowering serum uric acid levels, the potential causal role of uric acid on these outcomes remains to be clarified with further studies. PMID:22000647
2014-01-01
Background To assess the association of maternal hyperuricemia with adverse pregnancy outcome and neonatal metabolic, neurologic and respiratory disturbances in normotensive singleton pregnant women. Method This prospective multicentric cohort study was conducted on 404 normotensive singleton pregnant women who were admitted for delivery in Vali-Asr and Akbar-Abadi teaching hospitals of Tehran University of Medical Sciences, Tehran, Iran. Upon enrollment maternal and umbilical sera were obtained for determining uric acid levels. 1 and 5 minutes Apgar scores, the need for neonatal resuscitation and neonatal intensive care unit (NICU) admission were recorded. In case of NICU admission a neonatal blood sample was drawn for determining uric acid, blood sugar and bilirubin levels. An intracranial ultrasound imaging was also carried out for the admittd neonates for detecting intraventricular hemorrhage. Results Maternal hyperuricemia (uric acid one standard deviation greater than the appropriate gestational age) was independently associated with preterm birth (odds ratio (OR), 3.17; 95% confidence interval (CI), 2.1 – 4.79), small for gestational age delivery (OR, 1.28; 95% CI, 1.04 – 2.57), NICU admission (OR, 1.65; 95% CI, 1.12 – 2.94) and neonatal IVH (OR, 8.14; 95% CI, 1.11 – 87.1). Conclusions Maternal hyperuricemia in normotensive singleton pregnant women is significantly associated with preterm and SGA delivery and the development of neonatal IVH. PMID:24636149
Serum Uric Acid Is Associated with Poor Outcome in Black Africans in the Acute Phase of Stroke
Ayeah, Chia Mark; Ba, H.; Mbahe, Salomon
2017-01-01
Background Prognostic significance of serum uric acid (SUA) in acute stroke still remains controversial. Objectives To determine the prevalence of hyperuricemia and its association with outcome of stroke patients in the Douala General Hospital (DGH). Methods This was a hospital based prospective cohort study which included acute stroke patients with baseline SUA levels and 3-month poststroke follow-up data. Associations between high SUA levels and stroke outcomes were analyzed using multiple logistic regression and survival analysis (Cox regression and Kaplan-Meier). Results A total of 701 acute stroke patients were included and the prevalence of hyperuricemia was 46.6% with a mean SUA level of 68.625 ± 24 mg/l. Elevated SUA after stroke was associated with death (OR = 2.067; 95% CI: 1.449–2.950; p < 0.001) but did not predict this issue. However, an independent association between increasing SUA concentration and mortality was noted in a Cox proportional hazards regression model (adjusted HR = 1.740; 95% CI: 1.305–2.320; p < 0.001). Furthermore, hyperuricemia was an independent predictor of poor functional outcome within 3 months after stroke (OR = 2.482; 95% CI: 1.399–4.404; p = 0.002). Conclusion The prevalence of hyperuricemia in black African stroke patients is quite high and still remains a predictor of poor outcome. PMID:29082062
An update on the genetic architecture of hyperuricemia and gout.
Merriman, Tony R
2015-04-10
Genome-wide association studies that scan the genome for common genetic variants associated with phenotype have greatly advanced medical knowledge. Hyperuricemia is no exception, with 28 loci identified. However, genetic control of pathways determining gout in the presence of hyperuricemia is still poorly understood. Two important pathways determining hyperuricemia have been confirmed (renal and gut excretion of uric acid with glycolysis now firmly implicated). Major urate loci are SLC2A9 and ABCG2. Recent studies show that SLC2A9 is involved in renal and gut excretion of uric acid and is implicated in antioxidant defense. Although etiological variants at SLC2A9 are yet to be identified, it is clear that considerable genetic complexity exists at the SLC2A9 locus, with multiple statistically independent genetic variants and local epistatic interactions. The positions of implicated genetic variants within or near chromatin regions involved in transcriptional control suggest that this mechanism (rather than structural changes in SLC2A9) is important in regulating the activity of SLC2A9. ABCG2 is involved primarily in extra-renal uric acid under-excretion with the etiological variant influencing expression. At the other 26 loci, probable causal genes can be identified at three (PDZK1, SLC22A11, and INHBB) with strong candidates at a further 10 loci. Confirmation of the causal gene will require a combination of re-sequencing, trans-ancestral mapping, and correlation of genetic association data with expression data. As expected, the urate loci associate with gout, although inconsistent effect sizes for gout require investigation. Finally, there has been no genome-wide association study using clinically ascertained cases to investigate the causes of gout in the presence of hyperuricemia. In such a study, use of asymptomatic hyperurcemic controls would be expected to increase the ability to detect genetic associations with gout.
Uric Acid Excretion Predicts Increased Blood Pressure Among American Adolescents of African Descent.
Mrug, Sylvie; Mrug, Michal; Morris, Anjana Madan; Reynolds, Nina; Patel, Anita; Hill, Danielle C; Feig, Daniel I
2017-04-01
Hyperuricemia predicts the incidence of hypertension in adults and its treatment has blood pressure (BP)-lowering effects in adolescents. To date, no studies have examined the predictive usage of hyperuricemia or urinary uric acid excretion on BP changes in adolescents. Mechanistic models suggest that uric acid impairs both endothelial function and vascular compliance, which would potentially exacerbate a myriad of hypertensive mechanisms, yet little is known about interaction of uric acid and other hypertension risk factors. The primary study was aimed at the effects of stress on BP in adolescents. A community sample of 84 low-income, urban adolescents (50% male, 95% African American, mean age = 13.36 ± 1 years) was recruited from public schools. Youth completed a 12-hour (overnight) urine collection at home and their BP was measured during rest and in response to acute psychosocial stress. Seventy-six of the adolescents participated in a follow-up visit at 1.5 years when their resting BP was reassessed. In this substudy, we assessed the relationship of renal urate excretion and BP reactivity. After adjusting for resting BP levels at baseline and other covariates, higher levels of uric acid excretion predicted greater BP reactivity to acute psychosocial stress and higher resting BP at 18 months. Urinary excretion of uric acid can serve as an alternative, noninvasive measure of serum uric acid levels that are predictive of BP changes. As hyperuricemia-associated hypertension is treatable, urban adolescents may benefit from routine screening for hyperuricemia or high uric acid excretion. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.
Effect of ethanol on metabolism of purine bases (hypoxanthine, xanthine, and uric acid).
Yamamoto, Tetsuya; Moriwaki, Yuji; Takahashi, Sumio
2005-06-01
There are many factors that contribute to hyperuricemia, including obesity, insulin resistance, alcohol consumption, diuretic use, hypertension, renal insufficiency, genetic makeup, etc. Of these, alcohol (ethanol) is the most important. Ethanol enhances adenine nucleotide degradation and increases lactic acid level in blood, leading to hyperuricemia. In beer, purines also contribute to an increase in plasma uric acid. Although rare, dehydration and ketoacidosis (due to ethanol ingestion) are associated with the ethanol-induced increase in serum uric acid levels. Ethanol also increases the plasma concentrations and urinary excretion of hypoxanthine and xanthine via the acceleration of adenine nucleotide degradation and a possible weak inhibition of xanthine dehydrogenase activity. Since many factors such as the ALDH2*1 gene and ADH2*2 gene, daily drinking habits, exercise, and dehydration enhance the increase in plasma concentration of uric acid induced by ethanol, it is important to pay attention to these factors, as well as ingested ethanol volume, type of alcoholic beverage, and the administration of anti-hyperuricemic agents, to prevent and treat ethanol-induced hyperuricemia.
Effect of urate-lowering therapies on renal disease progression in patients with hyperuricemia.
Levy, Gerald D; Rashid, Nazia; Niu, Fang; Cheetham, T Craig
2014-05-01
To evaluate the association between hyperuricemia and renal disease progression in a real-world, large observational database study. We conducted a population-based retrospective cohort study identifying 111,992 patients with hyperuricemia (> 7 mg/dl) from a large medical group. The final cohort were ≥ 18 years old, urate-lowering therapy (ULT)-naïve, and had the following laboratory results available: at least 1 glomerular filtration rate (GFR) level before the index date and at least 1 serum uric acid (sUA) level and GFR in the followup 36-month period. The cohort was categorized into 3 groups: never treated (NoTx), ULT time receiving therapy of < 80% (< 80%), and ULT time receiving therapy of ≥ 80% (≥ 80%). Outcomes were defined as a ≥ 30% reduction in GFR from baseline, dialysis, or GFR of ≤ 15 ml/min. A subanalysis of patients with sUA < 6 mg/dl at study conclusion was performed. Cox proportional hazards regression model determined factors associated with renal function decline. A total of 16,186 patients met inclusion criteria. There were 11,192 NoTx patients, 3902 with < 80% time receiving ULT, and 1092 with ≥ 80% time receiving ULT. Factors associated with renal disease progression were age, sex, hypertension, diabetes, congestive heart failure, hospitalizations, rheumatoid arthritis, and higher sUA at baseline. Time receiving therapy was not associated with renal outcomes. Patients who achieved sUA < 6 mg/dl had a 37% reduction in outcome events (p < 0.0001; HR 0.63, 95% CI: 0.5-0.78). Hyperuricemia is an independent risk factor for renal function decline. Patients treated with ULT who achieved sUA < 6 mg/dl on ULT showed a 37% reduction in outcome events.
Ito, Hiroyuki; Antoku, Shinichi; Furusho, Masahide; Shinozaki, Masahiro; Abe, Mariko; Mifune, Mizuo; Togane, Michiko; Ito, Kiyoko; Sanaka, Tsutomu
2013-01-01
Background/Aims The prevalence of the risk factors for atherosclerosis, other than diabetes mellitus, among type 2 diabetic patients with different stages of chronic kidney disease (CKD) determined by glomerular filtration rate (GFR) was investigated. Methods The prevalence of ten risk factors (age ≥65 years, history of smoking, male gender, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia) was determined in 2,107 Japanese type 2 diabetic patients with different stages of CKD (six stages according to GFR). Results The risk factors for age ≥65 years and male gender were found in 49 and 62% of the study subjects, respectively. The percentages of subjects with a current history of smoking, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia were 35, 44, 47, 70, 61, 13, 21 and 26%, respectively. The prevalence of age ≥65 years, male gender, albuminuria, hypertension, hypo-HDL-cholesterolemia, hyperuricemia and anemia was greater in the later stages of GFR, whereas the prevalence of hypercholesterolemia and obesity did not differ between stages. The prevalence of a current history of smoking was lower in the later stages of GFR. The cumulative number of risk factors increased from 3.1 to 6.8 in the later stages of GFR. Conclusion Among type 2 diabetic patients with CKD, the total number of risk factors increases with the progression of renal dysfunction. It is important to pay attention to newly recognized risk factors for hyperuricemia and anemia, in addition to hypertension, albuminuria and hypo-HDL-cholesterolemia, in monitoring diabetic patients with later stages of CKD. PMID:23904855
Ichikawa, Daisuke; Saito, Toki; Ujita, Waka; Oyama, Hiroshi
2016-12-01
Our purpose was to develop a new machine-learning approach (a virtual health check-up) toward identification of those at high risk of hyperuricemia. Applying the system to general health check-ups is expected to reduce medical costs compared with administering an additional test. Data were collected during annual health check-ups performed in Japan between 2011 and 2013 (inclusive). We prepared training and test datasets from the health check-up data to build prediction models; these were composed of 43,524 and 17,789 persons, respectively. Gradient-boosting decision tree (GBDT), random forest (RF), and logistic regression (LR) approaches were trained using the training dataset and were then used to predict hyperuricemia in the test dataset. Undersampling was applied to build the prediction models to deal with the imbalanced class dataset. The results showed that the RF and GBDT approaches afforded the best performances in terms of sensitivity and specificity, respectively. The area under the curve (AUC) values of the models, which reflected the total discriminative ability of the classification, were 0.796 [95% confidence interval (CI): 0.766-0.825] for the GBDT, 0.784 [95% CI: 0.752-0.815] for the RF, and 0.785 [95% CI: 0.752-0.819] for the LR approaches. No significant differences were observed between pairs of each approach. Small changes occurred in the AUCs after applying undersampling to build the models. We developed a virtual health check-up that predicted the development of hyperuricemia using machine-learning methods. The GBDT, RF, and LR methods had similar predictive capability. Undersampling did not remarkably improve predictive power. Copyright © 2016 Elsevier Inc. All rights reserved.
Ito, Hiroyuki; Antoku, Shinichi; Abe, Mariko; Omoto, Takashi; Shinozaki, Masahiro; Nishio, Shinya; Mifune, Mizuo; Togane, Michiko; Nakata, Masaya; Yamashita, Tatsuya
Objective The effects of febuxostat therapy on hyperuricemia in patients with and without type 2 diabetes were compared in this retrospective observational study after pair-matching using the propensity scores. Methods In total, 160 patients with hyperuricemia were studied as the treated set, and the 155 subjects in whom the administration of febuxostat was not discontinued during the observation period were investigated in the full analysis. The study subjects were divided into two groups based on the style of initiation of febuxostat: initial and switching therapy from allopurinol administration. Results The reduction in the serum uric acid (sUA) levels at six months after the initiation of febuxostat administration did not significantly differ between the patients with and without diabetes in both the initial (206±114 and 226±113 μmol/L in patients with and without diabetes, respectively) and switching (154±91 and 129±90 μmol/L in patients with and without diabetes, respectively) therapy groups. The eGFR values were significantly increased compared to the baseline levels only in the patients without diabetes. The changes in the eGFR values were significantly associated with the presence of diabetes and sUA at baseline in a multivariate analysis. The frequency of adverse events was not significantly different between the patients with and without diabetes. Conclusion Although febuxostat exerted a similar sUA-lowering effect against hyperuricemia in patients with type 2 diabetes compared to those without, the renoprotective effect was attenuated in those with diabetes compared to nondiabetic subjects.
Ito, Hiroyuki; Antoku, Shinichi; Abe, Mariko; Omoto, Takashi; Shinozaki, Masahiro; Nishio, Shinya; Mifune, Mizuo; Togane, Michiko; Nakata, Masaya; Yamashita, Tatsuya
2016-01-01
Objective The effects of febuxostat therapy on hyperuricemia in patients with and without type 2 diabetes were compared in this retrospective observational study after pair-matching using the propensity scores. Methods In total, 160 patients with hyperuricemia were studied as the treated set, and the 155 subjects in whom the administration of febuxostat was not discontinued during the observation period were investigated in the full analysis. The study subjects were divided into two groups based on the style of initiation of febuxostat: initial and switching therapy from allopurinol administration. Results The reduction in the serum uric acid (sUA) levels at six months after the initiation of febuxostat administration did not significantly differ between the patients with and without diabetes in both the initial (206±114 and 226±113 μmol/L in patients with and without diabetes, respectively) and switching (154±91 and 129±90 μmol/L in patients with and without diabetes, respectively) therapy groups. The eGFR values were significantly increased compared to the baseline levels only in the patients without diabetes. The changes in the eGFR values were significantly associated with the presence of diabetes and sUA at baseline in a multivariate analysis. The frequency of adverse events was not significantly different between the patients with and without diabetes. Conclusion Although febuxostat exerted a similar sUA-lowering effect against hyperuricemia in patients with type 2 diabetes compared to those without, the renoprotective effect was attenuated in those with diabetes compared to nondiabetic subjects. PMID:27853065
Serum uric acid and target organ damage in essential hypertension
Ofori, Sandra N; Odia, Osaretin J
2014-01-01
Background Hypertension is a major risk factor for cardiovascular mortality, as it acts through its effects on target organs, such as the heart and kidneys. Hyperuricemia increases cardiovascular risk in patients with hypertension. Objective To assess the relationship between serum uric acid and target organ damage (left ventricular hypertrophy and microalbuminuria) in untreated patients with essential hypertension. Patients and methods: A cross-sectional study was carried out in 130 (85 females, 45 males) newly diagnosed, untreated patients with essential hypertension. Sixty-five healthy age- and sex-matched non-hypertensive individuals served as controls for comparison. Left ventricular hypertrophy was evaluated by cardiac ultrasound scan, and microalbuminuria was assessed in an early morning midstream urine sample by immunoturbidimetry. Blood samples were collected for assessing uric acid levels. Results Mean serum uric acid was significantly higher among the patients with hypertension (379.7±109.2 μmol/L) than in the controls (296.9±89.8 μmol/L; P<0.001), and the prevalence of hyperuricemia was 46.9% among the hypertensive patients and 16.9% among the controls (P<0.001). Among the hypertensive patients, microalbuminuria was present in 54.1% of those with hyperuricemia and in 24.6% of those with normal uric acid levels (P=0.001). Similarly, left ventricular hypertrophy was more common in the hypertensive patients with hyperuricemia (70.5% versus 42.0%, respectively; P=0.001). There was a significant linear relationship between mean uric acid levels and the number of target organ damage (none versus one versus two: P=0.012). Conclusion These results indicate that serum uric acid is associated with target organ damage in patients with hypertension, even at the time of diagnosis; thus, it is a reliable marker of cardiovascular damage in our patient population. PMID:24833906
Serum uric acid and target organ damage in essential hypertension.
Ofori, Sandra N; Odia, Osaretin J
2014-01-01
Hypertension is a major risk factor for cardiovascular mortality, as it acts through its effects on target organs, such as the heart and kidneys. Hyperuricemia increases cardiovascular risk in patients with hypertension. To assess the relationship between serum uric acid and target organ damage (left ventricular hypertrophy and microalbuminuria) in untreated patients with essential hypertension. A cross-sectional study was carried out in 130 (85 females, 45 males) newly diagnosed, untreated patients with essential hypertension. Sixty-five healthy age- and sex-matched non-hypertensive individuals served as controls for comparison. Left ventricular hypertrophy was evaluated by cardiac ultrasound scan, and microalbuminuria was assessed in an early morning midstream urine sample by immunoturbidimetry. Blood samples were collected for assessing uric acid levels. Mean serum uric acid was significantly higher among the patients with hypertension (379.7±109.2 μmol/L) than in the controls (296.9±89.8 μmol/L; P<0.001), and the prevalence of hyperuricemia was 46.9% among the hypertensive patients and 16.9% among the controls (P<0.001). Among the hypertensive patients, microalbuminuria was present in 54.1% of those with hyperuricemia and in 24.6% of those with normal uric acid levels (P=0.001). Similarly, left ventricular hypertrophy was more common in the hypertensive patients with hyperuricemia (70.5% versus 42.0%, respectively; P=0.001). There was a significant linear relationship between mean uric acid levels and the number of target organ damage (none versus one versus two: P=0.012). These results indicate that serum uric acid is associated with target organ damage in patients with hypertension, even at the time of diagnosis; thus, it is a reliable marker of cardiovascular damage in our patient population.
Genomic Influences on Hyperuricemia and Gout.
Merriman, Tony
2017-08-01
Genome-wide association studies (GWAS) have identified nearly 30 loci associated with urate concentrations that also influence the subsequent risk of gout. The ABCG2 Q141 K variant is highly likely to be causal and results in internalization of ABCG2, which can be rescued by drugs. Three other GWAS loci contain uric acid transporter genes, which are also highly likely to be causal. However identification of causal genes at other urate loci is challenging. Finally, relatively little is known about the genetic control of progression from hyperuricemia to gout. Only 4 small GWAS have been published for gout. Copyright © 2017 Elsevier Inc. All rights reserved.
Li, Lanzhou; Teng, Meiyu; Liu, Yange; Qu, Yidi; Zhang, Yuanzhu; Lin, Feng; Wang, Di
2017-01-01
This study was performed to investigate the therapeutic effects and possible mechanisms of sunflower (Helianthus annuus) head extract (SHE) on gout. First, the components of sunflower head powder and SHE were analyzed systematically. SHE, especially SHEB (extracted with 20% ethanol and 80% double-distilled water), strongly suppressed the swelling of the ankles in rats with acute gout induced by monosodium urate (MSU) crystals and reduced the levels of uric acid and xanthine oxidase (XO) in mice with hyperuricemia induced by oteracil potassium and yeast extract powder. Hematoxylin and eosin staining indicated that SHEB reduced inflammation cells and increased the joint space in the ankle compared with the control rats with MSU-induced gout. In the rats with acute gout, among 13 detected inflammatory cytokines, SHEB significantly enhanced the serum levels of interleukin-10 and the monocyte chemoattractant protein 1 α . In the mice with hyperuricemia, SHEB reduced the levels of glutathione peroxidase, superoxide dismutase, malondialdehyde, and nitrogen monoxide in liver tissues. The potential therapeutic effects of SHE on gout are probably due to the production of anti-inflammatory cytokines and the suppression of XO activity via the modulation of oxidative stress status.
Li, Lanzhou; Teng, Meiyu; Liu, Yange; Qu, Yidi; Zhang, Yuanzhu
2017-01-01
This study was performed to investigate the therapeutic effects and possible mechanisms of sunflower (Helianthus annuus) head extract (SHE) on gout. First, the components of sunflower head powder and SHE were analyzed systematically. SHE, especially SHEB (extracted with 20% ethanol and 80% double-distilled water), strongly suppressed the swelling of the ankles in rats with acute gout induced by monosodium urate (MSU) crystals and reduced the levels of uric acid and xanthine oxidase (XO) in mice with hyperuricemia induced by oteracil potassium and yeast extract powder. Hematoxylin and eosin staining indicated that SHEB reduced inflammation cells and increased the joint space in the ankle compared with the control rats with MSU-induced gout. In the rats with acute gout, among 13 detected inflammatory cytokines, SHEB significantly enhanced the serum levels of interleukin-10 and the monocyte chemoattractant protein 1α. In the mice with hyperuricemia, SHEB reduced the levels of glutathione peroxidase, superoxide dismutase, malondialdehyde, and nitrogen monoxide in liver tissues. The potential therapeutic effects of SHE on gout are probably due to the production of anti-inflammatory cytokines and the suppression of XO activity via the modulation of oxidative stress status. PMID:28929115
Nakashima, Akio; Yamauchi, Atsushi; Matsumoto, Junichi; Dohgu, Shinya; Takata, Fuyuko; Koga, Mitsuhisa; Fukae, Jiro; Tsuboi, Yoshio; Kataoka, Yasufumi
2018-05-25
The development of Parkinson's disease (PD) involves the degeneration of dopaminergic neurons caused by oxidative stress. Accumulating clinical evidence indicates that high blood levels of uric acid (UA), an intrinsic antioxidative substance, are associated with reduced risk of PD. However, this hypothesis has not been confirmed by in-vivo experiments. The present study investigated the effects of UA on behavioral abnormalities in the development of PD. We used unilateral 6-hydroxydopamine-lesioned mice, which were fed on a diet containing 1% UA and 2.5% potassium oxonate (an uricase inhibitor) to induce hyperuricemia. A significant elevation in UA levels was found in groups that were fed a UA diet. The 6-hydroxydopamine-lesioned mice showed impaired rotarod performance and increased apomorphine-induced contralateral rotations. These behavioral abnormalities were significantly reversed by feeding a UA diet for 1 week before and 5 weeks after surgery (subchronic hyperuricemia). These behavioral improvements occurred in parallel with recovery of tyrosine hydroxylase protein levels in the lesioned striatal side. The present study with a dietary hyperuricemia mice model confirms that UA exerts a neuroprotective effect on dopaminergic neuronal loss, improving motor dysfunction and ameliorating PD development.
Febuxostat: drug review and update.
Grewal, Harmanjot K; Martinez, Joseph R; Espinoza, Luis R
2014-05-01
Gouty arthritis and hyperuricemia have ailed humans for centuries. Recent advances in understanding of the mechanism(s) of their development have changed our perception of the disease process. Despite these gains, the treatment options available are limited. The FDA approval of febuxostat for the treatment of hyperuricemia in gout has been a significant step forward. Since its approval in 2009, febuxostat has proven to be safe and efficacious although concerns remain regarding its long-term effects and superiority to other uricosuric agents, such as allopurinol. A comprehensive literature review of PubMed and Ovid examining clinical trials and post-marketing studies yielded congruent findings on efficacy and safety in elderly populations and those with mild-to-moderate renal/hepatic impairment. A lack of literature and clinical studies was found with regard to comparison of febuxostat to FDA-approved high-dose allopurinol (> 300 mg), the safety of febuxostat in the treatment of severe renal/hepatic impairment and the benefit in the treatment of secondary cases of hyperuricemia. Febuxostat is effective in the treatment of mild-to-moderate renal/hepatic impairment with dramatic effects on the serum urate level. It can be used safely in patients with hypersensitivity reactions to allopurinol. Further research is needed to determine the long-term benefits and risks.
Kojima, Sunao; Matsui, Kunihiko; Ogawa, Hisao; Jinnouchi, Hideaki; Hiramitsu, Shinya; Hayashi, Takahiro; Yokota, Naoto; Kawai, Naoki; Tokutake, Eiichi; Uchiyama, Kazuaki; Sugawara, Masahiro; Kakuda, Hirokazu; Wakasa, Yutaka; Mori, Hisao; Hisatome, Ichiro; Waki, Masako; Ohya, Yusuke; Kimura, Kazuo; Saito, Yoshihiko
2017-01-01
Since uric acid is associated with cardiovascular and renal disease, a treatment to maintain blood uric acid level may be required in patients with hyperuricemia. This study aims to evaluate preventive effects of febuxostat, a selective xanthine oxidase inhibitor, on cerebral, cardiovascular, and renal events in patients with hyperuricemia compared to conventional treatment. This study is a prospective randomized open-label blinded endpoint study. Patient enrolment was started in November 2013 and was completed in October 2014. The patients will be followed for at least 3 years. The primary endpoint is a composite of cerebral, cardiovascular, and renal events, and all deaths including death due to cerebral, cardiovascular, and renal disease, new or recurring cerebrovascular disease, new or recurring non-fatal coronary artery disease, cardiac failure requiring hospitalization, arteriosclerotic disease requiring treatment, renal impairment, new atrial fibrillation, and all deaths other than cerebral or cardiovascular or renal disease. These events will be independently evaluated by the Event Assessment Committee under blinded information regarding the treatment group. The study was registered at ClinicalTrials.gov with the identifier NCT01984749. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Frezzatti, Rodrigo; Silveira, Paulo Flavio
2011-01-01
Background Acute renal failure is one of the most serious complications of envenoming resulting from Crotalus durissus terrificus bites. This study evaluated the relevance of hyperuricemia and oxidative stress and the effects of allopurinol and probenecid in renal dysfunction caused by direct nephrotoxicity of C. d. terrificus venom. Methodology/Principal Findings Hematocrit, protein, renal function and redox status were assessed in mice. High ratio of oxidized/reduced glutathione and hyperuricemia induced by C. d. terrificus venom were ameliorated by both, allopurinol or probenecid, but only allopurinol significantly reduced the lethality caused by C. d. terrificus venom. The effectiveness of probenecid is compromised probably because it promoted hypercreatinemia and hypocreatinuria and worsed the urinary hypo-osmolality in envenomed mice. In turn, the highest effectiveness of allopurinol might be due to its ability to diminish the intracellular formation of uric acid. Conclusions/Significance Data provide consistent evidences linking uric acid with the acute renal failure induced by C. d. terrificus venom, as well as that this envenoming in mice constitutes an attractive animal model suitable for studying the hyperuricemia and that the allopurinol deserves to be clinically evaluated as an approach complementary to anti-snake venom serotherapy. PMID:21909449
Chen, Rong-Jane; Chen, Mei-Huei; Chen, Yen-Lin; Hsiao, Ching-Mao; Chen, Hsiu-Min; Chen, Siao-Jhen; Wu, Ming-Der; Yech, Yi-Jen; Yuan, Gwo-Fang; Wang, Ying-Jan
2017-07-01
Uric acid (UA) is an end product of purine metabolism by the enzyme xanthine oxidase (XOD). Hyperuricemia is characterized by the accumulation of serum UA and is an important risk factor for gout and many chronic disorders. XOD inhibitors or uricase (catalyzes UA to the more soluble end product) can prevent these chronic diseases. However, currently available hypouricemic agents induce severe side effects. Therefore, we developed new microbial fermented extracts (MFEs) with substantial XOD inhibition activity from Lactobacillus (MFE-21) and Acetobacter (MFE-25), and MFE-120 with high uricase activity from Aspergillus. The urate-lowering effects and safety of these MFEs were evaluated. Our results showed that MFE-25 exerts superior urate-lowering effects in the therapeutic model. In the preventive model, both MFE-120 and MFE-25 significantly reduced UA. The results of the safety study showed that no organ toxicity and no treatment-related adverse effects were observed in mice treated with high doses of MFEs. Taken together, the results showed the effectiveness of MFEs in reducing hyperuricemia without systemic toxicity in mice at high doses, suggesting that they are safe for use in the treatment and prevention of hyperuricemia. Copyright © 2016. Published by Elsevier B.V.
Kuwabara, Masanari; Hisatome, Ichiro; Niwa, Koichiro; Hara, Shigeko; Roncal-Jimenez, Carlos A; Bjornstad, Petter; Nakagawa, Takahiko; Andres-Hernando, Ana; Sato, Yuka; Jensen, Thomas; Garcia, Gabriela; Rodriguez-Iturbe, Bernardo; Ohno, Minoru; Lanaspa, Miguel A; Johnson, Richard J
2018-01-01
Prehypertension frequently progresses to hypertension, a condition associated with high morbidity and mortality from cardiovascular diseases and stroke. However, the risk factors for developing hypertension from prehypertension remain poorly understood. We conducted a retrospective cohort study using the data from 3584 prehypertensive Japanese adults (52.1±11.0 years, 2081 men) found to be prehypertensive in 2004 and reexamined in 2009. We calculated the cumulative incidences of hypertension over 5 years, examined risk factors, and calculated odds ratios (ORs) for developing hypertension after adjustments for age, sex, body mass index, smoking and drinking habits, baseline systolic and diastolic blood pressure, pulse rate, diabetes mellitus, dyslipidemia, chronic kidney disease, and serum uric acid levels. The additional analysis evaluated whether serum uric acid (hyperuricemia) constituted an independent risk factor for developing hypertension. The cumulative incidence of hypertension from prehypertension over 5 years was 25.3%. There were no significant differences between women and men (24.4% versus 26.0%; P =0.28). The cumulative incidence of hypertension in subjects with hyperuricemia (n=726) was significantly higher than those without hyperuricemia (n=2858; 30.7% versus 24.0%; P <0.001). After multivariable adjustments, the risk factors for developing hypertension from prehypertension were age (OR, 1.023; P <0.001), female sex (OR, 1.595; P <0.001), higher body mass index (OR, 1.051; P <0.001), higher baseline systolic (OR, 1.072; P <0.001) and diastolic blood pressure (OR, 1.085; P <0.001), and higher serum uric acid (OR, 1.149; P <0.001). Increased serum uric acid is a strong risk marker for developing hypertension from prehypertension. Further studies are needed to determine whether treatment of hyperuricemia in prehypertensive subjects could impede the onset of hypertension. © 2017 American Heart Association, Inc.
Zhu, X; Chen, J; Han, F; Cheng, M; Xu, L; Zhang, L; Ding, X; Le, Y
2009-11-01
Hyperuricemia and posttransplantation erythrocytosis (PTE) are frequent complications after kidney transplantation and are important risk factors for cardiovascular events. Losartan decreases serum uric acid and hemoglobin (Hb) concentrations and may be a useful agent for treatment of hyperuricemia and PTE. To evaluate the influence of losartan on serum creatinine (SCr), serum uric acid, and hemoglobin (Hb) concentrations in patients after kidney transplantation and to evaluate the safety profile of losartan in these patients. Sixty-six Han Chinese patients (43 men and 23 women; mean [SD] age, 40.45 [11.50] years) were enrolled in the study. All patients had undergone a first cadaveric donor kidney transplantation at least 3 months previously and had stable graft function with SCr concentration less than 176.8 micromol/L and Hb concentration greater than 110 g/L. The patients were divided into 2 groups (losartan group, n = 34; and control group, n = 32) according to the odevity of patient identification number. Patients in the losartan group received losartan, 50 mg/d; patients in the control group did not receive losartan. Each patient was followed up for 6 months. Nine patients in the losartan group and 5 patients in the control group dropped out because of acute renal insufficiency, anemia, acute rejection, or poor compliance. The serum uric acid concentration in the losartan group continuously decreased at months 1, 2, 3, and 6 (P = .12, P = .01, P = .04, and P = .005 compared with baseline, and P = .02, P = .003, P = .02, and P = .006 compared with control), especially in the patients with hyperuricemia (P = .02, P < .001, P = .003, and P < .001 compared with baseline, and P = .02, P = .002, P = .02, and P = .002 compared with control). The Hb level in the losartan group decreased significantly at months 1, 2, 3, and 6 (P = .003, P < .001, P = .004, and P = 0.02 compared with baseline, and P = .001, P < .001, P = .001, and P = .005 compared with control), especially in patients with PTE. In patients without PTE, there was no significant decline in Hb concentration in the losartan group compared with baseline. There was no significant decline in estimated glomerular filtration rate in the losartan group. Losartan may be an effective agent for treatment of hyperuricemia and PTE in Han Chinese patients after kidney transplantation. However, in some patients, losartan may not be safe.
2014-01-01
Background Hyperuricemia is a risk factor for the onset of chronic kidney disease (CKD) and is significantly associated with the progression of CKD. However, there is no sufficient evidence by interventional research supporting a cause-effect relationship. Hyperuricemic patients without gouty arthritis, whose serum urate (SUA) concentration is ≥8.0 mg/dL and who have a complication, are treated by pharmacotherapy in addition to lifestyle guidance. Nevertheless, there is no evidence that rationalizes pharmacotherapy for patients with hyperuricemia who have no complication and whose SUA concentration is below 9.0 mg/dL. Methods/Design The FEATHER (FEbuxostat versus placebo rAndomized controlled Trial regarding reduced renal function in patients with Hyperuricemia complicated by chRonic kidney disease stage 3) study is a prospective, multicenter, double-blind, randomized, placebo-controlled trial of febuxostat—a novel, nonpurine, selective, xanthine oxidase inhibitor. The present study will enroll, at 64 medical institutions in Japan, 400 Japanese patients aged 20 years or older who have hyperuricemia without gouty arthritis, who present CKD stage 3, and whose SUA concentration is 7.1-10.0 mg/dL. Patients are randomly assigned to either the febuxostat or the control group, in which febuxostat tablets and placebo are administered orally, respectively. The dosage of the study drugs should be one 10-mg tablet/day at weeks 1 to 4 after study initiation, increased to one 20-mg tablet/day at weeks 5 to 8, and elevated to one 40-mg tablet/day at week 9 and then maintained until week 108. The primary endpoint is estimated glomerular filtration rate (eGFR) slope. The secondary endpoints include the amount and percent rate of change in eGFR from baseline to week 108, the amount and percent rate of change in SUA concentration from baseline to week 108, the proportion of patients who achieved an SUA concentration ≤6.0 mg/dL, and the incidence of renal function deterioration. Discussion The present study aims to examine whether febuxostat prevents a further reduction in renal function as assessed with eGFR in subjects and will (1) provide evidence to indicate the inverse association between a reduction in SUA concentration and an improvement in renal function and (2) rationalize pharmacotherapy for subjects and clarify its clinical relevance. Trial registration UMIN Identifier: UMIN000008343 PMID:24433285
Prevalence and features of fatty liver detected by physical examination in Guangzhou
Liao, Xian-Hua; Cao, Xu; Liu, Jie; Xie, Xiao-Hua; Sun, Yan-Hong; Zhong, Bi-Hui
2013-01-01
AIM: To investigate the prevalence of fatty liver discovered upon physical examination of Chinese patients and determine the associated clinical characteristics. METHODS: A total of 3433 consecutive patients who received physical examinations at the Huangpu Division of the First Affiliated Hospital at Sun Yat-sen University in Guangzhou, China from June 2010 to December 2010 were retrospectively enrolled in the study. Results of biochemical tests, abdominal ultrasound, electrocardiography, and chest X-ray were collected. The diagnosis of fatty liver was made if a patient met any two of the three following ultrasonic criteria: (1) liver and kidney echo discrepancy and presence of an increased liver echogenicity (bright); (2) unclear intrahepatic duct structure; and (3) liver far field echo decay. RESULTS: The study population consisted of 2201 males and 1232 females, with a mean age of 37.4 ± 12.8 years. When all 3433 patients were considered, the overall prevalence of hyperlipidemia was 38.1%, of fatty liver was 26.0%, of increased alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels was 11.9%, of gallstone was 11.4%, of hyperglycemia was 7.3%, of hypertension was 7.1%, and of hyperuricemia was 6.2%. Of the 2605 patients who completed the abdominal ultrasonography exam, 677 (26.0%) were diagnosed with fatty liver and the prevalence was higher in males (32.5% vs females: 15.3%, P < 0.001). The overall prevalence of fatty liver increased with age, with the peak prevalence (39.5%) found in the 60 to 70-year-old age group. Among patients between the ages of 18 to 50-year-old, the prevalence of fatty liver was significantly higher in males (20.2% vs females: 8.7%, P < 0.001); the difference in prevalence between the two sexes in patients > 50-year-old did not reach statistical significance. Only 430 of the patients diagnosed with fatty liver had complete information; among those, increased ALT and/or AST levels were detected in only 30%, with all disturbances being mild or moderate. In these 430 patients, the overall prevalence of hypertriglyceridemia was 31.4%, of mixed type hyperlipidemia was 20.9%, of hypercholesterolemia was 12.3%, of hyperglycemia was 17.6%, of hypertension was 16.0%, of hyperuricemia was 15.3%, and of gallstone was 14.4%. Again, the prevalences of hypertriglyceridemia and hyperuricemia were higher in males (hypertriglyceridemia, 36.0% vs females: 12.0%, P < 0.05; hyperuricemia, 17.3% vs females: 7.2%, P < 0.05); in contrast, however, the prevalences of mixed type hyperlipidemia and hypercholesterolemia was higher in females (mixed type hyperlipidemia, 18.7% vs females: 30.1%, P < 0.05, hypercholesterolemia, 9.5% vs females: 24.1%, P < 0.05). Finally, comparison of the fatty liver group to the non-fatty liver group showed that prevalences of hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia were higher in the former (all P < 0.01). CONCLUSION: A high prevalence of fatty liver is detected upon physical examination in Guangzhou, and the primary associated clinical findings are hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia. PMID:23983438
Prevalence and features of fatty liver detected by physical examination in Guangzhou.
Liao, Xian-Hua; Cao, Xu; Liu, Jie; Xie, Xiao-Hua; Sun, Yan-Hong; Zhong, Bi-Hui
2013-08-28
To investigate the prevalence of fatty liver discovered upon physical examination of Chinese patients and determine the associated clinical characteristics. A total of 3433 consecutive patients who received physical examinations at the Huangpu Division of the First Affiliated Hospital at Sun Yat-sen University in Guangzhou, China from June 2010 to December 2010 were retrospectively enrolled in the study. Results of biochemical tests, abdominal ultrasound, electrocardiography, and chest X-ray were collected. The diagnosis of fatty liver was made if a patient met any two of the three following ultrasonic criteria: (1) liver and kidney echo discrepancy and presence of an increased liver echogenicity (bright); (2) unclear intrahepatic duct structure; and (3) liver far field echo decay. The study population consisted of 2201 males and 1232 females, with a mean age of 37.4 ± 12.8 years. When all 3433 patients were considered, the overall prevalence of hyperlipidemia was 38.1%, of fatty liver was 26.0%, of increased alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels was 11.9%, of gallstone was 11.4%, of hyperglycemia was 7.3%, of hypertension was 7.1%, and of hyperuricemia was 6.2%. Of the 2605 patients who completed the abdominal ultrasonography exam, 677 (26.0%) were diagnosed with fatty liver and the prevalence was higher in males (32.5% vs females: 15.3%, P < 0.001). The overall prevalence of fatty liver increased with age, with the peak prevalence (39.5%) found in the 60 to 70-year-old age group. Among patients between the ages of 18 to 50-year-old, the prevalence of fatty liver was significantly higher in males (20.2% vs females: 8.7%, P < 0.001); the difference in prevalence between the two sexes in patients > 50-year-old did not reach statistical significance. Only 430 of the patients diagnosed with fatty liver had complete information; among those, increased ALT and/or AST levels were detected in only 30%, with all disturbances being mild or moderate. In these 430 patients, the overall prevalence of hypertriglyceridemia was 31.4%, of mixed type hyperlipidemia was 20.9%, of hypercholesterolemia was 12.3%, of hyperglycemia was 17.6%, of hypertension was 16.0%, of hyperuricemia was 15.3%, and of gallstone was 14.4%. Again, the prevalences of hypertriglyceridemia and hyperuricemia were higher in males (hypertriglyceridemia, 36.0% vs females: 12.0%, P < 0.05; hyperuricemia, 17.3% vs females: 7.2%, P < 0.05); in contrast, however, the prevalences of mixed type hyperlipidemia and hypercholesterolemia was higher in females (mixed type hyperlipidemia, 18.7% vs females: 30.1%, P < 0.05, hypercholesterolemia, 9.5% vs females: 24.1%, P < 0.05). Finally, comparison of the fatty liver group to the non-fatty liver group showed that prevalences of hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia were higher in the former (all P < 0.01). A high prevalence of fatty liver is detected upon physical examination in Guangzhou, and the primary associated clinical findings are hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia.
Yasu, Takeo; Kobayashi, Shunsuke; Horii, Mai; Kurokawa, Yosuke
2016-12-01
Tumor lysis syndrome (TLS) is a life-threatening oncologic emergency. The control of serum uric acid level (UA) is important for prevention of TLS. Febuxostat has demonstrated its superiority over allopurinol in decreasing UA level. We retrospectively evaluated the efficacy of febuxostat 10 mg in prevention of hyperuricemia associated with TLS (HU-TLS) in 12 patients with non-Hodgkin's lymphoma (NHL). Mean UA levels were found to significantly decrease (p = 0.003). HU-TLS was prevented in all patients. Thus, febuxostat 10 mg is effective in prevention of HU-TLS. Future study is need to determine whether the incidence of HU-TLS change with dosage of febuxostat. .
Raffler, Gabriele; Zitt, Emanuel; Sprenger-Mähr, Hannelore; Nagel, Mato; Lhotta, Karl
2016-04-01
Uromodulin (UMOD)-associated kidney disease belongs to the group of autosomal dominant interstitial kidney diseases and is caused by mutations in the UMOD gene. Affected patients present with hyperuricemia, gout, and progressive renal failure. The disease is thought to be very rare but is probably underdiagnosed. Two index patients from two families with tubulointerstitial nephropathy and hyperuricemia were examined, including blood and urine chemistry, ultrasound, and mutation analysis of the UMOD gene. In addition, other available family members were studied. In a 46-year-old female patient with a fractional excretion of uric acid of 3 %, analysis of the UMOD gene revealed a p.W202S missense mutation. The same mutation was found in her 72-year-old father, who suffers from gout and end-stage renal disease. The second index patient was a 47-year-old female with chronic kidney disease and gout for more than 10 years. Her fractional uric acid excretion was 3.5 %. Genetic analysis identified a novel p.H250Q UMOD mutation that was also present in her 12-year-old son, who had normal renal function and uric acid levels. In patients suffering from chronic tubulointerstitial nephropathy, hyperuricemia, and a low fractional excretion of uric acid mutation, analysis of the UMOD gene should be performed to diagnose UMOD-associated kidney disease.
Effects of Sodium Glucose Cotransporter-2 Inhibitors on Serum Uric Acid in Type 2 Diabetes Mellitus.
Ahmadieh, Hala; Azar, Sami
2017-09-01
Hyperuricemia has been linked to metabolic syndrome, cardiovascular disease, and chronic kidney disease. Hyperuricemia and type 2 diabetes mellitus were inter-related, type 2 diabetes mellitus was more at risk of having a higher serum uric acid level, and also individuals with higher serum uric acid had higher risk of developing type 2 diabetes in the future. Insulin resistance seems to play an important role in the causal relationship between metabolic syndrome, type 2 diabetes, and hyperuricemia. Oral diabetic drugs that would have additional beneficial effects on reducing serum uric acid levels are of importance. Selective SGLT2 inhibitors were extensively studied in type 2 diabetes mellitus and were found to have improvement of glycemic control, in addition to their proven metabolic effects on weight and blood pressure. Additional beneficial effect of SGLT2 inhibitors on serum uric acid level reduction is investigated. Recently, data have been accumulating showing that they have additional beneficial effects on serum uric acid reduction. As for the postulated mechanism, serum uric acid decreased in SGLT2 inhibitor users as a result of the increase in the urinary excretion rate of uric acid, due to the inhibition of uric acid reabsorption mediated by the effect of the drug on the GLUT9 isoform 2, located at the collecting duct of the renal tubule.
Lin, Jianping; Chen, Shaoqing; Li, Shuzhen; Lu, Meili
2016-01-01
Background. Chinese medicinal herbs may be useful for the treatment of hyperuricemia, but there has been no systematic assessment of their efficacy and safety. Objectives. To systematically assess the efficacy and safety of Chinese medicinal herbs for the treatment of hyperuricemia. Methods. Six electronic databases were searched from their inception to December 2015. Randomized controlled clinical trials (RCTs) were included. Cochrane criteria were applied to assess the risk of bias. Data analysis was performed using RevMan software version 5.2. Results. Eleven RCTs with 838 patients were included. There was no significant difference in serum uric acid between Chinese medicinal herbs and traditional Western medicine (SME: 0.19, 95% CI: −0.04 to 0.43; p = 0.10). In terms of overall efficacy, the Chinese medicinal herbs were significantly superior to Western medicine (RR: 1.11; 95% CI: 1.04 to 1.17; p = 0.0007). The Chinese medicinal herbs were better than Western medicine in reducing the adverse reactions (RR: 0.30; 95% CI: 0.15 to 0.62; p = 0.001). And all these funnel plots showed unlikelihood of publishing bias. Conclusions. The results indicate that Chinese medicinal herbs may have greater overall efficacy with fewer adverse drug reactions, although the evidence is weak owing to the low methodological quality and the small number of the included trials. PMID:27818696
Mangiferin alleviates hypertension induced by hyperuricemia via increasing nitric oxide releases.
Yang, Hua; Bai, Wenwei; Gao, Lihui; Jiang, Jun; Tang, Yingxi; Niu, Yanfen; Lin, Hua; Li, Ling
2018-06-06
Mangiferin, a natural glucosyl xanthone, was confirmed to be an effective uric acid (UA)- lowering agent with dual action of inhibiting production and promoting excretion of UA. In this study, we aimed to evaluate the effect of mangiferin on alleviating hypertension induced by hyperuricemia. Mangiferin (30, 60, 120 mg/kg) was administered intragastrically to hyperuricemic rats induced by gavage with potassium oxonate (750 mg/kg). Systolic blood pressure (SBP), serum levels of UA, nitric oxide (NO), C-reactionprotein (CRP) and ONOO - were measured. The mRNA and protein levels of endothelial nitric oxide synthase (eNOS), intercellular adhesion molecule-1 (ICAM-1), CRP were also analyzed. Human umbilical vein endothelial cells (HUVECs) were used in vitro studies. Administration of mangiferin significantly decreased the serum urate level and SBP at 8 weeks and last to 12 weeks. Further more, mangiferin could increase the release of NO and decrease the level of CRP in blood. In addition, mangiferin reversed the protein expression of eNOS, CRP, ICAM-1 and ONOO - in aortic segments in hyperuricemic rats. The results in vitro were consistent with the observed results in vivo. Taken together, these data suggested that mangiferin has played an important part in alleviating hypertension induced by hyperuricemia via increasing NO secretion and improving endothelial function. Copyright © 2018 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Hypercalcemia in tumor lysis syndrome.
Shah, Binay Kumar
2014-09-01
Tumor lysis syndrome (TLS) is characterized by hyperkalemia, hyperuricemia, hypocalcemia and hyperphosphatemia. This report describes a case of hypercalcemia in TLS in a patient with diffuse large B cell lymphoma.
... oxidase inhibitor to treat hyperuricemia (high levels of uric acid) in people with gout (sudden attacks of redness, ... is in a class of medications called selective uric acid reabsorption inhibitors. It works by helping the kidneys ...
Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao
2017-04-01
The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P < .05 was regarded as statistically significant. Three SNPs (rs2230911, rs208294 and rs435309) did not deviate significantly from HWE (P > .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P < .001]. There was also a higher risk of primary gout in genotype (CG + GG) compared with genotype CC [OR (95% CI) = 1.876 (1.303, 2.701), P = .001]. However, no significant difference in allelic or genotypic frequency was observed between primary gout patients and hyperuricemia patients (P > .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for primary gout.
Sircar, Dipankar; Chatterjee, Soumya; Waikhom, Rajesh; Golay, Vishal; Raychaudhury, Arpita; Chatterjee, Suparna; Pandey, Rajendra
2015-12-01
Hyperuricemia is a putative risk factor for the progression of chronic kidney disease (CKD). We hypothesized that control of asymptomatic hyperuricemia may slow disease progression in CKD. This was a single-center, double-blind, randomized, parallel-group, placebo-controlled study. Eligible participants were adults from Eastern India aged 18 to 65 years with CKD stages 3 and 4, with asymptomatic hyperuricemia. The intervention group received febuxostat, 40mg, once daily for 6 months, while the placebo group received placebo; both groups were followed up for 6 months. The primary outcome was the proportion of patients showing a >10% decline in estimated glomerular filtration rate (eGFR) from baseline in the febuxostat and placebo groups. Secondary outcomes included changes in eGFRs in the 2 groups from baseline and at the end of the study period. 45 patients in the febuxostat group and 48 in the placebo group were analyzed. Mean eGFR in the febuxostat group showed a nonsignificant increase from 31.5±13.6 (SD) to 34.7±18.1mL/min/1.73m(2) at 6 months. With placebo, mean eGFR decreased from a baseline of 32.6±11.6 to 28.2±11.5mL/min/1.73m(2) (P=0.003). The difference between groups was 6.5 (95% CI, 0.08-12.81) mL/min/1.73m(2) at 6 months (P=0.05). 17 of 45 (38%) participants in the febuxostat group had a >10% decline in eGFR over baseline compared with 26 of 48 (54%) from the placebo group (P<0.004). Limitations of this study included small numbers of patients and short follow-up, and ∼10% of the randomly assigned population dropped out prior to completion. Febuxostat slowed the decline in eGFR in CKD stages 3 and 4 compared to placebo. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Changing electrolyte and acido-basic profile in HIV-infected patients in the HAART era.
Isnard Bagnis, Corinne; Du Montcel, Sophie Tezenas; Fonfrede, Michele; Jaudon, Marie Chantal; Thibault, Vincent; Carcelain, Guislaine; Valantin, Marc Antoine; Izzedine, Hassan; Servais, Aude; Katlama, Christine; Deray, Gilbert
2006-01-01
HIV-infected patients may develop a variety of underreported metabolic abnormalities that may be classified into HIVAN, specific HIV abnormalities, coincidental renal disorders and anti-retroviral-treatment-induced side effects. Our descriptive cross-sectional study evaluates the prevalence of electrolyte and acid base disorders in HIV patients in the HAART era in a tertiary care teaching hospital. All consecutive HIV-infected patients (n = 1,232) presenting at our Department of Infectious Disease over 3 months were included. All available biochemical data obtained at admission or on the day of the visit were analyzed. We identified risk factors for electrolyte and acid base disorders with univariate regression analysis and multivariate stepwise regression analysis. Variables tested for significance included age, sex, absolute CD4 and CD8 counts, hepatitis B and C antibodies, and use and type of anti-retroviral medication. Most frequent and clinically relevant abnormalities were hyperuricemia in 41.3%, hypophosphatemia in 17.2% and low bicarbonate level in 13.6% of HIV-tested patients. Plasma magnesium was out of the normal range in 38.9% and blood glucose in 25.3% of the tested patients. When CD4 count was below 200/mm3, 9.2% of tested patients experienced low serum calcium (vs. 0.5% if CD4 count >200/mm3, p < 0.002), 11.4% increased creatinine plasma level (vs. 2.3% if CD4 count >200/mm3, p < 0.0001) and 24.5% low serum bicarbonate (vs. 13.7% if CD4 count >200/mm3, p < 0.0001). Protease inhibitor treatment was a significant risk factor of hyperuricemia (p < 0.003). Non-nucleoside reverse transcriptase inhibitor therapy was significantly associated with less hyperuricemia (OR = 0.6, 95% CI 0.38-0.96) and with hypophosphatemia (OR = 2.0, 95% CI 1.1-3.4). The profile of biochemical abnormalities in HIV-infected patients has changed, hyperuricemia and hypophosphatemia being the most prevalent. Causes are poorly understood. Interpretation of drug-induced side effects in the HIV patient is only meaningful if performed versus a control group of patients. Copyright 2006 S. Karger AG, Basel
Li, Jianbo; Yang, Yang; Lu, Likang; Ma, Qiujin; Zhang, Jinjie
2018-01-01
Background Morin, one of the most widely distributed flavonoids in plants, has been identified as a potent antihyperuricemic agent. Its poor water solubility and fast in vivo clearance, however, have limited its application in the treatment of hyperuricemia. In this study, a novel amphiphilic polymer (hydroxyethyl starch-deoxycholic acid [HES-DOCA]) was synthesized to overcome these limitations. Methods HES-DOCA conjugates with various substitution degrees were prepared by chemical grafting DOCA to HES through ester formation. The structures of the conjugates were confirmed by infrared spectroscopy and 1H-NMR. Physicochemical characterizations of HES-DOCA nanoparticles-loaded Morin (Morin/HES-DOCA-NPs) were studied using dynamic light scattering and transmission electron microscopy (TEM). In vitro release studies were performed to evaluate the release properties of Morin from the NPs. Subsequently, in vivo pharmacokinetic parameters of Morin/HES-DOCA-NPs were investigated in Wistar rats through intravenous administration (2 mg/kg, equivalent to Morin). Antihyperuricemic efficacy of the NPs was evaluated in a rat hyperuricemic model. Results The optimized HES-based amphiphilic polymer contained approximately 10 DOCA groups per 100 anhydroglucose units of HES, which can spontaneously self-assemble to form spherical NPs as demonstrated by TEM images. Morin/HES-DOCA-NPs were monodispersed (polydispersity index = 0.05) with a mean diameter of 197 nm and exhibited a zeta potential of −14 mV. The use of DOCA as the polymer’s hydrophobic segment enabled high drug loading efficiency (15.6%). After systemic administration, Morin/HES-DOCA-NPs exhibited significantly longer half-life and higher systemic exposure (elimination half-life and area under the plasma concentration–time curve) compared with free drug Morin. In a rat hyperuricemic model, treatment with Morin/HES-DOCA-NPs demonstrated superior therapeutic efficacy over Morin in decreasing serum uric acid level, increasing the uricosuric action, as well as attenuating hyperuricemia-associated inflammation in kidney of rats. Conclusion Collectively, these findings suggest that the novel HES-based NP formulation of Morin may have great potential for clinical treatment of hyperuricemia. PMID:29692610
Tsuji, Takayuki; Ohishi, Kazuhisa; Takeda, Asumi; Goto, Daiki; Sato, Taichi; Ohashi, Naro; Fujigaki, Yoshihide; Kato, Akihiko; Yasuda, Hideo
2018-04-26
Febuxostat is tolerable in chronic kidney disease (CKD) patients with hyperuricemia. However, the long-term effect of lowering uric acid with febuxostat on renal function and blood pressure has not been elucidated. This was a 2 years retrospective observational study. 86 CKD patients with hyperuricemia who continued with allopurinol (allopurinol group, n = 30), switched from allopurinol to febuxostat (switched group, n = 25), or were newly prescribed febuxostat (febuxostat group, n = 31) were included in this study. Serum uric acid, estimated glomerular filtration rate (eGFR), blood pressure, and urinary protein were analyzed. Moreover, the impact of serum uric acid reduction on renal function and blood pressure was assessed. Serum uric acid in the switched and febuxostat groups was significantly reduced at 6 months (switched group; 8.49 ± 1.32-7.19 ± 1.14 mg/dL, p < 0.0001, febuxostat group; 9.43 ± 1.63-6.31 ± 0.90 mg/dL, p < 0.0001). In the allopurinol group, serum uric acid was increased (6.86 ± 0.87-7.10 ± 0.85 mg/dL, p = 0.0213). eGFR was significantly increased (35.2 ± 12.8-37.3 ± 13.9 mL/min/1.73 m 2 , p = 0.0232), while mean arterial pressure (93.1 ± 10.8-88.2 ± 9.5 mmHg, p = 0.0039) was significantly decreased at 6 months in the febuxostat group, resulting in the retention of eGFR for 2 years. The impact of serum uric acid reduction might have beneficial effects on CKD progression and blood pressure. However, a large prospective study is needed to determine the long-term efficacy of febuxostat therapy in CKD patients with hyperuricemia.
Low serum uric acid concentration augments insulin effects on the prevalence of metabolic syndrome.
Porchia, Leonardo M; Gonzalez-Mejia, M Elba; Torres-Rasgado, Enrique; Ruiz-Vivanco, Guadalupe; Pérez-Fuentes, Ricardo
2018-05-01
Insulin and uric acid were shown affect the prevalence of Metabolic Syndrome (MetS), but no studies examine their interaction. Therefore, we conducted this study to determine their biological interaction in subjects from central Mexico. 433 subjects were enrolled for a cross-sectional study. MetS was defined according to the Harmonizing Definition. Hyperuricemia was defined as ≥7.0 mg/dL in males and ≥5.8 mg/dL in females. Hyperinsulinemia was defined as ≥11.0 μU/mL. Pearson correlation coefficient (r) was calculated to determine the association between uric acid or insulin and MetS. Logistic regression was used to determine the risk (odds ratio) of developing MetS. Biological interactions were determined by the PROCESS Macro and Anderson's method. Insulin and uric acid levels were elevated in MetS positive group (p < .05) and correlated with the number of MetS components (r = 0.276 and r = 0.166, p < .001, respectively). The interaction between uric acid and insulin was associated with the number of MetS components (PROCESS Model 1, interaction coefficient = -0.009, 95%CI: -0.017 to -0.001, p = .036). Johnson-Neyman analysis suggests the interaction is lost when uric acid concentration increased >7.0 mg/dL. When the cohort was separated by hyperinsulinemia and hyperuricemia, there was a significant risk of developing MetS for subjects with hyperuricemia (odds ratio = 2.3; 95%CI: 1.1-4.8, p < .05), hyperinsulinemia (odds ratio = 3.1; 95%CI: 1.9-4.9, p < .05), or both (odds ratio = 7.4; 95%CI: 3.2-17.2, p < .05); however, there was no multiplicative or additive interaction. Here, we show that uric acid and insulin augments the prevalence of MetS; however, no biological interaction was determined for hyperuricemia and hyperinsulinemia. Copyright © 2017 Diabetes India. Published by Elsevier Ltd. All rights reserved.
Hyperuricemia, Type 2 Diabetes Mellitus, and Hypertension: an Emerging Association.
Mortada, Ibrahim
2017-09-01
Uric acid is the final oxidation product of purine metabolism in circulation and has been associated with the occurrence of gout and kidney stones. Type 2 diabetes mellitus and hypertension are two important public health challenges, and both are linked to increased risk of cardiovascular events. Hyperuricemia has recently emerged as an independent risk factor in the development of type 2 diabetes mellitus and hypertension through several proposed mechanisms. Few clinical trials investigated the use of uric acid lowering agents in the management of these two disease entities; however, their results provided encouraging evidence to a potential role for these agents in fighting disease burden. Larger randomized controlled trials are therefore warranted to establish the role of uric acid as a promising target for novel therapeutic interventions in the management of type 2 diabetes mellitus and hypertension.
Sezai, Akira; Soma, Masayoshi; Nakata, Kin-ichi; Osaka, Shunji; Ishii, Yusuke; Yaoita, Hiroko; Hata, Hiroaki; Shiono, Motomi
2015-10-01
The NU-FLASH trial demonstrated that febuxostat was more effective for hyperuricemia than allopurinol. This time, we compared these medications in patients with chronic kidney disease (CKD) from the NU-FLASH trial. In the NU-FLASH trial, 141 cardiac surgery patients with hyperuricemia were randomized to a febuxostat group or an allopurinol group. This study analyzed 109 patients with an estimated glomerular filtration rate (eGFR) ≤60 mL/min/1.73 m(2), and also analyzed 87 patients with stage 3 CKD. The primary endpoint was the serum uric acid level. Secondary endpoints included serum creatinine, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, total cholesterol, triglycerides, low-density lipoprotein, high-density lipoprotein, and high-sensitivity C-reactive protein. Among patients with an eGFR≤60 mL/min/1.73 m(2), uric acid levels were significantly lower in the febuxostat group than the allopurinol group from 1 month of treatment onward. The serum creatinine, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, and high-sensitivity C-reactive protein were also significantly lower in the febuxostat group. Similar results were obtained in the patients with stage 3 CKD. In cardiac surgery patients with renal dysfunction, febuxostat reduced uric acid earlier than allopurinol, had a stronger renoprotective effect than allopurinol, and also had superior antioxidant and anti-inflammatory effects. Copyright © 2015. Published by Elsevier Ltd.
Liu, Shuyun; Yuan, Yujia; Zhou, Yijie; Zhao, Meng; Chen, Younan; Cheng, Jingqiu; Lu, Yanrong; Liu, Jingping
2017-10-01
Hyperuricemia is an important risk factor for cardiovascular and renal diseases. Phloretin had shown antioxidant and anti-inflammatory properties, but its role in endothelial injury is rarely reported. In this study, we aimed to investigate the protective effect of phloretin on UA-induced injury in human umbilical vein endothelial cells. The effects of UA and phloretin on cell viability, inflammation, THP-1 monocyte adhesion, endothelial cell tube formation, GLUT9 expression and UA uptake in human umbilical vein endothelial cells were evaluated. The changes of nuclear factor-kappa B/extracellular regulated protein kinases signalling were also analysed. Our results showed that UA reduced cell viability and tube formation, and increased inflammation and monocytes adhesion in human umbilical vein endothelial cells in a dose-dependent manner. In contrast, phloretin significantly attenuated pro-inflammatory factors expression and endothelial injury induced by UA. Phloretin inhibited the activation of extracellular regulated protein kinases/nuclear factor-kappa B pathway, and reduced GLUT9 and it mediated UA uptake in human umbilical vein endothelial cells. These results indicated that phloretin attenuated UA-induced endothelial injury via a synergic mechanism including direct anti-inflammatory effect and lowering cellular UA uptake. Our study suggested that phloretin might be a promising therapy for hyperuricemia-related cardiovascular diseases. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Prevalence of hyperuricaemia in a rural population of Nigerian Niger Delta region.
Alikor, C A; Emem-Chioma, P C; Odia, O J
2013-01-01
Hyperuricemia is a cardiovascular disease risk factor that has been poorly researched into in Africa and its prevalence is largely unknown in the rural areas in Nigeria and in the Niger Delta region of Nigeria in particular. A cross-sectional rural survey involving 500 subjects aged 15 years and above. Demographic and social data were obtained using a questionnaire. Anthropometric (height, weight, waist circumference) and blood pressure measurements were taken. Blood samples were taken for blood uric acid, glucose and lipid check. The mean age of the study subjects was 41.32 +/- 17.0 (males, 42.84 +/- 17.8; females, 40.62 +/- 16.6) with a range of 15 years to 95 years. The male to female ratio was 1:2.3. The mean serum uric acid was 337.58 +/- 94.59 mmol/l with a significant higher mean for females (males 333.20 +/- 88.70, females 339.56 +/- 97.21, p < 0.001). Hyperuricemia was found in 86 subject giving a prevalence of 17.2% with higher prevalence in males (males 25%, females 13.7%; x2 = 7.75, p = 0.006). Correlational analysis of serum uric acid with other parameters revealed that waist circumference, total cholesterol, low-density lipoprotein and gender had significant association with uric acid. Male gender was found to be a significant predictor for hyperuricaemia following a logistic regression. The prevalence of hyperuricemia is high in this rural community of study. There is need for more research considering the cardiovascular and other implications of hyperuricaemia.
Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin
2010-02-01
Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.
Tang, Dandan; Zhang, Jinyi; Zhou, Rongxin; Xie, Ya-Ni; Hou, Xiandeng; Xu, Kailai; Wu, Peng
2018-05-10
Overexpression and crystallization of uric acid have been recognized as the course of hyperuricemia and gout, which is produced via xanthine oxidase (XOD)-catalyzed oxidation of xanthine. Therefore, the medicinal therapy of hyperuricemia and gout is majorly based on the inhibition of the XOD enzymatic pathway. The spectroscopic nature of xanthine and uric acid, namely both absorption (near the ultraviolet region) and emission (non-fluorescent) characteristics, hinders optical assay development for XOD analysis. Therefore, the state-of-the-art analysis of XOD and the screening of XOD inhibitors are majorly based on chromatography. Here, we found the near ultraviolet absorption of uric acid overlapped well with the absorption of a large bandgap semiconductor quantum dots, ZnS. On the other hand, the intrinsic weak fluorescence of ZnS QDs can be substantially improved via transition metal ion doping. Therefore, herein, we developed an inner filter effect-based assay for XOD analysis and inhibitor screening with Mn-doped ZnS QDs. The phosphorescence of Mn-doped ZnS QDs could be quenched by uric acid generated from xanthine catabolism by XOD, leading to the phosphorescence turn-off detection of XOD with a limit of detection (3σ) of 0.02 U L-1. Furthermore, the existence of XOD inhibitors could inhibit the XOD enzymatic reaction, resulting in weakened phosphorescence quenching. Therefore, the proposed assay could also be explored for the facile screening analysis of XOD inhibitors, which is important for the potential medicinal therapy of hyperuricemia and gout.
Yu, Shuai; Chen, Ying; Hou, Xu; Xu, Donghua; Che, Kui; Li, Changgui; Yan, Shengli; Wang, Yangang; Wang, Bin
2016-03-01
Previous studies suggested a possible association between serum uric acid levels and peripheral neuropathy in patients with type 2 diabetes, but no definite evidence was available. A systematic review and meta-analysis of relevant studies were performed to comprehensively estimate the association. Pubmed, Web of Science, Embase, and China Biology Medicine (CBM) databases were searched for eligible studies. Study-specific data were combined using random-effect or fixed-effect models of meta-analysis according to between-study heterogeneity. Twelve studies were finally included into the meta-analysis, which involved a total of 1388 type 2 diabetic patients with peripheral neuropathy and 4746 patients without peripheral neuropathy. Meta-analysis showed that there were obvious increased serum uric acid levels in diabetic patients with peripheral neuropathy (weighted mean difference [WMD] = 50.03 μmol/L, 95% confidence interval [95%CI] 22.14-77.93, P = 0.0004). Hyperuricemia was also significantly associated with increased risk of peripheral neuropathy in patients with type 2 diabetes (risk ratio [RR] = 2.83, 95%CI 2.13-3.76, P < 0.00001). Meta-analysis of two studies with adjusted risk estimates showed that hyperuricemia was independently associated with increased risk of peripheral neuropathy in type 2 diabetic patients (RR = 1.95, 95%CI 1.23-3.11, P = 0.005). Type 2 diabetic patients with peripheral neuropathy have obvious increased serum uric acid levels, and hyperuricemia is associated with increased risk of peripheral neuropathy. Further prospective cohort studies are needed to validate the impact of serum uric acid levels on peripheral neuropathy risk.
Krishnan, Eswar
2014-09-01
African Americans have a substantially higher prevalence of risk factors for gout than Caucasians. The aim of the present study was to compare the risk for incident gout among African Americans and Caucasians. Incidence rates of physician-diagnosed gout among 11,559 Caucasian men and 931 African American men aged 35 to 57 years and at high cardiovascular risk, observed for 7 years as a part of the Multiple Risk Factor Intervention Trial, were analyzed. Cox regression models were used to account for potential confounding by age, body mass index, diuretic use, hypertension and diabetes status, aspirin and alcohol consumption, and kidney disease. At baseline, after accounting for risk factors, African Americans had a 14% lower prevalence of hyperuricemia than Caucasians. Incidence of gout increased with increasing prevalence of risk factors in both Caucasians and African Americans. Ethnic disparities in incidence rates were most apparent among those without other risk factors for gout. In separate Cox regression models, after accounting for risk factors, African American ethnicity was associated with a hazard ratio of 0.78 (95% confidence interval [CI], 0.66-0.93) for physician-diagnosed gout and 0.88 (95% CI, 0.85-0.90) for incident hyperuricemia. Significant interactions were observed; the association was the strongest (hazard ratio 0.47; 0.37-0.60). These associations were unaffected by addition of serum urate as a covariate or by using alternate case definitions for gout. After accounting for the higher prevalence of risk factors, African American ethnicity is associated with a significantly lower risk for gout and hyperuricemia compared with Caucasian ethnicity. Copyright © 2014 Elsevier Inc. All rights reserved.
Oyama, Jun-Ichi; Tanaka, Atsushi; Sato, Yasunori; Tomiyama, Hirofumi; Sata, Masataka; Ishizu, Tomoko; Taguchi, Isao; Kuroyanagi, Takanori; Teragawa, Hiroki; Ishizaka, Nobukazu; Kanzaki, Yumiko; Ohishi, Mitsuru; Eguchi, Kazuo; Higashi, Yukihito; Yamada, Hirotsugu; Maemura, Koji; Ako, Junya; Bando, Yasuko K; Ueda, Shinichiro; Inoue, Teruo; Murohara, Toyoaki; Node, Koichi
2016-06-18
Xanthine oxidase inhibitors are anti-hyperuricemic drugs that decrease serum uric acid levels by inhibiting its synthesis. Xanthine oxidase is also recognized as a pivotal enzyme in the production of oxidative stress. Excess oxidative stress induces endothelial dysfunction and inflammatory reactions in vascular systems, leading to atherosclerosis. Many experimental studies have suggested that xanthine oxidase inhibitors have anti-atherosclerotic effects by decreasing in vitro and in vivo oxidative stress. However, there is only limited evidence on the clinical implications of xanthine oxidase inhibitors on atherosclerotic cardiovascular disease in patients with hyperuricemia. We designed the PRIZE study to evaluate the effects of febuxostat on a surrogate marker of cardiovascular disease risk, ultrasonography-based intima-media thickness of the carotid artery in patients with hyperuricemia. The study is a multicenter, prospective, randomized, open-label and blinded-endpoint evaluation (PROBE) design. A total of 500 patients with asymptomatic hyperuricemia (uric acid >7.0 mg/dL) and carotid intima-media thickness ≥1.1 mm will be randomized centrally to receive either febuxostat (10-60 mg/day) or non-pharmacological treatment. Randomization is carried out using the dynamic allocation method stratified according to age (<65, ≥65 year), gender, presence or absence of diabetes mellitus, serum uric acid (<8.0, ≥8.0 mg/dL), and carotid intima-media thickness (<1.3, ≥1.3 mm). In addition to administering the study drug, we will also direct lifestyle modification in all participants, including advice on control of body weight, sleep, exercise and healthy diet. Carotid intima-media thickness will be evaluated using ultrasonography performed by skilled technicians at a central laboratory. Follow-up will be continued for 24 months. The primary endpoint is percentage change in mean intima-media thickness of the common carotid artery 24 months after baseline, measured by carotid ultrasound imaging. PRIZE will be the first study to provide important data on the effects of febuxostat on atherosclerosis in patients with asymptomatic hyperuricemia. Trial Registration Unique trial Number, UMIN000012911 ( https://upload.umin.ac.jp/cgi-open-bin/ctr/ctr.cgi?function=brows&action=brows&type=summary&recptno=R000015081&language=E ).
Yan, Ling; Ye, Lu; Wang, Kun; Zhou, Jie; Zhu, Chunjia
2016-05-25
Objective: To investigate the effect of atorvastatin on reflow in patients with acute ST-segment elevation myocardial infarction (STEMI) after percutaneous coronary intervention (PCI) and its relation to serum uric acid levels. Methods: One hundred and fourteen STEMI patients undergoing primary PCI were enrolled and randomly divided into two groups:55 cases received oral atorvastatin 20 mg before PCI (routine dose group) and 59 cases received oral atorvastatin 80 mg before PCI (high dose group). According to the initial serum uric acid level, patients in two groups were further divided into normal uric acid subgroup and hyperuricemia subgroup. The changes of uric acid level and coronary artery blood flow after PCI were observed. Correlations between the decrease of uric acid, the dose of atorvastatin and the blood flow of coronary artery after PCI were analyzed. Results: Serum uric acid levels were decreased after treatment in both groups (all P <0.05), and patients with hyperuricemia showed more significant decrease in serum uric acid level ( P <0.05). Compared with the routine dose group, serum uric acid level in patients with hyperuricemia decreased more significantly in the high dose group ( P <0.05), but no significant difference was observed between patients with normal serum uric acid levels in two groups ( P >0.05). Among 114 patients, there were 19 cases without reflow after PCI (16.7%). In the routine dose group, there were 12 patients without reflow, in which 3 had normal uric acid and 9 had high uric acid levels ( P <0.01). In the high dose group, there were 7 patients without reflow, in which 2 had normal uric acid and 5 had high uric acid ( P <0.05). Logistic regression analysis showed that hyperuricemia was one of independent risk factors for no-reflow after PCI ( OR =1.01, 95% CI :1.01-1.11, P <0.01). The incidence of no-flow after PCI in the routine dose group was 21.8% (12/55), and that in the high dose group was 11.9% (7/59) ( P <0.01). Conclusion: High dose atorvastatin can decrease serum uric acid levels and improve reflow after PCI in patients with STEMI.
Evaluation of cardiovascular risk in stages of gout by a complex multimodal ultrasonography.
Gancheva, Rada; Kundurdjiev, Atanas; Ivanova, Mariana; Kundurzhiev, Todor; Kolarov, Zlatimir
2017-01-01
The aim of our work was to assess ultrasound features of cardiovascular (CV) risk in stages of gout. Cross-sectional complex multimodal ultrasound study of 169 age-matched patients, with similar distribution of arterial hypertension, diabetes mellitus, obesity and chronic renal failure, was divided into four groups: 41 with asymptomatic hyperuricemia, 52 gout without tophi, 42 gouty tophi and 34 controls with osteoarthritis. Parameters independently associated with CV risk were measured: renal resistive index (RRI), left ventricular mass index (LVMi), mitral annulus early diastolic velocity (e'), intima-media thickness (IMT) and common carotid artery resistive index (CCARI). Multivariate analyses were performed to evaluate the impact of gout stages and CV risk factors on ultrasound alterations. Gouty tophi increased the risk of having IMT >0.90 mm with an OR 11.51 (95 % CI 2.32-57.21, p = 0.003), gout without tophi raised the risk with an OR 6.25 (95 % CI 1.37-28.44, p = 0.018), while asymptomatic hyperuricemia had no effect on IMT. The category of CCARI >0.70 was influenced by tophi with an OR 11.18 (95 % CI 2.61-47.83, p = 0.001) and by arterial hypertension with an OR 3.22 (95 % CI 1.11-9.36, p = 0.032). Neither asymptomatic hyperuricemia nor gout without tophi modified the development of abnormally high CCARI. Gout stages had no impact on LVMi, e' and RRI. Tophi are related to worsened ultrasonographic parameters evaluating target organs in gout, relative to earlier stages of the disease. They create a strong risk of carotid arteries' changes even beyond arterial hypertension.
Association of serum uric acid with aortic stiffness and pressure in a Chinese workplace setting.
Chen, Xin; Li, Yan; Sheng, Chang-Sheng; Huang, Qi-Fang; Zheng, Yang; Wang, Ji-Guang
2010-04-01
In the present analysis, we investigated the association of serum uric acid with aortic stiffness and pressure as measured by carotid-femoral pulse wave velocity (cf-PWV) and central systolic blood pressure (SBP), respectively. Our study was conducted in the framework of cardiovascular health examinations for the employees of a factory and their family members (ages 15-79 years). We performed arterial measurements using the SphygmoCor device. Hyperuricemia was defined as a serum uric acid concentration of at least 420 micromol/l in men and 360 micromol/l in women. The 940 study participants included 207 (22.0%) hypertensive patients, of whom 92 (9.8%) took antihypertensive medication. Men (n = 620), compared with women (n = 320), had significantly (P < or = 0.03) higher serum uric acid concentration (363 +/- 76 vs. 272 +/- 64 micromol/l), prevalence of hyperuricemia (17.9% vs. 7.5%), cf-PWV (7.41 vs. 7.16 m/s), and central SBP (114.4 vs. 108.8 mm Hg). Both before and after adjustment for age, serum uric acid was significantly (P < or = 0.02) and positively associated with cf-PWV and central SBP in all subjects and in men and women separately. After full adjustment for covariates, the association with cf-PWV remained statistically significant (P < or = 0.009) in all subjects and men, and with central SBP in all subjects only. Categorical analyses were confirmatory. In all subjects, patients with hyperuricemia had significantly (P = 0.03) higher cf-PWV (7.51 vs. 7.29 m/s) and central SBP (114.9 vs. 112.1 mm Hg) than those with normal serum uric acid. Serum uric acid was associated with aortic stiffness and pressure in a Chinese workplace setting, especially in men.
Hashiguchi, Masayuki; Maruyama, Junya; Shimizu, Mikiko; Takahashi, Daichi; Shiga, Tsuyoshi
2018-02-20
To investigate whether 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitor (statin) use is associated with an increased risk of diabetes mellitus and hyperglycemia, we performed a nested case-control study using a postmarketing surveillance database in Japan. The database cohort included 26,849 cases of statin use and 5308 cases of other lipid-lowering drug use in patients with hyperlipidemia. Participants received at least 1 type of statin, had a clear medication history of statin use, and had no complications of diabetes mellitus. Cases were defined as onset of diabetes mellitus or hyperglycemia during statin intake. For each case, 20 controls were randomly selected and matched by time point. The factors associated with an increased risk of diabetes mellitus and hyperglycemia during statin intake examined included sex, age, body mass index, statin use duration, complications, concomitant medication, and clinical laboratory tests. Statin-associated diabetes mellitus or hyperglycemia was identified based on abnormal elevation of blood glucose concentrations beyond the reference range. A total of 19,868 patients met the inclusion criteria, of whom 24 were patients in the case group. Two complicating factors, fatty liver (adjusted odds ratio 16.10) and hyperuricemia (adjusted odds ratio 28.96), were extracted for onset of diabetes mellitus or hyperglycemia. Nonalcoholic fatty liver was associated with diabetes mellitus, obesity, and insulin resistance, and hyperuricemia was associated with lifestyle. This study suggested that the onset of diabetes mellitus or hyperglycemia might be increased with statin use in patients with complications of fatty liver and hyperuricemia. © 2018, The American College of Clinical Pharmacology.
Zhang, Zhe-qing; Deng, Juan; He, Li-ping; Ling, Wen-hua; Su, Yi-xiang; Chen, Yu-ming
2013-01-01
Background Although many adiposity indices may be used to predict obesity-related health risks, uncertainty remains over which of them performs best. Objective This study compared the predictive capability of direct and indirect adiposity measures in identifying people at higher risk of metabolic abnormalities. Methods This population-based cross-sectional study recruited 2780 women and 1160 men. Body weight and height, waist circumference (WC), and hip circumference (HC) were measured and body mass index (BMI), waist-to-hip ratio (WHR), and waist-to-height ratio (WHtR) were calculated. Body fat (and percentage of fat) over the whole body and the trunk were determined by bioelectrical impedance analysis (BIA). Blood pressure, fasting lipid profiles, and glucose and urine acid levels were assessed. Results In women, the ROC and the multivariate logistic regression analyses both showed that WHtR consistently had the best performance in identifying hypertension, dyslipidemia, hyperuricemia, diabetes/IFG, and metabolic syndrome (MetS). In men, the ROC analysis showed that WHtR was the best predictor of hypertension, WHtR and WC were equally good predictors of dyslipidemia and MetS, and WHtR was the second-best predictor of hyperuricemia and diabetes/IFG. The multivariate logistic regression also found WHtR to be superior in discriminating between MetS, diabetes/IFG, and dyslipidemia while BMI performed better in predicting hypertension and hyperuricemia in men. The BIA-derived indices were the second-worst predictors for all of the endpoints, and HC was the worst. Conclusion WHtR was the best predictor of various metabolic abnormalities. BMI may be used as an alternative measure of obesity for identifying hypertension in both sexes. PMID:23951031
Serum urate levels and consumption of common beverages and alcohol among Chinese in Singapore.
Teng, Gim Gee; Tan, Chuen Seng; Santosa, Amelia; Saag, Kenneth G; Yuan, Jian-Min; Koh, Woon-Puay
2013-09-01
Western studies suggest that beverages may affect serum urate (SU) levels, but data from Asian populations are scarce. We evaluated the associations between beverages and SU levels in Singaporean Chinese. The study population consisted of 483 subjects ages 45-74 years from the Singapore Chinese Health Study cohort, recruited between 1993 and 1998. Lifestyle factors, medical histories, and diet were collected through in-person interviews. SU levels and other biomarkers were measured from blood collected between 1994 and 1996. The mean age was 57.6 years and 44% were men. The geometric mean SU level was 321 μmoles/liter (range 157-719). Mean SU levels increased with alcohol consumption (P = 0.024 for trend). The mean SU level of daily alcohol drinkers was 42.6 μmoles/liter higher than that of nondrinkers. Similarly, increasing frequency of green tea intake was associated with rising SU levels. The highest mean SU level was observed in daily green tea drinkers (difference of 25.0 μmoles/liter) relative to nondrinkers (P = 0.009 for trend). Compared to nondrinkers, daily alcohol drinkers had an almost 5-fold increase in association with hyperuricemia (odds ratio [OR] 4.83, 95% confidence interval [95% CI] 1.10-21.23), whereas daily green tea drinkers had a 2-fold increase in association with hyperuricemia (OR 2.12, 95% CI 1.03-4.36). The present study did not show elevated levels of SU in individuals who consumed black tea, coffee, fruit juice, or soda. Alcohol consumption increases SU levels. The finding that daily drinking of green tea is associated with hyperuricemia needs validation in future studies. Copyright © 2013 by the American College of Rheumatology.
Xu, Shaoyong; Liu, Xiangyang; Ming, Jie; Chen, Shenren; Wang, Yangang; Liu, Xiumei; Liu, Hong; Peng, Yongde; Wang, Jianqin; Lin, Jinying; Ji, Haiwang; Liu, Bin; Lu, Ying; Liu, Peng; Zhang, Yonghong; Ji, Qiuhe
2015-07-01
To compare the efficiency and safety of febuxostat with those of allopurinol in Chinese patients with gout and hyperuricemia. The trial which was conducted at 13 centers in China during 2011-2013 included a 2-week run-in and a 24-week treatment period. A total of 504 eligible participants with gout and with serum urate ≥ 480 μmol/L were randomly assigned 1 : 1 : 1 to febuxostat 40 mg/day, febuxostat 80 mg/day and allopurinol 300 mg/day groups. The primary efficacy endpoint was the percentage of subjects whose last three serum urate levels were < 360 μmol/L. The primary efficacy endpoint was reached by 33.5% of subjects taking febuxostat 80 mg/day, 22.5% of those taking febuxostat 40 mg/day and 17.0% of those taking allopurinol 300 mg/day (P < 0.001 for the comparison between febuxostat 80 mg/day and allopurinol 300 mg/day groups; P = 0.216 for the comparison between febuxostat 40 mg/day and allopurinol 300 mg/day groups). The incidence of gout flare was relatively high in each group during the first 8 weeks and gradually decreased thereafter. There was no statistically significant difference between the three groups (P > 0.05). The incidence of adverse events was similar in the three treatment groups. The most frequent treatment-related adverse events were liver function test abnormalities. Febuxostat 80 mg/day had superior urate-lowering efficacy to that of febuxostat 40 mg/day or allopurinol 300 mg/day, which was comparable in Chinese gout patients with hyperuricemia. Febuxostat, at a daily dose of 40 or 80 mg, was safe and well tolerated. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.
Hirai, Toshinori; Kimura, Toshimi; Echizen, Hirotoshi
2016-01-01
Whether renal dysfunction influences the hypouricemic effect of febuxostat, a xanthine oxidase (XO) inhibitor, in patients with hyperuricemia due to overproduction or underexcretion of uric acid (UA) remains unclear. We aimed to address this question with a modeling and simulation approach. The pharmacokinetics (PK) of febuxostat were analyzed using data from the literature. A kinetic model of UA was retrieved from a previous human study. Renal UA clearance was estimated as a function of creatinine clearance (CLcr) but non-renal UA clearance was assumed constant. A reversible inhibition model for bovine XO was adopted. Integrating these kinetic formulas, we developed a PK-pharmacodynamic (PK-PD) model for estimating the time course of the hypouricemic effect of febuxostat as a function of baseline UA level, febuxostat dose, treatment duration, body weight, and CLcr. Using the Monte Carlo simulation method, we examined the performance of the model by comparing predicted UA levels with those reported in the literature. We also modified the models for application to hyperuricemia due to UA overproduction or underexcretion. Thirty-nine data sets comprising 735 volunteers or patients were retrieved from the literature. A good correlation was observed between the hypouricemic effects of febuxostat estimated by our PK-PD model and those reported in the articles (observed) (r=0.89, p<0.001). The hypouricemic effect was estimated to be augmented in patients with renal dysfunction irrespective of the etiology of hyperuricemia. While validation in clinical studies is needed, the modeling and simulation approach may be useful for individualizing febuxostat doses in patients with various clinical characteristics.
Liu, Chi-Ming; Tung, Tao-Hsin; Liu, Jorn-Hon; Chen, Victor Tze-Kai; Lin, Ching-Heng; Hsu, Chung-Te; Chou, Pesus
2005-01-01
AIM: To explore any gender-related differences in prevalence of and condition-associated factors related to an elevated serum alanine aminotransferase (ALT) level amongst residents of Kinmen, Taiwan. METHODS: A total of 11 898 of a potential 20 112 regional residents aged 30 years or more completed a related questionnaire that was carried out by the Yang-Ming Crusade between 1991 and 1994 inclusively, with blood samples being collected by public nurses. The overall questionnaire response rate was 59.3% (52.4% for males and 66.0% for females). RESULTS: The prevalence of an elevated serum ALT level for this sub-population was found to be 7.2%, the prevalence revealing a statistically significant decrease with increasing population age (P<0.0001). Males exhibited a greater prevalence of elevated serum ALT level than did females (9.4% vs 5.3%, P<0.0001). Using multiple logistic regression analysis, in addition to male gender, a younger age, greater waist circumference, presence of type-2 diabetes and hyperuricemia were the significant factors associated with an elevated serum ALT level for both males and females. Gender-related differences as regards associated factors were also revealed. For males, obesity was significantly related to an elevated serum ALT level (OR = 1.28, 95%CI: 1.00-1.66) but this was not so for females (OR = 1.09, 95%CI: 0.84-1.42). Hypertriglyceridemia (OR = 1.80, 95%CI: 1.36-2.39) and hyperuricemia (OR = 1.61, 95%CI: 1.03-2.52) were significantly related to elevated serum ALT levels only for females. CONCLUSION: Several gender-related differences were noted pertaining to the prevalence of and relationship between obesity, hypertriglyceridemia and hyperuricemia and elevated serum ALT level in the present study. PMID:15786537
Wang, Yu; Lin, Zhijian; Zhang, Bing; Nie, Anzheng; Bian, Meng
2017-01-01
Excessive production and/or reduced excretion of uric acid could lead to hyperuricemia, which could be a major cause of disability. Hyperuricemia has received increasing attention in the last few decades due to its global prevalence. Cichorium intybus L., commonly known as chicory, is a perennial herb of the asteraceae family. It was previously shown to exert potent hypouricemic effects linked with decreasing uric acid formation in the liver by down-regulating the activity of xanthine oxidase, and increasing uric acid excretion by up-regulating the renal OAT3 mRNA expression. The present study aimed to evaluate its extra-renal excretion and possible molecular mechanism underlying the transporter responsible for intestinal uric acid excretion in vivo. Chicory was administered intragastrically to hyperuricemic rats induced by drinking 10% fructose water. The uricosuric effect was evaluated by determining the serum uric acid level as well as the intestinal uric acid excretion by HPLC. The location and expression levels of ATP-binding cassette transporter, sub-family G, member 2 (ABCG2) in jejunum and ileum were analyzed. The administration of chicory decreased the serum uric acid level significantly and increased the intestinal uric acid excretion obviously in hyperuricemic rats induced by 10% fructose drinking. Staining showed that ABCG2 was expressed in the apical membrane of the epithelium and glands of the jejunum and ileum in rats. Further examination showed that chicory enhanced the mRNA and protein expressions of ABCG2 markedly in a dose-dependent manner in jejunum and ileum. These findings indicate that chicory increases uric acid excretion by intestines, which may be related to the stimulation of intestinal uric acid excretion via down-regulating the mRNA and protein expressions of ABCG2.
Hyperferritinemia increases the risk of hyperuricemia in HFE-hereditary hemochromatosis.
Flais, Jérémy; Bardou-Jacquet, Edouard; Deugnier, Yves; Coiffier, Guillaume; Perdriger, Aleth; Chalès, Gérard; Ropert, Martine; Loréal, Olivier; Guggenbuhl, Pascal
2017-05-01
Hyperuricemia is becoming increasingly frequent in the population, and is known to be sometimes the cause of gout. The impact of uric acid is still not clearly understood, however. The iron metabolism may interact with the uric acid metabolism. The aim of this study was to examine the relationship between the serum uric acid and serum ferritin levels in a cohort of hemochromatosis patients who were homozygous for the HFE p.Cys282Tyr mutation. 738 patients with the HFE gene mutation Cys282Tyr in the homozygous state were included in the study. The variables measured during the initial evaluation were compared in univariate analysis by Student's t test. In multivariate analysis, linear stepwise regression was used. In the group of hyperuricemic patients, ferritinemia was significantly higher than in the group of non-hyperuricemic patients (1576.7±1387.4μg/l vs. 1095.63±1319.24μg/l, P<0.005). With multivariate analysis, only ferritin and BMI independently explained the uricemia (R 2 =0.258) after adjustment for age, glycemia and CRP. The correlation between uricemia and log(ferritin) with partial regression correlation coefficients was 0.307 (P<0.01). The increase in uricemia is associated with the increase in ferritin in a population of patients who were homozygous for the HFE gene mutation p.Cys282Tyr and this independently of factors commonly associated with hyperuricemia. The increase in uric acid associated with hyperferritinemia, could be a response to the visceral toxicity of excess non-transferrin bound iron linked to oxidative stress via the antioxidant properties of uric acid. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
Kark, Jeremy D.
2011-01-01
Background. Kidney disease is commonly accompanied by hyperuricemia. However, the contribution of serum uric acid (SUA) to kidney injury is debated. Our objective was to assess the long-term prediction of renal failure by SUA. Methods. Visit 2 participants in the Jerusalem Lipid Research Clinic cohort with normal baseline kidney function were followed for 24–28 years. SUA levels were assessed for associations with acute renal failure (ARF) and chronic renal failure (CRF) as defined by hospital discharge records, and mortality, ascertained through linkage with the national population registry. Results. Among 2449 eligible participants (1470 men, 979 women aged 35–78 years in 1976–79), SUA was positively linked with male sex, serum creatinine and components of the metabolic syndrome but was lower in smokers and in diabetic subjects. The 22- to 25-year incidence of hospital-diagnosed kidney failure (145 first events, 67% CRF) and the 24- to 28-year mortality (587 events) were higher in subject with hyperuricemia (>6.5 mg/dL in men and >5.3 mg/dL in women, reflecting the upper quintiles), independent of baseline kidney function and covariates. Hyperuricemia conferred adjusted hazard ratios of 1.36 (P = 0.003), 2.14 (P < 0.001) and 2.87 (P = 0.003) for mortality, CRF and ARF, respectively. Conclusions. SUA predicts renal failure incidence and all-cause mortality independently of demographic and clinical covariates. These results lend support to the undertaking of clinical trials to examine the effect of uric acid-lowering strategies on kidney outcomes. PMID:21220750
Head fat is a novel method of measuring metabolic disorder in Chinese obese patients
2014-01-01
Background Body adiposity, especially ectopic fat accumulation, has a range of metabolic and cardiovascular effects. The aim of this study was to investigate the association between head fat and metabolic values in Chinese obese patients. Methods Data of this cross-sectional study from 66 obese patients were collected. Fat distribution was measured by dual-energy X-ray absorptiometry, and data of body weight, body mass index (BMI), neck circumference (NC), waist circumference (WC), hip circumference (HC), visceral index, basal metabolism (BM), glucose metabolism, lipid levels, uric acid (UA) had been collected. Results 1) Head fat was significantly associated with BMI, WC, HC, visceral index, BM, total fat and total fat excluding head fat in both males and females (p < 0.05). Head fat was positively correlated with upper limb fat, trunk fat, weight, fasting plasma C peptide, fasting plasma insulin and UA in women(p < 0.05), and the association was not statistically significant in male (p > 0.05). Head fat was positively corrected with NC in males (p < 0.05) but not females (p > 0.05). There was no significant correlation between head fat and fasting plasma glucose, total choleslerolemia, triglyceridemia, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and free fat acid in either gender (p > 0.05). 2) Receiver operating characteristic analysis showed that a head fat of 1925.6 g and a head fat of 1567.85 g were the best cut-off values to determine subjects with low high-density lipoprotein cholesterol and hyperuricemia respectively. Conclusions Head fat accumulation was closely associated with increased body fat, hyperinsulinemia, hyperuricemia, and impared lipid profile, suggesting it might be used as an indicator for dyslipidemia and hyperuricemia. PMID:25015267
Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki
2010-01-01
The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651
GLUT9 influences uric acid concentration in patients with Lesch-Nyhan disease.
Torres, Rosa J; Puig, Juan G
2018-06-01
Patients with deficient hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity present hyperuricemia and/or hyperuricosuria, with a variable degree of neurological manifestations. Hyperuricemia in HPRT deficiency is due to uric acid overproduction and is frequently treated with allopurinol. Renal uric acid excretion is sharply increased in these patients. In recent years, several renal tubular urate transporter single nucleotide polymorphisms (SNPs), including those of the GLUT9, ABCG2 and URAT1 genes, have been described that influence the renal handling of uric acid and modulate serum urate levels. In the present study, we analyzed whether GLUT9, ABCG2 and URAT1 gene SNPs are able to influence uric acid levels and allopurinol response in patients with HPRT deficiency. Three SNPs, URAT1 rs11231825, GLUT9 rs16890979 and ABCG2 rs2231142, previously associated in our population with hyperuricemia and gout, were analyzed in 27 patients with HPRT deficiency treated with allopurinol for at least 5 years. Patients with HPRT deficiency having allele A of rs16890979 in the GLUT9 gene present with a lower serum urate concentration at diagnosis, before allopurinol treatment is instituted, and need lower allopurinol doses to maintain serum urate levels between 268 and 446 μmol/L (4.5 and 7.5 mg/dL). No relationship between rs2231142 in the ABCG2 gene or rs11231825 in the URAT1 gene and serum urate levels or allopurinol response was found in our patients with HPRT deficiency. GLUT9 SNPs influence the renal handling of uric acid and modulate serum urate levels and the response to treatment in patients with uric acid overproduction due to HPRT deficiency. © 2018 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N
2015-11-05
Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.
Hyperuricemia in the inhabitants of the Marshall Islands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, W.H.; Harper, J.A.; Heotis, P.M.
1984-06-01
Annual medical examinations are conducted by Brookhaven National Laboratory (BNL) for a population of Marshallese who were accidentally exposed to radioactive fallout in 1954, for a comparison population, and for all inhabitants of the atolls of Rongelap and Utirik. Disease surveillance includes analysis of serum samples. Elevated serum uric acid (SUA) levels are common along Pacific populations, and modifying environmental factors have been investigated as a cause for this finding. The authors have studied SUA levels of people living in the Marshall Islands, and have found elevated values similar to those reported for other Micronesian populations. The nearly Gaussian distributionmore » of individual serum uric acid values for men, and for women less than or equal to45 years of age, indicates that the elevation is due to a regularized increase in serum uric acid rather than to a subpopulation that has pathologic hyperuricemia. The higher serum uric acid levels appear, therefore, to be normal for the Marshallese, a conclusion supported by the infrequency of clinical gout in the population tested.« less
Wang, Yinan; Zhao, Min; Ye, Hao; Shao, Yizhen; Yu, Yongbo; Wang, Miao; Zhao, Chunjie
2017-08-01
Cortex Fraxini is an important traditional Chinese herbal medicine used for the treatment of gout and hyperuricemia. An efficient and rapid ultra-performance liquid chromatography mass spectrometry method was developed and validated for simultaneous quantitation of six coumarins (aesculin, fraxin, aesculetin, fraxetin, sopoletin and 7-hydroxycoumarin) in normal and hyperuricemic rats plasma after oral administration of Cortex Fraxini. The method could successfully be applied for pharmacokinetics studies. The pharmacokinetic behavior of six coumarins in normal and hyperuricemia rats plasma was determined. Results showed that, for some of analytes, the pharmacokinetic parameters (AUC 0-t , AUC 0-∞ , C max , T max and CL) were significantly different between normal and hyperuricemic rats. The different pharmacokinetic parameters might result from renal impairment or a change of metabolic enzymes in the pathological state. The pharmacokinetic study in pathological state could provide more useful information to guide the clinical use of traditional Chinese herbal medicine. Copyright © 2017 John Wiley & Sons, Ltd.
Cost-effectiveness analysis of febuxostat in patients with gout in Spain.
Perez-Ruiz, F; Díaz-Torné, C; Carcedo, D
2016-06-01
Objectives Cost-effectiveness of febuxostat compared with allopurinol in the treatment of hyperuricemia in patients with gout. Methods Costs, clinical outcomes, and QALYs were estimated using a Markov model. Febuxostat 80 mg and 120 mg sequentially, used as first line and second line therapy, was compared with allopurinol 300 mg. Patients switched to the next treatment in the sequence according to a dichotomous response vs no response (target serum urate level < 6 mg/dl outcome) after 3 months of active treatment. A 3% discount rate and 5-year time horizon were applied. National Health System. Results The addition of febuxostat to any therapeutic strategy was an efficient option, with incremental cost-effectiveness ratios (ICER) compared with allopurinol 300 mg ranging from €5268-€9737. Conclusions Febuxostat is a cost-effective treatment in Spain for the management of hyperuricemia in gout patients, with ICERs far below accepted Spanish efficiency thresholds (30 000€/QALY).
Protection by Purines in Toxin Models of Parkinson’s Disease
2014-08-01
Nucleoside transport and metabolism in erythrocytes from the Yucatan miniature pig. Evidence that inosine functions as an in vivo energy substrate...BJ, Choi HK. Prevalence of gout and hyperuricemia in the us general population: The national health and nutrition examination survey 2007–2008
Correlation between epicardial fat thickness and biochemical markers of metabolic risk.
Rubio-Guerra, Alberto Francisco; Benítez-Maldonado, Daniel Rabindranath; Lozano-Nuevo, José Juan; Arana-Pazos, Karla Corina; Huerta-Ramirez, Saul; Narváez-Rivera, Jorge Luis
2018-02-28
Epicardial fat has been associated with increased cardiovascular risk and the development of atherosclerosis. Transthoracic echocardiography provides a reliable measurement of epicardial fat thickness (EFT). The aim of this study is to evaluate the relationship between EFT and biochemical parameters of metabolic risk. We assessed 211 patients who underwent echocardiography; EFT was measured by two cardiologists. In addition, patients' glycaemia, lipid profile and serum uric acid were measured. Statistical analysis was performed with the Pearson coefficient test and Odds ratio. A positive correlation between EFT with glycaemia (r=.064), total serum cholesterol (r=.0056), high density lipoproteins (r=-.038), or with triglycerides (r=.118) was not observed. However, we did find a significant positive correlation between EFT and serum uric acid (r=.415, P<.00001). The odds ratio for EFT>3mm in patients with hyperuricemia was 6.26 (IC 95 2.79-14, P<.0001). Hyperuricemia is strongly associated with EFT in Mexican patients; EFT is a useful tool for global cardiovascular risk calculation. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.
Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese
Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong
2015-01-01
Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10−13, BCAS3), 9p24.2 (rs12236871, P=1.48 × 10−10, RFX3) and 11p15.5 (rs179785, P=1.28 × 10−8, KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis. PMID:25967671
Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese.
Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong
2015-05-13
Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10(-13), BCAS3), 9p24.2 (rs12236871, P=1.48 × 10(-10), RFX3) and 11p15.5 (rs179785, P=1.28 × 10(-8), KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis.
The kidney in hyperuricemia and gout.
Mount, David B
2013-03-01
Gout is a painful inflammatory arthritis associated with hyperuricemia, with a prevalence of almost 10 million in the USA. Reduced renal excretion of urate is the underlying hyperuricemic mechanism in the vast majority of gout patients; most of the genes that affect serum urate level (SUA) encode urate transporters or associated regulatory proteins. Acquired influences can also modulate SUA and renal urate excretion, sometimes precipitating acute gout. Coincidentally, the prevalence of renal comorbidities in gout - hypertension, chronic kidney disease (CKD), and nephrolithiasis - is very high. Recent advances in genetics and molecular physiology have greatly enhanced the understanding of renal reabsorption and secretion of filtered urate. Moreover, baseline SUA appears to be set by the net balance of absorption and secretion across epithelial cells in the kidney and intestine. There have also been substantial advances in the management of gout in patients with CKD. The stage is set for an increasingly molecular understanding of baseline and regulated urate transport by the kidney and intestine. The increasing prevalence of gout with CKD will be balanced by an expanding spectrum of therapeutic options for this important disease.
Rényi, Imre; Bárdi, Edit; Udvardi, Erzsébet; Kovács, Gábor; Bartyik, Katalin; Kajtár, Pál; Masát, Péter; Nagy, Kálmán; Galántai, Ilona; Kiss, Csongor
2007-01-01
To prevent acute renal failure in children at risk for developing tumor lysis syndrome due to acute lymphoblastic leukemia or non-Hodgkin's lymphoma treated according to international BFM protocols, we investigated recombinant urate oxidase (rasburicase) in the first Central European openlabeled, prospective, multicenter phase IV trial. Rasburicase was administered intravenously, at 0.2 mg/kg for 5 consecutive days to 36 patients. Blood levels of uric acid, creatinine, phosphorus, calcium, lactate dehydrogenase and complete blood count were measured daily during rasburicase treatment and on days 6, 7 and 12. Initial uric acid level decreased significantly by 4 hours (from 343 micromol/L to 58 micromol/L, p<0.001), except for one steroid-resistant patient who required hemodialysis on day 14 after having introduced combined cytostatic treatment. Comparing the data of a subgroup of 12 patients receiving rasburicase with that of a historic cohort of 14 patients treated with allopurinol indicated the superiority of rasburicase over allopurinol in prophylaxis and treatment of hyperuricemia in children with leukemia and lymphoma.
Yan, Haiyan; Ma, Ying; Liu, Mei; Zhou, Lanlan
2008-09-01
Hyperuricemia is associated with a number of pathological conditions, such as gout. Lowering of elevated uric acid levels in the blood could be achieved by xanthine oxidase inhibitors and inhibitors of renal urate reabsorption. Some natural compounds isolated from herbs used in traditional Chinese medicine have been previously demonstrated to act as xanthine oxidase inhibitors. In the present investigation, Paederia scandens (Lour.) Merrill (Rubiaceae) extract (PSE; 4.5, 2.25, and 1.125 g/kg) orally for 14 days was demonstrated to possess in vivo potent hypouricemic activity in hyperuricemic rats pretreated with potassium oxonate. In addition, PSE was also demonstrated to be an inhibitor of xanthine oxidase. Lineweaver-Burk analysis of the enzyme kinetics indicated that the inhibition of PSE was of a mixed type. Using an oxonate-induced hyperuricemic rat model, PSE was indeed shown to exhibit uricosuric action in vivo, which could explain, at least in part, the observed hypouricemic effect of PSE in these rats. The potential application of this compound in the treatment of conditions associated with hyperuricemia is discussed.
Kocic, Gordana; Sokolovic, Dusan; Jevtovic, Tatjana; Cvetkovic, Tatjana; Veljkovic, Andrej; Kocic, Hristina; Stojanovic, Svetlana; Jovanovic, Aneta; Jovanovic, Jelena; Zivkovic, Petar
2014-11-01
Cardiovascular repair and myocardial contractility may be improved by migration of bone marrow stem cells (BMSC) and their delivery to the site of injury, a process known as BMSC homing. The aim of our study was to examine the dietary effect of a newly patented depurinized milk (DP) that is almost free of uric acid and purine and pyrimidine compounds compared with a standard commercial 1.5% fat UHT milk diet or allopurinol therapy in rat experimental hyperuricemia. Bone marrow stem cell potential (BMCD34(+), CD34-postive bone marrow cells), plasma oxidative stress parameters [advanced oxidation protein products, AOPP) and thiobarbituric acid reactive substances (TBARS)], myocardial damage markers [creatine phosphokinase (CPK), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH)], plasma cholesterol, and high-density lipoprotein cholesterol were investigated. The DP milk diet significantly increased the number of BMCD34(+) stem cells compared with commercial UHT milk. Allopurinol given alone also increased the number of BMCD34(+). Hyperuricemia caused a significant increase in all plasma enzyme markers for myocardial damage (CPK, LDH, and AST). A cardioprotective effect was achieved with allopurinol but almost equally with DP milk and more than with commercial milk. Regarding plasma AOPP, TBARS, and cholesterol levels, the most effective treatment was DP milk. In conclusion, the protective role of a milk diet on cardiovascular function may be enhanced through the new depurinized milk diet, which may improve cardiovascular system function via increased bone marrow stem cell regenerative potential, decreased plasma oxidative stress parameters, and decreased levels of myocardial damage markers and cholesterol. New dairy technology strategies focused on eliminating harmful milk compounds should be completely nontoxic. Novel milk products should be tested for their ability to improve tissue repair and function. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Gout, allopurinol intake and clinical outcomes in the hospitalized multimorbid elderly.
Franchi, Carlotta; Salerno, Francesco; Conca, Alessio; Djade, Codjo D; Tettamanti, Mauro; Pasina, Luca; Corrao, Salvatore; Marengoni, Alessandra; Marcucci, Maura; Mannucci, Pier Mannuccio; Nobili, Alessandro
2014-11-01
Increased serum uric acid has been considered a cardiovascular risk factor but no study has assessed its relation with hospital mortality or length of stay. On the basis of data obtained from a prospective registry, the prevalence of gout/hyperuricemia and its association with these and other clinical parameters was evaluated in an Italian cohort of elderly patients acutely admitted to internal medicine or geriatric wards. While the prevalence of gout was calculated by counting patients with this diagnosis hyperuricemia was inferred in patients taking allopurinol at hospital admission or discharge, on the assumption that this drug was only prescribed owing to the finding of high serum levels of uric acid. A series of clinical and demographic variables were evaluated for their association with gout/hyperuricemia. Of 1380 patients, 139 (10%) had a diagnosis of gout or were prescribed allopurinol. They had more co-morbidities (7.0 vs 5.6; P<0.0001) and consumed more drugs (6.8 vs 5.0; P<0.0001). The CIRS (co-morbidity index) was worse in these patients (OR 1.28 95% CI 1.15-1.41). Multivariable regression analysis showed that only renal and heart failures were independently associated with gout/allopurinol intake. Moreover, this combined event was associated with an increased risk of adverse events during hospitalization (OR 1.66, 95% CI 1.16-2.36), but not with the risk of re-hospitalization, length of hospital stay or death. Gout/allopurinol intake has a high prevalence in elderly patients acutely admitted to hospital and are associated with renal and cardiovascular diseases, an increased rate of adverse events and a high degree of drug consumption. In contrast, this finding did not affect the length of hospitalization nor hospital mortality. Copyright © 2014 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.
Huang, Xinfang; Du, Hui; Gu, Jieruo; Zhao, Dongbao; Jiang, Lindi; Li, Xinfu; Zuo, Xiaoxia; Liu, Yi; Li, Zhanguo; Li, Xiangpei; Zhu, Ping; Li, Juan; Zhang, Zhiyi; Huang, Anbin; Zhang, Yuanchao; Bao, Chunde
2014-07-01
Febuxostat, a novel non-purine selective inhibitor of xanthine oxidase, has been identified as a potential alternative to allopurinol in patients with hyperuricemia. The purpose of this study was to compare the urate-lowering (UL) efficacy and safety of daily febuxostat and allopurinol in Chinese gout patients with hyperuricemia. Gout patients (n = 512) with serum uric acid (sUA) concentrations of at least 8.0 mg/dL were randomized to receive daily febuxostat 40 mg or 80 mg or allopurinol 300 mg for 28 weeks. Prophylaxis against gout flares with meloxicam or colchicine was provided during weeks 1 through 8. The primary endpoint was the percentage of subjects achieving a sUA concentration of <6.0 mg/dL at the last three monthly measurements. The primary endpoint was reached in 44.77% of patients receiving 80 mg of febuxostat, 27.33% of those receiving 40 mg of febuxostat, and 23.84% of those receiving allopurinol. The UL efficacy in the febuxostat 80 mg group was higher than in the allopurinol (P < 0.0001) and febuxostat 40 mg (P = 0.0008) groups. The UL efficacy of the febuxostat 40 mg group was statistically non-inferior to that of the allopurinol group. No significant change in the number of tophi was observed during the final visit relative to baseline in each treatment group. The rate of gout flares requiring treatment from weeks 9 through 28 and the incidence of adverse events was similar among treatment groups. The UL efficacy of daily febuxostat 80 mg was greater than that of febuxostat 40 mg and allopurinol 300 mg, which exhibited comparable UL efficacy. Safety of febuxostat and allopurinol was comparable at the doses tested. © 2014 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.
Tabara, Yasuharu; Kohara, Katsuhiko; Kawamoto, Ryuichi; Hiura, Yumiko; Nishimura, Kunihiro; Morisaki, Takayuki; Kokubo, Yoshihiro; Okamura, Tomonori; Tomoike, Hitonobu; Iwai, Naoharu; Miki, Tetsuro
2010-01-01
Recent genome-wide association studies have identified several genetic variants as susceptibility loci for serum uric acid (UA) levels. We also identified a common nonsense mutation, W258X, responsible for renal hypouricemia. Here, we investigated clinical implications of these genetic variants by cross-sectional and longitudinal genetic epidemiological analysis. The study enrolled 5,165 Japanese subjects aged 64 ± 12 years from the general population. Clinical parameters were obtained from the personal health records, evaluated at medical checkups. Serum UA levels were significantly different between the SLC22A12 rs11231825 (CC/CT/TT: 4.5 ± 1.6, 5.0 ± 1.4, 5.3 ± 1.4 mg/dl; p = 7.6 × 10(-20)), SLC2A9 rs1014290 (TT/TG/GG: 4.9 ± 1.4, 5.1 ± 1.4, 5.3 ± 1.4 mg/dl; p = 3.1 × 10(-11)) and ABCG2 rs2231142 (TT/TG/GG: 5.3 ± 1.5, 5.2 ± 1.4, 5.1 ± 1.4 mg/dl; p = 2.0 × 10(-5)) genotypes. During 9.4 years of follow-up, 87 new cases of hyperuricemia were diagnosed. Multiple logistic regression analysis identified the accumulation of risk alleles as a significant determinant of future development of hyperuricemia (OR = 7.94; 95% CI: 1.97-53.6). In contrast, subjects with nonsense mutation predominantly showed lower UA levels (XX/XW/WW: 1.3 ± 1.7, 3.6 ± 1.0, 5.2 ± 1.4 mg/dl; p = 9.3 × 10(-82)). However, these subjects showed significantly reduced renal function (β = -0.111; p < 0.001) independently of possible covariates. Accumulation of risk genotypes was an independent risk factor for future development of hyperuricemia. Genetically developed hypouricemia was an independent risk factor for decreased renal function. Copyright © 2010 S. Karger AG, Basel.
2013-01-01
Background Uric acid (UA) may protect muscle function from oxidative damage due to reactive oxygen species through its powerful antioxidant capacity. However, several studies have demonstrated that hyperuricemia is closely related to systemic inflammation and has oxidant properties effects, both of which may increase the risk of muscle strength loss. The purpose of this study was to examine the association of serum UA concentration with grip strength and leg extension power in adult men. Methods This study is a cross-sectional survey in which 630 Japanese male employees aged 30 years and older participated. Five hundred and eighty-six subjects participated in the measurement of grip strength, and 355 subjects participated in the measurement of leg extension power. Blood samples were obtained for serum UA analysis. Results After adjustment for potential confounders, grip strength differed significantly between participants with and those without hyperuricemia (geometric mean and 95% confidence interval [CI]: 40.3 [39.2–41.3] kg vs. 41.9 [41.3–42.5] kg; P = 0.01). In addition, serum UA levels (quartiles) showed an inverted J-shaped curve with grip strength (mean and 95% CI: Q1, 41.6 [40.6–42.6] kg; Q2, 42.2 [41.2–43.2] kg; Q3, 41.8 [40.8–42.8] kg; Q4, 40.4 [39.3–41.4] kg; P for quadratic trend = 0.05). The results in the leg extension power group were similar to those observed in the grip strength group. Conclusion This population-based cross-sectional study shows for the first time that hyperuricemia is associated with poor muscle strength. Moreover, the results indicate an inverted J-shaped association between serum UA quartiles and muscle strength. PMID:24000893
Low-level lead exposure and the prevalence of gout: an observational study.
Krishnan, Eswar; Lingala, Bharathi; Bhalla, Vivek
2012-08-21
Blood lead levels (BLLs) less than 1.21 µmol/L (<25 µg/dL) among adults are considered acceptable by current national standards. Lead toxicity can lead to gouty arthritis (gout), but whether the low lead exposure in the contemporary general population confers risk for gout is not known. To determine whether BLLs within the range currently considered acceptable are associated with gout. Population-based cross-sectional study. The National Health and Nutrition Examination Survey for 2005 through 2008. 6153 civilians aged 40 years or older with an estimated glomerular filtration rate greater than 10 mL/min per 1.73 m2. Outcome variables were self-reported physician diagnosis of gout and serum urate level. Blood lead level was the principal exposure variable. Additional data collected were anthropometric measures, blood pressure, dietary purine intake, medication use, medical history, and serum creatinine concentration. The prevalence of gout was 6.05% (95% CI, 4.49% to 7.62%) among patients in the highest BLL quartile (mean, 0.19 µmol/L [3.95 µg/dL]) compared with 1.76% (CI, 1.10% to 2.42%) among those in the lowest quartile (mean, 0.04 µmol/L [0.89 µg/dL]). Each doubling of BLL was associated with an unadjusted odds ratio of 1.74 (CI, 1.47 to 2.05) for gout and 1.25 (CI, 1.12 to 1.40) for hyperuricemia. After adjustment for renal function, diabetes, diuretic use, hypertension, race, body mass index, income, and education level, the highest BLL quartile was associated with a 3.6-fold higher risk for gout and a 1.9-fold higher risk for hyperuricemia compared with the lowest quartile. Blood lead level does not necessarily reflect the total body lead burden. Blood lead levels in the range currently considered acceptable are associated with increased prevalence of gout and hyperuricemia.
Rayner, Brian L; Trinder, Yvonne A; Baines, Donette; Isaacs, Sedick; Opie, Lionel H
2006-02-01
Hyperuricemia may counter benefits of blood pressure (BP) reduction, although this is controversial. We examined the effects of candesartan and losartan on uric acid, creatinine, and fibrinogen. Patients with hypertension and serum uric acid > or = 0.42 mmol/L (7 mg/dL) associated with diuretics were randomized to receive losartan 50 to 100 mg or candesartan 8 to 16 mg for 24 weeks. At randomization and after 24 weeks, systolic and diastolic BP, serum uric acid, creatinine, and fibrinogen were measured. A total of 59 patients were entered into the study (30 in the losartan and 29 in the candesartan group). Mean systolic and diastolic BP were reduced in the candesartan group, from 156 mm Hg at baseline to 132 mm Hg at 24 weeks, and from 90.9 to 80.8 mm Hg respectively, P < .0001), and in the losartan group from 150.3 to 132 mm Hg and from 89.6 to 77.6 respectively, P < 0001). Overall mean values of fibrinogen levels were again reduced from 4.39 g/L at baseline to 4.01 g/L at 24 weeks (P < .02). Mean values of serum uric acid in the losartan and candesartan groups were similar at baseline (0.44 and 0.46 mmol/L, respectively), but they were lower in the losartan group after 24 weeks (0.39 and 0.48 mmol/L, P = .01). Twelve patients (44%) in the candesartan group had a 10% increase in serum creatinine compared with four patients (14.2%) in the losartan group (P < .02). Candesartan and losartan lowered BP, but only losartan reduced uric acid. The lowering of fibrinogen in both groups may explain the reduction in stroke with angiotensin receptor blockers. The effect of persistent hyperuricemia on renal function requires further study.
Hydroxychavicol: a potent xanthine oxidase inhibitor obtained from the leaves of betel, Piper betle.
Murata, Kazuya; Nakao, Kikuyo; Hirata, Noriko; Namba, Kensuke; Nomi, Takao; Kitamura, Yoshihisa; Moriyama, Kenzo; Shintani, Takahiro; Iinuma, Munekazu; Matsuda, Hideaki
2009-07-01
The screening of Piperaceous plants for xanthine oxidase inhibitory activity revealed that the extract of the leaves of Piper betle possesses potent activity. Activity-guided purification led us to obtain hydroxychavicol as an active principle. Hydroxychavicol is a more potent xanthine oxidase inhibitor than allopurinol, which is clinically used for the treatment of hyperuricemia.
Serum Uric Acid and Risk for Acute Kidney Injury Following Contrast.
Kanbay, Mehmet; Solak, Yalcin; Afsar, Baris; Nistor, Ionut; Aslan, Gamze; Çağlayan, Ozlem Hilal; Aykanat, Asli; Donciu, Mihaela-Dora; Lanaspa, Miguel A; Ejaz, Ahsan A; Johnson, Richard J; Covic, Adrian
2017-02-01
Contrast-induced acute kidney injury (CI-AKI) is a common cause of hospital-acquired acute kidney injury (AKI). We evaluated the evidence that uric acid (UA) plays a pathogenic role in CI-AKI. Ten studies were eligible for inclusion for meta-analysis. Hyperuricemia predicted risk for cases with AKI in prospective cohort studies. Higher levels of serum UA (SUA), as defined by the authors, were associated with a 2-fold increased risk to develop AKI (pooled odds ratio 2.03; 95% confidence interval [CI] 1.48-2.78). Significant heterogeneity was found in cohort studies ( P = .001, I 2 = 85.7%). In 2 clinical trials, lowering of SUA with saline hydration was significantly associated with reduced risk for AKI compared with saline hydration alone or saline hydration with N-acetyl cysteine. An analysis of 2 randomized controlled trials found that allopurinol with saline hydration had a significant protective effect on renal function (assessed by serum creatinine values) compared with hydration alone (mean difference: -0.52 mg/dL; 95% CI: -0.81 to -0.22). Hyperuricemia independently predicts CI-AKI. Two clinical trials suggest lowering SUA may prevent CI-AKI. The mechanism by which UA induces CI-AKI is likely related to acute uricosuria.
Amat, Nurmuhammat; Umar, Anwar; Hoxur, Parida; Anaydulla, Mihrigul; Imam, Guzalnur; Aziz, Ranagul; Upur, Halmurat; Kijjoa, Anake; Moore, Nicholas
2015-04-25
Karapxa decoction (KD) is a Traditional Uighur Medicine used for hepatitis, cholecystitis, gastralgia, oedema, gout and arthralgia. Because of its purported effect in gout, its effects were tested in hyperuricemic mice models induced by yeast extract paste or potassium oxonate, as well as its capacity to scavenge free radicals in vitro. Hyperuricemia was induced in mice by yeast extract paste or potassium oxonate. KD was given orally for 14 days at 200, 400 and 800 mg/kg/day, with Allopurinol 10 mg/kg/day as positive control. Serum uric acid (UA), and liver xanthine oxidase activity (XO) were measured. Scavenging activity of KD on 1, 1-diphenyl-2-picrylhydrazyl radicals (DPP•), nitric oxide (•NO), superoxide (O2•-), efficiency against lipid peroxidation, and XO inhibition were determined in vitro. KD inhibited liver XO activity and reduced serum uric acid in hyperuricemic mice. KD also showed noticeable antioxidant activity, scavenging free radicals (DPP•, •NO and O2•-). It was effective against lipid peroxidation and inhibited XO in vitro. This study supports the traditional use of Karapxa decoction to treat hyperuricemia and gout.
ARISTOLOCHIA BRACTEOLATE RETZ. ATTENUATES HYPERURICEMIA IN A METABOLIC ARTHRITIS RAT MODEL.
Li, Yun-Peng; Wu, Shuang; Ran, Afou; Xu, Da-Yong; Wei, Jing-Mei; Zhao, Zi-Long
2017-01-01
The leaves of Aristolochia bracteolata Retz. has been documented in the folk medicine literature for its anti-arthritic activity. The target of the research envisaged was to elucidate the activity of A. bracteolata extract on hyperuricemic condition in arthritis rat model. Dried and powdered plant leaves were extracted using ether and chloroform. Potassium oxonate was injected intra-articularly to produce arthritis. The hyperuricemic effect, of A. bracteolate was analyzed by studying levels of uric acid in serum as well as in urine of arthritis induced rats. Effects of plant extracts were also studied on BUN (blood urea nitrogen) levels and fraction of uric acid excreted. Results indicate that administration of A. bracteolata presented substantial change in uric acid concentration, augmented by potassium oxonate administration in rats. The reduction in levels of uric acid levels was nearly same as allopurinol. The investigation also revealed that the primary plant extract has nephroprotective effect by enhancing the production of Prostaglandin E 2 and Interleukin-1. Histological studies of rat kidney slices indicated the safety of the present plant extract. The crude extract of A. bracteolate can be used to reduce hyperuricemia in metabolic arthritis produced in rat model, without inducing any potential damaging effects.
Effects of febuxostat on serum urate level in Japanese hyperuricemia patients.
Yamamoto, Tetsuya; Hidaka, Yuji; Inaba, Masaaki; Ishimura, Eiji; Ooyama, Hiroshi; Kakuda, Hirokazu; Moriwaki, Yuji; Higami, Kenshi; Ohtawara, Akira; Hosoya, Tatsuo; Nishikawa, Hazime; Taniguchi, Atsuo; Ueda, Takanori; Yamauchi, Takahiro; Fujimori, Shin; Mineo, Ikuo; Yamanaka, Hisashi
2015-09-01
We assessed the efficacy and adverse effects of febuxostat in male hyperuricemia patients. This was a 12-week, multicenter, open-label, uncontrolled study. The enrolled subjects were 89 hyperuricemic male patients (12 overexcretors, 56 normal excretors, and 21 underexcretors). The endpoint was percent change in serum urate level. The concentration of urate in serum before and 12 weeks after beginning administration of febuxostat in the overexcretors was 9.34 ± 1.48 and 5.59 ± 1.17 mg/dl, respectively, while those were 8.59 ± 1.24 and 5.41 ± 1.35 mg/dl, respectively, in the normal excretors, and 8.29 ± 1.01and 5.11 ± 1.71 mg/dl, respectively, in the underexcretors. After 12 weeks, the rate of change in serum urate after beginning administration of febuxostat was - 0.384 ± 0.186 in the overexcretors, - 0.368 ± 0.128 in the normal excretors, and - 0.365 ± 0.217 in the underexcretors, with no significant differences among them. A common adverse event related to febuxostat was gout flare. Febuxostat effectively reduced the concentration of urate in serum in hyperuricemic patients regardless of the level of uric acid excreted in urine without severe adverse effects.
Niegawa, Tomomi; Takitani, Kimitaka; Takaya, Ryuzo; Ishiro, Manabu; Kuroyanagi, Yuichi; Okasora, Keisuke; Minami, Yukako; Matsuda, Takuya; Tamai, Hiroshi
2017-09-01
Down syndrome, caused by trisomy 21, is characterized by congenital abnormalities as well as mental retardation. From the neonatal stage through adolescence, patients with Down syndrome often have several complications. Thus, it is important to attain knowledge of the prevalence of these comorbidities in children with Down syndrome. We, therefore, evaluated the biochemical data, thyroid function, and anthropometric parameters, and analyzed the association among them in Japanese children and early adolescents with Down syndrome. There was no difference in the prevalence of obesity and overweight between boys and girls. The level of uric acid was higher in boys than in girls. Moreover, the prevalence of hyperuricemia was also higher in boys than in girls (approximately 32% and 10%, respectively). The prevalence of subclinical hypothyroidism in children with Down syndrome was approximately 20%, with no significant sex differences. The levels of uric acid and dehydroepiandrosterone-sulfate were positively associated with age, while the levels of thyroid-stimulating hormone and free thyroxine had a negative association with age. Overall, children with Down syndrome, exhibit a higher incidence of hyperuricemia. Therefore, uric acid levels, as well as thyroid function, from childhood to early adulthood should be monitored in this patient cohort.
[Risk factors for non communicable chronic diseases among workers of a financial company].
Fagalde, María del Pilar; del Solar, José Antonio; Guerrero, Marcia; Atalah, Eduardo
2005-08-01
The epidemic of cardiovascular diseases in Chile, requires the development of strategies in health promotion and prevention. To assess the prevalence of risk factors for chronic non communicable diseases among workers of a financial company in Metropolitan Santiago. Assessment of 2,225 workers (1,383 males with a median age of 49 years and 842 females with a median age of 43 years). All answered an enquiry about education, medical history, smoking habits and physical activity. Body mass index and blood pressure were measured and a blood sample was obtained to measure blood glucose and lipid levels. Logistic repression models were used to determine the main risk factors for hypertension, diabetes, obesity, hypercholesterolemia and hyperuricemia. Sixteen percent of studied subjects were obese, 49% had overweight, 57% had hypercholesterolemia, 28% had high blood pressure, 4% were diabetic, 4% had hyperuricemia, 45% smoked and 83% were sedentary. Each worker had a mean of 2.4+/-1.1 risk factors. This figure was significantly higher among men, obese subjects, those older than 40 years and those with a lower educational level. There is an important disease burden among the studied subjects, specially among obese and older individuals. Healthy lifestyles should be promoted in this population.
White blood cell count and the incidence of hyperuricemia: insights from a community-based study.
Liu, Jian; Shen, Pingyan; Ma, Xiaobo; Yu, Xialian; Ni, Liyan; Hao, Xu; Wang, Weiming; Chen, Nan
2018-06-23
Hyperuricemia (HUA) is a risk factor for chronic kidney disease (CKD). The relationship between HUA and white blood cell (WBC) count remains unknown. A sampling survey for CKD was conducted in Sanlin community in 2012 and 2014. CKD was defined as proteinuria in at least the microalbuminuric stage or an estimated GFR of 60 mL/(min∙1.73 m 2 ). HUA was defined as serum uric acid > 420 μmol/L in men and > 360 μmol/L in women. This study included 1024 participants. The prevalence of HUAwas 17.77%. Patients with HUA were more likely to have higher levels of WBC count, which was positively associated with HUA prevalence. This association was also observed in participants without CKD, diabetes mellitus, hyperlipidemia, or obesity. Multivariate logistic regression analysis showed that WBC count was independently associated with the risk for HUA in male and female participants. Compared with participants without HUA, inflammatory factors such as high-sensitivity C-reactive protein, tumor necrosis factor-α, and interleukin 6 increased in participants with HUA. Hence, WBC count is positively associated with HUA, and this association is independent of conventional risk factors for CKD.
Renal Transport of Uric Acid: Evolving Concepts and Uncertainties
Bobulescu, Ion Alexandru; Moe, Orson W.
2013-01-01
In addition to its role as a metabolic waste product, uric acid has been proposed to be an important molecule with multiple functions in human physiology and pathophysiology and may be linked to human diseases beyond nephrolithiasis and gout. Uric acid homeostasis is determined by the balance between production, intestinal secretion, and renal excretion. The kidney is an important regulator of circulating uric acid levels, by reabsorbing around 90% of filtered urate, while being responsible for 60–70% of total body uric acid excretion. Defective renal handling of urate is a frequent pathophysiologic factor underpinning hyperuricemia and gout. In spite of tremendous advances over the past decade, the molecular mechanisms of renal urate transport are still incompletely understood. Many transport proteins are candidate participants in urate handling, with URAT1 and GLUT9 being the best characterized to date. Understanding these transporters is increasingly important for the practicing clinician as new research unveils their physiology, importance in drug action, and genetic association with uric acid levels in human populations. The future may see the introduction of new drugs that specifically act on individual renal urate transporters for the treatment of hyperuricemia and gout. PMID:23089270
Characterization of Mesoamerican Nephropathy in a Kidney Failure Hotspot in Nicaragua.
Kupferman, Joseph; Amador, Juan José; Lynch, Katherine E; Laws, Rebecca L; López-Pilarte, Damaris; Ramírez-Rubio, Oriana; Kaufman, James S; Lau, Jorge Luis; Weiner, Daniel E; Robles, Ninoska Violeta; Verma, Karina P; Scammell, Madeleine K; McClean, Michael D; Brooks, Daniel R; Friedman, David J
2016-11-01
Mesoamerican nephropathy (MeN) is a kidney disease of unknown cause that mainly affects working-age men in Central America. Despite being a major cause of morbidity and mortality in this region, its clinical characteristics have not been well defined. Cross-sectional family-based study. 266 members of 24 families with high chronic kidney disease (CKD) burdens in a MeN hotspot in Northwestern Nicaragua. We compared clinical and biochemical characteristics of affected individuals first with their unaffected relatives and then with NHANES (National Health and Nutrition Examination Survey) participants with CKD in order to reveal identifying features of MeN. CKD defined as serum creatinine level ≥ 1.5mg/dL in men and ≥1.4mg/dL in women. Clinical and biochemical parameters, including serum sodium, potassium, bicarbonate, calcium, magnesium, phosphorus, and uric acid. Hyperuricemia, in many cases severe, was common among patients with MeN. Uric acid levels in patients with MeN were higher than those in NHANES participants (mean, 9.6 vs 7.4mg/dL for men in each group) despite more frequent use of uric acid-lowering medications in Nicaraguan individuals (71.7% vs 11.2%). In multivariable linear mixed-effects regression analysis, uric acid levels were 2.0mg/dL (95% CI, 1.0-3.0; P<0.001) higher in patients with MeN compared with their NHANES counterparts after adjusting for age, estimated glomerular filtration rate, and uric acid-lowering therapies. In contrast to prior reports, hyponatremia and hypokalemia were not common. CKD defined by single serum creatinine measurement; population likely not representative of full MeN phenotype spectrum across Central America; major differences between MeN and NHANES groups in important characteristics such as age, ancestry, and recruitment method. Hyperuricemia out of proportion to the degree of decreased kidney function was common among Nicaraguan patients with MeN. Our results suggest that rather than being solely a consequence of CKD, hyperuricemia may play a role in MeN pathogenesis, a hypothesis that deserves further study. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Choi, Hyon K; Curhan, Gary
2007-06-15
Coffee is one of the most widely consumed beverages in the world and may affect serum uric acid levels and risk of gout via various mechanisms. Our objective was to evaluate the relationship between coffee, tea, and caffeine intake and serum uric acid level in a nationally representative sample of men and women. Using data from 14,758 participants ages >/=20 years in the Third National Health and Nutrition Examination Survey (1988-1994), we examined the relationship between coffee, tea, and caffeine intake and serum uric acid level using linear regression. Additionally, we examined the relationship with hyperuricemia (serum uric acid >7.0 mg/dl among men and >5.7 mg/dl among women) using logistic regression. Intake was assessed by a food frequency questionnaire. Serum uric acid level decreased with increasing coffee intake. After adjusting for age and sex, serum uric acid level associated with coffee intake of 4 to 5 and >/=6 cups daily was lower than that associated with no intake by 0.26 mg/dl (95% confidence interval [95% CI] 0.11, 0.41) and 0.43 mg/dl (95% CI 0.23, 0.65; P for trend < 0.001), respectively. After adjusting for other covariates, the differences remained significant (P for trend < 0.001). Similarly, there was a modest inverse association between decaffeinated coffee intake and serum uric acid levels (multivariate P for trend 0.035). Total caffeine from coffee and other beverages and tea intake were not associated with serum uric acid levels (multivariate P for trend 0.15). The multivariate odds ratio for hyperuricemia in individuals with coffee intake >/=6 cups daily compared with those with no coffee use was 0.57 (95% CI 0.35, 0.94; P for trend 0.001). These findings from a nationally representative sample of US adults suggest that coffee consumption is associated with lower serum uric acid level and hyperuricemia frequency, but tea consumption is not. The inverse association with coffee appears to be via components of coffee other than caffeine.
Kawasaki, Yukihiko; Hosoya, Mitsuaki; Yasumura, Seiji; Ohira, Tetsuya; Satoh, Hiroaki; Suzuki, Hitoshi; Sakai, Akira; Ohtsuru, Akira; Takahashi, Atsushi; Ozasa, Kotaro; Kobashi, Gen; Kamiya, Kenji; Yamashita, Shunichi; Abe, Masafumi
2015-01-01
To assist in the long-term health management of residents and evaluate the health impacts after the Tokyo Electric Power Company's Fukushima Daiichi Nuclear Power Plant accident in Fukushima Prefecture, the Fukushima prefectural government decided to implement the Fukushima Health Management Survey. This report describes the results for residents aged 15 years or younger who received health checks and evaluates the data obtained from 2011 and 2012. The target group consisted of residents aged 15 years or younger who had lived in the evacuation zone. The health checks were performed on receipt of an application from any of the residents. The checks, which included the measurements of height, weight, blood pressure, biochemical laboratory findings, and peripheral blood findings, were performed as required. 1) A total of 17,934 (64.5%) and 11,780 (43.5%) residents aged 15 years or younger received health checks in 2011 and 2012, respectively. 2) In both years, a number of male and female residents in the 7-15 year age group were found to suffer from obesity, hyperlipidemia, hyperuricemia, or liver dysfunction. Furthermore, pediatric aged 15 years or younger were commonly observed to suffer from hypertension or glucose metabolic abnormalities. 3) A comparison of data from 2012 and 2011 demonstrated that both males and females frequently showed increased body height and decreased body weight in 2012. The prevalence of hypertension, glucose metabolic abnormalities, or high γ-GTP values in males and females in the 7-15 year age group in 2012 was lower than that in 2011. However, the prevalence of hyperuricemia among residents in the 7-15 year age group was higher in 2012 than in 2011. These results suggested that some residents aged 15 years or under who had lived in the evacuation zone had developed obesity, hyperlipidemia, hyperuricemia, liver dysfunction, hypertension, or glucose metabolic abnormalities. Therefore, we think that it is necessary to continue the health checks for these residents in order to ameliorate these lifestyle-related diseases.
Kawasaki, Yukihiko; Hosoya, Mitsuaki; Yasumura, Seiji; Ohira, Tetsuya; Satoh, Hiroaki; Suzuki, Hitoshi; Sakai, Akira; Ohtsuru, Akira; Takahashi, Atsushi; Ozasa, Kotaro; Kobashi, Gen; Kamiya, Kenji; Yamashita, Shunichi; Abe, Masafumi
2014-01-01
To assist in the long-term health management of residents and evaluate health impacts after the Tokyo Electric Power Company's Fukushima Daiichi Nuclear Power Plant accident in Fukushima Prefecture, the Fukushima prefectural government decided to conduct the Fukushima Health Management Survey. This report describes the results for residents aged 16 years or older who received the health check examinations and evaluates the data obtained from 2011 and 2012. The target group consisted of residents aged 16 years or older who had lived in the evacuation zone. The health check examinations were performed on receipt of an application for a health check examination from any of the residents. The examinations, including measurements of height, weight, abdominal circumference/body mass index (BMI), blood pressure, biochemical laboratory findings, and peripheral blood findings, were performed as required. 1) A total of 56,399 (30.9%) and 47,009 (25.4%) residents aged 16 years or older received health checks in 2011 and 2012, respectively. 2) In both years, a number of male and female residents in the 16-39 year age group were found to suffer obesity, hyperlipidemia, hyperuricemia, or liver dysfunction, and the prevalence of obesity and hyperlipidemia among residents increased with age. Furthermore, the proportion of residents with hypertension, glucose metabolic abnormalities or renal dysfunction was higher in those aged 40 years or older. 3) The frequencies of obesity, hypertension and hyperlipidemia among residents in 2012 were lower than those in 2011. However, the prevalence of liver dysfunction, hyperuricemia, glucose metabolic abnormalities and renal dysfunction among residents was higher in 2012 than in 2011. These results suggested the number of residents who had lived in the evacuation zone with obesity, hyperlipidemia, hyperuricemia, liver dysfunction, hypertension, glucose metabolic abnormalities, or renal dysfunction increased with age in all age groups. Therefore, we think that it is necessary to continue with health check examinations for these residents in order to ameliorate lifestyle-related disease.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Objective Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. Methods The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. Results We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Conclusion Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9. PMID:25268603
Ayasreh, Nadia; Bullich, Gemma; Miquel, Rosa; Furlano, Mónica; Ruiz, Patricia; Lorente, Laura; Valero, Oliver; García-González, Miguel Angel; Arhda, Nisrine; Garin, Intza; Martínez, Víctor; Pérez-Gómez, Vanessa; Fulladosa, Xavier; Arroyo, David; Martínez-Vea, Alberto; Espinosa, Mario; Ballarín, Jose; Ars, Elisabet; Torra, Roser
2018-05-18
Autosomal dominant tubulointerstitial kidney disease (ADTKD) is a rare underdiagnosed cause of end-stage renal disease (ESRD). ADTKD is caused by mutations in at least 4 different genes: MUC1, UMOD, HNF1B, and REN. Retrospective cohort study. 56 families (131 affected individuals) with ADTKD referred from different Spanish hospitals. Clinical, laboratory, radiologic, and pathologic data were collected, and genetic testing for UMOD, MUC1, REN, and HNF1B was performed. Hyperuricemia, ultrasound findings, renal histology, genetic mutations. Age at ESRD, rate of decline in estimated glomerular filtration rate. ADTKD was diagnosed in 25 families (45%), 9 carried UMOD pathogenic variants (41 affected members), and 16 carried the MUC1 pathogenic mutation c.(428)dupC (90 affected members). No pathogenic variants were identified in REN or HNF1B. Among the 77 individuals who developed ESRD, median age at onset of ESRD was 51 years for those with ADTKD-MUC1 versus 56 years (P=0.1) for those with ADTKD-UMOD. Individuals with the MUC1 duplication presented higher risk for developing ESRD (HR, 2.24; P=0.03). The slope of decline in estimated glomerular filtration rate showed no significant difference between groups (-3.0mL/min/1.73m 2 per year in the ADTKD-UMOD group versus -3.9mL/min/1.73m 2 per year in the ADTKD-MUC1 group; P=0.2). The prevalence of hyperuricemia was significantly higher in individuals with ADTKD-UMOD (87% vs 54%; P=0.006). Although gout occurred more frequently in this group, the difference was not statistically significant (24% vs 7%; P=0.07). Relatively small Spanish cohort. MUC1 analysis limited to cytosine duplication. The main genetic cause of ADTKD in our Spanish cohort is the MUC1 pathogenic mutation c.(428)dupC. Renal survival may be worse in individuals with the MUC1 mutation than in those with UMOD mutations. Clinical presentation does not permit distinguishing between these variants. However, hyperuricemia and gout are more frequent in individuals with ADTKD-UMOD. Copyright © 2018 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
The Effect of Allopurinol on Renal Function.
Krishnamurthy, Aneesa; Lazaro, Deana; Stefanov, Dimitre G; Blumenthal, David; Gerber, Donald; Patel, Sheetal
2017-01-01
Hyperuricemia is associated with development of gout, hypertension, and renal disease. The impact of allopurinol, a urate-lowering therapy, on renal function is unclear, especially in patients with chronic kidney disease who are at higher risk of hypersensitivity reaction. The aim of this study was to determine the effect of allopurinol on kidney function in hyperuricemic male veterans. This is a retrospective cohort study using pharmacy, medical, and laboratory records of veterans enrolled at the Veterans Administration New York Harbor Healthcare System, Brooklyn campus. Fifty patients with hyperuricemia defined as a serum uric acid greater than 7 mg/dL (average of ~9 mg/dL), newly started on allopurinol for any reason, with evidence of treatment compliance, were matched by age, race, sex, and estimated glomerular filtration rate (EGFR) to 50 hyperuricemic control subjects. The retrospective cases were observed from October 2000 until November 2006, at which time there was a change in the laboratory analyzer, making further comparisons inappropriate. On average, patients treated with a mean 221 (SD, 96) mg/d dose of allopurinol achieved 11.9 mL/min higher GFR (95% confidence interval, 4.8-11.9 mg/d dose; P = 0.01) than did the control group. Treatment effect was found to depend on the initial EGFR, as indicated by the significant treatment by initial EGFR interaction (P = 0.004) and increased with a higher initial EGFR. The allopurinol-treated group had a 0.10 mg/dL lower final creatinine level (95% confidence interval, 0.003-0.20 mg/dL; P = 0.04) than did the control subjects, adjusted for initial creatinine and age. The average length of follow-up was 3.4 years. There were 5 mild adverse events in the treated cases. Treatment of hyperuricemic patients with allopurinol over an average of 3.4 years resulted in a significant improvement of kidney function in this male cohort from the Veterans Administration Healthcare System. Clinicians should consider this potential benefit of allopurinol in the treatment of patients with hyperuricemia, those with overall maintained renal function.
NALP3 inflammasome functional polymorphisms and gout susceptibility.
Miao, Zhi-Min; Zhao, Shi-Hua; Yan, Sheng-Li; Li, Chang-Gui; Wang, Yan-Gang; Meng, Dong-Mei; Zhou, Li; Mi, Qing-Sheng
2009-01-01
Gout is the most common autoinflammatory arthritis characterized by elevated serum urate and recurrent attacks of intra-articular crystal deposition of monosodium urate (MSU). Although the pathogenesis of gout is still unclear, accumulated studies indicate that genetic factors trigger gout development, including some susceptibility genes that control the production and clearance of urate and lead to hyperuricemia. However, the epidemiological evidence suggests that only less than 10% of hyperuricemia patients develop gout, indicating that other genes unrelated to the urate metabolism may also contribute to the diseases susceptibility. Accumulated evidences have implied that MSU crystal-induced inflammation is a paradigm of innate immunity and that NALP3 inflammasome, an innate immune complex containing NALP3, ASC and CARD-8, is involved in gout development. Recent studies suggest that NALP3 and CARD-8 functional mutations contribute to the development of autoinflammatory diseases including hereditary periodic fever syndrome, arthritis as well as hypertension susceptibility. Taking into account these genetic findings, here we would like to propose a novel hypothesis that functional mutations in NALP3 inflammasome may make NALP3 inflammasome as attractive susceptibility candidates and genetic markers for gout. Further clinical genetic studies need to be performed to confirm the role of NALP3 inflammasome in the etiology of gout.
Zhao, Jianxing; Huang, Ying
2015-10-23
Monitoring blood uric acid (UA) is important in all patients on urate-lowering therapy so that the selection of the effective drugs and dosage adjustments could be made until the target level is reached. The issue is that frequent needle jabs are unacceptable. Reported mean levels of salivary UA were 185-240 μmol/l in healthy adults. A linear correlation was demonstrated between UA concentrations in saliva and plasma. We monitored salivary UA instead of plasmatic UA in a patient with gout. Allopurinol and benzbromarone were used as the therapeutic drugs. Salivary UA; urinary UA and creatinine; and plasmatic UA, creatinine, kynurenine and tryptophan were measured by HPLC. Salivary UA indicated the efficacy of therapy accurately and conveniently. After eight weeks therapy, the weekly mean levels of salivary UA were reduced and maintained to <300 μmol/l, which was equivalent to <360 μmol/l of plasmatic UA according to the salivary UA/plasmatic UA ratio of this patient. Measurement of salivary UA is a noninvasive and useful way for monitoring the status of hyperuricemia and the therapeutic efficacy of urate-lowering therapy. It has value for the management of hyperuricemia and gout. Copyright © 2015 Elsevier B.V. All rights reserved.
Hunyadi, A.; Liktor-Busa, E.; Márki, Á.; Martins, A.; Jedlinszki, N.; Hsieh, T. J.; Báthori, M.; Hohmann, J.; Zupkó, I.
2013-01-01
The leaves of Morus alba L. have a long history in Traditional Chinese Medicine and also became valued by the ethnopharmacology of many other cultures. The worldwide known antidiabetic use of the drug has been suggested to arise from a complex combination effect of various constituents. Moreover, the drug is also a potential antihyperuricemic agent. Considering that type 2 diabetes and hyperuricemia are vice-versa in each other's important risk factors, the use of mulberry originated phytotherapeutics might provide an excellent option for the prevention and/or treatment of both conditions. Here we report a series of relevant in vitro and in vivo studies on the bioactivity of an extract of mulberry leaves and its fractions obtained by a stepwise gradient on silica gel. In vivo antihyperglycemic and antihyperuricemic activity, plasma antioxidant status, as well as in vitro glucose consumption by adipocytes in the presence or absence of insulin, xanthine oxidase inhibition, free radical scavenging activity, and inhibition of lipid peroxidation were tested. Known bioactive constituents of M. alba (chlorogenic acid, rutin, isoquercitrin, and loliolide) were identified and quantified from the HPLC-DAD fingerprint chromatograms. Iminosugar contents were investigated by MS/MS, 1-deoxynojirimycin was quantified, and amounts of 2-O-alpha-D-galactopyranosyl-1-deoxynojirimicin and fagomine were additionally estimated. PMID:24381639
Mahbub, M H; Yamaguchi, Natsu; Takahashi, Hidekazu; Hase, Ryosuke; Ishimaru, Yasutaka; Sunagawa, Hiroshi; Amano, Hiroki; Kobayashi-Miura, Mikiko; Kanda, Hideyuki; Fujita, Yasuyuki; Yamamoto, Hiroshi; Yamamoto, Mai; Kikuchi, Shinya; Ikeda, Atsuko; Kageyama, Naoko; Nakamura, Mina; Tanabe, Tsuyoshi
2017-12-15
Previous studies demonstrated independent contributions of plasma free amino acids (PFAAs) and high uric acid (UA) concentrations to increased risks of lifestyle-related diseases (LSRDs), but the important associations between these factors and LSRDs remain unknown. We quantified PFAAs and UA amongst Japanese subjects without LSRDs (no-LSRD, n = 2805), and with diabetes mellitus (DM, n = 415), dyslipidemia (n = 3207), hypertension (n = 2736) and metabolic syndrome (MetS, n = 717). The concentrations of most amino acids differed significantly between the subjects with and without hyperuricemia (HU) and also between the no-LSRD and LSRD groups (p < 0.05 to 0.001). After adjustment, the logistic regression analyses revealed that lysine in DM, alanine, proline and tyrosine in dyslipidemia, histidine, lysine and ornithine in hypertension, and lysine and tyrosine in MetS demonstrated significant positive associations with HU among the patients with LSRDs only (p < 0.05 to 0.005). By contrast, arginine, asparagine and threonine showed significant inverse associations with HU in the no-LSRD group only (p < 0.05 to 0.01). For the first time, we provide evidence for distinct patterns of association between PFAAs and HU in LSRDs, and postulate the possibility of interplay between PFAAs and UA in their pathophysiology.
Analysis of Risk Factors for Colonic Diverticular Bleeding: A Matched Case-Control Study.
Sugihara, Yuusaku; Kudo, Shin-ei; Miyachi, Hideyuki; Misawa, Masashi; Okoshi, Shogo; Okada, Hiroyuki; Yamamoto, Kazuhide
2016-03-01
Diverticular bleeding can occasionally cause massive bleeding that requires urgent colonoscopy (CS) and treatment. The aim of this study was to identify significant risk factors for colonic diverticular hemorrhage. Between January 2009 and December 2012, 26,602 patients underwent CS at our institution. One hundred twenty-three patients underwent an urgent CS due to acute lower gastrointestinal hemorrhage. Seventy-two patients were diagnosed with colonic diverticular hemorrhage. One hundred forty-nine age- and sex-matched controls were selected from the patients with nonbleeding diverticula who underwent CS during the same period. The relationship of risk factors to diverticular bleeding was compared between the cases and controls. Uni- and multivariate conditional logistic regression analyses demonstrated that the use of nonsteroidal anti-inflammatory drugs (odds ratio [OR], 14.70; 95% confidence interval [CI], 3.89 to 55.80; p<0.0001), as well as the presence of cerebrovascular disease (OR, 8.66; 95% CI, 2.33 to 32.10; p=0.00126), and hyperuricemia (OR, 15.5; 95% CI, 1.74 to 138.00; p=0.014) remained statistically significant predictors of diverticular bleeding. Nonsteroidal anti-inflammatory drugs, cerebrovascular disease and hyperuricemia were significant risks for colonic diverticular hemorrhage. The knowledge obtained from this study may provide some insight into the diagnostic process for patients with lower gastrointestinal bleeding.
Management of hyperuricemia in gout: focus on febuxostat
Reinders, Mattheus K; Jansen, Tim L Th A
2010-01-01
Gout is the most common inflammatory arthritis in an elderly population, and can be diagnosed with absolute certainty by polarization microscopy. However, diagnosis may be challenging because atypical presentations are more common in the elderly. Management of hyperuricemia in the elderly with gout requires special consideration because of co-medication, contra-indications, and risk of adverse reactions. Urate-lowering agents include allopurinol and uricosuric agents. These also must be used sensibly in the elderly, especially when renal function impairment is present. However, if used at the lowest dose that maintains the serum urate level below 5.0 to 6.0 mg/dL (0.30 to 0.36 mmol/L), the excess urate in the body will eventually be eliminated, acute flares will no longer occur, and tophi will resolve. Febuxostat, a new xanthine oxidase inhibitor, is welcomed, as few alternatives for allopurinol are available. Its pharmacokinetics and pharmacodynamics are not significantly altered in patients with moderate renal function or hepatic impairment. Its antihyperuricemic efficacy at 80 to 120 mg/day is better than “standard dosage” allopurinol (300 mg/day). Long-term safety data and efficacy data on tophus diminishment and reduction of gout flares have recently become available. Febuxostat may provide an important option in patients unable to use allopurinol, or refractory to allopurinol. PMID:20169038
The ygeW encoded protein from Escherichia coli is a knotted ancestral catabolic transcarbamylase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yongdong; Jin, Zhongmin; Yu, Xiaolin
Purine degradation plays an essential role in nitrogen metabolism in most organisms. Uric acid is the final product of purine catabolism in humans, anthropoid apes, birds, uricotelic reptiles, and almost all insects. Elevated levels of uric acid in blood (hyperuricemia) cause human diseases such as gout, kidney stones, and renal failure. Although no enzyme has been identified that further degrades uric acid in humans, it can be oxidized to produce allantoin by free-radical attack. Indeed, elevated levels of allantoin are found in patients with rheumatoid arthritis, chronic lung disease, bacterial meningitis, and noninsulin-dependent diabetes mellitus. In other mammals, some insectsmore » and gastropods, uric acid is enzymatically degraded to the more soluble allantoin through the sequential action of three enzymes: urate oxidase, 5-hydroxyisourate (HIU) hydrolase and 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) decarboxylase. Therefore, an elective treatment for acute hyperuricemia is the administration of urate oxidase. Many organisms, including plants, some fungi and several bacteria, are able to catabolize allantoin to release nitrogen, carbon, and energy. In Arabidopsis thaliana and Eschrichia coli, S-allantoin has recently been shown to be degraded to glycolate and urea by four enzymes: allantoinase, allantoate amidohydrolase, ureidoglycine aminohydrolase, and ureidoglycolate amidohydrolase.« less
Niegawa, Tomomi; Takitani, Kimitaka; Takaya, Ryuzo; Ishiro, Manabu; Kuroyanagi, Yuichi; Okasora, Keisuke; Minami, Yukako; Matsuda, Takuya; Tamai, Hiroshi
2017-01-01
Down syndrome, caused by trisomy 21, is characterized by congenital abnormalities as well as mental retardation. From the neonatal stage through adolescence, patients with Down syndrome often have several complications. Thus, it is important to attain knowledge of the prevalence of these comorbidities in children with Down syndrome. We, therefore, evaluated the biochemical data, thyroid function, and anthropometric parameters, and analyzed the association among them in Japanese children and early adolescents with Down syndrome. There was no difference in the prevalence of obesity and overweight between boys and girls. The level of uric acid was higher in boys than in girls. Moreover, the prevalence of hyperuricemia was also higher in boys than in girls (approximately 32% and 10%, respectively). The prevalence of subclinical hypothyroidism in children with Down syndrome was approximately 20%, with no significant sex differences. The levels of uric acid and dehydroepiandrosterone-sulfate were positively associated with age, while the levels of thyroid-stimulating hormone and free thyroxine had a negative association with age. Overall, children with Down syndrome, exhibit a higher incidence of hyperuricemia. Therefore, uric acid levels, as well as thyroid function, from childhood to early adulthood should be monitored in this patient cohort. PMID:28955133
Taurine decreased uric acid levels in hyperuricemic rats and alleviated kidney injury.
Feng, Ying; Sun, Fang; Gao, Yongchao; Yang, Jiancheng; Wu, Gaofeng; Lin, Shumei; Hu, Jianmin
2017-07-29
Hyperuricemia can lead to direct kidney damage. Taurine participates in several renal physiological processes and has been shown as a renoprotective agent. It has been reported that taurine could reduce uric acid levels in diabetic rats, but to date there was no research on the effects of taurine on hyperuricemic rats with kidney injury. In present study, hyperuricemic rat models were induced by intragastric administration of adenine and ethambutol hydrochloride for 10 days, and taurine (1% or 2%) were added in the drinking water 7 days in advance for consecutively 17 days. The results showed that taurine alleviated renal morphological and pathological changes as well as kidney dysfunction in hyperuricemic rats. Taurine could efficiently decrease the elevated xanthine oxidase activities in hyperuricemic rats, indicating its effect on the regulation of uric acid formation. The reabsorption and secretion of uric acid are dependent on a number of urate transporters. Expressions of three urate transporters were significantly down-regulated in hyperuricemic rats, while taurine prevented the decrease of mRNA and protein expression levels of these urate transporters. The results indicate that taurine might play a role in the regulation of renal uric acid excretion. Therefore, taurine could be a promising agent for the treatment of hyperuricemia. Copyright © 2017 Elsevier Inc. All rights reserved.
Current Concepts of Hyperuricemia and Gout
Klinenberg, James R.
1969-01-01
Recent studies have confirmed that gout is an inborn error of metabolism. It has now become evident that the hyperuricemia associated with gout might occur either due to overproduction of uric acid, underexcretion of uric acid or a combination of these processes. Furthermore, patients with excessive purine synthesis may have a specific enzyme defect resulting in altered feedback inhibition of purine synthesis. A neurological disease manifest by mental retardation, choreo-athetosis, aggressive behavior, lip-biting and self-mutilation and associated with decidedly increased purine biosynthesis serves as a prototype of this kind of disorder. Other defects in regulation of purine biosynthesis have been postulated but their existence not yet confirmed. It has been demonstrated that urate crystals which are deposited from hyperuricemic body fluids set up an acute inflammatory reaction by means of a variety of chemical mediators. Thus, acute gouty arthritis is now recognized as an example of “crystal induced” synovitis. The treatment of gout consists of (1) the control of acute gouty attacks, and (2) the maintenance of normal serum uric acid concentrations. This latter may be achieved either with uricosuric drugs or with xanthine oxidase inhibition. With these principles in mind, it is now possible to avoid many of the severe crippling effects of gout and to restore the vast majority of gouty patients to useful and productive lives. PMID:5773483
Sautin, Yuri Y; Nakagawa, Takahiko; Zharikov, Sergey; Johnson, Richard J
2007-08-01
Uric acid is considered a major antioxidant in human blood that may protect against aging and oxidative stress. Despite its proposed protective properties, elevated levels of uric acid are commonly associated with increased risk for cardiovascular disease and mortality. Furthermore, recent experimental studies suggest that uric acid may have a causal role in hypertension and metabolic syndrome. All these conditions are thought to be mediated by oxidative stress. In this study we demonstrate that differentiation of cultured mouse adipocytes is associated with increased production of reactive oxygen species (ROS) and uptake of uric acid. Soluble uric acid stimulated an increase in NADPH oxidase activity and ROS production in mature adipocytes but not in preadipocytes. The stimulation of NADPH oxidase-dependent ROS by uric acid resulted in activation of MAP kinases p38 and ERK1/2, a decrease in nitric oxide bioavailability, and an increase in protein nitrosylation and lipid oxidation. Collectively, our results suggest that hyperuricemia induces redox-dependent signaling and oxidative stress in adipocytes. Since oxidative stress in the adipose tissue has recently been recognized as a major cause of insulin resistance and cardiovascular disease, hyperuricemia-induced alterations in oxidative homeostasis in the adipose tissue might play an important role in these derangements.
Gout and arrhythmias: In search for causation beyond association.
Giannopoulos, Georgios; Angelidis, Christos; Deftereos, Spyridon
2018-06-13
Gout is a systemic disease, characterized by the formation and deposition of crystals in tissues (mainly in and around the joints) of individuals with elevated serum uric acid levels. Lately, a considerable number of reports relating elevated uric acid and/or gout with rhythm disorders, such as atrial fibrillation, have been published. This review summarizes evidence linking common arrhythmias and hyperuricemia/gout and discusses questions or controversies that surround it. Overall, existing evidence may not be overwhelming, but strongly suggests a positive correlation between uric acid levels and common rhythm disorders. Needless to say that such a link - as a univariate association between the two - is to be expected, given the extensive overlap of risk factors and comorbidities of hyperuricemia/gout and arrhythmias. However, the observed associations seem to persist - in most studies - after extensive adjustment for potential confounders. Still, multivariable analyses of epidemiologically collected data cannot substitute for proof coming from basic and clinical studies. There is obviously a need for further basic research to establish a causal relationship between uric acid effects and arrhythmias, as well as translational studies and clinical trials to investigate the therapeutic implications of such a relationship. Simply put, we are fairly certain that there is association, but proof of causation is what we are still in want of. Copyright © 2018. Published by Elsevier Inc.
Tian, Simiao; Zhang, Xiuzhi; Xu, Yang; Dong, Huimin
2016-01-01
Abstract The body mass index (BMI) and waist circumference (WC) are commonly used anthropometric measures for predicting cardiovascular diseases risk factors, but it is uncertain which specific measure might be the most appropriate predictor of a cluster of cardiometabolic abnormalities (CMA) in Chinese adults. A body shape index (ABSI) and body roundness index (BRI) have been recently developed as alternative anthropometric indices that may better reflect health status. The main aims of this study were to investigate the predictive capacity of ABSI and BRI in identifying various CMA compared to BMI, WC, waist-to-hip ratio (WHpR), and waist-to-height ratio (WHtR), and to determine whether there exists a best single predictor of all CMA. We used data from the 2009 wave of the China Health and Nutrition Survey, and the final analysis included 8126 adults aged 18 to 85 years with available fasting blood samples and anthropometric measurements. Receiver-operating characteristic (ROC) analyses were conducted to assess the best anthropometric indices to predict the risk of hypertension, diabetes, dyslipidemia, hyperuricemia, and metabolic syndrome (MetS). Logistic regression models were fit to evaluate the OR of each CMA according to anthropometric indices. In women, the ROC analysis showed that BRI and WHtR had the best predictive capability in identifying all of CMA (area under the curves [AUCs] ranged from 0.658 to 0.721). In men, BRI and WHtR were better predictor of hypertension, diabetes, and at least 1 CMA (AUC: 0.668, 0.708, and 0.698, respectively), whereas BMI and WC were more sensitive predictor of dyslipidemia, hyperuricemia, and MetS. Furthermore, the ABSI showed the lowest AUCs for each CMA. According to the multivariate logistic regression analysis, BRI and WHtR were superior in discriminating hyperuricemia and at least 1 CMA while BMI performed better in predicting hypertension, diabetes, and MetS in women. In men, WC and BRI were the 2 best predictor of all CMA except MetS, and the ABSI was the worst. Our results showed the novel index BRI could be used as a single suitable anthropometric measure in simultaneously identifying a cluster of CMA compared to BMI and WHtR, especially in Chinese women, whereas the ABSI showed the weakest discriminative power. PMID:27559964
Tian, Simiao; Zhang, Xiuzhi; Xu, Yang; Dong, Huimin
2016-08-01
The body mass index (BMI) and waist circumference (WC) are commonly used anthropometric measures for predicting cardiovascular diseases risk factors, but it is uncertain which specific measure might be the most appropriate predictor of a cluster of cardiometabolic abnormalities (CMA) in Chinese adults. A body shape index (ABSI) and body roundness index (BRI) have been recently developed as alternative anthropometric indices that may better reflect health status. The main aims of this study were to investigate the predictive capacity of ABSI and BRI in identifying various CMA compared to BMI, WC, waist-to-hip ratio (WHpR), and waist-to-height ratio (WHtR), and to determine whether there exists a best single predictor of all CMA.We used data from the 2009 wave of the China Health and Nutrition Survey, and the final analysis included 8126 adults aged 18 to 85 years with available fasting blood samples and anthropometric measurements. Receiver-operating characteristic (ROC) analyses were conducted to assess the best anthropometric indices to predict the risk of hypertension, diabetes, dyslipidemia, hyperuricemia, and metabolic syndrome (MetS). Logistic regression models were fit to evaluate the OR of each CMA according to anthropometric indices.In women, the ROC analysis showed that BRI and WHtR had the best predictive capability in identifying all of CMA (area under the curves [AUCs] ranged from 0.658 to 0.721). In men, BRI and WHtR were better predictor of hypertension, diabetes, and at least 1 CMA (AUC: 0.668, 0.708, and 0.698, respectively), whereas BMI and WC were more sensitive predictor of dyslipidemia, hyperuricemia, and MetS. Furthermore, the ABSI showed the lowest AUCs for each CMA. According to the multivariate logistic regression analysis, BRI and WHtR were superior in discriminating hyperuricemia and at least 1 CMA while BMI performed better in predicting hypertension, diabetes, and MetS in women. In men, WC and BRI were the 2 best predictor of all CMA except MetS, and the ABSI was the worst.Our results showed the novel index BRI could be used as a single suitable anthropometric measure in simultaneously identifying a cluster of CMA compared to BMI and WHtR, especially in Chinese women, whereas the ABSI showed the weakest discriminative power.
Romi, Muhammad Mansyur; Arfian, Nur; Tranggono, Untung; Setyaningsih, Wiwit Ananda Wahyu; Sari, Dwi Cahyani Ratna
2017-10-31
Uric acid (UA) plays important roles in inducing renal inflammation, intra-renal vasoconstriction and renal damage. Endothelin-1 (ET-1) is a well-known profibrotic factor in the kidney and is associated with fibroblast expansion. We examined the role of hyperuricemia conditions in causing elevation of ET-1 expression and kidney injury. Hyperuricemia was induced in mice using daily intraperitoneal injection of uric acid 125 mg/Kg body weight. An NaCl injection was used in control mice. Mice were euthanized on days-7 (UA7) and 14 (UA14). We also added allopurinol groups (UAL7 and UAL14) with supplementation of allopurinol 50 mg/Kg body weight orally. Uric acid and creatinine serum were measured from blood serum. Periodic Acid Schiff (PAS) and Sirius Red staining were done for glomerulosclerosis, tubular injury and fibrosis quantification. mRNA expression examination was performed for nephrin, podocin, preproEndothelin-1 (ppET-1), MCP-1 and ICAM-1. PDGFRβ immunostaining was done for quantification of fibroblast, while α-SMA immunostaining was done for localizing myofibroblast. Western blot analysis was conducted to quantify TGF-β1, α-SMA and Endothelin A Receptor (ETAR) protein expression. Uric acid and creatinine levels were elevated after 7 and 14 days and followed by significant increase of glomerulosclerosis and tubular injury score in the uric acid group (p < 0.05 vs. control). Both UA7 and UA14 groups had higher fibrosis, tubular injury and glomerulosclerosis with significant increase of fibroblast cell number compared with control. RT-PCR revealed down-regulation of nephrin and podocin expression (p < 0.05 vs. control), and up-regulation of MCP-1, ET-1 and ICAM-1 expression (p < 0.05 vs. control). Western blot revealed higher expression of TGF-β1 and α-SMA protein expression. Determination of allopurinol attenuated kidney injury was based on reduction of fibroblast cell number, inflammation mediators and ppET-1 expression with reduction of TGF-β1 and α-SMA protein expression. UA induced glomerulosclerosis, tubular injury and renal fibrosis with reduction of podocyte function and inflammatory mediator elevation. ET-1 and fibroblast expansion might modulate hyperuricemia induced renal fibrosis.
An old disease with new insights: Update on diagnosis and treatment of gout
Bitik, Berivan; Öztürk, M. Akif
2014-01-01
Gout is an acute and chronic inflammatory disorder associated with high morbidity and impaired quality of life. There has been a substantial increase in the prevalence and incidence of gout in recent years. Novel diagnostic and therapeutic options have provided new insights into the pathogenesis and management of hyperuricemia and gout in the last decade. This clinical review aims to summarize the diagnostic process and management of acute and chronic gout. PMID:27708879
Soskind, Rose; Abazia, Daniel T; Bridgeman, Mary Barna
2017-08-01
Gout is a rheumatologic condition associated with elevated serum uric acid levels and deposition of monosodium urate crystals in joints and soft tissues. Areas covered: In this article, we describe the role of currently available drug therapies for managing acute gout flares and used in reducing serum urate levels. Further, we explore the role of novel small molecular therapies and biologic agents in the treatment of refractory or severe gout symptoms. A literature search of MEDLINE and MEDLINE In-Process & Other Non-Indexed Citations Databases (1996-June 2017) was conducted utilizing the key words 'gout', 'interleukin-1 inhibitors', 'acute gout', 'gout treatment', 'urate lowering therapies', 'hyperuricemia', 'colchicine', 'pegloticase', 'lesinurad', 'xanthine oxidase', 'xanthine oxidase inhibitors', 'allopurinol', 'febuxostat', 'uricosurics', 'probenecid', and 'benzbromarone'. All published articles regarding therapeutic management of gout and hyperuricemia were evaluated. References of selected articles, data from poster presentations, and abstract publications were additionally reviewed. Expert opinion: Numerous therapies are currently available to managing acute gout flares and for lowering serum urate levels; advances in the understanding of the pathophysiology of this disorder has led to the emergence of targeted therapies and novel biologic preparations currently in development which may improve the clinical management of severe or refractory cases of disease that fail to respond to traditional therapies.
Bao, Ying; Curhan, Gary; Merriman, Tony; Plenge, Robert; Kraft, Peter; Choi, Hyon K.
2015-01-01
Background Diuretic-induced gout might occur only among those with a genetic predisposition to hyperuricemia, as suggested by a recent study with 108 self-reported gout cases. Methods We examined the role of urate genes on the risk of diuretic-induced incident gout in 6850 women from the Nurses’ Health Study (NHS) and in 4,223 men from the Health Professionals Follow-up Study (HPFS). Two published genetic risk scores (GRS) were calculated using urate-associated SNPs for eight genes (GRS8) and for 29 genes (GRS29). Results Our analyses included 727 and 354 confirmed incident gout cases in the HPFS and NHS, respectively. The multivariate RR for diuretic use was 2.20 and 1.69 among those with a GRS8 < and ≥ the median (p for interaction=0.27). The corresponding RRs using GRS29 were 2.19 and 1.88 (p for interaction=0.40). The lack of interaction persisted in the NHS (all p values >0.20) and in our analyses limited to those with hypertension in both cohorts. SLC22A11 (OAT4) showed a significant interaction only among women but in the opposite direction to the recent study. Conclusion In these large prospective studies, individuals with a genetic predisposition for hyperuricemia are not at a higher risk of developing diuretic-induced gout than those without. PMID:25667207
Sever, Sakine; Weinstein, David A.; Wolfsdorf, Joseph I.; Gedik, Reyhan; Schaefer, Ernst J.
2013-01-01
Case Summary A female presented in infancy with hypotonia, undetectable serum glucose, lactic acidosis, and triglycerides > 5,000 mg/dl. The diagnosis of type 1A glycogen storage disease (GSD) was made by liver biopsy that showed increased glycogen and absent glucose-6-phosphatase enzyme activity. She was treated with dextrose feeding, which was replaced by frequent cornstarch feeding, with improvement of her metabolic parameters. At age 18 years she had marked hypertriglyceridemia (3,860 mg/dl) and eruptive xanthomas, and was treated with fenofibrate, atorvastatin, and fish oil. At age 29 years she was noted to have multiple liver adenomas, severe anemia, and hyperuricemia. Aggressive cornstarch therapy was commenced with a goal of maintaining her blood glucose levels > 75 mg/dl and lactate levels < 2 mmol/L. After 15 months on this regimen, her lipids levels (measured in mg/dl) off all medications were: total cholesterol 222, triglycerides 179, high density lipoprotein cholesterol 32, and calculated low density lipoprotein cholesterol 154. Her weight was stable with a body mass index of 24.8 kg/m2. Her liver adenomas had decreased in size, and her anemia and hyperuricemia had improved. She was homozygous for the R83C missense mutation in G6PC. Our data indicate that optimized metabolic control to maintain blood glucose levels > 75 mg/dl is critical in the management of this disease. PMID:23312056
The Potential Biomarkers to Identify the Development of Steatosis in Hyperuricemia
He, Xiaojuan; Lu, Cheng; He, Bing; Niu, Xuyan; Xiao, Cheng; Xu, Gang; Bian, Zhaoxiang; Zu, Xianpeng; Zhang, Ge; Zhang, Weidong; Lu, Aiping
2016-01-01
Hyperuricemia (HU) often progresses to combine with non-alcoholic fatty liver disease (NAFLD) in the clinical scenario, which further exacerbates metabolic disorders; early detection of biomarkers, if obtained during the HU progression, may be beneficial for preventing its combination with NAFLD. This study aimed to decipher the biomarkers and mechanisms of the development of steatosis in HU. Four groups of subjects undergoing health screening, including healthy subjects, subjects with HU, subjects with HU combined with NAFLD (HU+NAFLD) and subjects with HU initially and then with HU+NAFLD one year later (HU→HU+NAFLD), were recruited in this study. The metabolic profiles of all subjects’ serum were analyzed by liquid chromatography quadruple time-of-flight mass spectrometry. The metabolomic data from subjects with HU and HU+NAFLD were compared, and the biomarkers for the progression from HU to HU+NAFLD were predicted. The metabolomic data from HU→HU+NAFLD subjects were collected for further verification. The results showed that the progression was associated with disturbances of phospholipase metabolism, purine nucleotide degradation and Liver X receptor/retinoic X receptor activation as characterized by up-regulated phosphatidic acid, cholesterol ester (18:0) and down-regulated inosine. These metabolic alterations may be at least partially responsible for the development of steatosis in HU. This study provides a new paradigm for better understanding and further prevention of disease progression. PMID:26890003
Roncal-Jimenez, Carlos; García-Trabanino, Ramón; Barregard, Lars; Lanaspa, Miguel A; Wesseling, Catharina; Harra, Tamara; Aragón, Aurora; Grases, Felix; Jarquin, Emmanuel R; González, Marvin A; Weiss, Ilana; Glaser, Jason; Sánchez-Lozada, Laura G; Johnson, Richard J
2016-01-01
Mesoamerican nephropathy (MeN), an epidemic in Central America, is a chronic kidney disease of unknown cause. In this article, we argue that MeN may be a uric acid disorder. Individuals at risk for developing the disease are primarily male workers exposed to heat stress and physical exertion that predisposes to recurrent water and volume depletion, often accompanied by urinary concentration and acidification. Uric acid is generated during heat stress, in part consequent to nucleotide release from muscles. We hypothesize that working in the sugarcane fields may result in cyclic uricosuria in which uric acid concentrations exceed solubility, leading to the formation of dihydrate urate crystals and local injury. Consistent with this hypothesis, we present pilot data documenting the common presence of urate crystals in the urine of sugarcane workers from El Salvador. High end-of-workday urinary uric acid concentrations were common in a pilot study, particularly if urine pH was corrected to 7. Hyperuricemia may induce glomerular hypertension, whereas the increased urinary uric acid may directly injure renal tubules. Thus, MeN may result from exercise and heat stress associated with dehydration-induced hyperuricemia and uricosuria. Increased hydration with water and salt, urinary alkalinization, reduction in sugary beverage intake, and inhibitors of uric acid synthesis should be tested for disease prevention. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Chang, Ye; Guo, Xiaofan; Guo, Liang; Li, Zhao; Yang, Hongmei; Yu, Shasha; Sun, Guozhe; Sun, Yingxian
2016-01-01
This study aimed to comprehensively compare the general characteristics, lifestyles, serum parameters, ultrasonic cardiogram (UCG) parameters, depression, quality of life, and various comorbidities between empty nest and non-empty nest elderly among rural populations in northeast China. This analysis was based on our previous study which was conducted from January 2012 to August 2013, using a multistage, stratified, random cluster sampling scheme. The final analyzed sample consisted of 3208 participants aged no less than 60 years, which was further classified into three groups: non-empty nest group, empty nest group (living as a couple), and empty nest group (living alone). More than half of the participants were empty nest elderly (60.5%). There were no significant statistical differences for serum parameters, UCG parameters, lifestyles, dietary pattern, and scores of Patient Health Questionnaire-9 (PHQ-9) and World Health Organization Quality of Life questionnaire, abbreviated version (WHOQOL-BREF) among the three groups. Empty nest elderly showed no more risk for comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, left atrial enlargement (LAE), and stroke. Our study indicated that empty nest elderly showed no more risk for depression, low quality of life and comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, LAE, and stroke among rural populations in northeast China. PMID:27618905
Jung, Moon Hee; Seong, Pil Nam; Kim, Myung Hwan; Myong, Na-Hye
2013-01-01
The application of polyphenols has attracted great interest in the field of functional foods and nutraceuticals due to their potential health benefits in humans. However, the effectiveness of polyphenols depends on their bioactivity and bioavailability. In the present study, the bioactive component from green tea extract (GTE) was administrated orally (50 mg/kg body weight/day) as free or in a microencapsulated form with maltodextrin in rats fed a high fructose diet. High fructose diet induced features of metabolic syndrome including hypertriglyceridemia, hyperuricemia, increased serum total cholesterol, and retroperitoneal obesity. In addition, myocardial fibrosis was increased. In rats receiving high fructose diet, the lowering of blood triglycerides, total cholesterol, non esterified fatty acid (NEFA) and uric acid, as well as the reduction in final body weight and retroperitoneal fat weight associated with the administration of GTE, led to a reversal of the features of metabolic syndrome (P < 0.05). In particular, the administration of microencapsulated GTE decreased myocardial fibrosis and increased liver catalase activity consistent with a further alleviation of serum NEFA, and hyperuricemia compared to administration of GTE. Taken together, our results suggest that microencapsulation of the bioactive components of GTE might have a protective effect on cardiovasucular system by attenuating the adverse features of myocardial fibrosis, decreasing uric acid levels and increasing hepatic catalase activity effectively by protecting their bioactivities. PMID:24133615
Landry, Nichole K.; El-Achkar, Tarek M.; Lieske, John C.
2017-01-01
Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys’ thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies. PMID:29145399
Chang, Ye; Li, Yuan; Guo, Xiaofan; Guo, Liang; Sun, Yingxian
2016-09-02
We aimed to determine the association of atherogenic index of plasma (AIP) with hyperuricemia (HUA) in the rural population of northeast China. This cross-sectional study was conducted in the rural areas of northeast China from January 2012 to August 2013, and the final analysis included data obtained form 5253 men and 6092 women. 1104 participants (9.7%) suffered from HUA. Spearman rank test showed that AIP was positively correlated with uric acid in both sexes (r = 0.310 for men and r = 0.347 for women, both p < 0.001). AIP was classified into three groups: the low (<0.11), the intermediate (0.11-0.21) and the increased (>0.21) risk. The prevalence of HUA increased with AIP. Multivariate logistic regression analysis showed that, compared to the low AIP group, participants in increased AIP group had a 2.536-fold risk for HUA (2.164-fold in male and 2.960-fold in female) after adjustment for covariates. Results of receiver operating characteristic curves showed that the area under the curve (95% confidence intervals) was 0.686 (0.665-0.707) for male and 0.730 (0.706-0.755) for female. We indicated that increased AIP was associated with higher serum uric acid levels and could be identified as an independent risk factor of HUA in the rural population of northeast China.
Chang, Ye; Guo, Xiaofan; Guo, Liang; Li, Zhao; Yang, Hongmei; Yu, Shasha; Sun, Guozhe; Sun, Yingxian
2016-08-27
This study aimed to comprehensively compare the general characteristics, lifestyles, serum parameters, ultrasonic cardiogram (UCG) parameters, depression, quality of life, and various comorbidities between empty nest and non-empty nest elderly among rural populations in northeast China. This analysis was based on our previous study which was conducted from January 2012 to August 2013, using a multistage, stratified, random cluster sampling scheme. The final analyzed sample consisted of 3208 participants aged no less than 60 years, which was further classified into three groups: non-empty nest group, empty nest group (living as a couple), and empty nest group (living alone). More than half of the participants were empty nest elderly (60.5%). There were no significant statistical differences for serum parameters, UCG parameters, lifestyles, dietary pattern, and scores of Patient Health Questionnaire-9 (PHQ-9) and World Health Organization Quality of Life questionnaire, abbreviated version (WHOQOL-BREF) among the three groups. Empty nest elderly showed no more risk for comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, left atrial enlargement (LAE), and stroke. Our study indicated that empty nest elderly showed no more risk for depression, low quality of life and comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, LAE, and stroke among rural populations in northeast China.
Ma, Lijie; Liu, Yan; Landry, Nichole K; El-Achkar, Tarek M; Lieske, John C; Wu, Xue-Ru
2017-01-01
Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys' thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies.
Honda, Sari; Miura, Yukari; Masuda, Akiko; Masuda, Toshiya
2014-01-01
Xanthine oxidase (XO) inhibitory activity has been found in boiling water extracts from roasted coffee beans. Therefore, assay-guided purification of the extracts was performed using size-exclusion column chromatography, and subsequently with reversed phase HPLC to afford lactone derivatives of chlorogenic acids. Among the tested lactones, crypto- and neochlorogenic lactones showed potent XO inhibitory activities compared with three major chlorogenic acids found in coffee beans. These XO inhibitory lactones may ameliorate gout and hyperuricemia in humans who drink coffee.
Kaneko, Chihiro; Ogura, Jiro; Sasaki, Shunichi; Okamoto, Keisuke; Kobayashi, Masaki; Kuwayama, Kaori; Narumi, Katsuya; Iseki, Ken
2017-03-01
A high intake of fructose increases the risk for hyperuricemia. It has been reported that long-term fructose consumption suppressed renal uric acid excretion and increased serum uric acid level. However, the effect of single administration of fructose on excretion of uric acid has not been clarified. We used male Wistar rats, which were orally administered fructose (5g/kg). Those rats were used in each experiment at 12h after administration. Single administration of fructose suppressed the function of ileal uric acid excretion and had no effect on the function of renal uric acid excretion. Breast cancer resistance protein (BCRP) predominantly contributes to intestinal excretion of uric acid as an active homodimer. Single administration of fructose decreased BCRP homodimer level in the ileum. Moreover, diphenyleneiodonium (DPI), an inhibitor of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox), recovered the suppression of the function of ileal uric acid excretion and the Bcrp homodimer level in the ileum of rats that received single administration of fructose. Single administration of fructose decreases in BCRP homodimer level, resulting in the suppression the function of ileal uric acid excretion. The suppression of the function of ileal uric acid excretion by single administration of fructose is caused by the activation of Nox. The results of our study provide a new insight into the mechanism of fructose-induced hyperuricemia. Copyright © 2016 Elsevier B.V. All rights reserved.
Higashino, Toshihide; Matsuo, Hirotaka; Okada, Yukinori; Nakashima, Hiroshi; Shimizu, Seiko; Sakiyama, Masayuki; Tadokoro, Shin; Nakayama, Akiyoshi; Kawaguchi, Makoto; Komatsu, Mako; Hishida, Asahi; Nakatochi, Masahiro; Ooyama, Hiroshi; Imaki, Junko; Shinomiya, Nariyoshi
2018-01-01
Gout is a multifactorial disease characterized by acute inflammatory arthritis, and it is caused as a consequence of hyperuricemia. A recent meta-analysis of genome-wide association studies has newly identified the relationship between serum uric acid (SUA) levels and rs889472, a single nucleotide polymorphism of musculoaponeurotic fibrosarcoma oncogene (MAF/c-MAF). However, it remained unclear whether rs889472 is associated with gout susceptibility. In the present study, we investigate the association between c-MAF rs889472 and gout in Japanese male population. We genotyped 625 male patients who were clinically diagnosed as gout and 1221 male control subjects without hyperuricemia or a history of gout by TaqMan method. As a result, the major allele (C), which reportedly increases SUA levels, had a higher frequency in the gout cases (58.8%) than in the controls (55.0%). A logistic regression analysis showed a significant association between rs889472 and gout (p = 0.029, odds ratio = 1.17; 95% confidence interval 1.02-1.34). C-MAF is reported as a pivotal transcriptional factor in the development and differentiation of renal proximal tubular cells. Because urate is mainly regulated in renal proximal tubular cells, c-MAF may have an important role in urate regulation in the kidney and influence not only SUA but also gout susceptibility. Our finding shows that rs889472 of c-MAF is associated with gout susceptibility.
Dalbeth, Nicola; Bardin, Thomas; Doherty, Michael; Lioté, Frédéric; Richette, Pascal; Saag, Kenneth G; So, Alexander K; Stamp, Lisa K; Choi, Hyon K; Terkeltaub, Robert
2017-09-01
In November 2016, the American College of Physicians (ACP) published a clinical practice guideline on the management of acute and recurrent gout. This guideline differs substantially from the latest guidelines generated by the American College of Rheumatology (ACR), European League Against Rheumatism (EULAR) and 3e (Evidence, Expertise, Exchange) Initiative, despite reviewing largely the same body of evidence. The Gout, Hyperuricemia and Crystal-Associated Disease Network (G-CAN) convened an expert panel to review the methodology and conclusions of these four sets of guidelines and examine possible reasons for discordance between them. The G-CAN position, presented here, is that the fundamental pathophysiological knowledge underlying gout care, and evidence from clinical experience and clinical trials, supports a treat-to-target approach for gout aimed at lowering serum urate levels to below the saturation threshold at which monosodium urate crystals form. This practice, which is truly evidence-based and promotes the steady reduction in tissue urate crystal deposits, is promoted by the ACR, EULAR and 3e Initiative recommendations. By contrast, the ACP does not provide a clear recommendation for urate-lowering therapy (ULT) for patients with frequent, recurrent flares or those with tophi, nor does it recommend monitoring serum urate levels of patients prescribed ULT. Results from emerging clinical trials that have gout symptoms as the primary end point are expected to resolve this debate for all clinicians in the near term future.
Zhang, Naijin; Chen, Yintao; Guo, Xiaofan; Sun, Guozhe; Sun, Yingxian
2017-03-01
Till now, no evidence illustrates the prevalence and predictors of metabolically healthy obesity (MHO) in rural areas of China. The objective of this study was, firstly, to examine the prevalence of MHO in rural areas of China, and identify contributing determinants of MHO, Secondly, to comprehensively investigate to the different characteristics between MHO and metabolically unhealthy obesity (MUO). We conducted a population-based cross-sectional study of 2037 participants with obesity in rural Liaoning Province during 2012-2013. Obesity was defined as BMI ≥28 kg/m 2 and metabolically healthy was defined as not having the metabolic syndrome. The prevalence of MHO was 23.1%, and significantly decreased with advancing age in female group. However there was no significant tendency with advancing age in male group. Independent determinant factors for MHO were age <55 years (odds ratio [OR] 1.659; p = .001), non-current smoking (OR 1.397; p = .038), pre-menopause (OR 1.648; p = .030) and non-hyperuricemia (OR 2.317; p < .001), whereas race, gender, diet score, current drinking, marriage, sleep duration, hyperhomocysteinemia, levels of physical activity, annual income and educational status were not significant contributors. In conclusion, we found that age <55 years, non-current smoking, pre-menopause and non-hyperuricemia were identified as independent determinant factors for MHO in this population.
A concise history of gout and hyperuricemia and their treatment.
Nuki, George; Simkin, Peter A
2006-01-01
First identified by the Egyptians in 2640 BC, podagra (acute gout occurring in the first metatarsophalangeal joint) was later recognized by Hippocrates in the fifth century BC, who referred to it as 'the unwalkable disease'. The term is derived from the Latin word gutta (or 'drop'), and referred to the prevailing medieval belief that an excess of one of the four 'humors'--which in equilibrium were thought to maintain health--would, under certain circumstances, 'drop' or flow into a joint, causing pain and inflammation. Throughout history, gout has been associated with rich foods and excessive alcohol consumption. Because it is clearly associated with a lifestyle that, at least in the past, could only be afforded by the affluent, gout has been referred to as the 'disease of kings'. Although there is evidence that colchicine, an alkaloid derived from the autumn crocus (Colchicum autumnale), was used as a powerful purgative in ancient Greece more than 2000 years ago, its first use as a selective and specific treatment for gout is attributed to the Byzantine Christian physician Alexander of Tralles in the sixth century AD. Uricosuric agents were first used at the end of the 19th century. In the modern era, nonsteroidal anti-inflammatory drugs are usually the drugs of choice for treating acute gout. Perhaps the most important historical advance in the treatment of hyperuricemia was the development of xanthine oxidase inhibitors, which are effective in reducing plasma and urinary urate levels and have been shown to reverse the development of tophaceous deposits.
Pichholiya, Meenu; Yadav, Arvind Kumar; Luhadia, S K; Tahashildar, Jameela; Aseri, M L
2016-01-01
To compare the efficacy and safety of febuxostat and allopurinol in pyrazinamide (PZA)-induced hyperuricemia in patients taking antitubercular therapy (ATT). This randomized controlled study was conducted at a tertiary care teaching institute of Rajasthan in all the sputum-positive tubercular patients aged between 18 and 65 years of either sex. Serum uric acid level was monitored at 0 th , 2 nd , 4 th , 6 th , and 8 th week of ATT. Patients whose uric acid level was found to be increased at 2 nd week were finally recruited in the study. Ninety patients who developed hyperuricemia due to ATT were divided randomly into three groups (Group A - febuxostat, Group B - allopurinol, and Group C - control) of thirty patients each. Mean serum uric acid levels were calculated at all the weeks in all the groups, and serum uric acid levels were compared by applying student's t -test and ANOVA. Mean serum uric acid level decreased from 10.698 mg/dl (at 2 nd week) to 7.846 mg/dl (at 8 th week) in Group A and from 11.34 mg/dl (at 2 nd week) to 7.280 mg/dl (at 8 th week) in Group B. Numbers of adverse events encountered across both the treatment groups were same with both the drugs. Allopurinol and febuxostat were equally efficacious in lowering PZA induced raised serum uric acid level in tubercular patients, and it was possible to continue ATT without withdrawing PZA.
Zhu, Liran; Dong, Yifan; Na, Sha; Han, Ru; Wei, Chengyin; Chen, Guangliang
2017-09-01
The current study aimed to investigate whether the saponins, bioactive component of effects of D. collettii, could reduce the serum uric acid level in a hyperuricemic mouse via regulation of urate transporters. Chronic hyperuricemia model was established by combine administration of adenine (100mg/kg) and ethambutol (250mg/kg). In the model group, the serum uric acid (SUA), urine uric acid (UUA) volume, and 24-h UUA values increased significantly, while the uric acid clearance rate (CUr) and creatinine clearance rate (CCr) values decreased. Further, the model groups showed significantly lower expression of organic anion transporter 1 (OAT1) and organic anion transporter 3 (OAT3) and significantly higher expression of renal tubular urate transporter 1 (URAT1), glucose transporter 9 (GLUT9) and URAT1 mRNA than the normal control group. Saponins administration was found to have a dose-dependent effect, as evidenced by the increase in the 24-h UUA, CUr and CCr values; the decrease in SUA; the decrease in the renal expression of URAT1 mRNA and URAT1 and GLUT9 proteins; and the increase in the renal expression of the OAT1 and OAT3 proteins. The saponins extracted from D. collettii rhizomes had an obvious anti-hyperuricemic effect through downregulation of the URAT1 mRNA and the URAT1 and GLUT9 proteins and upregulation of the OAT1 and OAT3 proteins. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
El Mashad, Ghada Mohamed; ElSayed, Hanan M; Nosair, Nahla A
2016-01-01
Children with end-stage renal disease (ESRD) suffer from dyslipidemia and hyperuricemia that might play a causal role in the progression of cardiovascular disease (CVD). The aim of the study is to assess the effects of Vitamin C supplementation on uric acid, ascorbic acid, and serum lipid levels among children on hemodialysis (HD). This prospective study was conducted in the pediatric nephrology unit at Menoufia University Hospital. The study included a total of 60 children with ESRD on maintenance HD therapy. They were divided into two groups: Group I (supplemented group, n = 30) received intravenous Vitamin C supplementation and Group II (control, n = 30) received placebo (intravenous saline) for three months. The results are shown as a mean ± standard deviation. Statistical evaluation was performed by SPSS software (version 11.5) using paired t-test. After supplementation with Vitamin C, the serum Vitamin C and high-density lipoprotein levels increased significantly with a significant reduction in the levels of serum uric acid, cholesterol, low-density lipoproteins, and triglyceride at the end of the study period. No significant changes were observed in the control group. Vitamin C can serve as a useful urate lowering medicine in HD patients to avoid complications of hyperuricemia. Furthermore, it had favorable effects on the lipid profile. This improvement can be considered as a preventive strategy in the progression of CVD in HD patients. Vitamin C supplementation improves ascorbic acid deficiency in these patients.
Hirai, Toshinori; Itoh, Toshimasa; Kimura, Toshimi; Echizen, Hirotoshi
2018-06-06
Febuxostat is an active xanthine oxidase (XO) inhibitor that is widely used in the hyperuricemia treatment. We aimed to evaluate the predictive performance of a pharmacokinetic-pharmacodynamic (PK-PD) model for hypouricemic effects of febuxostat. Previously, we have formulated a PK--PD model for predicting hypouricemic effects of febuxostat as a function of baseline serum urate levels, body weight, renal function, and drug dose using datasets reported in preapproval studies (Hirai T et al., Biol Pharm Bull 2016; 39: 1013-21). Using an updated model with sensitivity analysis, we examined the predictive performance of the PK-PD model using datasets obtained from the medical records of patients who received febuxostat from March 2011 to December 2015 at Tokyo Women's Medical University Hospital. Multivariate regression analysis was performed to explore clinical variables to improve the predictive performance of the model. A total of 1,199 serum urate data were retrieved from 168 patients (age: 60.5 ±17.7 years, 71.4% males) who received febuxostat as hyperuricemia treatment. There was a significant correlation (r=0.68, p<0.01) between serum urate levels observed and those predicted by the modified PK-PD model. A multivariate regression analysis revealed that the predictive performance of the model may be improved further by considering comorbidities, such as diabetes mellitus, estimated glomerular filtration rate (eGFR), and co-administration of loop diuretics (r = 0.77, p<0.01). The PK-PD model may be useful for predicting individualized maintenance doses of febuxostat in real-world patients. This article is protected by copyright. All rights reserved.
Gout and Metabolic Syndrome: a Tangled Web.
Thottam, Gabrielle E; Krasnokutsky, Svetlana; Pillinger, Michael H
2017-08-26
The complexity of gout continues to unravel with each new investigation. Gout sits at the intersection of multiple intrinsically complex processes, and its prevalence, impact on healthcare costs, and association with important co-morbidities make it increasingly relevant. The association between gout and type 2 diabetes, hypertension, hyperlipidemia, cardiovascular disease, renal disease, and obesity suggest that either gout, or its necessary precursor hyperuricemia, may play an important role in the manifestations of the metabolic syndrome. In this review, we analyze the complex interconnections between gout and metabolic syndrome, by reviewing gout's physiologic and epidemiologic relationships with its major co-morbidities. Increasing evidence supports gout's association with metabolic syndrome. More specifically, both human studies and animal models suggest that hyperuricemia may play a role in promoting inflammation, hypertension and cardiovascular disease, adipogenesis and lipogenesis, insulin and glucose dysregulation, and liver disease. Fructose ingestion is associated with increased rates of hypertension, weight gain, impaired glucose tolerance, and dyslipidemia and is a key driver of urate biosynthesis. AMP kinase (AMPK) is a central regulator of processes that tend to mitigate against the metabolic syndrome. Within hepatocytes, leukocytes, and other cells, a fructose/urate metabolic loop drives key inhibitors of AMPK, including AMP deaminase and fructokinase, that may tilt the balance toward metabolic syndrome progression. Preliminary evidence suggests that agents that block the intracellular synthesis of urate may restore AMPK activity and help maintain metabolic homeostasis. Gout is both an inflammatory and a metabolic disease. With further investigation of urate's role, the possibility of proper gout management additionally mitigating metabolic syndrome is an evolving and important question.
Polymorphisms of uric transporter proteins in the pathogenesis of gout in a Chinese Han population.
Wan, W; Xu, X; Zhao, D B; Pang, Y F; Wang, Y X
2015-03-30
In this study, we analyzed single nucleotide polymorphisms (SNP) in urate transporter genes to examine the pathogenesis of gout. We conducted a 1:1-matched case-control study that included 110 patients with acute gout attacks as the patient group and 110 healthy age- and gender-matched subjects as the control group. Clinical parameters were recorded and blood biochemistry tests were conducted for both groups. Multivariate logistic regression analysis was used to analyze the data. Hyperuricemia, hypercholesterolemia, and hypertriglyceridemia were found to be the main risk factors for the onset of gout, with relative risks of 29.2 (P < 0.001), 25.5 (P = 0.003), and 11.2 (P < 0.001). For all detected SNP, rs2231142, located in ABCG2, showed the largest frequency differences for the G/G, G/T, and T/T genotypes between groups: the distribution of these genotypes in the case group was 22, 49, and 26 individuals, respectively, and was 54, 38, and 9 individuals, respectively, in the control group. There was a statistically significant difference between the 2 groups (P < 0.001) and the odds ratio was 7.091 (95% confidence interval = 2.867-17.541). Other SNPs (rs1165196, rs1165205, rs1183201, rs17300741, rs2078267, rs2242206, rs3733591, and rs9358856) showed no significant difference between the groups (P > 0.05). The risk factors of gout were hyperuricemia, hypercholesterolemia, hypertriglyceridemia, and the T/T genotype of the rs2231142 locus in the ABCG2 gene; expression of the G/G genotype may be a protective factor against gout development.
Choi, Hyon K; Zhu, Yanyan; Mount, David B
2010-03-01
This review provides an update on recent findings with regards to the genetics of hyperuricemia and gout, including recent data from genome-wide association studies (GWAS). Five GWAS around the same time reported that genetic variants of SLC2A9/GLUT9 were associated with lower serum uric acid (SUA) levels and the effects were stronger among women (e.g. SUA level difference per copy of a minor allele, -0.46 mg/dl in women vs. -0.22 mg/dl in men). One study involving four cohorts and one meta-analysis of 14 genome-wide scans found that genetic variants of ABCG2 were associated with higher SUA concentrations and these effects were stronger among men (e.g. uric acid level difference per copy of the minor allele, 0.32 mg/dl in men vs. 0.18 mg/dl in women). Limited data indicate that these associations likely translate into those with the risk of gout. Functional determination that GLUT9 and ABCG2 can transport urate at the apical border of proximal tubules implicates them as substantial players in the renal excretion of urate. Furthermore, five novel genetic loci have been reported in the meta-analysis of 14 genome-wide scans. Combined with their activities as urate transporters and their strong associations with serum uric acid concentrations, GLUT9 and ABCG2 appeared to be important modulators of uric acid levels and likely of the risk of gout. Together with a growing list of environmental risk factors, these genetic data add considerably to our understanding of the pathogenesis of hyperuricemia and gout.
Sever, Sakine; Weinstein, David A; Wolfsdorf, Joseph I; Gedik, Reyhan; Schaefer, Ernst J
2012-01-01
A female presented in infancy with hypotonia, undetectable serum glucose, lactic acidosis, and triglycerides >5000 mg/dL. The diagnosis of type 1A glycogen storage disease was made via the result of a liver biopsy, which showed increased glycogen and absent glucose-6-phosphatase enzyme activity. The patient was treated with dextrose administered orally, which was replaced by frequent feedings of cornstarch, which resulted in an improvement of her metabolic parameters. At age 18 years of age, she had marked hypertriglyceridemia (3860 mg/dL) and eruptive xanthomas and was treated with fenofibrate, atorvastatin, and fish oil. At age 29 years she was noted to have multiple liver adenomas, severe anemia, and hyperuricemia. Aggressive cornstarch therapy was commenced with a goal of maintaining her blood glucose levels >75 mg/dL and lactate levels <2 mmol/L. After 15 months on this regimen, her lipids levels (measured in mg/dL) off all medications were as follows: total cholesterol 222, triglycerides 179, high-density lipoprotein cholesterol 32, and calculated low-density lipoprotein cholesterol 154. Her weight was stable with a body mass index of 24.8 kg/m(2). Her liver adenomas had decreased in size, and her anemia and hyperuricemia had improved. She was homozygous for the R83C missense mutation in G6PC. Our data indicate that optimized metabolic control to maintain blood glucose levels >75 mg/dL is critical in the management of this disease. Copyright © 2012. Published by Elsevier Inc.
Petsch, Christina; Araujo, Elizabeth G; Englbrecht, Matthias; Bayat, Sara; Cavallaro, Alexander; Hueber, Axel J; Lell, Michael; Schett, Georg; Manger, Bernhard; Rech, Juergen
2016-06-01
To investigate the prevalence of monosodium urate (MSU) crystal deposits, indicative for gout, in a population of rheumatoid arthritis (RA) patients with concomitant hyperuricemia and to analyze the clinical and disease-specific characteristics of RA patients who exhibit MSU crystal deposits. Overall, 100 consecutive patients with the diagnosis of RA and a serum urate level above 6mg/dl underwent dual energy computed tomography (DECT) of both feet and hands to search for MSU crystals in a prospective study between October 2011 and July 2013. Presence and extent of MSU crystal deposits on DECT was assessed by automated volume measurement. Demographic and disease-specific characteristics were recorded and included into two logistic regression models to test for the factors associated with MSU crystal deposits in RA. Hyperuricemic RA patients were mostly male (55%), over 60 years of age (63 ± 11 years), had established disease (8.7 ± 10.5 years) and a mean disease activity score 28 (DAS 28) of 3.2. In total, 20 out of 100 patients displayed MSU crystal deposits in DECT. Interestingly, the majority (70%) of the RA patients positive for MSU crystal deposits were seronegative RA patients. Hence, every third seronegative RA patient had MSU crystal deposits. According to logistic regression model analysis, seronegative status correlated positively with presence of urate deposits (p = 0.019). These data show that a considerable number of RA patients display periarticular MSU crystal deposits. Seronegative patients were shown to be predominantly affected with every third patient being positive for urate deposits. Copyright © 2016 Elsevier Inc. All rights reserved.
Motta, Massimo; Russo, Cristina; Vacante, Marco; Liardo, Rocco Luca Emanuele; Reitano, Francesca; Cammalleri, Lisa; Costanzo, Mario; Benfatto, Giuseppe; Frazzetto, Paola; Mondati, Enrico; Malaguarnera, Michele; Pennisi, Giovanni
2011-01-01
Elderly neoplastic patients frequently may show hypertension and hyperuricemia, before and after chemotherapeutic treatments. The purpose of this study was to evaluate the efficacy of losartan which is an antihypertensive drug with uricosuric properties vs. amlodipine in hypertensive neoplastic elderly patients. This was an open-labeled, randomized, comparative trial. The study was performed as a 30-day study. Seventy patients with cancer were randomly assigned to receive losartan or amlodipine. Blood pressure (BP), blood urea nitrogen (BUN) levels, creatinine, serum and urinary uric acid, creatinine and uric acid clearance were determined before and after chemotherapy. One day after chemotherapy in losartan group vs. amlodipine group we observed a significant difference in urinary uric acid (p<0.001) of 18 mg/24 h vs. 40 mg/24 h. Thirty days after chemotherapy we observed a significant difference in azotemia of 0.0 mg/dl vs. 3.8 mg/dl (p<0.001), serum uric acid of 0.05 mg/dl vs. 0.49 mg/dl (p<0.001), urinary uric acid (p<0.001) of 23 mg/24 h vs. 0.0 mg/24 h, GFR of 2 ml/min/1.73 m(2) vs. -8 ml/min/1.73 m(2) (p<0.05) and systolic BP (SBP) of 3.6 mmHg vs. 0.8 mmHg (p<0.05). The findings of the present study support the effective role of losartan compared to amlodipine in treating hypertension and hyperuricemia in elderly patients under chemotherapeutic treatment. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Tsuruta, Yuki; Mochizuki, Toshio; Moriyama, Takahito; Itabashi, Mitsuyo; Takei, Takashi; Tsuchiya, Ken; Nitta, Kosaku
2014-11-01
Hyperuricemia is a frequent complication of chronic kidney disease (CKD). Febuxostat is a novel xanthine oxidase inhibitor that is metabolized by many metabolic pathways in the kidney and the liver. We performed a 1-year cohort study of 73 hyperuricemic patients who had an estimated glomerular filtration rate (eGFR) below 45 ml/min and were being treated with urate-lowering therapy. In 51 patients, treatment was changed from allopurinol to febuxostat, and the other 22 patients were continued on allopurinol. The serum levels of uric acid (UA) level, creatinine, and other biochemical parameters were measured at baseline and after 3, 6, 9, and 12 months of treatment. The serum UA levels significantly decreased from 6.1 ± 1.0 to 5.7 ± 1.2 mg/dl in the febuxostat group and significantly increased from 6.2 ± 1.1 to 6.6 ± 1.1 mg/dl in the allopurinol group. The eGFR decreased 27.3 to 25.7 ml/min in the febuxostat group and from 26.1 to 19.9 ml/min in the allopurinol group. The switch from allopurinol to febuxostat was significantly associated with the changes in eGFR according to a multiple regression analysis (β = -0.22145, P < 0.05). Febuxostat reduced the serum UA levels and slowed the progression of renal disease in our CKD cohort in comparison with allopurinol.
Pichholiya, Meenu; Yadav, Arvind Kumar; Luhadia, S. K.; Tahashildar, Jameela; Aseri, M. L.
2016-01-01
Objectives: To compare the efficacy and safety of febuxostat and allopurinol in pyrazinamide (PZA)-induced hyperuricemia in patients taking antitubercular therapy (ATT). Methods: This randomized controlled study was conducted at a tertiary care teaching institute of Rajasthan in all the sputum-positive tubercular patients aged between 18 and 65 years of either sex. Serum uric acid level was monitored at 0th, 2nd, 4th, 6th, and 8th week of ATT. Patients whose uric acid level was found to be increased at 2nd week were finally recruited in the study. Ninety patients who developed hyperuricemia due to ATT were divided randomly into three groups (Group A - febuxostat, Group B - allopurinol, and Group C - control) of thirty patients each. Mean serum uric acid levels were calculated at all the weeks in all the groups, and serum uric acid levels were compared by applying student's t-test and ANOVA. Results: Mean serum uric acid level decreased from 10.698 mg/dl (at 2nd week) to 7.846 mg/dl (at 8th week) in Group A and from 11.34 mg/dl (at 2nd week) to 7.280 mg/dl (at 8th week) in Group B. Numbers of adverse events encountered across both the treatment groups were same with both the drugs. Conclusion: Allopurinol and febuxostat were equally efficacious in lowering PZA induced raised serum uric acid level in tubercular patients, and it was possible to continue ATT without withdrawing PZA. PMID:27721537
Torres-Sánchez, M J; Ávila-Barranco, E; Esteban de la Rosa, R J; Fernández-Castillo, R; Esteban, M A; Carrero, J J; García-Valverde, M; Bravo-Soto, J A
2016-03-01
To determine in patients with autosomal dominant polycystic kidney disease the relationship between total renal volume (the sum of both kidneys, TRV) as measured by magnetic resonance and renal function; and its behaviour according to sex and the presence of arterial hypertension, hypercholesterolaemia and hyperglycemia. Cross-sectional study including patients with autosomal dominant polycystic kidney disease who underwent periodic reviews at Nephrology external consultations at Hospital de las Nieves de Granada, and who underwent an magnetic resonance to estimate renal volume between January 2008 and March 2011. We evaluated 67 patients (59.7% women, average age of 48±14.4 years) and found a significant positive association between TRV and serum creatinine or urea, which was reversed compared with estimated glomerular filtration by MDRD-4 and Cockcroft-Gault. Women showed an average serum creatinine level and a significantly lower TRV level compared with males. Subgroups affected by arterial hypertension and hyperuricemia presented average values for serum creatinine and urea, higher for TRV and lower for estimated glomerular filtration. The hypercholesterolaemia subgroup showed higher average values for urea and lower for estimated glomerular filtration, without detecting significant differences compared with TRV. The volume of polycystic kidneys measured by magnetic resonance is associated with renal function, and can be useful as a complementary study to monitor disease progression. The presence of arterial hypertension, hyperuricemia or hypercholesterolaemia is associated with a poorer renal function. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Medicina Interna (SEMI). All rights reserved.
Yu, Zhifeng; Fong, Wing Ping; Cheng, Christopher H K
2006-01-01
Hyperuricemia is associated with a number of pathological conditions such as gout. Lowering of elevated uric acid level in the blood could be achieved by xanthine oxidase inhibitors and inhibitors of renal urate reabsorption. Some natural compounds isolated from herbs used in traditional Chinese medicine have been previously demonstrated to possess xanthine oxidase inhibitory activities. In the present investigation, morin (3,5,7,2',4'-pentahydroxyflavone), which occurs in the twigs of Morus alba L. documented in traditional Chinese medicinal literature to treat conditions akin to gout, was demonstrated to exert potent inhibitory action on urate uptake in rat renal brush-border membrane vesicles, indicating that this compound acts on the kidney to inhibit urate reabsorption. Lineweaver-Burk transformation of the inhibition kinetics data demonstrated that the inhibition of urate uptake was of a competitive type, with a K(i) value of 17.4 microM. In addition, morin was also demonstrated to be an inhibitor of xanthine oxidase. Lineweaver-Burk analysis of the enzyme kinetics indicated that the mode of inhibition was of a mixed type, with K(i) and K(ies) values being 7.9 and 35.1 microM, respectively. Using an oxonate-induced hyperuricemic rat model, morin was indeed shown to exhibit an in vivo uricosuric action, which could explain, in part at least, the observed hypouricemic effect of morin in these rats. The potential application of this compound in the treatment of conditions associated with hyperuricemia was discussed.
Belostotsky, Ruth; Ben-Shalom, Efrat; Rinat, Choni; Becker-Cohen, Rachel; Feinstein, Sofia; Zeligson, Sharon; Segel, Reeval; Elpeleg, Orly; Nassar, Suheir; Frishberg, Yaacov
2011-02-11
An uncharacterized multisystemic mitochondrial cytopathy was diagnosed in two infants from consanguineous Palestinian kindred living in a single village. The most significant clinical findings were tubulopathy (hyperuricemia, metabolic alkalosis), pulmonary hypertension, and progressive renal failure in infancy (HUPRA syndrome). Analysis of the consanguineous pedigree suggested that the causative mutation is in the nuclear DNA. By using genome-wide SNP homozygosity analysis, we identified a homozygous identity-by-descent region on chromosome 19 and detected the pathogenic mutation c.1169A>G (p.Asp390Gly) in SARS2, encoding the mitochondrial seryl-tRNA synthetase. The same homozygous mutation was later identified in a third infant with HUPRA syndrome. The carrier rate of this mutation among inhabitants of this Palestinian isolate was found to be 1:15. The mature enzyme catalyzes the ligation of serine to two mitochondrial tRNA isoacceptors: tRNA(Ser)(AGY) and tRNA(Ser)(UCN). Analysis of amino acylation of the two target tRNAs, extracted from immortalized peripheral lymphocytes derived from two patients, revealed that the p.Asp390Gly mutation significantly impacts on the acylation of tRNA(Ser)(AGY) but probably not that of tRNA(Ser)(UCN). Marked decrease in the expression of the nonacylated transcript and the complete absence of the acylated tRNA(Ser)(AGY) suggest that this mutation leads to significant loss of function and that the uncharged transcripts undergo degradation. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
A causal role for uric acid in fructose-induced metabolic syndrome.
Nakagawa, Takahiko; Hu, Hanbo; Zharikov, Sergey; Tuttle, Katherine R; Short, Robert A; Glushakova, Olena; Ouyang, Xiaosen; Feig, Daniel I; Block, Edward R; Herrera-Acosta, Jaime; Patel, Jawaharlal M; Johnson, Richard J
2006-03-01
The worldwide epidemic of metabolic syndrome correlates with an elevation in serum uric acid as well as a marked increase in total fructose intake (in the form of table sugar and high-fructose corn syrup). Fructose raises uric acid, and the latter inhibits nitric oxide bioavailability. Because insulin requires nitric oxide to stimulate glucose uptake, we hypothesized that fructose-induced hyperuricemia may have a pathogenic role in metabolic syndrome. Four sets of experiments were performed. First, pair-feeding studies showed that fructose, and not dextrose, induced features (hyperinsulinemia, hypertriglyceridemia, and hyperuricemia) of metabolic syndrome. Second, in rats receiving a high-fructose diet, the lowering of uric acid with either allopurinol (a xanthine oxidase inhibitor) or benzbromarone (a uricosuric agent) was able to prevent or reverse features of metabolic syndrome. In particular, the administration of allopurinol prophylactically prevented fructose-induced hyperinsulinemia (272.3 vs.160.8 pmol/l, P < 0.05), systolic hypertension (142 vs. 133 mmHg, P < 0.05), hypertriglyceridemia (233.7 vs. 65.4 mg/dl, P < 0.01), and weight gain (455 vs. 425 g, P < 0.05) at 8 wk. Neither allopurinol nor benzbromarone affected dietary intake of control diet in rats. Finally, uric acid dose dependently inhibited endothelial function as manifested by a reduced vasodilatory response of aortic artery rings to acetylcholine. These data provide the first evidence that uric acid may be a cause of metabolic syndrome, possibly due to its ability to inhibit endothelial function. Fructose may have a major role in the epidemic of metabolic syndrome and obesity due to its ability to raise uric acid.
Mannucci, E; Monami, M; Bardini, G; Ognibene, A; Rotella, C M
2007-12-01
The adoption of the International Diabetes Federation (IDF) criteria for metabolic syndrome (MS), in comparison with the National Cholesterol Educational Program (NCEP) criteria, produces different changes in estimates of prevalence in diverse populations. Few data are available in Caucasian non-diabetic subjects. The prevalence of NCEP- and IDF-defined MS was assessed in a sample of 2,945 individuals, aged 55.2+/-11.5 yr, enrolled in a screening program for diabetes. Association of different definitions of MS with glucose intolerance (120-min glucose 7.8 mmol/l after a 75 g-oral glucose load) and hyperuricemia (>0.38 mmol/l) was also assessed. The prevalence of MS was 16.6% and 29.7% with NCEP and IDF definitions, respectively. The prevalence of NCEP-defined MS was higher than IDF-MS through all age ranges; among those aged >60 yr, the prevalence of IDF-MS reached 52.8% (vs 33.1% for NCEP-MS). Both NCEP- and IDF-MS were associated with glucose intolerance and hyperuricemia. Individuals fulfilling IDF, but not NCEP criteria for MS, showed a prevalence of glucose intolerance (22.7%) significantly (p<0.05) lower than those fulfilling NCEP criteria only (31.6%) or both sets of criteria (31.8%). In Caucasian subjects without known diabetes, IDF criteria produce a relevant increase in estimates of prevalence of MS, particularly in older subjects, when compared with NCEP criteria. NCEP-MS seems to be more effective than IDF-MS in the identification of glucose intolerant subjects.
Coexistence of Sarcoidosis and Gouty Arthritis.
Semiz, Hüseyin; Kobak, Senol
2017-08-21
Sarcoidosis is an inflammatory disease with unknown cause characterized by non-caseating granuloma formations. It may present with bilateral hilar lymphadenopathy, skin lesions, the involvement of eye and symptoms on the locomotor system. Gouty arthritis is an autoinflammatory disease characterized by hyperuricemia, recurrent arthritis attacks and the deposition of monosodium urate crystals in the joints and the surrounding tissues. We reported the coexistence of sarcoidosis and gouty arthritis in this paper. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.
Deng, Siyun; Deng, Qifei; Hu, Die; Li, Jun; Zhu, Xiaoyan; Guo, Huan; Wu, Tangchun
2014-06-01
To analyze the relationship between metabolites of polycyclic aromatic hydrocarbons (PAHs) and serum uric acid levels in coke oven workers and to provide new clues to the pathogenic mechanism of PAHs. A total of 1302 coke oven workers were divided into four groups, namely control group and low-, intermediate-, and high-dose exposure groups. The concentrations of ambient PAHs at each workplace were determined by high-performance liquid chromatography. The detailed information on the occupational history and health of workers was collected by questionnaire survey and physical examination, and so were their blood and urine samples. Serum uric acid and creatinine levels were measured using a Hitachi 7020 automatic biochemical analyzer. Ten urinary PAH metabolites were detected by gas chromatography-mass spectrometry. Serum uric acid levels were the highest in the high-dose exposure group, followed by the intermediate- and low-dose exposure groups, and were the lowest in the control group. There were significant correlations between serum uric acid levels and the quartiles of 1-hydroxynaphthalene and 1-hydroxyphenanthrene (P < 0.05). After adjustment for PAH metabolite-related relationship, only urinary 1-hydroxyphenanthrene was significantly correlated with serum uric acid levels (P = 0.001). After adjustment for confounding factors and using the 1st quartile of 1-hydroxyphenanthrene as a reference, the odds ratio for hyperuricemia in subjects with the 2nd, 3rd, and 4th quartiles of 1-hydroxyphenanthrene were 1.55, 1.57, and 2.35, respectively. Urinary 1-hydroxyphenanthrene is associated with a dose-response increase in serum uric acid levels in coke oven workers, and exposure to phenanthrene in PAHs may be a risk factor for hyperuricemia.
Characteristic and Outcome of Psoriatic Arthritis Patients with Hyperuricemia.
AlJohani, Roa'A; Polachek, Ari; Ye, Justine Yang; Chandran, Vinod; Gladman, Dafna D
2018-02-01
To determine the characteristics of patients with psoriatic arthritis (PsA) who have hyperuricemia (HUC) and their outcomes, especially cardiovascular (CVD) and kidney diseases. Patients have been followed prospectively at the PsA clinic according to a standard protocol at 6- to 12-month intervals. We defined HUC in men > 450 µ mol/l or women > 360 µ mol/l. We matched patients with HUC based on sex and age ± 5 years with normal uric acid patients. Demographics information and disease characteristics were reviewed. Outcomes of patients with HUC, especially CVD and kidney diseases, were recorded. Conditional logistic regression was performed to determine factors independently associated with HUC in patients with PsA. There were 325 (31.9%) out of 1019 patients with PsA who had HUC. Of these, 318 cases were matched to 318 controls. There were 11 (3.4%) out of 325 patients with HUC who had gout. Patients with HUC had longer disease duration and a higher Psoriasis Area and Severity Index. They had more concurrent comorbidities, including CVD and metabolic diseases, as well as higher prevalence of kidney stones and higher creatinine. Only 1 patient with HUC was treated with allopurinol at first evaluation visit and 7 patients during followup. Over the followup, 163 of the 318 patients had persistent HUC (pHUC) for more than 2 visits. Patients with pHUC developed more myocardial infarction, heart failure, and renal impairment. Multivariate analysis showed an association between pHUC, PsA disease duration, and obesity. HUC is common in patients with PsA, especially in those with longer disease duration and obesity. Proper control of HUC and metabolic diseases may play a preventive role in improving PsA outcomes.
Tanaka, Kenichi; Nakayama, Masaaki; Kanno, Makoto; Kimura, Hiroshi; Watanabe, Kimio; Tani, Yoshihiro; Hayashi, Yoshimitsu; Asahi, Koichi; Terawaki, Hiroyuki; Watanabe, Tsuyoshi
2015-12-01
Hyperuricemia is associated with the onset of chronic kidney disease (CKD) and renal disease progression. Febuxostat, a novel, non-purine, selective xanthine oxidase inhibitor, has been reported to have a stronger effect on hyperuricemia than conventional therapy with allopurinol. However, few data are available regarding the clinical effect of febuxostat in patients with CKD. A prospective, randomized, open-label, parallel-group trial was conducted in hyperuricemic patients with stage 3 CKD. Patients were randomly assigned to treatment with febuxostat (n = 21) or to continue conventional therapy (n = 19). Treatment was continued for 12 weeks. The efficacy of febuxostat was determined by monitoring serum uric acid (UA) levels, blood pressures, renal function, and urinary protein levels. In addition, urinary liver-type fatty acid-binding protein (L-FABP), urinary albumin, urinary beta 2 microglobulin (β2MG), and serum high sensitivity C-reactive protein were measured before and 12 weeks after febuxostat was added to the treatment. Febuxostat resulted in a significantly greater reduction in serum UA (-2.2 mg/dL) than conventional therapy (-0.3 mg/dL, P < 0.001). Serum creatinine and estimated glomerular filtration rate changed little during the study period in each group. However, treatment with febuxostat for 12 weeks reduced the urinary levels of L-FABP, albumin, and β2MG, whereas the levels of these markers did not change in the control group. Febuxostat reduced serum UA levels more effectively than conventional therapy and might have a renoprotective effect in hyperuricemic patients with CKD. Further studies should clarify whether febuxostat prevents the progression of renal disease and improves the prognosis of CKD.
Mirheydar, Hossein S; Banapour, Pooya; Massoudi, Rustin; Palazzi, Kerrin L; Jabaji, Ramzi; Reid, Erin G; Millard, Frederick E; Kane, Christopher J; Sur, Roger L
2014-01-01
This study describes the incidence and risk factors of de novo nephrolithiasis among patients with lymphoproliferative or myeloproliferative diseases who have undergone chemotherapy. From 2001 to 2011, patients with lymphoproliferative or myeloproliferative disorders treated with chemotherapy were retrospectively identified. The incidence of image proven nephrolithiasis after chemotherapy was determined. Demographic and clinical variables were recorded. Patients with a history of nephrolithiasis prior to chemotherapy were excluded. The primary outcome was incidence of nephrolithiasis, and secondary outcomes were risk factors predictive of de novo stone. Comparative statistics were used to compare demographic and disease specific variables for patients who developed de novo stones versus those who did not. A total of 1,316 patients were identified and the incidence of de novo nephrolithiasis was 5.5% (72/1316; symptomatic stones 1.8% 24/1316). Among patients with nephrolithiasis, 72.2% had lymphoproliferative disorders, 27.8% had myeloproliferative disorders, and 25% utilized allopurinol. The median urinary pH was 5.5, and the mean serum uric acid, calcium, potassium and phosphorus levels were 7.5, 9.6, 4.3, and 3.8 mg/dL, respectively. In univariate analysis, mean uric acid (p=0.013), calcium (p<0.001)), and potassium (p=0.039) levels were higher in stone formers. Diabetes mellitus (p<0.001), hypertension (p=0.003), and hyperlipidemia (p<0.001) were more common in stone formers. In multivariate analysis, diabetes mellitus, hyperuricemia, and hypercalcemia predicted stone. We report the incidence of de novo nephrolithiasis in patients who have undergone chemotherapy. Diabetes mellitus, hyperuricemia, and hypercalcemia are patient-specific risk factors that increase the odds of developing an upper tract stone following chemotherapy.
Li, Yongmei; Fan, Xing; Li, Chunjun; Zhi, Xinyue; Peng, Liyuan; Han, Hongling; Sun, Bei
2018-03-28
Chronic kidney disease (CKD) is a common chronic microvascular complication and the major cause of death in diabetic patients. This study was conceived to explore the possible mechanisms of how hyperuricemia and obesity contribute to renal function impairment in type 2 diabetic (T2DM) patients. A cross-sectional study in 609 participants recruited from a T2DM population in North China was conducted. The multiplicative interaction between body mass index (BMI) and uric acid (UA) level was assessed using an interaction term in a logistic regression analysis. Our results indicate that male T2DM patients having higher BMI (OR 1.711, p = 0.038), blood urine nitrogen (BUN) (OR 1.100, p = 0.034), and 24-hour urinary micro-albumin levels (OR 1.004, p = 0.021) were much more likely to have high UA. Whereas, for female T2DM patients, the OR of BMI, BUN, and triglyceride were 1.169 (p = 0.001), 1.337 (p = 0.000), and 1.359 (p = 0.006), respectively. In this study population, obesity and elevated UA work together to increase the risk of renal injury. In vitro experiments indicate that reactive oxygen species (ROS) production increased with UA treatment in human renal glomerular endothelial cells (HRGECs), while endothelial nitric oxide synthase (eNOS) production level dropped. UA also increased monocyte chemotactic protein-1 (MCP-1) expression and nuclear factor kappa B (NF-κB) activation. Taken together, our results indicate that high concentrations of UA lead to endothelial dysfunction through the activation of the inflammatory response and induction of oxidative stress, even in non-obese T2DM patients.
Cao, Xia; Xie, Xiumei; Xu, Guo; Yuan, Hong; Chen, Zhiheng
2014-06-01
To investigate the relationship between high-normal blood pressure and chronic kidney disease (CKD) in occupational physical examination population in Changsha. With a convenient sampling method, a cross-sectional survey of representative sample of 11 274 white collar workers was conducted in Changsha between March 2011 and May 2011 in a large comprehensive hospital. All subjects were assigned into 4 groups: a normal blood pressure group, a high-normal blood pressure group, an undiagnosed hypertension group, and a diagnosed hypertension group. Anthropometry, blood pressure, blood sample and urine sample were measured with standard instruments and methodology for all the subjects. Multiple logistic regression analysis was used to identify risk factors for CKD. The prevalence of CKD in the normal blood pressure, high-normal blood pressure, undiagnosed hypertension, and diagnosed hypertension were 3.31%, 6.60%, 11.78%, and 17.35%, respectively. The prevalence of CKD in males was significantly higher than that in females (P<0.01). For males with high-normal blood pressure, the CKD risk was significantly greater (OR, 1.30; 95% CI:1.03 - 1.63) than those with optimal blood pressure. The logistic regression analysis showed that there was an additive effect of hyperuricemia on CKD risk in men with high-normal blood pressure compared with men with optimal blood pressure (OR, 2.25; 95% CI, 1.59 - 3.19; P<0.05). The prevalence of CKD in people with the high-normal blood pressure is 6.60% in occupational physical examination population in Changsha. CKD is a high risk for men with highnormal blood pressure and hyperuricemia is an independent risk factor.
Chan, Te-Fu; Lin, Wei-Ting; Chen, Yi-Ling; Huang, Hsiao-Ling; Yang, Wei-Zeng; Lee, Chun-Ying; Chen, Meng-Hsueh; Wang, Tsu-Nai; Huang, Meng-Chuan; Chiu, Yu-Wen; Huang, Chun-Chi; Tsai, Sharon; Lin, Chih-Lung; Lee, Chien-Hung
2014-01-01
Background The metabolic effect of fructose in sugar-sweetened beverages (SSB) has been linked to de novo lipogenesis and uric acid (UA) production. Objectives This study investigated the biological effects of SSB consumption on serum lipid profiles and retinol-binding protein 4 (RBP4) among Taiwanese adolescents. Methods We evaluated the anthropometric parameters and biochemical outcomes of 200 representative adolescents (98 boys and 102 girls) who were randomly selected from a large-scale cross-sectional study. Data were analyzed using multiple regression models adjusted for covariates. Results Increased SSB consumption was associated with increased waist and hip circumferences, body mass index (BMI) values and serum UA, triglyceride (TG) and RBP4 levels. Adolescents who consumed >500 ml/day of beverages half-to-heavily sweetened with high-fructose corn syrup (HFCS) exhibited TG and RBP4 levels 22.7 mg/dl and 13.92 ng/ml higher than non-drinkers, respectively. HFCS drinkers with hyperuricemia had higher TG levels than HFCS drinkers with normal UA levels (98.6 vs. 81.6 mg/dl). The intake of HFCS-rich SSBs and high value of BMI (≥24) interactively reinforced RBP4 levels among overweight/obese adolescents. Circulating RBP4 levels were significantly correlated with weight-related outcomes and TG and UA concentration among HFCS drinkers (r = 0.253 to 0.404), but not among non-drinkers. Conclusions High-quantity HFCS-rich beverage consumption is associated with higher TG and RBP4 levels. Hyperuricemia is likely to intensify the influence of HFCS-rich SSB intake on elevated TG levels, and in overweight and obese adolescents, high BMI may modify the action of fructose on higher circulating levels of RBP4. PMID:24475021
Schmitt, Ana Carolina Basso; Cardoso, Maria Regina Alves; Lopes, Heno; Pereira, Wendry Maria Paixão; Pereira, Elaine Cristina; de Rezende, Debora Aparecida Paccola; Guarizi, Rubia Guibo; Dellu, Mayra Cecilia; Oliveira, Jéssica de Moura; Flauzino, Erika; Blümel, Juan E; Aldrighi, José Mendes
2013-04-01
The aims of this study were to estimate the prevalence of metabolic syndrome among women aged 35 to 65 years and to identify associated factors. This was a cross-sectional study. We randomly selected 581 women (aged 35-65 y) from among those enrolled in a family health program in the city of Pindamonhangaba, Brazil. Metabolic syndrome was identified in accordance with the definition of the National Cholesterol Education Program Adult Treatment Panel III. Health conditions and lifestyle habits were evaluated by a survey, and anthropometric measurements were obtained. The prevalence of metabolic syndrome was estimated, and Poisson regression was used to evaluate the associations between metabolic syndrome `and the factors investigated. The prevalence of metabolic syndrome was 42.2% (95% CI, 38.1-46.2). The most common metabolic syndrome component was abdominal obesity (60.6%), followed by low levels of high-density lipoprotein cholesterol (51.3%), high levels of triglycerides (41.4%), high blood pressure (31.7%), and diabetes (13.9%). The following factors were associated with metabolic syndrome: the 45- to 54-year age group (prevalence ratio, 1.54; 95% CI, 1.08-2.01), the 55- to 65-year age group (prevalence ratio, 3.51; 95% CI, 1.49-3.10), hyperuricemia (prevalence ratio, 2.95; 95% CI, 1.15-1.86), and sleep apnea risk (prevalence ratio, 2.41; 95% CI, 1.16-1.82). We found an inverse association between metabolic syndrome and having had more than 5 years of schooling (prevalence ratio, 0.65; 95% CI, 0.65-1.04). The prevalence of metabolic syndrome is high, and the associated clinical factors are hyperuricemia and risk of sleep apnea.
Circulating Levels of Uric Acid and Risk for Metabolic Syndrome.
Rubio-Guerra, Alberto F; Morales-López, Herlinda; Garro-Almendaro, Ana K; Vargas-Ayala, German; Durán-Salgado, Montserrat B; Huerta-Ramírez, Saul; Lozano-Nuevo, Jose J
2017-01-01
Hyperuricemia leads to insulin resistance, whereas insulin resistance decreases renal excretion of uric acid, both mechanisms link elevated serum uric acid with metabolic syndrome. The aim of this study is to evaluate the probability for the development of metabolic syndrome in low-income young adults with hyperuricaemia. We evaluated 103 patients less than 40 years of age, from a low-income population, and without history of cardiovascular disease, in all of them the presence of metabolic syndrome was assessed in accordance with the International Diabetes Federation criteria. In all patients, fasting serum uric acid levels were measured; hyperuricaemia was defined as serum uric acid values 6.5 mg/dl in men and 5.1 mg/dl in women. Statistical analysis was performed with odds ratio. 83 of our patients (80.5%) suffered metabolic syndrome, the odds ratio for the presence of metabolic syndrome in patients with hyperuricaemia was 5.1 (p=0.002, I.C 1.8- 14.5). When patients were evaluated by gender a significantly association between hyperuricaemia and metabolic syndrome was found in women (odds ratio 3.6, p=0.048, C.I. 1.0-12.9), and men (odds ratio 10.2, p= 0.015, IC 1.5-13.2). When uric acid was correlated with the components of metabolic syndrome, we only found a positive correlation with waist circumference (r=0.483). Our results showed a significant association between hyperuricemia and metabolic syndrome in low-income young adults in Mexico. DR is associated with estimated risk of CVD in type 2 diabetic patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Serum uric acid levels and mortality in the Japanese population: the Yamagata (Takahata) study.
Kamei, Keita; Konta, Tsuneo; Ichikawa, Kazunobu; Sato, Hiroko; Suzuki, Natsuko; Kabasawa, Asami; Suzuki, Kazuko; Hirayama, Atsushi; Shibata, Yoko; Watanabe, Tetsu; Kato, Takeo; Ueno, Yoshiyuki; Kayama, Takamasa; Kubota, Isao
2016-12-01
Serum uric acid level is regulated by gender, dietary habit, genetic predisposition, and renal function, and is associated with the development of renal and cardiovascular diseases. This study prospectively investigated the association between serum uric acid levels and mortality in a community-based population. Three thousand four hundred and eighty-seven subjects regardless of the antihyperuricemic medication (45 % male; mean age 62 years old) from the Takahata town in Japan participated in this study and were followed up for 8 years (median 7.5 years). We examined the association between serum uric acid levels at baseline and the all-cause and cardiovascular mortality, respectively, in this population. One hundred seventy-nine subjects died during the follow-up period, with 49 deaths attributed to cardiovascular causes. Kaplan-Meier analysis revealed that the all-cause mortality was significantly higher along with the increase in serum uric acid levels at baseline among female (Log-rank P < 0.01), but not male subjects (P = 0.97). Cox-proportional hazard model analysis with adjustment for possible confounders including age, renal function, and comorbidities revealed that hyperuricemia (uric acid ≥7.0 mg/dL) was an independent risk factor for all-cause and cardiovascular mortality, respectively, in female [hazard ratio (HR) 5.92, 95 % confidence interval (CI) 2.10-14.6 for all-cause mortality, and HR 10.7, 95 % CI 1.76-50.2 for cardiovascular mortality], but not male subjects. Hyperuricemia was an independent risk for all-cause and cardiovascular mortality in female, but not among the male subjects in a community-based population.
Kim, Chang Seong; Jin, Dong-Chan; Yun, Young Cheol; Bae, Eun Hui; Ma, Seong Kwon; Kim, Soo Wan
2017-01-01
Background It is thought that hyperuricemia might lower the risk of mortality among hemodialysis patients, unlike in the general population, but the evidence is controversial. The aim of the current study was to evaluate the impact of serum uric acid level on the long-term clinical outcomes of hemodialysis patients in Korea. Methods Retrospective analysis was performed on data from the End-Stage Renal Disease Registry of the Korean Society of Nephrology. This included data for 7,333 patients (mean age, 61 ± 14 years; 61% male) who received hemodialysis from January 2001 through April 2015. Initial laboratory data were used in the analysis. Results The mean serum uric acid level in this study was 7.1 ± 1.7 mg/dL. Body mass index, normalized protein catabolic rate, albumin, and cholesterol were positively correlated with serum uric acid level after controlling for age and sex. After controlling for demographic data, comorbidities, and residual renal function, a higher uric acid level was independently associated with a significantly lower all-cause mortality (hazard ratio [HR], 0.90 per 1 mg/dL increase in uric acid level; 95% confidence interval [CI], 0.83–0.97; P = 0.008), but not cardiovascular mortality (HR, 0.90; 95% CI, 0.80–1.01; P = 0.078). Comparing uric acid levels in the highest and lowest quintiles, the HR for all-cause mortality was 0.65 (95% CI, 0.42–0.99; P = 0.046). Conclusion Hyperuricemia was strongly associated with a lower risk of all-cause mortality, but there seems to be no significant association between serum uric acid level and cardiovascular mortality among Korean hemodialysis patients with end-stage renal disease. PMID:29285429
Hyperuricemia Causes Pancreatic β-Cell Death and Dysfunction through NF-κB Signaling Pathway
Jia, Lu; Xing, Jing; Ding, Ying; Shen, Yachen; Shi, Xuhui; Ren, Wei; Wan, Meng; Guo, Jianjin; Zheng, Shujing; Liu, Yun; Liang, Xiubin; Su, Dongming
2013-01-01
Accumulating clinical evidence suggests that hyperuricemia is associated with an increased risk of type 2 diabetes. However, it is still unclear whether elevated levels of uric acid can cause direct injury of pancreatic β-cells. In this study, we examined the effects of uric acid on β-cell viability and function. Uric acid solution or normal saline was administered intraperitoneally to mice daily for 4 weeks. Uric acid-treated mice exhibited significantly impaired glucose tolerance and lower insulin levels in response to glucose challenge than did control mice. However, there were no significant differences in insulin sensitivity between the two groups. In comparison to the islets in control mice, the islets in the uric acid–treated mice were markedly smaller in size and contained less insulin. Treatment of β-cells in vitro with uric acid activated the NF-κB signaling pathway through IκBα phosphorylation, resulting in upregulated inducible nitric oxide synthase (iNOS) expression and excessive nitric oxide (NO) production. Uric acid treatment also increased apoptosis and downregulated Bcl-2 expression in Min6 cells. In addition, a reduction in insulin secretion under glucose challenge was observed in the uric acid–treated mouse islets. These deleterious effects of uric acid on pancreatic β-cells were attenuated by benzbromarone, an inhibitor of uric acid transporters, NOS inhibitor L-NMMA, and Bay 11–7082, an NF-κB inhibitor. Further investigation indicated that uric acid suppressed levels of MafA protein through enhancing its degradation. Collectively, our data suggested that an elevated level of uric acid causes β-cell injury via the NF-κB-iNOS-NO signaling axis. PMID:24205181
Chittoor, Geetha; Haack, Karin; Mehta, Nitesh R; Laston, Sandra; Cole, Shelley A; Comuzzie, Anthony G; Butte, Nancy F; Voruganti, V Saroja
2017-01-17
Reduced renal excretion of uric acid plays a significant role in the development of hyperuricemia and gout in adults. Hyperuricemia has been associated with chronic kidney disease and cardiovascular disease in children and adults. There are limited genome-wide association studies associating genetic polymorphisms with renal urate excretion measures. Therefore, we investigated the genetic factors that influence the excretion of uric acid and related indices in 768 Hispanic children of the Viva La Familia Study. We performed a genome-wide association analysis for 24-h urinary excretion measures such as urinary uric acid/urinary creatinine ratio, uric acid clearance, fractional excretion of uric acid, and glomerular load of uric acid in SOLAR, while accounting for non-independence among family members. All renal urate excretion measures were significantly heritable (p <2 × 10 -6 ) and ranged from 0.41 to 0.74. Empirical threshold for genome-wide significance was set at p <1 × 10 -7 . We observed a strong association (p < 8 × 10 -8 ) of uric acid clearance with a single nucleotide polymorphism (SNP) in zinc finger protein 446 (ZNF446) (rs2033711 (A/G), MAF: 0.30). The minor allele (G) was associated with increased uric acid clearance. Also, we found suggestive associations of uric acid clearance with SNPs in ZNF324, ZNF584, and ZNF132 (in a 72 kb region of 19q13; p <1 × 10 -6 , MAFs: 0.28-0.31). For the first time, we showed the importance of 19q13 region in the regulation of renal urate excretion in Hispanic children. Our findings indicate differences in inherent genetic architecture and shared environmental risk factors between our cohort and other pediatric and adult populations.
Huang, Yingjuan; Meng, Jun; Sun, Baoguo; Xiang, Ting; Zhou, Xin; Xu, Biyu; Wu, Yingzi; Chen, Zexiong; Zhang, Shijun
2017-04-01
Hyperuricemia (HUA) is the most common disease associated with cardiovascular disease, metabolic syndrome, hypertension, and kidney disease. The objective of the current study was to evaluate the preliminary efficacy, mechanism, and safety of acupuncture on serum uric acid in patients with asymptomatic HUA. A randomized, placebo-controlled trial among 123 patients with asymptomatic HUA was conducted. The acupoints used in the acupuncture group were bilateral Five Shu in Spleen Meridian. Each participant received the intervention once daily for 10 consecutive days. The sham group received the same treatment duration on the same acupoints by the Park Sham Device. All patients underwent measurements of serum or urine creatinine, uric acid, serum lipid profiles, fasting plasma glucose, HbA1c, xanthine oxidase (XOD) and urate-anion exchanger (URAT-1). At the end of the intervention, the individuals in the acupuncture group were found to have significantly less levels of serum uric acid than those in the sham group [(453±65 vs. 528±81) μmol/L, p<0.01]. Acupuncture was effective on increasing the urine uric acid level, urine pH value and 24-hour urine volume than the sham treatment (p<0.05 for all). Interestingly, acupuncture significantly decreased the level of URAT-1 (p<0.01) but not XOD than that of the sham intervention. The adverse events were that 3 patients experienced severe pain. Acupuncture on Five Shu in Spleen Meridian appeared to be safe and efficacious for decreasing serum uric acid in a Chinese HUA patient population. The mechanism might be associated with the decrease level of enzyme URAT-1. ChiCTR-TRC-13004122. Copyright © 2017 Elsevier B.V. All rights reserved.
Dietary Sodium Modifies Serum Uric Acid Concentrations in Humans.
Todd, Alwyn S; Walker, Robert J; MacGinley, Robert J; Kelly, Jaimon; Merriman, Tony R; Major, Tanya J; Johnson, Richard J
2017-11-06
Subjects with hypertension are frequently obese or insulin resistant, both conditions in which hyperuricemia is common. Obese and insulin-resistant subjects are also known to have blood pressure that is more sensitive to changes in dietary sodium intake. Whether hyperuricemia is a resulting consequence, moderating or contributing factor to the development of hypertension has not been fully evaluated and very few studies have reported interactions between sodium intake and serum uric acid. We performed further analysis of our randomized controlled clinical trials (Australian New Zealand Clinical Trials Registry #12609000161224 and #12609000292279) designed to assess the effects of modifying sodium intake on concentrations of serum markers, including uric acid. Uric acid and other variables (including blood pressure, renin, and aldosterone) were measured at baseline and 4 weeks following the commencement of low (60 mmol/day), moderate (150 mmol/day), and high (200-250 mmol/day) dietary sodium intake. The median aldosterone-to-renin ratio was 1.90 [pg/ml]/[pg/ml] (range 0.10-11.04). Serum uric acid fell significantly in both the moderate and high interventions compared to the low sodium intervention. This pattern of response occurred when all subjects were analyzed, and when normotensive or hypertensive subjects were analyzed alone. Although previously reported in hypertensive subjects, these data provide evidence in normotensive subjects of an interaction between dietary sodium intake and serum uric acid. As this interaction is present in the absence of hypertension, it is possible it could play a role in hypertension development, and will need to be considered in future trials of dietary sodium intake. The trials were registered with the Australian and New Zealand Clinical Trials Registry as ACTRN12609000161224 and ACTRN1260. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Miyake, Teruki; Kumagi, Teru; Furukawa, Shinya; Hirooka, Masashi; Kawasaki, Keitarou; Koizumi, Mitsuhito; Todo, Yasuhiko; Yamamoto, Shin; Abe, Masanori; Kitai, Kohichiro; Matsuura, Bunzo; Hiasa, Yoichi
2014-01-01
Background It is not clear whether elevated uric acid is a risk factor for the onset of impaired fasting glucose after stratifying by baseline fasting plasma glucose levels. We conducted a community-based retrospective longitudinal cohort study to clarify the relationship between uric acid levels and the onset of impaired fasting glucose, according to baseline fasting plasma glucose levels. Methods We enrolled 6,403 persons (3,194 men and 3,209 women), each of whom was 18–80 years old and had >2 annual check-ups during 2003–2010. After excluding persons who had fasting plasma glucose levels ≥6.11 mM and/or were currently taking anti-diabetic agents, the remaining 5,924 subjects were classified into quartiles according to baseline fasting plasma glucose levels. The onset of impaired fasting glucose was defined as fasting plasma glucose ≥6.11 mM during the observation period. Results In the quartile groups, 0.9%, 2.1%, 3.4%, and 20.2% of the men developed impaired fasting glucose, respectively, and 0.1%, 0.3%, 0.5%, and 5.6% of the women developed impaired fasting glucose, respectively (P trend <0.001). After adjusting for age, body mass index, systolic blood pressure, triacylglycerols, high density lipoprotein-cholesterol, creatinine, fatty liver, family history of diabetes, alcohol consumption, and current smoking, uric acid levels were positively associated with onset of impaired fasting glucose in men with highest-quartile fasting plasma glucose levels (adjusted hazard ratio, 1.003; 95% confidence interval, 1.0001–1.005, P = 0.041). Conclusions Among men with high fasting plasma glucose, hyperuricemia may be independently associated with an elevated risk of developing impaired fasting glucose. PMID:25237894
Kuwabara, Masanari; Borghi, Claudio; Cicero, Arrigo F G; Hisatome, Ichiro; Niwa, Koichiro; Ohno, Minoru; Johnson, Richard J; Lanaspa, Miguel A
2018-06-15
High serum uric acid (SUA) is associated with the dyslipidemia, but whether hyperuricemia predicts an increase in serum low-density lipoprotein (LDL) cholesterol is unknown. This study is to evaluate whether an elevated SUA predicts the development of high LDL cholesterol as well as hypertriglyceridemia. This is a retrospective 5-year cohort study of 6476 healthy Japanese adults (age, 45.7 ± 10.1 years; 2.243 men) who underwent health examinations at 2004 and were reevaluated in 2009 at St. Luke's International Hospital, Tokyo, Japan. Subjects were included if at their baseline examination they did not have hypertension, diabetes mellitus, dyslipidemia, chronic kidney disease, or if they were on medication for hyperuricemia and/or gout. The analysis was adjusted for age, body mass index (BMI), smoking and drinking habits, baseline estimated glomerular filtration rate (eGFR), baseline SUA and SUA change over the 5 years. High baseline SUA was an independent risk for developing high LDL cholesterol both in men (OR: 1.159 per 1 mg/dL increase, 95% CI:1.009-1.331) and women (OR: 1.215, 95% CI:1.061-1.390). Other risk factors included a higher baseline LDL cholesterol, higher BMI, and higher baseline eGFR (the latter two in women only). Increased SUA over 5 years were also independent risks for developing high LDL cholesterol and hypertriglyceridemia, but not for low high-density lipoprotein (HDL) cholesterol. This is the first study to report that an elevated SUA increases the risk for developing high LDL cholesterol, as well as hypertriglyceridemia. This may shed light into the role of SUA in cardiovascular disease. Copyright © 2018 Elsevier B.V. All rights reserved.
Maarman, Gerald J; Andrew, Brittany M; Blackhurst, Dee M; Ojuka, Edward O
2017-04-01
Excess uric acid has been shown to induce oxidative stress, triglyceride accumulation, and mitochondrial dysfunction in the liver and is an independent predictor of type-2 diabetes. Skeletal muscle plays a dominant role in type 2 diabetes and presents a large surface area to plasma uric acid. However, the effects of uric acid on skeletal muscle are underinvestigated. Our aim was therefore to characterize the effects of excessive uric acid on oxidative stress, triglyceride content, and mitochondrial function in skeletal muscle C 2 C 12 myotubes and assess how these are modulated by the antioxidant molecule melatonin. Differentiated C 2 C 12 myotubes were exposed to 750 µM uric acid or uric acid + 10 nM melatonin for 72 h. Compared with control, uric acid increased triglyceride content by ~237%, oxidative stress by 32%, and antioxidant capacity by 135%. Uric acid also reduced endogenous ROUTINE respiration, complex II-linked oxidative phosphorylation, and electron transfer system capacities. Melatonin counteracted the effects of uric acid without further altering antioxidant capacity. Our data demonstrate that excess uric acid has adverse effects on skeletal muscle similar to those previously reported in hepatocytes and suggest that melatonin at a low physiological concentration of 10 nM may be a possible therapy against some adverse effects of excess uric acid. NEW & NOTEWORTHY Few studies have investigated the effects of uric acid on skeletal muscle. This study shows that hyperuricemia induces mitochondrial dysfunction and triglyceride accumulation in skeletal muscle. The findings may explain why hyperuricemia is an independent predictor of diabetes. Copyright © 2017 the American Physiological Society.
[ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].
Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I
2016-03-01
The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.
Merriman, Tony R; Choi, Hyon K; Dalbeth, Nicola
2014-05-01
Gout results from deposition of monosodium urate (MSU) crystals. Elevated serum urate concentrations (hyperuricemia) are not sufficient for the development of disease. Genome-wide association studies (GWAS) have identified 28 loci controlling serum urate levels. The largest genetic effects are seen in genes involved in the renal excretion of uric acid, with others being involved in glycolysis. Whereas much is understood about the genetic control of serum urate levels, little is known about the genetic control of inflammatory responses to MSU crystals. Extending knowledge in this area depends on recruitment of large, clinically ascertained gout sample sets suitable for GWAS. Copyright © 2014 Elsevier Inc. All rights reserved.
TRAUMATIC (FOREIGN BODY) PERICARDITIS IN A TOCO TOUCAN (RAMPHASTOS TOCO).
Máinez, Mireia; Rosell, Jorge; Such, Roger; Cardona, Teresa; Juan-Sallés, Carles
2016-12-01
An approximately 10-yr-old, captive-born female toco toucan ( Ramphastos toco ) was presented due to an acute onset of depression and apathy. On visual and physical examination, it showed an abnormal posture and dehydration, respectively. Serum biochemistry revealed hyperuricemia (39.4 mg/dl) and elevated glutamic oxaloacetic transaminase (GOT; 1,050 U/L). Radiographs demonstrated an enlargement of the cardiac silhouette. The bird died 7 days after presentation, despite treatment with enrofloxacin, allopurinol, a preparation of hepatorenal protectors, and complex B vitamins with dextrose. Necropsy revealed severe fibrinohemorrhagic pericarditis with a 15 mm long and 2.5 mm diameter, rigid foreign body in the pericardial exudate. Microscopically, this foreign body was of vegetal origin.
Diabetes, overweight and risk of postmenopausal breast cancer: a case-control study in Uruguay.
Ronco, Alvaro L; De Stefani, Eduardo; Deneo-Pellegrini, Hugo; Quarneti, Aldo
2012-01-01
Obese postmenopausal women increase their risk of developing breast cancer (BC), in particular if they display an android-type pattern of adiposity, which is also associated to increased risks of diabetes mellitus, hypertension and cardiovascular disease. In order to explore the associations among anthropometry (body mass index, body composition, somatotype), some specific items of medical history (diabetes, hypertension, dislypidemias, hyperuricemia) and the risk of BC in Uruguayan women, a case-control study was carried out between 2004-2009 at our Oncology Unit. 912 women of ages between 23-69 years (367 new BC cases and 545 non hospitalized, age-matched controls with a normal mammography) were interviewed. Twenty body measurements were taken in order to calculate body composition and somatotype. Patients were queried on socio-demographics, reproductive history, family history of cancer, a brief food frequency questionnaire and on personal history of diabetes, dislypidemias, hyperuricemia, hypertension and gallbladder stones. Uni- and multivariate analyses were done, generating odds ratios (ORs) as an expression of relative risks. A personal history of diabetes was positively associated to BC risk (OR=1.64, 95% CI 1.00-2.69), being higher among postmenopausal women (OR=1.92, 95% CI 1.04-3.52). The risks of BC for diabetes in postmenopausal women with overweight combined with dislypidemia (OR=9.33, 95% CI 2.10-41.5) and high fat/muscle ratio (OR=7.81, 95% CI 2.01-30.3) were significantly high. As a conclusion, a personal history of diabetes and overweight was strongly associated to BC. The studied sample had a subset of high-risk of BC featured by postmenopausal overweight and diabetic women, who also had a personal history of hypertension and/or dyslipidemia. The present results could contribute to define new high risk groups and individuals for primary as well as for secondary prevention, since this pattern linked to the metabolic syndrome is usually not considered for BC prevention.
Vasiliou, Vasilis; Sandoval, Monica; Backos, Donald S; Jackson, Brian C; Chen, Ying; Reigan, Philip; Lanaspa, Miguel A; Johnson, Richard J; Koppaka, Vindhya; Thompson, David C
2013-02-25
Gout, a common form of inflammatory arthritis, is strongly associated with elevated uric acid concentrations in the blood (hyperuricemia). A recent study in Icelanders identified a rare missense single nucleotide polymorphism (SNP) in the ALDH16A1 gene, ALDH16A1*2, to be associated with gout and serum uric acid levels. ALDH16A1 is a novel and rather unique member of the ALDH superfamily in relation to its gene and protein structures. ALDH16 genes are present in fish, amphibians, protista, bacteria but absent from archaea, fungi and plants. In most mammalian species, two ALDH16A1 spliced variants (ALDH16A1, long form and ALDH16A1_v2, short form) have been identified and both are expressed in HepG-2, HK-2 and HK-293 human cell lines. The ALDH16 proteins contain two ALDH domains (as opposed to one in the other members of the superfamily), four transmembrane and one coiled-coil domains. The active site of ALDH16 proteins from bacterial, frog and lower animals contain the catalytically important cysteine residue (Cys-302); this residue is absent from the mammalian and fish orthologs. Molecular modeling predicts that both the short and long forms of human ALDH16A1 protein would lack catalytic activity but may interact with the hypoxanthine-guanine phosphoribosyltransferase (HPRT1) protein, a key enzyme involved in uric acid metabolism and gout. Interestingly, such protein-protein interactions with HPRT1 are predicted to be impaired for the long or short forms of ALDH16A1*2. These results lead to the intriguing possibility that association between ALDH16A1 and HPRT1 may be required for optimal HPRT activity with disruption of this interaction possibly contributing to the hyperuricemia seen in ALDH16A1*2 carriers. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Influence of the ABCG2 gout risk 141 K allele on urate metabolism during a fructose challenge.
Dalbeth, Nicola; House, Meaghan E; Gamble, Gregory D; Pool, Bregina; Horne, Anne; Purvis, Lauren; Stewart, Angela; Merriman, Marilyn; Cadzow, Murray; Phipps-Green, Amanda; Merriman, Tony R
2014-01-30
Both genetic variation in ATP-binding cassette sub-family G member 2 (ABCG2) and intake of fructose-containing beverages are major risk factors for hyperuricemia and gout. This study aimed to test the hypothesis that the ABCG2 gout risk allele 141 K promotes the hyperuricaemic response to fructose loading. Healthy volunteers (n = 74) provided serum and urine samples immediately before and 30, 60, 120 and 180 minutes after ingesting a 64 g fructose solution. Data were analyzed based on the presence or absence of the ABCG2 141 K gout risk allele. The 141 K risk allele was present in 23 participants (31%). Overall, serum urate (SU) concentrations during the fructose load were similar in those with and without the 141 K allele (PSNP = 0.15). However, the 141 K allele was associated with a smaller increase in SU following fructose intake (PSNP <0.0001). Those with the 141 K allele also had a smaller increase in serum glucose following the fructose load (PSNP = 0.002). Higher fractional excretion of uric acid (FEUA) at baseline and throughout the fructose load was observed in those with the 141 K risk allele (PSNP <0.0001). However, the change in FEUA in response to fructose was not different in those with and without the 141 K risk allele (PSNP = 0.39). The 141 K allele effects on serum urate and glucose were more pronounced in Polynesian participants and in those with a body mass index ≥25 kg/m². In contrast to the predicted responses for a hyperuricemia/gout risk allele, the 141 K allele is associated with smaller increases in SU and higher FEUA following a fructose load. The results suggest that ABCG2 interacts with extra-renal metabolic pathways in a complex manner to regulate SU and gout risk. The study was registered by the Australian Clinical Trials Registry (ACTRN12610001036000).
Serum Uric Acid Level Predicts Progression of IgA Nephropathy in Females but Not in Males
Shoji, Tatsuya; Shinzawa, Maki; Hasuike, Yukiko; Nagatoya, Katsuyuki; Yamauchi, Atsushi; Hayashi, Terumasa; Kuragano, Takayuki; Moriyama, Toshiki; Isaka, Yoshitaka; Nakanishi, Takeshi
2016-01-01
Background Immunoglobulin A nephropathy (IgAN) is one of most common forms of glomerulonephritis. At this point, the clinical impact of hyperuricemia on IgAN is not clear. The aim of the present study was to explore the clinical impact of hyperuricemia on the progression of IgAN. Study Design Multicenter retrospective cohort study. Setting & Participants 935 IgAN patients who were diagnosed by kidney biopsy at Osaka University Hospital, Osaka General Hospital, and Osaka Rosai Hospital. were included in this study. Predictor Uric acid levels at renal biopsy. Outcomes The outcome of interest was the time from the kidney biopsy to the time when a 50% increase in the baseline serum creatinine level was observed, which was defined as "progression". Measurements The baseline characteristics according to the kidney biopsy at the time of diagnosis were collected from the medical records, and included age, gender, body mass index, hypertension, diabetes (use of antidiabetic drugs), serum levels of creatinine, urinary protein, smoking status, RAAS blockers and steroid therapy. Results An elevated serum uric acid level was an independent risk factor for progression in female patients (per 1.0 mg/dL, multivariate-adjusted incident rate ratio 1.33 [95% confidence interval 1.07, 1.64], P = 0.008) but not in male patients (1.02 [0.81, 1.29], P = 0.855). To control a confounding effect of renal function on an association between serum uric acid level and progression in female patients, age- and serum creatinine-matched and propensity score-matched analyses were performed, and these results also supported the effect by uric acid on kidney disease progression independent of basal kidney function. Limitations A cohort analyzed retorospectively. Conclusions This study revealed that an elevated uric acid level was an independent risk factor for ESKD in female IgAN patients. Therefore, uric acid might be a treatable target in female IgAN patients. PMID:27560997
Ilundain-González, Ana Isabel; Gimeno-Orna, José Antonio; Sáenz-Abad, Daniel; Pons-Dolset, Jordi; Cebollada-Del Hoyo, Jesús; Lahoza-Pérez, María Del Carmen
Hyperuricemia is associated to cardiovascular disease. However, the contribution of uric acid (UA) to cardiovascular mortality in diabetic patients is controversial. To assess the impact of UA levels on the risk of cardiovascular mortality risk in a cohort of patients with type 2 diabetes mellitus (T2DM). A prospective cohort study on outpatients with T2DM. The clinical endpoint was cardiovascular death. Anthropometric, demographic, clinical, and biochemical variables were collected, including UA levels, urinary albumin excretion and estimated glomerular filtration rate. The independent contribution of UA levels to cardiovascular mortality was assessed using multivariate Cox regression models, progressively adjusted for potential confounders. A total of 452 patients with a mean age of 65.9 (SD 9.5) years were enrolled. Mean UA level was 4.2mg/dL. Quartiles of UA levels were Q1 < 3.3; Q2: 3.3-4.2; Q3: 4.3-5.1; Q4 > 5.1mg/dL. UA levels significantly correlated with estimated glomerular filtration rate (Rho=-0.227; p<0.001). During a median follow-up time of 13 years, cardiovascular mortality rates were higher in Q4 of the UA distribution (Q1: 10.7; Q2: 11.7; Q3: 10.7; Q4: 21.6 per 1000 patient-years; p = 0.027). UA was a predictor of cardiovascular mortality in the univariate analysis (HR1mg/dL = 1.30; p=0.002), but not in a multivariate analysis adjusted for urinary albumin excretion and eGFR (HR1mg/dL=1.20; p=0.12). High UA levels are associated to cardiovascular mortality in patients with T2DM. However, the role of UA may be mediated by impaired kidney function in patients with hyperuricemia. Copyright © 2018 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.
Long, Wentong; Panwar, Pankaj; Witkowska, Kate; Wong, Kenneth; O'Neill, Debbie; Chen, Xing-Zhen; Lemieux, M. Joanne; Cheeseman, Chris I.
2015-01-01
High blood urate levels (hyperuricemia) have been found to be a significant risk factor for cardiovascular diseases and inflammatory arthritis, such as hypertension and gout. Human glucose transporter 9 (hSLC2A9) is an essential protein that mainly regulates urate/hexose homeostasis in human kidney and liver. hSLC2A9 is a high affinity-low capacity hexose transporter and a high capacity urate transporter. Our previous studies identified a single hydrophobic residue in trans-membrane domain 7 of class II glucose transporters as a determinant of fructose transport. A mutation of isoleucine 335 to valine (I355V) in hSLC2A9 can reduce fructose transport while not affecting glucose fluxes. This current study demonstrates that the I335V mutant transports urate similarly to the wild type hSLC2A9; however, Ile-335 is necessary for urate/fructose trans-acceleration exchange to occur. Furthermore, Trp-110 is a critical site for urate transport. Two structural models of the class II glucose transporters, hSLC2A9 and hSLC2A5, based on the crystal structure of hSLC2A1 (GLUT1), reveal that Ile-335 (or the homologous Ile-296 in hSLC2A5) is a key component for protein conformational changes when the protein translocates substrates. The hSLC2A9 model also predicted that Trp-110 is a crucial site that could directly interact with urate during transport. Together, these studies confirm that hSLC2A9 transports both urate and fructose, but it interacts with them in different ways. Therefore, this study advances our understanding of how hSLC2A9 mediates urate and fructose transport, providing further information for developing pharmacological agents to treat hyperuricemia and related diseases, such as gout, hypertension, and diabetes. PMID:25922070
Lin, Z M; Zhang, R S; Fan, C X; Liang, Y L; Li, L; Zhao, L; Qu, J C; Xu, X; Zhao, H Y; Liu, X N; Zhu, K S
2017-05-01
Objective: To observe the effect of febuxostat on epithelial-to-mesenchymal transition (EMT) of kidney tubules and the levels of serum IL-6 nad transforming growth factor (TGF)β(1) in hyperuricemic rats. Methods: Forty male SD rats were divided into 4 groups: normal control group (NC group), oteracil potassium group (OP group), oteracil potassium with febuxostat group (OF group) and oteracil potassium with benzbromarone group (OB group). Each group had 10 rats and balanced in body weights. To induce hyperuricemia, rats were given oteracil potassium by gastric gavage once a day for eight weeks. Rats in OF group and OB group were given either febuxostat or benbromarone starting with oteracil potassium, and rats in NC group was given saline only. Blood samples were taken before, and at the end of 4 and 8 weeks of the treatments and serum uric acid, creatinine, blood usea nitrogen(BUN), IL-6 and TGFβ(1) contents were measured at each time point. Renal pathological changes were observed via HE and Masson staining, and the expression of α-SMA and E-cadherin were detected by immunohistochemistry. Results: Compared with those in NC group, the levels of serum uric acid, creatinine, BUN, IL-6 and TGFβ(1) in the another three groups were increased significantly (all P <0.01). However, the IL-6 and TGFβ(1) contents in OF group were much lower than those in OP group ( P <0.01). HE and Masson staining showed that OF group had less damage and tubulointerstitial fibrosis than OP group and OB group ( P <0.01). Moreover, the expression of α-SMA was significantly down-regulated ( P <0.01) and that of E-cadherin was significantly up-regulated in OF group compared with those in OP group. Conclusion: Febuxostat treatment significantly inhibited EMT and reduced the levels of IL-6 and TGFβ(1) in hyperuricemia rats.
Effects of Febuxostat on Oxidative Stress.
Fukui, Toshiki; Maruyama, Mie; Yamauchi, Kazuhiro; Yoshitaka, Sumie; Yasuda, Tadashi; Abe, Youichi
2015-07-01
We previously examined factors that affect the measured derivatives of reactive oxygen metabolites (d-ROMs), an indicator of reactive oxygen species production, and biological antioxidant potential (BAP), an indicator of antioxidant capacity, in typical health checkup examinees and reported the usefulness of measuring both indicators simultaneously. In addition, a positive correlation reportedly exists between d-ROMs and the visceral fat area measured by using computed tomography. A recent study of the relationship between uric acid levels and various obesity-related factors found that visceral fat was the factor most strongly related to uric acid levels. Uric acid is itself a potent endogenous antioxidant, but because reactive oxygen species are produced during uric acid generation, it is suggested that uric acid may have opposing effects. The objective of this study was to analyze the effect of febuxostat, a novel xanthine oxidase inhibitor, on oxidative stress. Study subjects were 43 hyperuricemia outpatients receiving care in the internal medicine department of our institution. The subjects were divided into a new administration group (29 patients) and a switched administration group (14 patients); the latter were allopurinol-treated patients with hyperuricemia who were switched to febuxostat. In addition to measuring the patients' uric acid and creatinine levels and estimated glomerular filtration rate before and after treatment, their d-ROMs and BAP as well as the BAP/d-ROMs ratio were also measured. Both groups exhibited significant decreases in uric acid levels, as well as significant decreases in d-ROMs and BAP. No significant changes were observed in the BAP/dROMs ratio or renal function, including creatinine levels and estimated glomerular filtration rate. Febuxostat could significantly reduce d-ROMs. However, BAP levels were also significantly reduced concurrently. No changes were observed in the BAP/d-ROMs ratios. This regulatory mechanism is believed to have counteracted changes in the in vivo oxidative stress balance caused by febuxostat administration. Copyright © 2015 Elsevier HS Journals, Inc. All rights reserved.
Phytochemical investigation of some traditional chinese medicines and endophyte cultures.
Tan, R X; Meng, J C; Hostettmann, K
2000-01-01
For many social and environmental reasons, over the last few decades, there has been an increase in chronic and life-threatening diseases including mycoses, hyperuricemia-related disorders and some mental illnesses such as depression, anxiety and Parkinson's disease. In order to fight these diseases, compounds acting on various biological targets, including enzymes such as xanthine oxidase or monoamine oxidase, have to be screened. The enzyme xanthine oxidase catalyses the oxidation of hypoxanthine to xanthine and then to uric acid, which plays a crucial role in hyperuricemiarelated disorders such as gout and renal stones. One of the therapeutic approaches to treat these diseases is the use of xanthine oxidase inhibitors that block the production of uric acid. Monoamine oxidases (E.C.1.4.3.4) A and B catalyse the oxidative deamination of monoamines in the central nervous system and peripheral tissues. Inhibitors of MAO A are clinically useful to treat anxiety and depression since they are expected to increase both noradrenalin and serotonin levels in the brain. On the other hand, inhibition of MAO B appears to be an effective approach for the prevention and adjunct treatment of Parkinson's disease. In traditional Chinese medical practice, many medicinal herbs have been used to treat chronic diseases such as fungal infections, hyperuricemia-based disorders and mental illnesses. This usage is indicative for the presumable presence of antifungal phytochemicals and inhibitors of xanthine and monoamine oxidases. Plants do not represent the only source for interesting natural products; some endophytes ('special' microorganisms living inside the healthy host plant) are also known to produce secondary metabolites of promising pharmaceutical and/or agricultural potential. The above observations prompted us to search for natural antifungal compounds and inhibitors of xanthine and monoamine oxidases in different Chinese plants and endophyte cultures. The active constituents isolated were mainly mono-, sesqui-, di-, and triterpenes, sterols, coumarins, flavonoids, phenylethanoids, stilbenoids, alkaloids and alcohols.
Global metabolomic profiling targeting childhood obesity in the Hispanic population.
Butte, Nancy F; Liu, Yan; Zakeri, Issa F; Mohney, Robert P; Mehta, Nitesh; Voruganti, V Saroja; Göring, Harald; Cole, Shelley A; Comuzzie, Anthony G
2015-08-01
Metabolomics may unravel important biological pathways involved in the pathophysiology of childhood obesity. We aimed to 1) identify metabolites that differ significantly between nonobese and obese Hispanic children; 2) collapse metabolites into principal components (PCs) associated with obesity and metabolic risk, specifically hyperinsulinemia, hypertriglyceridemia, hyperleptinemia, and hyperuricemia; and 3) identify metabolites associated with energy expenditure and fat oxidation. This trial was a cross-sectional observational study of metabolomics by using gas chromatography-mass spectrometry and ultrahigh-performance liquid chromatography-tandem mass spectrometry analyses performed on fasting plasma samples from 353 nonobese and 450 obese Hispanic children. Branched-chained amino acids (BCAAs) (Leu, Ile, and Val) and their catabolites, propionylcarnitine and butyrylcarnitine, were significantly elevated in obese children. Strikingly lower lysolipids and dicarboxylated fatty acids were seen in obese children. Steroid derivatives were markedly higher in obese children as were markers of inflammation and oxidative stress. PC6 (BCAAs and aromatic AAs) and PC10 (asparagine, glycine, and serine) made the largest contributions to body mass index, and PC10 and PC12 (acylcarnitines) made the largest contributions to adiposity. Metabolic risk factors and total energy expenditure were associated with PC6, PC9 (AA and tricarboxylic acid cycle metabolites), and PC10. Fat oxidation was inversely related to PC8 (lysolipids) and positively related to PC16 (acylcarnitines). Global metabolomic profiling in nonobese and obese children replicates the increased BCAA and acylcarnitine catabolism and changes in nucleotides, lysolipids, and inflammation markers seen in obese adults; however, a strong signature of reduced fatty acid catabolism and increased steroid derivatives may be unique to obese children. Metabolic flexibility in fuel use observed in obese children may occur through the activation of alternative intermediary pathways. Insulin resistance, hyperleptinemia, hypertriglyceridemia, hyperuricemia, and oxidative stress and inflammation evident in obese children are associated with distinct metabolomic profiles. © 2015 American Society for Nutrition.
Han, Tianshu; Lan, Li; Qu, Rongge; Xu, Qian; Jiang, Ruyue; Na, Lixin; Sun, Changhao
2017-10-01
Although hyperuricemia and insulin resistance significantly correlated, their temporal sequence and how the sequence influence on future risk of hypertension are largely unknown. This study assessed temporal relationship between uric acid and insulin resistance and its impact on future risk of hypertension by examining a longitudinal cohort including 8543 subjects aged 20 to 74 years from China, with an average follow-up of 5.3 years. Measurements of fasting uric acid, as well as fasting and 2-hour serum glucose and insulin, were obtained at baseline and follow-up. Indicators of hepatic and peripheral insulin resistance were calculated. Cross-lagged panel and mediation analysis were used to examine the temporal relationship between uric acid and insulin resistance and its impact on follow-up hypertension. After adjusting for covariates, the cross-lagged path coefficients ( β 1 values) from baseline uric acid to follow-up insulin resistance indices were significantly greater than path coefficients ( β 2 values) from baseline insulin resistance indices to follow-up uric acid ( β 1 =0.110 versus β 2 =0.017; P <0.001, for hepatic insulin resistance; β 1 =-0.208 versus β 2 =-0.021; P <0.001, for peripheral insulin resistance). The path coefficients from baseline uric acid to follow-up insulin resistance indices in the hypertensive group were significantly greater than that in the normotensive group ( P <0.001 for the difference of β 1 values in the 2 groups). Insulin resistance partially mediated the effect of uric acid on subsequent hypertension, and the mediation effect of peripheral insulin resistance was significantly greater than that of hepatic insulin resistance (31.3% versus 13.2%; P <0.001, for the difference of mediation effects). These findings provide evidence that higher uric acid levels probably precede insulin resistance, and peripheral insulin resistance likely plays a more important role in the development of hypertension than hepatic insulin resistance does. © 2017 American Heart Association, Inc.
Mulè, G; Castiglia, A; Morreale, M; Geraci, G; Cusumano, C; Guarino, L; Altieri, D; Panzica, M; Vaccaro, F; Cottone, S
2017-04-01
In experimental investigations conducted in rats, raising serum uric acid (SUA) levels resulted in the stimulation of intrarenal renin expression. Studies in humans exploring the association of SUA with plasma renin activity (PRA) yielded conflicting results. Moreover, little is known about the relationship of SUA with plasma aldosterone concentration (PAC). The study aimed to assess the relationship between SUA levels, PRA, and PAC and the influence of age, gender, body mass index (BMI), and hyperuricemia on these relationships in subjects with essential hypertension (EH). We enrolled 372 hypertensive patients (mean age 45 ± 12 years, men 67%) with uncomplicated EH that was not pharmacologically treated. The study population was divided in tertiles according to SUA levels. While PRA did not differ significantly across the three tertiles, PAC was higher in subjects belonging to the uppermost tertile of SUA than those in the lower ones (p = 0.0429); however, this difference lost statistical significance after adjustment for age, sex, BMI, and serum creatinine. Univariate correlation analyses showed significant associations of SUA with PRA (r = 0.137; p = 0.008) and PAC (r = 0.179; p < 0.001). However, these relationships were not significant after correcting for confounding factors in multiple linear regression analyses. We did not observe statistically significant effect modification by gender, age, BMI, and hyperuricemia. SUA levels are weakly associated with PRA and PAC in adults with untreated EH. These relationships were lost after adjustment for age, sex, BMI, and serum creatinine. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
Vasiliou, Vasilis; Sandoval, Monica; Backos, Donald S.; Jackson, Brian C.; Chen, Ying; Reigan, Philip; Lanaspa, Miguel A.; Johnson, Richard J.; Koppaka, Vindhya; Thompson, David C.
2013-01-01
Gout, a common form of inflammatory arthritis, is strongly associated with elevated uric acid concentrations in the blood (hyperuricemia). A recent study in Icelanders identified a rare missense single nucleotide polymorphism (SNP) in the ALDH16A1 gene, ALDH16A1*2, to be associated with gout and serum uric acid levels. ALDH16A1 is a novel and rather unique member of the ALDH superfamily in relation to its gene and protein structures. ALDH16 genes are present in fish, amphibians, protista, bacteria but absent from archaea, fungi and plants. In most mammalian species, two ALDH16A1 spliced variants (ALDH16A1, long form and ALDH16A1_v2, short form) have been identified and both are expressed in HepG-2, HK-2 and HK-293 human cell lines. The ALDH16 proteins contain two ALDH domains (as opposed to one in the other members of the superfamily), four transmembrane and one coiled-coil domains. The active site of ALDH16 proteins from bacterial, frog and lower animals contain the catalytically important cysteine residue (Cys-302); this residue is absent from the mammalian and fish orthologs. Molecular modeling predicts that both the short and long forms of human ALDH16A1 protein would lack catalytic activity but may interact with the hypoxanthine-guanine phosphoribosyltransferase (HPRT1) protein, a key enzyme involved in uric acid metabolism and gout. Interestingly, such protein-protein interactions with HPRT1 are predicted to be impaired for the long or short forms of ALDH16A1*2. These results lead to the intriguing possibility that association between ALDH16A1 and HPRT1 may be required for optimal HPRT activity with disruption of this interaction possibly contributing to the hyperuricemia seen in ALDH16A1*2 carriers. PMID:23348497
Dong, J; Ni, Y-Q; Chu, X; Liu, Y-Q; Liu, G-X; Zhao, J; Yang, Y-B; Yan, Y-X
2016-02-01
Obesity has become a major health problem in contemporary society and it is closely related to many chronic diseases, so it is an important issue for measuring adiposity accurately and predicting its future. Prevention and treatment of overweight and obesity has become one of the key prevention and treatment of metabolic disorders. In this study, we compared the ability of the four anthropometric indicators (body mass index, waist circumstance, waist-height ratio, waist-to-hip ratio) to identify metabolic disorders (hypertension, hyperlipidaemia, hyperglycemia and hyperuricemia) by receiver operating characteristic (ROC) curve analyses and to provide evidence for clinical practice. In this large scale cross-sectional study, 13,275 Han adults (including 7595 males and 5680 females) received physical examination between January, 2009 and January, 2010 in Xuanwu Hospital of Capital Medical University were investigated by the means of questionnaire, Meanwhile, the physical examination and serological results were recorded. A package known as Statistical Package for Social Scientist (SPSS) was employed to analyse the responses while t-test, one-way analysis of variance (ANOVA), ROC analysis and chi-square statistical methods were used to test the hypotheses. WC, WHtR, WHR and BMI were all significantly (P < 0.001) correlated with all metabolic risk factors regardless of gender. And the area under the curve (AUC) of WHtR was significantly greater than that of WC, BMI or WHR in the prediction of hypertension, hyperlipidaemia, hyperglycemia and hyperuricemia. Our data show that WHtR was the best predictor of various metabolic disorders. The diagnostic value in descending order was WHtR > WHR > WC > BMI. Therefore we recommend WHtR in assessment of obese patients, in order to better assess the risks of their metabolic diseases. Copyright © 2015 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Yang, Qingmei; Fu, Chensheng; Xiao, Jing; Ye, Zhibin
2018-01-01
Adiponectin (APN) is a protein hormone that is primarily derived from adipocytes. It can also be secreted by renal cells. Hypoadiponectinemia has been documented in patients with hyperuricemia, however, whether soluble uric acid (SUA) regulates the expression of APN and APN receptor 1 (AdipoR1) in renal proximal tubule epithelial cells (PTECs) remains to be elucidated. The present study investigated the expression of APN and AdipoR1 in cultured PTECs that were exposed to SUA through immunofluorescence and western blot analysis. In addition, Sprague-Dawley rats with oxonic acid-induced hyperuricemia (HUA) with or without febuxostat treatment were employed as an animal model to measure 24 h urine protein, serum creatinine, urea nitrogen, uric acid and homeostasis model assessment of insulin resistance. Renal pathology was evaluated using hematoxylin and eosin and immunohistochemical staining. APN and AdipoR1 expression in the renal cortex were evaluated by western blotting. The results demonstrated that, in PTECs, the expression of APN and AdipoR1 was constant and increased upon SUA exposure. Similar observations were made within the proximal renal tubules of rats, and the oxonic acid-induced increases in APN and AdipoR1 were offset by febuxostat treatment. Furthermore, SUA-treated PTECs exhibited an increase in the expression of NLR family pyrin domain-containing (NLRP) 3, which was dose-dependent. NLRP3 expression was also significantly increased in the renal cortex of HUA rats compared with control and febuxostat-treated rats. In conclusion, SUA enhanced the expression of APN and AdipoR1 in PTECs, which was associated with an increase in NLRP3 expression. The APN-AdipoR1 pathway was demonstrated to have an important role in in vitro and in vivo models of renal proximal tubule inflammatory injury. Therefore, this pathway may be a potential therapy target in urate nephropathy. PMID:29359786
Alasia, D D; Emem-Chioma, P C; Wokoma, F S
2010-10-01
The presence of hyperuricemia and renal function impairment, especially in the absence of urate stone formation is strongly suggestive of lead nephropathy. The evaluation of this association is essential in areas where lead exposure is still prevalent and uncontrolled. To determine the relationship between serum uric acid and renal function indices in lead-exposed workers. A cross-sectional study of 190 adults with occupational lead exposure and 80 adults (comparison group), matched for age and sex was performed in Port Harcourt, South-south Nigeria. Blood lead was used as the biomarker of lead exposure while serum urea, serum creatinine, urine albumin (using urine albumin:creatinine ratio), estimated glomerular filtration rate (GFR) and serum uric acid were the renal function indices measured. Occupationally lead-exposed subjects had a significantly (p = 0.008) higher mean±SD blood lead levels (50.37±24.58 μg/dL) than the comparison group (41.40±26.85). The mean±SD serum urea (8.6±2.3 mg/dL), creatinine (1.0±0.2 mg/dL) and serum uric acid (4.6±1.2 mg/dL) were significantly (p < 0.01) higher in the study subjects than the comparison group (7.6±2.4, 0.9±0.2, and 3.9±1.1 mg/dL, respectively). The mean±SD creatinine clearance was significantly (p = 0.002) lower in the study subjects than the comparison group (98.9±21.3 vs. 108.2±25.2 mL/min/1.72 m2). Serum uric acid level correlated positively with serum creatinine (r = 0.134) and negatively with GFR (r = -0.151). People with occupational lead exposure are at risk of developing hyperuricemia and renal impairment.
Enzi, G; Busetto, L; Inelmen, E M; Coin, A; Sergi, G
2003-04-01
In recent years, advances in epidemiological approaches and laboratory technology, along with the availability of sophisticated imaging methods to evaluate body fat distribution, made it possible to define the close correlation between visceral fat accumulation and the occurrence of metabolic abnormalities, cardiovascular diseases and respiratory disturbances in obese patients. Some 250 y ago, JB Morgagni with the help of only a knife for anatomical dissection, an acute mind, and an observational skillfulness was able to identify the intra-abdominal and mediastinal fat accumulation in android obesity. He clearly described the association between visceral obesity, hypertension, hyperuricemia, atherosclerosis and obstructive sleep apnea syndrome, long before the modern recognition of this syndrome.
ABCG2 variant has opposing effects on onset ages of Parkinson's disease and gout
Matsuo, Hirotaka; Tomiyama, Hiroyuki; Satake, Wataru; Chiba, Toshinori; Onoue, Hiroyuki; Kawamura, Yusuke; Nakayama, Akiyoshi; Shimizu, Seiko; Sakiyama, Masayuki; Funayama, Manabu; Nishioka, Kenya; Shimizu, Toru; Kaida, Kenichi; Kamakura, Keiko; Toda, Tatsushi; Hattori, Nobutaka; Shinomiya, Nariyoshi
2015-01-01
Uric acid (urate) has been suggested to play a protective role in Parkinson's disease onset through its antioxidant activity. Dysfunction of ABCG2, a high-capacity urate exporter, is a major cause for early-onset gout based on hyperuricemia. In this study, the effects of a dysfunctional ABCG2 variant (Q141K, rs2231142) were analyzed on the ages at onset of gout patients (N = 507) and Parkinson's disease patients (N = 1015). The Q141K variant hastened the gout onset (P = 0.0027), but significantly associated with later Parkinson's disease onset (P = 0.025). Our findings will be helpful for development of more effective prevention of Parkinson's disease. PMID:25815357
A case of Werner's syndrome associated with osteosarcoma.
Murata, K; Hatamochi, A; Shinkai, H; Ishikawa, Y; Kawaguchi, N; Goto, M
1999-10-01
We described a case of Werner's syndrome associated with osteosarcoma. A 37-year-old Japanese man was diagnosed as having Werner's syndrome by the presence of juvenile cataracts, skin sclerosis and hyperpigmentation of the feet, high-pitched voice, characteristic bird-like appearance of the face with beak-shaped nose, thinning of the entire skin and hyperkeratoses on soles, hyperlipemia, hyperuricemia, diabetes melitus, and the mutated responsible gene (WRN). He had a 3-month history of a tumor on his left forearm. Histologically, the tumor included four histological patterns; a malignant fibrous histiocytoma-like, a desmoid-like, a dermatofibrosarcoma protuberans-like, and a chondrosarcoma-like pattern. Tumoral osteoid formation was also found in the tumor. Therefore, the tumor was diagnosed as osteosarcoma.
ABCG2 variant has opposing effects on onset ages of Parkinson's disease and gout.
Matsuo, Hirotaka; Tomiyama, Hiroyuki; Satake, Wataru; Chiba, Toshinori; Onoue, Hiroyuki; Kawamura, Yusuke; Nakayama, Akiyoshi; Shimizu, Seiko; Sakiyama, Masayuki; Funayama, Manabu; Nishioka, Kenya; Shimizu, Toru; Kaida, Kenichi; Kamakura, Keiko; Toda, Tatsushi; Hattori, Nobutaka; Shinomiya, Nariyoshi
2015-03-01
Uric acid (urate) has been suggested to play a protective role in Parkinson's disease onset through its antioxidant activity. Dysfunction of ABCG2, a high-capacity urate exporter, is a major cause for early-onset gout based on hyperuricemia. In this study, the effects of a dysfunctional ABCG2 variant (Q141K, rs2231142) were analyzed on the ages at onset of gout patients (N = 507) and Parkinson's disease patients (N = 1015). The Q141K variant hastened the gout onset (P = 0.0027), but significantly associated with later Parkinson's disease onset (P = 0.025). Our findings will be helpful for development of more effective prevention of Parkinson's disease.
González-Rozas, M; Prieto de Paula, J M; Franco Hidalgo, S; López Pedreira, M R
2013-09-01
Gout is a common illness, usually of unknown etiology, is more frequent in men, and with a prevalence that increases with age. It is characterized by recurrent episodes of acute arthritis due to the deposition of monosodium urate crystals in joints. The underlying disorder in most cases is hyperuricemia, usually as a consequence of impairment in its renal excretion. Although it is generally believed that both the diagnosis and treatment are simple, the truth is that the level of adherence of clinical decisions using the existing guidelines is poor. We describe a case of chronic tophaceous gout, and review the general characteristics of this condition. Copyright © 2011 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.
Natural Products for Antithrombosis
Chen, Cen; Zhang, Qian; Wang, Feng-Qin; Hu, Yuan-Jia; Xia, Zhi-Ning
2015-01-01
Thrombosis is considered to be closely related to several diseases such as atherosclerosis, ischemic heart disease and stroke, as well as rheumatoid arthritis, hyperuricemia, and various inflammatory conditions. More and more studies have been focused on understanding the mechanism of molecular and cellular basis of thrombus formation as well as preventing thrombosis for the treatment of thrombotic diseases. In reality, there is considerable interest in the role of natural products and their bioactive components in the prevention and treatment of thrombosis related disorders. This paper briefly describes the mechanisms of thrombus formation on three aspects, including coagulation system, platelet activation, and aggregation, and change of blood flow conditions. Furthermore, the natural products for antithrombosis by anticoagulation, antiplatelet aggregation, and fibrinolysis were summarized, respectively. PMID:26075003
New developments in the epidemiology and genetics of gout.
Zaka, Raihana; Williams, Charlene J
2006-06-01
The prevalence of gout appears to be rapidly increasing worldwide and is no longer a disorder suffered primarily by over-fed alcohol consumers. Emerging risk factors include longevity, metabolic syndrome, and new classes of pharmacologic agents. In some ethnic populations, no obvious risk factors can explain the high incidence of hyperuricemia and gout, suggesting a genetic liability. Studies to identify genes associated with gout have included families with defects in purine metabolism, as well as families in whom the occurrence of gout is secondary to renal disorders such as juvenile hyperuricemic nephropathy and medullary cystic kidney disease. Case-control studies of isolated aboriginal cohorts suffering from primary gout have revealed several chromosomal loci that may harbor genes that are important to the development and/or progression of gout.
Febuxostat hypersensitivity: another cause of DRESS syndrome in chronic kidney disease?
Paschou, E; Gavriilaki, E; Papaioannou, G; Tsompanakou, A; Kalaitzoglou, A; Sabanis, N
2016-11-01
Febuxostat is a xanthine oxidase inhibitor that during the last years has successfully replaced allopurinol treatment in patients with chronic kidney disease (CKD) and hyperuricemia. Several adverse events have been observed during therapy with febuxostat. DRESS (Drug Reaction with Eosinophilia and Systemic Symptoms) syndrome induced by febuxostat has been poorly described, mainly in patient with CKD who previously developed allopurinol hypersensitivity syndrome. DRESS syndrome is characterized by manifold cutaneous reactions and systemic disorders with potential devastating consequences. The underlying pathogenetic mechanisms remain unidentified, though immune responses are often complicated. P-i concept can partially explain the phenomenon. The role of renal insufficiency appears to be crucial and further investigation is required. The present article describes the case of a CKD patient that developed febuxostat-related DRESS syndrome.
Effects of hypervitaminosis of vitamin B3 on silkworm biology.
Etebari, Kayvan; Matindoost, Leila
2004-12-01
A high-dose of vitamin B(3) in silkworm diet interrupts larval feeding and normal growth. High mortality of larvae occurs during molting and they cannot complete this process normally. Also the larvae exhibit nicotinamide hypervitaminosis symptoms such as immobility, dyspepsia, darkening of the skin, inability to excrete normally, exerting brownish fluid from anus and swelling of rectal muscles. Maximum larval weights in 1, 2 and 3 g/l treatments were 2.9, 1.6 and 1.2 g respectively, while maximum larval weight in the control was 5.6 g. Larval stage compared to control had increased 18, 26 and 31 days respectively. The concentration increase of uric acid in haemolymph demonstrates the hyperuricemia, while other measured biochemical compounds show significant decrease; sodium and potassium did not change significantly.
de Albuquerque Ugoline, Bruno César; de Souza, Jacqueline; Ferrari, Fernanda Cristina; Ferraz-Filha, Zilma Schimith; Coelho, Grazielle Brandão; Saúde-Guimarães, Dênia Antunes
2017-02-23
Lychnophora passerina (Mart ex DC) Gardn (Asteraceae), popularly known as Brazilian arnica, is used in Brazilian folk medicine to treat pain, rheumatism, bruises, inflammatory diseases and insect bites. Investigate the influence of the seasons on the anti-inflammatory and anti-hyperuricemic activities of ethanolic extract of L. passerina and the ratio of the goyazensolide content, main chemical constituent of the ethanolic extract, with these activities. Ethanolic extracts of aerial parts of L. passerina were obtained from seasons: summer (ES), autumn (EA), winter (EW) and spring (EP). The sesquiterpene lactone goyazensolide, major metabolite, was quantified in ES, EA, EW and EP by a developed and validated HPLC-DAD method. The in vivo anti-hyperuricemic and anti-inflammatory effects of the ethanolic extracts from L. passerina and goyazensolide were assayed on experimental model of oxonate-induced hyperuricemia in mice, liver xanthine oxidase (XOD) inhibition and on carrageenan-induced paw edema in mice. HPLC method using aqueous solution of acetic acid 0.01% (v/v) and acetonitrile with acetic acid 0.01% (v/v) as a mobile phase in a gradient system, with coumarin as an internal standard and DAD detection at 270nm was developed. The validation parameters showed linearity in a range within 10.0-150.0µg/ml, with intraday and interday precisions a range of 0.61-3.82. The accuracy values of intraday and interday analysis within 87.58-100.95%. EA showed the highest goyazensolide content. From the third to the sixth hour after injection of carrageenan, treatments with all extracts at the dose of 125mg/kg were able to reduce edema. Goyazensolide (10mg/kg) showed significant reduction of paw swelling from the second hour assay. This sesquiterpene lactone was more active than extracts and presented similar effect to indomethacin. Treatments with ES, EA and EP (125mg/kg) and goyazensolide (10mg/kg) reduced serum urate levels compared to hyperuricemic control group and were able to inhibit liver XOD activity. One of the mechanisms by which ES, EA, EP and goyazensolide exercise their anti-hyperuricemic effect is by the inhibition of liver XOD activity. Goyazensolide was identified as the main compound present in ES, EA, EW and EP and it is shown to be one of the chemical constituents responsible for the anti-inflammatory and anti-hyperuricemic effects of the ethanolic extracts. The anti-inflammatory and anti-hyperuricemic activities of the ethanolic extracts from L. passerina were not proportionally influenced by the variation of goyazensolide content throughout the seasons. The involvement of goyazensolide on in vivo anti-inflammatory and anti-hyperuricemic activities of L.passerina extracts was confirmed, as well as the possibility of participation of other constituents on these effects. This study demonstrated that the aerial parts of L. passerina may be collected in any season for use as anti-inflammatory agent. For use in hyperuricemia, the best seasons for the collection are summer, autumn and spring. The ethanolic extract of L. passerina and goyazensolide can be considered promising agents in the therapeutic of inflammation, hyperuricemia and gout. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Zgaga, Lina; Theodoratou, Evropi; Kyle, Janet; Farrington, Susan M.; Agakov, Felix; Tenesa, Albert; Walker, Marion; McNeill, Geraldine; Wright, Alan F.; Rudan, Igor; Dunlop, Malcolm G.; Campbell, Harry
2012-01-01
Introduction Hyperuricemia is a strong risk factor for gout. The incidence of gout and hyperuricemia has increased recently, which is thought to be, in part, due to changes in diet and lifestyle. Objective of this study was to investigate the association between plasma urate concentration and: a) food items: dairy, sugar-sweetened beverages (SSB) and purine-rich vegetables; b) related nutrients: lactose, calcium and fructose. Methods A total of 2,076 healthy participants (44% female) from a population-based case-control study in Scotland (1999–2006) were included in this study. Dietary data was collected using a semi-quantitative food frequency questionnaire (FFQ). Nutrient intake was calculated using FFQ and composition of foods information. Urate concentration was measured in plasma. Results Mean urate concentration was 283.8±72.1 mmol/dL (females: 260.1±68.9 mmol/dL and males: 302.3±69.2 mmol/dL). Using multivariate regression analysis we found that dairy, calcium and lactose intakes were inversely associated with urate (p = 0.008, p = 0.003, p = 0.0007, respectively). Overall SSB consumption was positively associated with urate (p = 0.008), however, energy-adjusted fructose intake was not associated with urate (p = 0.66). The intake of purine-rich vegetables was not associated to plasma urate (p = 0.38). Conclusions Our results suggest that limiting purine-rich vegetables intake for lowering plasma urate may be ineffectual, despite current recommendations. Although a positive association between plasma urate and SSB consumption was found, there was no association with fructose intake, suggesting that fructose is not the causal agent underlying the SSB-urate association. The abundant evidence supporting the inverse association between plasma urate concentration and dairy consumption should be reflected in dietary guidelines for hyperuricemic individuals and gout patients. Further research is needed to establish which nutrients and food products influence plasma urate concentration, to inform the development of evidence-based dietary guidelines. PMID:22701608
Prevalence and Risk Factors of CKD in Chinese Patients with Periodontal Disease
Chen, Wei; Liang, Mengjun; Luo, Wei; Wu, Xianfeng; Ruan, Yiping; Wang, Jie; Xu, Ricong; Zhan, Xiaojiang; Yu, Jianwen; Tan, Jiaqing; Dong, Xiuqing; Zhang, Jincai; Yu, Xueqing
2013-01-01
Background Periodontal disease is common among adults and is associated with an increasing risk of chronic kidney disease (CKD). We aimed to investigate the prevalence and risk factors of CKD in patients with periodontal disease in China. Methods In the current cross-sectional study, patients with periodontal disease were included from Guangdong Provincial Stomatological Hospital between March 2011 and August 2011. CKD was defined as estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m2, the presence of albuminuria, or hematuria. All patients with periodontal disease underwent a periodontal examination, including periodontal probing pocket depth, gingival recession, and clinical attachment level by Florida Probe. They completed a questionnaire and had blood and urine samples taken. The adjusted prevalence of indicators of kidney damage was calculated and risk factors associated with CKD were analyzed. Results A total of 1392 patients with periodontal disease were invited to participate this study and 1268 completed the survey and examination. After adjusting for age and sex, the prevalence of reduced eGFR, albuminuria, and hematuria was 2.7% (95% CI 1.7–3.7), 6.7% (95% CI 5.5–8.1) and 10.9% (95% CI 9.2–12.5), respectively. The adjusted prevalence of CKD was 18.2% (95% CI 16.2–20.3). Age, male, diabetes, hypertension, history of CKD, hyperuricemia, and interleukin-6 levels (≥7.54 ng/L) were independent risk factors for reduced eGFR. Female, diabetes, hypertension, history of CKD, hyperuricemia, high level of cholesterol, and high sensitivity C-reactive protein (hsCRP) (≥1.03 mg/L) and TNF-α levels (≥1.12 ng/L) were independently associated with an increased risk of albuminuria. Female, lower education (
Mahor, Durga; Priyanka, Anu; Prasad, Gandham S; Thakur, Krishan Gopal
2016-01-01
Consumption of foods and beverages with high purine content increases the risk of hyperuricemia, which causes gout and can lead to cardiovascular, renal, and other metabolic disorders. As patients often find dietary restrictions challenging, enzymatically lowering purine content in popular foods and beverages offers a safe and attractive strategy to control hyperuricemia. Here, we report structurally and functionally characterized purine nucleoside phosphorylase (PNP) from Kluyveromyces lactis (KlacPNP), a key enzyme involved in the purine degradation pathway. We report a 1.97 Å resolution crystal structure of homotrimeric KlacPNP with an intrinsically bound hypoxanthine in the active site. KlacPNP belongs to the nucleoside phosphorylase-I (NP-I) family, and it specifically utilizes 6-oxopurine substrates in the following order: inosine > guanosine > xanthosine, but is inactive towards adenosine. To engineer enzymes with broad substrate specificity, we created two point variants, KlacPNPN256D and KlacPNPN256E, by replacing the catalytically active Asn256 with Asp and Glu, respectively, based on structural and comparative sequence analysis. KlacPNPN256D not only displayed broad substrate specificity by utilizing both 6-oxopurines and 6-aminopurines in the order adenosine > inosine > xanthosine > guanosine, but also displayed reversal of substrate specificity. In contrast, KlacPNPN256E was highly specific to inosine and could not utilize other tested substrates. Beer consumption is associated with increased risk of developing gout, owing to its high purine content. Here, we demonstrate that KlacPNP and KlacPNPN256D could be used to catalyze a key reaction involved in lowering beer purine content. Biochemical properties of these enzymes such as activity across a wide pH range, optimum activity at about 25°C, and stability for months at about 8°C, make them suitable candidates for food and beverage industries. Since KlacPNPN256D has broad substrate specificity, a combination of engineered KlacPNP and other enzymes involved in purine degradation could effectively lower the purine content in foods and beverages. PMID:27768715
Carrillo, Elena; Lomas, Amparo; Pinés, Pedro J; Lamas, Cristina
2017-01-01
Mutations in hepatocyte nuclear factor 1β gene ( HNF1B ) are responsible for a multisystemic syndrome where monogenic diabetes (classically known as MODY 5) and renal anomalies, mostly cysts, are the most characteristic findings. Urogenital malformations, altered liver function tests, hypomagnesemia or hyperuricemia and gout are also part of the syndrome. Diabetes in these patients usually requires early insulinization. We present the case of a young non-obese male patient with a personal history of renal multicystic dysplasia and a debut of diabetes during adolescence with simple hyperglycemia, negative pancreatic autoimmunity and detectable C-peptide levels. He also presented epididymal and seminal vesicle cysts, hypertransaminasemia, hyperuricemia and low magnesium levels. In the light of these facts we considered the possibility of a HNF1B mutation. The sequencing study of this gene confirmed a heterozygous mutation leading to a truncated and less functional protein. Genetic studies of his relatives were negative; consequently, it was classified as a de novo mutation. In particular, our patient maintained good control of his diabetes on oral antidiabetic agents for a long period of time. He eventually needed insulinization although oral therapy was continued alongside, allowing reduction of prandial insulin requirements. The real prevalence of mutations in HNF1B is probably underestimated owing to a wide phenotypical variability. As endocrinologists, we should consider this possibility in young non-obese diabetic patients with a history of chronic non-diabetic nephropathy, especially in the presence of some of the other characteristic manifestations. HNF1B mutations are a rare cause of monogenic diabetes, often being a part of a multisystemic syndrome.The combination of young-onset diabetes and genitourinary anomalies with slowly progressive nephropathy of non-diabetic origin in non-obese subjects should rise the suspicion of such occurrence. A family history may not be present.Once diagnosis is made, treatment of diabetes with oral agents is worth trying, since the response can be sustained for a longer period than the one usually described. Oral treatment can help postpone insulinization and, once this is necessary, can help reduce the required doses.
Kalil, Roberto S; Carpenter, Myra A; Ivanova, Anastasia; Gravens-Mueller, Lisa; John, Alin A; Weir, Matthew R; Pesavento, Todd; Bostom, Andrew G; Pfeffer, Marc A; Hunsicker, Lawrence G
2017-12-01
Elevated uric acid concentration is associated with higher rates of cardiovascular (CV) morbidity and mortality in the general population. It is not known whether hyperuricemia increases the risk for CV death or transplant failure in kidney transplant recipients. Post hoc cohort analysis of the FAVORIT Study, a randomized controlled trial that examined the effect of homocysteine-lowering vitamins on CV disease in kidney transplantation. Adult recipients of kidney transplants in the United States, Canada, or Brazil participating in the FAVORIT Study, with hyperhomocysteinemia, stable kidney function, and no known history of CV disease. Uric acid concentration. The primary end point was a composite of CV events. Secondary end points were all-cause mortality and transplant failure. Risk factors included in statistical models were age, sex, race, country, treatment assignment, smoking history, body mass index, presence of diabetes mellitus, history of CV disease, blood pressure, estimated glomerular filtration rate (eGFR), donor type, transplant vintage, lipid concentrations, albumin-creatinine ratio, and uric acid concentration. Cox proportional hazards models were fit to examine the association of uric acid concentration with study end points after risk adjustment. 3,512 of 4,110 FAVORIT participants with baseline uric acid concentrations were studied. Median follow-up was 3.9 (IQR, 3.0-5.3) years. 503 patients had a primary CV event, 401 died, and 287 had transplant failure. In unadjusted analyses, uric acid concentration was significantly related to each outcome. Uric acid concentration was also strongly associated with eGFR. The relationship between uric acid concentration and study end points was no longer significant in fully adjusted multivariable models (P=0.5 for CV events; P=0.09 for death, and P=0.1 for transplant failure). Unknown use of uric acid-lowering agents among study participants. Following kidney transplantation, uric acid concentrations are not independently associated with CV events, mortality, or transplant failure. The strong association between uric acid concentrations with traditional risk factors and eGFR is a possible explanation. Copyright © 2017 National Kidney Foundation, Inc. All rights reserved.
Kennedy, LeAnne D; Koontz, Susannah; Rao, Kamakshi
2011-01-01
Tumor lysis syndrome (TLS) is defined as a group of metabolic derangements that result from the massive and abrupt release of cellular components into the bloodstream after rapid lysis of tumor cells. Breakdown of released materials leads to a number of electrolyte abnormalities, including elevated uric acid concentrations in the blood (hyperuricemia), which carries potentially serious consequences. The diagnosis, prevention, and management of TLS is complicated by variability in definitions, differences in risk factors based on patient- and tumor-specific characteristics, and practitioner preferences in terms of pharmaceutical management strategies. The best prevention and management option for a particular patient depends on the patient’s baseline risk for TLS development, the severity of symptoms in the event of TLS development, practical management considerations, and financial implications of treatment. PMID:22287858
Febuxostat for the chronic management of hyperuricemia in patients with gout.
Chinchilla, Sandra Pamela; Urionaguena, Irati; Perez-Ruiz, Fernando
2016-01-01
Febuxostat is a non-purine, selective inhibitor of both isoforms of xanthine oxido-reductase (XOR), and a major alternative to the scarce number of urate-lowering medications available in the last decades. Its inhibition of XOR is more potent than allopurinol in a mg to mg comparison, what is associated to achievement of serum urate target more frequently than allopurinol at doses tested in clinical trials, especially in patients with the highest baseline serum urate levels. Its pharmacokinetics is not greatly dependent on renal clearance, contrary to allopurinol, what may be an advantage in patients with chronic kidney disease. Several trials are further evaluating both the cardiovascular safety of febuxostat and its possible beneficial effect on renal function preservation. Still scarce, but clinically interesting, evidence on its use in transplant patients has been recently released.
Saponins from sea cucumber and their biological activities.
Zhao, Yingcai; Xue, Changhu; Zhang, Tiantian; Wang, YuMing
2018-06-22
Sea cucumbers, belonging to the phylum Echinodermata, have been valued for centuries as a nutritious and functional food with various bioactivities. Sea cucumbers can produce highly active substances, notably saponins, the main secondary metabolites, which are the basis of their chemical defense. The saponins are mostly triterpene glycosides with triterpenes or steroid in aglycone, which possess multiple biological properties including anti-tumor, hypolipidemic activity, improvement of nonalcoholic fatty liver, inhibition of fat accumulation, anti-hyperuricemia, promotion of bone marrow hematopoiesis, anti-hypertension, etc. Sea cucumber saponins have received attention due to their rich sources, low toxicity, high efficiency, and few side effects. This review summarizes current research on the structure and activities of sea cucumber saponins based on the physiological and pharmacological activities from source, experimental models, efficacy and mechanisms, which may provide a valuable reference for the development of sea cucumber saponins.
[A case of rhabdomyolysis caused by saw palmetto of healthy foods].
Hanaka, Minako; Yoshii, Chiharu; Yatera, Kazuhiro; Ito, Chiyo; Chojin, Yasuo; Nagata, Shuya; Yamasaki, Kei; Nishida, Chinatsu; Kawanami, Toshinori; Kawanami, Yukiko; Ishimoto, Hiroshi; Mukae, Hiroshi
2012-06-01
An 82-year-old man visited our hospital when he developed a fever of over 38 degrees C after having consumed 5 types of health foods. He had previously been treated for chronic obstructive pulmonary disease, hypertension and hyperuricemia. Blood examination on admission revealed renal dysfunction, marked elevation of C-reactive protein, and an elevated level of serum creatine kinase. According to the laboratory data and his clinical history, rhabdomyolysis complicated by acute renal failure was suspected, but his condition improved and his fever was reduced with fluid infusion. As a drug lymphocyte stimulation test was positive for only saw palmetto in the 5 health foods, we diagnosed the case as rhabdomyolysis induced by saw palmetto. We believe that this is the first case of a health food being the cause of rhabdomyolysis.
Maarman, Gerald J.; Ojuka, Edward
2016-01-01
The consumption of fructose, a major constituent of the modern diet, has raised increasing concern about the effects of fructose on health. Research suggests that excessive intake of fructose (>50 g/d) causes hyperuricemia, insulin resistance, mitochondrial dysfunction, de novo lipogenesis by the liver, and increased production of reactive oxygen species (ROS) in muscle. In a number of tissues, uric acid has been shown to stimulate the production of ROS via activation of transforming growth factor β1 and NADPH (nicotinamide adenine dinucleotide phosphate) oxidase 4. The role of uric acid in fructose-induced production of ROS in skeletal muscle, however, has not been investigated. This review examines the evidence for fructose-induced production of ROS in skeletal muscle, highlights proposed mechanisms, and identifies gaps in current knowledge. PMID:26946251
Choi, Hyon
2014-01-01
Synopsis Gout is the most prevalent inflammatory arthritis in men. The findings of several epidemiological studies from a diverse range of countries suggest that the prevalence of gout has risen over the last few decades. Whilst incidence data are scarce, data from the US suggests that the incidence of gout is also rising. Evidence from prospective epidemiological studies has confirmed dietary factors (animal purines, alcohol and fructose), obesity, the metabolic syndrome, hypertension, diuretic use, and chronic kidney disease as clinically relevant risk factors for hyperuricemia and gout. Low-fat dairy products, coffee, and vitamin C appear to have a protective effect. Further prospective studies are required to examine other proposed risk factors for hyperuricaemia and gout such as the use of β-blockers and angiotension-II receptor antagonists (other than losartan), obstructive sleep apnoea, and osteoarthritis, and putative protective factors such as calcium-channel blockers and losartan. PMID:24703341
PACHER, PÁL; NIVOROZHKIN, ALEX; SZABÓ, CSABA
2008-01-01
The prototypical xanthine oxidase (XO) inhibitor allopurinol, has been the cornerstone of the clinical management of gout and conditions associated with hyperuricemia for several decades. More recent data indicate that XO also plays an important role in various forms of ischemic and other types of tissue and vascular injuries, inflammatory diseases, and chronic heart failure. Allopurinol and its active metabolite oxypurinol showed considerable promise in the treatment of these conditions both in experimental animals and in small-scale human clinical trials. Although some of the beneficial effects of these compounds may be unrelated to the inhibition of the XO, the encouraging findings rekindled significant interest in the development of additional, novel series of XO inhibitors for various therapeutic indications. Here we present a critical overview of the effects of XO inhibitors in various pathophysiological conditions and also review the various emerging therapeutic strategies offered by this approach. PMID:16507884
Rank in Self-Defense Forces and risk factors for atherosclerotic disease.
Sakuta, Hidenari; Suzuki, Takashi
2005-10-01
Socioeconomic status is associated with prevalence of and risk for atherosclerotic disease. We investigated the relationship between rank in the Self-Defense Forces (SDFs) and risk factors for atherosclerotic disease among middle-aged, male, SDFs personnel. Subjects were classified into five groups according to their ranks in the SDFs, i.e., class 1 (lowest, n = 289), class 2 (low, n = 170), class 3 (middle, n = 229), class 4 (high, n = 197), and class 5 (highest, n = 89). Low rank was associated with current cigarette smoking, alcohol abstaining, and poorer vegetable consumption. It was also associated with prevalence of type 2 diabetes, elevated gamma-glutamyltransferase activity, and high white blood cell counts. Prevalence of obesity, hypertension, hypercholesterolemia, hypertriglyceridemia, or hyperuricemia was not associated with rank in this population. Rank may be regarded as one of the markers that reflect individual health states among middle-aged male personnel.
Nishizawa, Tohru; Taniura, Takehito; Nomura, Shosaku
2015-12-01
Platelet-derived microparticles (PDMPs) and adiponectin play an important role in the development of atherothrombosis. We investigated the effect of febuxostat on circulating PDMP levels and adiponectin in hyperuricemic patients. Levels of PDMP and biomarkers were measured using an ELISA at baseline and after 2 and 6 months of treatment. Plasma levels of PDMPs and biomarkers were higher, while those of adiponectin were lower in hyperuricemic patients than in normouricemic controls. Uric acid and interleukin (IL)-6 levels decreased significantly in hyperuricemic patients after 2 months of febuxostat treatment. However, PDMP and biomarkers decreased significantly in hyperuricemic patients after only 6 months of febuxostat treatment and adiponectin increased significantly. These results suggest that the effects of febuxostat for PDMPs seen may be the effect on xanthine oxidase but not the decrease of uric acid, and febuxostat may be beneficial for primary prevention of atherothrombosis in hyperuricemic patients.
Adiponectin as a routine clinical biomarker.
Kishida, Ken; Funahashi, Tohru; Shimomura, Iichiro
2014-01-01
Adiponectin is a protein synthesized and secreted predominantly by adipocytes into the peripheral blood. However, circulating adiponectin level is inversely related with body weight, especially visceral fat accumulation. The mechanism of this paradoxical relation remains obscure. Low circulating adiponectin concentrations (hypoadiponectinemia; <4 μg/mL) are associated with a variety of diseases, including dysmetabolism (type 2 diabetes, insulin resistance, hypertension, dyslipidemia, metabolic syndrome, hyperuricemia), atherosclerosis (coronary artery disease, stroke, peripheral artery disease), sleep apnea, non-alcoholic fatty liver disease, gastritis and gastro-esophageal reflux disease, inflammatory bowel diseases, pancreatitis, osteoporosis, and cancer (endometrial cancer, postmenopausal breast cancer, leukemia, colon cancer, gastric cancer, prostate cancer). On the other hand, hyperadiponectinemia is associated with cardiac, renal and pulmonary diseases. This review article focuses on the significance of adiponectin as a clinical biomarker of obesity-related diseases. Routine measurement of adiponectin in patients with lifestyle-related diseases is highly recommended. Copyright © 2013 Elsevier Ltd. All rights reserved.
Does Altered Uric Acid Metabolism Contribute to Diabetic Kidney Disease Pathophysiology?
Gul, Ambreen; Zager, Philip
2018-03-01
Multiple experimental and clinical studies have identified pathways by which uric acid may facilitate the development and progression of chronic kidney disease (CKD) in people with diabetes. However, it remains uncertain if the association of uric acid with CKD represents a pathogenic effect or merely reflects renal impairment. In contrast to many published reports, a recent Mendelian randomization study did not identify a causal link between uric acid and CKD in people with type 1 diabetes. Two recent multicenter randomized control trials, Preventing Early Renal Function Loss in Diabetes (PERL) and FEbuxostat versus placebo rAndomized controlled Trial regarding reduced renal function in patients with Hyperuricemia complicated by chRonic kidney disease stage 3 (FEATHER), were recently designed to assess if uric acid lowering slows progression of CKD. We review the evidence supporting a role for uric acid in the pathogenesis of CKD in people with diabetes and the putative benefits of uric acid lowering.
Keenan, Robert T
2017-02-01
This article outlines several important issues regarding the management of patients with gout. The topics discussed include best practices for gout based on the most current guidelines, opportunities for improving gout management, and current and emerging therapies for gout. [PubMed and Google Scholar databases] were search for all articles and trials published before 2016, using the key terms [hyperuricemia, gout, tophi, joint erosion, joint damage, treatment guidelines, American College of Rheumatology (ACR), European League Against Rheumatism (EULAR), flare, comorbidity, epidemiology, adherence, serum uric acid (sUA), monosodium urate (MSU), <6 mg/dL, MSU crystal formation, as well as individual drug names and classes of treatments of interest (allopurinol, febuxostat, colchicine, non-steroidal anti-inflammatories (NSAIDs)]. Studies were selected that presented data on gout treatment, including drugs under development, and on the management of gout from both the physician and patient perspectives. The reference lists of identified articles were searched manually for additional publications. Gout, a progressive debilitating form of inflammatory arthritis, is caused by factors that elevate serum uric acid (sUA) levels, leading to hyperuricemia. Continued elevated sUA can result in monosodium urate crystal deposition in joints and soft tissues, causing acute and chronic inflammation. Crystal deposition can lead to chronic gout, with an increased number of flares, tophi development, and structural joint damage. The aims of gout treatment are to reduce the sUA level to <6 mg/dL, to inhibit the formation of new crystals, and to promote the dissolution of existing crystals. Gout is often poorly managed for several reasons, including a lack of adherence to treatment guidelines by health care providers, patients' poor adherence to therapy, and differences between a provider's and patient's perspectives regarding treatment. Patients need to be educated about their diagnosis and management of the disease, such as the importance of compliance with long-term treatment. Gout treatment may also confounded by contraindications to current standards of therapy and the limitations of current treatment paradigms. Recently approved medications, as well as drugs under development, may provide new ways for reaching the sUA target and also "curing" the disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
The role of uric acid in the pathogenesis of diabetic retinopathy based on notch pathway.
Zhu, Dan-Dan; Wang, Yun-Zhi; Zou, Chen; She, Xin-Ping; Zheng, Zhi
2018-06-19
Uric acid has been proposed as an independent risk factor of diabetic retinopathy. Although Notch signaling was reported to be affected in the presence of high concentrations of uric acid or glucose, the underlying mechanisms of hyperuricemia through the Notch signaling pathway to promote the development of diabetic retinopathy remain unknown. We incubated human retinal endothelial cells (HRECs) with high glucose, high uric acid and high glucose plus high glucose respectively and evaluated the apoptosis rate in different treated cells by Tunel staining. We induced diabetic model by intraperitoneally streptozotocin. Then healthy rats and diabetic rats were given with adenine and oteracil potassium by gavage. Using automatic biochemical analyzer to detect blood glucose, uric acid, urea nitrogen, creatinine levels, to verify the success of modeling. The expression and mRNA levels of ICAM-1, IL-6, MCP-1, TNF-a, receptors Notch 1, ligands Dll 1, Dll 4, Jagged 1, Jagged 2 were detected by RT-PCR and Western-Blot. Notch1 siRNA was used to interfere Notch signaling pathway, the expression and mRNA levels of ICAM-1, IL-6, MCP-1 and TNF-α was detected by RT-PCR and Western blot respectively. In vitro models, the apoptosis of HRECs cells in high uric acid plus high glucose group was the most significant. In vitro and vivo models, detection of inflammatory cytokines revealed that the expression of inflammatory cytokines increased most significantly in high uric acid plus high glucose group. Notch signaling pathway activity was also increased most significantly in high uric acid plus high glucose group. After Notch 1 siRNA transfection in high glucose and high glucose plus uric acid group, the activity of Notch signaling pathway was successfully down-regulated. We found that the apoptosis of HRECs was significantly decreased in cells transfected with Notch 1 siRNA compared to the blank vector group, and the expression of inflammatory cytokines in cells was also significantly decreased. Our study reported that high uric acid can promote the inflammation of the retina and increase the activity of Notch signaling pathway on the basis of high glucose. Hyperuricemia promotes the development of diabetic retinopathy by increasing the activity of Notch signaling pathway. Notch signaling pathway is a potential therapeutic target for diabetic retinopathy. Copyright © 2018. Published by Elsevier Inc.
Sofue, Tadashi; Inui, Masashi; Hara, Taiga; Nishijima, Yoko; Moriwaki, Kumiko; Hayashida, Yushi; Ueda, Nobufumi; Nishiyama, Akira; Kakehi, Yoshiyuki; Kohno, Masakazu
2014-01-01
Background Post-transplant hyperuricemia (PTHU), defined as serum uric acid concentration ≥7.0 mg/dL or need for treatment with allopurinol or benzbromarone, reduces long-term allograft survival in kidney transplant recipients. Febuxostat, a new nonpurine selective xanthine oxidase inhibitor, is well tolerated in patients with moderate renal impairment. However, its efficacy and safety in kidney recipients with PTHU is unclear. We therefore assessed the efficacy and safety of febuxostat in stable kidney transplant recipients with PTHU. Methods Of 93 stable adult kidney transplant recipients, 51 were diagnosed with PTHU (PTHU group) and 42 were not (NPTHU group). Of the 51 patients with PTHU, 26 were treated with febuxostat (FX group) and 25 were not (NFX group), at the discretion of each attending physician. One-year changes in serum uric acid concentrations, rates of achievement of target uric acid (<6.0 mg/dL), estimated glomerular filtration rates in allografts, and adverse events were retrospectively analyzed in the FX, NFX, and NPTHU groups. Results The FX group showed significantly greater decreases in serum uric acid (−2.0±1.1 mg/dL versus 0.0±0.8 mg/dL per year, P<0.01) and tended to show a higher rate of achieving target uric acid levels (50% versus 24%; odds ratio 3.17 [95% confidence interval 0.96–10.5], P=0.08) than the NFX group. Although baseline allograft estimated glomerular filtration rates tended to be lower in the FX group than in the NFX group (40±14 mL/min/1.73 m2 versus 47±19 mL/min/1.73 m2), changes in allograft estimated glomerular filtration rate were similar (+1.0±4.9 mL/min/1.73 m2 versus −0.2±6.9 mL/min/1.73 m2 per year, P=0.50). None of the patients in the FX group experienced any severe adverse effects, such as pancytopenia or attacks of gout, throughout the entire study period. Nephrologists were more likely than urologists to start febuxostat in kidney transplant recipients with PTHU (69% versus 8%). Conclusion Treatment with febuxostat sufficiently lowered uric acid levels without severe adverse effects in stable kidney transplant recipients with PTHU. PMID:24600205
Sofue, Tadashi; Inui, Masashi; Hara, Taiga; Nishijima, Yoko; Moriwaki, Kumiko; Hayashida, Yushi; Ueda, Nobufumi; Nishiyama, Akira; Kakehi, Yoshiyuki; Kohno, Masakazu
2014-01-01
Post-transplant hyperuricemia (PTHU), defined as serum uric acid concentration ≥7.0 mg/dL or need for treatment with allopurinol or benzbromarone, reduces long-term allograft survival in kidney transplant recipients. Febuxostat, a new nonpurine selective xanthine oxidase inhibitor, is well tolerated in patients with moderate renal impairment. However, its efficacy and safety in kidney recipients with PTHU is unclear. We therefore assessed the efficacy and safety of febuxostat in stable kidney transplant recipients with PTHU. Of 93 stable adult kidney transplant recipients, 51 were diagnosed with PTHU (PTHU group) and 42 were not (NPTHU group). Of the 51 patients with PTHU, 26 were treated with febuxostat (FX group) and 25 were not (NFX group), at the discretion of each attending physician. One-year changes in serum uric acid concentrations, rates of achievement of target uric acid (<6.0 mg/dL), estimated glomerular filtration rates in allografts, and adverse events were retrospectively analyzed in the FX, NFX, and NPTHU groups. The FX group showed significantly greater decreases in serum uric acid (-2.0±1.1 mg/dL versus 0.0±0.8 mg/dL per year, P<0.01) and tended to show a higher rate of achieving target uric acid levels (50% versus 24%; odds ratio 3.17 [95% confidence interval 0.96-10.5], P=0.08) than the NFX group. Although baseline allograft estimated glomerular filtration rates tended to be lower in the FX group than in the NFX group (40±14 mL/min/1.73 m(2) versus 47±19 mL/min/1.73 m(2)), changes in allograft estimated glomerular filtration rate were similar (+1.0±4.9 mL/min/1.73 m(2) versus -0.2±6.9 mL/min/1.73 m(2) per year, P=0.50). None of the patients in the FX group experienced any severe adverse effects, such as pancytopenia or attacks of gout, throughout the entire study period. Nephrologists were more likely than urologists to start febuxostat in kidney transplant recipients with PTHU (69% versus 8%). Treatment with febuxostat sufficiently lowered uric acid levels without severe adverse effects in stable kidney transplant recipients with PTHU.
A novel mice model of metabolic syndrome: the high-fat-high-fructose diet-fed ICR mice.
Zhuhua, Zhang; Zhiquan, Wang; Zhen, Yang; Yixin, Niu; Weiwei, Zhang; Xiaoyong, Li; Yueming, Liu; Hongmei, Zhang; Li, Qin; Qing, Su
2015-01-01
Currently, the metabolic syndrome (MS) is occurring at growing rates worldwide, raising extensive concerns on the mechanisms and therapeutic interventions for this disorder. Herein, we described a novel method of establishing MS model in rodents. Male Institute of Cancer Research (ICR) mice were fed with high-fat-high-fructose (HFHF) diet or normal chow (NC) respectively for 12 weeks. Metabolic phenotypes were assessed by glucose tolerance test, insulin tolerance test and hyperinsulinemic-euglycemic clamp. Blood pressure was measured by a tail-cuff system. At the end of the experiment, mice were sacrificed, and blood and tissues were harvested for subsequent analysis. Serum insulin levels were measured by ELISA, and lipid profiles were determined biochemically. The HFHF diet-fed ICR mice exhibited obvious characteristics of the components of MS, including obvious obesity, severe insulin resistance, hyperinsulinemia, dislipidemia, significant hypertension and hyperuricemia. Our data suggest that HFHF diet-fed ICR mice may be a robust and efficient animal model that could well mimic the basic pathogenesis of human MS.
Song, Jeong Uk; Jang, Jae Wan; Kim, Tae Hun; Park, Heuisul; Park, Wan Su; Jung, Sang-Hun; Kim, Geun Tae
2016-02-01
Inhibition of xanthine oxidase (XO) has obviously been a central concept for controlling hyperuricemia, which causes serious and painful inflammatory arthritis disease such as gout. We discovered a series of novel 2-(indol-2-yl)thiazole derivatives as XO inhibitors at the level of nanomolar activity. Structure-guided design using molecular modeling program (Accelrys Software program) provided an excellent basis for optimization of 2-(indol-2-yl)thiazole compounds. Structure-activity relationship indicated that hydrophobic alkoxy group (isopropoxy, cyclopentoxy) at 5-position and hydrogen binding acceptor (NO2, CN) at 7-position of indole ring appear as critical functional groups. Among the compounds, 2-(7-nitro-5-isopropoxy-indol-2-yl)-4-methylthiazole-5-carboxylic acid (9m) exhibits the most potent XO inhibitory activity (IC50 value: 5.1 nM) and the excellent uric acid lowering activity in potassium oxonate induced hyperuricemic rat model. Copyright © 2016. Published by Elsevier Ltd.
Complications and total care of a child with acute leukemia.
Vietti, T J; Ragab, A H
1975-03-01
The complications which occur in a child with acute leukemia depend on the stage of the disease and the therapeutic regiman. Most children will present with some manifestation of marrow failure. An occasional child will have marked leukocytosis and disturbance of organ function due to massive leukemic infiltrates. Metabolic disturbances such as hyperuricemia and hyperphosphatemia-hypocalcemia may develop, expecially after therapy is initiated. The myelosuppression and immunosuppression due to drug toxicity may result in opportunistic infections. Other toxicities which can occur with a chemotherapeutic regimen are numerois and varied, and the physician must be cognizant of them in order to minimize damage. Therapy to the central nervous system, either for subclinical or clinical disease, has been associated with a variety of symptoms ranging from meningismus to paraplegia and death. To prevent the development of these complications, and to manage them effectively if they occur, the physician must be knowlegeable about their etiology, clinical and laboratory manifestations, and treatment.
From genotype to phenotype; clinical variability in Lesch-Nyhan disease. The role of epigenetics.
Trigueros Genao, M; Torres, R J
2014-11-01
Lesch-Nyhan disease is a rare genetic disease characterized by a deficiency in the function of the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT). Patients affected by this disease experience hyperuricemia, motor disorders, mental retardation and, in the most severe cases, self-mutilation. Its clinical manifestations depend on the enzymatic activity of HGPRT, which is classically linked to the type of alteration in the HGPRT gene. More than 400 mutations of this gene have been found. At present, one of the controversial aspects of the disease is the relationship between the genotype and phenotype; cases have been described lacking a mutation, such as the patient presented in this article, as well as families who despite sharing the same genetic defect show disorders with differing severity. Epigenetic processes, which modify the genetic expression without changing the sequence of the deoxyribonucleic acid (DNA), could explain the clinical variability observed in this disease. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.
Laughon, S Katherine; Catov, Janet; Roberts, James M
2009-12-01
We sought to investigate whether uric acid concentrations are increased in pregnant women with insulin resistance and to correlate both with fetal growth. Uric acid, glucose, and insulin were measured in plasma at 20.4 (+/-2.0) weeks' gestation in 263 women. The association between uric acid and insulin resistance, as estimated using the homeostasis model assessment (HOMA), was analyzed and related to birthweights. In 212 (80.6%) women who remained normotensive throughout pregnancy, HOMA increased 1.23 U per 1-mg/dL increase in uric acid (95% confidence interval, 1.07-1.42; P=.003). Infants born to normotensive women in the upper quartile of uric acid and lowest HOMA quartile weighed 435.6 g less than infants of women with highest uric acid and HOMA quartiles (P<.005). Increasing uric acid concentrations were associated with insulin resistance in midpregnancy. Hyperuricemia was associated with lower birthweight in normotensive women, and this effect was attenuated by insulin resistance.
Wearable salivary uric acid mouthguard biosensor with integrated wireless electronics.
Kim, Jayoung; Imani, Somayeh; de Araujo, William R; Warchall, Julian; Valdés-Ramírez, Gabriela; Paixão, Thiago R L C; Mercier, Patrick P; Wang, Joseph
2015-12-15
This article demonstrates an instrumented mouthguard capable of non-invasively monitoring salivary uric acid (SUA) levels. The enzyme (uricase)-modified screen printed electrode system has been integrated onto a mouthguard platform along with anatomically-miniaturized instrumentation electronics featuring a potentiostat, microcontroller, and a Bluetooth Low Energy (BLE) transceiver. Unlike RFID-based biosensing systems, which require large proximal power sources, the developed platform enables real-time wireless transmission of the sensed information to standard smartphones, laptops, and other consumer electronics for on-demand processing, diagnostics, or storage. The mouthguard biosensor system offers high sensitivity, selectivity, and stability towards uric acid detection in human saliva, covering the concentration ranges for both healthy people and hyperuricemia patients. The new wireless mouthguard biosensor system is able to monitor SUA level in real-time and continuous fashion, and can be readily expanded to an array of sensors for different analytes to enable an attractive wearable monitoring system for diverse health and fitness applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Zhou, Yunli; Zhang, Mi; He, Dan; Hu, Xueyuan; Xiong, Huarong; Wu, Jianyong; Zhu, Biyue; Zhang, Jingqing
2016-01-01
Enzyme therapy is an effective strategy to treat diseases. Three strategies were pursued to provide the favorable microenvironments for uricase (UCU) to eventually improve its features: using the right type of buffer to constitute the liquid media where catalyze reactions take place; entrapping UCU inside the selectively permeable lipid vesicle membranes; and entrapping catalase together with UCU inside the membranes. The nanosized alkaline enzymosomes containing UCU/(UCU and catalase) (ESU/ESUC) in bicine buffer had better thermal, hypothermal, acid-base and proteolytic stabilities, in vitro and in vivo kinetic characteristics, and uric acid lowering effects. The favorable microenvironments were conducive to the establishment of the enzymosomes with superior properties. It was the first time that two therapeutic enzymes were simultaneously entrapped into one enzymosome having the right type of buffer to achieve added treatment efficacy. The development of ESU/ESUC in bicine buffer provides valuable tactics in hypouricemic therapy and enzymosomal application. PMID:26823332
Wearable salivary uric acid mouthguard biosensor with integrated wireless electronics
Kim, Jayoung; Imani, Somayeh; de Araujo, William R.; Warchall, Julian; Valdés-Ramírez, Gabriela; Paixão, Thiago R.L.C.; Mercier, Patrick P.; Wang, Joseph
2016-01-01
This article demonstrates an instrumented mouthguard capable of non-invasively monitoring salivary uric acid (SUA) levels. The enzyme (uricase)-modified screen printed electrode system has been integrated onto a mouthguard platform along with anatomically-miniaturized instrumentation electronics featuring a potentiostat, microcontroller, and a Bluetooth Low Energy (BLE) transceiver. Unlike RFID-based biosensing systems, which require large proximal power sources, the developed platform enables real-time wireless transmission of the sensed information to standard smartphones, laptops, and other consumer electronics for on-demand processing, diagnostics, or storage. The mouthguard biosensor system offers high sensitivity, selectivity, and stability towards uric acid detection in human saliva, covering the concentration ranges for both healthy people and hyperuricemia patients. The new wireless mouthguard biosensor system is able to monitor SUA level in real-time and continuous fashion, and can be readily expanded to an array of sensors for different analytes to enable an attractive wearable monitoring system for diverse health and fitness applications. PMID:26276541
Bilateral Proliferative Retinopathy as the Initial Presentation of Chronic Myeloid Leukemia
Macedo, Mafalda S. F.; Figueiredo, Ana R. M.; Ferreira, Natália N.; Barbosa, Irene M. A.; Furtado, Maria João F. B. S.; Correia, Nuno F. C. B. A.; Gomes, Miguel P.; Lume, Miguel R. B.; Menéres, Maria João S.; Santos, Marinho M. N.; Meireles S., M. Angelina C.
2013-01-01
The authors report a rare case of a 48-year-old male with chronic myeloid leukemia (CML) who initially presented with a bilateral proliferative retinopathy. The patient complained of recent visual loss and floaters in both eyes (BE). Ophthalmologic evaluation revealed a best corrected visual acuity (BCVA) of 20/50 in the right eye and 20/200 in the left eye (LE). Fundoscopy showed the presence of bilateral peripheral capillary dropout with multiple retinal sea fan neovascularisations, which were confirmed on fluorescein angiography. Full blood count revealed hyperleukocytosis, thrombocytosis, anemia, and hyperuricemia. Bone marrow aspiration and biopsy showed the reciprocal chromosomal translocation t (9;22), diagnostic of CML. The patient was started on hydroxyurea, allopurinol and imatinib mesylate. He received bilateral panretinal laser photocoagulation and a vitrectomy was performed in the LE. The patient has been in complete hematologic, cytogenetic, and major molecular remission while on imatinib and his BCVA is 20/25 in BE. PMID:24339689
The role of xanthine oxidoreductase and uric acid in metabolic syndrome.
Battelli, Maria Giulia; Bortolotti, Massimo; Polito, Letizia; Bolognesi, Andrea
2018-08-01
Xanthine oxidoreductase (XOR) could contribute to the pathogenesis of metabolic syndrome through the oxidative stress and the inflammatory response induced by XOR-derived reactive oxygen species and uric acid. Hyperuricemia is strongly linked to hypertension, insulin resistance, obesity and hypertriglyceridemia. The serum level of XOR is correlated to triglyceride/high density lipoprotein cholesterol ratio, fasting glycemia, fasting insulinemia and insulin resistance index. Increased activity of endothelium-linked XOR may promote hypertension. In addition, XOR is implicated in pre-adipocyte differentiation and adipogenesis. XOR and uric acid play a role in cell transformation and proliferation as well as in the progression and metastatic process. Collected evidences confirm the contribution of XOR and uric acid in metabolic syndrome. However, in some circumstances XOR and uric acid may have anti-oxidant protective outcomes. The dual-face role of both XOR and uric acid explains the contradictory results obtained with XOR inhibitors and suggests caution in their therapeutic use. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Madlala, Hlengiwe P; Maarman, Gerald J; Ojuka, Edward
2016-04-01
The consumption of fructose, a major constituent of the modern diet, has raised increasing concern about the effects of fructose on health. Research suggests that excessive intake of fructose (>50 g/d) causes hyperuricemia, insulin resistance, mitochondrial dysfunction, de novo lipogenesis by the liver, and increased production of reactive oxygen species (ROS) in muscle. In a number of tissues, uric acid has been shown to stimulate the production of ROS via activation of transforming growth factor β1 and NADPH (nicotinamide adenine dinucleotide phosphate) oxidase 4. The role of uric acid in fructose-induced production of ROS in skeletal muscle, however, has not been investigated. This review examines the evidence for fructose-induced production of ROS in skeletal muscle, highlights proposed mechanisms, and identifies gaps in current knowledge. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Serum uric acid as prognostic marker of coronary heart disease (CHD).
Purnima, Samudrala; El-Aal, Bahiga Galal Abd
A substantial body of epidemiological and experimental evidence suggests the significance of serum uric acid as an important and independent risk factor of cardio vascular and renal diseases especially in patients with diabetes mellitus, hypertension. Hyperuricemia is a risk factor of coronary heart disease. Several studies showed positive association between hyperuricemia and CHD risk factors. To analyze the serum uric acid levels in patients with diabetes and hypertension, which helps in understanding its role as prognostic marker of coronary heart disease. The study was conducted in population of Wadi-Al Dawasir (K.S.A.) aged 20-80 years through random sampling from October 2012 to June 2013. It included 250 samples and the cases were categorized into diabetic and hypertensive. In the cases, purely hypertensive were 52, diabetic were 57 and mixed group included both diabetic and hypertensive patients 65. Fasting blood was collected to analyze lipid profile which included (total cholesterol, triglycerides, high density lipoprotein, low density lipoprotein) and serum uric acid in association with age and heredity was also studied. Patient demographics were recorded. The study revealed significant association of serum uric acid (p<0.014*) and total cholesterol (p<0.007**) triglycerides (p<0.009**) low density lipoprotein (p<0.044*) in hypertensive group. Serum uric acid levels in the mixed group patients with diabetes and hypertension reported serum uric acid (p<0.0037), total cholesterol (p<0.089+) proved to have increased risk of coronary heart disease. When compared to controls (non-diabetic p<0.529) and (non-hypertensive p<0.021*) with respect to serum uric acid levels show the magnitude of risk to coronary heart disease. With progressing age the association of lipid profile and serum uric acid reported (p<0.001**) in diabetics. Significant correlations were found between serum uric acid and risk factors for CHD. This is first study of its kind in this region of K.S.A., which helps the community to understand the role of serum uric acid in coronary heart disease, justifies the objective of research in taking preventive measures to combat the deleterious effect of coronary heart disease. Prevention and early detection of elevated uric acid in both hypertensive and diabetic patients could serve as effective investigative tool in reducing coronary heart disease. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.
Fabre, Stéphanie; Clerson, Pierre; Launay, Jean-Marie; Gautier, Jean-François; Vidal-Trecan, Tiphaine; Riveline, Jean-Pierre; Platt, Adam; Abrahamsson, Anna; Miner, Jeffrey N; Hughes, Glen; Richette, Pascal; Bardin, Thomas
2018-05-02
The uric acid (UA) level in patients with gout is a key factor in disease management and is typically measured in the laboratory using plasma samples obtained after venous puncture. This study aimed to assess the reliability of immediate UA measurement with capillary blood samples obtained by fingertip puncture with the HumaSens plus point-of-care meter. UA levels were measured using both the HumaSens plus meter in the clinic and the routine plasma UA method in the biochemistry laboratory of 238 consenting diabetic patients. HumaSens plus capillary and routine plasma UA measurements were compared by linear regression, Bland-Altman plots, intraclass correlation coefficient (ICC), and Lin's concordance coefficient. Values outside the dynamic range of the meter, low (LO) or high (HI), were analyzed separately. The best capillary UA thresholds for detecting hyperuricemia were determined by receiver operating characteristic (ROC) curves. The impact of potential confounding factors (demographic and biological parameters/treatments) was assessed. Capillary and routine plasma UA levels were compared to reference plasma UA measurements by liquid chromatography-mass spectrometry (LC-MS) for a subgroup of 67 patients. In total, 205 patients had capillary and routine plasma UA measurements available. ICC was 0.90 (95% confidence interval (CI) 0.87-0.92), Lin's coefficient was 0.91 (0.88-0.93), and the Bland-Altman plot showed good agreement over all tested values. Overall, 17 patients showed values outside the dynamic range. LO values were concordant with plasma values, but HI values were considered uninterpretable. Capillary UA thresholds of 299 and 340 μmol/l gave the best results for detecting hyperuricemia (corresponding to routine plasma UA thresholds of 300 and 360 μmol/l, respectively). No significant confounding factor was found among those tested, except for hematocrit; however, this had a negligible influence on the assay reliability. When capillary and routine plasma results were discordant, comparison with LC-MS measurements showed that plasma measurements had better concordance: capillary UA, ICC 0.84 (95% CI 0.75-0.90), Lin's coefficient 0.84 (0.77-0.91); plasma UA, ICC 0.96 (0.94-0.98), Lin's coefficient 0.96 (0.94-0.98). UA measurements with the HumaSens plus meter were reasonably comparable with those of the laboratory assay. The meter is easy to use and may be useful in the clinic and in epidemiologic studies.
A novel mice model of metabolic syndrome: the high-fat-high-fructose diet-fed ICR mice
Zhuhua, Zhang; Zhiquan, Wang; Zhen, Yang; Yixin, Niu; Weiwei, Zhang; Xiaoyong, Li; Yueming, Liu; Hongmei, Zhang; Li, Qin; Qing, Su
2015-01-01
Currently, the metabolic syndrome (MS) is occurring at growing rates worldwide, raising extensive concerns on the mechanisms and therapeutic interventions for this disorder. Herein, we described a novel method of establishing MS model in rodents. Male Institute of Cancer Research (ICR) mice were fed with high-fat-high-fructose (HFHF) diet or normal chow (NC) respectively for 12 weeks. Metabolic phenotypes were assessed by glucose tolerance test, insulin tolerance test and hyperinsulinemic-euglycemic clamp. Blood pressure was measured by a tail-cuff system. At the end of the experiment, mice were sacrificed, and blood and tissues were harvested for subsequent analysis. Serum insulin levels were measured by ELISA, and lipid profiles were determined biochemically. The HFHF diet-fed ICR mice exhibited obvious characteristics of the components of MS, including obvious obesity, severe insulin resistance, hyperinsulinemia, dislipidemia, significant hypertension and hyperuricemia. Our data suggest that HFHF diet-fed ICR mice may be a robust and efficient animal model that could well mimic the basic pathogenesis of human MS. PMID:26134356
Inborn Errors of Fructose Metabolism. What Can We Learn from Them?
Tran, Christel
2017-04-03
Fructose is one of the main sweetening agents in the human diet and its ingestion is increasing globally. Dietary sugar has particular effects on those whose capacity to metabolize fructose is limited. If intolerance to carbohydrates is a frequent finding in children, inborn errors of carbohydrate metabolism are rare conditions. Three inborn errors are known in the pathway of fructose metabolism; (1) essential or benign fructosuria due to fructokinase deficiency; (2) hereditary fructose intolerance; and (3) fructose-1,6-bisphosphatase deficiency. In this review the focus is set on the description of the clinical symptoms and biochemical anomalies in the three inborn errors of metabolism. The potential toxic effects of fructose in healthy humans also are discussed. Studies conducted in patients with inborn errors of fructose metabolism helped to understand fructose metabolism and its potential toxicity in healthy human. Influence of fructose on the glycolytic pathway and on purine catabolism is the cause of hypoglycemia, lactic acidosis and hyperuricemia. The discovery that fructose-mediated generation of uric acid may have a causal role in diabetes and obesity provided new understandings into pathogenesis for these frequent diseases.
Inborn Errors of Fructose Metabolism. What Can We Learn from Them?
Tran, Christel
2017-01-01
Fructose is one of the main sweetening agents in the human diet and its ingestion is increasing globally. Dietary sugar has particular effects on those whose capacity to metabolize fructose is limited. If intolerance to carbohydrates is a frequent finding in children, inborn errors of carbohydrate metabolism are rare conditions. Three inborn errors are known in the pathway of fructose metabolism; (1) essential or benign fructosuria due to fructokinase deficiency; (2) hereditary fructose intolerance; and (3) fructose-1,6-bisphosphatase deficiency. In this review the focus is set on the description of the clinical symptoms and biochemical anomalies in the three inborn errors of metabolism. The potential toxic effects of fructose in healthy humans also are discussed. Studies conducted in patients with inborn errors of fructose metabolism helped to understand fructose metabolism and its potential toxicity in healthy human. Influence of fructose on the glycolytic pathway and on purine catabolism is the cause of hypoglycemia, lactic acidosis and hyperuricemia. The discovery that fructose-mediated generation of uric acid may have a causal role in diabetes and obesity provided new understandings into pathogenesis for these frequent diseases. PMID:28368361
Integrating Cellular Metabolism into a Multiscale Whole-Body Model
Krauss, Markus; Schaller, Stephan; Borchers, Steffen; Findeisen, Rolf; Lippert, Jörg; Kuepfer, Lars
2012-01-01
Cellular metabolism continuously processes an enormous range of external compounds into endogenous metabolites and is as such a key element in human physiology. The multifaceted physiological role of the metabolic network fulfilling the catalytic conversions can only be fully understood from a whole-body perspective where the causal interplay of the metabolic states of individual cells, the surrounding tissue and the whole organism are simultaneously considered. We here present an approach relying on dynamic flux balance analysis that allows the integration of metabolic networks at the cellular scale into standardized physiologically-based pharmacokinetic models at the whole-body level. To evaluate our approach we integrated a genome-scale network reconstruction of a human hepatocyte into the liver tissue of a physiologically-based pharmacokinetic model of a human adult. The resulting multiscale model was used to investigate hyperuricemia therapy, ammonia detoxification and paracetamol-induced toxication at a systems level. The specific models simultaneously integrate multiple layers of biological organization and offer mechanistic insights into pathology and medication. The approach presented may in future support a mechanistic understanding in diagnostics and drug development. PMID:23133351
Ojha, Ritu; Singh, Jagjeet; Ojha, Anu; Singh, Harbinder; Sharma, Sahil; Nepali, Kunal
2017-03-01
Xanthine oxidase (XO) is a versatile molybdoflavoprotein, widely distributed, occurring in milk, kidney, lung, heart, and vascular endothelium. Catalysis by XO to produce uric acid and reactive oxygen species leads to many diseases. Anti hyperuricemic therapy by xanthine oxidase inhibitors has been mainly employed for the treatment of gout. Area covered: This review covers the patent literature (2011-2015) and also presents the interesting strategies/rational approaches employed for the design of xanthine oxidase inhibitors reported recently. Expert opinion: Recent literature indicates that various non purine scaffolds have been extensively investigated for xanthine oxidase inhibition. The significant potential endowed by heteroaryl based compounds, in particularly fused heterocycles clearly highlights their clinical promise and the need for detailed investigation. Studies by various research groups have also revealed that the flavone framework is open for isosteric replacements and structural modifications for yielding potent non purine xanthine oxidase inhibitors. In addition, various plant extracts recently reported to possess significant xanthine oxidase inhibitory potential presents enough promise to initiate a screening program for the identification of other plant extracts and phytoconstituents possessing inhibitory potential towards the enzyme.
Mechanisms by Which Dehydration May Lead to Chronic Kidney Disease.
Roncal-Jimenez, C; Lanaspa, M A; Jensen, T; Sanchez-Lozada, L G; Johnson, R J
2015-01-01
Dehydration, a condition that characterizes excessive loss of body water, is well known to be associated with acute renal dysfunction; however, it has largely been considered reversible and to be associated with no long-term effects on the kidney. Recently, an epidemic of chronic kidney disease has emerged in Central America in which the major risk factor seems to be recurrent heat-associated dehydration. This has led to studies investigating whether recurrent dehydration may lead to permanent kidney damage. Three major potential mechanisms have been identified, including the effects of vasopressin on the kidney, the activation of the aldose reductase-fructokinase pathway, and the effects of chronic hyperuricemia. The discovery of these pathways has also led to the recognition that mild dehydration may be a risk factor in progression of all types of chronic kidney diseases. Furthermore, there is some evidence that increasing hydration, particularly with water, may actually prevent CKD. Thus, a whole new area of investigation is developing that focuses on the role of water and osmolarity and their influence on kidney function and health. © 2015 S. Karger AG, Basel.
Jegapragasan, Mithulan; Calniquer, Alejandro; Hwang, William D; Nguyen, Quynh T; Child, Zachary
2014-04-01
Study Design Case report. Objective The objective of this study is to report the occurrence of tophaceous gout in the lumbar spine. Methods Using a case report to illustrate the key points of gout in the spine, we provide a brief review of gout in the literature as it relates to its orthopedic and spinal manifestations as well as guidelines for management. Results This case report details the occurrence of a large and clinically significant finding of tophaceous gout in the lumbar spine in a 24-year-old man with a known history of gout and a 3-year history of progressive back pain. Conclusion A high index of suspicion can assist in diagnosis of patients presenting with back pain or neurologic findings with a history of gout. A previous history of gout (especially the presence of tophi), hyperuricemia, and the radiological characteristics presented here should aid the clinician in making the diagnosis of spinal gout. Early diagnosis has the potential to prevent the need for surgical intervention.
Relation between uric acid and metabolic syndrome in subjects with cardiometabolic risk
da Silva, Hellen Abreu; Carraro, Júlia Cristina Cardoso; Bressan, Josefina; Hermsdorff, Helen Hermana Miranda
2015-01-01
Objective To identify possible relations between serum uric acid levels and metabolic syndrome and its components in a population with cardiometabolic risk. Methods This cross-sectional study included 80 subjects (46 women), with mean age of 48±16 years, seen at the Cardiovascular Health Program. Results The prevalence of hyperuricemia and metabolic syndrome was 6.3% and 47.1%, respectively. Uric acid level was significantly higher in individuals with metabolic syndrome (5.1±1.6mg/dL), as compared to those with no syndrome or with pre-syndrome (3.9±1.2 and 4.1±1.3mg/dL, respectively; p<0.05). The uric acid levels were significantly higher in men presenting abdominal obesity, and among women with abdominal obesity, lower HDL-c levels and higher blood pressure (p<0.05). Conclusion Uric acid concentrations were positively related to the occurrence of metabolic syndrome and its components, and there were differences between genders. Our results indicate serum uric acid as a potential biomarker for patients with cardiometabolic risk. PMID:26018145
Uric acid contributes greatly to hepatic antioxidant capacity besides protein.
Mikami, T; Sorimachi, M
2017-12-20
Uric acid is the end-product of purine nucleotide metabolism and an increase in uric acid concentration in the body results in hyperuricemia, ultimately leading to gout. However, uric acid is a potent antioxidant and interacts with reactive oxygen species (ROS) to be non-enzymatically converted to allantoin. Uric acid accounts for approximately 60 % of antioxidant capacity in the plasma; however, its contribution to tissue antioxidant capacity is unknown. In this study, the contribution of uric acid to tissue antioxidant capacity and its conversion to allantoin by scavenging ROS in tissue were examined. The results showed that a decrease in hepatic uric acid content via allopurinol administration significantly reduced hepatic total-radical trapping antioxidant parameter (TRAP) content in protein-free cytosol. Additionally, treating protein-free cytosol with uricase led to a further reduction of hepatic TRAP content. Allantoin was also detected in the solution containing protein-free cytosol that reacted with ROS. These findings suggest that in the absence of protein, uric acid contributes greatly to antioxidant capacity in the liver, where uric acid is converted to allantoin by scavenging ROS.
Lin, Lianzhu; Yang, Qingyun; Zhao, Kun; Zhao, Mouming
2018-07-01
Adlay bran free phenolic extract has been previously demonstrated to possess potent xanthine oxidase (XOD) inhibitory activity. The aims of this study were to characterize the free phenolic profile of adlay bran and investigate the structure-activity relationship, underlying mechanism and interaction of phenolic acids as XOD inhibitors. A total of twenty phenolics including ten phenolic acids, two coumarins, two phenolic aldedhyes and six flavonoids were identified in a phenolic compound-guided separation by UPLC-QTOF-MS/MS. Adlay bran free phenolic extract possessed strong XOD inhibitory activity related to hydroxycinnamic acids with methoxyl groups. The hydrogen bonding and hydrophobic interactions were the main forces in the binding of adlay phenolics to XOD. Sinapic acid, identified in adlay bran for the first time, possessed strong XOD inhibitory activity in a mixed non-competitive manner, and synergistic effects with other adlay phenolic acids at low concentrations, and would be a promising agent for preventing and treating hyperuricemia. Copyright © 2018. Published by Elsevier Ltd.
The anti-hyperuricemic effect of epigallocatechin-3-gallate (EGCG) on hyperuricemic mice.
Zhu, Chuang; Xu, Yan; Liu, Zeng-Hui; Wan, Xiao-Chun; Li, Da-Xiang; Tai, Ling-Ling
2018-01-01
Epigallocatechin-3-gallate (EGCG), a major constituent of green tea catechin, has been used for antioxidant. This study aimed to evaluate the antihyperuricemic activity of EGCG on hyperuricemic mice. We demonstrated that serum uric acid (UA) level was decreased significantly with dose-dependence by EGCG treated with 10, 20, and 50mg/kg. Compared with the model, data on blood urea nitrogen (BUN) supported that there was significance with high dose of EGCG (50mg/kg). Levels of serum creatinine (Cr) in each EGCG-treated group were decreased but not significant; the activities of hepatic xanthine oxidase (XOD) and adenosine deaminase (ADA) in high dose groups' EGCG were notably lower than those of model group. EGCG could downregulate the renal mRNA expression levels of glucose transporter 9 (GLUT9) and urate transporter 1 (URAT1) on hyperuricemic mice. These results presented that EGCG had obvious hypouricemic and renal protective effects on hyperuricemic mice. Our data may have a potential value in clinical practice in the treatment of hyperuricemia. Copyright © 2017. Published by Elsevier Masson SAS.
Angelopoulos, Theodore J; Lowndes, Joshua; Sinnett, Stephanie; Rippe, James M
2015-02-01
The impact of fructose, commonly consumed with sugars by humans, on blood pressure and uric acid has yet to be defined. A total of 267 weight-stable participants drank sugar-sweetened milk every day for 10 weeks as part of their usual, mixed-nutrient diet. Groups 1 and 2 had 9% estimated caloric intake from fructose or glucose, respectively, added to milk. Groups 3 and 4 had 18% of estimated caloric intake from high fructose corn syrup or sucrose, respectively, added to the milk. Blood pressure and uric acid were determined prior to and after the 10-week intervention. There was no effect of sugar type on either blood pressure or uric acid (interaction P>.05), and a significant time effect for blood pressure was noted (P<.05). The authors conclude that 10 weeks of consumption of fructose at the 50th percentile level, whether consumed as pure fructose or with fructose-glucose-containing sugars, does not promote hyperuricemia or increase blood pressure. © 2014 Wiley Periodicals, Inc.
Qu, Xin; Sui, Jianxin; Mi, Nasha; Lin, Hong
2017-01-01
Seafood is regarded as a high-purine food that may induce gout, which has attracted extensive attention concerning its safety. Therefore, the aim of this study was to develop a simple and reliable method to determine the purine content in seafood and its change during storage to offer consumers healthy diet information. Chromatographic separation was carried out using Waters Atlantis dC 18 column, and potassium phosphate monobasic solution (0.02 mol L -1 , pH 3.6) as a mobile phase. The average recovery yields of four purines were 91.5-105.0%, and relative standard deviation values were around 1.8-6.5%. Shrimp and snail contained higher amounts of purine than fish and bivalves; the livers and skins of fish contained higher amounts of purine than muscles; and the main purine varied depending on the type of seafood. Also, purine content of seafood changed during storage. The purine content of seafood differed depending on species, body part and degree of freshness, which could recommend consumers a healthy diet, especially for people with hyperuricemia and gout. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Lanaspa, Miguel A.; Sanchez-Lozada, Laura G.; Cicerchi, Christina; Li, Nanxing; Roncal-Jimenez, Carlos A.; Ishimoto, Takuji; Le, Myphuong; Garcia, Gabriela E.; Thomas, Jeffrey B.; Rivard, Christopher J.; Andres-Hernando, Ana; Hunter, Brandi; Schreiner, George; Rodriguez-Iturbe, Bernardo; Sautin, Yuri Y.; Johnson, Richard J.
2012-01-01
Excessive dietary fructose intake may have an important role in the current epidemics of fatty liver, obesity and diabetes as its intake parallels the development of these syndromes and because it can induce features of metabolic syndrome. The effects of fructose to induce fatty liver, hypertriglyceridemia and insulin resistance, however, vary dramatically among individuals. The first step in fructose metabolism is mediated by fructokinase (KHK), which phosphorylates fructose to fructose-1-phosphate; intracellular uric acid is also generated as a consequence of the transient ATP depletion that occurs during this reaction. Here we show in human hepatocytes that uric acid up-regulates KHK expression thus leading to the amplification of the lipogenic effects of fructose. Inhibition of uric acid production markedly blocked fructose-induced triglyceride accumulation in hepatocytes in vitro and in vivo. The mechanism whereby uric acid stimulates KHK expression involves the activation of the transcription factor ChREBP, which, in turn, results in the transcriptional activation of KHK by binding to a specific sequence within its promoter. Since subjects sensitive to fructose often develop phenotypes associated with hyperuricemia, uric acid may be an underlying factor in sensitizing hepatocytes to fructose metabolism during the development of fatty liver. PMID:23112875
Fructose Intake, Serum Uric Acid, and Cardiometabolic Disorders: A Critical Review.
Caliceti, Cristiana; Calabria, Donato; Roda, Aldo; Cicero, Arrigo F G
2017-04-18
There is a direct relationship between fructose intake and serum levels of uric acid (UA), which is the final product of purine metabolism. Recent preclinical and clinical evidence suggests that chronic hyperuricemia is an independent risk factor for hypertension, metabolic syndrome, and cardiovascular disease. It is probably also an independent risk factor for chronic kidney disease, Type 2 diabetes, and cognitive decline. These relationships have been observed for high serum UA levels (>5.5 mg/dL in women and >6 mg/dL in men), but also for normal to high serum UA levels (5-6 mg/dL). In this regard, blood UA levels are much higher in industrialized countries than in the rest of the world. Xanthine-oxidase inhibitors can reduce UA and seem to minimize its negative effects on vascular health. Other dietary and pathophysiological factors are also related to UA production. However, the role of fructose-derived UA in the pathogenesis of cardiometabolic disorders has not yet been fully clarified. Here, we critically review recent research on the biochemistry of UA production, the relationship between fructose intake and UA production, and how this relationship is linked to cardiometabolic disorders.
Wills, Sarah; Beaufrère, Hugues; Watrous, Gwyneth; Oblak, Michelle L; Smith, Dale A
2016-11-01
CASE DESCRIPTION A 13-year-old female green iguana (Iguana iguana) was examined because of a 6-day history of vomiting, anorexia, and lethargy and a 4-day history of decreased fecal and urate output. CLINICAL FINDINGS Physical examination revealed a distended abdomen, signs of depression, pallor, tachycardia, harsh lung sounds, and vomiting. Abdominal radiographs revealed gas distention of the stomach and small intestine with fluid lines evident on the lateral view. Plasma biochemical analysis indicated hypochloremic metabolic alkalosis, hyperglycemia, and hyperuricemia. TREATMENT AND OUTCOME Exploratory laparotomy confirmed a diagnosis of small intestinal entrapment and 170° volvulus involving approximately 80% (20 to 30 cm) of the small intestine. The portion of the small intestine extending from the middle portion of the duodenum to the caudal extent of the ileum was resected, and end-to-end anastomosis of the remaining small intestine was performed. The iguana recovered without apparent complications and was reportedly doing well 1 year after surgery. CLINICAL RELEVANCE Findings suggested that iguanas, as hindgut fermenters, may tolerate > 70% resection of the small intestine with a good outcome and no clinical evidence of residual gastrointestinal dysfunction.
Zheng, Min; Huang, Yizhong; Ji, Jiuxiu; Xiao, Shijun; Ma, Junwu; Huang, Lusheng
2018-09-01
The purine contents of animal foods are becoming widely concerned because excess intake of purine increases the risk of hyperuricemia and gout. In this study, we investigated the impacts of breed, tissue and sex on pork purine content and its correlations with multiple meat quality traits. Among six pig breeds, the average value of total purine contents (TP) in longissimus lumborum muscle was lowest in Chinese Laiwu pigs (114.2 mg/100 g) while highest in Chinese Bamaxiang mini pigs (139.3 mg/100 g). Considerable variations in TP were observed within most breeds, as well as among twelve pork organs with the range from 7 to 245 mg/100 g. However, no significant differences in TP were found between barrows and gilts. Intriguingly, lower purine content in meat was significantly associated with higher ultimate pH, better meat color and more abundant intramuscular fat content and marbling. The results thus suggest that the selection of low-purine pig species is available, which may simultaneously improve other meat quality traits. Copyright © 2018 Elsevier Ltd. All rights reserved.
Field, Cara L; Beaufrère, Hugues; Wakamatsu, Nobuko; Rademacher, Nathalie; MacLean, Robert
2012-12-01
A 22-year-old female African black-footed penguin (Spheniscus demersus), housed indoors with other African and rockhopper penguins, was presented acutely with lethargy, ataxia, and hind limb weakness after a molt. The penguin would assume a hunched position and, when resting, sat on its hocks or lay on its keel. Physical and neurologic examination revealed hind limb paraparesis, proprioceptive deficits, and tiptoe walking. Results of a complete blood cell count and biochemical analysis revealed mild heterophilic leukocytosis, anemia, mild hypoalbuminemia, hypokalemia, and hyperuricemia. Results of whole-body radiographs and coelioscopy were unremarkable. Two computed tomographies of the spine at a 3-month interval revealed a lesion at the mobile thoracic vertebra proximal to the synsacrum with associated spinal cord compression. The penguin was treated with itraconazole, doxycycline, and meloxicam, and it initially improved with return to near normal gait and behavior. However, 5 months after the onset of clinical signs, the penguin was euthanatized after a relapse with worsening of the neurologic signs. Postmortem and histopathologic examination revealed focal granulomatous discospondylitis at the penultimate mobile thoracic vertebra, with intralesional bacteria from which Staphylococcus aureus was cultured.
Genomewide scan for gout in taiwanese aborigines reveals linkage to chromosome 4q25.
Cheng, Li Shu-Chuan; Chiang, Shang-Lun; Tu, Hung-Pin; Chang, Shun-Jen; Wang, Tsu-Nai; Ko, Allen Min-Jen; Chakraborty, Ranajit; Ko, Ying-Chin
2004-09-01
Gout is a disorder of uric-acid metabolism. The Pacific Austronesian population, including Taiwanese aborigines, has a remarkably high prevalence of hyperuricemia and gout, which suggests a founder effect across the Pacific region. We report here a genomewide linkage study of 21 multiplex pedigrees with gout from an aboriginal tribe in Taiwan. From observations of familial clustering, early onset of gout, and clinically severe manifestations, we hypothesized that a major gene plays a role in this trait. Using 382 random polymorphic markers spread across 22 autosomes, we demonstrated a highly significant linkage for gout at marker D4S2623 on chromosome 4q25 (P=.0002 by nonparametric linkage [the NPL(all) statistic]; empirical P=.0006; LOD=4.3, P=4.4x10-6 by logistic regression). When alcohol consumption was included as a covariate in the model, the LOD score increased to 5.66 (P=1.3x10-6). Quantitative traits, including serum uric acid and creatinine, also showed a moderate linkage to this region. To our knowledge, this is the first genome-scan report to identify a genetic locus harboring a gout-susceptibility gene.
Effect of uric acid on inflammatory COX-2 and ROS pathways in vascular smooth muscle cells.
Oğuz, Nurgül; Kırça, Mustafa; Çetin, Arzu; Yeşilkaya, Akın
2017-10-01
Hyperuricemia is thought to play a role in cardiovascular diseases (CVD), including hypertension, coronary artery disease and atherosclerosis. However, exactly how uric acid contributes to these pathologies is unknown. An underlying mechanism of inflammatory diseases, such as atherosclerosis, includes enhanced production of cyclooxygenase-2 (COX-2) and superoxide anion. Here, we aimed to examine the effect of uric acid on inflammatory COX-2 and superoxide anion production and to determine the role of losartan. Primarily cultured vascular smooth muscle cells (VSMCs) were time and dose-dependently induced by uric acid and COX-2 and superoxide anion levels were measured. COX-2 levels were determined by ELISA, and superoxide anion was measured by the superoxide dismutase (SOD)-inhibitable reduction of ferricytochrome c method. Uric acid elevated COX-2 levels in a time-dependent manner. Angiotensin-II receptor blocker, losartan, diminished uric-acid-induced COX-2 elevation. Uric acid also increased superoxide anion level in VSMCs. Uric acid plays an important role in CVD pathogenesis by inducing inflammatory COX-2 and ROS pathways. This is the first study demonstrating losartan's ability to reduce uric-acid-induced COX-2 elevation.
Uric Acid Secretion from Adipose Tissue and Its Increase in Obesity*
Tsushima, Yu; Nishizawa, Hitoshi; Tochino, Yoshihiro; Nakatsuji, Hideaki; Sekimoto, Ryohei; Nagao, Hirofumi; Shirakura, Takashi; Kato, Kenta; Imaizumi, Keiichiro; Takahashi, Hiroyuki; Tamura, Mizuho; Maeda, Norikazu; Funahashi, Tohru; Shimomura, Iichiro
2013-01-01
Obesity is often accompanied by hyperuricemia. However, purine metabolism in various tissues, especially regarding uric acid production, has not been fully elucidated. Here we report, using mouse models, that adipose tissue could produce and secrete uric acid through xanthine oxidoreductase (XOR) and that the production was enhanced in obesity. Plasma uric acid was elevated in obese mice and attenuated by administration of the XOR inhibitor febuxostat. Adipose tissue was one of major organs that had abundant expression and activities of XOR, and adipose tissues in obese mice had higher XOR activities than those in control mice. 3T3-L1 and mouse primary mature adipocytes produced and secreted uric acid into culture medium. The secretion was inhibited by febuxostat in a dose-dependent manner or by gene knockdown of XOR. Surgical ischemia in adipose tissue increased local uric acid production and secretion via XOR, with a subsequent increase in circulating uric acid levels. Uric acid secretion from whole adipose tissue was increased in obese mice, and uric acid secretion from 3T3-L1 adipocytes was increased under hypoxia. Our results suggest that purine catabolism in adipose tissue could be enhanced in obesity. PMID:23913681
Uetani, Mirei; Suwazono, Yasushi; Kobayashi, Etsuko; Inaba, Takeya; Oishi, Mitsuhiro; Nogawa, Koji
2006-03-01
Hyperuricemia is a lifestyle-related disease. Although there have been many previous reports about the association of serum uric acid (UA) levels with lifestyle, including eating habits and alcohol intake, there has been no report of a longitudinal study of the relationship between serum UA levels and shift work. To clarify the influence of shift work on serum UA levels in Japanese workers. This was a 4-year cohort study of 15 871 workers at a telecommunications company. Pooled logistic regression analyses by sex were performed, with job schedule type, age, body mass index (BMI), lifestyle and the results of blood chemistries as covariates. In males, shift work, part-time work, BMI, consumption of alcohol (less than twice per week, two to five times per week or more than five times per week) and little preference for vegetables were positively associated with the development of increased serum UA (>or=8 mg/dl in males, >or=6 mg/dl in females). In females, age, BMI and a history of smoking were positively associated with the development of increased serum UA. This study revealed that shift work is independently related to increased serum UA in males.
Lanaspa, Miguel A; Andres-Hernando, Ana; Orlicky, David J; Cicerchi, Christina; Jang, Cholsoon; Li, Nanxing; Milagres, Tamara; Kuwabara, Masanari; Wempe, Michael F; Rabinowitz, Joshua D; Johnson, Richard J; Tolan, Dean R
2018-04-23
Increasing evidence suggests a role for excessive intake of fructose in the Western diet as a contributor to the current epidemics of metabolic syndrome and obesity. Hereditary fructose intolerance (HFI) is a difficult and potentially lethal orphan disease associated with impaired fructose metabolism. In HFI, the deficiency of aldolase B results in the accumulation of intracellular phosphorylated fructose, leading to phosphate sequestration and depletion, increased adenosine triphosphate (ATP) turnover, and a plethora of conditions that lead to clinical manifestations such as fatty liver, hyperuricemia, Fanconi syndrome, and severe hypoglycemia. Unfortunately, there is currently no treatment for HFI, and avoiding sugar and fructose has become challenging in our society. In this report, through use of genetically modified mice and pharmacological inhibitors, we demonstrate that the absence or inhibition of ketohexokinase (Khk), an enzyme upstream of aldolase B, is sufficient to prevent hypoglycemia and liver and intestinal injury associated with HFI. Herein we provide evidence for the first time to our knowledge of a potential therapeutic approach for HFI. Mechanistically, our studies suggest that it is the inhibition of the Khk C isoform, not the A isoform, that protects animals from HFI.
Kahnert, Kathrin; Alter, Peter; Welte, Tobias; Huber, Rudolf M; Behr, Jürgen; Biertz, Frank; Watz, Henrik; Bals, Robert; Vogelmeier, Claus F; Jörres, Rudolf A
2018-06-04
Recent investigations showed single associations between uric acid levels, functional parameters, exacerbations and mortality in COPD patients. The aim of this study was to describe the role of uric acid within the network of multiple relationships between function, exacerbation and comorbidities. We used baseline data from the German COPD cohort COSYCONET which were evaluated by standard multiple regression analyses as well as path analysis to quantify the network of relations between parameters, particularly uric acid. Data from 1966 patients were analyzed. Uric acid was significantly associated with reduced FEV 1 , reduced 6-MWD, higher burden of exacerbations (GOLD criteria) and cardiovascular comorbidities, in addition to risk factors such as BMI and packyears. These associations remained significant after taking into account their multiple interdependences. Compared to uric acid levels the diagnosis of hyperuricemia and its medication played a minor role. Within the limits of a cross-sectional approach, our results strongly suggest that uric acid is a biomarker of high impact in COPD and plays a genuine role for relevant outcomes such as physical capacity and exacerbations. These findings suggest that more attention should be paid to uric acid in the evaluation of COPD disease status.
Ferraz-Filha, Zilma Schimith; Ferrari, Fernanda Cristina; Araújo, Marcela Carolina de Paula Michel; Bernardes, Ana Catharina Fernandes P. F.
2017-01-01
Tabebuia species (Bignoniaceae) have long been used in folk medicine as anti-inflammatory, antirheumatic, antimicrobial, and antitumor. The aim of this study was to investigate if aqueous extract from the leaves (AEL) of Tabebuia roseoalba (Ridl.) Sandwith, Bignoniaceae, and its constituents could be useful to decrease serum uric acid levels and restrain the gout inflammatory process. HPLC analysis identified caffeic acid and chlorogenic acid in AEL. Antihyperuricemic effects and inhibition of liver XOD (xanthine oxidoreductase) by AEL and identified compounds were evaluated in hyperuricemic mice. Anti-inflammatory activity was evaluated on MSU (monosodium urate) crystal-induced paw edema. In addition, AEL antioxidant activity in vitro was evaluated. AEL, caffeic, and chlorogenic acids were able to reduce serum uric acid levels in hyperuricemic mice probably through inhibition of liver xanthine oxidase activity and significantly decreased the paw edema induced by MSU crystals. AEL showed significant antioxidant activity in all evaluated assays. The results show that the AEL of Tabebuia roseoalba can be a promising agent for treatment for gout and inflammatory diseases. We suggest that caffeic and chlorogenic acids may be responsible for the activities demonstrated by the species. PMID:29375639
Purine derivate content and amino acid profile in larval stages of three edible insects.
Bednářová, Martina; Borkovcová, Marie; Komprda, Tomáš
2014-01-15
Considering their high content of protein, insects are a valuable alternative protein source. However, no evaluation of their purine content has so far been done. High content of purine derivates may lead to the exclusion of such food from the diet of people with specific diseases. The aim of this study was to analyse the content of selected purine derivates and amino acid profile in the three insect species most often used for entomophagy in Europe and compare them with the purine content in egg white and chicken breast. The content of individual purine derivates and their total content were significantly dependent on insect species. The purine content in all three species was significantly higher (P < 0.05) than in egg white, but some values were significantly lower (P < 0.05) than in chicken breast. The total protein content was 548.9 g kg(-1) dry matter (DM) in mealworm (Tenebrio molitor), 551.6 g kg(-1) DM in superworm (Zophobas atratus) and 564.9 g kg(-1) DM in cricket (Gryllus assimilis). Larvae of mealworm and superworm are protein-rich and purine-low meat alternatives. In contrast, cricket nymphs are protein-rich and purine-rich and cannot be recommended for people with hyperuricemia or gout. © 2013 Society of Chemical Industry.
Direct-acting antiviral agents against hepatitis C virus and lipid metabolism.
Kanda, Tatsuo; Moriyama, Mitsuhiko
2017-08-21
Hepatitis C virus (HCV) infection induces steatosis and is accompanied by multiple metabolic alterations including hyperuricemia, reversible hypocholesterolemia and insulin resistance. Total cholesterol, low-density lipoprotein-cholesterol and triglyceride levels are increased by peginterferon and ribavirin combination therapy when a sustained virologic response (SVR) is achieved in patients with HCV. Steatosis is significantly more common in patients with HCV genotype 3 but interferon-free regimens are not always effective for treating HCV genotype 3 infections. HCV infection increases fatty acid synthase levels, resulting in the accumulation of fatty acids in hepatocytes. Of note, low-density lipoprotein receptor, scavenger receptor class B type I and Niemann-Pick C1-like 1 proteins are candidate receptors that may be involved in HCV. They are also required for the uptake of cholesterol from the external environment of hepatocytes. Among HCV-infected patients with or without human immunodeficiency virus infection, changes in serum lipid profiles are observed during interferon-free treatment and after the achievement of an SVR. It is evident that HCV affects cholesterol metabolism during interferon-free regimens. Although higher SVR rates were achieved with interferon-free treatment of HCV, special attention must also be paid to unexpected adverse events based on host metabolic changes including hyperlipidemia.
Abe, Masanori; Okada, Kazuyoshi; Matsumoto, Koichi
2009-10-01
The goal of antihypertensive treatment is to reduce cardiovascular and cerebrovascular events associated with high blood pressure. A combination therapy with different antihypertensive agents is more successful than monotherapy in most hypertensive patients, with the added advantage of a better safety profile. Therefore, treatment of hypertensive patients with fixed-dose combination therapy consisting of the angiotensin II receptor blocker losartan along with hydrochlorothiazide (HCTZ) has several potential benefits over monotherapy with each individual component. It provides more effective blood pressure control, a reduction in the likelihood of adverse effects and facilitation of patient compliance due to a simple once-daily regimen. One of the advantages of the combination of losartan with HCTZ is the potential reduction in HCTZ-induced metabolic disorders; in particular, this combination can have attractive benefits for patients of hyperuricemia. Losartan plus HCTZ fixed-dose combination therapy is frequently recommended for the treatment of hypertension and lowers blood pressure in mild-to-moderate and even severe hypertensive patients to a level comparable with other classes of antihypertensive agents in combination with HCTZ. Fixed-dose combination therapy with losartan plus HCTZ is a logical choice as antihypertensive therapy for patients in whom combination therapy is necessary to achieve additional blood pressure reduction.
Morinaga, Jun; Zhao, Jiabin; Endo, Motoyoshi; Kadomatsu, Tsuyoshi; Miyata, Keishi; Sugizaki, Taichi; Okadome, Yusuke; Tian, Zhe; Horiguchi, Haruki; Miyashita, Kazuya; Maruyama, Nobuhiro; Mukoyama, Masashi; Oike, Yuichi
2018-01-01
Angiopoietin-like proteins (ANGPTLs) 3, 4, and 8 reportedly contribute to progression of metabolic disease, a risk factor for cardiovascular disease (CVD). The purpose of this study was to investigate whether circulating ANGPTL levels are associated with CVD risk after adjustment for potential confounding factors. We conducted a single center, cross-sectional study of 988 Japanese subjects undergoing routine health checks. Serum ANGPTL3, 4, and 8 levels were measured using an enzyme-linked immunosorbent assay. Using multiple regression analysis we evaluated potential association of circulating ANGPTL3, 4, and 8 levels with general medical status including age, sex, smoking, drinking, obesity, hypertension, impaired glycometabolism, dyslipidemia, hyperuricemia, hepatic impairment, chronic kidney disease, anemia, cardiac abnormality, and inflammation. Circulating ANGPTL3 levels were relatively high in health-related categories of hepatic impairment and inflammation. Circulating ANGPTL4 levels were also significantly high in impaired glycometabolism or hepatic impairment but decreased in inflammation. Finally, increased ANGPTL8 levels were observed in obesity, impaired glycometabolism and dyslipidemia. Particularly, increased levels of circulating ANGPTL8 were positively correlated with circulating triglycerides and LDL-cholesterol levels and inversely correlated with circulating HDL-cholesterol levels. Circulating ANGPTL3, 4, and 8 levels reflect some risk factors for CVD development.
Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko
2013-11-04
In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.
[Consensus document for the detection and management of chronic kidney disease].
Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador
2014-11-01
Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.
[Consensus document for the detection and management of chronic kidney disease].
Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador
2014-11-01
Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014. Published by Elsevier Espana.
Zhao, Ping; Chen, Ke-li; Zhang, Guo-li
2017-01-01
This study was aimed at evaluating the effects of Selaginella moellendorffii Hieron. (SM) on gouty arthritis and getting an insight of the possible mechanisms. HPLC method was developed for chemical analysis. The paw oedema, the neutrophil accumulation, inflammatory mediators, lipid peroxidation, and histopathological changes of the joints were analyzed in gouty arthritis rat model, and the kidney injury and serum urate were detected in hyperuricemic mice. Pharmacokinetic result demonstrated that the main apigenin glycosides might be quantitatively transformed into apigenin in the mammalian body. Among these compounds, the apigenin exhibited the strongest effect on xanthine oxidase (XOD). SM aqueous extract has proved to be active in reducing hyperuricemia in dose-dependent manner, and the levels of blood urea nitrogen (BUN) and creatinine (Cr) in high dose group were decreased significantly as compared with hyperuricemic control group (P < 0.01). The high dose of SM extract could significantly prevent the paw swelling, reduce gouty joint inflammatory features, reduce the release of IL-1β and TNF-α, lower malondialdehyde (MDA) and myeloperoxidase (MPO) levels, and increase superoxide dismutase (SOD) level (P < 0.01). For the first time, this study provides a rational basis for the traditional use of SM aqueous extract against gout in folk medicine. PMID:28250791
Mojto, V; Gvozdjakova, A; Kucharska, J; Rausova, Z; Vancova, O; Valuch, J
2018-01-01
The aim of the study was to observe the influence of 11-days complete water fasting (WF) and regeneration diet (RD) on renal function, body weight, blood pressure and oxidative stress. Therapeutic WF is considered a healing method. Ten volunteers drank only water for 11 days, followed by RD for the next 11 days. Data on body weight, blood pressure, kidney functions, antioxidants, lipid peroxidation, cholesterols, triacylglycerols and selected biochemical parameters were obtained. WF increased uric acid and creatinine and decreased glomerular filtration rate. After RD, the parameters were comparable to baseline values. Urea was not affected. Lipid peroxidation (TBARS) decreased and maintained stable after RD. Fasting decreased α-tocopherol and increased γ-tocopherol, no significant changes were found after RD. Coenzyme Q10 decreased after RD. HDL-cholesterol decreased in WF. Total- and LDL-cholesterol decreased after RD. Other biochemical parameters were within the range of reference values. The effect of the complete fasting on kidney function was manifested by hyperuricemia. Renal function was slightly decreased, however maintained within the reference values. After RD, it returned to baseline values. The positive effect of the complete water fasting was in the reduction of oxidative stress, body weight and blood pressure (Tab. 3, Ref. 25).
Surgical versus pharmacologic treatment of intraspinal gout.
Chang, I-Chang
2005-04-01
A controversy between pharmacologic and surgical treatment of intraspinal gout exists in the literature. If gout is diagnosed timely, pharmacologic therapy may avert the need of surgery. The lack of readily available synovial fluid makes the diagnosis particularly difficult. The purpose of this study was to evaluate the clinical pictures and magnetic resonance imaging features in rapid differentiations of intraspinal gout. I retrospectively evaluated lumbar intraspinal tophaceous gout without the classic radiographic punched-out lesions. Four patients (average age, 65 years) had a history of hyperuricemia with multiple tophaceous deposits in the joints or visceral organs or both. The common presentations were low back pain with or without inflammatory reaction (fever, elevated C-reactive protein level, and mild leukocytosis). The patients also presented with intermittent claudication or radiculopathy of variable duration or both. The gouty tophi yielded homogeneous and hypointense masses on T1- and T2-weighted images, with multiple hypointense speckles. The masses were located in bilateral lumbar facet joints in all patients, with additional midline extension along the ligamentum flavum in three. All patients had uneventful outcomes after surgical decompression and pharmacologic treatment. Rapid deposition of tophi may aggravate nerve compression. If neurologic deficits are found, surgical decompression can provide a satisfactory outcome. Therapeutic study, Level IV. See the Guidelines for Authors for a complete description of levels of evidence.
Frequency of metabolic abnormalities in urinary stones patients
Ahmad, Iftikhar; Pansota, Mudassar Saeed; Tariq, Muhammad; Tabassum, Shafqat Ali
2013-01-01
Objective: To determine the frequency of metabolic abnormalities in the serum and urine of patients with urinary stones disease. Methods: Two hundred patients with either multiple or recurrent urolithiasis diagnosed on ultrasonography and intravenous urography were included in this study. 24 hour urine sample were collected from each patient and sent for PH, specific gravity, Creatinine, uric acid, calcium, phosphate, oxalate, citrate and magnesium. In addition, blood sample of each patient was also sent for serum levels of urea, creatinine, uric acid, phosphate and calcium. Results: Mean age of patients was 38 ± 7.75 years with male to female ratio of 2:1. The main presenting complaint was lumber pain and 82.5% patients were found to have calcium oxalate stones on chemical analysis. Metabolic abnormalities were found in 90.5% patients, whereas there were no metabolic abnormalities in 19 (9.5%) patients. Forty patients (21.5%) only had one metabolic abnormality and 157 (78.5%) patients had multiple metabolic abnormalities. Hyperoxaluria was the most commonly observed metabolic abnormality and was found in 64.5% patients. Other significant metabolic abnormalities were hypercalciuria, Hypercalcemia, hypocitraturia and hyperuricemia. Conclusion: This study concludes that frequency of metabolic abnormalities is very high in patients with urolithiasis and hyperoxaluria, hypercalciuria and hypocitraturia are the most important metabolic abnormalities observed in these patients. PMID:24550954
Frequency of metabolic abnormalities in urinary stones patients.
Ahmad, Iftikhar; Pansota, Mudassar Saeed; Tariq, Muhammad; Tabassum, Shafqat Ali
2013-11-01
To determine the frequency of metabolic abnormalities in the serum and urine of patients with urinary stones disease. Two hundred patients with either multiple or recurrent urolithiasis diagnosed on ultrasonography and intravenous urography were included in this study. 24 hour urine sample were collected from each patient and sent for PH, specific gravity, Creatinine, uric acid, calcium, phosphate, oxalate, citrate and magnesium. In addition, blood sample of each patient was also sent for serum levels of urea, creatinine, uric acid, phosphate and calcium. Mean age of patients was 38 ± 7.75 years with male to female ratio of 2:1. The main presenting complaint was lumber pain and 82.5% patients were found to have calcium oxalate stones on chemical analysis. Metabolic abnormalities were found in 90.5% patients, whereas there were no metabolic abnormalities in 19 (9.5%) patients. Forty patients (21.5%) only had one metabolic abnormality and 157 (78.5%) patients had multiple metabolic abnormalities. Hyperoxaluria was the most commonly observed metabolic abnormality and was found in 64.5% patients. Other significant metabolic abnormalities were hypercalciuria, Hypercalcemia, hypocitraturia and hyperuricemia. This study concludes that frequency of metabolic abnormalities is very high in patients with urolithiasis and hyperoxaluria, hypercalciuria and hypocitraturia are the most important metabolic abnormalities observed in these patients.
Gürbüz Özgür, Börte; Aksu, Hatice; Birincioğlu, Mustafa; Dost, Turhan
2015-11-01
Allopurinol is a xanthine oxidase enzyme inhibitor that is widely used for the treatment of hyperuricemia and gout. The activity of tryptophan 2,3-dioxygenase, which metabolizes tryptophan (TRP), is decreased by xanthine oxidase inhibitors, causing TRP levels in the body to be increased. Increases in TRP levels in the brain might have antidepressant effects. The purpose of this study is to evaluate the antidepressant effects of allopurinol compared to those of fluoxetine, which is a proven antidepressant. Thirty-two Wistar albino male rats were divided into four groups (control, 10mg/kg fluoxetine, 50mg/kg allopurinol, 50mg/kg allopurinol+10 mg/kg fluoxetine; n=8 per group), and forced swimming tests were performed before and after 14days of drug administration. Serotonin, 5-hydroxyindolacetic acid and uric acid levels were measured in blood samples after the final treatment. When allopurinol and fluoxetine were administered separately, a decrease in the duration of immobility and an increased duration of swimming were observed in the forced swimming test. The results showed similar antidepressant efficacies between allopurinol and fluoxetine. However, we found no statistically significant difference in the antidepressant effect of the combined therapy versus single drug therapy. Copyright © 2015 Elsevier Inc. All rights reserved.
Zeng, Qing Yu; Chen, Ren; Darmawan, John; Xiao, Zheng Yu; Chen, Su Biao; Wigley, Richard; Le Chen, Shun; Zhang, Nai Zheng
2008-01-01
Introduction Epidemiological studies of rheumatic diseases have been conducted during the past 20 years in China. The aim of this study was to clarify prevalence rates of common rheumatic diseases in China. Methods Relevant reports of population-based surveys conducted from 1980 to 2006 were retrieved. Studies using the World Health Organization-International League of Associations for Rheumatology COPCORD (Community Oriented Program for Control of Rheumatic Diseases) protocol and those that did not employ this protocol but were published in recognized journals were identified and analyzed. Results Thirty-eight surveys including 241,169 adults from 25 provinces/cities were pooled for analysis. The prevalence of rheumatic complaints ranged from 11.6% to 46.4%, varying by locality, study protocol and age of the people surveyed. Prevalence of symptomatic osteoarthritis (OA) varied from 5.1% to 20.8%, with common sites of involvement being the lumbar spine, knee joint and cervical spine. Compared with rates of radiographic and symptomatic knee OA in the USA, elderly men in Beijing exhibited similar prevalence rates and elderly women exhibited a higher prevalence. The prevalence of hip OA and hand OA was much lower in Chinese than in Caucasian populations, but both kinds of OA were more common in coal miners. The prevalence of ankylosing spondylitis ranged from 0.2% to 0.54% among Han ethnic Chinese and were lower among mixed ethnic populations. The prevalence of psoriatic arthritis ranged from 0.01% to 0.1%, and that of reactive arthritis was 0.02%; undifferentiated spondyloarthropathy was identified in 0.64% to 1.2% of the individuals included in the surveys. The prevalence of rheumatoid arthritis (RA) ranged from 0.2% to 0.93%, with the highest rate being reported from a Taiwan urban area. In mainland China there were no significant differences in prevalence of RA between the northern and southern parts of China, or between different ethnic groups. The prevalence of hyperuricemia increased after the 1980s. The prevalence of gout was found to have increased in recent decades from 0.15% to 1.98%, apart from in the Taiwan aborigines, among whom the highest prevalence rate of 11.7% was recorded. The prevalence of primary Sjögren's syndrome in Beijing was 0.77% by the Copenhagen criteria and 0.33% by the San Diego criteria. The prevalence of soft tissue rheumatism was 2.5% to 5.7%. Fibromyalgia was seldom observed in China. Conclusion Rheumatic diseases are common in China. The prevalence of rheumatic complaints varied with the locality surveyed. The prevalence of OA is comparable with that in Western countries but varies in terms of joint involvement. The prevalence of ankylosing spondylitis is similar to that in Caucasians. Except in Taiwan, the prevalence of RA in China is lower than that in developed countries. The prevalence of hyperuricemia and gout increased after the 1980s, but it remains lower than that in developed countries. More studies are required to evaluate prevalence rates among minority groups in the west and northwest parts of China, and further study is needed to address fibromyalgia in China. PMID:18237382
Han, Jia; Liu, Ying; Rao, Fangwen; Nievergelt, Caroline M.; O’Connor, Daniel T.; Wang, Xingyu; Liu, Lisheng; Bu, Dingfang; Liang, Yu; Wang, Fang; Zhang, Luxia; Zhang, Hong; Chen, Yuqing; Wang, Haiyan
2013-01-01
Uromodulin (UMOD) genetic variants cause familial juvenile hyperuricemic nephropathy, characterized by hyperuricemia, decreased renal excretion of UMOD and uric acid; such findings suggest a role for UMOD in the regulation of plasma uric acid. We screened common variants across the UMOD locus in two populations, one from a community-based Chinese population, the other from California twins and siblings. Transcriptional activity of promoter variants was estimated in luciferase reporter plasmids transfected into HEK293 cells and mlMCD3 cells. By variance components in twin pairs, uric acid concentration and excretion were heritable traits. In the primary population from Beijing, we identified that carriers of haplotype GCC displayed higher plasma uric acid, and 3 UMOD promoter variants associated with plasma uric acid. UMOD promoter variants displayed reciprocal effects on urine uric acid excretion and plasma uric acid concentration, suggesting a primary effect on renal tubular handling of urate. These UMOD genetic marker-on-trait associations for uric acid were replicated in an independent American population sample. Site-directed mutagenesis at trait-associated UMOD promoter variants altered promoter activity in transfected luciferase reporter plasmids. These results suggest that UMOD promoter variants seem to initiate a cascade of transcriptional and biochemical changes influencing UMOD secretion, eventuating in elevation of plasma uric acid. PMID:23344472
Risk Factors for Gout and Prevention: A Systematic Review of the Literature
Singh, Jasvinder A.; Reddy, Supriya G.; Kundukulam, Joseph
2014-01-01
Purpose Our objective was to perform a systematic review of risk factors and prevention of gout. We searched Medline for fully published reports in English using keywords including but not limited to “gout”, “epidemiology”, “primary prevention”, “secondary prevention”, “risk factors’. Data from relevant articles meeting inclusion criteria was extracted using standardized forms. Main Findings Of the 751 titles and abstracts, 53 studies met the criteria and were included in the review. Several risk factors were studied. Alcohol consumption increased the risk of incident gout, especially beer and hard liquor. Several dietary factors increased the risk of incident gout, including meat intake, seafood intake, sugar sweetened soft drinks, and consumption of foods high in fructose. Diary intake, folate intake and coffee consumption were each associated with a lower risk of incident gout and in some cases a lower rate of gout flares. Thiazide and loop diuretics were associated with higher risk of incident gout and higher rate of gout flares. Hypertension, renal insufficiency, hypertriglyceridemia, hypercholesterolemia, hyperuricemia, diabetes, obesity and early menopause were each associated with a higher risk of incident gout and/or gout flares. Summary Several dietary risk factors for incident gout and gout flares are modifiable. Prevention and optimal management of comorbidities is likely to decreased risk of gout. Research in preventive strategies for the treatment of gout is needed. PMID:21285714
Managing Gout Flares in the Elderly: Practical Considerations.
Abhishek, Abhishek
2017-12-01
Gout is common in the elderly, affecting an estimated 4.7 million people aged > 60 years in the USA alone. The incidence and prevalence of gout increases, and male predisposition to gout reduces, with increasing age. The elderly have more comorbidities, and gout manifests differently, with more frequent involvement of knees, ankles, and wrists at disease onset, systemic upset, and tophi. Comorbidities and polypharmacy make the management of gout flares challenging in this population. Intra-articular corticosteroid injection remains the treatment of choice for accessible joints, oral prednisolone is preferred over low-dose colchicine, and non-steroidal anti-inflammatory drugs (NSAIDs) are best avoided. Xanthine oxidase inhibitors (XOI) remain the first-line treatment for hyperuricemia in the elderly. Arhalofenate, an emerging uricosuric anti-inflammatory drug, prevents gout flares while reducing serum urate. It may be particularly relevant in the treatment of gout in the elderly as they are unable to tolerate long-term colchicine for flare prophylaxis and frequently have contraindications to corticosteroids and NSAIDs. However, given its modest urate-lowering effect, it can only be used in combination with an XOI, and the safety and efficacy of this drug has not been examined in the elderly or in those with chronic kidney disease. Diuretics and beta-blockers should be discontinued where feasible, whereas low-dose aspirin can be continued if otherwise indicated.
Research progress in the genetics of hyperuricaemia and gout.
Zheng, Min; Ma, Jun-wu
2016-04-01
Gout is one of the most common inflammatory arthritis caused by hyperuricaemia, which is affected by both genetic factors and environmental factors. Early researches show that a few of rare monogenic mutations, such as PRPS1 and HPRT1 mutations, lead to abnormal purine anabolism and then cause hyperuricaemia and gout. In recent years, genome-wide association studies (GWAS) have identified dozens of susceptibility loci and/or candidate genes associated with hyperuricemia and gout. Loss-of-function mutations in SLC2A9, SLC22A11, and SLC22A12 cause hereditary hypouricaemia, while their overexpression may increase the reabsorption of uric acid. In contrast, loss-of-function mutations in ABCG2, SLC17A1, and SLC17A3 cause urate underexcretion of renal and intestinal. These variations leading to blood uric acid excretion disorder (excess reabsorption and underexcretion) are the main genetic factors affecting hyperuicemia and gout. Moreover, to some degree, inhibins-activins growth factor system, transcription factors, cytoskeleton and gene-environment interaction can also affect the level of blood uric acid. In addition, two risk genes, RFX3 and KCNQ1, which might impair immune response and lead to functional deficiency of beta cell were recently discovered to influence hyperuiceamia and gout in Han Chinese. This paper systematically reviews genetic studies on hyperuricaemia and gout to improve our understanding of pathogenesis of hyperuricaemia and gout.
Identification of rs671, a common variant of ALDH2, as a gout susceptibility locus.
Sakiyama, Masayuki; Matsuo, Hirotaka; Nakaoka, Hirofumi; Yamamoto, Ken; Nakayama, Akiyoshi; Nakamura, Takahiro; Kawai, Sayo; Okada, Rieko; Ooyama, Hiroshi; Shimizu, Toru; Shinomiya, Nariyoshi
2016-05-16
Gout is a common disease resulting from hyperuricemia. Recently, a genome-wide association study identified an association between gout and a single nucleotide polymorphism (SNP) rs2188380, located on an intergenic region between MYL2 and CUX2 on chromosome 12. However, other genes around rs2188380 could possibly be gout susceptibility genes. Therefore, we performed a fine-mapping study of the MYL2-CUX2 region. From 8,595 SNPs in the MYL2-CUX2 region, 9 tag SNPs were selected, and genotyping of 1,048 male gout patients and 1,334 male controls was performed by TaqMan method. Eight SNPs showed significant associations with gout after Bonferroni correction. rs671 (Glu504Lys) of ALDH2 had the most significant association with gout (P = 1.7 × 10(-18), odds ratio = 0.53). After adjustment for rs671, the other 8 SNPs no longer showed a significant association with gout, while the significant association of rs671 remained. rs671 has been reportedly associated with alcohol drinking behavior, and it is well-known that alcohol drinking elevates serum uric acid levels. These data suggest that rs671, a common functional SNP of ALDH2, is a genuine gout-associated SNP in the MYL2-CUX2 locus and that "A" allele (Lys) of rs671 plays a protective role in the development of gout.
Pang, Hui; Han, Bing; Fu, Qiang; Zong, Zhenkun
2017-07-05
The presence of acute myocardial infarction (AMI) confers a poor prognosis in atrial fibrillation (AF), associated with increased mortality dramatically. This study aimed to evaluate the predictive value of CHADS 2 and CHA 2 DS 2 -VASc scores for AMI in patients with AF. This retrospective study enrolled 5140 consecutive nonvalvular AF patients, 300 patients with AMI and 4840 patients without AMI. We identified the optimal cut-off values of the CHADS 2 and CHA 2 DS 2 -VASc scores each based on receiver operating characteristic curves to predict the risk of AMI. Both CHADS 2 score and CHA 2 DS 2 -VASc score were associated with an increased odds ratio of the prevalence of AMI in patients with AF, after adjustment for hyperlipidaemia, hyperuricemia, hyperthyroidism, hypothyroidism and obstructive sleep apnea. The present results showed that the area under the curve (AUC) for CHADS 2 score was 0.787 with a similar accuracy of the CHA 2 DS 2 -VASc score (AUC 0.750) in predicting "high-risk" AF patients who developed AMI. However, the predictive accuracy of the two clinical-based risk scores was fair. The CHA 2 DS 2 -VASc score has fair predictive value for identifying high-risk patients with AF and is not significantly superior to CHADS 2 in predicting patients who develop AMI.
Wang, Jing; Shi, Dongfang; Zheng, Meizhu; Ma, Bing; Cui, Jing; Liu, Chunming; Liu, Chengyu
2017-11-01
Natural products have become one of the most important resources for discovering novel xanthine oxidase inhibitors, which are commonly employed in the treatment of hyperuricemia and gout. However, to date, few reports exist regarding the use of monoterpene glycosides as xanthine oxidase inhibitors. Thus, we herein report the use of ultrafiltration coupled with liquid chromatography in the screening of monoterpene glycoside xanthine oxidase inhibitors from the extract of Paeonia lactiflora (P. lactiflora), and both high-performance counter-current chromatography and medium-pressure liquid chromatography were employed to separate the main constituents. Furthermore, the xanthine oxidase inhibitory activities and the mechanisms of inhibition of the isolated compounds were evaluated using a multi-mode microplate reader by Molecular Devices. As a result, three monoterpene glycosides were separated by combined high-performance counter-current chromatography and medium-pressure liquid chromatography in purities of 90.4, 98.0, and 86.3%, as determined by liquid chromatography. These three compounds were identified as albiflorin, paeoniflorin, and 1-O-β-ᴅ-glucopyranosyl-8-O-benzoylpaeonisuffrone by electrospray ionization tandem mass spectrometry, and albiflorin and paeoniflorin were screened as potential xanthine oxidase inhibitors by ultrafiltration with liquid chromatography. The evaluation results of xanthine oxidase inhibitory activity corresponded with the screening results, as only albiflorin and paeoniflorin exhibited xanthine oxidase inhibitory activity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seegmiller, J.E.; Dixon, R.M.; Kemp, G.J.
The hyperuricemia responsible for the development of gouty arthritis results from a wide range of environmental factors and underlying genetically determined aberrations of metabolism. {sup 31}P magnetic resonance spectroscopy studies of children with hereditary fructose intolerance revealed a readily detectable rise in phosphomonoesters with a marked fall in inorganic phosphate in their liver in vivo and a rise in serum urate in response to very low doses of oral fructose. Parents and some family members heterozygous for this enzyme deficiency showed a similar pattern when given a substantially larger dose of fructose. Three of the nine heterozygotes thus identified alsomore » had clinical gout, suggesting the possibility of this defect being a fairly common cause of gout. In the present study this same noninvasive technology was used to identify the same spectral pattern in 2 of the 11 families studied with hereditary gout. In one family, the index patient's three brothers and his mother all showed the fructose-induced abnormality of metabolism, in agreement with the maternal inheritance of metabolism, in agreement with the maternal inheritance of the gout in this family group. The test dose of fructose used produced a significantly larger increment in the concentration of serum urate in the patients showing the changes in {sup 31}P magnetic resonance spectra than in the other patients with familial gout or in nonaffected members, thus suggesting a simpler method for initial screening for the defect.« less
Sakuta, Hidenari; Suzuki, Takashi
2008-03-01
To assess the validity of the criterion of overweight for Asian people that is recommended by Western Pacific Region of the World Health Organization. We carried out a cross-sectional analysis of the association between the criterion of overweight for ethnic Asian people--body mass indices (BMI) of 23.0-24.9 kg/m(2)--and the presence of obesity-related metabolic disorders among middle-aged Japanese men (n = 974, age range 51-59). The odds ratios (95% confidence interval) of overweight to those with normal weight (BMI < 23.0 kg/m(2)) were 1.61 (1.11-2.33) for the presence of impaired glucose tolerance, 1.95 (1.30-2.93) for hypertension, 2.22 (1.63-3.03) for hypercholesterolemia, 2.83 (2.02-3.97) for hypertriglyceridemia, and 2.06 (1.06-4.00) for hyperuricemia. Overweight was not associated with the presence of type 2 diabetes or with high gamma-glutamyl transferase in the present study (odds ratios: 1.09 and 1.05, respectively). Adjustment for age, rank, and lifestyle factors affected the results only slightly. Based on these results, we conclude that the Asian criterion of overweight appears to be rational in terms of its association with obesity-related metabolic disorders in male personnel of the Japan Self-Defense Forces in their fifties.
Previous Dosage of Allopurinol Is a Strong Determinant of Febuxostat Efficacy.
Koide, Hiroyoshi; Hira, Daiki; Tsujimoto, Masayuki; Katsube, Yurie; Minegaki, Tetsuya; Uzu, Takashi; Ikeda, Yoshito; Morita, Shin-Ya; Nishiguchi, Kohshi; Terada, Tomohiro
2017-01-01
Febuxostat has currently played pivotal role in the treatment of hyperuricemia, but there is little comprehensive information for the determinants of individual difference in efficacy of febuxostat. Therefore, the present study, a retrospective investigation, was carried out to analyze the effects of patient characteristics on the efficacy of febuxostat. A total of 225 patients who were continuously prescribed the same dose of febuxostat for 8-12 weeks from the initial therapy were enrolled in the present study. The data, including patient information and laboratory data, were collected from electronic medical records. Serum urate lowering effects of febuxostat were evaluated by calculating the change in serum urate level at baseline and at 8-12 weeks after starting febuxostat. The multiple regression analysis showed the change in serum urate level was significantly lower in male patients and in those with a lower baseline serum urate level, higher previous dose of allopurinol, lower dose of febuxostat and lower body surface area-unadjusted estimated glomerular filtration rate. Concomitantly administered drugs did not show a significantly influence on the efficacy of febuxostat. In conclusion, it should be noted that the serum urate lowering efficacy of febuxostat may decrease in patients with a higher previous dose of allopurinol, renal impairment or male patients. The basic findings of the present study are believed to contribute to the proper use of febuxostat.
Šmelcerović, Andrija; Tomović, Katarina; Šmelcerović, Žaklina; Petronijević, Živomir; Kocić, Gordana; Tomašič, Tihomir; Jakopin, Žiga; Anderluh, Marko
2017-07-28
Xanthine oxidase (XO), a versatile metalloflavoprotein enzyme, catalyzes the oxidative hydroxylation of hypoxanthine and xanthine to uric acid in purine catabolism while simultaneously producing reactive oxygen species. Both lead to the gout-causing hyperuricemia and oxidative damage of the tissues where overactivity of XO is present. Over the past years, significant progress and efforts towards the discovery and development of new XO inhibitors have been made and we believe that not only experts in the field, but also general readership would benefit from a review that addresses this topic. Accordingly, the aim of this article was to overview and select the most potent recently reported XO inhibitors and to compare their structures, mechanisms of action, potency and effectiveness of their inhibitory activity, in silico calculated physico-chemical properties as well as predicted pharmacokinetics and toxicity. Derivatives of imidazole, 1,3-thiazole and pyrimidine proved to be more potent than febuxostat while also displaying/possessing favorable predicted physico-chemical, pharmacokinetic and toxicological properties. Although being structurally similar to febuxostat, these optimized inhibitors bear some structural freshness and could be adopted as hits for hit-to-lead development and further evaluation by in vivo studies towards novel drug candidates, and represent valuable model structures for design of novel XO inhibitors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Sakai, Daisuke; Chung, Hyun Cheol; Oh, Do-Youn; Park, Se Hoon; Kadowaki, Shigenori; Kim, Yeul Hong; Tsuji, Akihito; Komatsu, Yoshito; Kang, Yoon-Koo; Uenaka, Kazunori; Wijayawardana, Sameera R; Wacheck, Volker; Wang, Xuejing; Yamamura, Ayuko; Doi, Toshihiko
2017-12-01
Mesenchymal-epithelial transition factor (MET) is expressed in gastric cancer and associated with poor clinical outcomes. We assessed activity, safety, and pharmacokinetics of emibetuzumab, a bivalent monoclonal anti-MET antibody that blocks ligand-dependent and ligand-independent MET signaling. This non-randomized, single-arm, Phase 2 study enrolled Asian patients with MET diagnostic positive advanced gastric adenocarcinoma. Emibetuzumab (2000 mg, intravenous) was given on days 1 and 15 (28-day cycle). The primary endpoint was 8-week progression-free survival rate. Secondary objectives included safety, pharmacokinetics, overall survival, and change in tumor size. Tumors from 65 patients were immunohistochemically screened to enroll 15 MET diagnostic positive patients (23% positivity; 8 Japanese, 7 Korean; 10 male). Eight-week progression-free survival rate was 0.47 (70% CI, 0.33-0.59). Disease control rate was 40% (target lesion decreases, three patients; no complete/partial responses according to RECIST). Median overall survival was 17.1 weeks (95% CI, 6.3-not achievable). No serious emibetuzumab-related adverse events or new safety signals emerged. Grade ≥ 3 possibly drug-related adverse events were hyperkalemia, hyponatremia, and hyperuricemia (one each). Emibetuzumab's pharmacokinetics profile was similar to that observed previously. MET expression and clinical outcomes were not obviously associated. Emibetuzumab was well tolerated with limited single-agent activity in advanced gastric adenocarcinoma.
Johnson, Richard J; Bakris, George L; Borghi, Claudio; Chonchol, Michel B; Feldman, David; Lanaspa, Miguel A; Merriman, Tony R; Moe, Orson W; Mount, David B; Sanchez Lozada, Laura Gabriella; Stahl, Eli; Weiner, Daniel E; Chertow, Glenn M
2018-06-01
Urate is a cause of gout, kidney stones, and acute kidney injury from tumor lysis syndrome, but its relationship to kidney disease, cardiovascular disease, and diabetes remains controversial. A scientific workshop organized by the National Kidney Foundation was held in September 2016 to review current evidence. Cell culture studies and animal models suggest that elevated serum urate concentrations can contribute to kidney disease, hypertension, and metabolic syndrome. Epidemiologic evidence also supports elevated serum urate concentrations as a risk factor for the development of kidney disease, hypertension, and diabetes, but differences in methodologies and inpacts on serum urate concentrations by even subtle changes in kidney function render conclusions uncertain. Mendelian randomization studies generally do not support a causal role of serum urate in kidney disease, hypertension, or diabetes, although interpretation is complicated by nonhomogeneous populations, a failure to consider environmental interactions, and a lack of understanding of how the genetic polymorphisms affect biological mechanisms related to urate. Although several small clinical trials suggest benefits of urate-lowering therapies on kidney function, blood pressure, and insulin resistance, others have been negative, with many trials having design limitations and insufficient power. Thus, whether uric acid has a causal role in kidney and cardiovascular diseases requires further study. Copyright © 2018 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
[Alcohol intake and gamma -GTP observed from the viewpoint of an occupational physician].
Oikawa, Takamitsu
2007-06-01
Alcohol is an important basic factor in health management at the workplace. The fact is, however, when alcohol is pervasive in a worker's daily life, effective measures are very difficult to carry out. We examined an intervention program based on serum y -GTP (IU/l) measurements at physical examination. Subjects were clients of the Keio Counseling Center in2005 (male, 5568: female, 1725). Among nondrinkers, gamma-GTP values were under 50 in 83% of men and 93% of women. Relative risk of lifestyle-related diseases (obesity, hypertension, hyperlipidemia, hyperuricemia, hyperglycemia and fatty liver) among male drinkers increased dramatically when gamma-GTP exceeded 50,with a further gradual increase for gamma-GTP over 100. Moreover, relative risk of over two concurrent diseases among obesity, hypertension, hyperlipidemia and hyperglycemia increased when gamma-GTP exceeded 25 and greatly increased beyond 50. While the findings suggest 25 or less as an ideal gamma-GTP values, a workplace program might more practically regard values over 50 as a threshold for management measures and values over 100 as indicating enforced management. At the workplace, management of other diseases including lifestyle-related diseases, alcoholism per se, and mental health issues needs to be carried out in a balanced, coordinated manner. Cooperation of related medical institutions and effective alcohol treatment program, and efforts to enlist the understanding and trust of all workers are needed.
Refrigeration is not necessary for measurement of uric acid in patients treated with rasburicase.
Lindeman, Neal I; Melanson, Stacy E F; McDonnell, Anne; DeAngelo, Daniel J; Jarolim, Petr
2013-05-01
Rasburicase, used for hyperuricemia of tumor lysis syndrome, retains activity at room temperature (RT) in in vitro studies. Cold-temperature handling is recommended for uric acid measurements in patients receiving rasburicase: collection in prechilled tubes, transportation on ice, and 4°C centrifugation. We performed a prospective study of these requirements. A total of 65 pairs of blood samples were collected from 34 patients, 12-24 h after receiving rasburicase. The effect of temperature on uric acid concentration was tested on paired samples handled either at RT or when cold: centrifugation (18 sample pairs), collection tube (14 pairs), transportation (24 pairs), and nine pairs were retested after 1 h at RT. No significant temperature effect was seen on the uric acid measurements for any of the cold-handling steps: proportional, absolute biases were -1.4%, -0.06 mg/dL (centrifugation), -1.5%, +0.02 mg/dL (tube temperature), and -2.2%, -0.01 mg/dL (transportation). A 20% negative bias was seen in samples retested after 1 h at RT. Cold handling (prechilled tubes, iced transportation, 4°C centrifugation) was equivalent to RT for immediate measurement. An additional 1 h delay at RT led to a 20% decrease in uric acid. The cold handling measures required by the manufacturer are not necessary for uric acid testing of patients receiving rasburicase treatment, if testing is performed without delay.
Metformin ameliorates high uric acid-induced insulin resistance in skeletal muscle cells.
Yuan, Huier; Hu, Yaqiu; Zhu, Yuzhang; Zhang, Yongneng; Luo, Chaohuan; Li, Zhi; Wen, Tengfei; Zhuang, Wanling; Zou, Jinfang; Hong, Liangli; Zhang, Xin; Hisatome, Ichiro; Yamamoto, Tetsuya; Cheng, Jidong
2017-03-05
Hyperuricemia occurs together with abnormal glucose metabolism and insulin resistance. Skeletal muscle is an important organ of glucose uptake, disposal, and storage. Metformin activates adenosine monophosphate-activated protein kinase (AMPK) to regulate insulin signaling and promote the translocation of glucose transporter type 4 (GLUT4), thereby stimulating glucose uptake to maintain energy balance. Our previous study showed that high uric acid (HUA) induced insulin resistance in skeletal muscle tissue. However, the mechanism of metformin ameliorating UA-induced insulin resistance in muscle cells is unknown and we aimed to determine it. In this study, differentiated C2C12 cells were exposed to UA (15 mg/dl), then reactive oxygen species (ROS) was detected with DCFH-DA and glucose uptake with 2-NBDG. The levels of phospho-insulin receptor substrate 1 (IRS1; Ser307), phospho-AKT (Ser473) and membrane GLUT4 were examined by western blot analysis. The impact of metformin on UA-induced insulin resistance was monitored by adding Compound C, an AMPK inhibitor, and LY294002, a PI3K/AKT inhibitor. Our data indicate that UA can increase ROS production, inhibit IRS1-AKT signaling and insulin-stimulated glucose uptake, and induce insulin resistance in C2C12 cells. Metformin can reverse this process by increasing intracellular glucose uptake and ameliorating UA-induced insulin resistance. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Hantoushzadeh, Sedigheh; Sheikh, Mahdi; Javadian, Pouya; Shariat, Mamak; Amini, Elaheh; Abdollahi, Alireza; Kashanian, Maryam
2014-04-01
To assess the association of vaginal pH ≥ 5 in the absence of vaginal infection with systemic inflammation and adverse pregnancy outcome. Four-hundred sixty pregnant women completed the study, upon enrollment Vaginal pH was measured for all women, maternal and umbilical sera were obtained for determining C-reactive protein (CRP) and uric acid levels. Umbilical blood was tested for gas parameters, 1 and 5 min Apgar scores, the need for neonatal resuscitation and neonatal intensive care unit (NICU) admission were recorded. Elevated vaginal pH was significantly associated with preterm birth (odds ratio (OR), 2.23; 95% confidence interval (CI), 1.04-4.76), emergency cesarean section (OR 2.57; 95% CI 1.32-5), neonatal resuscitation in the delivery room (OR 2.85; 95% CI 1.1-7.38), elevated cord base deficit (OR 8.01; 95% CI 1.61-39.81), low cord bicarbonate (OR 4.16, 95% CI 1.33-12.92) and NICU admission (OR 2.02; 95% CI 1.12-3.66). Increased vaginal pH was also significantly associated with maternal leukocytosis, hyperuricemia and elevated CRP levels in maternal and umbilical sera. Elevated vaginal pH in the absence of current vaginal infection still constitutes a risk for adverse pregnancy outcome which is mediated by systemic inflammatory response.
[Consensus document for the detection and management of chronic kidney disease].
Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador
2014-01-01
Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.
Renal manifestations of primary mitochondrial disorders
Finsterer, Josef; Scorza, Fulvio
2017-01-01
The aim of the present review was to summarize and discuss previous findings concerning renal manifestations of primary mitochondrial disorders (MIDs). A literature review was performed using frequently used databases. The study identified that primary MIDs frequently present as mitochondrial multiorgan disorder syndrome (MIMODS) at onset or in the later course of the MID. Occasionally, the kidneys are affected in MIDs. Renal manifestations of MIDs include renal insufficiency, nephrolithiasis, nephrotic syndrome, renal cysts, renal tubular acidosis, Bartter-like syndrome, Fanconi syndrome, focal segmental glomerulosclerosis, tubulointerstitial nephritis, nephrocalcinosis, and benign or malign neoplasms. Among the syndromic MIDs, renal involvement has been most frequently reported in patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes syndrome, Kearns-Sayre syndrome, Leigh syndrome and mitochondrial depletion syndromes. Only in single cases was renal involvement also reported in chronic progressive external ophthalmoplegia, Pearson syndrome, Leber's hereditary optic neuropathy, coenzyme-Q deficiency, X-linked sideroblastic anemia and ataxia, myopathy, lactic acidosis, and sideroblastic anemia, pyruvate dehydrogenase deficiency, growth retardation, aminoaciduria, cholestasis, iron overload, lactacidosis, and early death, and hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis syndrome. The present study proposes that the frequency of renal involvement in MIDs is probably underestimated. Diagnosis of renal involvement follows general guidelines and treatment is symptomatic. Thus, renal manifestations of primary MIDs require recognition and appropriate management, as they determine the outcome of MID patients. PMID:28515908
Choi, Sung Won; Ryu, Ok Hee; Choi, Sun Jin; Song, In Sun; Bleyer, Anthony J; Hart, Thomas C
2005-10-01
As a consequence of uromodulin gene mutations, individuals develop precocious hyperuricemia, gout, and progressive renal failure. In vitro studies suggest that pathologic accumulation of uromodulin/Tamm-Horsfall glycoprotein (THP) occurs in the endoplasmic reticulum (ER), but the pathophysiology of renal damage is unclear. It was hypothesized that programmed cell death triggered by accumulation of misfolded THP in the ER causes progressive renal disease. Stably transfected human embryonic kidney 293 cells and immortalized thick ascending limb of Henle's loop cells with wild-type and mutated uromodulin cDNA were evaluated to test this hypothesis. Immunocytochemistry, ELISA, and deglycosylation studies indicated that accumulation of mutant THP occurred in the ER. FACS analyses showed a significant increase in early apoptosis signal in human embryonic kidney 293 and thick ascending limb of Henle's loop cells that were transfected with mutant uromodulin constructs. Colchicine and sodium 4-phenylbutyrate treatment increased secretion of THP from the ER to the cell membrane and into the culture media and significantly improved cell viability. These findings indicate that intracellular accumulation of THP facilitates apoptosis and that this may provide the pathologic mechanism responsible for the progressive renal damage associated with uromodulin gene mutations. Colchicine and sodium 4-phenylbutyrate reverse these processes and could potentially be beneficial in ameliorating the progressive renal damage in uromodulin-associated kidney diseases.
Kırça, M; Oğuz, N; Çetin, A; Uzuner, F; Yeşilkaya, A
2017-04-01
Hyperuricemia and angiotensin II (Ang II) may have a pathogenetic role in the development of hypertension and atherosclerosis as well as cardiovascular disease (CVD) and its prognosis. The purpose of this study was to investigate whether uric acid can induce proliferative pathways of vascular smooth muscle cell (VSMC) that are thought to be responsible for the development of CVD. The phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK), p44/42 mitogen-activated protein kinase (p44/42 MAPK) and platelet-derived growth factor receptor β (PDGFRβ) was measured by Elisa and Western blot techniques to determine the activation of proliferative pathways in primary cultured VSMCs from rat aorta. Results demonstrated that uric acid can stimulate p38 MAPK, p44/42 MAPK and PDGFRβ phosphorylation in a time- and concentration-dependent manner. Furthermore, treatment of VSMCs with the angiotensin II type I receptor (AT1R) inhibitor losartan suppressed p38 MAPK and p44/42 MAPK induction by uric acid. The stimulatory effect of uric acid on p38 MAPK was higher compared to that of Ang II. The results of this study show for the first time that uric acid-induced PDGFRβ phosphorylation plays a crucial role in the development of CVDs and that elevated uric acid levels could be a potential therapeutical target in CVD patients.
Uric acid stones increase the risk of chronic kidney disease.
Li, Ching-Chia; Chien, Tsu-Ming; Wu, Wen-Jeng; Huang, Chun-Nung; Chou, Yii-Her
2018-02-28
The aim of this study was to compare the clinical characteristics of uric acid stones and their potential risk for chronic kidney disease (CKD). A total of 401 patients (196 with uric acid stone and 205 without) were enrolled from our database of patients with urolithiasis. We analyzed the clinical demographic features, stone location, urine chemistries, and renal function. There was a significant difference (p < 0.001) between the two groups in terms of age, with the higher mean age in the uric acid group. Patients with uric acid stones had much lower pH of urine (p < 0.001) and higher serum uric acid level (p = 0.002). Notably, those with uric acid stones had worse eGFR than those with non-uric acid stones. Multivariate analysis confirmed that age over 60 years (ORs = 9.19; 95% CI 3.5-24.3), female sex (ORs = 4.01; 95% CI 1.8-9.0), hyperuricemia (ORs = 8.47; 95% CI 1.6-43.5), and uric acid stone (OR = 2.86; 95% CI 1.2-6.7) were the independent predictors of poor prognoses in CKD. Therefore, an association exists between uric acid stones and higher prevalence of CKD. Patients with uric acid stones may need close monitoring of renal function during follow-up.
Hirata, Go; Aoki, Shigeru; Sakamaki, Kentaro; Takahashi, Tsuneo; Hirahara, Fumiki; Ishikawa, Hiroshi
2016-01-01
To investigate clinical features of mirror syndrome. We retrospectively reviewed 71 cases of fetal hydrops with or without mirror syndrome, and compared with respect to maternal age, the body mass index, the primipara rate, the gestational age at delivery, the timing of fetal hydrops onset, the severity of fetal edema, placental swelling, the laboratory data and the fetal mortality. The data are expressed as the medians. Mirror syndrome developed in 29% (10/35) of the cases with fetal hydrops. In mirror group, the onset time of fetal hydrops was significantly earlier (29 weeks versus 31 weeks, p = 0.011), and the severity of fetal hydrops (fetal edema/biparietal diameter) was significantly higher than non-mirror group (0.23 versus 0.16, p < 0.001). There was significantly higher serum human chorionic gonadotropin (hCG) (453,000 IU/L versus 80,000 IU/L, p < 0.001) and lower hemoglobin (8.9 g/dL versus 10.1 g/dL, p =0.002), hypoalbuminemia (2.3 mg/dL versus 2.7 mg/dL, p = 0.007), hyperuricemia (6.4 mg/dL versus 5.0 mg/dL, p = 0.043) in mirror group. Mirror syndrome is occurred frequently in early and severe fetal hydrops and cause hemodilution and elevation of serum hCG.
Hoeltzenbein, Maria; Stieler, Katja; Panse, Mary; Wacker, Evelin; Schaefer, Christof
2013-01-01
Allopurinol is a purine analogue that inhibits xanthine oxidase. It is mainly used for the treatment of hyperuricemia in patients with gout or tumor lysis syndrome. Experience with allopurinol in pregnancy is scarce. In 2011, Kozenko et al. reported on a child with multiple malformations after maternal treatment with allopurinol throughout pregnancy. Possible teratogenicity of allopurinol was proposed due to the similarity of the pattern of malformations in children with mycophenolate embryopathy. A possible common mechanism of both drugs, i.e. disruption of purine synthesis, was discussed. We report on the outcome of 31 prospectively ascertained pregnancies with allopurinol exposure at least during first trimester. Pregnancy outcomes were 2 spontaneous abortions, 2 elective terminations of pregnancy and 27 live born children. The overall rate of major malformations (3.7%) and of spontaneous abortions (cumulative incidence 11%, 95%-CI 3–40) were both within the normal range. However, there was one child with severe malformations including microphthalmia, cleft lip and palate, renal hypoplasia, low-set ears, hearing deficit, bilateral cryptorchidism, and micropenis. The striking similarity of the anomalies in this child and the case described by Kozenko et al. might be considered as a signal for teratogenicity. Thus, we would recommend caution with allopurinol treatment in the first trimester, until further data are available. PMID:23840514
Managing blood pressure control in Asian patients: safety and efficacy of losartan.
Cheung, Tommy Tsang; Cheung, Bernard Man Yung
2014-01-01
Hypertension is common in Asian populations and is a major cause of cardiovascular diseases. The prevalence of hypertension is increasing in many Asian countries. The overall prevalence of hypertension in India and the People's Republic of China has been estimated to be 20.6% in men and 22.6% in women. However, the rates of detection, treatment, and control of hypertension remain low in Asia. This reflects a low level of literacy and education, as well as a low level of access to medical care. To overcome these obstacles, strategies targeted at education, promotion, and optimization of medical care, are crucial to achieve target blood pressure control. Angiotensin receptor blockers are one of the first-line treatments for essential hypertension because they confer better cardiovascular outcomes. Losartan has been widely evaluated for the management of hypertension. Although some studies suggested that the blood pressure-lowering effect of losartan is perhaps lower than for other angiotensin receptor blockers, losartan has been demonstrated to be beneficial in terms of renal protection in patients with diabetes, heart failure resulting from either systolic or diastolic dysfunction, and diuretic-induced hyperuricemia. However, most of these data were obtained from Caucasian populations. The efficacy and safety of losartan in Asian populations may be different because of genetic and ethnic variations. Therefore, the efficacy and safety of losartan in Asian patients with hypertension warrant further study.
Homozygous SLC2A9 Mutations Cause Severe Renal Hypouricemia
Gray, Nicola K.; Campbell, Susan; Shu, Xinhua; Sawyer, Lindsay; Richardson, William; Rechavi, Gideon; Amariglio, Ninette; Ganon, Liat; Sela, Ben-Ami; Bahat, Hilla; Goldman, Michael; Weissgarten, Joshua; Millar, Michael R.; Wright, Alan F.; Holtzman, Eliezer J.
2010-01-01
Hereditary hypouricemia may result from mutations in the renal tubular uric acid transporter URAT1. Whether mutation of other uric acid transporters produces a similar phenotype is unknown. We studied two families who had severe hereditary hypouricemia and did not have a URAT1 defect. We performed a genome-wide homozygosity screen and linkage analysis and identified the candidate gene SLC2A9, which encodes the glucose transporter 9 (GLUT9). Both families had homozygous SLC2A9 mutations: A missense mutation (L75R) in six affected members of one family and a 36-kb deletion, resulting in a truncated protein, in the other. In vitro, the L75R mutation dramatically impaired transport of uric acid. The mean concentration of serum uric acid of seven homozygous individuals was 0.17 ± 0.2 mg/dl, and all had a fractional excretion of uric acid >150%. Three individuals had nephrolithiasis, and three had a history of exercise-induced acute renal failure. In conclusion, homozygous loss-of-function mutations of GLUT9 cause a total defect of uric acid absorption, leading to severe renal hypouricemia complicated by nephrolithiasis and exercise-induced acute renal failure. In addition to clarifying renal handling of uric acid, our findings may provide a better understanding of the pathophysiology of acute renal failure, nephrolithiasis, hyperuricemia, and gout. PMID:19926891
Neiffer, Donald L; Lydick, Dianna; Burks, Kyle; Doherty, Donna
2005-12-01
Toxicosis associated with benzimidazole anthelmintics has been reported with increasing frequency in zoologic collections. Clinical signs, clinicopathologic abnormalities, and gross and histologic lesions are primarily the result of damage to the gastrointestinal and hematopoietic systems. Profound leukopenia, especially granulocytopenia, is the most common and severe clinicopathologic change associated with benzimidazole administration. Death usually occurs from overwhelming systemic bacterial and/or fungal infections secondary to severe immunosuppression. In this 125-day study, six male Hermann's tortoises (Testudo hermanni) were treated orally with two 5-day courses of fenbendazole 2 wk apart at a dosage of 50 mg/kg. Serial blood samples were used to assess hematologic and plasma biochemical changes before, during, and following the treatment period. Although the tortoises remained healthy, blood sampling indicated an extended heteropenia with transient hypoglycemia, hyperuricemia, hyperphosphatemia, and equivocal hyperproteinemia/hyperglobulinemia, which were considered to be in response to fenbendazole administration. Changes in several other clinicopathologic parameters appeared to correlate with fenbendazole administration. The hematologic and biochemical changes seen in the healthy animals in this study should be considered when treating compromised tortoises with fenbendazole. Hematologic and plasma biochemical status of tortoises/reptiles should be determined before treatment and monitored during the treatment period. The risk of mortality of an individual from nematode infection should be assessed relative to the potential for metabolic alteration and secondary septicemia following damage to hematopoietic and gastrointestinal systems by fenbendazole.
Managing blood pressure control in Asian patients: safety and efficacy of losartan
Cheung, Tommy Tsang; Cheung, Bernard Man Yung
2014-01-01
Hypertension is common in Asian populations and is a major cause of cardiovascular diseases. The prevalence of hypertension is increasing in many Asian countries. The overall prevalence of hypertension in India and the People’s Republic of China has been estimated to be 20.6% in men and 22.6% in women. However, the rates of detection, treatment, and control of hypertension remain low in Asia. This reflects a low level of literacy and education, as well as a low level of access to medical care. To overcome these obstacles, strategies targeted at education, promotion, and optimization of medical care, are crucial to achieve target blood pressure control. Angiotensin receptor blockers are one of the first-line treatments for essential hypertension because they confer better cardiovascular outcomes. Losartan has been widely evaluated for the management of hypertension. Although some studies suggested that the blood pressure-lowering effect of losartan is perhaps lower than for other angiotensin receptor blockers, losartan has been demonstrated to be beneficial in terms of renal protection in patients with diabetes, heart failure resulting from either systolic or diastolic dysfunction, and diuretic-induced hyperuricemia. However, most of these data were obtained from Caucasian populations. The efficacy and safety of losartan in Asian populations may be different because of genetic and ethnic variations. Therefore, the efficacy and safety of losartan in Asian patients with hypertension warrant further study. PMID:24672231
Yang, Hongbo; Wang, Linjie; Qiu, Xiaonan; Yan, Kemin; Gong, Fengying; Zhu, Huijuan; Pan, Hui
2018-04-25
Recombinant human growth hormone (rhGH) replacement therapy is usually stopped after linear growth completion in patients with growth hormone deficiency. In patients with multiple pituitary hormone deficiency (MPHD), the long-term effects of discontinuation of rhGH replacement are unknown. In this study, the anthropometric and metabolic parameters of 24 male patients with adult growth hormone deficiency (AGHD) due to MPHD in childhood after cessation of rhGH therapy for a mean of 7.1 years were measured and compared with 35 age-matched controls. Body composition was evaluated by bioelectrical impedance analysis (BIA). In the AGHD group, body mass index (BMI) was significantly increased and 29.2% had obesity. The AGHD group had a 17.7 cm increase in waist circumference (WC). The fat free mass (FFM) was significantly lower in the AGHD group. Both the fat mass (FM) and percentage of fat mass (FM%) were significantly increased in the AGHD group. Both the systolic blood pressure (BP) and diastolic pressure were significantly lower in AGHD group. The lipid profile was generally similar in both groups, except for a decrease of high density lipoprotein-cholesterol (HDL-C) in the AGHD group. There was significant hyperuricemia in the AGHD group. Cessation of rhGH leads to a significant increase of FM in early adulthood in male patients with childhood-onset MPHD (CO-MPHD).
Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y
2013-11-01
Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.
[Glycogen storage disease type Ⅰa: a rare cause of gout in adolescent and young adult patients].
Xu, N; Huang, X M; Fang, W G; Zhang, Y; Qiu, Z Q; Zeng, X J
2018-04-01
Objective: To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰa (GSD Ⅰa), so as to improve the awareness of this disease. Methods: The clinical features, laboratory findings, treatments and prognosis of 5 GSD Ⅰa patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed. GSD Ⅰa was confirmed by liver biopsy and genotyping. Results: Among the 5 patients (median age: 27 years), 3 were males and 2 were females. The mean age of gout onset was 17 ranging from 10 to 22 years old. The common manifestations of GSD included hepatomegaly since childhood, hypoglycemia, growth retardation, anemia, hyperlactacidemia and hyperlipidemia. All the 5 patients were complicated with gouty tophi and kidney stone. Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms, respectively. Renal damage occurred in 3 cases. All the patients underwent several therapeutic modalities including lifestyle intervention, allopurinol, and raw corn starch treatment. Conclusions: Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi. GSD should be suspected if there exist clinical manifestations like hepatomegaly, recurrent hypoglycemia, growth retardation. Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.
Effects of multiple genetic loci on the pathogenesis from serum urate to gout
Dong, Zheng; Zhou, Jingru; Jiang, Shuai; Li, Yuan; Zhao, Dongbao; Yang, Chengde; Ma, Yanyun; Wang, Yi; He, Hongjun; Ji, Hengdong; Yang, Yajun; Wang, Xiaofeng; Xu, Xia; Pang, Yafei; Zou, Hejian; Jin, Li; Wang, Jiucun
2017-01-01
Gout is a common arthritis resulting from increased serum urate, and many loci have been identified that are associated with serum urate and gout. However, their influence on the progression from elevated serum urate levels to gout is unclear. This study aims to explore systematically the effects of genetic variants on the pathogenesis in approximately 5,000 Chinese individuals. Six genes (PDZK1, GCKR, TRIM46, HNF4G, SLC17A1, LRRC16A) were determined to be associated with serum urate (PFDR < 0.05) in the Chinese population for the first time. ABCG2 and a novel gene, SLC17A4, contributed to the development of gout from hyperuricemia (OR = 1.56, PFDR = 3.68E-09; OR = 1.27, PFDR = 0.013, respectively). Also, HNF4G is a novel gene associated with susceptibility to gout (OR = 1.28, PFDR = 1.08E-03). In addition, A1CF and TRIM46 were identified as associated with gout in the Chinese population for the first time (PFDR < 0.05). The present study systematically determined genetic effects on the progression from elevated serum urate to gout and suggests that urate-associated genes functioning as urate transporters may play a specific role in the pathogenesis of gout. Furthermore, two novel gout-associated genes (HNF4G and SLC17A4) were identified. PMID:28252667
Effects of multiple genetic loci on the pathogenesis from serum urate to gout.
Dong, Zheng; Zhou, Jingru; Jiang, Shuai; Li, Yuan; Zhao, Dongbao; Yang, Chengde; Ma, Yanyun; Wang, Yi; He, Hongjun; Ji, Hengdong; Yang, Yajun; Wang, Xiaofeng; Xu, Xia; Pang, Yafei; Zou, Hejian; Jin, Li; Wang, Jiucun
2017-03-02
Gout is a common arthritis resulting from increased serum urate, and many loci have been identified that are associated with serum urate and gout. However, their influence on the progression from elevated serum urate levels to gout is unclear. This study aims to explore systematically the effects of genetic variants on the pathogenesis in approximately 5,000 Chinese individuals. Six genes (PDZK1, GCKR, TRIM46, HNF4G, SLC17A1, LRRC16A) were determined to be associated with serum urate (P FDR < 0.05) in the Chinese population for the first time. ABCG2 and a novel gene, SLC17A4, contributed to the development of gout from hyperuricemia (OR = 1.56, P FDR = 3.68E-09; OR = 1.27, P FDR = 0.013, respectively). Also, HNF4G is a novel gene associated with susceptibility to gout (OR = 1.28, P FDR = 1.08E-03). In addition, A1CF and TRIM46 were identified as associated with gout in the Chinese population for the first time (P FDR < 0.05). The present study systematically determined genetic effects on the progression from elevated serum urate to gout and suggests that urate-associated genes functioning as urate transporters may play a specific role in the pathogenesis of gout. Furthermore, two novel gout-associated genes (HNF4G and SLC17A4) were identified.
Tang, Hong-Jin; Li, Wei; Zhou, Mei; Peng, Li-Ying; Wang, Jin-Xin; Li, Jia-Huang; Chen, Jun
2018-05-10
Xanthine oxidase, which catalyzes the oxidative reaction of hypoxanthine and xanthine into uric acid, is a key enzyme to the pathogenesis of hyperuricemia and gout. In this study, for the purpose of discovering novel xanthine oxidase (XO) inhibitors, a series of 2-arylbenzo[b]furan derivatives (3a-3d, 4a-4o and 6a-6d) were designed and synthesized. All these compounds were evaluated their xanthine oxidase inhibitory and antioxidant activities by using in vitro enzymatic assay and cellular model. The results showed that a majority of the designed compounds exhibited potent xanthine oxidase inhibitory effects and antioxidant activities, and compound 4a emerged as the most potent xanthine oxidase inhibitor (IC 50 = 4.45 μM). Steady-state kinetic measurements of the inhibitor 4a with the bovine milk xanthine oxidase indicated a mixed type inhibition with 3.52 μM K i and 13.14 μM K is , respectively. The structure-activity relationship analyses have also been presented. Compound 4a exhibited the potent hypouricemic effect in the potassium oxonate-induced hyperuricemic mice model. A molecular docking study of compound 4a was performed to gain an insight into its binding mode with xanthine oxidase. These results highlight the identification of a new class of xanthine oxidase inhibitors that have potential to be more efficacious in treatment of gout. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Management of pediatric tumor lysis syndrome.
Tazi, Illias; Nafl, Hatim; Elhoudzi, Jamila; Mahmal, Lahoucine; Harif, Mhamed
2011-09-01
Tumor lysis syndrome (TLS) is a serious complication of malignancies and can result in renal failure or death. In tumors with a high proliferative rate with a relatively large mass and a high sensitivity to cytotoxic agents, the initiation of therapy often results in the rapid release of intracellular anions, cations and the metabolic products of proteins and nucleic acids into the bloodstream. The increased concentrations of uric acid, phosphates, potassium and urea can overwhelm the body's homeostatic mechanisms to process and excrete these materials and result in the clinical spectrum associated with TLS. Typical clinical sequelae include gastrointestinal disturbances, neuromuscular effects, cardiovascular complications, acute renal failure and death. Tumor lysis syndrome can also compromise the efficacy or administration of curative therapies. Available evidence suggests that the incidence of clinical TLS is approximately 3-7% for acute leukemias and 4-11% for lymphomas. Pediatric cancers are the leading cause of death by disease in children. The most common pediatric cancers include the leukemias, lymphomas, central nervous system tumors and neuroblastoma. Thus, TLS is a major concern to practitioners caring for pediatric oncology patients. Given the complexity of TLS prevention and treatment, a multidisciplinary approach involving the collaboration of medical oncologists/ hematologists and nephrologists has the greatest potential of ensuring optimal patient outcomes. Rehydration is fundamental in the management of TLS in addition to the current standard therapy for hyperuricemia which include rasburicase and allopurinol. The early recognition and treatment of metabolic abnormalities often prevents the severe and life-threatening complications associated with tumor lysis syndrome.
Akyuz, Sukru; Karaca, Mehmet; Kemaloglu Oz, Tugba; Altay, Servet; Gungor, Baris; Yaylak, Baris; Yazici, Selcuk; Ozden, Kivilcim; Karakus, Gultekin; Cam, Nese
2014-01-01
Efficacy of intravenous (IV) volume expansion in preventing contrast-induced acute kidney injury (CI-AKI) is well known. However, the role of oral hydration has not been well established. The aim of this work was to evaluate the efficacy of oral hydration in preventing CI-AKI. We prospectively randomized 225 patients undergoing coronary angiography and/or percutaneous coronary intervention in either oral hydration or IV hydration groups. Patients who have at least one of the high-risk factors for developing CI-AKI (advanced age, type 2 diabetes mellitus, anemia, hyperuricemia, a history of cardiac failure or systolic dysfunction) were included in the study. All patients had normal renal function or stage 1-2 chronic kidney disease. Patients in the oral hydration group were encouraged to drink unrestricted amounts of fluids freely whereas isotonic saline infusion was performed by the standard protocol in the IV hydration group. CI-AKI occurred in 8/116 patients (6.9%) in the oral hydration group and 8/109 patients (7.3%) in the IV hydration group (p = 0.89). There was also no statistically significant difference between the two groups when different CI-AKI definitions were taken into account. Oral hydration is as effective as IV hydration in preventing CI-AKI in patients with normal kidney function or stage 1-2 chronic kidney disease, and who also have at least one of the other high-risk factors for developing CI-AKI. © 2014 S. Karger AG, Basel.
Allopurinol Against Progression of Chronic Kidney Disease.
Golmohammadi, Sima; Almasi, Afshin; Manouchehri, M; Omrani, Hamid Reza; Zandkarimi, Mohammad Reza
2017-07-01
Hyperuricemia is common in approximately 50% of patients with kidney failure due to decreased uric acid excretion, and it has been recently known as an independent factor in the progression of renal insufficiency. Allopurinol inhibits the production of uric acid. The aim of this study was to evaluate the effect of allopurinol on chronic kidney disease progression. In a clinical trial, patients with stages 3 and 4 of chronic kidney disease were divided into two groups to receive allopurinol, 100 mg, daily and placebo for 12 months. Patients' kidney function and serum uric acid levels were assessed at baseline and 3, 6, and 12 months after initial administration. Subgroups of patients with severe and mild glomerular filtration rate (GFR) impairment (GFR, 15 mL/min/1.73 m2 to 30 mL/min/1.73 m2 and 30 mL/min/1.73 m2 to 60 mL/min/1.73 m2, respectively), were compared between the groups. Serum uric acid levels decreased significantly during after 12 months of allopurinol administration (P = .004). In patients with severe GFR impairment, serum creatinine levels did not decrease significantly and there was no significant increase in GFR, but in those with mild GFR impairment, serum creatinine levels decreased and GFR increase significantly (P < .001) after administration of allopurinol. These effects were not observed in the control subgroups. Allopurinol may slow down stage 3 chronic kidney disease progression and could be administered with other effective medications for controlling the kidney disease.
New and Pipeline Drugs for Gout.
Keenan, Robert T; Schlesinger, Naomi
2016-06-01
Gout is the most common inflammatory arthropathy in the western world. Affecting millions and accounting for lost wages, increased health care costs, and significant disability, it remains a burden for those afflicted, their families, and the health care system. Despite the availability of a number of effective therapies, gout is often inadequately treated, and its impact on the patients overall health and well-being is underestimated by physicians and patients alike. For many decades, controlling acute flares was the priority in the management of gout. More recently, however, a deeper understanding of gout pathophysiology has resulted in a new appreciation that gout impacts the patient with consequences well beyond the episodes of acute inflammatory arthritis. Reflecting the chronic nature of the disease, gout treatment needs to be chronic as well, and aimed at reducing the underlying cause of gout-hyperuricemia-as well as the symptom of acute attacks. Therapy therefore requires both urate lowering and anti-inflammatory strategies. Unfortunately, the most commonly used urate lowering and anti-inflammatory treatments may be problematic in some gout patients, who often have multiple comorbidities that establish relative contraindications. Novel urate lowering therapies, and new medications to treat and prevent acute gouty flares, can not only improve care of the individual; they can also lead to a better discourse for the edification of those who manage and are managed for this underestimated disease. In this paper, we discuss new and pipeline drugs for acute gout, prophylactic anti-inflammatory therapies as well as urate lowering therapies.
Hosoya, Tatsuo; Kuriyama, Satoru; Ohno, Iwao; Kawamura, Tetsuya; Ogura, Makoto; Ikeda, Masato; Ishikawa, Masahiro; Hayashi, Fumihiro; Kanai, Tatsuya; Tomonari, Haruo; Soejima, Michimasa; Akaba, Kiyoaki; Tokudome, Goro; Endo, S; Fukui, A; Gomi, H; Hamaguchi, A; Hanaoka, K; Hara, Y; Hara, Y; Hasegawa, T; Hayakawa, H; Hikida, M; Hirano, K; Horiguchi, M; Hosoya, M; Ichida, K; Imai, T; Ishii, T; Ishikawa, H; Kameda, C; Kasai, T; Kobayashi, A; Kobayashi, H; Kurashige, M; Kusama, Y; Maezawa, H; Maezawa, Y; Maruyama, Y; Matsuda, H; Matsuo, N; Matsuo, T; Miura, Y; Miyajima, M; Miyakawa, M; Miyazaki, Y; Mizuguchi, M; Nakao, M; Nokano, H; Ohkido, I; Ohtsuka, Y; Okada, K; Okamoto, H; Okonogi, H; Saikawa, H; Saito, H; Sekiguchi, C; Suetsugu, Y; Sugano, N; Suzuki, T; Suzuki, T; Takahashi, H; Takahashi, Y; Takamizawa, S; Takane, K; Morita, T; Takazoe, K; Tanaka, H; Tanaka, S; Terawaki, H; Toyoshima, R; Tsuboi, N; Udagawa, T; Ueda, H; Ueda, Y; Uetake, M; Unemura, S; Utsunomiya, M; Utsunomiya, Y; Yamada, T; Yamada, Y; Yamaguchi, Y; Yamamoto, H; Yokoo, T; Yokoyama, K; Yonezawa, H; Yoshida, H; Yoshida, M; Yoshizawa, T
2012-04-01
Achieving adequate blood pressure (BP) control often requires more than one antihypertensive agent. The purpose of this study was to determine whether a fixed-dose formulation of losartan (LOS) plus hydrochlorothiazide (HCTZ) (LOS/HCTZ) is effective in achieving a greater BP lowering in patients with uncontrolled hypertension. The study was a prospective, multicenter, observational trial exploring the antihypertensive effect of a single tablet of LOS 50 mg/HCTZ 12.5 mg. A total of 228 patients whose BP had previously been treated with more than one antihypertensive agents without having achieved BP goal below 130/80 mmHg enrolled in the study. A significant decrease in systolic and diastolic BP was observed in both clinic and home measurement after switching from the previous treatment to LOS/HCTZ. There was a significant decrease in both B-type natriuretic peptide (BNP) and urinary albumin creatinine (Cr) excretion ratio (ACR), especially in patients with elevated values. In contrast, there was a significant increase in serum Cr concentration in conjunction with a decrease in estimated glomerular filtration rate (eGFR). Overall serum uric acid (UA) concentration increased, whereas in patients with hyperuricemia there was a significant reduction in this value. Switching to LOS/HCTZ provides a greater reduction in clinic and home BP in patients with uncontrolled hypertension. This combination therapy may lead to cardio-, reno protection and improve UA metabolism.
Collino, Massimo; Benetti, Elisa; Rogazzo, Mara; Mastrocola, Raffaella; Yaqoob, Muhammed M; Aragno, Manuela; Thiemermann, Christoph; Fantozzi, Roberto
2013-01-15
Although high-fructose corn syrup (HFCS-55) is the major sweetener in foods and soft-drinks, its potential role in the pathophysiology of diabetes and obesity ("diabesity") remains unclear. Peroxisome-proliferator activated receptor (PPAR)-δ agonists have never been tested in models of sugar-induced metabolic abnormalities. This study was designed to evaluate (i) the metabolic and renal consequences of HFCS-55 administration (15% wt/vol in drinking water) for 30 weeks on male C57Bl6/J mice and (ii) the effects of the selective PPAR-δ agonist GW0742 (1 mg/kg/day for 16 weeks) in this condition. HFCS-55 caused (i) hyperlipidemia, (ii) insulin resistance, and (iii) renal injury/inflammation. In the liver, HFCS-55 enhanced the expression of fructokinase resulting in hyperuricemia and caused abnormalities in known insulin-driven signaling events. In the kidney, HFCS-55 enhanced the expression of the NLRP3 (nucleotide-binding domain and leucine-rich-repeat-protein 3) inflammasome complex, resulting in caspase-1 activation and interleukin-1β production. All of the above effects of HFCS-55 were attenuated by the specific PPAR-δ agonist GW0742. Thus, we demonstrate for the first time that the specific PPAR-δ agonist GW0742 attenuates the metabolic abnormalities and the renal dysfunction/inflammation caused by chronic HFCS-55 exposure by preventing upregulation of fructokinase (liver) and activation of the NLRP3 inflammasome (kidney). Copyright © 2012 Elsevier Inc. All rights reserved.
Hira, Daiki; Chisaki, Yugo; Noda, Satoshi; Araki, Hisazumi; Uzu, Takashi; Maegawa, Hiroshi; Yano, Yoshitaka; Morita, Shin-Ya; Terada, Tomohiro
2015-01-01
The aim of the present study was to determine the influence of severe renal dysfunction (estimated glomerular filtration rate <30 ml/min/1.73 m(2), including hemodialysis) on the pharmacokinetics and therapeutic effects of febuxostat using a population pharmacokinetic analysis. This study recruited patients with hyperuricemia who were initially treated with allopurinol, but were switched to febuxostat, and it consists of 2 sub-studies: a pharmacokinetic study (26 patients) and retrospective efficacy evaluation study (51 patients). The demographic and clinical data of patients were collected from electronic medical records. Plasma febuxostat concentrations were obtained at each hospital visit. Population pharmacokinetic modeling was performed with NONMEM version 7.2. A total of 128 plasma febuxostat concentrations from 26 patients were used in the population pharmacokinetic analysis. The data were best described by a 1-compartment model with first order absorption. Covariate analysis revealed that renal function did not influence the pharmacokinetics of febuxostat, whereas actual body weight significantly influenced apparent clearance and apparent volume of distribution. The retrospective efficacy analysis showed the favorable therapeutic response of febuxostat switched from allopurinol in patients with moderate to severe renal impairment. No serious adverse event associated with febuxostat was observed irrespective of renal function. The population pharmacokinetic analysis and therapeutic analysis of febuxostat revealed that severe renal dysfunction had no influence on the pharmacokinetic parameters of febuxostat. These results suggest that febuxostat is tolerated well by patients with severe renal impairment. © 2015 S. Karger AG, Basel.
Uric acid and serum antioxidant capacity: a reaction to atherosclerosis?
Nieto, F J; Iribarren, C; Gross, M D; Comstock, G W; Cutler, R G
2000-01-01
the evidence of a potential beneficial role of antioxidants in preventing atherosclerotic disease is not entirely consistent. to assess the longitudinal association of serum total antioxidant capacity and serum antioxidants with the presence of subclinical carotid atherosclerosis. Prospective case-control study nested within an historical cohort. Cases were 150 individuals with elevated carotid intimal-medial thickness measured by B-mode ultrasound at the first two examinations of the Atherosclerosis Risk in Communities Study (1987-92). Controls were 150 age-gender-matched individuals with low carotid intimal-medial thickness. Serum antioxidant vitamins, uric acid, and serum total antioxidant capacity were measured in frozen serum samples collected from the same individuals in 1974 (13-15 years prior to the determination of case-control status). Compared to controls, atherosclerosis cases had significantly higher levels of serum total antioxidant capacity in 1974 than controls. This difference was almost entirely explained by increased serum concentration of uric acid in cases. In contrast with cross-sectional results, uric acid serum concentration in 1974, was significantly higher in cases than in controls, even after adjusting for the main cardiovascular risk factors. Cases had significantly lower levels of alpha-carotene in the 1974 sera than controls, but no other differences in serum antioxidant vitamin concentrations were observed. The higher serum uric acid concentration seemed associated with elevated total serum antioxidant capacity among individuals with atherosclerosis. This finding is consistent with experimental evidence suggesting that hyperuricemia may be a compensatory mechanism to counteract oxidative damage related to atherosclerosis and aging in humans.
Uric acid in plants and microorganisms: Biological applications and genetics - A review.
Hafez, Rehab M; Abdel-Rahman, Tahany M; Naguib, Rasha M
2017-09-01
Uric acid increased accumulation and/or reduced excretion in human bodies is closely related to pathogenesis of gout and hyperuricemia. It is highly affected by the high intake of food rich in purine. Uric acid is present in both higher plants and microorganisms with species dependent concentration. Urate-degrading enzymes are found both in plants and microorganisms but the mechanisms by which plant degrade uric acid was found to be different among them. Higher plants produce various metabolites which could inhibit xanthine oxidase and xanthine oxidoreductase, so prohibit the oxidation of hypoxanthine to xanthine then to uric acid in the purine metabolism. However, microorganisms produce group of degrading enzymes uricase, allantoinase, allantoicase and urease, which catalyze the degradation of uric acid to the ammonia. In humans, researchers found that several mutations caused a pseudogenization (silencing) of the uricase gene in ancestral apes which exist as an insoluble crystalloid in peroxisomes. This is in contrast to microorganisms in which uricases are soluble and exist either in cytoplasm or peroxisomes. Moreover, many recombinant uricases with higher activity than the wild type uricases could be induced successfully in many microorganisms. The present review deals with the occurrence of uric acid in plants and other organisms specially microorganisms in addition to the mechanisms by which plant extracts, metabolites and enzymes could reduce uric acid in blood. The genetic and genes encoding for uric acid in plants and microorganisms are also presented.
Ma, Yanjie; Cao, Huimin; Li, Zhixin; Fang, Jinzhi; Wei, Xiaomin; Cheng, Peng; Jiao, Rui; Liu, Xiaoran; Li, Ya; Xing, Yun; Tang, Jiali; Jin, Liang; Li, Taiming
2017-10-16
Hyperuricemia (HUA) is related to diabetes. Uric acid-induced inflammation and oxidative stress are risk factors for diabetes and its complications. Human urate transporter 1 (URAT1) regulates the renal tubular reabsorption of uric acid. IA-2(5)-P2-1, a potent immunogenic carrier designed by our laboratory, can induce high-titer specific antibodies when it carries a B cell epitope, such as B cell epitopes of DPP4 (Dipeptidyl peptidase-4), xanthine oxidase. In this report, we describe a novel multi-epitope vaccine composing a peptide of URAT1, an anti-diabetic B epitope of insulinoma antigen-2(IA-2) and a Th2 epitope (P2:IPALDSLTPANED) of P277 peptide in human heat shock protein 60 (HSP60). Immunization with the multi-epitope vaccine in streptozotocin-induced diabetes C57BL/6J mice successfully induced specific anti-URAT1 antibody, which inhibited URAT1 action and uric acid reabsorption, and increased pancreatic insulin level with a lower insulitis incidence. Vaccination with U-IA-2(5)-P2-1 (UIP-1) significantly reduced blood glucose and uric acid level, increased Th2 cytokines interleukin (IL)-10 and IL-4, and regulated immune reactions through a balanced Th1/Th2 ratio. These results demonstrate that the URAT1-based multi-epitope peptide vaccine may be a suitable therapeutic approach for diabetes and its complications.
Chronic kidney disease in Chinese postmenopausal women: A cross-sectional survey.
Pei, F; Zhou, Z; Li, Y; Ren, Y; Yang, X; Liu, G; Xia, Q; Hu, Z; Zhang, L; Zhao, M; Wang, H
2017-02-01
Despite advances in the management of chronic kidney disease (CKD), there is ongoing uncertainty regarding the prevalence of CKD in postmenopausal women. This study was designed to investigate both CKD prevalence and related risk factors in a cohort of postmenopausal Chinese women. A cross-sectional survey was administered to a nationally representative sample of female Chinese participants, including a total of 47,204 subjects, among whom were 8573 self-reported postmenopausal women. CKD was defined as either an estimated glomerular filtration rate (eGFR) of <60 mL/min/1.73 m2 body surface area or else the presence of albuminuria. All subjects completed a questionnaire that included items related to their lifestyles and medical histories. Data were collected on blood pressure, serum creatinine, urinary albumin, and urinary creatinine. Risk factors correlated with the presence of CKD were analyzed using logistic regression analysis. Results showed that the adjusted prevalence of an eGFR of < 60 mL/min/1.73 m2 among this postmenopausal survey cohort was 5.3% (95% confidence interval: 4.7-6.1) and of albuminuria, 12.4% (11.7-13.1). The overall prevalence of CKD in this postmenopausal cohort was 16.6% (15.8-17.4). Factors associated with kidney pathology included nephrotoxic drug use, history of cardiovascular disease, hyperuricemia, hypertension, and diabetes (the lower limit of multivariable adjusted odds ratios > 1). The current study revealed a high prevalence of CKD in Chinese postmenopausal women. These results provide baseline data for disease prevention and treatment.
Yang, Hua; Gao, Lihui; Niu, Yanfen; Zhou, Yuanfang; Lin, Hua; Jiang, Jing; Kong, Xiangfu; Liu, Xu; Li, Ling
2015-01-01
Mangiferin, a natural glucosyl xanthone from the leaves of Mangifera indica L., was previously shown to exert potent hypouricemic effects associated with inhibition of the activity of xanthine dehydrogenase/oxidase. The present study aimed to evaluate its uricosuric effect and possible molecular mechanisms underlying the renal urate transporters responsible for urate reabsorption in vivo. Mangiferin (1.5-24.0 mg/kg) was administered intragastrically to hyperuricemic mice and rats induced by the intraperitoneal injection of uric acid and potassium oxonate, respectively. The uricosuric effect was evaluated by determining the serum and urinary urate levels as well as fractional excretion of uric acid (FEUA). The mRNA and protein levels of renal urate-anion transporter 1 (URAT1), organic anion transporter 10 (OAT10), glucose transporter 9 (GLUT9), and PDZ domain-containing protein (PDZK1) were analyzed. The administration of mangiferin significantly decreased the serum urate levels in hyperuricemic mice in a dose- and time-dependent manner. In hyperuricemic rats, mangiferin also reduced the serum urate levels and increased the urinary urate levels and FEUA. These results indicate that mangiferin has uricosuric effects. Further examination showed that mangiferin markedly inhibited the mRNA and protein expression of renal URAT1, OAT10, and GLUT9 in hyperuricemic rats, but did not interfere with PDZK1 expression. Taken together, these findings suggest that mangiferin promotes urate excretion by the kidney, which may be related to the inhibition of urate reabsorption via downregulation of renal urate transporters.
Jabur, W L; Nasa, P; Mohammed, K A; Kulkarni, A; Tomaraei, S N
2018-01-01
Exercise-induced rhabdomyolysis (EIR) is an uncommon cause of severe rhabdomyolysis and a very rare cause of acute kidney injury (AKI). A prospective observational study of 25 patients diagnosed with EIR was conducted in a multispecialty hospital in Dubai, from 2009 to 2015. Five out of 25 patients experienced AKI necessitating temporary renal replacement therapy. The initial presentation, biochemical parameters, and clinical course of patients were monitored, to understand epidemiology and risk factors for the development of AKI. There was male preponderance (4 out of 5 patients), higher rate of systemic symptoms (all 5 patients) versus 60% in NRAKI), oligo-anuria (all 5 patients), compartment syndrome (3 out \\of 5) and severe dehydration seen in patients with RAKI group. On laboratory evaluation, there was higher rise in creatinine kinase (CK) enzyme, serum and urine myoglobin levels impaired renal function on presentation, hyperuricemia, high D-dimer level, PCV of more than 55%, found to be associated with RAKI as compared to NRAKI group. Hematuria by positive urine dipstick with absent red blood cells on urinalysis, is an insensitive tool as was present in only 62% and 43% of RAKI and NRAKI groups, respectively. It was also observed that delayed pesentation for medical care, metabolic acidosis, were commonly associated with AKI. All patients with RAKI required RRT for a comparable period of time (3-4 weeks). In all of them, no deterioration or relapse reported on follow-up of 3 months.
Lee, Kyung-Ann; Ryu, Se-Ri; Park, Seong-Jun; Kim, Hae-Rim; Lee, Sang-Heon
2018-05-01
Hyperuricemia and gout are associated with increased risk of cardiovascular disease and metabolic syndrome. The aim of this study was to evaluate the correlation of total tophus volumes, measured using dual-energy computed tomography, with cardiovascular risk and the presence of metabolic syndrome. Dual-energy computed tomography datasets from 91 patients with a diagnosis of gout were analyzed retrospectively. Patients who received urate lowering therapy were excluded to avoid the effect on tophus volume. The total volumes of tophaceous deposition were quantified using automated volume assessment software. The 10-year cardiovascular risk using the Framingham Risk Score and metabolic syndrome based on the Third Adult Treatment Panel criteria were estimated. Fifty-five and 36 patients with positive and negative dual-energy computed tomography results, respectively, were assessed. Patients with positive dual-energy computed tomography results showed significantly higher systolic blood pressure, diastolic blood pressure, fasting glucose, and higher prevalence of chronic kidney disease, compared with those with negative dual-energy computed tomography results. The total tophus volumes were significantly correlated with the Framingham Risk Score, and the number of metabolic syndrome components (r = 0.22 and p = 0.036 and r = 0.373 and p < 0.001, respectively). The total tophus volume was one of the independent prognostic factors for the Framingham Risk Score in a multivariate analysis. This study showed the correlation of total tophus volumes with cardiovascular risk and metabolic syndrome-related comorbidities. A high urate burden could affect unfavorable cardiovascular profiles.
Miyake, Kazumasa; Akimoto, Teppei; Hanada, Yuriko; Nagoya, Hiroyuki; Kodaka, Yasuhiro; Ueki, Nobue; Kusunoki, Masafumi; Kawagoe, Tetsuro; Futagami, Seiji; Takahashi, Yasuhiro; Takano, Hitoshi; Sakamoto, Choitsu
2015-09-01
Impact of acid suppressants on lower gastrointestinal bleeding remains unclear in low-dose aspirin users; we aimed to investigate this relationship. Retrospective cohort study of low-dose aspirin users who underwent coronary angiography for ischaemic heart disease in our institution between October 2005 and December 2006; patients were evaluated for upper or lower gastrointestinal bleedings within 3 years post-angiography. 538 patients were enrolled (males, 74.4%; mean age 67.4±10.6 years). Risk for upper gastrointestinal bleeding decreased with concomitant use of statins (HR, 0.37; 95% CI, 0.15-0.89), calcium channel blockers (HR, 0.29; 95% CI, 0.10-0.85), and histamine-2 receptor antagonists (HR, 0.26; 95% CI, 0.08-0.89). Concomitant use of proton pump inhibitors tended to decrease risk of upper gastrointestinal bleeding (HR, 0.27; 95% CI, 0.06-1.18). Risk for lower gastrointestinal bleeding increased with both concomitant use of warfarin (HR, 15.68; 95% CI, 4.43-55.53) and proton pump inhibitors (HR, 6.55; 95% CI, 2.01-21.32), but not with histamine-2 receptor antagonists. Hyperuricemia lowered risk for lower gastrointestinal bleeding (HR, 0.12; 95% CI, 0.02-0.88). In low-dose aspirin users, concomitant use of proton pump inhibitors increased lower gastrointestinal bleeding risk, independent from effects on upper gastrointestinal bleeding. Copyright © 2015 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
Metabolic syndrome in hypertensive patients: An unholy alliance
Mulè, Giuseppe; Calcaterra, Ilenia; Nardi, Emilio; Cerasola, Giovanni; Cottone, Santina
2014-01-01
For many years, it has been recognized that hypertension tends to cluster with various anthropometric and metabolic abnormalities including abdominal obesity, elevated triglycerides, reduced high-density lipoprotein cholesterol, glucose intolerance, insulin resistance and hyperuricemia. This constellation of various conditions has been transformed from a pathophysiological concept to a clinical entity, which has been defined metabolic syndrome (MetS). The consequences of the MetS have been difficult to assess without commonly accepted criteria to diagnose it. For this reason, on 2009 the International Diabetes Federation, the American Heart Association and other scientific organizations proposed a unified MetS definition. The incidence of the MetS has been increasing worldwide in parallel with an increase in overweight and obesity. The epidemic proportion reached by the MetS represents a major public health challenge, because several lines of evidence showed that the MetS, even without type 2 diabetes, confers an increased risk of cardiovascular morbidity and mortality in different populations including also hypertensive patients. It is likely that the enhanced cardiovascular risk associated with MetS in patients with high blood pressure may be largely mediated through an increased prevalence of preclinical cardiovascular and renal changes, such as left ventricular hypertrophy, early carotid atherosclerosis, impaired aortic elasticity, hypertensive retinopathy and microalbuminuria. Indeed, many reports support this notion, showing that hypertensive patients with MetS exhibit, more often than those without it, these early signs of end organ damage, most of which are recognized as significant independent predictors of adverse cardiovascular outcomes. PMID:25276291
Gaubert, Mélanie; Marlinge, Marion; Alessandrini, Marine; Laine, Marc; Bonello, Laurent; Fromonot, Julien; Cautela, Jennifer; Thuny, Franck; Barraud, Jeremie; Mottola, Giovanna; Rossi, Pascal; Fenouillet, Emmanuel; Ruf, Jean; Guieu, Régis; Paganelli, Franck
2018-06-01
The role of serum uric acid in coronary artery disease has been extensively investigated. It was suggested that serum uric acid level (SUA) is an independent predictor of endothelial dysfunction and related to coronary artery lesions. However, the relationship between SUA and severity of coronary atherosclerosis evaluated via endothelial dysfunction using peripheral arterial tone (PAT) and the reactive hyperhemia index (RHI) has not been investigated during a first episode of acute coronary syndrome (ACS). The aim of our study was to address this point. We prospectively enrolled 80 patients with a first episode of ACS in a single-center observational study. All patients underwent coronary angiography, evaluation of endothelial function via the RHI, and SUA measurement. The severity of the coronary artery lesion was assessed angiographically, and patients were classified in three groups based on the extent of disease and Gensini and SYNTAX scores. Endothelial function was considered abnormal if RHI < 1.67. We identified a linear correlation between SUA and RHI (R 2 = 0.66 P < 0.001). In multivariable analyses, SUA remained associated with RHI, even after adjustment for traditional cardiovascular risk factors and renal function. SUA was associated with severity of coronary artery disease. SUA is associated with severity of coronary atherosclerosis in patients with asymptomatic hyperuricemia. This inexpensive, readily measured biological parameter may be useful to monitor ACS patients.
Hyperuricaemia and preeclampsia: is there a pathogenic link?
Schackis, R C
2004-01-01
A hypothesis, based on animal studies and human observational studies, was developed proposing a direct pathogenic link between hyperuricemia and preeclampsia. Epidemiological characteristics of preeclampsia such as its uniqueness to humans and an increased incidence of preeclampsia in multiple pregnancies, increased body mass index, renal and hypertensive disease all have uric acid as their common denominator. Animal studies have linked hyperuricaemia to hypertensive, cardiovascular and renal disease. The aim of the study was to determine whether lowering the serum uric acid levels in preeclampsia would affect biochemical parameters and hypertensive control. A randomized, double-blind, placebo controlled study. A tertiary referral center. Forty women with preeclampsia between 26 and 32 weeks gestation. Probenecid 250 mg twice daily for seven days. Renal function and haematological parameters, hypertensive control. In the Probenecid group, there was a significant drop in the serum uric acid levels. Lower uric acid levels in the Probenecid group had no significant effect on blood pressure. Patients in the Probenecid group had a significantly lower serum creatinine value at the end of the study when compared to patients in the placebo group. Other renal function parameters (creatinine clearance, urea, 24 h urinary protein excretion) did not show any significant difference between the two groups. Platelet count differed between the two groups with the platelet count being significantly higher in the Probenecid group at the end of the study. The significant improvement in the platelet count in the Probenecid group warrants further study.
Castillo-Martínez, D; Marroquín-Fabián, E; Lozada-Navarro, A C; Mora-Ramírez, M; Juárez, M; Sánchez-Muñoz, F; Vargas-Barrón, J; Sandoval, J; Amezcua-Guerra, L M
2016-01-01
The objective of this paper is to assess whether pulmonary hypertension (PH) may be detected at one point in time or longitudinally predicted by serum uric acid (sUA) levels in systemic lupus erythematosus (SLE). We conducted a post-hoc analysis of a long-term followed cohort of Mexican SLE patients. Echocardiography-based definitions of PH by the ESC/ERS/ISHLT and its associations with clinical and laboratory data on enrollment were studied. Especially, the impact that sUA levels at baseline may have on the future development of PH in patients with normal pulmonary artery systolic pressure (PASP) was explored. Out of the 156 SLE patients originally enrolled in the cohort, 44 met the inclusion criteria for the present study and were grouped as having (n =10) or not having (n = 34) PH. At baseline, sUA levels of 5.83 ± 1.79 and 5.82 ± 1.97 mg/dl (p = ns) were found in patients with and without PH, respectively. No association between PASP and other markers was found. In patients with normal PASP, the presence of sUA ≥ 7 mg/dl at baseline predicted future development of PH (relative risk 8.5, 1.0009 to 72; p = 0.04). In SLE, sUA levels at one point in time are useless to detect PH. However, steady hyperuricemia may predict the future development of PH in patients with normal PASP at baseline. © The Author(s) 2015.
El-Bassossy, Hany M; Dsokey, Nora; Fahmy, Ahmed
2014-12-01
Vascular dysfunction is an important complication associated with metabolic syndrome (MS). Here we fully characterized vascular complications in a rat model of fructose-induced MS. MS was induced by adding fructose (10%) to drinking water to male Wistar rats of 6 weeks age. Blood pressure (BP) and isolated aorta responses phenylephrine (PE), KCl, acetylcholine (ACh), and sodium nitroprusside (SNP) were recorded after 6, 9, and 12 weeks of fructose administration. In addition, serum levels of glucose, insulin, uric acid, tumor necrosis factor α (TNFα), lipids, advanced glycation end products (AGEs), and arginase activity were determined. Furthermore, aortic reactive oxygen species (ROS) generation, hemeoxygenase-1 expression, and collagen deposition were examined. Fructose administration resulted in a significant hyperinslinemia after 6 weeks which continued for 12 weeks. It was also associated with a significant increase in BP after 6 weeks which was stable for 12 weeks. Aorta isolated from MS animals showed exaggerated contractility to PE and KCl and impaired relaxation to ACh compared with control after 6 weeks which were clearer at 12 weeks of fructose administration. In addition, MS animals showed significant increases in serum levels of lipids, uric acid, AGEs, TNFα, and arginase enzyme activity after 12 weeks of fructose administration. Furthermore, aortae isolated from MS animals were characterized by increased ROS generation and collagen deposition. In conclusion, adding fructose (10%) to drinking water produces a model of MS with vascular complications after 12 weeks that are characterized by insulin resistance, hypertension, disturbed vascular reactivity and structure, hyperuricemia, dyslipidemia, and low-grade inflammation.
NASA Astrophysics Data System (ADS)
Ramachandran, G.; Muthu, S.; Uma Maheswari, J.
2013-02-01
Fourier transform Raman and Fourier transform infrared spectra of 1,2-Dihydropyrazolo (4,3-E) Pyrimidin-4-one were recorded in the regions 3500-100 cm-1 and 4000-400 cm-1 respectively in the solid phase. 1,2-Dihydropyrazolo (4, 3-E) Pyrimidin-4-one is used to treat hyperuricemia and its complication including chronic gout. The equilibrium geometry harmonic vibrational frequencies, infrared intensities and Raman intensities were calculated by Hartee Fock and density functional B3LYP methods with 6-31G (d, p) basis set, using Gaussian 03W program package on a Pentium IV/1.6 GHz personal computer. The thermodynamic functions of the title compound were also performed at the above methods and basis set. A detailed interpretation of the infrared and Raman spectra of 1,2-Dihydropyrazolo (4,3-E) Pyrimidin-4-one is reported. Stability of the molecule arising from hyper conjugative interactions, charge delocalization has been analyzed using natural bond orbital (NBO) analysis. UV-vis of the compound was recorded. The calculated HOMO and LUMO energies show that chemical activity of the molecule. The first order hyperpolarizability (β) of this novel molecular system and related properties of 1,2-Dihydropyrazolo (4,3-E) Pyrimidin-4-one are calculated using HF/6-31G (d, p) method on the finite field approach. The experimental spectra also coincide satisfactorily with those of theoretically constructed spectra.
Presence of Gout is Associated With Increased Prevalence and Severity of Knee Osteoarthritis
Howard, Rennie G.; Samuels, Jonathan; Gyftopoulos, Soterios; Krasnokutsky, Svetlana; Leung, Joseph; Swearingen, Christopher J.; Pillinger, Michael H.
2015-01-01
Background Gout and osteoarthritis (OA) are the most prevalent arthritides, but their relationship is neither well established nor well understood. Objectives We assessed whether a diagnosis of gout or asymptomatic hyperuricemia (AH) is associated with increased prevalence/severity of knee OA. Methods 119 male patients ages 55–85 were sequentially enrolled from the primary care clinics of an urban VA hospital, assessed and categorized into 3 groups: gout (ACR Classification Criteria), AH ([serum urate] ≥ 6.8 mg/dL, no gout), and control ([serum urate] < 6.8 mg/dL, no gout). 25 patients from each group subsequently underwent formal assessment of knee OA presence and severity (ACR Clinical/Radiographic Criteria, Kellgren-Lawrence (KL) grade). Musculoskeletal ultrasound was used to detect monosodium urate (MSU) deposition at the knees and 1st metatarsophalangeal (MTP) joints. Results 68.0% of gout, 52.0% of AH, and 28.0% of age-matched control subjects had knee OA (gout vs. control, P=0.017). Odds ratio for knee OA in gout vs. controls was 5.46 prior to, and 3.80 after adjusting for BMI. Gout subjects also had higher KL grades than controls (P=0.001). Subjects with sonographically-detected MSU crystal deposition on cartilage were more likely to have OA than those without (60.0 vs 27.5%, P=0.037), with crystal deposition at the 1st MTP joints correlating most closely with OA knee involvement. Conclusion Knee OA was more prevalent in gout patients vs. controls, and intermediate in AH. Knee OA was more severe in gout patients vs. controls. PMID:25710856
Metabolic characteristics and renal dysfunction in 65 patients with tophi prior to gout.
Lu, Chuan-Chin; Wu, Shyi-Kuen; Chung, Wei-Sheng; Lin, Liang-Hung; Hung, Ta-Wei; Yeh, Chih-Jung
2017-08-01
Tophi typically occur many years after uncontrolled gout. Therefore, their development before gout remains unusual. Such patients might exhibit some characteristic differences compared with typical tophaceous gout patients. In this study, 65 tophaceous gout patients with tophi as the first sign of gout (tophi-first group) were enrolled. Their clinical characteristics were compared with those of 1421 patients whose tophi occurred after gout (tophi-after group). Compared with the tophi-after group, the tophi-first group had a significantly higher percentage of female patients and patients with elderly onset of disease and a lower percentage of patients with a positive family history; these patients had lower body mass indices, serum urate levels, and estimated glomerular filtration rates (eGFRs). Female sex and negative family history were identified as the principal determinants of tophi development before gout. The decreasing eGFR among the tophi-first group was not due to the group per se but was a result of older age, longer tophi duration, and hyperuricemia. The most common site of initial tophi occurrence in both groups was the toe. In the tophi-first group, the occurrence rates for initial tophi sites were significantly higher at the finger but were lower at the ankle. The tophi-first group exhibited distinct characteristics of age, gender, family history, BMI, serum urate levels, and initial tophi site. This group had fewer comorbidities but similar renal dysfunction compared with the tophi-after group. Thus, patients presenting with tophi should be treated promptly, even if they have no history of gout symptoms.
Kurahashi, Hiroaki; Watanabe, Masami; Sugimoto, Morito; Ariyoshi, Yuichi; Mahmood, Sabina; Araki, Motoo; Ishii, Kazushi; Nasu, Yasutomo; Nagai, Atsushi; Kumon, Hiromi
2013-01-01
Gender identity disorder (GID) results from a disagreement between a person's biological sex and the gender to which he or she identifies. With respect to the treatment of female to male GID, testosterone replacement therapy (TRT) is available. The uric acid (UA) level can be influenced by testosterone; however, the early effects and dose-dependency of TRT on the serum UA concentration have not been evaluated in this population. We herein conducted a dose-response analysis of TRT in 160 patients with female to male GID. The TRT consisted of three treatment groups who received intramuscular injections of testosterone enanthate: 125 mg every two weeks, 250 mg every three weeks and 250 mg every two weeks. Consequently, serum UA elevation was observed after three months of TRT and there was a tendency toward testosterone dose-dependency. The onset of hyperuricemia was more prevalent in the group who received the higher dose. We also demonstrated a positive correlation between increased levels of serum UA and serum creatinine. Since the level of serum creatinine represents an individual's muscle volume and the muscle is a major source of purine, which induces UA upregulation, the serum UA elevation observed during TRT is at least partially attributed to an increase in muscle mass. This is the first study showing an association between serum UA elevation and a TRT-induced increase in muscle mass. The current study provides important information regarding TRT for the follow-up and management of the serum UA levels in GID patients.
Sugar-sweetened beverages and risk of obesity and type 2 diabetes: Epidemiologic evidence
Hu, Frank B.; Malik, Vasanti S.
2010-01-01
In recent decades, temporal patterns in SSB intake have shown a close parallel between the upsurge in obesity and rising levels of SSB consumption. SSBs are beverages that contain added caloric sweeteners such as sucrose, high-fructose corn syrup or fruit-juice concentrates, all of which result in similar metabolic effects. They include the full spectrum of soft drinks, carbonated soft drinks, fruitades, fruit drinks, sports drinks, energy and vitamin water drinks, sweetened iced tea, cordial, squashes, and lemonade, which collectively are the largest contributor to added sugar intake in the US. It has long been suspected that SSBs have an etiologic role in the obesity epidemic, however only recently have large epidemiological studies been able to quantify the relationship between SSB consumption and long-term weight-gain, type 2 diabetes (T2DM) and cardiovascular disease (CVD) risk. Experimental studies have provided important insight into potential underlying biological mechanisms. It is thought that SSBs contribute to weight gain in part by incomplete compensation for energy at subsequent meals following intake of liquid calories. They may also increase risk of T2DM and CVD as a contributor to a high dietary glycemic load leading to inflammation, insulin resistance and impaired β-cell function. Additional metabolic effects from the fructose fraction of these beverages may also promote accumulation of visceral adiposity, and increased hepatic de novo lipogenesis, and hypertension due to hyperuricemia. Consumption of SSBs should therefore be replaced by healthy alternatives such as water, to reduce risk of obesity and chronic diseases. PMID:20138901
Liu, Z M; Ho, C S; Chen, Y M; Woo, J
2015-02-01
Hyperuricemia is a recognized risk factor for cardiovascular diseases. Soy foods contain a moderate amount of purine and may predispose to raised serum uric acid (UA). However, no study has examined the long-term effect of soy intake on UA levels. We examined whether consumption of soy foods and isoflavone extracts for 6 months altered serum UA. The analysis included two randomized controlled trials (soy protein trial and whole soy trial) among total 450 postmenopausal women with either prehypertension or prediabetes. We conducted a pooled analysis by combining participants from both the soy flour and soy protein groups (combined soy foods group), participants from both the isoflavone and daidzein groups (combined isoflavone group) and participants from both milk placebo groups. Fasting venous samples were obtained at baseline and the end of the trial for serum UA analysis. In the pooled data, 417 subjects completed the study according to protocol. The baseline serum UA levels were comparable among the three combined groups. There was a lower decrease in UA levels among women in the combined soy foods group compared with women in the other two groups (p = 0.028 and 0.026). The net decrease and % decrease in UA were 14.5 μmol/L (95 % CI 1.93-25.6, p = 0.023) or 4.9 % (95 % CI 1.3-8.5 %, p = 0.023) between the combined soy foods group and placebo group. Among Chinese postmenopausal women with either prehypertension or prediabetes, soy intake did not increase urate levels.
Uric Acid: The Unknown Uremic Toxin.
Treviño-Becerra, Alejandro
2018-01-01
This review brings together concepts of uric acid metabolism affecting renal parenchyma and its function and the current therapies to reduce hyperuricemia (HyU) and avoid renal disease progression. High uric acid plays an important role in several chronic diseases including kidney diseases such as lithiasis, gout nephropathy, and preeclampsia. In the last 30 years, it has been shown that reducing HyU with low protein and low purine diets in addition to allopurinol creates physiopathological conditions that produce a slight increase in the glomerular filtration rate (GFR). In recent years, in a new era of research in clinical, genetics, pharmacological, and epidemiologic fields, they have been moving forward to support the idea that reduction in HyU could benefit the chronic renal failure (CRF) patients (stage III-IV), thereby avoiding the drop of GFR for undefined mechanisms. There are several clinical trials in progress that show the HyU reducing to very low values and an increased GFR. In a young population, when treating HyU there is a reduction in high blood pressure. There are some reports showing that HyU could play a role in the diabetic nephropathy. Therefore, there have been some speculations that HyU treatment could stop the progression of CRF modifying the natural history of the diseases. So there will be new clinical trials with old and new medication and metabolic procedure to maintain a very low blood levels in the unknown uremic toxin know as uric acid which seems to be the toxin to the damage kidney. © 2018 S. Karger AG, Basel.
Nonalcoholic fatty liver disease: Evolving paradigms
Lonardo, Amedeo; Nascimbeni, Fabio; Maurantonio, Mauro; Marrazzo, Alessandra; Rinaldi, Luca; Adinolfi, Luigi Elio
2017-01-01
In the last years new evidence has accumulated on nonalcoholic fatty liver disease (NAFLD) challenging the paradigms that had been holding the scene over the previous 30 years. NAFLD has such an epidemic prevalence as to make it impossible to screen general population looking for NAFLD cases. Conversely, focusing on those cohorts of individuals exposed to the highest risk of NAFLD could be a more rational approach. NAFLD, which can be diagnosed with either non-invasive strategies or through liver biopsy, is a pathogenically complex and clinically heterogeneous disease. The existence of metabolic as opposed to genetic-associated disease, notably including ”lean NAFLD” has recently been recognized. Moreover, NAFLD is a systemic condition, featuring metabolic, cardiovascular and (hepatic/extra-hepatic) cancer risk. Among the clinico-laboratory features of NAFLD we discuss hyperuricemia, insulin resistance, atherosclerosis, gallstones, psoriasis and selected endocrine derangements. NAFLD is a precursor of type 2 diabetes (T2D) and metabolic syndrome and progressive liver disease develops in T2D patients in whom the course of disease is worsened by NAFLD. Finally, lifestyle changes and drug treatment options to be implemented in the individual patient are also critically discussed. In conclusion, this review emphasizes the new concepts on clinical and pathogenic heterogeneity of NAFLD, a systemic disorder with a multifactorial pathogenesis and protean clinical manifestations. It is highly prevalent in certain cohorts of individuals who are thus potentially amenable to selective screening strategies, intensive follow-up schedules for early identification of liver-related and extrahepatic complications and in whom earlier and more aggressive treatment schedules should be carried out whenever possible. PMID:29085206
COX-2/mPGES-1/PGE2 cascade activation mediates uric acid-induced mesangial cell proliferation.
Li, Shuzhen; Sun, Zhenzhen; Zhang, Yue; Ruan, Yuan; Chen, Qiuxia; Gong, Wei; Yu, Jing; Xia, Weiwei; He, John Ci-Jiang; Huang, Songming; Zhang, Aihua; Ding, Guixia; Jia, Zhanjun
2017-02-07
Hyperuricemia is not only the main feature of gout but also a cause of gout-related organ injuries including glomerular hypertrophy and sclerosis. Uric acid (UA) has been proven to directly cause mesangial cell (MC) proliferation with elusive mechanisms. The present study was undertaken to examined the role of inflammatory cascade of COX-2/mPGES-1/PGE2 in UA-induced MC proliferation. In the dose- and time-dependent experiments, UA increased cell proliferation shown by the increased total cell number, DNA synthesis rate, and the number of cells in S and G2 phases in parallel with the upregulation of cyclin A2 and cyclin D1. Interestingly, UA-induced cell proliferation was accompanied with the upregulation of COX-2 and mPGES-1 at both mRNA and protein levels. Strikingly, inhibition of COX-2 via a specific COX-2 inhibitor NS-398 markedly blocked UA-induced MC proliferation. Meanwhile, UA-induced PGE2 production was almost entirely abolished. Furthermore, inhibiting mPGES-1 by a siRNA approach in MCs also ameliorated UA-induced MC proliferation in line with a significant blockade of PGE2 secretion. More importantly, in gout patients, we observed a significant elevation of urinary PGE2 excretion compared with healthy controls, indicating a translational potential of this study to the clinic. In conclusion, our findings indicated that COX-2/mPGES-1/PGE2 cascade activation mediated UA-induced MC proliferation. This study offered new insights into the understanding and the intervention of UA-related glomerular injury.
Efficacy and safety of febuxostat in elderly female patients.
Mizuno, Tomohiro; Hayashi, Takahiro; Hikosaka, Sayo; Shimabukuro, Yuka; Murase, Maho; Takahashi, Kazuo; Hayashi, Hiroki; Yuzawa, Yukio; Nagamatsu, Tadashi; Yamada, Shigeki
2014-01-01
Maintenance of low serum urate levels is important for the management of gout. Achieving the recommended serum urate levels of less than 6.0 mg/dL is difficult in elderly (65 years of age or older) patients with renal impairment. Xanthine oxidase inhibitors allopurinol and febuxostat are used for this purpose. Although febuxostat had been shown to be efficacious in elderly patients, its safety and efficacy in elderly female patients with hyperuricemia remain unclear. The aim of this study was to assess the efficacy and safety of febuxostat in elderly female patients. We studied a retrospective cohort study. The study included elderly Japanese patients (65 years of age or older) who were treated with febuxostat at Fujita Health University Hospital from January 2012 to December 2013. The treatment goal was defined as achievement of serum urate levels of 6.0 mg/dL or lower within 16 weeks; this was the primary endpoint in the present study. Adverse events of febuxostat were defined as more than twofold increases in Common Terminology Criteria for adverse events scores from baseline. We evaluated 82 patients treated with febuxostat during the observation period and classified them into male (n=53) and female (n=29) groups. The mean time to achievement of the treatment goal was significantly shorter in the female group (53 days) than in the male group (71 days). There were no significant differences in adverse events between the 2 groups. Our findings suggest that the efficacy of febuxostat in elderly female patients is superior to that in elderly male patients and that the safety is equivalent.
Yamaguchi, Akinori; Harada, Makoto; Yamada, Yosuke; Hashimoto, Koji; Kamijo, Yuji
2017-05-18
The ability of antihyperuricemic therapy to exert renoprotective effects in patients with chronic kidney disease (CKD) is controversial. In the present study, we studied patient characteristics that may mask favorable impact of antihyperuricemic therapy on the progression of CKD. This was a single-center, retrospective, follow-up study. One-hundred and seventy-eight CKD patients with hyperuricemia who received febuxostat therapy were included in this study. Mean serum uric acid (mUA) level after treatment and changes in estimated glomerular filtration rate (ΔeGFR) over 6 months were measured and their correlation was examined. Patients were divided into two groups based on mUA, and their ΔeGFR were compared. These analyses were evaluated in various subgroups. Febuxostat therapy markedly decreased UA level in any CKD stage patients without resulting in serious adverse events. eGFRs of CKD patients in the mUA < 6.0 mg/dl group were maintained, whereas those in the mUA ≥ 6.0 mg/dl group decreased. A significant inverse correlation was observed between mUA and ΔeGFR (r = -0.16, p = 0.019). The renoprotective effects of febuxostat were significant in the following subgroups: male patients, age < 70 years, systolic blood pressure < 130 mmHg, normal cholesterol levels, and absence of diabetes. Coexisting vascular risk factors appear to exert additive masking effects against febuxostat renoprotection. The results of this study suggest that various vascular risk factors markedly attenuate the renoprotective effects of febuxostat.
Hossain, Md Murad; Mukheem, Abdul; Kamarul, Tunku
2015-08-15
Hypoadiponectinemia is characterized by low plasma adiponectin levels that can be caused by genetic factors, such as single nucleotide polymorphisms (SNPs) and mutations in the adiponectin gene or by visceral fat deposition/obesity. Reports have suggested that hypoadiponectinemia is associated with dyslipidemia, hypertension, hyperuricemia, metabolic syndrome, atherosclerosis, type 2 diabetes mellitus and various cardiovascular diseases. Previous studies have highlighted several potential strategies to up-regulate adiponectin secretion and function, including visceral fat reduction through diet therapy and exercise, administration of exogenous adiponectin, treatment with peroxisome proliferator-activating receptor gamma (PPARγ) agonists (e.g., thiazolidinediones (TZDs)) and ligands (e.g., bezafibrate and fenofibrate) or the blocking of the renin-angiotensin system. Likewise, the up-regulation of the expression and stimulation of adiponectin receptors by using adiponectin receptor agonists would be an effective method to treat obesity-related conditions. Notably, adiponectin is an abundantly expressed bioactive protein that also exhibits a wide spectrum of biological properties, such as insulin-sensitizing, anti-diabetic, anti-inflammatory and anti-atherosclerotic activities. Although targeting adiponectin and its receptors has been useful for treating diabetes and other metabolic-related diseases in experimental studies, current drug development based on adiponectin/adiponectin receptors for clinical applications is scarce, and there is a lack of available clinical trial data. This comprehensive review discusses the strategies that are presently being pursued to harness the potential of adiponectin up-regulation. In addition, we examined the current status of drug development and its potential for clinical applications. Copyright © 2015 Elsevier Inc. All rights reserved.
Gillen, Michael; Yang, Chun; Wilson, David; Valdez, Shakti; Lee, Caroline; Kerr, Bradley; Shen, Zancong
2017-07-01
Lesinurad is a selective uric acid reabsorption inhibitor approved for the treatment of hyperuricemia associated with gout in combination with xanthine oxidase inhibitors. In vitro assays indicate that lesinurad is an inducer of CYPs in the order CYP3A > CYP2C8 > CYP2C9 > CYP2C19 > CYP2B6 and an inhibitor of CYP2C8 and CYP2C9. To investigate the drug interaction potential of lesinurad, clinical drug interaction studies were conducted. Open-label studies in volunteers investigated the effects of single-/multiple-dose lesinurad on the pharmacokinetics of sildenafil and amlodipine (CYP3A4 induction), tolbutamide (CYP2C9 inhibition/induction), and repaglinide (CYP2C8 inhibition/induction). There was no apparent induction of CYP2C8 and CYP2C9 following repeated lesinurad administration, although no inhibition of CYP2C9 and modest inhibition of CYP2C8 were observed following single-dose lesinurad. Consistent with in vitro observations, lesinurad (200 mg once daily) was an inducer of CYP3A based on the effects on sildenafil exposure. Sildenafil exposure decreased by approximately 34% for C max and AUC when administered with multiple-dose lesinurad 200 mg and allopurinol 300 mg, relative to sildenafil alone. During lesinurad therapy, the possibility of reduced efficacy of concomitant drugs that are CYP3A substrates should be considered and their efficacy monitored because of induction of CYP3A by lesinurad. © 2017, The American College of Clinical Pharmacology.
Intensive short course chemotherapy for treatment of Greek children with tuberculosis.
Tsakalidis, D; Pratsidou, P; Hitoglou-Makedou, A; Tzouvelekis, G; Sofroniadis, I
1992-12-01
This prospective study with an 18-month posttreatment follow-up evaluated the efficacy of intensive short course chemotherapy in Greek children with pulmonary or extrapulmonary tuberculosis. Between November, 1988, and March 1991 a 2-month regimen of rifampin, 10 to 12 mg/kg/day, isoniazid, 10 to 12 mg/kg/day, and pyrazinamide, 30 to 35 mg/kg/day, followed by rifampin and isoniazid for the remaining 4 months, was administered orally to 36 children with tuberculosis. Twenty-three boys and 13 girls ages 8 months to 12 years (mean, 5 1/2 years) were enrolled in the study. The diagnostic criteria for establishing tuberculosis were tuberculin skin test reactivity, radiographic findings compatible with tuberculosis, epidemiological data and clinical and laboratory findings. Four children had extrapulmonary and 32 had pulmonary tuberculosis; 9 of the latter were asymptomatic. Among the pulmonary cases there were 2 children with pleural effusion. Clinical response to therapy was apparent within 7 to 14 days; the pleural effusions resolved in 2 to 6 weeks and the pulmonary infiltrates cleared in 2 to 6 months. Hilar adenopathy regressed within 18 months or longer. No serious problems with drug tolerance or toxicity were noted during the treatment period. Temporary hyperuricemia and transient elevation in serum transaminases were observed in 11 patients but no drug modification was required. There were no posttreatment relapses. These findings suggest that intensive short course chemotherapy for the treatment of Greek children with pulmonary or extrapulmonary tuberculosis appears to be effective, safe, of good patient compliance and comparable to the longer treatment regimens.
Chen, Yu-Fen; Hu, Yi-Chun; Shen, Hsi-Che; Chang, Hui-Te; Tung, Tao-Hsin
2014-01-01
To discuss the prevalence and associated factors related to an elevated serum alanine aminotransferase (ALT) level among the elderly agricultural and fishing population. A total of 6542 (3989 males and 2553 females) healthy adults voluntarily admitted to a teaching hospital for a physical checkup in 2010 in Taipei, Taiwan. Fasting blood samples were drawn via venipuncture, and clinical nurses interviewed the study participants using a structured questionnaire from. The overall prevalence of an elevated serum ALT level was 18.2% and revealed a statistically significant decrease with increasing age (P < 0.001). The men exhibited a higher prevalence than the women (19.7% vs 15.9%; P < 0.001). Male sex; younger age; and presence of obesity, hypertension, hyperuricemia, and hypoalbuminemia were significantly associated with an elevated serum ALT level. Sex-related differences were also revealed. For the men, type 2 diabetes (odds ratio [OR], 1.23; 95% confidence interval [CI], 1.02-1.57), hypercholesterolemia (OR, 1.78; 95% CI, 1.22-2.83), hypertriglyceridemia (OR, 1.32; 95% CI, 1.04-1.73), and low high-density lipoprotein (OR, 1.26; 95% CI, 1.05-1.51) were significantly related to an elevated serum ALT level, but this was not so for the women. The disparity of ALT in age groups was revealed. Several sex-related differences were indicated pertaining to the prevalence of an elevated serum ALT level among elderly specific occupational population.
Kuo, Chi-Mei; Chien, Wu-Hsiung; Shen, Hsi-Che; Hu, Yi-Chun; Chen, Yu-Fen; Tung, Tao-Hsin
2013-01-01
To quantify the prevalence of and associated factors for chronic kidney disease (CKD) among male elderly fishing and agricultural population in Taipei, Taiwan. Subjects (n = 2,766) aged 65 years and over voluntarily admitted to a teaching hospital for a physical checkup were collected in 2010. CKD was defined as an estimated glomerular filtration rate <60 mL/min/1.73 m². Among these subjects, the over prevalence of chronic kidney disease was 13.6% (95% CI: 12.3-14.9%). The age-specific prevalence of CKD in 65-74 years, 75-84 years, and ≥85 years was 8.2%, 19.1%, and 27.0%, respectively. From the multiple logistic regression, age (OR = 1.05, 95% CI: 1.02-1.09), hyperuricemia (OR = 2.94, 95% CI: 1.90-3.78), central obesity (OR = 1.17, 95% CI: 1.02-1.56), hyperglycemia (OR = 1.23, 95% CI: 1.11-1.67), hypertriglyceridemia (OR = 1.25, 95% CI: 1.08-1.66), and lower HDL-C (OR = 1.61, 95% CI: 1.23-1.92) were statistically significantly related to CKD. The presence of metabolic components (one or two versus none, OR = 1.10, 95% CI: 1.04-1.25; three or more versus none, OR = 2.12, 95% CI: 1.86-2.78) also appeared to be statistically significantly related to CKD after adjustment for other independent factors. Several clinical factors independently affect the development of CKD in the elderly male fishing and agricultural population.
Masaki, Mitsuru; Mano, Toshiaki; Eguchi, Akiyo; Fujiwara, Shohei; Sugahara, Masataka; Hirotani, Shinichi; Tsujino, Takeshi; Komamura, Kazuo; Koshiba, Masahiro; Masuyama, Tohru
2016-11-01
Left ventricular (LV) diastolic dysfunction is associated with hypertension and hyperuricemia. However, it is not clear whether the L- and N-type calcium channel blocker will improve LV diastolic dysfunction through the reduction of uric acid. The aim of this study was to investigate the effects of anti-hypertensive therapy, the L- and N-type calcium channel blocker, cilnidipine or the L-type calcium channel blocker, amlodipine, on left atrial reverse remodeling and uric acid in hypertensive patients. We studied 62 patients with untreated hypertension, randomly assigned to cilnidipine or amlodipine for 48 weeks. LV diastolic function was assessed with the left atrial volume index (LAVI), mitral early diastolic wave (E), tissue Doppler early diastolic velocity (E') and the ratio (E/E'). Serum uric acid levels were measured before and after treatment. After treatment, systolic and diastolic blood pressures equally dropped in both groups. LAVI, E/E', heart rate and uric acid levels decreased at 48 weeks in the cilnidipine group but not in the amlodipine group. The % change from baseline to 48 weeks in LAVI, E wave, E/E' and uric acid levels were significantly lower in the cilnidipine group than in the amlodipine group. Larger %-drop in uric acid levels were associated with larger %-reduction of LAVI (p < 0.01). L- and N-type calcium channel blocker but not L-type calcium channel blocker may improve LV diastolic function in hypertensive patients, at least partially through the decrease in uric acid levels.
Li, Min-Rui; Zhang, Sheng-Hong; Chao, Kang; Liao, Xian-Hua; Yao, Jia-Yan; Chen, Min-Hu; Zhong, Bi-Hui
2014-01-01
AIM: To investigate the relationship between Apolipoprotein C3 (APOC3) (-455T>C) polymorphism and nonalcoholic fatty liver disease (NAFLD) in the Southern Chinese Han population. METHODS: In this prospective case-control study, we recruited 300 NAFLD patients and 300 healthy controls to a cohort representing Southern Chinese Han population at The First Affiliated Hospital, Sun Yat-sen University, from January to December 2012. Polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing were used to genotype the APOC3 (-455T>C) variants. RESULTS: After adjusting for age, gender, and body-mass index, TC and CC genotypes were found to increase the susceptibility to NAFLD compared to the TT genotype, with adjusted odds ratios (ORs) of 1.77 (95%CI: 1.16-2.72) and 2.80 (95%CI: 1.64-4.79), respectively. Further stratification analysis indicated that carriers of the CC genotype was more susceptible to insulin resistance (IR) than those of the TT genotype, with an OR of 3.24 (95%CI: 1.52-6.92). The CC genotype also was associated with a significantly higher risk of hypertension, hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol (HDL) (P < 0.05). No association was found between the APOC3 (-455T>C) polymorphism and obesity, impaired glucose tolerance, hyperuricemia, hypercholesterolemia, or high levels of low-density lipoprotein cholesterol (LDL) (P > 0.05). CONCLUSION: APOC3 (-455T>C) genetic variation is involved in the susceptibility to developing NAFLD, IR, hypertension, hypertriglyceridemia, and low HDL in the Southern Chinese Han population. PMID:25320541
Milaneschi, Yuri; Zhang, Yongqing; Becker, Kevin G.; Zukley, Linda; Ferrucci, Luigi
2017-01-01
Uric acid has been linked with increased risk of chronic disease such as cardiovascular disease and this association has been attributed to a pro-inflammatory effect. Indeed, observational studies have shown that high uric acid is associated with high level of pro-inflammatory cytokines in the blood. However, whether high uric acid directly affects inflammation or rather represents a parallel defensive antioxidant mechanism in response to pathology that causes inflammation is unknown. To determine whether acute increase or decrease uric acid levels affects inflammation in healthy individuals, a randomized, placebo-controlled, double blind clinical study of uric acid or rasburicase with 20 healthy volunteers in each treatment-placebo group was conducted at the National Institute on Aging (NIA) Clinical Research Unit (CRU) at Harbor Hospital in Baltimore, MD. Change in inflammatory response was assessed by administering an oral lipid tolerance before and after the treatment of uric acid, rasburicase and placebo. Following uric acid administration, there was an accentuated increase in IL-6 during the oral lipid tolerance test (P<0.001). No significant differences were observed after lowering of uric acid with rasburicase. No side effects were reported throughout the trial. In health individuals, acute increase in uric acid results in an increased IL-6 response when challenged with lipid load. Such effect of amplification of inflammatory response may explain the higher risk of chronic diseases observed in subclinical hyperuricemia in observational studies. Trial Registration: ClinicalTrials.gov NCT01323335 PMID:28786993
Uric Acid in Pregnancy: New Concepts.
Moreno Santillan, Armando Alberto; Briones Garduño, Jesus Carlos; Diaz de Leon Ponce, Manuel Antonio
2018-01-01
The relationship between hyperuricemia and hypertensive disorders is well established; however, until today, the role of uric acid in the clinical course of severe preeclampsia has not been elucidated. Some recent studies suggest that at the time of presentation, subjects with severe preeclampsia frequently have significantly elevated serum uric acid levels, and that the degree of elevation correlates with the severity of the maternal syndrome and fetal morbimortality. In this chapter, we present our workgroup experience. In 2016, we designed a prospective, cross-sectional comparative study. A sample of 200 patients - 100 with severe preeclampsia and 100 with normotensive pregnancy - was obtained. Plasmatic uric acid levels were recorded in units of mg/dL as clinical variables and as laboratory and fetal growth data. We considered uric acid equal to or more than 6.0 mg/dL as the elevated level. To relate the significance of elevated uric acid levels with variables, chi-square tests and Mann-Whitney U test were applied. Any p value equal or <0.05 was accepted as significant. We found significant difference (p = 0.05) between serum uric acid levels among both groups. In comparison with the healthy patients, patients with severe preeclampsia and uric acid greater than 6 mg/dl presented significant differences in relation to fetal complications and maternal laboratory and clinical variables. Our conclusion is that values equal to or greater than 6 mg/dL of serum uric acid in patients with severe preeclampsia may be a valuable biomarker for preeclampsia and an association with the presence of adverse fetal and maternal effects. © 2018 S. Karger AG, Basel.
Lin, Huang-Shen; Cheng, Chun-Wen; Lin, Ming-Shyan; Chou, Yen-Li; Chang, Pey-Jium; Lin, Jing-Chi; Ye, Jung-Jr
2016-01-01
To investigate the clinical characteristics, adverse drug reactions, and outcomes of the oldest old patients (aged ≥80 years) with tuberculosis (TB) treated with rifampicin, isoniazid, and pyrazinamide (RIP)-containing regimens. A retrospective chart review study. A 1,200-bed tertiary teaching hospital in southwest Taiwan. We conducted a retrospective observational study between January 1, 2005 and December 31, 2011. Seven hundred adult patients (aged ≥18 years) with TB treated with RIP-containing anti-TB regimens were reviewed, including 161 oldest old patients. Clinical outcomes included clinical responsiveness and microbiological eradication. Adverse outcomes included drug-induced hepatitis, and other symptoms included gastrointestinal upset (eg, abdominal pain, vomiting, diarrhea, or dyspepsia), skin rash, joint pain, and hyperuricemia. Compared with the non-oldest old adult patients, the oldest old patients more frequently had hepatitis (P=0.014), gastrointestinal upset (P=0.029), and unfavorable outcomes (P<0.001). In a multivariate analysis, hepatitis during treatment (adjusted odds ratio: 3.482, 95% confidence interval: 1.537-7.885; P<0.003) and oldest old age (adjusted odds ratio: 5.161, 95% confidence interval: 2.294-11.613; P<0.010) were independent risk factors for unfavorable outcomes. In the oldest old patients with hepatitis, rifampicin use was more common in the favorable outcome group than in the unfavorable outcome group (100% vs 37.5%; P=0.001). The oldest old age and hepatitis during RIP treatment were associated with unfavorable outcomes. For the oldest old patients with TB having hepatitis during treatment, rifampicin rechallenge and use might benefit the treatment outcome.
Du, Juan; Yang, Xiaomeng; Li, Xia; Li, Ling; Zhou, Yan; Yang, Tao
2018-01-01
Barley grass powder is the best functional food that provides nutrition and eliminates toxins from cells in human beings; however, its functional ingredients have played an important role as health benefit. In order to better cognize the preventive and therapeutic role of barley grass for chronic diseases, we carried out the systematic strategies for functional ingredients of barley grass, based on the comprehensive databases, especially the PubMed, Baidu, ISI Web of Science, and CNKI, between 2008 and 2017. Barley grass is rich in functional ingredients, such as gamma-aminobutyric acid (GABA), flavonoids, saponarin, lutonarin, superoxide dismutase (SOD), K, Ca, Se, tryptophan, chlorophyll, vitamins (A, B1, C, and E), dietary fiber, polysaccharide, alkaloid, metallothioneins, and polyphenols. Barley grass promotes sleep; has antidiabetic effect; regulates blood pressure; enhances immunity; protects liver; has anti-acne/detoxifying and antidepressant effects; improves gastrointestinal function; has anticancer, anti-inflammatory, antioxidant, hypolipidemic, and antigout effects; reduces hyperuricemia; prevents hypoxia, cardiovascular diseases, fatigue, and constipation; alleviates atopic dermatitis; is a calcium supplement; improves cognition; and so on. These results support that barley grass may be one of the best functional foods for preventive chronic diseases and the best raw material of modern diet structure in promoting the development of large health industry and further reveal that GABA, flavonoids, SOD, K-Ca, vitamins, and tryptophan mechanism of barley grass have preventive and therapeutic role for chronic diseases. This paper can be used as a scientific evidence for developing functional foods and novel drugs for barley grass for preventive chronic diseases.
Hong, Quan; Qi, Ka; Feng, Zhe; Huang, Zhiyong; Cui, Shaoyuan; Wang, Liyuan; Fu, Bo; Ding, Rui; Yang, Jurong; Chen, Xiangmei; Wu, Di
2012-05-01
Uric acid (UA) has proven to be a causal agent in endothelial dysfunction in which ROS production plays an important role. Calcium overload in mitochondria can promote the mitochondrial production of ROS. We hypothesize that calcium transduction in mitochondria contributes to UA-induced endothelial dysfunction. We first demonstrated that high concentrations of UA cause endothelial dysfunction, marked by a reduction in eNOS protein expression and NO release in vitro. We further found that a high concentration of UA increased levels of [Ca2+]mito, total intracellular ROS, H2O2, and mitochondrial O2·-, and Δψmito but not the [Ca2+]cyt level. When the mitochondrial calcium channels NCXmito and MCU were blocked by CGP-37157 and Ru360, respectively, the UA-induced increases in the levels of [Ca2+]mito and total intracellular ROS were significantly reduced. Mitochondrial levels of O2·- and Δψmito were reduced by inhibition of NCXmito but not of MCU. Moreover, inhibition of NCXmito, but not of MCU, blocked the UA-induced reductions in eNOS protein expression and NO release. The increased generation of mitochondrial O2·- induced by a high concentration of UA is triggered by mitochondrial calcium overload and ultimately leads to endothelial dysfunction. In this process, the activation of NCXmito is the major cause of the influx of calcium into mitochondria. Our results provide a new pathophysiological mechanism for UA-induced endothelial dysfunction and may offer a new therapeutic target for clinicians. Copyright © 2012 Elsevier Ltd. All rights reserved.
Uric acid as one of the important factors in multifactorial disorders – facts and controversies
Pasalic, Daria; Marinkovic, Natalija; Feher-Turkovic, Lana
2012-01-01
With considering serum concentration of the uric acid in humans we are observing hyperuricemia and possible gout development. Many epidemiological studies have shown the relationship between the uric acid and different disorders such are obesity, metabolic syndrome, hypertension and coronary artery disease. Clinicians and investigators recognized serum uric acid concentration as very important diagnostic and prognostic factor of many multifactorial disorders. This review presented few clinical conditions which are not directly related to uric acid, but the concentrations of uric acid might have a great impact in observing, monitoring, prognosis and therapy of such disorders. Uric acid is recognized as a marker of oxidative stress. Production of the uric acid includes enzyme xanthine oxidase which is involved in producing of radical-oxigen species (ROS). As by-products ROS have a significant role in the increased vascular oxidative stress and might be involved in atherogenesis. Uric acid may inhibit endothelial function by inhibition of nitric oxide-function under conditions of oxidative stress. Down regulation of nitric oxide and induction of endothelial dysfunction might also be involved in pathogenesis of hypertension. The most important and well evidenced is possible predictive role of uric acid in predicting short-term outcome (mortality) in acute myocardial infarction (AMI) patients and stroke. Nephrolithiasis of uric acid origin is significantly more common among patients with the metabolic syndrome and obesity. On contrary to this, uric acid also acts is an “antioxidant”, a free radical scavenger and a chelator of transitional metal ions which are converted to poorly reactive forms. PMID:22384520
Uric acid as one of the important factors in multifactorial disorders--facts and controversies.
Pasalic, Daria; Marinkovic, Natalija; Feher-Turkovic, Lana
2012-01-01
With considering serum concentration of the uric acid in humans we are observing hyperuricemia and possible gout development. Many epidemiological studies have shown the relationship between the uric acid and different disorders such are obesity, metabolic syndrome, hypertension and coronary artery disease. Clinicians and investigators recognized serum uric acid concentration as very important diagnostic and prognostic factor of many multifactorial disorders. This review presented few clinical conditions which are not directly related to uric acid, but the concentrations of uric acid might have a great impact in observing, monitoring, prognosis and therapy of such disorders. Uric acid is recognized as a marker of oxidative stress. Production of the uric acid includes enzyme xanthine oxidase which is involved in producing of radical-oxigen species (ROS). As by-products ROS have a significant role in the increased vascular oxidative stress and might be involved in atherogenesis. Uric acid may inhibit endothelial function by inhibition of nitric oxide-function under conditions of oxidative stress. Down regulation of nitric oxide and induction of endothelial dysfunction might also be involved in pathogenesis of hypertension. The most important and well evidenced is possible predictive role of uric acid in predicting short-term outcome (mortality) in acute myocardial infarction (AMI) patients and stroke. Nephrolithiasis of uric acid origin is significantly more common among patients with the metabolic syndrome and obesity. On contrary to this, uric acid also acts is an "antioxidant", a free radical scavenger and a chelator of transitional metal ions which are converted to poorly reactive forms.
Dalbeth, Nicola; Schumacher, H Ralph; Fransen, Jaap; Neogi, Tuhina; Jansen, Tim L; Brown, Melanie; Louthrenoo, Worawit; Vazquez-Mellado, Janitzia; Eliseev, Maxim; McCarthy, Geraldine; Stamp, Lisa K; Perez-Ruiz, Fernando; Sivera, Francisca; Ea, Hang-Korng; Gerritsen, Martijn; Scire, Carlo A; Cavagna, Lorenzo; Lin, Chingtsai; Chou, Yin-Yi; Tausche, Anne-Kathrin; da Rocha Castelar-Pinheiro, Geraldo; Janssen, Matthijs; Chen, Jiunn-Horng; Cimmino, Marco A; Uhlig, Till; Taylor, William J
2016-12-01
To identify the best-performing survey definition of gout from items commonly available in epidemiologic studies. Survey definitions of gout were identified from 34 epidemiologic studies contributing to the Global Urate Genetics Consortium (GUGC) genome-wide association study. Data from the Study for Updated Gout Classification Criteria (SUGAR) were randomly divided into development and test data sets. A data-driven case definition was formed using logistic regression in the development data set. This definition, along with definitions used in GUGC studies and the 2015 American College of Rheumatology (ACR)/European League Against Rheumatism (EULAR) gout classification criteria were applied to the test data set, using monosodium urate crystal identification as the gold standard. For all tested GUGC definitions, the simple definition of "self-report of gout or urate-lowering therapy use" had the best test performance characteristics (sensitivity 82%, specificity 72%). The simple definition had similar performance to a SUGAR data-driven case definition with 5 weighted items: self-report, self-report of doctor diagnosis, colchicine use, urate-lowering therapy use, and hyperuricemia (sensitivity 87%, specificity 70%). Both of these definitions performed better than the 1977 American Rheumatism Association survey criteria (sensitivity 82%, specificity 67%). Of all tested definitions, the 2015 ACR/EULAR criteria had the best performance (sensitivity 92%, specificity 89%). A simple definition of "self-report of gout or urate-lowering therapy use" has the best test performance characteristics of existing definitions that use routinely available data. A more complex combination of features is more sensitive, but still lacks good specificity. If a more accurate case definition is required for a particular study, the 2015 ACR/EULAR gout classification criteria should be considered. © 2016, American College of Rheumatology.
Serseg, Talia; Benarous, Khedidja
2018-03-18
Side effects of some drugs may be useful in certain cases. In this work, we studied the inhibitory effects of some medications as: Folic Acid which is taken by pregnant women, Colchicine and Febuxostat which is used as treatment of gout disease. These cases are linked to obesity, where women (BMI ≥ 30) have twice higher odds of having an NTD-affected pregnancy than the normal weight women, and the Gout disease frequently occurs in combination of a Metabolic syndrome. The risk of gout increases with the increase of the mass index. In the first part of this study, we studied the inhibition activity of these medications on lipase activity of Candida rugosa in vitro, the results show that these drugs have an important inhibition activity with IC50 values 0.64 mg/ml for Folic acid and 0.66 mg/ml for Febuxostat. İn silico studies were aimed to determine the mechanism of inhibition and different interactions for two enzymes: Candida rugosa lipase and human pancreatic lipase. Autodock vina was used for molecular docking with 50 runs and 1000 obtained solutions. The results show competitive, Non-competitive and uncompetitive inhibition for folic acid, febuxostat and colchicine respectively for two enzymes with different repetition ratios of hydrogen bonds. The saved interactions were with His449 and Ser209 for the three molecules. These observations support a higher intake of dietary folate, and febuxostat for losing weight to decreased NTD risk and prevent hyperuricemia and recurrent gout attacks. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Nishikawa, Atsushi; Ishida, Takehiro; Taketsuna, Masanori; Yoshiki, Fumito; Enomoto, Hiroyuki
2016-01-01
This postmarketing surveillance study assessed the safety and effectiveness of teriparatide in patients with osteoporosis at high risk of fracture in Japan. The patients received teriparatide 20 μg daily by subcutaneous injection, for a maximum of 24 months. Safety and effectiveness analyses were based on data from 1,847 patients who were predominantly female (92.6%) with a mean age of 75.4 years. A total of 157 adverse drug reactions (ADRs) were reported in 140 (7.58%) patients; the most common ADRs were hyperuricemia, nausea, and dizziness. Only six (0.32%) patients reported serious ADRs, the most common being nausea (two patients; 0.1%). Persistence with teriparatide treatment was 60.8% and 39.1% at 18 and 24 months, respectively. There were significant increases in biomarkers for bone formation (procollagen type I N-terminal propeptide and bone-specific alkaline phosphatase) and bone resorption (collagen type I cross-linked C telopeptide and tartrate-resistant acid phosphatase 5b) throughout the study. These were accompanied by significant increases in bone mineral density and low incidences of new vertebral and nonvertebral fractures. Patient-reported measurements for health-related quality of life revealed significant improvements from baseline in back pain and overall health-related quality of life (Short Form-8™ health survey). The results of this 24-month postmarketing surveillance study imply that teriparatide has a favorable safety profile and is effective in the treatment of patients with osteoporosis at high risk of fracture in Japan. Teriparatide may also be a useful treatment for osteoporosis in other societies with aging populations. PMID:27462147
Shani, Michal; Vinker, Shlomo; Dinour, Dganit; Leiba, Merav; Twig, Gilad; Holtzman, Eliezer J; Leiba, Adi
2016-10-01
The risk associated with serum uric acid (SUA) levels within the normal range is unknown, especially among lean and apparently healthy adults. Evaluating whether high-normal SUA levels, 6.8 mg/dL and below, are associated with an increased diabetes risk, compared with low-normal SUA. This was a cohort study with 10 years of followup involving all clinics of the largest nationally distributed Health Maintenance Organization in Israel. Participants included 469,947 examinees, 40-70 years old at baseline, who had their SUA measured during 2002. We excluded examinees who had hyperuricemia (SUA > 6.8 mg/dL), impaired fasting glucose, overweight or obesity and chronic cardiovascular or renal disorders. The final cohort was composed of 30 302 participants. Participants were followed up to a new diagnosis of diabetes during the study period. Odds ratio of developing diabetes among participants with high-normal baseline SUA were compared with low-normal (2 ≤ uric acid < 3 and 3 ≤ uric acid < 4 in women and men, respectively). In a logistic regression model adjusted for age, body mass index, socioeconomic status, smoking, baseline estimated glomerular filtration rate, and baseline glucose, SUA levels of 4-5 mg/dL for women were associated with 61% increased risk for incident diabetes (95% confidence interval, 1.1-2.3). At the highest normal levels for women (SUA, 5-6 mg/dL) the odds ratio was 2.7 (1.8-4.0), whereas men had comparable diabetes risk at values of 6-6.8 mg/dL (hazard ratio, 1.35; 95% confidence interval, 0.9-2.1). SUA levels within the normal range are associated with an increased risk for new-onset diabetes among healthy lean women when compared with those with low-normal values.
Risk of incident diabetes in patients with gout: a cohort study
Kim, Seoyoung C.; Liu, Jun; Solomon, Daniel H.
2015-01-01
Background Patients with hyperuricemia or gout often have metabolic syndrome. Few prospective studies examined the risk of incident diabetes mellitus (DM) in patients with gout, and no data exist whether the DM risk in gout differs by sex. Methods Using data from a US commercial insurance plan (2003–2012), we conducted a cohort study to examine the overall and sex-specific incidence rate (IR) of DM in patients aged ≥40 years with gout compared to those with osteoarthritis. Incident DM was defined based on a diagnosis of DM and a dispensing for anti-diabetic drugs. We tested the sex-specific effect of gout on DM risk. Results The study cohort consisted of 54,075 gout and 162,225 osteoarthritis patients, matched on age, sex and index date. The mean age was 56.2 years and 84.8% were men. Over a mean follow-up of 1.9 years, the IR of DM was 1.91 per 100 person-years in gout and 1.12 per 100 person-years in osteoarthritis patients. After adjusting for age, comorbidities, medications, and health care utilization, gout was associated with an increased risk of DM (hazard ratio [HR] 1.45, 95%CI 1.37–1.54) for both sexes. The impact of gout on the risk of incident DM was greater in women (HR 1.78, 95%CI 1.51–2.09) than men (HR 1.41, 95%CI 1.33–1.50) with a significant interaction between sex and gout (p=0.0009). Conclusion Gout was associated with an increased risk of developing DM compared with osteoarthritis after adjusting for potential confounders, and the risk associated with gout was higher among women than men. PMID:25332119
Patients with gout differ from healthy subjects in renal response to changes in serum uric acid.
Liu, Sha; Perez-Ruiz, Fernando; Miner, Jeffrey N
2017-03-01
Our objectives were to determine whether a change in serum uric acid (sUA) resulted in a corresponding change in the fractional excretion of uric acid (FEUA) and whether the renal response was different in patients with gout versus healthy subjects. FEUA was calculated from previously published studies and four new phase I studies in healthy subjects and/or patients with gout before and after treatment to lower or raise sUA. Treatments included xanthine oxidase inhibitors to lower sUA as well as infusion of uric acid and provision of a high-purine diet to raise sUA. Plots were created of FEUA versus sUA before and after treatment. For the phase I studies, percent change in FEUA per mg/dL change in sUA was calculated separately for healthy subjects and patients with gout, and compared using Student's t test. Analysis of previously published data and the new phase I clinical data indicates that changing sUA by a non-renal mechanism leads to a change in FEUA. The magnitude of change is greater in subjects with higher baseline FEUA versus patients with gout. Healthy subjects excrete more urate than do patients with gout at physiological urate-filtered load; this difference disappears when the urate-filtered load is decreased to ∼5000mg/24hours. These observations are consistent with a less saturated urate reabsorption system in patients with gout versus healthy subjects, resulting in elevated retention of uric acid. Further investigation could lead to the discovery of mechanisms responsible for the etiology of hyperuricemia/gout. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
Tu, Hung-Pin; Tung, Yi-Ching; Tsai, Wen-Chan; Lin, Gau-Tyan; Ko, Ying-Chin; Lee, Su-Shin
2017-03-01
Alcohol intake is strongly associated with hyperuricemia, which may cause gout. This study evaluated the risk of gout in patients with alcohol-related diseases and alcohol dependence syndrome. We used the Taiwan National Health Insurance Research Database (NHIRD) to conduct a nationwide population-based cohort study to assess the risk of gout and gout incidence in patients with alcohol-related diseases and alcohol dependence syndrome (as defined by the International Classification of Diseases, Ninth Revision). In the NHIRD records from 1998 to 2008, we identified 11,675 cases of alcohol-related diseases. The control group comprised 23,350 cases without alcohol-related diseases propensity score-matched (1 case: 2 controls) for age, age group, and sex. The results revealed that alcohol-related diseases were significantly associated with gout risk (adjusted hazard ratio 1.88; P<0.0001). Of the alcohol-related disease cases, 34.1% of the patients had alcohol dependence syndrome (males 34.8%; females 32.4%), and alcohol dependence was independently associated with gout occurrence (relative risk [RR] 2.01; P<0.0001). Severe alcohol-dependent patients (who were also the heavy benzodiazepines users), were associated with an increased risk of gout (RR 1.71 to 4.21, P≤0.0182). Physicians should be aware of the association between alcohol dependence syndrome and gout occurrence, and alcohol use assessment and measures to prevent alcohol dependence should be implemented in the integrative care for patients with gout. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
Zhang, Lili; Spencer, Kylee L.; Voruganti, V. Saroja; Jorgensen, Neal W.; Fornage, Myriam; Best, Lyle G.; Brown-Gentry, Kristin D.; Cole, Shelley A.; Crawford, Dana C.; Deelman, Ewa; Franceschini, Nora; Gaffo, Angelo L.; Glenn, Kimberly R.; Heiss, Gerardo; Jenny, Nancy S.; Kottgen, Anna; Li, Qiong; Liu, Kiang; Matise, Tara C.; North, Kari E.; Umans, Jason G.; Kao, W. H. Linda
2013-01-01
A loss-of-function mutation (Q141K, rs2231142) in the ATP-binding cassette, subfamily G, member 2 gene (ABCG2) has been shown to be associated with serum uric acid levels and gout in Asians, Europeans, and European and African Americans; however, less is known about these associations in other populations. Rs2231142 was genotyped in 22,734 European Americans, 9,720 African Americans, 3,849 Mexican Americans, and 3,550 American Indians in the Population Architecture using Genomics and Epidemiology (PAGE) Study (2008–2012). Rs2231142 was significantly associated with serum uric acid levels (P = 2.37 × 10−67, P = 3.98 × 10−5, P = 6.97 × 10−9, and P = 5.33 × 10−4 in European Americans, African Americans, Mexican Americans, and American Indians, respectively) and gout (P = 2.83 × 10−10, P = 0.01, and P = 0.01 in European Americans, African Americans, and Mexican Americans, respectively). Overall, the T allele was associated with a 0.24-mg/dL increase in serum uric acid level (P = 1.37 × 10−80) and a 1.75-fold increase in the odds of gout (P = 1.09 × 10−12). The association between rs2231142 and serum uric acid was significantly stronger in men, postmenopausal women, and hormone therapy users compared with their counterparts. The association with gout was also significantly stronger in men than in women. These results highlight a possible role of sex hormones in the regulation of ABCG2 urate transporter and its potential implications for the prevention, diagnosis, and treatment of hyperuricemia and gout. PMID:23552988
Torres, Rosa J; de Miguel, Eugenio; Bailén, Rebeca; Banegas, José R; Puig, Juan G
2014-09-01
Primary gout has been associated with single-nucleotide polymorphisms (SNP) in several tubular urate transporter genes. No study has assessed the association of reabsorption and secretion urate transporter gene SNP with gout in a single cohort of documented primary patients with gout carefully subclassified as normoexcretors or underexcretors. Three reabsorption SNP (SLC22A12/URAT1, SLC2A9/GLUT9, and SLC22A11/OAT4) and 2 secretion transporter SNP (SLC17A1/NPT1 and ABCG2/BRCP) were studied in 104 patients with primary gout and in 300 control subjects. The patients were subclassified into normoexcretors and underexcretors according to their serum and 24-h urinary uric acid levels under strict conditions of dietary control. Compared with control subjects, patients with gout showed different allele distributions of the 5 SNP analyzed. However, the diagnosis of underexcretor was only positively associated with the presence of the T allele of URAT1 rs11231825, the G allele of GLUT9 rs16890979, and the A allele of ABCG2 rs2231142. The association of the A allele of ABCG2 rs2231142 in normoexcretors was 10 times higher than in underexcretors. The C allele of NPT1 rs1165196 was only significantly associated with gout in patients with normal uric acid excretion. Gout with uric acid underexcretion is associated with transporter gene SNP related mainly to tubular reabsorption, whereas uric acid normoexcretion is associated only with tubular secretion SNP. This finding supports the concept of distinctive mechanisms to account for hyperuricemia in patients with gout with reduced or normal uric acid excretion.
Common variant of ALPK1 is not associated with gout: a replication study.
Chiba, Toshinori; Matsuo, Hirotaka; Sakiyama, Masayuki; Nakayama, Akiyoshi; Shimizu, Seiko; Wakai, Kenji; Suma, Shino; Nakashima, Hiroshi; Sakurai, Yutaka; Shimizu, Toru; Ichida, Kimiyoshi; Shinomiya, Nariyoshi
2015-01-01
Gout is one of the most kinds of common inflammatory arthritis as a consequence of hyperuricemia. Alpha-protein kinase 1 (ALPK1) gene locates in a gout-susceptibility locus on chromosome 4q21-31, and encodes ALPK1 protein which plays a pivotal role in the phosphorylation of myosin 1. In the previous genetic study of Taiwanese populations, 3 single nucleotide polymorphisms (SNPs), rs11726117, rs231247 and rs231253, in ALPK1 gene were reported to have a significant association with gout. However, no replication study has been performed to confirm this association. Therefore, we first conducted a replication study with clinically defined gout patients in a different population. Linkage disequilibrium (LD) analyzes of the 3 SNPs in ALPK1 revealed that these SNPs are in strong LD in a Japanese population. Among the 3 SNPs of ALPK1, rs11726117 (M861T) is the only missense SNP. Therefore, rs11726117 was genotyped in a Japanese population of 903 clinically defined gout cases and 1,302 controls, and was evaluated for a possible association with gout. The minor allele frequencies of rs11726117 were 0.26 and 0.25 in the case and control groups, respectively. The association analysis has not detected a significant association between rs11726117 and gout susceptibility in a Japanese population (p = 0.44). Because ABCG2, a major causative gene for gout, also locates in the gout-susceptibility locus on chromosome 4q, these findings suggest that among genes in a gout-susceptibility locus, not ALPK1 but ABCG2 could be important as a gout-susceptible gene.
Determinants of blood uric acid levels in a dyslipidemic Arab population.
Al-Meshaweh, Ahoud F; Jafar, Yaqoub; Asem, Mohammad; Akanji, Abayomi O
2012-01-01
The objective of this study was to explore the relationships between circulating uric acid and lipid levels and components of the metabolic syndrome (MetS) in Arab dyslipidemic patients, a group already at high coronary artery disease risk. The medical records of 1,229 subjects (632 men, 597 women) referred for treatment of dyslipidemia and followed up for at least 12 months were reviewed. Serum levels of uric acid and lipids (total cholesterol, triglycerides, low-density lipoprotein, high-density lipoprotein) and other variables in the National Cholesterol Education Program ATP III criteria definition of MetS were assessed at initial presentation and every 4- 6 months, under specific lipid-lowering treatment (statins and/or fibrates), in each of the subjects. Their respective associations were explored by appropriate logistic regression techniques with control for confounding risk factors, including age, gender and body mass index. 306 subjects (24.9%) of the study population were hyperuricemic; they were more likely to be men, obese and diabetic. Also the serum uric acid level (mean ± SD) was greater in men with MetS compared with men without (377.0 ± 98.0 vs. 361.6 ± 83.1 μmol/l, p < 0.05), an observation not reproduced in women. Uric acid levels had significant associations with the presence of fasting hyperglycemia, hypertension and large waist circumference (WC) in men, but only with large WC in women. With statin treatment, uric acid levels decreased by 10% within 1 year of treatment; with fibrates, uric acid levels remained unchanged or slightly increased. The data showed that hyperuricemia is common in dyslipidemic patients in Kuwait, where its important determinants are male sex, obesity, diabetes and statin treatment. Copyright © 2011 S. Karger AG, Basel.
Pascual, Eliseo; Pedraz, Teresa
2004-05-01
We have reviewed the latest publications on epidemiology of gout; also there have been new insights into the regulation of the inflammation resulting from the regular interaction occurring between MSU crystals and cells in both asymptomatic and symptomatic gouty joints. Finally we review different publications of clinical interest. The incidence of gout has been found to be increasing, and the disease starts at an earlier age; this likely relates to changes in dietary habits that lead to the development of the insulin resistance syndrome to which hyperuricemia, and thus gout, relates. Dietary modifications to correct the insulin resistance syndrome and reduce uricemia by increasing renal clearance of urate have heath consequences that go far beyond their beneficial effect on gout. Monosodium urate crystals and cells interact in the asymptomatic joints of gouty patients. The mechanisms that trigger a gouty attack with this background and those responsible for the self-limitation of gouty attacks are not understood. The degree of maturation of the monocytes-macrophages present in the fluid appears to modulate the consequences of the crystal-cell interaction and gives a hint of how from the crystal-cell interaction may result in such divergent consequences as intense inflammation or the absence of symptoms. Interest in gout treatment continues, as shown by the number of papers on the subject reviewed. In most cases, gout is an easy disease to treat, but we do not have enough information about how to handle those few patients with "difficult" disease, and what we refer colloquially to as difficult gout has not been properly defined yet. Gout incidence and severity appear to be increasing likely in relation to dietary habits. Switching the pattern of secretion of inflammatory mediators with maturating macrophages which contain MSU crystals may be the key to self limitation of gouty attacks. We must define better which gout is a "difficult" one.
Urine alkalization facilitates uric acid excretion
2010-01-01
Background Increase in the incidence of hyperuricemia associated with gout as well as hypertension, renal diseases and cardiovascular diseases has been a public health concern. We examined the possibility of facilitated excretion of uric acid by change in urine pH by managing food materials. Methods Within the framework of the Japanese government's health promotion program, we made recipes which consist of protein-rich and less vegetable-fruit food materials for H+-load (acid diet) and others composed of less protein but vegetable-fruit rich food materials (alkali diet). Healthy female students were enrolled in this consecutive 5-day study for each test. From whole-day collected urine, total volume, pH, organic acid, creatinine, uric acid and all cations (Na+,K+,Ca2+,Mg2+,NH4+) and anions (Cl-,SO42-,PO4-) necessary for the estimation of acid-base balance were measured. Results Urine pH reached a steady state 3 days after switching from ordinary daily diets to specified regimens. The amount of acid generated ([SO42-] +organic acid-gut alkai) were linearly related with those of the excretion of acid (titratable acidity+ [NH4+] - [HCO3-]), indicating that H+ in urine is generated by the metabolic degradation of food materials. Uric acid and excreted urine pH retained a linear relationship, where uric acid excretion increased from 302 mg/day at pH 5.9 to 413 mg/day at pH 6.5, despite the fact that the alkali diet contained a smaller purine load than the acid diet. Conclusion We conclude that alkalization of urine by eating nutritionally well-designed food is effective for removing uric acid from the body. PMID:20955624
Iskierko, Zofia; Sosnowska, Marta; Sharma, Piyush Sindhu; Benincori, Tiziana; D'Souza, Francis; Kaminska, Izabela; Fronc, Krzysztof; Noworyta, Krzysztof
2015-12-15
A novel recognition unit of chemical sensor for selective determination of the inosine, renal disfunction biomarker, was devised and prepared. For that purpose, inosine-templated molecularly imprinted polymer (MIP) film was deposited on an extended-gate field-effect transistor (EG-FET) signal transducing unit. The MIP film was prepared by electrochemical polymerization of bis(bithiophene) derivatives bearing cytosine and boronic acid substituents, in the presence of the inosine template and a thiophene cross-linker. After MIP film deposition, the template was removed, and was confirmed by UV-visible spectroscopy. Subsequently, the film composition was characterized by spectroscopic techniques, and its morphology and thickness were determined by AFM. The finally MIP film-coated extended-gate field-effect transistor (EG-FET) was used for signal transduction. This combination is not widely studied in the literature, despite the fact that it allows for facile integration of electrodeposited MIP film with FET transducer. The linear dynamic concentration range of the chemosensor was 0.5-50 μM with inosine detectability of 0.62 μM. The obtained detectability compares well to the levels of the inosine in body fluids which are in the range 0-2.9 µM for patients with diagnosed diabetic nephropathy, gout or hyperuricemia, and can reach 25 µM in certain cases. The imprinting factor for inosine, determined from piezomicrogravimetric experiments with use of the MIP film-coated quartz crystal resonator, was found to be 5.5. Higher selectivity for inosine with respect to common interferents was also achieved with the present molecularly engineered sensing element. The obtained analytical parameters of the devised chemosensor allow for its use for practical sample measurements. Copyright © 2015 Elsevier B.V. All rights reserved.
Wu, Wei-Chun; Lin, Pei-Chen; Hung, Chun-Chi; Lin, Hung-Hsun; Cheng, Ching-Mei; Lee, Chung-Yin; Chiu, Kuei-Fen; Lin, Wen-Yi; Huang, Chia-Tsuan; Wu, Ming-Tsang
2015-12-01
Individuals with prediabetes (100-125 mg/dL) and diabetes mellitus (DM) increase the risk of all-cause and cardiovascular disease (CVD) mortality. Since personal substance use such as cigarette smoking, alcohol drinking, and areca nut chewing may confound the true effect of clinical biochemistries on the risk of prediabetes, this study aims to examine the relationship between clinical biochemical parameters and the risk of prediabetes among Taiwanese without the habits of consuming tobacco, alcohol drinking, or areca nut. Women aged between 40 years and 64 years who came to one community teaching hospital between January 1, 2001 and December 31, 2008 for general health screening for the first time were studied. The general health screening is provided every 3 years gratis. The package of this health screening includes personal history, physical examination, and biochemical tests in serum and urine. In total, 8580 nonsmoking, nondrinking, and nonareca nut chewing women who did not have a history of DM were eligible for this study. Of these, 1861 (21.7%) out of 8580 women were prediabetic. Compared to women with normal fasting glucose (NFG), we found a dose-response relationship of the risk of prediabetes with age and body mass index (BMI) and total cholesterol, triglyceride, glutamic-pyruvic transaminase (GPT), and uric acid in serum. Women with hypertension or proteinuria (≥30 mg/dL) had also an increased risk to have prediabetes. Besides age, the factors of BMI, hypertension, dyslipidemia, GPT, hyperuricemia, and proteinuria are the main risk factors for prediabetes in Taiwanese women without substance uses. A follow-up study is necessary to clarify the causality of these important biochemical parameters and prediabetes. Copyright © 2014. Published by Elsevier B.V.
Sunagawa, Sumito; Shirakura, Takashi; Hokama, Noboru; Kozuka, Chisayo; Yonamine, Masato; Namba, Toyotaka; Morishima, Satoko; Nakachi, Sawako; Nishi, Yukiko; Ikema, Tomomi; Okamoto, Shiki; Matsui, Chieko; Hase, Naoki; Tamura, Mizuho; Shimabukuro, Michio; Masuzaki, Hiroaki
2018-06-03
There is a controversy whether hyperuricemia is an independent risk for cardiometabolic diseases. Serum level of uric acid is affected by a wide variety of factors involved in its production and excretion. On the other hand, evidence has accumulated that locally and systemically activated xanthine oxidase (XO), a rate limiting enzyme for production of uric acid, is linked to metabolic derangement in humans and rodents. We therefore explored the clinical implication of plasma XO activity in patients with type 2 diabetes mellitus (T2DM) and metabolic syndrome (MetS). We enrolled 60 patients with T2DM and MetS. MetS was defined according to the 2005 International Diabetes Federation guidelines. Plasma XO activity was measured by highly sensitive fluorometric assay measuring the conversion of pterin to isoxanthopterin, and explored associations between the value of plasma XO activity and metabolic parameters. Value of plasma XO activity was correlated with indices of insulin resistance and level of circulating liver transaminases. On the other hand, level of serum uric acid was not correlated with indices of insulin resistance. The value of plasma XO activity was not correlated with serum uric acid level. Plasma XO activity correlates with indices of insulin resistance and liver dysfunction in Japanese patients with T2DM and MetS. Through assessing the plasma XO activity, patients demonstrating normal level of serum uric acid with higher activity of XO can be screened, thereby possibly providing a clue to uncover metabolic risks in T2DM and MetS. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Bouhenni, Hamida; Daoudi, Hadjer; Djemai, Haidar; Noirez, Philippe; Rouabah, Abdelkader; Vitiello, Damien; Rouabah, Leila
2017-11-23
Background Association of hyperuricemia, dyslipidemia and high blood pressure (BP) among adolescents with high waist-to-height ratio (WHtR) remains not fully addressed and could represent a new way to diagnose adolescents early with cardiometabolic risk. Objective We aimed to determine abdominal obesity (AO) prevalence and investigate relations between AO, uric acid (UA), lipid profiles, BP and geographical patterns in adolescents. Subjects 577 and 204 Algerian students aged between 10 and 19 years were included in our epidemiological and biochemical studies, respectively. Methods Height, weight, waist circumference (Wc) and hip circumferences, body mass index (BMI) and BP were measured. Fasting blood sampling was performed to measure glycemia, lipid profile, uricemia, insulinemia and leptinemia. The WHtR ≥0.50 was applied for the diagnosis of AO and geodemographics was evaluated. Results The prevalence of AO was 12.13% among all students, 19.17% and 16.39% among students living in urban and plain areas, respectively. The risk of AO may be reduced in rural and mountainous areas. Lipid parameters, UA, insulin and leptin serum concentrations were significantly increased in adolescents with WHtR ≥0.50 compared to those with WHtR <0.50. Cardiometabolic risk was increased with WHtR ≥0.50 and BMI >26. Means of BMI, Wc, BP, and lipid parameters were significantly increased in the fourth quartiles compared to the first quartile of UA. Conclusion Urban areas and plains represent factors contributing to AO and WHtR ≥0.50 may be used as a cut-off point to define risks of high BP, lipid abnormalities and UA serum level in Algerian adolescents.
Araki, Shin-ichi; Nishio, Yoshihiko; Araki, Atsushi; Umegaki, Hiroyuki; Sakurai, Takashi; Iimuro, Satoshi; Ohashi, Yasuo; Uzu, Takashi; Maegawa, Hiroshi; Kashiwagi, Atsunori; Ito, Hideki
2012-04-01
Diabetic nephropathy is a serious complication in patients with type 2 diabetes. The aim of this study was to explore the factors associated with the progression of this complication in elderly patients with type 2 diabetes. This retrospective study of a subgroup of patients registered with the Japanese Elderly Diabetes Intervention Trial included 621 Japanese patients with type 2 diabetes mellitus (age ≥ 65 years, 346 with normoalbuminuria, 190 with microalbuminuria and 85 with overt proteinuria). Multivariate Cox proportional hazard regression model with a backward stepwise procedure was applied to select factors with significant effects on worsening of nephropathy stage and the doubling of serum creatinine. During the follow up (median 52 months), 21% of patients progressed from normoalbuminuria and microalbuminuria to a worse nephropathy stage. Aging, female sex and high-density lipoprotein cholesterol were identified as independent and significant factors that worsen nephropathy stage. Also, 6.1% of patients showed doubling of serum creatinine during follow up. A positive history of cardiovascular disease, hyperuricemia and conventional therapy were identified as significant factors involved in the doubling of serum creatinine. The cumulative incidence of the doubling of serum creatinine was significantly lower in the intensive therapy group than the conventional therapy group (P = 0.016), although that of progression of nephropathy stage was similar in the two groups. We identified several factors associated with the progression of diabetic nephropathy in elderly patients with type 2 diabetes. The results suggest that multiple risk factor intervention seems important in preventing deterioration of renal dysfunction. © 2012 Japan Geriatrics Society.
Iterative outlier removal: A method for identifying outliers in laboratory recalibration studies
Parrinello, Christina M.; Grams, Morgan E.; Sang, Yingying; Couper, David; Wruck, Lisa M.; Li, Danni; Eckfeldt, John H.; Selvin, Elizabeth; Coresh, Josef
2016-01-01
Background Extreme values that arise for any reason, including through non-laboratory measurement procedure-related processes (inadequate mixing, evaporation, mislabeling), lead to outliers and inflate errors in recalibration studies. We present an approach termed iterative outlier removal (IOR) for identifying such outliers. Methods We previously identified substantial laboratory drift in uric acid measurements in the Atherosclerosis Risk in Communities (ARIC) Study over time. Serum uric acid was originally measured in 1990–92 on a Coulter DACOS instrument using an uricase-based measurement procedure. To recalibrate previous measured concentrations to a newer enzymatic colorimetric measurement procedure, uric acid was re-measured in 200 participants from stored plasma in 2011–13 on a Beckman Olympus 480 autoanalyzer. To conduct IOR, we excluded data points >3 standard deviations (SDs) from the mean difference. We continued this process using the resulting data until no outliers remained. Results IOR detected more outliers and yielded greater precision in simulation. The original mean difference (SD) in uric acid was 1.25 (0.62) mg/dL. After four iterations, 9 outliers were excluded, and the mean difference (SD) was 1.23 (0.45) mg/dL. Conducting only one round of outlier removal (standard approach) would have excluded 4 outliers (mean difference [SD] = 1.22 [0.51] mg/dL). Applying the recalibration (derived from Deming regression) from each approach to the original measurements, the prevalence of hyperuricemia (>7 mg/dL) was 28.5% before IOR and 8.5% after IOR. Conclusion IOR is a useful method for removal of extreme outliers irrelevant to recalibrating laboratory measurements, and identifies more extraneous outliers than the standard approach. PMID:27197675
Prevalence of diabetes mellitus and prediabetes in the adult Romanian population: PREDATORR study.
Mota, Maria; Popa, Simona Georgiana; Mota, Eugen; Mitrea, Adina; Catrinoiu, Doina; Cheta, Dan Mircea; Guja, Cristian; Hancu, Nicolae; Ionescu-Tirgoviste, Constantin; Lichiardopol, Radu; Mihai, Bogdan Mircea; Popa, Amorin Remus; Zetu, Cornelia; Bala, Cornelia Gabriela; Roman, Gabriela; Serafinceanu, Cristian; Serban, Viorel; Timar, Romulus; Veresiu, Ioan Andrei; Vlad, Adrian Radu
2016-05-01
The PREDATORR (PREvalence of DiAbeTes mellitus, prediabetes, overweight, Obesity, dyslipidemia, hyperuricemia and chronic kidney disease in Romania) study is the first national study analyzing the prevalence of diabetes mellitus (DM) and prediabetes, and their association with cardiometabolic, sociodemographic, and lifestyle risk factors in the Romanian population aged 20-79 years. This was an epidemiological study with a stratified, cross-sectional, cluster random sampling design. Sociodemographic, lifestyle, and anamnestic data were collected through self- and interviewer-administered questionnaires, and biochemical assays and oral glucose tolerance tests were performed. In all, 2728 participants from 101 clinics of general practitioners were randomly selected, with a probability proportional to population size according to the 2002 Romanian Census. The participation rate was 99.6%. Impaired glucose regulation (prediabetes, known and unknown DM) was found in 28.1% of the study population. The overall age- and sex-adjusted prevalence of DM was 11.6% (95% CI 9.6%-13.6%), of which 2.4% (95% CI 1.7%-3.1%) had unknown DM. The prevalence of DM increased with age and was higher in men than in women. The age- and sex-adjusted prevalence of prediabetes was 16.5% (95%CI 14.8%-18.2%), with the highest percentage in the 60-79 year age group and in women. Obesity, abdominal obesity, dyslipidemia, low education level, and a family history of diabetes were associated with glucose metabolism disorders. The PREDATORR study shows a high prevalence of impaired glucose regulation in the adult Romanian population, providing data on the prevalence of DM and prediabetes and their association with several risk factors. © 2015 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley Sons & Australia, Ltd.
Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia
Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie; Struck, Maggie; Ramirez, Harvey E.; Jordan, Juan; Andrutis, Karl; Chou, Janice Y.; Byrne, Barry J.
2010-01-01
Abstract Glycogen storage disease type Ia (GSDIa; von Gierke disease; MIM 232200) is caused by a deficiency in glucose-6-phosphatase-α. Patients with GSDIa are unable to maintain glucose homeostasis and suffer from severe hypoglycemia, hepatomegaly, hyperlipidemia, hyperuricemia, and lactic acidosis. The canine model of GSDIa is naturally occurring and recapitulates almost all aspects of the human form of disease. We investigated the potential of recombinant adeno-associated virus (rAAV) vector-based therapy to treat the canine model of GSDIa. After delivery of a therapeutic rAAV2/8 vector to a 1-day-old GSDIa dog, improvement was noted as early as 2 weeks posttreatment. Correction was transient, however, and by 2 months posttreatment the rAAV2/8-treated dog could no longer sustain normal blood glucose levels after 1 hr of fasting. The same animal was then dosed with a therapeutic rAAV2/1 vector delivered via the portal vein. Two months after rAAV2/1 dosing, both blood glucose and lactate levels were normal at 4 hr postfasting. With more prolonged fasting, the dog still maintained near-normal glucose concentrations, but lactate levels were elevated by 9 hr, indicating that partial correction was achieved. Dietary glucose supplementation was discontinued starting 1 month after rAAV2/1 delivery and the dog continues to thrive with minimal laboratory abnormalities at 23 months of age (18 months after rAAV2/1 treatment). These results demonstrate that delivery of rAAV vectors can mediate significant correction of the GSDIa phenotype and that gene transfer may be a promising alternative therapy for this disease and other genetic diseases of the liver. PMID:20163245
Vukovic, Jonatan; Modun, Darko; Budimir, Danijela; Sutlovic, Davorka; Salamunic, Ilza; Zaja, Ivan; Boban, Mladen
2009-11-01
We examined the effects of acute, food-induced moderate increase of plasma uric acid (UA) on arterial stiffness and markers of oxidative damage in plasma in healthy males exposed to 100% normobaric oxygen. Acute elevation of plasma UA was induced by consumption of red wine, combination of ethanol and glycerol, or fructose. By using these beverages we were able to separate the effects of UA, wine polyphenols and ethanol. Water was used as a control beverage. Ten males randomly consumed test beverages in a cross-over design over the period of 4 weeks, one beverage per week. They breathed 100% O(2) between 60(th) and 90(th)min of the 4-h study protocol. Pulse wave augmentation index (AIx) at brachial and radial arteries, plasma antioxidant capacity (AOC), thiobarbituric acid-reactive substances (TBARS), lipid hydroperoxides (LOOH) assessed by xylenol orange method, UA and blood ethanol concentrations were determined before and 60, 90, 120, 150 and 240 min after beverage consumption. Consumption of the beverages did not affect the AIx, TBARS or LOOH values during 60 min before exposure to hyperoxia, while AOC and plasma UA increased except in the water group. Significant increase of AIx, plasma TBARS and LOOH, which occurred during 30 min of hyperoxia in the water group, was largely prevented in the groups that consumed red wine, glycerol+ethanol or fructose. In contrast to chronic hyperuricemia, generally considered as a risk factor for cardiovascular diseases and metabolic syndrome, acute increase of UA acts protectively against hyperoxia-induced oxidative stress and related increase of arterial stiffness in large peripheral arteries.
Uric Acid, Metabolic Syndrome and Atherosclerosis: The Chicken or the Egg, Which Comes First?
De Pergola, Giovanni; Cortese, Francesca; Termine, Gaetano; Meliota, Giovanni; Carbonara, Rossella; Masiello, Michele; Cortese, Anna M; Silvestris, Francesco; Caccavo, Domenico; Ciccone, Marco Matteo
2018-01-01
A great debate in literature exists nowadays on the role of uric acid as a marker of cardiovascular and metabolic organ damage or a risk factor for cardiovascular and metabolic disease. The study aimed to determine the relationship among serum uric acid and metabolic syndrome and atherosclerosis, by means of carotid intima media-thickness, in a cohort of 811 otherwise healthy overweight/obese subjects, without overt atherosclerosis not using any kind of drug. Uric acid levels were positively related to male gender, waist circumference, BMI, systolic and diastolic pressure levels, fasting insulin, fasting glucose, HOMA-IR, triglycerides, total cholesterol, LDL cholesterol, the presence of metabolic syndrome and the number of the components of metabolic syndrome and negatively related to HDL cholesterol levels. No correlation was found between uric acid and carotid intima media thickness. At the multiple regression analysis, only waist circumference and triglycerides (positively) and HDL-cholesterol (negatively) maintained an independent association with uric acid as dependent variable, while age, female gender and uric acid showed a significant independent association with metabolic syndrome as dependent variable. Moreover, the analysis of the odd ratios showed that the risk of developing metabolic syndrome was consistent with uric acid levels ranging from 3 mg/dl to 8 mg/dl. The presence of metabolic syndrome does not seem to provide hyperuricemia. By contrast, higher serum uric acid level may predict the risk of metabolic syndrome. Moreover, our results suggest that uric acid cannot be considered a risk factor for early atherosclerosis, at least when assessed using carotid ultrasound. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Tamura, Kazuo; Kawai, Yasukazu; Kiguchi, Toru; Okamoto, Masataka; Kaneko, Masahiko; Maemondo, Makoto; Gemba, Kenichi; Fujimaki, Katsumichi; Kirito, Keita; Goto, Tetsuya; Fujisaki, Tomoaki; Takeda, Kenji; Nakajima, Akihiro; Ueda, Takanori
2016-10-01
Control of serum uric acid (sUA) levels is very important during chemotherapy in patients with malignant tumors, as the risks of tumor lysis syndrome (TLS) and renal events are increased with increasing levels of sUA. We investigated the efficacy and safety of febuxostat, a potent non-purine xanthine oxidase inhibitor, compared with allopurinol for prevention of hyperuricemia in patients with malignant tumors, including solid tumors, receiving chemotherapy in Japan. An allopurinol-controlled multicenter, open-label, randomized, parallel-group comparative study was carried out. Patients with malignant tumors receiving chemotherapy, who had an intermediate risk of TLS or a high risk of TLS and were not scheduled to be treated with rasburicase, were enrolled and then randomized to febuxostat (60 mg/day) or allopurinol (300 or 200 mg/day). All patients started to take the study drug 24 h before chemotherapy. The primary objective was to confirm the non-inferiority of febuxostat to allopurinol based on the area under the curve (AUC) of sUA for a 6-day treatment period. Forty-nine and 51 patients took febuxostat and allopurinol, respectively. sUA decreased over time after initiation of study treatment. The least squares mean difference of the AUC of sUA between the treatment groups was -33.61 mg h/dL, and the 95 % confidence interval was -70.67 to 3.45, demonstrating the non-inferiority of febuxostat to allopurinol. No differences were noted in safety outcomes between the treatment groups. Febuxostat demonstrated an efficacy and safety similar to allopurinol in patients with malignant tumors receiving chemotherapy. http://www.clinicaltrials.jp ; Identifier: JapicCTI-132398.
Steinberg, Alexandra S; Vince, Bradley D; Choi, Yun-Jung; Martin, Robert L; McWherter, Charles A; Boudes, Pol F
2017-03-01
Arhalofenate (ARH), in development for gout, has uricosuric and anti-flare activities. ARH plus febuxostat (FBX) were evaluated in subjects with gout for serum uric acid (SUA) lowering, drug interaction, and safety. Open phase II trial in gout volunteers (NCT02252835). Cohort 1 received ARH 600 mg for 2 weeks, followed by sequential 1-week co-administration of FBX 80 mg followed by 40 mg. FBX 40 mg was continued alone for 2 weeks. Cohort 2 received ARH 800 mg for 2 weeks, followed by sequential 1-week co-administration of FBX 40 mg followed by 80 mg. FBX 80 mg was continued alone for 2 weeks. SUA, its fractional excretion (FEUA), and plasma oxypurines were assessed. Pharmacokinetics of FBX and ARH were determined alone and in combination for cohort 2. Baseline mean SUA was 9.4 mg/dl for cohort 1 (n = 16) and 9.2 mg/dl for cohort 2 (n = 16). The largest SUA decrease (63%) was observed with ARH 800 mg + FBX 80 mg, with all subjects reaching SUA < 6 mg/dl and 93% < 5 mg/dl. The area under the curve (AUC) (0-t) of ARH acid + FBX/ARH acid was 108%. The AUC (0-t) of FBX + ARH acid/FBX was 87%. As expected, FBX increased oxypurines and increases were unaffected by ARH co-administration. Baseline FEUA were low (3.5%-4.6%) and ARH increased them toward normal without overexcretion of UA. ARH was well tolerated and appeared safe. ARH and FBX lowered SUA by complementary mechanisms. The combination provided greater decreases than each drug alone. The combination was well tolerated and appeared safe. NCT02252835.
Shirakura, Takashi; Nomura, Johji; Matsui, Chieko; Kobayashi, Tsunefumi; Tamura, Mizuho; Masuzaki, Hiroaki
2016-08-01
Xanthine oxidase (XO) is an enzyme responsible for the production of uric acid. XO produces considerable amount of oxidative stress throughout the body. To date, however, its pathophysiologic role in hypertension and endothelial dysfunction still remains controversial. To explore the possible involvement of XO-derived oxidative stress in the pathophysiology of vascular dysfunction, by use of a selective XO inhibitor, febuxostat, we investigated the impact of pharmacological inhibition of XO on hypertension and vascular endothelial dysfunction in spontaneously hypertensive rats (SHRs). Sixteen-week-old SHR and normotensive Wistar-Kyoto (WKY) rats were treated with tap water (control) or water containing febuxostat (3 mg/kg/day) for 6 weeks. Systolic blood pressure (SBP) in febuxostat-treated SHR (220 ± 3 mmHg) was significantly (P < 0.05) decreased compared with the control SHR (236 ± 4 mmHg) while SBP in febuxostat-treated WKY was constant. Acetylcholine-induced endothelium-dependent relaxation in aortas from febuxostat-treated SHR was significantly (P < 0.05) improved compared with the control SHR, whereas relaxation in response to sodium nitroprusside was not changed. Vascular XO activity and tissue nitrotyrosine level, a representative indicator of local oxidative stress, were considerably elevated in the control SHR compared with the control WKY, and this increment was abolished by febuxostat. Our results suggest that exaggerated XO activity and resultant increase in oxidative stress in this experimental model contribute to the hypertension and endothelial dysfunction, thereby supporting a notion that pharmacological inhibition of XO is valuable not only for hyperuricemia but also for treating hypertension and related endothelial dysfunction in human clinics.
Alshahawey, Mona; Shahin, Sara Mahmoud; Elsaid, Tamer Wahid; Sabri, Nagwa Ali
2017-01-01
Endothelial dysfunction is an important risk factor for cardiovascular diseases to occur in end-stage renal disease patients. Febuxostat, being a novel xanthine oxidase inhibitor, is apparently having a beneficial role in improving the endothelial dysfunction; however, data among hemodialysis patients are still limited. A prospective, placebo-controlled, block-randomized, double-blinded study was carried out to evaluate the effect of oral febuxostat on the endothelial dysfunction in hemodialysis patients. Fifty-seven eligible hemodialysis patients were randomly assigned to either the drug group (40 mg thrice weekly) or the placebo group. Serum Asymmetric dimethylarginine (ADMA), Serum uric acid (UA), and serum high sensitivity C-reactive protein (hsCRP) were measured at baseline and at the end of a 2-month study. Serum alanine aminotransferase (ALT), serum aspartate aminotransferase (AST), and the occurrence of pancytopenia were tested as safety parameters at baseline and at the end of study. Serum UA significantly decreased from 7.5 ± 0.8 to 5.1 ± 1.2 mg/dL in the febuxostat group, while it did not change significantly in the placebo group. Treatment with febuxostat resulted in a significant decrease in the serum ADMA level from 1.027 ± 0.116 to 0.944 ± 0.104 µmol/L and the serum hsCRP level from 12.5 ± 1.65 to 12.1 ± 1.70 mg/L. Testing of serum ALT, serum AST, and pancytopenia revealed no significant difference in both groups. Febuxostat appears to improve hyperuricemia and endothelial dysfunction and ameliorate inflammation in hemodialysis patients with no safety concerns. © 2017 S. Karger AG, Basel.
Kim, Seoyoung C; Schmidt, Bernhard M W; Franklin, Jessica M; Liu, Jun; Solomon, Daniel H; Schneeweiss, Sebastian
2013-12-01
Gout is a common form of inflammatory arthritis with an increasing prevalence in developed countries. It is well known that many patients with gout have significant comorbidities and high health care utilization. We aimed to describe the clinical characteristics and health care utilization patterns in patients with gout who were newly prescribed allopurinol, febuxostat, or colchicine. We used US insurance claims data (2009-2011) to conduct a population-based cohort study. There were 25,051 allopurinol, 4,288 febuxostat, and 6,238 colchicine initiators. The mean age was 53 years and 83-87% were men. More than one-half of the patients had hypertension and hyperlipidemia, 20% had diabetes mellitus, and 10% had cardiovascular disease. The mean uric acid level was similar across the groups at baseline, ranging from 8.1-8.5 mg/dl. Compared with allopurinol or colchicine initiators, febuxostat initiators had more comorbidities and greater health care utilization, including outpatient, inpatient, or emergency room visits, both at baseline and during followup. Use of gout-related drugs such as opioids, steroids, and nonsteroidal antiinflammatory drugs was most common in febuxostat initiators and least common in colchicine initiators. The median daily doses at both the start and end of treatment were 300 mg for allopurinol, 40 mg for febuxostat, and 1.2 mg for colchicine. The doses of allopurinol and febuxostat were rarely increased during followup. Patients who started allopurinol, febuxostat, or colchicine for gout generally had hyperuricemia and multiple comorbidities. Febuxostat initiators had more comorbidities and greater use of health care resources and gout-related drugs than the other groups. Overall, the doses of allopurinol or febuxostat remained unchanged over time. Copyright © 2013 by the American College of Rheumatology.
Kim, Seoyoung C.; Schmidt, Bernhard M.W.; Franklin, Jessica M.; Liu, Jun; Solomon, Daniel H.; Schneeweiss, Sebastian
2014-01-01
Background Gout is a common inflammatory arthritis with the increasing prevalence in the developed countries. It is well-known that many patients with gout have significant comorbidities and high health care utilization. Methods Using US insurance claims data (2009–2011), a population-based cohort study was conducted to describe clinical characteristics and health care utilization patterns in patients with gout newly prescribed allopurinol, febuxostat or colchicine. Results There were 25,051 allopurinol, 4,288 febuxostat and 6,238 colchicine initiators. Mean age was 53 years and 83%–87% were male. More than half of patients had hypertension and hyperlipidemia, 20% had diabetes and 10% cardiovascular disease. The mean uric acid level (mg/dl) was similar at baseline ranging from 8.1 to 8.5 across the groups. Compared to allopurinol or colchicine initiators, febuxostat initiators had more comorbidities and greater health care uses including outpatient, inpatient or emergency room visits, both at baseline and during the follow-up. Use of gout related drugs, such as opioids, steroids and non-steroidal anti-inflammatory drugs, was most common in febuxostat and least common in colchicine initiators. The median daily dose at both start and end of treatment was 300mg for allopurinol, 40mg for febuxostat, and 1.2mg for colchicine. The dosage of allopurinol and febuxostat was rarely increased during the follow-up. Conclusion Patients who started allopurinol, febuxostat or colchicine for gout generally had hyperuricemia and multiple comorbidities. Febuxostat initiators had more comorbidities and greater use of health care resources and gout-related drugs than other groups. Overall, the dosages of allopurinol or febuxostat remained unchanged over time. PMID:23861232
Efficacy and safety of febuxostat in elderly female patients
Mizuno, Tomohiro; Hayashi, Takahiro; Hikosaka, Sayo; Shimabukuro, Yuka; Murase, Maho; Takahashi, Kazuo; Hayashi, Hiroki; Yuzawa, Yukio; Nagamatsu, Tadashi; Yamada, Shigeki
2014-01-01
Background Maintenance of low serum urate levels is important for the management of gout. Achieving the recommended serum urate levels of less than 6.0 mg/dL is difficult in elderly (65 years of age or older) patients with renal impairment. Xanthine oxidase inhibitors allopurinol and febuxostat are used for this purpose. Although febuxostat had been shown to be efficacious in elderly patients, its safety and efficacy in elderly female patients with hyperuricemia remain unclear. Objective The aim of this study was to assess the efficacy and safety of febuxostat in elderly female patients. Methods We studied a retrospective cohort study. The study included elderly Japanese patients (65 years of age or older) who were treated with febuxostat at Fujita Health University Hospital from January 2012 to December 2013. The treatment goal was defined as achievement of serum urate levels of 6.0 mg/dL or lower within 16 weeks; this was the primary endpoint in the present study. Adverse events of febuxostat were defined as more than twofold increases in Common Terminology Criteria for adverse events scores from baseline. Results We evaluated 82 patients treated with febuxostat during the observation period and classified them into male (n=53) and female (n=29) groups. The mean time to achievement of the treatment goal was significantly shorter in the female group (53 days) than in the male group (71 days). There were no significant differences in adverse events between the 2 groups. Conclusion Our findings suggest that the efficacy of febuxostat in elderly female patients is superior to that in elderly male patients and that the safety is equivalent. PMID:25214776
Untangling the complex relationships between incident gout risk, serum urate, and its comorbidities.
Sun, Mengying; Vazquez, Ana I; Reynolds, Richard J; Singh, Jasvinder A; Reeves, Mathew; Merriman, Tony R; Gaffo, Angelo L; Los Campos, Gustavo de
2018-05-03
Many gout comorbidities (e.g., hypertension) are correlated with serum urate. In this investigation, we identified risk factors (e.g., systolic blood pressure [SBP]), that (1) are associated with incident gout, (2) have effects on gout risk that cannot be fully explained by correlated differences in serum urate, and (3) may modulate the relationship between gout and serum urate. Using data from the Atherosclerosis Risk in Communities (ARIC) study, we estimated the unadjusted associations between gout and risk factors by calculating ORs and using chi-square tests. The adjusted associations were analyzed using logistic regression by sequentially adding (1) one risk factor at a time or (2) all risk factors, to a baseline model that includes serum urate only. Stepwise selection was used to select main effects. Two-way interactions of variables from the main effects model were also analyzed. Average gout incidence was 2.7 per 1000 people per year. Serum urate was highly associated with incident gout, with odd ratios of 3.16 [95% CI 2.11, 4.76] and 25.9 [95% CI 17.2, 38.4] for moderately high (6-8 mg/dl) and high serum urate (> 8 mg/dl), relative to normal serum urate (< 6 mg/dl), respectively. Ethnicity and SBP were independently and additively associated with gout after accounting for serum urate levels. No significant interactions were found between serum urate and ethnicity or SBP. Ethnicity and hypertension are predictive of gout risk, and the associations cannot be fully explained by serum urate. For serum urate levels near the crystallization threshold (6-8 mg/dl) African Americans and people with hypertension are at two to three times greater risk for developing gout. The gout risk for this group appears to increase before the onset of severe hyperuricemia.
Pressler, Carsten A; Heinzinger, Jolanta; Jeck, Nikola; Waldegger, Petra; Pechmann, Ulla; Reinalter, Stephan; Konrad, Martin; Beetz, Rolf; Seyberth, Hannsjörg W; Waldegger, Siegfried
2006-08-01
Genetic defects of the Na+-K+-2Cl- (NKCC2) sodium potassium chloride co-transporter result in severe, prenatal-onset renal salt wasting accompanied by polyhydramnios, prematurity, and life-threatening hypovolemia of the neonate (antenatal Bartter syndrome or hyperprostaglandin E syndrome). Herein are described two brothers who presented with hyperuricemia, mild metabolic alkalosis, low serum potassium levels, and bilateral medullary nephrocalcinosis at the ages of 13 and 15 yr. Impaired function of sodium chloride reabsorption along the thick ascending limb of Henle's loop was deduced from a reduced increase in diuresis and urinary chloride excretion upon application of furosemide. Molecular genetic analysis revealed that the brothers were compound heterozygotes for mutations in the SLC12A1 gene coding for the NKCC2 co-transporter. Functional analysis of the mutated rat NKCC2 protein by tracer-flux assays after heterologous expression in Xenopus oocytes revealed significant residual transport activity of the NKCC2 p.F177Y mutant construct in contrast to no activity of the NKCC2-D918fs frameshift mutant construct. However, coexpression of the two mutants was not significantly different from that of NKCC2-F177Y alone or wild type. Membrane expression of NKCC2-F177Y as determined by luminometric surface quantification was not significantly different from wild-type protein, pointing to an intrinsic partial transport defect caused by the p.F177Y mutation. The partial function of NKCC2-F177Y, which is not negatively affected by NKCC2-D918fs, therefore explains a mild and late-onset phenotype and for the first time establishes a mild phenotype-associated SLC12A1 gene mutation.
Sarawek, Sasiporn; Feistel, Bjoern; Pischel, Ivo; Butterweck, Veronika
2008-02-01
Artichoke (Cynara scolymus L.) leaves have been historically used for the treatment of hyperuricemia and gout, however whether artichoke is truly efficacious for this indication, is still a matter of debate. Thus, the goal of the present study was first to examine the xanthine oxidase (XO) inhibitory activity of an artichoke leaf extract (ALE) and some of its main compounds in vitro and then further test potentially active substances for possible hypouricemic effects using an in vivo rat model. The in vitro study showed that ALE inhibited XO with only minimal inhibitory action (< 5 %) at 100 microg/mL. However, when selected compounds were tested, the caffeic acid derivatives revealed a weak XO inhibitory effect with IC (50) > 100 microM. From the tested flavones the aglycone luteolin potently inhibited XO with an IC (50) value of 1.49 microM. Luteolin 7-O-glucoside and luteolin 7-O-glucuronide showed lower XO inhibition activities with IC (50) values of 19.90 microM and 20.24 microM, respectively. However, oral administration of an aqueous ALE, luteolin, and luteolin 7-O-glucoside did not produce any observable hypouricemic effects after acute oral treatment in potassium oxonate-treated rats. After intraperitoneal injection of luteolin a decrease in uric acid levels was detected suggesting that the hypouricemic effects of luteolin are due to its original form rather than its metabolites produced by the gut flora. In conclusion, an aqueous ALE, caffeic acid derivatives and flavones exerted XO inhibitory effects in vitro but a hypouricemic activity could not be confirmed after oral administration.
The impact of high fructose on cardiovascular system: Role of α-lipoic acid.
Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H
2016-02-01
The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. © The Author(s) 2015.
Smith, William B; Hall, Jesse; Berg, Jolene K; Kazimir, Michal; Yamamoto, Amy; Walker, Susan; Lee, Caroline A; Shen, Zancong; Wilson, David M; Zhou, Dongmei; Gillen, Michael; Marbury, Thomas C
2018-06-11
BACKGROUND AND OBJECTIVE: Verinurad (RDEA3170) is a high-affinity, selective URAT1 transporter inhibitor in development for treating gout and asymptomatic hyperuricemia. This Phase I, single-dose study investigated the pharmacokinetics, pharmacodynamics, and safety of verinurad in adults with renal impairment and controls with normal renal function. Males aged 18-85 years were enrolled with serum urate (sUA) 4.5-10 mg/dl and creatinine clearance 60- < 90, 30- < 60, 15- < 30, or ≥ 90 ml/min (mild, moderate, severe renal impairment and controls, respectively; n = 7/8). Verinurad 15 mg was administered orally under fasted conditions. Serial plasma/serum and urine samplings were 30 min pre-dose to 72 h post-dose. Compared to controls, verinurad maximum observed plasma concentration increased by 53, 73, and 128% and area under the concentration-time curve increased by 24, 148, and 130%, in subjects with mild, moderate, and severe renal impairment, respectively; renal clearance decreased by 5, 42, and 79%. Exposures of major verinurad metabolites also increased with increasing renal impairment. Verinurad decreased sUA in all groups, with greater maximal changes in control and mild renal impairment than moderate and severe impairment groups (- 38.3, - 36.9, - 20.5, - 12.6%, respectively). There were no adverse event-related withdrawals or clinically meaningful changes in laboratory values. Exposures of verinurad and metabolites increased with decreasing renal function. Consistent with the renal-dependent mechanism of action of verinurad, increasing severity of renal impairment was associated with decreased sUA lowering. Verinurad safety assessments were similar regardless of renal impairment. Continued investigation of verinurad is warranted in patients with gout and renal impairment. CLINICALTRIALS. NCT02219516.
Perez Ruiz, Fernando; Sanchez-Piedra, Carlos A; Sanchez-Costa, Jesus T; Andrés, Mariano; Diaz-Torne, Cesar; Jimenez-Palop, Mercedes; De Miguel, Eugenio; Moragues, Carmen; Sivera, Francisca
2018-06-01
The objective of the study was to evaluate changes regarding main European League Against Rheumatism (EULAR) recommendations on diagnosis and treatment of gout compared to a previous assessment. The GEMA-2 (Gout Evaluation and MAnagement) is a transversal assessment of practice for gout by rheumatologists. Main outcome variables were improvement of the previous GEMA assessment regarding the rate of crystal-proven diagnosis and that reaching therapeutic serum urate target below 6 mg/dl at last visit. Other management variables (prophylaxis, treatment of flares, lifestyle change advice) were also evaluated along with general characteristics. The sample was powered to include at least 483 patients for up to 50% change. Data on management of 506 patients were retrieved from 38 out of 41 rheumatology units that participated in the previous GEMA audit. Crystal-proved diagnosis rate increased from 26% to 32% (31% improvement) and was higher in gout-dedicated practices; ultrasonography contributed to diagnosis in less than 1% of cases. Therapeutic serum urate at last visit improved from 41% to 64% of all patients (66% of patients on urate-lowering medications), in any case over 50% improvement from the previous assessment. The use of any urate-lowering medication available was not prescribed as per label dosing in patients who failed to achieve target serum urate. Clinical inertia to increase doses of either allopurinol or febuxostat was still present in clinical practice. Over 50% improvement in targeting therapeutic serum urate has been observed, but clinical inertia is still present. Diagnosis is still mostly clinically based, ultrasonography not being commonly contributive. Menarini España.
Reuter, Hannes; Herkenrath, Simon; Treml, Marcel; Halbach, Marcel; Steven, Daniel; Frank, Konrad; Castrogiovanni, Alessandra; Kietzmann, Ilona; Baldus, Stephan; Randerath, Winfried J
2018-05-29
Sleep-disordered breathing (SDB) is highly prevalent in patients with cardiovascular diseases (CVD) and associated with poor outcome. At least 50% of heart failure (HF) patients present with SDB, equally divided in obstructive sleep apnea (OSA) and central sleep apnea (CSA). CVD patients with SDB do not always present with typical SDB symptoms. Therefore, we asked whether established questionnaires allow for the reliable detection of SDB. In this prospective cohort study, 89 CVD patients (54 male, 59 ± 15 years, BMI 30 ± 6 kg/m 2 ) in stable clinical state underwent an ambulatory polygraphy. SDB was defined as an apnea-hypopnea index (AHI) ≥ 15/h. We evaluated the Epworth Sleepiness Scale (ESS), STOP-BANG and Berlin questionnaires as well as anthropometric data and comorbidities regarding their ability to predict SDB. The ESS showed no correlation with SDB. The sensitivity of the Berlin Questionnaire to detect SDB was 73%, specificity was 42%. The STOP-BANG questionnaire showed a sensitivity of 97% while specificity was 13%. Coronary heart disease and/or history of myocardial infarction, hyperuricemia and age significantly contributed to a logistic regression model predicting presence of SDB. However, our regression model explains only 36% of the variance regarding the presence or absence of SDB. The approach to find variables, which would allow an early and reliable differentiation between patients with CVD and coexistence or absence of SDB, failed. Thus, as CVD patients show a high SDB prevalence and poor outcome, only a systematic screening based on measures of respiration-related parameters (i.e., respiratory flow, blood oxygen saturation, etc.) allows for a reliable SDB assessment.
Extra-Renal Elimination of Uric Acid via Intestinal Efflux Transporter BCRP/ABCG2
Hosomi, Atsushi; Nakanishi, Takeo; Fujita, Takuya; Tamai, Ikumi
2012-01-01
Urinary excretion accounts for two-thirds of total elimination of uric acid and the remainder is excreted in feces. However, the mechanism of extra-renal elimination is poorly understood. In the present study, we aimed to clarify the mechanism and the extent of elimination of uric acid through liver and intestine using oxonate-treated rats and Caco-2 cells as a model of human intestinal epithelium. In oxonate-treated rats, significant amounts of externally administered and endogenous uric acid were recovered in the intestinal lumen, while biliary excretion was minimal. Accordingly, direct intestinal secretion was thought to be a substantial contributor to extra-renal elimination of uric acid. Since human efflux transporter BCRP/ABCG2 accepts uric acid as a substrate and genetic polymorphism causing a decrease of BCRP activity is known to be associated with hyperuricemia and gout, the contribution of rBcrp to intestinal secretion was examined. rBcrp was confirmed to transport uric acid in a membrane vesicle study, and intestinal regional differences of expression of rBcrp mRNA were well correlated with uric acid secretory activity into the intestinal lumen. Bcrp1 knockout mice exhibited significantly decreased intestinal secretion and an increased plasma concentration of uric acid. Furthermore, a Bcrp inhibitor, elacridar, caused a decrease of intestinal secretion of uric acid. In Caco-2 cells, uric acid showed a polarized flux from the basolateral to apical side, and this flux was almost abolished in the presence of elacridar. These results demonstrate that BCRP contributes at least in part to the intestinal excretion of uric acid as extra-renal elimination pathway in humans and rats. PMID:22348008
Kamei, Keita; Konta, Tsuneo; Hirayama, Atsushi; Ichikawa, Kazunobu; Kubota, Isao; Fujimoto, Shouichi; Iseki, Kunitoshi; Moriyama, Toshiki; Yamagata, Kunihiro; Tsuruya, Kazuhiko; Narita, Ichiei; Kondo, Masahide; Shibagaki, Yugo; Kasahara, Masato; Asahi, Koichi; Watanabe, Tsuyoshi
2017-06-01
Hyperuricemia is an established risk factor for cardiovascular events and mortality. This study investigated the association between serum uric acid and the incidence of nonfatal stroke in a Japanese community-based population. We used a nationwide database of 155,322 subjects (aged 40-73, male 39 %) who participated in the annual "Specific Health Check and Guidance in Japan" checkup from 2008 to 2010. We examined the relationship between the quintiles of serum uric acid levels at baseline and the incidence of nonfatal stroke during a 2-year study period using self-reported data. The crude incidence of nonfatal stroke was significantly associated with serum uric acid levels at baseline, showing the lowest values in subjects with the 3rd quintile (Q3: men, 5.0-5.6; women, 3.8-4.3) of uric acid levels (mg/dL) and the highest values in subjects with the highest quintile (Q5: men ≥7.1, women ≥5.5) both in men and women (P < 0.05). In multivariate-adjusted logistic regression analysis, the odds ratio (OR) of the Q5 group was significantly higher than for the Q3 group in both men and women [men: OR 1.26, 95 % confidence interval (CI) 1.04-1.54, women: OR 1.24, 95 % CI 1.00-1.48]. In the subgroup analysis, the OR of the Q5 group of uric acid levels for incident stroke was high, irrespective of characteristics such as age, sex, and renal function. This study has shown that serum uric acid is independently associated with the incidence of nonfatal stroke in the general Japanese population.
Factors Associated with CKD in the Elderly and Nonelderly Population
Lin, Ming-Yen; Chiu, Yi-Wen; Lee, Chien-Hung; Yu, Hui-Yen; Chen, Hung-Chun; Wu, Ming-Tsang
2013-01-01
Summary Background and objectives The risk factors for CKD in different age groups remain unknown. This community-based study aimed to identify the risk factors for CKD in elderly and nonelderly patients. Design, setting, participants, & measurements A multistage sampling survey for CKD was conducted in 2007 in Kaohsiung County, an area with the highest prevalence of dialysis in the world. CKD was defined as proteinuria in at least the microalbuminuric stage or an estimated GFR (eGFR) of <60 ml/min per 1.73 m2. The factors for CKD in elderly and nonelderly patient groups were identified (with age 60 years as a cutoff value). Results The analyses included 3352 participants, of whom 687 had CKD. The weighted prevalence of CKD was 19.4% (95% confidence interval [CI], 18.0%–20.7%). Elderly patients typically presented with low eGFR and nonelderly patients, with proteinuria. Age, annual income, use of oral analgesics, metabolic syndrome, hyperuricemia, and hemoglobin were risk factors for CKD in both age groups. In elderly patients, risk factors were medical history of diabetes mellitus, CKD, stroke, and not using analgesic injection (odds ratios [95% CIs], 3.58 [2.06–6.22], 3.66 [1.58–8.43], 3.89 [1.09–13.87], 2.27 [1.21–4.17], respectively). In nonelderly patients, associated risk factors for CKD were gout, hepatitis B virus infection, and use of the Chinese herbal medicine Long Dan Xie Gan Tang (odds ratios [95% CIs], 3.15 [1.96–5.07], 1.66 [1.09–2.53], and 8.86 [1.73–45.45], respectively). Conclusions The risk factors for CKD vary by age. PMID:23085726
McAdams, Mara A; Maynard, Janet W; Baer, Alan N; Köttgen, Anna; Clipp, Sandra; Coresh, Josef; Gelber, Allan C
2011-01-01
gout is often defined by self-report in epidemiologic studies. Yet the validity of self-reported gout is uncertain. We evaluated the reliability and sensitivity of the self-report of physician-diagnosed gout in the Campaign Against Cancer and Heart Disease (CLUE II) and the Atherosclerosis Risk in the Community (ARIC) cohorts. the CLUE II cohort comprises 12,912 individuals who self-reported gout status on either the 2000, 2003, or 2007 questionnaires. We calculated reliability as the percentage of participants reporting having gout on more than 1 questionnaire using Cohen's κ statistic. The ARIC cohort comprises 11,506 individuals who self-reported gout status at visit 4. We considered a hospital discharge diagnosis of gout or use of a gout-specific medication as the standard against which to calculate the sensitivity of self-reported, physician-diagnosed gout. of the 437 CLUE II participants who self-reported physician-diagnosed gout in 2000, and subsequently answered the 2003 questionnaire, 75% reported gout in 2003 (κ = 0.73). Of the 271 participants who reported gout in 2000, 73% again reported gout at the 2007 followup questionnaire (κ = 0.63). In ARIC, 196 participants met the definition for gout prior to visit 4 and self-reported their gout status at visit 4. The sensitivity of a self-report of physician-diagnosed gout was 84%. Accuracy was similar across sex and race subgroups, but differed across hyperuricemia and education strata. these 2 population-based US cohorts suggest that self-report of physician-diagnosed gout has good reliability and sensitivity. Thus, self-report of a physician diagnosis of gout is appropriate for epidemiologic studies.
Haidari, Fatemeh; Keshavarz, Seid Ali; Mohammad Shahi, Majid; Mahboob, Soltan-Ali; Rashidi, Mohammad-Reza
2011-01-01
Increased serum uric acid is known to be a major risk related to the development of several oxidative stress diseases. The aim of this study was to investigate the effect of parsley, quercetin and kaempferol on serum uric acid levels, liver xanthine oxidoreductase activity and two non-invasive biomarkers of oxidative stress (total antioxidant capacity and malondialdehyde concentration) in normal and oxonate-induced hyperuricemic rats. A total of 60 male Wistar rats were randomly divided into ten equal groups; including 5 normal groups (vehicle, parsley, quercetin, kaempferol and allopurinol) and 5 hyperuricemic groups (vehicle, parsley, quercetin, kaempferol and allopurinol). Parsley (5 g/Kg), quercetin (5 mg/Kg), kaempferol (5 mg/Kg) and allopurinol (5 mg/Kg) were administrated to the corresponding groups by oral gavage once a day for 2 weeks. The results showed that parsley and its flavonol did not cause any significant reduction in the serum uric acid levels in normal rats, but significantly reduced the serum uric acid levels of hyperuricemic rats in a time-dependent manner. All treatments significantly inhibited liver xanthine oxidoreductase activity. Parsley, kaempferol and quercetin treatment led also to a significant increase in total antioxidant capacity and decrease in malondialdehyde concentration in hyperuricemic rats. Although the hypouricemic effect of allopurinol was much higher than that of parsley and its flavonol constituents, it could not significantly change oxidative stress biomarkers. These features of parsley and its flavonols make them as a possible alternative for allopurinol, or at least in combination therapy to minimize the side effects of allopurinol to treat hyperuricemia and oxidative stress diseases.
Haidari, Fatemeh; Keshavarz, Seid Ali; Mohammad Shahi, Majid; Mahboob, Soltan-Ali; Rashidi, Mohammad-Reza
2011-01-01
Increased serum uric acid is known to be a major risk related to the development of several oxidative stress diseases. The aim of this study was to investigate the effect of parsley, quercetin and kaempferol on serum uric acid levels, liver xanthine oxidoreductase activity and two non-invasive biomarkers of oxidative stress (total antioxidant capacity and malondialdehyde concentration) in normal and oxonate-induced hyperuricemic rats. A total of 60 male Wistar rats were randomly divided into ten equal groups; including 5 normal groups (vehicle, parsley, quercetin, kaempferol and allopurinol) and 5 hyperuricemic groups (vehicle, parsley, quercetin, kaempferol and allopurinol). Parsley (5 g/Kg), quercetin (5 mg/Kg), kaempferol (5 mg/Kg) and allopurinol (5 mg/Kg) were administrated to the corresponding groups by oral gavage once a day for 2 weeks. The results showed that parsley and its flavonol did not cause any significant reduction in the serum uric acid levels in normal rats, but significantly reduced the serum uric acid levels of hyperuricemic rats in a time-dependent manner. All treatments significantly inhibited liver xanthine oxidoreductase activity. Parsley, kaempferol and quercetin treatment led also to a significant increase in total antioxidant capacity and decrease in malondialdehyde concentration in hyperuricemic rats. Although the hypouricemic effect of allopurinol was much higher than that of parsley and its flavonol constituents, it could not significantly change oxidative stress biomarkers. These features of parsley and its flavonols make them as a possible alternative for allopurinol, or at least in combination therapy to minimize the side effects of allopurinol to treat hyperuricemia and oxidative stress diseases. PMID:24250417
Lin, Huang-Shen; Cheng, Chun-Wen; Lin, Ming-Shyan; Chou, Yen-Li; Chang, Pey-Jium; Lin, Jing-Chi; Ye, Jung-Jr
2016-01-01
Objectives To investigate the clinical characteristics, adverse drug reactions, and outcomes of the oldest old patients (aged ≥80 years) with tuberculosis (TB) treated with rifampicin, isoniazid, and pyrazinamide (RIP)-containing regimens. Design A retrospective chart review study. Setting A 1,200-bed tertiary teaching hospital in southwest Taiwan. Participants We conducted a retrospective observational study between January 1, 2005 and December 31, 2011. Seven hundred adult patients (aged ≥18 years) with TB treated with RIP-containing anti-TB regimens were reviewed, including 161 oldest old patients. Outcome measures Clinical outcomes included clinical responsiveness and microbiological eradication. Adverse outcomes included drug-induced hepatitis, and other symptoms included gastrointestinal upset (eg, abdominal pain, vomiting, diarrhea, or dyspepsia), skin rash, joint pain, and hyperuricemia. Results Compared with the non-oldest old adult patients, the oldest old patients more frequently had hepatitis (P=0.014), gastrointestinal upset (P=0.029), and unfavorable outcomes (P<0.001). In a multivariate analysis, hepatitis during treatment (adjusted odds ratio: 3.482, 95% confidence interval: 1.537–7.885; P<0.003) and oldest old age (adjusted odds ratio: 5.161, 95% confidence interval: 2.294–11.613; P<0.010) were independent risk factors for unfavorable outcomes. In the oldest old patients with hepatitis, rifampicin use was more common in the favorable outcome group than in the unfavorable outcome group (100% vs 37.5%; P=0.001). Conclusion The oldest old age and hepatitis during RIP treatment were associated with unfavorable outcomes. For the oldest old patients with TB having hepatitis during treatment, rifampicin rechallenge and use might benefit the treatment outcome. PMID:27042029
Peláez-Ballestas, Ingris; Hernández Cuevas, Claudia; Burgos-Vargas, Rubén; Hernández Roque, Lizandra; Terán, Leobardo; Espinoza, Jesús; Esquivel-Valerio, Jorge A; Goycochea-Robles, María Victoria; Aceves, Francisco J; Bernard, Ana Guilaisne; Ventura, Lucio; Shumsky, Clara; Hernández Garduño, Adolfo; Vázquez-Mellado, Janitzia
2010-08-01
Observation of monosodium urate (MSU) crystal is the gold standard for diagnosis of gout, but is rarely performed in daily clinical practice, and diagnosis is based on clinical judgment. Our aim was to identify clinical and paraclinical data included in the European League Against Rheumatism recommendations (EULARr) and American College of Rheumatology proposed criteria (ACRp) for diagnosis of gout in patients with chronic gout according to their attending rheumatologists. This cross-sectional and multicenter study included consecutive patients from outpatient clinics with a diagnosis of gout by their attending rheumatologists according to their expertise. The frequency of each item from the ACRp and EULARr was determined. Possible combinations of the items that were frequent, clinically relevant, and simple to evaluate in daily practice were determined. We studied 549 patients (96% men), mean age 50 +/- 14 years. Analysis of MSU crystals was performed in 15%. We selected 7 clinical criteria and 1 laboratory measure because of their frequency, importance, and simplicity to obtain: current or past history of: > 1 attack of acute arthritis (93%); mono or oligoarthritis attacks (74%); rapid progression of pain and swelling (< 24 hours; 74%); podagra (70%); erythema (56%); unilateral tarsitis (33%); tophi (52%); and hyperuricemia (93%). The chronic gout diagnosis (CGD) proposal comprised >or= 4/8 of these; 88% of patients had the criteria of the CGD proposal while 75% had 6/11 ACRp criteria (p = 0.001). When analysis of MSU crystals was added, 90.1% (CGD) and 83.9% (ACRp) met the criteria (p = 0.004). Current or past history of >or= 4/8 CGD parameters is highly suggestive of chronic gout.
Ong, Bee Yean; Aziz, Zoriah
2017-02-01
Cordyceps sinensis (cordyceps) is a fungus used in traditional Chinese medicine as adjuvant immunosuppressive agent in patients with kidney transplant. This review evaluates current evidence on the efficacy and safety of natural and fermented cordyceps preparations in patients with kidney transplant. English and Chinese electronic databases including The Cochrane Central Register of Controlled Trials, EMBASE, MEDLINE, and CNKI (China National Knowledge Infrastructure) were searched up to December 2015 for relevant randomized controlled trials. Journals and conference proceedings were also searched. Two review authors independently selected trials for inclusion, extracted data, and assessed methodological quality. The primary outcome measures were incidence of acute graft rejection in the first year post-transplantation, one-year graft survival rate (defined as the percentage of patients with functioning grafts) and patient survival rate (or all-cause mortality). Nine studies were eligible for inclusion. These studies were considered to be at moderate risk of bias due to poor reporting of methods. Four studies that compared cordyceps-based therapy with azathioprine-based therapy gave comparable acute rejection rates, and graft and patient survival. The cordyceps-treated group however showed better kidney function and lower incidences of hyperuricemia, hyperlipidemia, hyperglycemia and liver injury. Cordyceps used with different combinations of immunosuppressant therapy showed significant reduction in proteinuria after 6-12 months. Compared to the group receiving cyclosporine A monotherapy, treatment with a combination of cordyceps and cyclosporine A showed less treatment-induced nephrotoxicity. Adverse events were either not monitored or poorly documented in most trials. Current evidence shows that cordyceps as an adjuvant to routine immunosuppressant therapy may benefit kidney transplant patient, however, better quality evidence is still required. Copyright © 2016 Elsevier Ltd. All rights reserved.
[Acute encephalopathy due to late-onset maple syrup urine disease in a school boy].
Qu, Su-Qing; Yang, Li-Cai; Luan, Zuo; Du, Kan; Yang, Hui
2012-03-01
Maple syrup urine disease is a common amino acids metabolic disease. In most patients, onset occurs in the neonatal period and infancy. In this study, the case of a school boy with acute encephalopathy due to late-onset maple syrup urine disease is summarized. The boy (8.5 years) was admitted because of acute encephalopathy after suffering from infection for two days at the age of eight and a half years. Metabolic acidosis, hyperuricemia and decreased protein level in cerebrospinal fluid were found by general laboratory tests. Magnetic resonance imaging of the brain revealed signal intensity abnormalities in the bilateral cerebellum dentate nucleus, brainstem, thalamus, putamen, caudate nucleus and cortex of the cerebral hemispheres. On T1WI and T2WI scanning, hyperintensive signal was found. Blood leucine and valine were significantly elevated. Urinary 2-hydroxy isovaleric acid, 3-hydroxybutyric acid, 2-keto isovaleric acid, and 2-keto acid also increased. Both the blood amino acid and urine organic acid profiles led to the diagnosis of maple syrup urine disease. In the acute period, the patient was treated with a large dose of vitamin B1, glucose, L-carnitine and a protein-restrict diet. The patient's condition improved significantly after five days of treatment, and he recovered completely two days later. Afterwards, treatment with vitamin B1, L-carnitine and a protein-restrict diet (1 g/kg/day) was continued. One and a half months later, blood amino acids and urine organic acids returned to normal. Magnetic resonance imaging of the brain also indicated a great improvement. It was concluded that inborn metabolic disease should be considered in the patients with an onset similar to acute encephalopathy. Early diagnosis and proper treatment can prevent brain damage and improve prognosis.
Kuwabara, Masanari; Hisatome, Ichiro; Roncal-Jimenez, Carlos A; Niwa, Koichiro; Andres-Hernando, Ana; Jensen, Thomas; Bjornstad, Petter; Milagres, Tamara; Cicerchi, Christina; Song, Zhilin; Garcia, Gabriela; Sánchez-Lozada, Laura G; Ohno, Minoru; Lanaspa, Miguel A; Johnson, Richard J
2017-01-01
Epidemics of chronic kidney disease (CKD) not due to diabetes mellitus (DM) or hypertension have been observed among individuals working in hot environments in several areas of the world. Experimental models have documented that recurrent heat stress and water restriction can lead to CKD, and the mechanism may be mediated by hyperosmolarity that activates pathways (vasopressin, aldose reductase-fructokinase) that induce renal injury. Here we tested the hypothesis that elevated serum sodium, which reflects serum osmolality, may be an independent risk factor for the development of CKD. This study was a large-scale, single-center, retrospective 5-year cohort study at Center for Preventive Medicine, St. Luke's International Hospital, Tokyo, Japan, between 2004 and 2009. We analyzed 13,201 subjects who underwent annual medical examination of which 12,041 subjects (age 35 to 85) without DM and/or CKD were enrolled. This analysis evaluated age, sex, body mass index, abdominal circumference, hypertension, dyslipidemia, hyperuricemia, fasting glucose, BUN, serum sodium, potassium, chloride and calculated serum osmolarity. Elevated serum sodium was an independent risk factor for development of CKD (OR: 1.03, 95% CI, 1.00-1.07) after adjusted regression analysis with an 18 percent increased risk for every 5 mmol/L change in serum sodium. Calculated serum osmolarity was also an independent risk factor for CKD (OR: 1.04; 95% CI, 1.03-1.05) as was BUN (OR: 1.08; 95% CI, 1.06-1.10) (independent of serum creatinine). Elevated serum sodium and calculated serum osmolarity are independent risk factors for developing CKD. This finding supports the role of limiting salt intake and preventing dehydration to reduce risk of CKD.
Stopa, Jack D; Chandani, Sushil; Tolan, Dean R
2011-02-08
Hereditary fructose intolerance (HFI) is a disease of carbohydrate metabolism that can result in hyperuricemia, hypoglycemia, liver and kidney failure, coma, and death. Currently, the only treatment for HFI is a strict fructose-free diet. HFI arises from aldolase B deficiency, and the most predominant HFI mutation is an alanine to proline substitution at position 149 (A149P). The resulting aldolase B with the A149P substitution (AP-aldolase) has activity that is <100-fold that of the wild type. The X-ray crystal structure of AP-aldolase at both 4 and 18 °C reveals disordered adjacent loops of the (α/β)(8) fold centered around the substitution, which leads to a dimeric structure as opposed to the wild-type tetramer. The effects of osmolytes were tested for restoration of structure and function. An initial screen of osmolytes (glycerol, sucrose, polyethylene glycol, 2,4-methylpentanediol, glutamic acid, arginine, glycine, proline, betaine, sarcosine, and trimethylamine N-oxide) reveals that glycine, along with similarly structured compounds, betaine and sarcosine, protects AP-aldolase structure and activity from thermal inactivation. The concentration and functional moieties required for thermal protection show a zwitterion requirement. The effects of osmolytes in restoring structure and function of AP-aldolase are described. Testing of zwitterionic osmolytes of increasing size and decreasing fractional polar surface area suggests that osmolyte-mediated AP-aldolase stabilization occurs neither primarily through excluded volume effects nor through transfer free energy effects. These data suggest that AP-aldolase is stabilized by binding to the native structure, and they provide a foundation for developing stabilizing compounds for potential therapeutics for HFI.
Smith, Graham D.; Robinson, Caroline; Stewart, Andrew P.; Edwards, Emily L.; Karet, Hannah I.; Norden, Anthony G. W.; Sandford, Richard N.
2011-01-01
Summary Background and objectives In a single-center renal clinic, we have established routine mutation testing to diagnose UMOD-associated kidney disease (UAKD), an autosomal dominant disorder typically characterized by gout, hyperuricemia, and renal failure in the third to sixth decades. Design, setting, participants, & measurements Four probands and their multigeneration kindreds were assessed by clinical, historical, and biochemical means. Diagnostic UMOD sequencing was performed, and mutant uromodulin was characterized in vitro. Results All available affected members of the four kindreds harbored the same complex indel change in UMOD, which was associated with almost complete absence of gout and a later onset of CKD; the youngest age at ESRD or death was 38 years (range, 38 to 68 years) compared with 3 to 70 years in other reports. Three mutation carriers (all ≤35 years) are currently asymptomatic. The indel sequence (c.278_289del TCTGCCCCGAAGinsCCGCCTCCT; p.V93_G97del/ins AASC) results in the replacement of five amino acids, including one cysteine, by four novel residues, also including a cysteine. Uromodulin staining of the only available patient biopsy suggested disorganized intracellular trafficking with cellular accumulation. Functional characterization of the mutant isoform revealed retarded intracellular trafficking associated with endoplasmic reticulum (ER) retention and reduced secretion into cell culture media, but to a lesser extent than we observed with the previously reported C150S mutation. Conclusions The indel mutation is associated with a relatively mild clinical UAKD phenotype, consistent with our in vitro analysis. UAKD should be routinely considered as a causative gene for ESRD of unknown cause, especially where there is an associated family history or where biopsy reveals interstitial fibrosis. PMID:22034507
Chen, Chih-Yen; Tsai, Chang-Youh; Lee, Pui-Ching; Lee, Shou-Dong
2013-01-01
Rheumatoid arthritis (RA) is a chronic inflammatory disease that damages the synovial joints, and patients with it are often anorexic and cachectic with high morbidity and mortality. Biological therapy with anti-tumor necrosis factor (TNF)-α has been proven effective as a treatment for RA. However, the long-term effects of anti-TNF-α therapy on body weight, appetite, plasma gut hormones and leptin have not been investigated. Twenty RA patients received subcutaneous injections of etanercept, a chimeric protein of human IgG1 Fc and TNF receptor p75, twice weekly for 12 consecutive months. Sequential changes in body weight, body fat, appetite rating, lipid profiles, gut hormones and leptin were measured at baseline and at 3 and 12 months after treatment. Ten RA patients who received non-biological disease modifying anti-rheumatic drugs were enrolled as the controls and were appraised at baseline and at 12 months after treatment (a nonrandomized study). Significant weight gain, hyperuricemia, decreased fasting plasma glucose-dependent insulinotropic polypeptide (GIP) levels, and loss of post-oral glucose suppression of plasma leptin concentration were found in the patients after the 12-month course of etanercept therapy, but not in the controls. A transient decrease in fasting plasma acyl ghrelin occurred at 3 months during etanercept treatment. Appetite score and serum lipid profiles did not change in either group. Long-term therapy with anti-TNF-α is promising in ameliorating body mass decrease in patients with active RA. Plasma levels of ghrelin, GIP and leptin may play significant roles in maintaining energy homeostasis in the anti-inflammatory responses during RA remission.
Increased risk for diabetes mellitus in patients with carbon monoxide poisoning
Huang, Chien-Cheng; Ho, Chung-Han; Chen, Yi-Chen; Lin, Hung-Jung; Hsu, Chien-Chin; Wang, Jhi-Joung; Su, Shih-Bin; Guo, How-Ran
2017-01-01
Carbon monoxide poisoning (COP) causes hypoxic injury and inflammatory and immunological reactions in the brain and local organs including the pancreas. Therefore, it is plausible that COP may increase the risk for developing diabetes mellitus (DM), but studies on this possible association are limited. We conducted a nationwide study in Taiwan to fill the data gap. We used the Nationwide Poisoning Database and the Longitudinal Health Insurance Database 2000 to identify all COP patients diagnosed between 1999 and 2012 (the study cohort) and then construct a comparison cohort of patients without COP through matching at 1:3 by the index date and age. The risk for DM between the two cohorts was compared by following up until 2013. We also investigated the independent predictors for DM in all the patients. During the study period, 22,308 COP patients were identified, and 66,924 non-COP patients were included in the comparison cohort accordingly. Patients with COP had an increased risk for DM with an adjusted hazard ratio (AHR) of 1.92 (95% confidence interval [CI]: 1.79–2.06) after adjusting for age, sex, comorbidities, and monthly income, especially in the subgroups of age <35 years, age ≥ 65 years, female sex, and comorbidities with congestive heart failure, hyperthyroidism, and polycystic ovary syndrome. Cox proportional hazard regression analysis showed that the increased risk for DM was highest in the first month after COP (AHR= 3.38; 95% CI: 2.29–4.99) and lasted even after 4 years (AHR= 1.82; 95% CI: 1.62–2.04). We found that COP, older age, male sex, hypertension, hyperlipidemia, hyperuricemia, and low monthly income were independent predictors for DM. Intervention studies are needed to validate the results and delineate the detailed mechanisms. PMID:28969020
Evidence Report: Risk of Renal Stone Formation
NASA Technical Reports Server (NTRS)
Sibonga, Jean D.; Pietrzyk, Robert
2017-01-01
The formation of renal stones poses an in-flight health risk of high severity, not only because of the impact of renal colic on human performance but also because of complications that could potentially lead to crew evacuation, such as hematuria, infection, hydronephrosis, and sepsis. Evidence for risk factors comes from urine analyses of crewmembers, documenting changes to the urinary environment that are conducive to increased saturation of stone-forming salts, which are the driving force for nucleation and growth of a stone nidus. Further, renal stones have been documented in astronauts after return to Earth and in one cosmonaut during flight. Biochemical analysis of urine specimens has provided indication of hypercalciuria and hyperuricemia, reduced urine volumes, and increased urine saturation of calcium oxalate and calcium phosphate. A major contributor to the risk for renal stone formation is bone atrophy with increased turnover of the bone minerals. Dietary and fluid intakes also play major roles in the risk because of the influence on urine pH (more acidic) and on volume (decreased). Historically, specific assessments on urine samples from some Skylab crewmembers indicated that calcium excretion increased early in flight, notable by day 10 of flight, and almost exceeded the upper threshold for normal excretion (300mg/day in males). Other crewmember data documented reduced intake of fluid and reduced intake of potassium, phosphorus, magnesium, and citrate (an inhibitor of calcium stone formation) in the diet. Hence, data from both short-duration and long-duration missions indicate that space travel induces risk factors for renal stone formation that continue to persist after flight; this risk has been documented by reported kidney stones in crewmembers.
Zhang, Chun; Fan, Kai; Ma, Xuefeng; Wei, Dongzhi
2012-01-01
Uricase has proven therapeutic value in treating hyperuricemia but sufficient reduction of its immunogenicity may be the largest obstacle to its chronic use. In this study, canine uricase was modified with 5 kDa mPEG-SPA and the impact of large aggregated uricases and cross-linked conjugates induced by difunctional PEG diol on immunogenicity was investigated. Recombinant canine uricase was first expressed and purified to homogeneity. Source 15Q anion-exchange chromatography was used to separate tetrameric and aggregated uricase prior to pegylation, while DEAE anion-exchange chromatography was used to remove Di-acid PEG (precursor of PEG diol) from unfractionated 5 kDa mPEG-propionic acid. Tetrameric and aggregated uricases were separately modified with the purified mPEG-SPA. In addition, tetrameric uricases was modified with unfractionated mPEG-SPA, resulting in three types of 5 kDa mPEG-SPA modified uricase. The conjugate size was evaluated by dynamic light scattering and transmission electron microscope. The influence of differently PEGylated uricases on pharmacokinetics and immunogenicity were evaluated in vivo. The accelerated blood clearance (ABC) phenomenon previously identified for PEGylated liposomes occurred in rats injected with PEGylated uricase aggregates. Anti-PEG IgM antibodies, rather than neutralizing antibodies, were found to mediate the ABC. The size of conjugates is important for triggering such phenomena and we speculate that 40-60 nm is the lower size limit that can trigger ABC. Removal of the uricase aggregates and the PEG diol contaminant and modifying with small PEG reagents enabled ABC to be successfully avoided and sufficient reduction in the immunogenicity of 5 kDa mPEG-modified tetrameric canine uricase.
Zhang, Chun; Fan, Kai; Ma, Xuefeng; Wei, Dongzhi
2012-01-01
Background Uricase has proven therapeutic value in treating hyperuricemia but sufficient reduction of its immunogenicity may be the largest obstacle to its chronic use. In this study, canine uricase was modified with 5 kDa mPEG-SPA and the impact of large aggregated uricases and cross-linked conjugates induced by difunctional PEG diol on immunogenicity was investigated. Methods and Findings Recombinant canine uricase was first expressed and purified to homogeneity. Source 15Q anion-exchange chromatography was used to separate tetrameric and aggregated uricase prior to pegylation, while DEAE anion-exchange chromatography was used to remove Di-acid PEG (precursor of PEG diol) from unfractionated 5 kDa mPEG-propionic acid. Tetrameric and aggregated uricases were separately modified with the purified mPEG-SPA. In addition, tetrameric uricases was modified with unfractionated mPEG-SPA, resulting in three types of 5 kDa mPEG-SPA modified uricase. The conjugate size was evaluated by dynamic light scattering and transmission electron microscope. The influence of differently PEGylated uricases on pharmacokinetics and immunogenicity were evaluated in vivo. The accelerated blood clearance (ABC) phenomenon previously identified for PEGylated liposomes occurred in rats injected with PEGylated uricase aggregates. Anti-PEG IgM antibodies, rather than neutralizing antibodies, were found to mediate the ABC. Conclusions The size of conjugates is important for triggering such phenomena and we speculate that 40–60 nm is the lower size limit that can trigger ABC. Removal of the uricase aggregates and the PEG diol contaminant and modifying with small PEG reagents enabled ABC to be successfully avoided and sufficient reduction in the immunogenicity of 5 kDa mPEG-modified tetrameric canine uricase. PMID:22745806
Rubio-Guerra, Alberto F; Garro-Almendaro, Ana K; Elizalde-Barrera, Cesar I; Suarez-Cuenca, Juan A; Duran-Salgado, Montserrat B
2017-02-01
Hyperuricemia leads to endothelial dysfunction and insulin resistance, and has been associated with diseases such as hypertension. Antihypertensive drugs modify serum uric acid levels, however, few data are available about their combinations on uricemia. In this study we evaluate the effect of two combinations of losartan, with amlodipine or with hydrochlorothiazide, on serum uric acid levels in hypertensive patients. A total of 60 hypertensive patients were randomized in two groups; group LA received losartan/amlodipine (100/5 mg) once a day, whereas LH group received losartan hydrochlorothiazide (100/12.5 mg) once a day for 3 months. In both groups serum uric acid levels were measured at the beginning and end of the study. Patients were evaluated monthly for blood pressure (BP) and adverse events. Statistical analysis was performed with a two-way analysis of variance (ANOVA) for repeated measures. All patients experienced a significant reduction of BP to the same extent (LA 155/94 to 123/79, LH 157/92 to 124/78 mmHg, p > 0.05). In the LA group, serum uric acid decreased from 6.5 ± 1.6 to 4.6 ± 1.3 mg/ml ( p = 0.0001), whereas in the LH group there was a nonsignificant increase from 5.82 ± 1.4 to 5.85 ± 1.5 mg/ml, ( p = 0.936). When both groups were compared, we found a significant reduction ( p < 0.00013) on serum uric acid levels in the LA group. Both combinations decrease BP values to the same extent, however, LA combination showed a reduction on serum uric acid levels, which may contribute to a reduction in the metabolic risk in hypertensive patients.
Acute peritoneal dialysis in neonates with acute kidney injury and hypernatremic dehydration.
Yildiz, Nurdan; Erguven, Müferet; Yildiz, Metin; Ozdogan, Tutku; Turhan, Pinar
2013-01-01
We aimed to evaluate the efficacy of acute peritoneal dialysis (PD) and clinical outcomes in neonates with acute kidney injury (AKI) and hypernatremic dehydration. ♢ The medical records of 15 neonates with AKI and hypernatremic dehydration who were treated with acute PD were reviewed. The diagnoses were AKI with hypernatremic dehydration with or without sepsis in 13 patients and AKI with hypernatremia and congenital nephropathy in 2 patients. The main indications for PD were AKI with some combination of oligoanuria, azotemia, hyperuricemia, and metabolic acidosis unresponsive to initial intensive medical treatment. ♢ The mean age of the patients at dialysis initiation was 11.9 ± 9 days, and the mean duration of PD was 6.36 ± 4.8 days. In 7 patients (46.7%), hypotension required the use of vasopressors, and in 6 patients (40%), mechanical ventilation was required. Peritoneal dialysis-related complications occurred in 7 patients (46.7%), the most common being catheter malfunction (n = 6). Four episodes of peritonitis occurred in the 15 patients (26.7%), 2 episodes in patients with congenital renal disease and 2 episodes in patients with sepsis and multiorgan failure, who did not survive. Congenital renal disease, septicemia, and the need for mechanical ventilation were important factors influencing patient survival. All patients with no pre-existing renal disease or sepsis recovered their renal function and survived. ♢ In neonates with AKI and hypernatremic dehydration, PD is safe and successful, and in patients without congenital renal disease or sepsis, the prognosis is good. Peritoneal dialysis should be the treatment of choice in neonates with AKI and hypernatremic dehydration who do not respond to appropriate medical treatment.
Zheng, Xiaoya; Wei, Qiang; Long, Jian; Gong, Lilin; Chen, Hua; Luo, Rong; Ren, Wei; Wang, Yonghong
2018-04-11
Little is known about the relationship between serum uric acid (SUA) and cardio-ankle vascular index (CAVI) in Chinese population. Therefore, we aimed to investigate the gender difference in the association of SUA and CAVI in a southwestern Chinese population. Data were obtained from subjects via routine physical examinations in the Public Health Center of our hospital between 2011 and 2014 in Chongqing. The data included completed anthropometry and blood biochemical indicators. The CAVI were recorded using an automatically VaseraVS-1000 vascular screening system. We found females with hyperuricemia (HUA) had significantly higher CAVI than women with normal SUA (8.45 ± 1.40 vs 7.67 ± 1.15, P<0.05). Then we defined high CAVI as CAVI≥9 m/s, and compared the percentage of high CAVI, we found women with HUA had higher percentage of high CAVI than women with normal SUA (26.83% vs 9.38%, P<0.05). Those differences were not significant in males. Also, the logistic regression analysis found age and hypertension were major independent risk factors associated with high CAVI in both genders. HUA and hyperglycemia were independently associated with high CAVI in females with an OR of 3.65, 95%CI (1.37-9.73) and 3.02, 95%CI (1.38-6.63) respectively. However, these significant associations were not be found in males. Our data showed positive associations between elevated SUA levels and higher CAVI risk in the inland Chinese females, but not in males. The reason for the gender differences were still unclear, sex hormones may play a role. Further prospective studies including detailed personal information and multicenter were required.
Baumgartner, Scott; Yeh, Li-Tain; Shen, Zancong; Kerr, Bradley; Manhard, Kimberly; Quart, Barry
2018-05-07
The objective of the study was to evaluate the effect of lesinurad, a selective uric acid uptake inhibitor, alone and in combination with the xanthine oxidase inhibitor allopurinol, on serum uric acid and urinary urate excretion in patients with gout and hyperuricemia. A phase 1b, multicenter, open-label, multiple-dose study was carried out in patients with gout with serum uric acid ≥8 mg/dL following washout of urate-lowering therapy. Patients were treated with allopurinol 300 mg/day alone in week 1; lesinurad 400 or 600 mg/day was added in week 2, followed by lesinurad 400 or 600 mg/day alone in week 3. Serum uric acid and urine uric acid were evaluated each week. Safety was assessed throughout the study. Lesinurad 400 or 600 mg/day added to allopurinol 300 mg/day reduced serum uric acid by 60% and 72%, respectively, versus allopurinol alone (37%) or lesinurad 400 mg/day (44%) or 600 mg/day (47%) alone. A 100% response rate of serum uric acid <6 mg/dL was achieved by all combinations (serum uric acid <5 mg/dL by 50%-90%). Mean 24-hour urate excretion compared with baseline was -35% with allopurinol, +36% and +56.5% with lesinurad 400 mg/day and 600 mg/day, respectively, and -11.6% and -7.1% with the respective combination therapies. Treatments were well tolerated. In this phase 1 trial, lesinurad added to allopurinol resulted in greater serum uric acid reduction than did allopurinol or lesinurad monotherapy. © 2018, The Authors. The Journal of Clinical Pharmacology published by Wiley Periodicals, Inc. on behalf of American College of Clinical Pharmacology.
Jun, Ji Eun; Lee, You-Bin; Lee, Seung-Eun; Ahn, Ji Yeon; Kim, Gyuri; Jin, Sang-Man; Hur, Kyu Yeon; Lee, Moon-Kyu; Kang, Mi Ra; Kim, Jae Hyeon
2018-05-01
Hyperuricemia was frequently noted in subjects with a high risk of cardiovascular disease (CVD). This study aimed to elucidate whether serum uric acid (SUA) is associated with development of moderate coronary artery calcification in generally healthy adults. A total of 9297 subjects underwent multidetector CT for the evaluation of CAC at least two times during their annual health examinations. Among them, 4461 participants without CVD history and who had no (scores 0) or minimal CAC (scores 1-10) in their first examination were enrolled. The association between SUA as a continuous and categorical variable and development of moderate coronary artery calcification (CAC score > 100) was assessed by Cox regression analysis. Receiver-operating characteristic (ROC) curves were constructed to investigate the diagnostic efficacy of SUA. During a median follow-up of 4.1 years, 131 incident cases of moderate calcification developed. Baseline SUA concentration was significantly higher in subjects with progression to moderate coronary artery calcification (6.6 ± 1.3 vs. 5.8 ± 1.3 mg/dL, p < 0.001). SUA as a continuous variable (per 1 mg/dL) and divided into quartiles was positively associated with a higher risk of development of moderate calcification after adjustment for conventional CVD risk factors. The addition of SUA to the conventional CVD risk factors improved the predictive power for development of moderate coronary artery calcification. SUA was an independent predictor for development of moderate coronary artery calcification in subjects with no or minimal calcification. Copyright © 2018 Elsevier B.V. All rights reserved.
Menopausal symptoms and the metabolic syndrome in Nigerian women with type 2 diabetes mellitus.
Ogbera, A; Fasanmade, O; Kalra, S
2011-02-01
To determine the frequency of occurrence of the metabolic syndrome and the age of onset and pattern of menopausal symptomatology in Nigerian women with type 2 diabetes mellitus. This was a cross-sectional study in which 201 menopausal women with type 2 diabetes mellitus aged between 40 and 85 years were studied. Their anthropometric indices, fasting lipid values, glucose parameters, uric acid and HbA(1c) were documented. The presence of the metabolic syndrome and menopausal symptoms were determined using the National Cholesterol Panel-ATP definition and MENQOL questionnaire, respectively. The test statistics used included the t test, χ(2) and correlation coefficient. The mean age (standard deviation) of the onset, median age and age range of menopause were 50.3 (4.8) years, 50 years and 40-57 years, respectively. The frequency of occurrence of menopausal symptoms ranged from 14% to 76%. Hot flushes, night sweats and dry skin are some of the vasomotor symptoms which occurred in 38%, 31% and 30%, respectively, of the subjects. The prevalence of the metabolic syndrome was 69%, with the pattern of occurrence of the menopausal symptoms being comparable in subjects with and without the metabolic syndrome. The frequency of occurrence of hyperuricemia in the study population was 42%. In the partial correlation analysis, serum uric acid concentration was significantly positively correlated with body mass index (r = 0.15, p = 0.02) and significantly negatively correlated with high density lipoprotein cholesterol (r = -0.1, p = 0.03). The age of onset of menopause in Nigerian women with type 2 diabetes mellitus is comparable to the age that is commonly reported and the metabolic syndrome is highly prevalent in this group of women.
The prevalence, awareness, treatment and control of dyslipidemia among adults in China.
Pan, Ling; Yang, Zhenhua; Wu, Yue; Yin, Rui-Xing; Liao, Yunhua; Wang, Jinwei; Gao, Bixia; Zhang, Luxia
2016-05-01
To analyze the prevalence, awareness, treatment, control and epidemiological characteristics of dyslipidemia in Chinese adults. In this cross-sectional study, we adopted a multi-stage, stratified sampling method to obtain representative samples of the general population aged >18 years from different urban and rural regions in China. All subjects completed a lifestyle and medical history questionnaire and were examined for risk factors. Dyslipidemia was defined according to criteria of the 2007 Chinese Guidelines on Prevention and Treatment of Dyslipidemia in Adults. Continuous variables were compared using variance analysis. Multivariate logistic regression analysis was performed to explore the risk factors of dyslipidemia. The prevalence of dyslipidemia was 34.0% overall, and 35.1%, and 26.3% in urban and rural areas, respectively. The prevalence of dyslipidemia was significantly higher in men than women (41.9% vs 32.5%; P < 0.001). Rates of awareness, treatment, and control were 31.0%, 19.5%, and 8.9%, respectively. Increasing age (OR = 1.012; 95% CI:1.010, 1.014), male sex (OR = 1.411; 95% CI:1.318, 1.510), obesity (OR = 1.424; 95% CI:1.345, 1.507), cardiovascular disease (OR = 1.343; 95% CI:1.125, 1.603), diabetes (OR = 1.955; 95% CI:1.751, 2.182), hypertension (OR = 1.481; 95% CI:1.391, 1.577) and hyperuricemia (OR = 2.223; 95% CI:2.060, 2.399) were independent risk factors of dyslipidemia. The prevalence of dyslipidemia among Chinese adults was high but awareness, treatment, and control of dyslipidemia were low. Urban high income earners and rural medium income earners show higher prevalence. Low income earners in urban and rural population have the worst awareness treatment, and control rate. There is an increased need for closely monitoring and controlling high risk factors in the populations including postmenopausal women, unhealthy lifestyle peoples and patients with chronic non-communicable diseases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Dyslipidemia in rural areas of North China: prevalence, characteristics, and predictive value.
Gao, Nannan; Yu, Yong; Zhang, Bingchang; Yuan, Zhongshang; Zhang, Haiqing; Song, Yongfeng; Zhao, Meng; Ji, Jiadong; Liu, Lu; Xu, Chao; Zhao, Jiajun
2016-09-13
The prevalence of cardiovascular disease has been increasing worldwide. As a common pathogenic risk factor, dyslipidemia played a great role in the incidence and progress of these diseases. We investigated to achieve accurate and up-to-date information on the prevalence of dyslipidemia and its associations with other lipid-related diseases in rural North China. Using a complex, multistage, probability sampling design, we conducted a large-scale cross-sectional study of 8528 rural participants aged over 18 years in Shandong Province. Prevalence and characteristics of dyslipidemia were demonstrated. The odds ratios between dyslipidemia types and lipid-related diseases were further analyzed by logistic regression. Among the overall population, 45.8 % suffered from dyslipidemia. The prevalence of lipid abnormality (including high and very high levels) was 18.6, 12.7, 9.8 and 12.7 % for total cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) cholesterol and triglycerides (TG), respectively. Among all participants with dyslipidemia, 23.9 % were aware, only 11.5 % were treated, 10.0 % were controlled. For subjects with dyslipidemia, the risk for non-alcoholic fatty liver disease (NAFLD) was highest with a 3.3-fold over that of non-dyslipidmia (OR = 3.30, P < 0.001); followed by hyperuricemia and diabetes mellitus (DM), while with 2-fold increase (OR = 1.99, P < 0.001; OR = 1.92, P < 0.001); with only 1.5-fold risk for atherosclerosis (AS) (OR = 1.47, P < 0.001). The presence of high cholesterol was mainly associated with AS, while abnormal TG was correlated with NAFLD and DM. Dyslipidemia has become a serious public health issue in rural North China. The rapid increase of high TC and incremental risk of high TG may contribute to the epidemic of AS, NAFLD and DM. It is imperative to develop individualized prevention and treatment guidelines according to dyslipidemia phenotypes.
Posadas-Sánchez, Rosalinda; Angeles-Martínez, Javier; Pérez-Hernández, Nonanzit; Rodríguez-Pérez, José Manuel; López-Bautista, Fabiola; Flores-Dominguez, Carmina; Fragoso, José Manuel; Posadas-Romero, Carlos; Vargas-Alarcón, Gilberto
2018-06-01
Interleukin 10 (IL-10) is an anti-inflammatory cytokine with a protective role in the formation and the development of the atherosclerotic plaque. The aim of the present study was to establish if IL-10 gene polymorphisms are associated with the development of premature coronary artery disease (pCAD) and cardiovascular risk factors in Mexican individuals. Three IL-10 gene polymorphisms [-592C/A (rs1800872), -819C/T (rs1800871), and -1082 A/G (rs1800896)] and IL-10 plasma levels were analyzed in 2266 individuals (1160 pCAD patients and 1106 healthy controls). Under recessive and co-dominant2 models, the -1082 A/G (rs1800896) G allele was associated with decreased risk of developing pCAD (OR = 0.572, P rec = 0.022 and OR = 0.567, P cod2 = 0.023). In pCAD patients, the polymorphisms were associated with hyperinsulinemia, small and dense LDLs, hypertension, and diabetes mellitus. In the control group, the polymorphisms were associated with hypertension, hyperuricemia, and small and dense LDLs. pCAD patients have significantly higher IL-10 plasma levels than healthy controls [0.91 (0.55-1.67) pg/mL vs 0.45 (0.24-0.98) pg/mL, respectively, P < 0.0001]. Nevertheless, these levels were not associated with the genotypes analyzed in the present study. The results suggest that the IL-10-1082 A/G (rs1800896) G allele is associated with a decreased risk of developing pCAD. In patients and controls, the polymorphisms analyzed were associated with some cardiovascular risk factors. Although, in pCAD patients the IL-10 plasma levels were higher, they were not associated with the genotypes of the polymorphisms examined. Copyright © 2018 Elsevier Ltd. All rights reserved.
Interaction of the GCKR and A1CF loci with alcohol consumption to influence the risk of gout.
Rasheed, Humaira; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2017-07-05
Some gout-associated loci interact with dietary exposures to influence outcome. The aim of this study was to systematically investigate interactions between alcohol exposure and urate-associated loci in gout. A total of 2792 New Zealand European and Polynesian (Māori or Pacific) people with or without gout were genotyped for 29 urate-associated genetic variants and tested for a departure from multiplicative interaction with alcohol exposure in the risk of gout. Publicly available data from 6892 European subjects were used to test for a departure from multiplicative interaction between specific loci and alcohol exposure for the risk of hyperuricemia (HU). Multivariate adjusted logistic and linear regression was done, including an interaction term. Interaction of any alcohol exposure with GCKR (rs780094) and A1CF (rs10821905) influenced the risk of gout in Europeans (interaction term 0.28, P = 1.5 × 10 -4 ; interaction term 0.29, P = 1.4 × 10 -4 , respectively). At A1CF, alcohol exposure suppressed the gout risk conferred by the A-positive genotype. At GCKR, alcohol exposure eliminated the genetic effect on gout. In the Polynesian sample set, there was no experiment-wide evidence for interaction with alcohol in the risk of gout (all P > 8.6 × 10 -4 ). However, at GCKR, there was nominal evidence for an interaction in a direction consistent the European observation (interaction term 0.62, P = 0.05). There was no evidence for an interaction of A1CF or GCKR with alcohol exposure in determining HU. These data support the hypothesis that alcohol influences the risk of gout via glucose and apolipoprotein metabolism. In the absence of alcohol exposure, genetic variants in the GCKR and A1CF genes have a stronger role in gout.
Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chou, J.Y.; Lei, K.J.; Shelly, L.L.
1994-09-01
Glycogen storage disease (GSD) type la (von Gierke disease) is caused by the deficiency of glucose-6-phosphatase (G6Pase), the key enzyme in glucose homeostasis. The disease presents with clinical manifestations of severe hypoglycemia, hepatomegaly, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. We have succeeded in isolating a murine G6Pase cDNA from a normal mouse liver cDNA library by differentially screening method. We then isolated the human G6Pase cDNA and gene. To date, we have characterized the G6Pase genes of twelve GSD type la patients and uncovered a total of six different mutations. The mutations are comprised of R83C (an Arg atmore » codon 83 to a Cys), Q347X (a Gly at codon 347 to a stop codon), 459insTA (a two basepair insertion at nucleotide 459 yielding a truncated G6Pase of 129 residues), R295C (an Arg at codon 295 to a Cys), G222R (a Gly at codon 222 to an Arg) and {delta}F327 (a codon deletion for Phe-327 at nucleotides 1058 to 1060). The relative incidences of these mutations are 37.5% (R83C), 33.3% (Q347X), 16.6% (459insTA), 4.2% (G222R), 4.2% (R295C) and 4.2% ({delta}F327). Site-directed mutagenesis and transient expression assays demonstrated that the R83C, Q347X, R295C, and {delta}F327 mutations abolished whereas the G222R mutation greatly reduced G6Pase activity. We further characterized the structure-function requirements of amino acids 83, 222, and 295 in G6Pase catalysis. The identification of mutations in GSD type la patients has unequivocally established the molecular basis of the type la disorder. Knowledge of the mutations may be applied to prenatal diagnosis and opens the way for developing and evaluating new therapeutic approaches.« less
Matias, Mariana Leticia; Romão, Mariana; Weel, Ingrid Cristina; Ribeiro, Vanessa Rocha; Nunes, Priscila Rezeck; Borges, Vera Therezinha; Araújo, João Pessoa; Peraçoli, José Carlos; de Oliveira, Leandro; Peraçoli, Maria Terezinha
2015-01-01
Preeclampsia (PE) is a specific syndrome of pregnancy, characterized by hypertension and proteinuria. This pathology is associated with hyperuricemia and elevated serum levels of inflammatory cytokines. Uric acid crystals may activate an intracellular complex called inflammasome, which is important for processing and release of inflammatory cytokines. This study investigated the state of monocyte activation, both endogenous and stimulated with monosodium urate (MSU), by gene expression of NLRP1 and NLRP3 receptors as well as their association with inflammatory cytokines expression. Monocytes were obtained from peripheral blood of 23 preeclamptic pregnant women, 23 normotensive pregnant women (NT) and 23 healthy non-pregnant women (NP). Inflammasome activation was evaluated by the gene expression of NLRP1, NLRP3, caspase-1, IL-1β, IL-18 and TNF-α by RT-qPCR in unstimulated monocytes (endogenous expression), or after cell stimulation with MSU (stimulated expression). The concentration of cytokines was assessed by ELISA. In preeclamptic pregnant women, gene expression of NLRP1, NLRP3, caspase-1, IL-1β and TNF-α by monocytes stimulated or not with MSU was significantly higher than in NT and NP groups. Stimulation of monocytes from preeclamptic and non-pregnant women with MSU induced increased gene expression of NLRP3, caspase-1 and TNF-α in relation to the endogenous expression in these groups, while this was not observed in the NT group. The cytokine determination showed that monocytes from women with PE produced higher endogenous levels of IL-1β, IL-18 and TNF-α compared to the other groups, while the stimulus with MSU led to higher production of these cytokines in preeclamptic group than in the NT group. In conclusion, the results showed increased basal gene expression of NLRP1 and NLRP3 receptors in monocytes from PE group. These cells stimulation with MSU demonstrates that uric acid plays a role in NLRP3 inflammasome activation, suggesting the participation of this inflammatory complex in the pathogenesis of preeclampsia.
Zierath, Sharon; Hughes, Angela M.; Fretwell, Neale; Dibley, Mark
2017-01-01
Background A large and growing number of inherited genetic disease mutations are now known in the dog. Frequencies of these mutations are typically examined within the breed of discovery, possibly in related breeds, but nearly always in purebred dogs. No report to date has examined the frequencies of specific genetic disease mutations in a large population of mixed-breed dogs. Further, veterinarians and dog owners typically dismiss inherited/genetic diseases as possibilities for health problems in mixed-breed dogs, assuming hybrid vigor will guarantee that single-gene disease mutations are not a cause for concern. Therefore, the objective of this study was to screen a large mixed-breed canine population for the presence of mutant alleles associated with five autosomal recessive disorders: hyperuricosuria and hyperuricemia (HUU), cystinuria (CYST), factor VII deficiency (FVIID), myotonia congenita (MYC) and phosphofructokinase deficiency (PKFD). Genetic testing was performed in conjunction with breed determination via the commercially-available Wisdom PanelTM test. Results From a population of nearly 35,000 dogs, homozygous mutant dogs were identified for HUU (n = 57) and FVIID (n = 65). Homozygotes for HUU and FVIID were identified even among dogs with highly mixed breed ancestry. Carriers were identified for all disorders except MYC. HUU and FVIID were of high enough frequency to merit consideration in any mixed-breed dog, while CYST, MYC, and PKFD are vanishingly rare. Conclusions The assumption that mixed-breed dogs do not suffer from single-gene genetic disorders is shown here to be false. Within the diseases examined, HUU and FVIID should remain on any practitioner’s rule-out list, when clinically appropriate, for all mixed-breed dogs, and judicious genetic testing should be performed for diagnosis or screening. Future testing of large mixed-breed dog populations that include additional known canine genetic mutations will refine our knowledge of which genetic diseases can strike mixed-breed dogs. PMID:29166669
Zierath, Sharon; Hughes, Angela M; Fretwell, Neale; Dibley, Mark; Ekenstedt, Kari J
2017-01-01
A large and growing number of inherited genetic disease mutations are now known in the dog. Frequencies of these mutations are typically examined within the breed of discovery, possibly in related breeds, but nearly always in purebred dogs. No report to date has examined the frequencies of specific genetic disease mutations in a large population of mixed-breed dogs. Further, veterinarians and dog owners typically dismiss inherited/genetic diseases as possibilities for health problems in mixed-breed dogs, assuming hybrid vigor will guarantee that single-gene disease mutations are not a cause for concern. Therefore, the objective of this study was to screen a large mixed-breed canine population for the presence of mutant alleles associated with five autosomal recessive disorders: hyperuricosuria and hyperuricemia (HUU), cystinuria (CYST), factor VII deficiency (FVIID), myotonia congenita (MYC) and phosphofructokinase deficiency (PKFD). Genetic testing was performed in conjunction with breed determination via the commercially-available Wisdom PanelTM test. From a population of nearly 35,000 dogs, homozygous mutant dogs were identified for HUU (n = 57) and FVIID (n = 65). Homozygotes for HUU and FVIID were identified even among dogs with highly mixed breed ancestry. Carriers were identified for all disorders except MYC. HUU and FVIID were of high enough frequency to merit consideration in any mixed-breed dog, while CYST, MYC, and PKFD are vanishingly rare. The assumption that mixed-breed dogs do not suffer from single-gene genetic disorders is shown here to be false. Within the diseases examined, HUU and FVIID should remain on any practitioner's rule-out list, when clinically appropriate, for all mixed-breed dogs, and judicious genetic testing should be performed for diagnosis or screening. Future testing of large mixed-breed dog populations that include additional known canine genetic mutations will refine our knowledge of which genetic diseases can strike mixed-breed dogs.
Hara, Shigeko; Tsuji, Hiroshi; Ohmoto, Yuki; Amakawa, Kazuhisa; Hsieh, Shiun Dong; Arase, Yasuji; Nakajima, Hiromu
2012-02-01
The objective of this study was to evaluate whether hyperuricemia, acidic urine, or their combination predicts metabolic syndrome (MetS). In study 1, 69,094 subjects who received a general health checkup between 1985 and 2005 were included in a cross-sectional study of serum uric acid (SUA) and urine pH in relation to MetS. In study 2, the association of SUA and urine pH with MetS development over a 5-year period was evaluated in 5617 subjects with body mass index less than 25 kg/m(2) at the first examination. In study 1, higher SUA and lower urine pH were both positively correlated to MetS status (P < .001). The combination of high SUA and low urine pH was significantly associated with higher MetS prevalence compared with the combination of low SUA and high urine pH (odds ratio, 3.383; 95% confidence interval [CI], 3.034-3.784 in men; odds ratio, 4.000; 95% CI, 2.992-5.452 in women). In study 2, the top quartile of SUA levels was associated with higher MetS development compared with the bottom quartile during the 5-year period in men (hazard ratio [HR], 1.793; 95% CI, 1.084-2.966; P = .023). In women, the HR was 3.732 (95% CI, 0.391-35.62; P = .252) for the upper vs the lower half of SUA levels. For urine pH, the HR was 1.955 (95% CI, 1.089-3.509; P = .025) for the bottom vs the top quartile in men. A likelihood ratio test confirmed that high SUA and low urine pH act synergistically in the development of MetS. High SUA, low urine pH, and their combination are predictive risk factors for MetS development. Copyright © 2012 Elsevier Inc. All rights reserved.
Liu, Yongwen; Liu, Changqin; Shi, Xiulin; Lin, Mingzhu; Yan, Bing; Zeng, Xin; Chen, Ningning; Lu, Shuhua; Liu, Suhuan; Yang, Shuyu; Li, Xuejun; Li, Zhibin
2017-06-01
Existing evidence about the associations of non-alcoholic fatty liver disease (NAFLD) and serum uric acid (SUA) with subclinical atherosclerosis is controversial. The aim of the present study was to examine the associations of NAFLD and SUA with subclinical atherosclerosis. In the present cross-sectional study, 1354 obese adults underwent hepatic ultrasonography and arteriosclerosis detection. Indices of subclinical atherosclerosis were brachial-ankle pulse wave velocity (ba-PWV) and the ankle-brachial index (ABI). Linear regression using multivariable fractional polynomial (MFP) modeling was used to examine independent associations of NAFLD and SUA with a-PWV and ABI. Compared with controls, mean (± SD) ba-PWV was significantly higher in subjects with NAFLD (1534 ± 292 vs 1433 ± 259 cm/s; P < 0.001) and hyperuricemia (HUA; 1519 ± 275 vs 1476 ± 287 cm/s; P = 0.007). After adjustment for sociodemographic and lifestyle factors, NAFLD and SUA were both positively related to ba-PWV (β = 0.120 and 0.064, respectively; P < 0.05 for both). With further adjustment for insulin resistance and components of metabolic syndrome (MetS), the positive correlations were no longer significant (β = 0.017 and 0.006; P > 0.05 for both). In addition, NAFLD, but not SUA, was negatively correlated with ABI (β = -0.073; P = 0.015). Using MFP modeling, the best fractional polynomial (FP) transformation model showed that non-linear transformations were appropriate for two variables in their relationship with ba-PWV, namely age and fasting insulin as first-degree FP transformations (age 3 and 1/insulin 0.5 , respectively). Neither NAFLD nor SUA was related to ba-PWV with increases in insulin resistance and MetS, but NAFLD was independently and negatively correlated with ABI. © 2016 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.
Kim, Hyunsuk; Koh, Junga; Park, Sue K; Oh, Kook Hwan; Kim, Yeong Hoon; Kim, Yaeni; Ahn, Curie; Oh, Yun Kyu
2018-05-24
The aim of this study was to describe the baseline characteristics of autosomal dominant polycystic kidney disease (ADPKD) in a cohort of Korean patients with chronic kidney disease (CKD). From April 2011 to February 2016, patients with CKD stage 1 to 5 (pre-dialysis) were enrolled as an ADPKD subcohort of the KoreaN Cohort Study for Outcomes in Patients With Chronic Kidney Disease. Baseline characteristics, the correlation of kidney and liver volume and kidney function, and the factors associated with kidney function were analyzed. A total of 364 ADPKD patients with a mean estimated glomerular filtration rate (eGFR) of 68.1 ± 33.3 mL/min/1.73 m 2 (50.5% male with a mean age of 47.0 ± 10.6 years) were enrolled from nine hospitals in Korea. Initially, 55.8% of the patients were asymptomatic, and pain was the most common symptom (12.9%); 87.6% and 77.5% of the patients had hypertension and hepatic cysts, respectively. The height-adjusted total kidney volumes (htTKV) were higher in male patients than in female patients. In contrast, the height-adjusted total liver volumes were higher in female patients than in male patients. The decrease rate of eGFR depending on Log(htTKV) was larger in the group aged between 41 and 50 than the other age groups. Older age, a higher 24-hour urine protein excretion, larger htTKV, and hyperuricemia were independently associated with lower eGFR, whereas using febuxostat was independently associated with higher eGFR. This subcohort will provide clinical characteristics and outcomes of Korean ADPKD patients and can compare with those of other previous cohorts. We have identified factors associated with advanced-stage CKD in Korean patients with ADPKD. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ng, Chau Yee; Yeh, Yu-Ting; Wang, Chuang-Wei; Hung, Shuen-Iu; Yang, Chih-Hsun; Chang, Ya-Ching; Chang, Wan-Chun; Lin, Yu-Jr; Chang, Chee-Jen; Su, Shih-Chi; Fan, Wen-Lang; Chen, Der-Yuan; Wu, Yeong-Jian Jan; Tian, Ya-Chung; Hui, Rosaline Chung-Yee; Chung, Wen-Hung
2016-07-01
Allopurinol, a common drug for treating hyperuricemia, is associated with cutaneous adverse drug reactions ranging from mild maculopapular exanthema to life-threatening severe cutaneous adverse reactions, including drug reaction with eosinophilia and systemic symptoms, Stevens-Johnson syndrome, and toxic epidermal necrolysis. We have previously reported that HLA-B*58:01 is strongly associated with allopurinol-induced severe cutaneous adverse reactions in Han Chinese, but the associations of the HLA-B*58:01 genotype in an allopurinol-induced hypersensitivity phenotype remain unclear. To investigate the comprehensive associations of HLA-B*58:01, we enrolled 146 patients with allopurinol-induced cutaneous adverse drug reactions (severe cutaneous adverse reactions, n = 106; maculopapular exanthema, n = 40) and 285 allopurinol-tolerant control subjects. Among these allopurinol-induced cutaneous adverse drug reactions, HLA-B*58:01 was strongly associated with severe cutaneous adverse reactions (odds ratio [OR] = 44.0; 95% confidence interval = 21.5-90.3; P = 2.6 × 10(-41)), and the association was correlated with disease severity (OR = 44.0 for severe cutaneous adverse reactions, OR = 8.5 for maculopapular exanthema). The gene dosage effect of HLA-B*58:01 also influenced the development of allopurinol-induced cutaneous adverse drug reactions (OR = 15.25 for HLA-B*58:01 heterozygotes and OR = 72.45 for homozygotes). Furthermore, coexistence of HLA-B*58:01 and renal impairment increased the risk and predictive accuracy of allopurinol-induced cutaneous adverse drug reactions (heterozygous HLA-B*58:01 and normal renal function: OR = 15.25, specificity = 82%; homozygous HLA-B*58:01 and severe renal impairment: OR = 1269.45, specificity = 100%). This HLA-B*58:01 correlation study suggests that patients with coexisting HLA-B*58:01 and renal impairment (especially estimated glomerular filtration rate < 30ml/minute/1.73 m(2)) should be cautious and avoid using allopurinol. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Low dopamine activity in Lesch Nyhan Disease. An 18-fluorodopa PET study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ernst, M.; Zametkin, A.; Matochik, J.
1996-05-01
Lesch-Nyhan Disease (LND) is a rare devastating X-linked recessive disorder characterized by the virtual absence of hypoxanthine guanine phosphoribosyl transferase (HPRT), a major enzyme of the salvage pathway of purine metabolism. The clinical presentation includes hyperuricemia choreoathetosis, dystonia, aggression and self-injurious behavior. The genetic and biochemical abnormalities are fully identified. However, the neuropathophysiological process by which the lack of HPRT produces the neuropsychiatric syndrome of LND in unclear. Presynaptic uptake of 18-Fluorodopa (FD) in basal ganglia, substantia nigra, and frontal and occipital cortices was measured by PET in 12 patients with LND, 10 to 20 years old, and 15 healthmore » controls, 12 to 23 years old. Radioactive counts (mCi/cc), recorded between 90 and 130 minutes after tracer injection, were measured in regions of interest by a rater blind to subjects` identities. Results were expressed as ratios of FD uptake in specific to non-specific (occipital cortex) brain areas. Presynaptic dopamine activity was significantly lower by 69% in putamen (p<0.0001), 61% in caudate (p<0.0001), 56% in frontal cortex (p=0.003) and 43% in substantiat nigra (p<0.016) in LND patients than in control subjects. Absolute FD measures in occipital regions did not differ between the two groups. Activity of FD in the basal ganglia was stable over time in the LND group and tended to increase in the control group (r=0.50, n=15, p=0.060). In the LND group, aggressive behavior was worse as FD activity was higher (r=0.60, n=12, p=0.40). LND is associated with a striking reduction of presynaptic dopamine activity that is not region-specific. The temporal stability of FD measures and of the severity of LND symptomatology is consistent with a developmental rather than degenerative process.« less
Febuxostat for treating allopurinol-resistant hyperuricemia in patients with chronic kidney disease.
Sakai, Yukinao; Otsuka, Tomoyuki; Ohno, Dai; Murasawa, Tsuneo; Sato, Naoki; Tsuruoka, Shuichi
2014-03-01
Availability of the novel xanthine oxidase inhibitor febuxostat, which has multiple excretion pathways, enables investigation of the significance of serum uric acid control on renal function in patients with chronic kidney disease (CKD). This was an exploratory, retrospective, observational study conducted at a single Japanese center. Serum uric acid concentrations and serum creatinine levels in the 6 months before and after the start of febuxostat treatment were collected for CKD patients switched from allopurinol after failing to achieve serum uric acid concentrations ≤6.0 mg/dL. Evaluable data were available for 60 patients, 67% of whom had advanced CKD (eGFR <30 mL/min/1.73 m2). Mean dose of febuxostat was 15.9 (± 8) mg/day. Mean serum uric acid concentration decreased from 8.4 (±1.4) mg/dL at baseline to 6.2 (±1.2) mg/dL at 6 months; 47.5% of patients achieved a level ≤6.0 mg/dL. The change from baseline in eGFR was positive at all time points during febuxostat treatment and the increase of 2.3 (±5.6) mL/min/1.73 m2 at 6 months was significant (p = 0.0027). Whereas the eGFR slope was negative during allopurinol treatment, it became positive after the switch to febuxostat. The change in eGFR slope before and after febuxostat treatment was significant for all patients (p < 0.01), for male patients (p < 0.05), and for patients with a baseline eGFR of <15 mL/min/1.73 m2 (p < 0.05). In patients with CKD, febuxostat reduces serum uric acid concentrations effectively and may suppress the progressive decline in renal function.
Effects of Febuxostat in Early Gout: A Randomized, Double-Blind, Placebo-Controlled Study.
Dalbeth, Nicola; Saag, Kenneth G; Palmer, William E; Choi, Hyon K; Hunt, Barbara; MacDonald, Patricia A; Thienel, Ulrich; Gunawardhana, Lhanoo
2017-12-01
To assess the effect of treatment with febuxostat versus placebo on joint damage in hyperuricemic subjects with early gout (1 or 2 gout flares). In this double-blind, placebo-controlled study, 314 subjects with hyperuricemia (serum uric acid [UA] level of ≥7.0 mg/dl) and early gout were randomized 1:1 to receive once-daily febuxostat 40 mg (increased to 80 mg if the serum UA level was ≥6.0 mg/dl on day 14) or placebo. The primary efficacy end point was the mean change from baseline to month 24 in the modified Sharp/van der Heijde erosion score for the single affected joint. Additional efficacy end points included change from baseline to month 24 in the Rheumatoid Arthritis Magnetic Resonance Imaging Scoring (RAMRIS) scores for synovitis, erosion, and edema in the single affected joint, the incidence of gout flares, and serum UA levels. Safety was assessed throughout the study. Treatment with febuxostat did not lead to any notable changes in joint erosion over 2 years. In both treatment groups, the mean change from baseline to month 24 in the modified Sharp/van der Heijde erosion score for the single affected joint was minimal, with no between-group differences. However, treatment with febuxostat significantly improved the RAMRIS synovitis score at month 24 compared with placebo treatment (change from baseline -0.43 versus -0.07; P <0.001), decreased the overall incidence of gout flares (29.3% versus 41.4%; P < 0.05), and improved serum UA control (62.8% versus 5.7%; P < 0.001). No major safety concerns were reported. Urate-lowering therapy with febuxostat improved magnetic resonance imaging-determined synovitis and reduced the incidence of gout flares in subjects with early gout. © 2017 The Authors. Arthritis & Rheumatology published by Wiley Periodicals, Inc. on behalf of American College of Rheumatology.