Sweetened beverage consumption and the risk of hyperuricemia in Mexican adults: a cross-sectional study

PubMed Central

2014-01-01

Background The prevalence of hyperuricemia has doubled worldwide during the last few decades. The substantial increase in sweetened beverage (SB) consumption has also coincided with the secular trend of hyperuricemia. Recent studies do show that the consumption of SB can induce hyperuricemia. However, the association between SB and hyperuricemia remains unclear. The aim of this study was to evaluate the association between SB consumption and levels of uric acid in Mexican adults. Methods We performed a cross-sectional analysis of data from selected adults participating in the baseline assessment of the Health Workers Cohort Study. A total of 6,705 participants of both sexes between ages 18 and 70 years were included. SB intake was estimated using a validated semi-quantitative food frequency questionnaire. Biochemical and anthropometric information was collected using standard procedures. Hyperuricemia was defined as uric acid levels ≥ 7.0 mg/dL in men and ≥ 5.8 mg/dL in women. The association of interest was assessed by multiple logistic regression models. Results The odds ratios (OR) for hyperuricemia in men who consume 0.5-1 SB/day was 1.59 (95% CI; 1.05-2.40) and 2.29 (95% CI; 1.55-3.38) for those who consume ≥3 SB/day when compared to men who consume less than half a SB/day. In women, the OR for hyperuricemia for those who consume >1.0- < 3.0 SB/day was 1.33 (95% CI; 1.04-1.70) and 1.35 (95% CI; 1.04-1.75) for those who consume ≥3 SB/day when compared to women who consume less than half a SB/day, independent of other covariables. Men and women with high SB consumption and a body mass index (BMI) ≥ 25 Kg/m2 had greater risk for hyperuricemia than men and women with low SB consumption and normal BMI < 25 Kg/m2. Conclusions Our findings suggest that the consumption of SB is associated with an increased risk of hyperuricemia in Mexican adults. However, longitudinal research is needed to confirm the association between SB intake and hyperuricemia. PMID:24884821

Physiology of Hyperuricemia and Urate-Lowering Treatments.

PubMed

Benn, Caroline L; Dua, Pinky; Gurrell, Rachel; Loudon, Peter; Pike, Andrew; Storer, R Ian; Vangjeli, Ciara

2018-01-01

Gout is the most common form of inflammatory arthritis and is a multifactorial disease typically characterized by hyperuricemia and monosodium urate crystal deposition predominantly in, but not limited to, the joints and the urinary tract. The prevalence of gout and hyperuricemia has increased in developed countries over the past two decades and research into the area has become progressively more active. We review the current field of knowledge with emphasis on active areas of hyperuricemia research including the underlying physiology, genetics and epidemiology, with a focus on studies which suggest association of hyperuricemia with common comorbidities including cardiovascular disease, renal insufficiency, metabolic syndrome and diabetes. Finally, we discuss current therapies and emerging drug discovery efforts aimed at delivering an optimized clinical treatment strategy.

A novel mice model of metabolic syndrome: the high-fat-high-fructose diet-fed ICR mice

PubMed Central

Zhuhua, Zhang; Zhiquan, Wang; Zhen, Yang; Yixin, Niu; Weiwei, Zhang; Xiaoyong, Li; Yueming, Liu; Hongmei, Zhang; Li, Qin; Qing, Su

2015-01-01

Currently, the metabolic syndrome (MS) is occurring at growing rates worldwide, raising extensive concerns on the mechanisms and therapeutic interventions for this disorder. Herein, we described a novel method of establishing MS model in rodents. Male Institute of Cancer Research (ICR) mice were fed with high-fat-high-fructose (HFHF) diet or normal chow (NC) respectively for 12 weeks. Metabolic phenotypes were assessed by glucose tolerance test, insulin tolerance test and hyperinsulinemic-euglycemic clamp. Blood pressure was measured by a tail-cuff system. At the end of the experiment, mice were sacrificed, and blood and tissues were harvested for subsequent analysis. Serum insulin levels were measured by ELISA, and lipid profiles were determined biochemically. The HFHF diet-fed ICR mice exhibited obvious characteristics of the components of MS, including obvious obesity, severe insulin resistance, hyperinsulinemia, dislipidemia, significant hypertension and hyperuricemia. Our data suggest that HFHF diet-fed ICR mice may be a robust and efficient animal model that could well mimic the basic pathogenesis of human MS. PMID:26134356

Distribution of Serum Uric Acid in Black Africans and Its Association With Cardiovascular Risk Factors.

PubMed

Moulin, Stephanie R; Baldo, Marcelo P; Souza, Juliana B; Luchi, Weverton M; Capingana, Daniel P; Magalhães, Pedro; Mill, José G

2017-01-01

Hyperuricemia is associated with cardiovascular disease and its prevalence is unknown in black Africans. This study reports hyperuricemia distribution and its association with cardiovascular risk factors in a selected Angolan population. A cross-sectional study in 585 black Africans was performed. Hyperuricemia was defined as uric acid >7.0 mg/dL in men or >5.7 mg/dL in women. Overall prevalence was 25%. Hyperuricemia was associated with hypertension (odds ratio [OR], 2.20; confidence interval [CI], 95% 1.41-3.47), high waist circumference (OR, 1.67; CI, 95% 1.05-2.65), and metabolic syndrome (OR, 1.66; CI, 95% 1.07-2.57). Compared to those with uric acid levels in the first quartile, individuals in the fourth quartile showed higher body mass index, waist circumference, systolic blood pressure, and plasma levels of creatinine and triglycerides. Hypertension, high waist circumference, and metabolic syndrome were the major cardiovascular risk factors associated with hyperuricemia. ©2016 Wiley Periodicals, Inc.

Serum urate levels and consumption of common beverages and alcohol among Chinese in Singapore.

PubMed

Teng, Gim Gee; Tan, Chuen Seng; Santosa, Amelia; Saag, Kenneth G; Yuan, Jian-Min; Koh, Woon-Puay

2013-09-01

Western studies suggest that beverages may affect serum urate (SU) levels, but data from Asian populations are scarce. We evaluated the associations between beverages and SU levels in Singaporean Chinese. The study population consisted of 483 subjects ages 45-74 years from the Singapore Chinese Health Study cohort, recruited between 1993 and 1998. Lifestyle factors, medical histories, and diet were collected through in-person interviews. SU levels and other biomarkers were measured from blood collected between 1994 and 1996. The mean age was 57.6 years and 44% were men. The geometric mean SU level was 321 μmoles/liter (range 157-719). Mean SU levels increased with alcohol consumption (P = 0.024 for trend). The mean SU level of daily alcohol drinkers was 42.6 μmoles/liter higher than that of nondrinkers. Similarly, increasing frequency of green tea intake was associated with rising SU levels. The highest mean SU level was observed in daily green tea drinkers (difference of 25.0 μmoles/liter) relative to nondrinkers (P = 0.009 for trend). Compared to nondrinkers, daily alcohol drinkers had an almost 5-fold increase in association with hyperuricemia (odds ratio [OR] 4.83, 95% confidence interval [95% CI] 1.10-21.23), whereas daily green tea drinkers had a 2-fold increase in association with hyperuricemia (OR 2.12, 95% CI 1.03-4.36). The present study did not show elevated levels of SU in individuals who consumed black tea, coffee, fruit juice, or soda. Alcohol consumption increases SU levels. The finding that daily drinking of green tea is associated with hyperuricemia needs validation in future studies. Copyright © 2013 by the American College of Rheumatology.

Association analysis between genetic variants in interleukin genes among different populations with hyperuricemia in Xinjiang Autonomous Region

PubMed Central

Zhang, Bei; Sun, Yuping; Li, Yuanyuan; Yu, Jiahui; Wang, Tingting; Xia, He; Li, Changgui; Liu, Shiguo; Yao, Hua

2015-01-01

To investigate whether functional variants of five interleukin genes (IL-1β, IL-10, IL-8, IL-18 and IL-18RAP) are associated with susceptibility to hyperuricemia among different nationalities (including Uygur, Kazak and Han populations) in the Xinjiang Autonomous Region of China. A total of 884 hyperuricemia patients and 1316 matched controls were recruited from the First Affiliated Hospital of Xinjiang Medical University in Urumqi. After genotyping of rs4073 in IL-8, rs16944 in IL-1, rs187238 in IL-18, rs1800871 in IL-10 and rs13015714 in IL-18RAP by TaqMan allele discrimination assays, an association analysis was performed using the χ2 test as well as a genotype-phenotype analysis. For the Uygur population, IL-8 rs4073, IL-18 rs187238 and IL-18RAP rs130154 polymorphisms were all associated with hyperuricemia (P<0.001 by genotype and P=0.008, OR 0.802 by allele for IL-8; P=0.01 by genotype and P=0.006, OR 1.332 by allele for IL-18 rs187238; P=0.007 by genotype and P=0.005, OR 1.27 by allele for IL-18RAP rs130154). For the Kazak population, only IL-18 rs187238 showed statistical significance with hyperuricemia (P=0.002 by genotype and P=0.007, OR 1.823 by allele). However, no differences were found between the five SNPs and hyperuricemia among the Han population. This study demonstrated genetic polymorphisms of different interleukin genes related to hyperuricemia vary in different nationalities in the Xinjiang Autonomous Region because of different geographical environments. IL-8, IL-1RL1 and IL-18 might be involved in the development of hyperuricemia in the Uygur population, whereas only IL-18 might be involved in the Kazak population. PMID:26722554

Cochlear dysfunction in hyperuricemia: otoacoustic emission analysis.

PubMed

Hamed, Sherifa A; El-Attar, Amal M

2010-01-01

The objective of this study is to provide evidence that primary hyperuricemia is associated with cochlear dysfunction as other metabolic diseases that interfere with cell metabolism. Cochlear function was evaluated in 25 subjects with asymptomatic hyperuricemia using routine diagnostic audiometry along with transient evoked and distortion product otoacoustic emissions (TEOAE and DPOAE, respectively). To support the notion that vascular compromise was a significant underlying factor for such cochlear dysfunction, we assessed vascular anatomical and functional states through measuring the common carotid artery intima-media thickness and flow velocity of the basal intracranial vessels. Compared with control subjects, reduced response levels of TEOAEs (P < .01) and amplitudes of DPOAEs (P < .001) were detected at higher frequencies. The reduced DPOAE levels at 5 kHz and TEOAEs at 4 kHz correlated significantly with uric acid (P < .05; P < .01), patients' age (P < .06; P < .05), duration since diagnosis of hyperuricemia (P < .05; P < .001), common carotid artery intima-media thickness (P < .05), mean flow velocities of middle cerebral arteries (P < .05), and vertebral arteries (P < .01). Multivariate analysis showed that the abnormalities at higher frequencies were significantly correlated with the duration and degree of hyperuricemia. These data suggest that subclinical changes in cochlear function are associated with hyperuricemia. They support the usefulness of otoacoustic emissions in early detection of cochlear dysfunction. It is possible that hyperuricemia could be accompanied by increased stiffness and/or compromise of blood supply of the outer hair cells, which will impair their electromotile response. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Febuxostat improves endothelial function in hemodialysis patients with hyperuricemia: A randomized controlled study.

PubMed

Tsuruta, Yuki; Kikuchi, Kan; Tsuruta, Yukio; Sasaki, Yuko; Moriyama, Takahito; Itabashi, Mitsuyo; Takei, Takashi; Uchida, Keiko; Akiba, Takashi; Tsuchiya, Ken; Nitta, Kosaku

2015-10-01

Endothelial dysfunction is often found in both hyperuricemia and hemodialysis patients. Recent studies have shown that treating hyperuricemia with allopurinol improves endothelial dysfunction. This study is performed to assess the effect of febuxostat on endothelial dysfunction in hemodialysis patients with hyperuricemia. We randomly assigned 53 hemodialysis patients with hyperuricemia to a febuxostat (10 mg daily) group and a control group and measured flow-mediated dilation, serum uric acid (UA) levels, systolic and diastolic blood pressure, malondialdehyde-modified low-density lipoprotein (MDA-LDL), and highly sensitive C-reactive protein (hsCRP) at baseline and at the end of a 4-week study period. Flow-mediated dilation increased from 5.3% ± 2.4% to 8.9% ± 3.6% in the febuxostat group but did not change significantly in the control group. Treatment with febuxostat resulted in a significant decrease in serum UA level and a significant decrease in MDA-LDL compared with baseline, but no significant difference was observed in hsCRP level or blood pressure. No significant differences were observed in the control group. Febuxostat improved endothelial dysfunction and reduced serum UA levels and oxidative stress in hemodialysis patients with hyperuricemia. © 2015 International Society for Hemodialysis.

[The relationship between smoking and hyperuricemia in Chinese residents].

PubMed

Chen, H G; Sheng, L T; Wan, Z Z; Wang, X C; Lin, Y H; Wang, Y X; Pan, X F; Pan, A

2018-05-06

Objective: To explore the relationship between smoking and hyperuricemia in Chinese residents. Methods: Based on data from the China Health and Nutrition Survey (CHNS), residents with blood samples provided in the 2009 round (including information of socio-demographic factors, lifestyle behaviors, medical history, and laboratory examinations etc.) were selected as the participants in the current analysis. Unconditional logistic regression models were utilized to compute the ORs and corresponding 95% CIs for assessing the relationship between smoking and hyperuricemia. Results: Among the 8 785 subjects, 1 435 had hyperuricemia with a prevalence rate of 16.3%, consisting of 886 men and 549 women with prevalence rates of 21.6% (886/4 110) and 11.7% (549/4 675) , respectively. Compared with never smokers, the adjusted OR (95% CI ) for hyperuricemia was 0.83 (0.70-0.98) among current smokers, 0.77 (0.63-0.94) among current smokers with 20-39 years of smoking, and 0.79 (0.65-0.97) among current smokers with 11-20 cigarettes per day. When stratified by gender and compared with non-smoker, the adjusted OR (95% CI ) for hyperuricemia among current smokers compared with never smokers was 0.83 (0.70-0.98) among men, while no significant association was found in female current smokers ( OR= 0.73, 95% CI: 0.42-1.26, P= 0.260). Conclusion: In Chinese residents, there is an inverse association between smoking and hyperuricemia prevalence, and this association may be related to duration and intensity of smoking among current smokers. The findings need to be validated in large prospective cohort studies.

A causal role for uric acid in fructose-induced metabolic syndrome.

PubMed

Nakagawa, Takahiko; Hu, Hanbo; Zharikov, Sergey; Tuttle, Katherine R; Short, Robert A; Glushakova, Olena; Ouyang, Xiaosen; Feig, Daniel I; Block, Edward R; Herrera-Acosta, Jaime; Patel, Jawaharlal M; Johnson, Richard J

2006-03-01

The worldwide epidemic of metabolic syndrome correlates with an elevation in serum uric acid as well as a marked increase in total fructose intake (in the form of table sugar and high-fructose corn syrup). Fructose raises uric acid, and the latter inhibits nitric oxide bioavailability. Because insulin requires nitric oxide to stimulate glucose uptake, we hypothesized that fructose-induced hyperuricemia may have a pathogenic role in metabolic syndrome. Four sets of experiments were performed. First, pair-feeding studies showed that fructose, and not dextrose, induced features (hyperinsulinemia, hypertriglyceridemia, and hyperuricemia) of metabolic syndrome. Second, in rats receiving a high-fructose diet, the lowering of uric acid with either allopurinol (a xanthine oxidase inhibitor) or benzbromarone (a uricosuric agent) was able to prevent or reverse features of metabolic syndrome. In particular, the administration of allopurinol prophylactically prevented fructose-induced hyperinsulinemia (272.3 vs.160.8 pmol/l, P < 0.05), systolic hypertension (142 vs. 133 mmHg, P < 0.05), hypertriglyceridemia (233.7 vs. 65.4 mg/dl, P < 0.01), and weight gain (455 vs. 425 g, P < 0.05) at 8 wk. Neither allopurinol nor benzbromarone affected dietary intake of control diet in rats. Finally, uric acid dose dependently inhibited endothelial function as manifested by a reduced vasodilatory response of aortic artery rings to acetylcholine. These data provide the first evidence that uric acid may be a cause of metabolic syndrome, possibly due to its ability to inhibit endothelial function. Fructose may have a major role in the epidemic of metabolic syndrome and obesity due to its ability to raise uric acid.

Sweetened beverages intake, hyperuricemia and metabolic syndrome: the Mexico City Diabetes Study.

PubMed

López-Molina, Rubén; Parra-Cabrera, Socorro; López-Ridaura, Ruy; González-Villalpando, María E; Ferrannini, Ele; González-Villalpando, Clicerio

2013-12-01

OBJECTIVE. To determine prevalence of hyperuricemia and its relation with intake of sweetened beverages (SB) and metabolic syndrome (MS) in low income urban Mexican population. MATERIALS AND METHODS. A cross-sectional analysis of The Mexico City Diabetes Study, a prospective population-based investigation (1 173 participants) was performed. We used logistic regression, adjusted by pertinent variables. We determined prevalence of hyperuricemia and explored associations of uric acid levels with MS and intake of SB. RESULTS. Prevalence of hyperuricemia was 26.5 and 19.8% in males and females respectively. In an adjusted multivariate model, body mass index, waist circumference, and triglyceride were higher as uric acid quartiles increased (p<0.005-0.001). The odds ratio for MS was 1.48 for 3rd uric acid quartile and 2.03 for 4th quartile. Higher consumption of SB was associated with higher uric acid levels (p<0.001). CONCLUSION. Prevalence of hyperuricemia is high. Potential association with intake of SB, resulting in metabolic alterations should be considered.

Risk factors for incident hyperuricemia during mid-adulthood in African American and White men and women enrolled in the ARIC cohort study

PubMed Central

2013-01-01

Background Increased serum urate levels are associated with poor outcomes including but not limited to gout. It is unclear whether serum urate levels are the sole predictor of incident hyperuricemia or whether demographic and clinical risk factors also predict the development of hyperuricemia. The goal of this study was to identify risk factors for incident hyperuricemia over 9 years in a population-based study, ARIC. Methods ARIC recruited individuals from 4 US communities; 8,342 participants who had urate levels <7.0 mg/dL were included in this analysis. Risk factors (including baseline, 3-year, and change in urate level over 3 years) for 9-year incident hyperuricemia (urate level of >7.0 g/dL) were identified using an AIC-based selection approach in a modified Poisson regression model. Results The 9-year cumulative incidence of hyperuricemia was 4%; men = 5%; women = 3%; African Americans = 6% and whites = 3%. The adjusted model included 9 predictors for incident hyperuricemia over 9 years: male sex (RR = 1.73 95% CI: 1.36-2.21), African-American race (RR = 1.79 95% CI: 1.37-2.33), smoking (RR = 1.27, 95% CI: 0.97-1.67),

Rationale and design of a multicenter randomized study for evaluating vascular function under uric acid control using the xanthine oxidase inhibitor, febuxostat: the PRIZE study.

PubMed

Oyama, Jun-Ichi; Tanaka, Atsushi; Sato, Yasunori; Tomiyama, Hirofumi; Sata, Masataka; Ishizu, Tomoko; Taguchi, Isao; Kuroyanagi, Takanori; Teragawa, Hiroki; Ishizaka, Nobukazu; Kanzaki, Yumiko; Ohishi, Mitsuru; Eguchi, Kazuo; Higashi, Yukihito; Yamada, Hirotsugu; Maemura, Koji; Ako, Junya; Bando, Yasuko K; Ueda, Shinichiro; Inoue, Teruo; Murohara, Toyoaki; Node, Koichi

2016-06-18

Xanthine oxidase inhibitors are anti-hyperuricemic drugs that decrease serum uric acid levels by inhibiting its synthesis. Xanthine oxidase is also recognized as a pivotal enzyme in the production of oxidative stress. Excess oxidative stress induces endothelial dysfunction and inflammatory reactions in vascular systems, leading to atherosclerosis. Many experimental studies have suggested that xanthine oxidase inhibitors have anti-atherosclerotic effects by decreasing in vitro and in vivo oxidative stress. However, there is only limited evidence on the clinical implications of xanthine oxidase inhibitors on atherosclerotic cardiovascular disease in patients with hyperuricemia. We designed the PRIZE study to evaluate the effects of febuxostat on a surrogate marker of cardiovascular disease risk, ultrasonography-based intima-media thickness of the carotid artery in patients with hyperuricemia. The study is a multicenter, prospective, randomized, open-label and blinded-endpoint evaluation (PROBE) design. A total of 500 patients with asymptomatic hyperuricemia (uric acid >7.0 mg/dL) and carotid intima-media thickness ≥1.1 mm will be randomized centrally to receive either febuxostat (10-60 mg/day) or non-pharmacological treatment. Randomization is carried out using the dynamic allocation method stratified according to age (<65, ≥65 year), gender, presence or absence of diabetes mellitus, serum uric acid (<8.0, ≥8.0 mg/dL), and carotid intima-media thickness (<1.3, ≥1.3 mm). In addition to administering the study drug, we will also direct lifestyle modification in all participants, including advice on control of body weight, sleep, exercise and healthy diet. Carotid intima-media thickness will be evaluated using ultrasonography performed by skilled technicians at a central laboratory. Follow-up will be continued for 24 months. The primary endpoint is percentage change in mean intima-media thickness of the common carotid artery 24 months after baseline, measured by carotid ultrasound imaging. PRIZE will be the first study to provide important data on the effects of febuxostat on atherosclerosis in patients with asymptomatic hyperuricemia. Trial Registration Unique trial Number, UMIN000012911 ( https://upload.umin.ac.jp/cgi-open-bin/ctr/ctr.cgi?function=brows&action=brows&type=summary&recptno=R000015081&language=E ).

Uric Acid, Hyperuricemia and Vascular Diseases

PubMed Central

Jin, Ming; Yang, Fan; Yang, Irene; Yin, Ying; Luo, Jin Jun; Wang, Hong; Yang, Xiao-Feng

2011-01-01

Uric acid is the product of purine metabolism. It is known that hyperuricemia, defined as high levels of blood uric acid, is the major etiological factor of gout. A number of epidemiological reports have increasingly linked hyperuricemia with cardiovascular and neurological diseases. Studies highlighting the pathogenic mechanisms of uric acid point to an inflammatory response as the primary mechanism for inducing gout and possibly contributing to uric acid's vascular effects. Monosodium urate (MSU) crystals induce an inflammatory reaction, which are recognized by Toll-like receptors (TLRs). These TLRs then activate NALP3 inflammasome. MSU also triggers neutrophil activation and further produces immune mediators, which lead to a proinflammatory response. In addition, soluble uric acid can also mediate the generation of free radicals and function as a pro-oxidant. This review summarizes the epidemiological studies of hyperuricemia and cardiovascular disease, takes a brief look at hyperuricemia and its role in neurological diseases, and highlights the studies of the advanced pathological mechanisms of uric acid and inflammation. PMID:22201767

Association Between Hyperuricemia and Major Adverse Cardiac Events in Patients with Acute Myocardial Infarction.

PubMed

Ranjith, Naresh; Myeni, Nomcebo N; Sartorius, Ben; Mayise, Chamsanqua

2017-02-01

To investigate the association between hyperuricemia and major adverse cardiac events (MACE) in patients with acute myocardial infarction (AMI). Consecutive patients admitted with AMI to the Coronary Care Unit at R. K. Khan Hospital (Durban, South Africa) between the years 2006 and 2014 were included. Demographic data, including clinical and biochemical information stored in an electronic database, were obtained from all patients. A total of 2683 patients were studied, of whom 65% were males. The mean age of the participants was 57.1 ± 11.5 years, with 79% presenting with ST elevation myocardial infarction. Sixty-one percent were smokers, 59% had diabetes mellitus, 52% had hypertension, and 58% presented with a family history of premature coronary artery disease. Twenty-six percent (n = 690) had hyperuricemia, were older (59 ± 12.1 vs. 56.5 ± 11.2 years) and more likely to present with hypertension (P < 0.001), lower ejection fraction (P < 0.001), and higher median creatinine levels (P < 0.001). A significantly greater proportion of patients with hyperuricemia experienced MACE (45% vs. 30%, P < 0.001). In both sexes, considerable heterogeneity for risk factors and clinical events was noted in individuals with hyperuricemia. Multivariable analyses for risk factors associated with mortality suggest that hyperuricemia conferred a significantly increased risk of mortality after adjustment [odds ratio (OR) 1.7 (95% confidence interval 1.0-2.8); P = 0.042]. A significant increasing risk trend for MACE was observed for increasing tertiles of serum uric acid concentrations above normal (P < 0.001), particularly for cardiac failure (P < 0.001) and death (P = 0.006). Hyperuricemia is significantly associated with hypertension, renal dysfunction, MACE, and independently confers a higher risk of mortality in patients with AMI. Significant heterogeneity was found by gender for risk factors and clinical events in individuals with hyperuricemia. A graded increase was demonstrated in the risk of MACE, particularly for cardiac failure and death, by increasing tertiles of hyperuricemia.

Hyperuricemia is associated with low cardiorespiratory fitness levels and excess weight in schoolchildren.

PubMed

Reis, Luiza N; Renner, Jane D P; Reuter, Cézane P; Horta, Jorge A; Paiva, Dulciane N; Valim, Andréia R de M; Sehn, Ana P; de Mello, Elza D; Burgos, Miria S

To evaluate the possible association between hyperuricemia and cardiorespiratory fitness levels/nutritional profile, grouped into a single variable, in schoolchildren. Cross-sectional study of 2335 students from Elementary schools, aged 7-17 years of both genders, stratified by conglomerates of a municipality in Southern Brazil. Body mass index (BMI) was calculated and cardiorespiratory fitness (CRF) was assessed by the 6-minute run/walk test. The BMI and CRF were grouped into a single variable, considering: (1) low and normal weight/fit; (2) low and normal weight/unfit; (3) overweight-obesity/fit; (4) overweight-obesity/unfit. The Poisson regression (prevalence ratio, PR) was used for the association between hyperuricemia and BMI/CRF ratio with 95% confidence intervals and differences were considered significant when p<0.05. There is an association, although subtle, between the presence of hyperuricemia with low levels of CRF and the presence of excess weight, when grouped into a single variable. Boys and girls with this condition have higher prevalence of hyperuricemia (PR: 1.07; p=0.007 for boys; PR: 1.10; p<0.001 for girls). Together, excess weight and low levels of cardiorespiratory fitness are associated with the presence of hyperuricemia in schoolchildren. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Subclinical carotid atherosclerosis and hyperuricemia in relation to renal impairment in a rural Japanese population: the Nagasaki Islands study.

PubMed

Shimizu, Yuji; Sato, Shimpei; Koyamatsu, Jun; Yamanashi, Hirotomo; Tamai, Mami; Kadota, Koichiro; Arima, Kazuhiko; Yamasaki, Hironori; Takamura, Noboru; Aoyagi, Kiyoshi; Maeda, Takahiro

2014-04-01

The influence of hyperuricemia on atherosclerosis is controversial. Subclinical carotid atherosclerosis can be defined in two ways in terms of mean and maximum carotid intima-media thickness (CIMT): one with mean CIMT≥1.1 mm and the other with maximum CIMT≥1.1 mm. However, no studies have been reported of the association between hyperuricemia and subclinical carotid atherosclerosis while taking the two different ways of classification into account. We conducted a cross-sectional study of 4133 subjects (1492 men and 2641 women) aged 30-89 years undergoing general health check-ups. For analysis of various associations, we calculated the multivariable odds ratios (ORs) for the two ways classifications of subclinical carotid atherosclerosis in relation to hyperuricemia. Hyperuricemia-related renal impairment constitutes a significant marker for subclinical carotid atherosclerosis with mean CIMT≥1.1 mm for both men and women, while hyperuricemia per se was found to be beneficially associated with risk of subclinical carotid atherosclerosis with maximum CIMT≥1.1 mm for men. The classical cardiovascular risk factors without adjustment for glomerular filtration rate (GFR) of ORs for subclinical carotid atherosclerosis (mean CIMT≥1.1 mm) and subclinical carotid atherosclerosis (maximum CIMT≥1.1 mm) were 2.20(1.10-4.22) and 0.84(0.63-1.13) for men and 2.12(1.02-4.38) and 0.92(0.66-1.27) for women. After further adjustment for GFR, the corresponding values were 1.54(0.74-3.20) and 0.67(0.49-0.92) for men and 1.32(0.61-2.88) and 0.80(0.57-1.12) for women. Hyperuricemia-related renal impairment is a significant marker for subclinical carotid atherosclerosis for both men and women, while hyperuricemia per se may be inversely associated with subclinical carotid atherosclerosis for men as seen in a rural community-dwelling Japanese population. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[Relationship between hyperuricemia and prognosis in patients with heart failure of coronary heart disease after revascularization].

PubMed

Peng, D; Wang, S P; Zhao, D H; Fan, Q C; Shu, J; Liu, J H

2018-05-08

Objective: To explore the effect of hyperuricemia on prognosis in patients with heart failure of coronary heart disease (CHD) after revascularization. Methods: A single-center retrospective study of all subjects who underwent percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG) as revascularization for CHD at Beijing Anzhen Hospital, Capital Medical University, between January 2005 and December 2014 was performed.Patients were divided into two groups by with or without hyperuricemia.The average follow-up was 1 818 d. Results: The Logistic regression analysis revealed that hyperuricemia was independent risk factors of readmission of heart failure( P =0.018, OR =1.499, 95% CI 1.071-2.098). The Cox regression analysis revealed that hyperuricemia was independent risk factor of all-cause mortality( P =0.002, RR =1.520, 95% CI 1.166-1.982), cardiovascular ( CV ) mortality( P =0.001, RR =1.811, 95% CI 1.279-2.566), heart failure mortality( P =0.006, RR =2.151, 95% CI 1.247-3.711). Conclusions: There is negative correlation between level of uric acid and left ventricular ejection fraction (LVEF). The patients with heart failure of coronary heart disease complicated with hyperuricemia have high risk of readmission of heart failure, all-cause mortality, CV mortality andheart failure mortality than patients with normal uric acid level. Hyperuricemia is an independent risk factor for patients with heart failure of coronary heart disease after revascularization.

Treating gout in kidney transplant recipients.

PubMed

Baroletti, Steven; Bencivenga, Gina Ann; Gabardi, Steven

2004-06-01

To review the etiology, treatment, and preventive strategies of hyperuricemia and gout in kidney transplant recipients. Primary literature was obtained via Medline (1966-June 2003). Studies evaluating treatment and prevention of hyperuricemia and gout in kidney transplantation were considered for evaluation. English-language studies were selected for inclusion. Approximately 14,000 kidney transplantations were performed in the United States in 2003, and of those transplant recipients, nearly 13% will experience a new onset of gout. The prevalence of hyperuricemia is even greater. There are several mechanisms by which hyperuricemia and gout develop in kidney transplant recipients. Medication-induced hyperuricemia and renal dysfunction are 2 of the more common mechanisms. Prophylactic and treatment options include allopurinol, colchicine, corticosteroids, and, if absolutely necessary, nonsteroidal antiinflammatory drugs. It is generally recommended to decide whether the risks of prophylactic therapy and treatment outweigh the benefits. Often, the risk of adverse events associated with agents to treat these ailments tends to outweigh the benefits; therefore, treatment is usually reserved for symptomatic episodes of acute gout. Practitioners must also decide if changes in immunosuppressive regimens may be of benefit on a patient-by-patient basis.

Japanese guideline for the management of hyperuricemia and gout: second edition.

PubMed

Yamanaka, Hisashi

2011-12-01

Gout is a urate deposition disease caused by persistent hyperuricemia. Because gout patients present with a variety of clinical symptoms, it is necessary to have a guideline for the standard management and care of gout and hyperuricemia. The Japanese Society of Gout and Nucleic Acid Metabolism, a scientific society committed to study nucleic acid metabolism and related diseases, established the first edition of the "Guideline for the Management of Hyperuricemia and Gout" in 2002, and published the revised version in January 2010. This second edition is not only evidence based on a search of systemic literature, but also includes consensus levels by a Delphi exercise to determine the strength of the recommendations. A draft version of this guideline was reviewed by internal and external reviewers as well as a patient. In this guideline, key messages from each chapter are listed as statements together with the evidence level, consensus level, and strength of the recommendation. In this proceeding, several selected chapters on the clinical management of gout and hyperuricemia are described. We hope this guideline is appropriately used for the standard management and care of patients with hyperuricemia and gout in daily practice.

Recent advances on uric acid transporters

PubMed Central

Xu, Liuqing; Shi, Yingfeng; Zhuang, Shougang; Liu, Na

2017-01-01

Uric acid is the product of purine metabolism and its increased levels result in hyperuricemia. A number of epidemiological reports link hyperuricemia with multiple disorders, such as kidney diseases, cardiovascular diseases and diabetes. Recent studies also showed that expression and functional changes of urate transporters are associated with hyperuricemia. Uric acid transporters are divided into two categories: urate reabsorption transporters, including urate anion transporter 1 (URAT1), organic anion transporter 4 (OAT4) and glucose transporter 9 (GLUT9), and urate excretion transporetrs, including OAT1, OAT3, urate transporter (UAT), multidrug resistance protein 4 (MRP4/ABCC4), ABCG-2 and sodium-dependent phosphate transport protein. In the kidney, uric acid transporters decrease the reabsorption of urate and increase its secretion. These transporters’ dysfunction would lead to hyperuricemia. As the function of urate transporters is important to control the level of serum uric acid, studies on the functional role of uric acid transporter may provide a new strategy to treat hyperuricemia associated diseases, such as gout, chronic kidney disease, hyperlipidemia, hypertension, coronary heart disease, diabetes and other disorders. This review article summarizes the physiology of urate reabsorption and excretion transporters and highlights the recent advances on their roles in hyperuricemia and various diseases. PMID:29246027

Urate-Lowering Agents in Asymptomatic Hyperuricemia: Role of Urine Sediment Analysis and Musculoskeletal Ultrasound.

PubMed

Viggiano, Davide; Gigliotti, Giuseppe; Vallone, Gianfranco; Giammarino, Anna; Nigro, Michelangelo; Capasso, Giovambattista

2018-01-01

Current urate-lowering therapy (ULT) includes three direct acting drugs (allopurinol, febuxostat, Rasburicase) and at least four 'indirect' drugs with other important targets (canagliflozin, losartan, fenofibrate and sevelamer). Moreover, the alcalinization of urines using bicarbonate can be used to dissolve urate crystals and the clinician may discontinue several drugs are known to increase serum levels of uric acid, such as diuretics, aspirin, cyclosporine, theophylline, mycophenolate and ACE inhibitors. While there is a consensus to start ULT in cases of symptomatic hyperuricemia (gout, urate-nephrolithiasis), the very frequent conditions of asymptomatic hyperuricemia remains a major conundrum. The effect of asymptomatic hyperuricemia on kidney function has had fluctuating positions over decades. The conflicting results might indicate: (i) the presence of counterbalancing positive and negative effects on kidney function of both serum uric acid and urate-lowering agents, (ii) the presence of a subpopulation of patients, as yet unidentified, which could truly benefit from a urate-lowering therapy. Therefore, today the treatment of asymptomatic hyperuricemia is not recommended nor excluded by current guidelines. Here we suggest that a possible guide for the treatment of asymptomatic hyperuricemia might be the presence of urate crystals in the urine sediment and/or signs of asymptomatic articular damage by urates, identified by musculo-skeletal ultrasound. Moreover, a watchful analysis of the trend in creatinine/eGFR, proteinuria or urate levels might also guide the clinician. Initiation of ULT and follow-up in cases of asymptomatic hyperuricemia should consider urine sediment analysis, musculoskeletal ultrasound and trends in creatinine, proteinuria and serum urate levels. © 2018 The Author(s). Published by S. Karger AG, Basel.

Hyperuricemia and metabolic syndrome in type 2 diabetes mellitus patients at Hawassa university comprehensive specialized hospital, South West Ethiopia.

PubMed

Woyesa, Shiferaw Bekele; Hirigo, Agete Tadewose; Wube, Temesgen Bizuayehu

2017-12-12

Metabolic syndrome is a cluster of the most dangerous heart attack risk factors such as diabetes and prediabetes, abdominal obesity, high cholesterol and high blood pressure. Hyperuricemia is a condition in which the serum uric acid concentration is greater than 5.5 mg per deciliter for child and greater than 7.2 and 6.0 mg per deciliters for male and female adults respectively. A cross-sectional study was conducted to determine the magnitude of hyperuricemia and associated factors among type 2 diabetes mellitus patients at Hawassa Comprehensive Specialized Hospital (HCSH) from February 28 to May 30 /2017. A random sampling technique was used to include 319 study subjects and a signed consent had been provided by each study subject before running any data collection. An interviewer administered structured questionnaire was used to collect socio-demographic and some clinically useful data. In addition to this, we reviewed the records of the study subjects to obtain other useful clinical data. Five milliliter blood specimen was collected from each study subjects after overnight fasting. A25TM Bio-System Random Access chemistry analyzer was used for blood sample analysis. All data were checked visually, coded and entered into epi-data version 3.4 and statistical analysis was performed using SPSS version 20.0 software. Bi-variate and multivariate logistic regressions were used to determine the association between explanatory and the outcome variables. The prevalence of hyperuricemia and metabolic syndrome among type 2 diabetic patients in the study area were 33.8%(n = 106) and 70.1% (n = 220) respectively. Having age greater or equal to 45 years (AOR: 1.9, CI: 1.-3.2, P value =0.015) and having metabolic syndrome (AOR: 2.6, CI: 1.5-4.7, P value = 0.001) were the determinant variables for hyperuricemia among type 2 diabetic patients. There was high prevalence of hyperuricemia among type 2 diabetic patients with high prevalence of metabolic syndrome. Therefore, regular health information about life style modification, early diagnosis and treatment for hyperuricemia and metabolic syndrome are essential to reduce hyperuricemia and metabolic syndrome in type 2 diabetic patients.

Value of three-dimensional speckle tracking echocardiography to assess left ventricular function in hyperuricemia patients.

PubMed

Zhang, Xiaojie; Lu, Qing; Zhang, Zhuojun; Chen, Yongle; Wang, Yanan; Wang, Youngshi; Li, Zheng; Jiang, Lindi

2018-05-22

To assess the value of three-dimensional speckle tracking echocardiography (3D STE) in evaluating the left ventricular (LV) function in hyperuricemia patients. We enrolled 15 healthy controls and 40 hyperuricemia patients and collected and analyzed full-volume 3D STE images of the left ventricle in the apical four-chamber heart view. Laboratory tests and 3D STE parameters, including left ventricular ejection fraction, left ventricular end-diastolic volume, left ventricular end-systolic volume, stroke volume (SV), global longitudinal strain (GLS), and global circumferential strain (GCS), were compared between hyperuricemia patients and healthy controls. Hyperuricemia patients exhibited higher body mass index (24.70 ± 2.9 vs. 21.83 ± 2.4 kg/m 2 , p = 0.001), C-reactive protein (5.82 ± 9.4 vs. 1.12 ± 1.8 g/L, p = 0.012), alanine transaminase (34.26 ± 26.6 vs. 17.60 ± 13.0 U/L, p = 0.011), aspartate transaminase (24.90 ± 11.3 vs. 17.70 ± 4.1 U/L, p = 0.001), blood urea nitrogen (5.11 ± 1.6 vs. 4.18 ± 0.6 mmol/L, p = 0.046), and serum creatinine (90.25 ± 14.6 vs. 77.93 ± 10.8 μmol/L, p = 0.006) levels, as well as a lower estimated glomerular filtration rate (87.87 ± 16.5 vs. 103.64 ± 11.3 mL/min/1.73m 2 , p = 0.002). The 3D STE parameters reflecting LV function, including SV (54.71 ± 9.6 vs. 61.92 ± 14.4 mL, p = 0.024), GLS (- 20.51 ± 4.0 vs. - 23.20 ± 4.0%, p = 0.019), and GCS (- 31.30 ± 5.0 vs. - 35.65 ± 2.5%, p = 0.000), were significantly decreased in hyperuricemia patients. Furthermore, GCS was significantly correlated with the serum uric acid (sUA) level even after adjustment of confounding variables like age, body mass index, and serum creatinine. 3D STE is a novel technique for recognizing the early decline in LV function, with GLS and GCS serving as reliable indicators, in hyperuricemia patients. Moreover, the degree of decline in LV function may be correlated with the sUA level in hyperuricemia patients.

G-protein beta3 subunit gene variant is unlikely to have a significant influence on serum uric acid level in Japanese workers.

PubMed

Suwazono, Yasushi; Kobayashi, Etsuko; Uetani, Mirei; Miura, Katsuyuki; Morikawa, Yuko; Ishizaki, Masao; Kido, Teruhiko; Nakagawa, Hideaki; Nogawa, Koji

2006-06-01

The C825T variant of the G-protein beta3 subunit (GNB3) gene has attracted renewed attention as a candidate gene for obesity, hypertension and hyperuricemia. The main role of G-protein is to translate signals from the cell surface into a cellular response. The 825T allele is associated with a splice variant of GNB3 protein and enhanced G-protein activation. We examined the relationship between this variant and the risk of hyperuricemia in Japanese workers. The study subjects were 1,452 men and 1,169 women selected from 3,834 men and 2,591 women in 1997. On the basis of common clinical criteria, hyperuricemia I was defined as serum uric acid >or= 7.0 mg/dl in men and 6.0 mg/dl in women or taking antihyperuricemic medication. The hyperuricemia I group consisted of 186 men and 20 women and its control of 1,266 men and 1,149 women. Hyperuricemia II was defined as serum uric acid > 5.7 mg/dl (median) in men and 3.9 mg/dl (median) in women or taking antihyperuricemic medication. The hyperuricemic II group consisted of 684 men and 570 women and its control of 768 men and 599 women. To replicate previous significant results in young Caucasian men, we selected these criteria because the authors of the study in young Caucasian men adopted the median in their subjects as a cut-off. The statistical power was estimated as 99% based on the significant results in Caucasians. Genotype and allele distributions in men and women with hyperuricemia I and II were not significantly different from those in the corresponding control groups. Logistic regression analysis on hyperuricemia I and II, and multiple regression on serum uric acid level demonstrated no significant effect of the C825T genotype. Despite the sufficient statistical power, this study could not demonstrate the significant influence of C825T on hyperuricemia or serum uric acid. The targeting of this polymorphism is unlikely to be beneficial in the prevention of hyperuricemia in the general Japanese population.

Effect and mechanism of dioscin from Dioscorea spongiosa on uric acid excretion in animal model of hyperuricemia.

PubMed

Zhang, Yi; Jin, Lijun; Liu, Jinchang; Wang, Wei; Yu, Haiyang; Li, Jian; Chen, Qian; Wang, Tao

2018-03-25

Dioscin, a spirostane glycoside, the rhizoma of Dioscorea septemloba (Diocoreacea) is used for diuresis, rheumatism, and joints pain. Given the poor solubility and stability of Dioscin, we proposed a hypothesis that Dioscin's metabolite(s) are the active substance(s) in vivo to contribute to the reducing effects on serum uric acid levels. The aim of this study is to identify the active metabolite(s) of Dioscin in vivo and to explore the mechanism of its antihyperuricemic activity. After oral administration of Dioscin in potassium oxonate (PO) induced hyperuricemia rats and adenine-PO induced hyperuricemia mice models, serum uric acid and creatinine levels, clearance of uric acid and creatinine, fractional excretion of uric acid, and renal pathological lesions were determined were used to evaluate the antihyperuricemic effects. Renal glucose transporter-9 (GLUT-9) and organic anion transporter-1 (OAT-1) expressions were analyzed by western blotting method. Renal uric acid excretion was evaluated using stably urate transporter-1 (URAT-1) transfected human epithelial kidney cell line. Intestinal uric acid excretion was evaluated by measuring the transcellular transport of uric acid in HCT116 cells. In hyperuricemia rats, both 25 and 50mg/kg of oral Dioscin decreased serum uric acid levels over 4h. In the hyperuricemia mice, two weeks treatment of Dioscin significantly decreased serum uric acid and creatinine levels, increased clearance of uric acid and creatinine, increased fractional excretion of uric acid, and reduced renal pathological lesions caused by hyperuricemia. In addition, renal GLUT -9 was significantly down-regulated and OAT-1 was up-regulated in Dioscin treated hyperuricemia mice. Dioscin's metabolite Tigogenin significantly inhibited uric acid re-absorption via URAT1 from 10 to 100μM. Diosgenin and Tigogenin increased uric acid excretion via ATP binding cassette subfamily G member 2 (ABCG2). Decreasing effect of Dioscin on serum uric acid level and enhancing effect on urate excretion were confirmed in hyperuricemia animal models. Tigogenin, a metabolite of Dioscin, was identified as an active substance with antihyperuricemic activity in vivo, through inhibition of URAT1 and promotion of ABCG2. Copyright © 2017 Elsevier B.V. All rights reserved.

Hyper-Uricemia and Gouty Access in the Adult Population of the Southeast of Gabon: Biochemical Aspects

PubMed Central

Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné

2018-01-01

Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age (p-value < 10−4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women (p-value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m2; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes (p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production. PMID:29518007

The association between hyperuricemia and betel nut chewing in Taiwanese men: a cross-sectional study.

PubMed

Tai, Tsai-Sung; Hsu, Chih-Cheng; Pai, Hsiang-Chu; Liu, Wen-Hsin; Hsu, Yueh-Han

2013-12-05

Studies have associated betel nut chewing with cancers, metabolic syndrome, cardiovascular disorders, chronic kidney disease, and proteinuria. This study investigated whether hyperuricemia is associated with betel nut chewing in men who participated in a health check-up program. From hospital records, we identified a total of 11,991 men who participated in the health check-up program from 2003 to 2009. They were divided into hyperuricemic group and non-hyperuricemic group. Laboratory tests, medical history, and status of cigarette smoking, alcohol consumption, and betel nut chewing were compared between the 2 groups. We calculated odds ratio (OR) and 95% confidence interval (CI) of hyperuricemia in association with betel nut consumption and other factors. Compared with the non-hyperuricemic group, the hyperuricemic group was slightly older (59.4 vs. 58.6 years) but less prevalent with betel nut use (11.8 vs. 13.6%, p = 0.003). Multivariable logistic regression analysis showed that hyperuricemia was negatively associated with betel nut chewing (OR 0.75, 95% CI 0.66-0.84), older age (OR 0.84, 95% CI 0.77-0.93), and diabetes mellitus (OR 0.57, 95% CI 0.50-0.64). On the other hand, hyperuricemia was positively associated with body mass index (OR 1.75, 95% CI 1.62-1.90), drinking (OR 1.36, 95% CI 1.25-1.49), hypertension (OR 1.41, 95% CI 1.30-1.52), mixed hyperlipidemia (OR 1.84, 95% CI 1.33-2.54), chronic kidney disease (OR 3.28, 95% CI 2.94-3.65), and proteinuria (OR 1.22, 95% CI 1.08-1.38). Smoking, hypercholesterolemia, and hypertriglyceridemia had no significant association with hyperuricemia. Our data suggest that betel nut chewing is negatively associated with hyperuricemia.

Autosomal Dominant Mutation in the Signal Peptide of Renin in a Kindred with Anemia, Hyperuricemia, and CKD

PubMed Central

Beck, Bodo B.; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A.; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T.F.

2012-01-01

Homozygous or compound heterozygous Renin (REN) mutations cause renal tubular dysgenesis (RTD), which is characterized by death in utero due to renal failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia and chronic renal failure. So far, only three different heterozygous REN mutations were reported. We performed mutation analysis of the REN gene in 39 kindreds with hyperuricemia and chronic kidney disease (CKD) previously tested negative for mutations in the UMOD and HNF1β genes. We identified one kindred with a novel c.28T>C (p.W10R) REN mutation in the signal sequence, concluding that REN mutations are rare events in CKD patients. Affected individuals over four generations were identified carrying the novel REN mutation and were characterized by significant anemia, hyperuricemia and CKD. Anemia was severe and disproportional to the degree of renal impairment. Moreover all heterozygous REN mutations are localized in the signal sequence. Therefore, screening of the REN gene for CKD patients with hyperuricemia and anemia may be focusing on exon 1 sequencing, which encodes the signal peptide. PMID:21903317

Physical Function, Hyperuricemia, and Gout in Older Adults.

PubMed

Burke, Bridget Teevan; Köttgen, Anna; Law, Andrew; Windham, Beverly Gwen; Segev, Dorry; Baer, Alan N; Coresh, Josef; McAdams-DeMarco, Mara A

2015-12-01

Gout prevalence is high in older adults and those affected are at risk of physical disability, yet it is unclear whether they have worse physical function. We studied gout, hyperuricemia, and physical function in 5,819 older adults (age ≥65 years) attending the 2011-2013 Atherosclerosis Risk in Communities Study visit, a prospective US population-based cohort. Differences in lower extremity function (Short Physical Performance Battery [SPPB] and 4-meter walking speed) and upper extremity function (grip strength) by gout status and by hyperuricemia prevalence were estimated in adjusted ordinal logistic regression (SPPB) and linear regression (walking speed and grip strength) models. Lower scores or times signify worse function. The prevalence of poor physical performance (first quartile) by gout and hyperuricemia was estimated using adjusted modified Poisson regression. Ten percent of participants reported a history of gout and 21% had hyperuricemia. There was no difference in grip strength by history of gout (P = 0.77). Participants with gout performed worse on the SPPB test; they had 0.77 times (95% confidence interval [95% CI] 0.65, 0.90, P = 0.001) the prevalence odds of a 1-unit increase in SPPB score and were 1.18 times (95% CI 1.07, 1.32, P = 0.002) more likely to have poor SPPB performance. Participants with a history of gout had slower walking speed (mean difference -0.03; 95% CI -0.05, -0.01, P < 0.001) and were 1.19 times (95% CI 1.06, 1.34, P = 0.003) more likely to have poor walking speed. Similarly, SPPB score and walking speed, but not grip strength, were worse in participants with hyperuricemia. Older adults with gout and hyperuricemia are more likely to have worse lower extremity, but not upper extremity, function. © 2015, American College of Rheumatology.

Serum Uric Acid, Kidney Function and Acute Ischemic Stroke Outcomes in Elderly Patients: A Single-Cohort, Perspective Study

PubMed Central

Falsetti, Lorenzo; Capeci, William; Tarquinio, Nicola; Viticchi, Giovanna; Silvestrini, Mauro; Catozzo, Vania; Fioranelli, Agnese; Buratti, Laura; Pellegrini, Francesco

2017-01-01

Chronic kidney disease and hyperuricemia have been associated to an increased risk and a worse prognosis in acute ischemic stroke. Several mechanisms, including platelet dysfunction, coagulation disorders, endothelial dysfunction, inflammation, and an increased risk of atrial fibrillation could be implicated. The role of serum uric acid in this setting is still object of debate. We enrolled all the consecutive patients admitted to our department for acute ischemic stroke. Cox regression analysis was used to evaluate the risk of in-hospital death considering serum uric acid levels and all the comorbidities. In the overall sample, hyperuricemia was independently associated to an increased risk of in-hospital mortality. This effect was stronger in patients with chronic kidney disease while, in the group of patients with normal renal function, the relationship between hyperuricemia and increased stroke mortality was not confirmed. Hyperuricemia could be associated to higher in-hospital mortality for ischemic stroke among elderly patients when affected by kidney disease. Survival does not seem to be affected by hyperuricemia in patients with normal kidney function. PMID:28461885

Efficacy and safety of febuxostat, a novel nonpurine selective inhibitor of xanthine oxidase for the treatment of hyperuricemia in kidney transplant recipients.

PubMed

Tojimbara, T; Nakajima, I; Yashima, J; Fuchinoue, S; Teraoka, S

2014-01-01

Febuxostat, a novel nonpurine selective inhibitor of xanthine oxidase, is a potential alternative to allopurinol for patients with hyperuricemia. In this study, we evaluated the efficacy and safety of febuxostat for the management of hyperuricemia in renal transplant recipients. Between June 2012 and January 2013, a total of 22 renal transplant recipients (56 ± 10 years old) with hyperuricemia were enrolled in this study. All patients underwent de novo kidney transplantation, except for 1 patient, who received a second kidney transplant. Ten patients receiving allopurinol and 3 patients receiving benzbromarone were converted to febuxostat at doses of 10-20 mg/d. In the remaining 9 patients, who did not have a history of other urate-lowering medications, febuxostat was initiated at a dose of 10 mg/d. Uric acid levels after initiation of febuxostat were significantly lower than before treatment (5.7 ± 0.7 mg/mL vs 8.0 ± 0.8 mg/mL; P < .001). At last follow-up visit, 16 of the 22 patients (73%) achieved uric acid levels of ≤ 6.0 mg/dL, despite the low dosage of febuxostat. All patients were maintained on febuxostat without serious adverse events, except for 1 patient, who discontinued febuxostat because of numbness in the arms. Low-dose febuxostat is a promising alternative to allopurinol or benzbromarone for the treatment of hyperuricemia in kidney transplant recipients. The long-term urate-lowering efficacy and safety of febuxostat with regard to renal function in kidney transplant recipients with hyperuricemia requires further investigation. Copyright © 2014 Elsevier Inc. All rights reserved.

[Hyperuricemia and gene mutations: a case report].

PubMed

Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco

2017-06-01

Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.

Association of Serum Uric Acid Levels in Psoriasis

PubMed Central

Li, Xin; Miao, Xiao; Wang, Hongshen; Wang, Yifei; Li, Fulun; Yang, Qiong; Cui, Rutao; Li, Bin

2016-01-01

Abstract High levels of serum uric acid (SUAC) are frequently detected in patients with psoriasis. However, the relationship between psoriasis and hyperuricemia remains unknown. Here we conducted a meta-analysis to identify the SUAC levels in subjects with psoriasis and to determine whether there is an associated risk between psoriasis and hyperuricemia. A comprehensive search of the literature from January 1980 to November 2014 across 7 databases (MEDLINE, Embase, Cochrane Central Register, and 4 Chinese databases) was conducted to determine whether there is an associated risk between psoriasis and hyperuricemia. Among the 170 identified reports, 14 observational studies were included in this meta-analysis. We found a significant higher SUAC level (MD 0.68, 95% CI 0.26–1.09; P = 0.002) in patients with psoriasis in Western Europe, but no significant differences were found between the East Asia and India subgroup (MD 1.22, 95% CI –0.13–2.56; P = 0.08) or the Middle East subgroup (MD 0.48, 95% CI –0.49–1.44; P = 0.33). Similar results were obtained from the meta-analysis of SUAC levels in subjects with severe psoriasis. Our meta-analysis showed that the correlation between psoriasis and hyperuricemia was either ethnicity- or region-dependent and that patients with psoriasis in Western Europe were more likely to have hyperuricemia. PMID:27175702

[Acute Hyperuricemia and Kidney Injury after Three Cycles of Dose-Dense Chemotherapy for Retroperitoneal Choriocarcinoma -- A Case Report].

PubMed

Sakai, Hitomi; Matsuda, Masanori; Kadokura, Genmu; Katsumata, Noriyuki

2016-02-01

A 32 year-old man was diagnosed with retroperitoneal choriocarcinoma with metastasis to the lungs and liver. One cycle of modified BEP regimen did not sufficiently decrease the hCG. Therefore, we chose the GETUG 13 protocol of dose dense chemotherapy. After 6 days of cisplatin administration(3 cycles), he was diagnosed with acute hyperuricemia and kidney injury. He was treated with intravenous hydration and rasburicase. The hyperuricemia improved after a few days.

The prevalence and predictors of metabolically healthy obesity in obese rural population of China: a cross-sectional study.

PubMed

Zhang, Naijin; Chen, Yintao; Guo, Xiaofan; Sun, Guozhe; Sun, Yingxian

2017-03-01

Till now, no evidence illustrates the prevalence and predictors of metabolically healthy obesity (MHO) in rural areas of China. The objective of this study was, firstly, to examine the prevalence of MHO in rural areas of China, and identify contributing determinants of MHO, Secondly, to comprehensively investigate to the different characteristics between MHO and metabolically unhealthy obesity (MUO). We conducted a population-based cross-sectional study of 2037 participants with obesity in rural Liaoning Province during 2012-2013. Obesity was defined as BMI ≥28 kg/m 2 and metabolically healthy was defined as not having the metabolic syndrome. The prevalence of MHO was 23.1%, and significantly decreased with advancing age in female group. However there was no significant tendency with advancing age in male group. Independent determinant factors for MHO were age <55 years (odds ratio [OR] 1.659; p = .001), non-current smoking (OR 1.397; p = .038), pre-menopause (OR 1.648; p = .030) and non-hyperuricemia (OR 2.317; p < .001), whereas race, gender, diet score, current drinking, marriage, sleep duration, hyperhomocysteinemia, levels of physical activity, annual income and educational status were not significant contributors. In conclusion, we found that age <55 years, non-current smoking, pre-menopause and non-hyperuricemia were identified as independent determinant factors for MHO in this population.

Hyperuricemia and the risk for coronary heart disease morbidity and mortality a systematic review and dose-response meta-analysis

NASA Astrophysics Data System (ADS)

Li, Min; Hu, Xiaolan; Fan, Yingli; Li, Kun; Zhang, Xiaowei; Hou, Wenshang; Tang, Zhenyu

2016-01-01

Considerable controversy exists regarding the association between hyperuricemia and coronary heart disease (CHD). Therefore, we performed a systematic review and dose-response meta-analysis of prospective studies to examine the controversy. Prospective cohort studies with relative risks (RRs) and 95% confidence intervals (CIs) for CHD according to serum uric acid levels in adults were eligible. A random-effects model was used to compute the pooled risk estimate. The search yielded 29 prospective cohort studies (n = 958410 participants). Hyperuricemia was associated with increased risk of CHD morbidity (adjusted RR 1.13; 95% CI 1.05 to 1.21) and mortality (adjusted RR 1.27; 95% CI 1.16 to 1.39). For each increase of 1 mg/dl in uric acid level, the pooled multivariate RR of CHD mortality was 1.13 (95% CI 1.06 to 1.20). Dose-response analysis indicated that the combined RR of CHD mortality for an increase of 1 mg uric acid level per dl was 1.02 (95% CI 0.84 to 1.24) without heterogeneity among males (P = 0.879, I2 = 0%) and 2.44 (95% CI 1.69 to 3.54) without heterogeneity among females (P = 0.526, I2 = 0%). The increased risk of CHD associated with hyperuricemia was consistent across most subgroups. Hyperuricemia may increase the risk of CHD events, particularly CHD mortality in females.

[Advance in treatment of hyperuricemia by Chinese medicine based on uric acid transporterome].

PubMed

Zhou, Qi; Liu, Shu-min

2015-11-01

With the development of the quality of life, the morbidity of hyperuricemia is increasing year by year. At the same time, it appears that this disease attacks the young people currently. As the study of pathogenesis of hyperuricemia advanced, a series of uric acid transporters were found during this process. Meanwhile, the definition of transporterome was proposed. They were divided into three groups according to the functions: reabsorption proteins, excretion proteins and skeleton proteins. At moment, the drugs for hyperuricmia mainly include uric acid composition inhibitors and uric acid excretion promoters. Since the excretion of uric acid plays a leading role during the process of attack of hyperurecimia, it makes sense to explore Chinese medicines with clear mechanism targeting the transporterome. Therefore, this paper would focus on transporterome and summarize the mechanisms of Chinese medicines in treating hyperuricemia.

Febuxostat for hyperuricemia in patients with advanced chronic kidney disease.

PubMed

Akimoto, Tetsu; Morishita, Yoshiyuki; Ito, Chiharu; Iimura, Osamu; Tsunematsu, Sadao; Watanabe, Yuko; Kusano, Eiji; Nagata, Daisuke

2014-01-01

Febuxostat is a nonpurine xanthine oxidase (XO) inhibitor, which recently received marketing approval. However, information regarding the experience with this agent among advanced chronic kidney disease (CKD) patients is limited. In the current study, we investigated the effects of oral febuxostat in patients with advanced CKD with asymptomatic hyperuricemia. We demonstrated, for the first time, that not only the serum levels of uric acid (UA) but also those of 8-hydroxydeoxyguanosine, an oxidative stress marker, were significantly reduced after six months of febuxostat treatment, with no adverse events. These results encouraged us to pursue further investigations regarding the clinical impact of lowering the serum UA levels with febuxostat in advanced CKD patients in terms of concomitantly reducing oxidative stress via the blockade of XO. More detailed studies with a larger number of subjects and assessments of the effects of multiple factors affecting hyperuricemia, such as age, sex, and dietary habits, would shed light on the therapeutic challenges of treating asymptomatic hyperuricemia in patients with various stages of CKD.

Fructose intake and risk of gout and hyperuricemia: a systematic review and meta-analysis of prospective cohort studies.

PubMed

Jamnik, Joseph; Rehman, Sara; Blanco Mejia, Sonia; de Souza, Russell J; Khan, Tauseef A; Leiter, Lawrence A; Wolever, Thomas M S; Kendall, Cyril W C; Jenkins, David J A; Sievenpiper, John L

2016-10-03

The prevalence of hyperuricemia and gout has increased in recent decades. The role of dietary fructose in the development of these conditions remains unclear. To conduct a systematic review and meta-analysis of prospective cohort studies investigating the association fructose consumption with incident gout and hyperuricemia. MEDLINE, EMBASE and the Cochrane Library were searched (through September 2015). We included prospective cohort studies that assessed fructose consumption and incident gout or hyperuricemia. 2 independent reviewers extracted relevant data and assessed study quality using the Newcastle-Ottawa Scale. We pooled natural-log transformed risk ratios (RRs) using the generic inverse variance method. Interstudy heterogeneity was assessed (Cochran Q statistic) and quantified (I 2 statistic). The overall quality of the evidence was assessed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach. 2 studies involving 125 299 participants and 1533 cases of incident gout assessed the association between fructose consumption and incident gout over an average of 17 years of follow-up. No eligible studies assessed incident hyperuricemia as an outcome. Fructose consumption was associated with an increase in the risk of gout (RR=1.62, 95% CI 1.28 to 2.03, p<0.0001) with no evidence of interstudy heterogeneity (I 2 =0%, p=0.33) when comparing the highest (>11.8% to >11.9% total energy) and lowest (<6.9% to <7.5% total energy) quantiles of consumption. Despite a dose-response gradient, the overall quality of evidence as assessed by GRADE was low, due to indirectness. There were only two prospective cohort studies involving predominantly white health professionals that assessed incident gout, and none assessed hyperuricemia. Fructose consumption was associated with an increased risk of developing gout in predominantly white health professionals. More prospective studies are necessary to understand better the role of fructose and its food sources in the development of gout and hyperuricemia. NCT01608620. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Hyper-Uricemia and Gouty Access in the Adult Population of the Southeast of Gabon: Biochemical Aspects.

PubMed

Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné

2018-03-08

Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age ( p -value < 10 -4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women ( p -value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m²; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes ( p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production.

Effects of hypervitaminosis of vitamin B3 on silkworm biology.

PubMed

Etebari, Kayvan; Matindoost, Leila

2004-12-01

A high-dose of vitamin B(3) in silkworm diet interrupts larval feeding and normal growth. High mortality of larvae occurs during molting and they cannot complete this process normally. Also the larvae exhibit nicotinamide hypervitaminosis symptoms such as immobility, dyspepsia, darkening of the skin, inability to excrete normally, exerting brownish fluid from anus and swelling of rectal muscles. Maximum larval weights in 1, 2 and 3 g/l treatments were 2.9, 1.6 and 1.2 g respectively, while maximum larval weight in the control was 5.6 g. Larval stage compared to control had increased 18, 26 and 31 days respectively. The concentration increase of uric acid in haemolymph demonstrates the hyperuricemia, while other measured biochemical compounds show significant decrease; sodium and potassium did not change significantly.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Genetic variation underlying renal uric acid excretion in Hispanic children: The Viva La Familia Study

USDA-ARS?s Scientific Manuscript database

Reduced renal excretion of uric acid plays a significant role in the development of hyperuricemia and gout in adults. Hyperuricemia has been associated with chronic kidney disease and cardiovascular disease in children and adults. There are limited genome-wide association studies associating genetic...

Rasburicase improves hyperuricemia in patients with acute kidney injury secondary to rhabdomyolysis caused by ecstasy intoxication and exertional heat stroke.

PubMed

Lin, Pei-Yi; Lin, Chun-Chen; Liu, Hsi-Che; Lee, Ming-Dar; Lee, Hung-Chang; Ho, Che-Sheng; Chiu, Nan-Chang; Peng, Chun-Chih; Huang, Fu-Yuan; Tsai, Jeng-Daw

2011-11-01

To report the successful use of rasburicase in two children with hyperuricemia secondary to severe rhabdomyolysis. : Case report. Pediatric intensive care unit in a freestanding quaternary hospital. Two pediatric patients with severe rhabdomyolysis and hyperuricemia caused by ecstasy intoxication and exertional heat stroke. Use of a single low dose (6 mg) of rasburicase, a urate oxidase enzyme. Rasburicase was administered on the first and second hospital days with a single low dose of 6 mg (0.086 mg/kg in patient A and 0.092 mg/kg in patient B). Within 24 hrs, the levels of serum uric acid in both patients decreased dramatically, and their creatinine levels decreased and urine output increased concurrently. Continuous improvements in the uric acid levels, creatinine levels, and urine output were noted during hospitalization. Rasburicase seems to be a safe and effective drug for improving hyperuricemia in patients with rhabdomyolysis and renal failure.

The effect of coffee, tea, and caffeine consumption on serum uric acid and the risk of hyperuricemia in Korean Multi-Rural Communities Cohort.

PubMed

Bae, Jisuk; Park, Pil Sook; Chun, Byung-Yeol; Choi, Bo Youl; Kim, Mi Kyung; Shin, Min-Ho; Lee, Young-Hoon; Shin, Dong Hoon; Kim, Seong-Kyu

2015-02-01

Caffeine, a commonly consumed food constituent, is known to exert beneficial physiological effects in humans. There is a lack of comprehensive population data for the effects of caffeine intake on urate metabolism. Therefore, the aim of this study was to determine whether coffee, tea, and caffeine intake influences serum uric acid and the risk of hyperuricemia in the Korean Multi-Rural Communities Cohort. We enrolled 9,400 participants in this study. An assessment of various dietary intake amounts of substances such as coffee and tea was performed using a food frequency questionnaire. The content of caffeine was calculated from coffee (74 mg/cup) and tea (15 mg/cup) intake information from the past year. Multivariate logistic regression models, multiple linear regression models, and analysis of covariance were applied to identify any association of dietary intake with serum uric acid levels or the risk of hyperuricemia. No trends for coffee, tea, or caffeine intake were found according to each quintile with serum uric acid in males, although there were weak, marginally significant trends between the content of coffee and caffeine intake and serum uric acid level in females (p = 0.07 for both). Tea intake in males and caffeine intake in females were significantly different between non-hyperuricemia and hyperuricemia (p = 0.04 and p = 0.04, respectively). In addition, a significant association of serum uric acid level with tea intake in males (β = 0.0006, p = 0.02) and with tea intake and caffeine intake in females (β = 0.0003, p = 0.04 and β = 0.0006, p = 0.02, respectively) was observed. There was no effect of coffee, tea, or caffeine intake on the risk of hyperuricemia in either males or females. This study suggests that caffeine consumption might have an effect on serum uric acid in females. However, coffee, tea, and caffeine intake amounts were not associated with the risk of hyperuricemia.

Cross-Over Trial of Febuxostat and Topiroxostat for Hyperuricemia With Cardiovascular Disease (TROFEO Trial).

PubMed

Sezai, Akira; Obata, Kazuaki; Abe, Keisuke; Kanno, Sakie; Sekino, Hisakuni

2017-10-25

We previously reported that febuxostat was more effective for hyperuricemia than allopurinol. The efficacy, however, of topiroxostat (a novel xanthine oxidase reductase inhibitor similar to febuxostat), for hyperuricemia is unknown.Methods and Results:Patients with cardiovascular disease and hyperuricemia, in whom serum uric acid (s-UA) was controlled at ≤6 mg/dL, were eligible for enrollment. Fifty-five patients were randomized to receive either febuxostat or topiroxostat for 6 months and were switched to the other drug for the following 6 months. The primary endpoint was s-UA. Secondary endpoints included serum creatinine, estimated glomerular filtration rate, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, lipid biomarkers, high-sensitivity C-reactive protein and B-type natriuretic protein. Although s-UA level was similar for both drugs, significantly more patients required dose escalation during treatment with topiroxostat. There were no differences in renal function, inflammatory and lipid markers between the 2 drugs. A biomarker of oxidative stress was significantly lower after 3 months of febuxostat compared with topiroxostat. Febuxostat causes more marked and more rapid reduction of s-UA than topiroxostat. With regard to the antioxidant effect, febuxostat was superior to topiroxostat after 3 months. The renal protective and anti-inflammatory effects of both drugs were also similar after 6 months of treatment. Thus, both of these agents were similarly effective for hyperuricemia in patients with cardiovascular disease.

[Association of blood uric acid with other cardiovascular risk factors in the male working population in Valencia].

PubMed

Corella, D; Silla, J; Ordovás, J M; Sabater, A; Ruiz de la Fuente, S; Portolés, O; González, J I; Saiz, C

1999-12-01

Serum uric acid has been reported to be a risk factor for cardiovascular disease (CVD). The objective of the present work was to determine the prevalence of hyperuricemia in a large size sample of a healthy male population, as well as the association between uric acid and other cardiovascular risk factors. A cross-sectional study was conducted in a randomly selected sample of 1,564 healthy men in Valencia (Spain), aged 20-67 years, working in the automobile industry. Serum values of uric acid, cholesterol, and glucose were obtained, as well as blood pressure and body mass index measurements. An assessment was made of socio-economic data, drug therapy, and smoking. The overall prevalence of hyperuricemia was 5.10%; it increased with age. A marked increase (p < 0.01) of hyperuricemic individuals was observed with increased prevalence of other cardiovascular risk factors (from 1.8% with hyperuricemia alone up to 28% among individuals with four simultaneous risk factors). By means of a multivariate logistic regression analysis, the OR of hyperuricemia associated with each factor were calculated: increased serum glucose was the variable with a stronger association (OR: 2.69; 95%CI: 1.21-5.99), obesity ranking next (OR: 2.50; 95%CI: 1.42-4.49). Statistically significant associations were also observed for increased serum cholesterol, increased blood pressure, and smoking. The prevalence of hyperuricemia varies with the simultaneous presence of other classical cardiovascular risk factors. Even in this healthy mediterranean population, uric acid is significantly associated with several components in the plurimetabolic syndrome.

Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model.

PubMed

Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi

2015-01-01

To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Losartan can alleviate experimental atherosclerosis induced by hyperuricemia.

Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model

PubMed Central

Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi

2015-01-01

Objective: To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Methods: Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. Results: After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Conclusions: Losartan can alleviate experimental atherosclerosis induced by hyperuricemia. PMID:26617751

Difference in the action mechanism of radon inhalation and radon hot spring water drinking in suppression of hyperuricemia in mice

PubMed Central

Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori

2016-01-01

Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)–induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m3 for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. PMID:27021217

Genetics of hyperuricemia and gout: implications for the present and future.

PubMed

George, Ronald L; Keenan, Robert T

2013-02-01

Gout is the most common inflammatory arthropathy and occurs in the setting of elevated serum urate levels. Gout is also known to be associated with multiple comorbidities including cardiovascular disease and the metabolic syndrome. Recent advances in research have increased our understanding and improved our knowledge of the pathophysiology of gout. Genome-wide association studies have permitted the identification of several new and common genetic factors that contribute to hyperuricemia and gout. Most of these are involved with the renal urate transport system (the uric acid transportasome), generally considered the most influential regulator of serum urate homeostasis. Thus far, SCL22A12, SCL2A9, and GLUT9 have been found to have the greatest variation and most influence on serum urate levels. However, genetics are only a part of the explanation in the development of hyperuricemia and gout. As results have been mixed, the role of known urate influential genes in gout's associated comorbidities remains unclear. Regardless, GWAS findings have expanded our understanding of the pathophysiology of hyperuricemia and gout, and will likely play a role in the development of future therapies and treatment of this ancient disease.

[Hyperuricemia in systemic lupus erythematosus: is it associated with the neuropsychiatric manifestations of the disease?

PubMed

Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam

2015-07-17

To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥ 6mg/dl for women and ≥ 7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

Association between serum uric acid, metabolic syndrome and microalbuminuria in previously untreated essential hypertensive patients.

PubMed

Rodilla, Enrique; Pérez-Lahiguera, Francisco; Costa, José A; González, Carmen; Miralles, Amparo; Moral, Desamparados; Pascual, José María

2009-01-17

The aim of the study was to assess the association of serum uric acid levels with microalbuminuria -urinary albumin excretion (UAE)> or = 30mg/24h-. Cross-sectional study in 429 (220 women) hypertensive, non diabetic, never treated patients (mean age: 47 years) with glomerular filtration rate > or =60ml/min/1.73m(2). The prevalence of microalbuminuria was 20.5%; 18% had hyperuricemia and 47% fulfilled the criteria for metabolic syndrome (MS). Baseline UAE correlated in the unvaried analysis to diastolic blood pressure, waist circumference, high-density lipoprotein cholesterol and uric acid. In multiple linear regression models, only MS (beta=0.113; p=0.03), and serum uric acid values (beta=0.04; p=0.05) were independently associated with logUAE, after adjustment for age and sex. Hyperuricemia (serum uric acid level > or =7.0mg/dl for men and > or =6.5mg/dl for women; odds ratio=2.18; 95% confidence interval, 1.21-3.92; p=0.010), and MS (odds ratio=2.16; 95% confidence interval, 1.32-3.53; p=0.002) were independently associated with a higher risk of microalbuminuria in multiple logistic regression analyses. The prevalence of microalbuminuria was 45.8% in patients with coexistent MS and hyperuricemia, as compared to 13.6% in hypertensive patients without it (p<0.001). In patients with concomitant MS and hyperuricemia the probability of being microalbuminuric was 3.7 times higher than in patients without those factors. Serum uric acid level is associated with microalbuminuria. Coexistence of MS and hyperuricemia in hypertensive patients increases almost 4 times the odds of being microalbuminuric.

The Dietary Fructose:Vitamin C Intake Ratio Is Associated with Hyperuricemia in African-American Adults.

PubMed

Zheng, Zihe; Harman, Jane L; Coresh, Josef; Köttgen, Anna; McAdams-DeMarco, Mara A; Correa, Adolfo; Young, Bessie A; Katz, Ronit; Rebholz, Casey M

2018-03-01

A high fructose intake has been shown to be associated with increased serum urate concentration, whereas ascorbate (vitamin C) may lower serum urate by competing with urate for renal reabsorption. We assessed the combined association, as the fructose:vitamin C intake ratio, and the separate associations of dietary fructose and vitamin C intakes on prevalent hyperuricemia. We conducted cross-sectional analyses of dietary intakes of fructose and vitamin C and serum urate concentrations among Jackson Heart Study participants, a cohort of African Americans in Jackson, Mississippi, aged 21-91 y. In the analytic sample (n = 4576), multivariable logistic regression was used to examine the separate associations of dietary intakes of fructose and vitamin C and the fructose:vitamin C intake ratio with prevalent hyperuricemia (serum urate ≥7 mg/dL), after adjusting for age, sex, smoking, waist circumference, systolic blood pressure, estimated glomerular filtration rate, diuretic medication use, vitamin C supplement use, total energy intake, alcohol consumption, and dietary intake of animal protein. Analyses for individual dietary factors (vitamin C, fructose) were adjusted for the other dietary factor. In the fully adjusted model, there were 17% greater odds of hyperuricemia associated with a doubling of the fructose:vitamin C intake ratio (OR: 1.17; 95% CI: 1.08, 1.28), 20% greater odds associated with a doubling of fructose intake (OR: 1.20; 95% CI: 1.08, 1.34), and 13% lower odds associated with a doubling of vitamin C intake (OR: 0.87; 95% CI: 0.78, 0.97). Dietary fructose and the fructose:vitamin C intake ratio were more strongly associated with hyperuricemia among men than women (P-interaction ≤ 0.04). Dietary intakes of fructose and vitamin C are associated with prevalent hyperuricemia in a community-based population of African Americans.

Autosomal dominant mutation in the signal peptide of renin in a kindred with anemia, hyperuricemia, and CKD.

PubMed

Beck, Bodo B; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T F

2011-11-01

Homozygous or compound heterozygous mutations in renin (REN) cause renal tubular dysgenesis, which is characterized by death in utero due to kidney failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia, and chronic kidney disease (CKD). To date, only 3 different heterozygous REN mutations have been published. We report mutation analysis of the REN gene in 39 kindreds with hyperuricemia and CKD who previously tested negative for mutations in the UMOD (uromodulin) and HNF1B (hepatocyte nuclear factor 1β) genes. We identified one kindred with a novel thymidine to cytosine mutation at position 28 in the REN complementary DNA, corresponding to a tryptophan to arginine substitution at amino acid 10, which is found within the signal sequence (c.28T>C; p.W10R). On this basis, we conclude that REN mutations are rare events in patients with CKD. Within the kindred, we found affected individuals over 4 generations who carried the novel REN mutation and were characterized by significant anemia, hyperuricemia, and CKD. Anemia was severe and disproportional to the degree of decreased kidney function. Because all heterozygous REN mutations that have been described are localized in the signal sequence, screening of the REN gene for patients with CKD with hyperuricemia and anemia may best be focused on sequencing of exon 1, which encodes the signal peptide. Published by Elsevier Inc.

Uric Acid Induces Renal Inflammation via Activating Tubular NF-κB Signaling Pathway

PubMed Central

Zhou, Yang; Fang, Li; Jiang, Lei; Wen, Ping; Cao, Hongdi; He, Weichun; Dai, Chunsun; Yang, Junwei

2012-01-01

Inflammation is a pathologic feature of hyperuricemia in clinical settings. However, the underlying mechanism remains unknown. Here, infiltration of T cells and macrophages were significantly increased in hyperuricemia mice kidneys. This infiltration of inflammatory cells was accompanied by an up-regulation of TNF-α, MCP-1 and RANTES expression. Further, infiltration was largely located in tubular interstitial spaces, suggesting a role for tubular cells in hyperuricemia-induced inflammation. In cultured tubular epithelial cells (NRK-52E), uric acid, probably transported via urate transporter, induced TNF-α, MCP-1 and RANTES mRNA as well as RANTES protein expression. Culture media of NRK-52E cells incubated with uric acid showed a chemo-attractive ability to recruit macrophage. Moreover uric acid activated NF-κB signaling. The uric acid-induced up-regulation of RANTES was blocked by SN 50, a specific NF-κB inhibitor. Activation of NF-κB signaling was also observed in tubule of hyperuricemia mice. These results suggest that uric acid induces renal inflammation via activation of NF-κB signaling. PMID:22761883

Prevalence of hyperuricemia and relation of serum uric acid with cardiovascular risk factors in a developing country

PubMed Central

Conen, D; Wietlisbach, V; Bovet, P; Shamlaye, C; Riesen, W; Paccaud, F; Burnier, M

2004-01-01

Background The prevalence of hyperuricemia has rarely been investigated in developing countries. The purpose of the present study was to investigate the prevalence of hyperuricemia and the association between uric acid levels and the various cardiovascular risk factors in a developing country with high average blood pressures (the Seychelles, Indian Ocean, population mainly of African origin). Methods This cross-sectional health examination survey was based on a population random sample from the Seychelles. It included 1011 subjects aged 25 to 64 years. Blood pressure (BP), body mass index (BMI), waist circumference, waist-to-hip ratio, total and HDL cholesterol, serum triglycerides and serum uric acid were measured. Data were analyzed using scatterplot smoothing techniques and gender-specific linear regression models. Results The prevalence of a serum uric acid level >420 μmol/L in men was 35.2% and the prevalence of a serum uric acid level >360 μmol/L was 8.7% in women. Serum uric acid was strongly related to serum triglycerides in men as well as in women (r = 0.73 in men and r = 0.59 in women, p < 0.001). Uric acid levels were also significantly associated but to a lesser degree with age, BMI, blood pressure, alcohol and the use of antihypertensive therapy. In a regression model, triglycerides, age, BMI, antihypertensive therapy and alcohol consumption accounted for about 50% (R2) of the serum uric acid variations in men as well as in women. Conclusions This study shows that the prevalence of hyperuricemia can be high in a developing country such as the Seychelles. Besides alcohol consumption and the use of antihypertensive therapy, mainly diuretics, serum uric acid is markedly associated with parameters of the metabolic syndrome, in particular serum triglycerides. Considering the growing incidence of obesity and metabolic syndrome worldwide and the potential link between hyperuricemia and cardiovascular complications, more emphasis should be put on the evolving prevalence of hyperuricemia in developing countries. PMID:15043756

Difference in the action mechanism of radon inhalation and radon hot spring water drinking in suppression of hyperuricemia in mice.

PubMed

Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori

2016-06-01

Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)-induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m(3) for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Hyperuricemia in systemic lupus erythematosus: is it associated with the neuropsychiatric manifestations of the disease?

PubMed

Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam

To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥6mg/dl for women and ≥7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

Levels of cytokines and microRNAs in individuals with asymptomatic hyperuricemia and ultrasonographic findings of gout: a bench-to-bedside approach.

PubMed

Estevez-Garcia, Irving O; Gallegos-Nava, Selma; Vera-Pérez, Erika; Silveira, Luis H; Ventura-Ríos, Lucio; Vancini, Gonzalo; Hernández-Díaz, Cristina; Sánchez-Muñoz, Fausto; Ballinas-Verdugo, Martha A; Gutierrez, Marwin; Pineda, Carlos; Rodriguez-Henriquez, Pedro; Castillo-Martínez, Diana; Amezcua-Guerra, Luis M

2018-02-18

To assess potential associations among serum cytokines and microRNA (miR) levels with ultrasound (US) findings suggestive of urate deposits in chronic asymptomatic hyperuricemia and gout. All participants underwent musculoskeletal US and measurements of serum IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IFN-γ, TNF, MCP-1, and ENA-78, as well as miR-146a, miR-155, and miR-223 levels. Thirty individuals with asymptomatic hyperuricemia, 31 normouricemic controls, and 30 gouty patients were included. The frequency of synovitis and double contour sign using US was similar between asymptomatic hyperuricemia (67% and 27%, respectively) and gouty participants (77% and 27%), and each had a higher frequency than controls (45% and 0%). Serum IL-6 and IL-8 levels were similar between patients with asymptomatic hyperuricemia (69.7±73.4 and 18.5±25.6 pg/ml, respectively) and gout (75.8±47.6 and 24.4±31.7 pg/ml), and higher than controls (28.2±17.6 and 7.4±6.0 pg/ml). A similar distribution was observed for miR-155 levels (0.22±0.18, 0.20±0.14, and 0.08±0.04, respectively). Associations between morphostructural abnormalities suggestive of urate deposits (regardless of clinical diagnosis) and serum markers were assessed. Subjects with urate deposits had higher IL-6 (257.2 versus 47.0 pg/mL; P=0.005), IL-8 (73.2 versus 12.0 pg/mL; P=0.026), and miR-155 (0.21 versus 0.16; P=0.015) levels than those without deposition findings. In asymptomatic individuals with chronic hyperuricemia, the presence of synovitis and double contour sign by US may represent a subclinical manifestation of monosodium urate crystals nucleation, capable of triggering inflammatory pathways (IL-6 and IL-8) and mechanisms of intercellular communication (miR-155) similar to what is observed in gout. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Association of Kidney Function and Waist Circumference with Uric Acid Levels in South Africans.

PubMed

Madala, Nomandla Daphne; Dubula, Thozama; Assounga, Alain Guy Honoré; Naicker, Saraladevi

2017-12-01

Recent evidence that hyperuricemia is associated with incident chronic kidney disease (CKD) provides a potential therapeutic target for CKD that has not been explored in Africans. With hyperuricemia and gout increasing globally, we sought to determine their prevalence in South Africans with varying kidney function levels. This was a cross-sectional study of ambulatory adult patients presenting at a General Internal Medicine Outpatients Clinic between September 2012 and March 2014. Demographic, clinical, and laboratory data collected were analyzed using STATA11. Odds ratios (ORs) and 95% confidence intervals were determined using multivariable logistic regression with bootstrapping. There were 225/261 (86.2%) black/Africans, 31/261 (11.9%) Indian South Africans, 3/261 (1.1%) Caucasians, and 2/261 (<1%) mixed ancestry South Africans. Mean age was 51.3 ± 14.5 years. Median (interquartile range) estimated glomerular filtration rate (eGFR) was 71 (38) mL/min/1.73 m 2 and 39.8% (104/261) of patients had CKD. Hyperuricemia prevalence was 43.7% (114/261) and increased from 16.7% in patients with eGFR ≥90 mL/min/1.73 m 2 to 74.2% with eGFR <30 mL/min/1.73 m 2 (P < 0.001). Gout prevalence was 5.4% (14/261), with equal distribution across eGFR categories (0.814). Factors independently associated with hyperuricemia were eGFR <90 [ORs 3.24 (1.15-9.14), 7.28 (2.26-23.49), and 7.88 (1.95-31.82) for eGFR 60-89.9, 30-60, and <30, respectively], albuminuria [2.32 (1.11-4.85)], and waist circumference [1.04 (1.01-1.06) per 1 cm increase]. In univariate and multivariable analysis, gout was positively associated with male gender and cardiovascular disease, while it was negatively associated with African ancestry, but none of these factors remained significant after bootstrapping; ORs 6.65 (0.64-69.24), 4.14 (0.61-28.07), and 0.18 (0.01-2.21), respectively. Hyperuricemia prevalence was high, with CKD and waist circumference being the strongest predictors. Gout was uncommon in black Africans. With population data lacking, screening high-risk individuals may provide insight into the burden of hyperuricemia and gout in South Africa.

Serum Uric Acid, Hyperuricemia and Body Mass Index in Children and Adolescents with Intellectual Disabilities

ERIC Educational Resources Information Center

Lin, Jin-Ding; Lin, Pei-Ying; Lin, Lan-Ping; Hsu, Shang-Wei; Yen, Chia-Feng; Fang, Wen-Hui; Wu, Sheng-Ru; Chien, Wu-Chien; Loh, Ching-Hui; Chu, Cordia M.

2009-01-01

The aims of the preset study were to describe the profile of serum uric acid, the prevalence of hyperuricemia and its risk factors among children and adolescents with intellectual disabilities. We conducted a cross-sectional study of 941 children and adolescents with intellectual disabilities (aged 4-18 years) who participated in annual health…

Serum Uric Acid Is Associated with Poor Outcome in Black Africans in the Acute Phase of Stroke

PubMed Central

Ayeah, Chia Mark; Ba, H.; Mbahe, Salomon

2017-01-01

Background Prognostic significance of serum uric acid (SUA) in acute stroke still remains controversial. Objectives To determine the prevalence of hyperuricemia and its association with outcome of stroke patients in the Douala General Hospital (DGH). Methods This was a hospital based prospective cohort study which included acute stroke patients with baseline SUA levels and 3-month poststroke follow-up data. Associations between high SUA levels and stroke outcomes were analyzed using multiple logistic regression and survival analysis (Cox regression and Kaplan-Meier). Results A total of 701 acute stroke patients were included and the prevalence of hyperuricemia was 46.6% with a mean SUA level of 68.625 ± 24 mg/l. Elevated SUA after stroke was associated with death (OR = 2.067; 95% CI: 1.449–2.950; p < 0.001) but did not predict this issue. However, an independent association between increasing SUA concentration and mortality was noted in a Cox proportional hazards regression model (adjusted HR = 1.740; 95% CI: 1.305–2.320; p < 0.001). Furthermore, hyperuricemia was an independent predictor of poor functional outcome within 3 months after stroke (OR = 2.482; 95% CI: 1.399–4.404; p = 0.002). Conclusion The prevalence of hyperuricemia in black African stroke patients is quite high and still remains a predictor of poor outcome. PMID:29082062

Determination of four different purines and their content change in seafood by high-performance liquid chromatography.

PubMed

Qu, Xin; Sui, Jianxin; Mi, Nasha; Lin, Hong

2017-01-01

Seafood is regarded as a high-purine food that may induce gout, which has attracted extensive attention concerning its safety. Therefore, the aim of this study was to develop a simple and reliable method to determine the purine content in seafood and its change during storage to offer consumers healthy diet information. Chromatographic separation was carried out using Waters Atlantis dC 18 column, and potassium phosphate monobasic solution (0.02 mol L -1 , pH 3.6) as a mobile phase. The average recovery yields of four purines were 91.5-105.0%, and relative standard deviation values were around 1.8-6.5%. Shrimp and snail contained higher amounts of purine than fish and bivalves; the livers and skins of fish contained higher amounts of purine than muscles; and the main purine varied depending on the type of seafood. Also, purine content of seafood changed during storage. The purine content of seafood differed depending on species, body part and degree of freshness, which could recommend consumers a healthy diet, especially for people with hyperuricemia and gout. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

The Epidemiology of Uric Acid and Fructose

PubMed Central

Rho, Young Hee; Zhu, Yanyan; Choi, Hyon K.

2011-01-01

During the past few decades, the mean serum uric acid levels and the prevalence of hyperuricemia in the general population appear to have increased. Correspondingly, the prevalence and incidence of gout have doubled. Potential reasons behind these trends include the increasing prevalence of obesity and metabolic syndrome, western life-style factors, increased prevalence of medical conditions (e.g. renal conditions, hypertension, and cardiovascular disorders) and use of medications that increase uric acid levels (e.g. diuretics and low-dose aspirin). The substantial increase in sugar-sweetened soft drinks and associated fructose consumption has also coincided with the secular trend of hyperuricemia and gout. Recently, several large-scale epidemiologic studies have clarified a number of these long-suspected risk factors in relation with hyperuricemia and gout. Furthermore, recent studies have illuminated the substantial comorbidities of hyperuricemia and gout, particularly metabolic-cardiovascular-renal conditions. While many prospective studies have suggested an independent association between serum uric acid levels and the future risk of cardiovascular-metabolic morbidities and mortality, only a limited number of randomized clinical trials and observational studies have recently demonstrated that the use of allopurinol can be beneficial against these outcomes. As these data are scarce and the effects of allopurinol might not be limited to lowering serum uric acid levels, the potential causal role of uric acid on these outcomes remains to be clarified with further studies. PMID:22000647

Maternal hyperuricemia in normotensive singleton pregnancy, a prenatal finding with continuous perinatal and postnatal effects, a prospective cohort study

PubMed Central

2014-01-01

Background To assess the association of maternal hyperuricemia with adverse pregnancy outcome and neonatal metabolic, neurologic and respiratory disturbances in normotensive singleton pregnant women. Method This prospective multicentric cohort study was conducted on 404 normotensive singleton pregnant women who were admitted for delivery in Vali-Asr and Akbar-Abadi teaching hospitals of Tehran University of Medical Sciences, Tehran, Iran. Upon enrollment maternal and umbilical sera were obtained for determining uric acid levels. 1 and 5 minutes Apgar scores, the need for neonatal resuscitation and neonatal intensive care unit (NICU) admission were recorded. In case of NICU admission a neonatal blood sample was drawn for determining uric acid, blood sugar and bilirubin levels. An intracranial ultrasound imaging was also carried out for the admittd neonates for detecting intraventricular hemorrhage. Results Maternal hyperuricemia (uric acid one standard deviation greater than the appropriate gestational age) was independently associated with preterm birth (odds ratio (OR), 3.17; 95% confidence interval (CI), 2.1 – 4.79), small for gestational age delivery (OR, 1.28; 95% CI, 1.04 – 2.57), NICU admission (OR, 1.65; 95% CI, 1.12 – 2.94) and neonatal IVH (OR, 8.14; 95% CI, 1.11 – 87.1). Conclusions Maternal hyperuricemia in normotensive singleton pregnant women is significantly associated with preterm and SGA delivery and the development of neonatal IVH. PMID:24636149

Uric acid and transforming growth factor in fructose-induced production of reactive oxygen species in skeletal muscle

PubMed Central

Maarman, Gerald J.; Ojuka, Edward

2016-01-01

The consumption of fructose, a major constituent of the modern diet, has raised increasing concern about the effects of fructose on health. Research suggests that excessive intake of fructose (>50 g/d) causes hyperuricemia, insulin resistance, mitochondrial dysfunction, de novo lipogenesis by the liver, and increased production of reactive oxygen species (ROS) in muscle. In a number of tissues, uric acid has been shown to stimulate the production of ROS via activation of transforming growth factor β1 and NADPH (nicotinamide adenine dinucleotide phosphate) oxidase 4. The role of uric acid in fructose-induced production of ROS in skeletal muscle, however, has not been investigated. This review examines the evidence for fructose-induced production of ROS in skeletal muscle, highlights proposed mechanisms, and identifies gaps in current knowledge. PMID:26946251

An update on the genetic architecture of hyperuricemia and gout.

PubMed

Merriman, Tony R

2015-04-10

Genome-wide association studies that scan the genome for common genetic variants associated with phenotype have greatly advanced medical knowledge. Hyperuricemia is no exception, with 28 loci identified. However, genetic control of pathways determining gout in the presence of hyperuricemia is still poorly understood. Two important pathways determining hyperuricemia have been confirmed (renal and gut excretion of uric acid with glycolysis now firmly implicated). Major urate loci are SLC2A9 and ABCG2. Recent studies show that SLC2A9 is involved in renal and gut excretion of uric acid and is implicated in antioxidant defense. Although etiological variants at SLC2A9 are yet to be identified, it is clear that considerable genetic complexity exists at the SLC2A9 locus, with multiple statistically independent genetic variants and local epistatic interactions. The positions of implicated genetic variants within or near chromatin regions involved in transcriptional control suggest that this mechanism (rather than structural changes in SLC2A9) is important in regulating the activity of SLC2A9. ABCG2 is involved primarily in extra-renal uric acid under-excretion with the etiological variant influencing expression. At the other 26 loci, probable causal genes can be identified at three (PDZK1, SLC22A11, and INHBB) with strong candidates at a further 10 loci. Confirmation of the causal gene will require a combination of re-sequencing, trans-ancestral mapping, and correlation of genetic association data with expression data. As expected, the urate loci associate with gout, although inconsistent effect sizes for gout require investigation. Finally, there has been no genome-wide association study using clinically ascertained cases to investigate the causes of gout in the presence of hyperuricemia. In such a study, use of asymptomatic hyperurcemic controls would be expected to increase the ability to detect genetic associations with gout.

Urine alkalization facilitates uric acid excretion

PubMed Central

2010-01-01

Background Increase in the incidence of hyperuricemia associated with gout as well as hypertension, renal diseases and cardiovascular diseases has been a public health concern. We examined the possibility of facilitated excretion of uric acid by change in urine pH by managing food materials. Methods Within the framework of the Japanese government's health promotion program, we made recipes which consist of protein-rich and less vegetable-fruit food materials for H+-load (acid diet) and others composed of less protein but vegetable-fruit rich food materials (alkali diet). Healthy female students were enrolled in this consecutive 5-day study for each test. From whole-day collected urine, total volume, pH, organic acid, creatinine, uric acid and all cations (Na+,K+,Ca2+,Mg2+,NH4+) and anions (Cl-,SO42-,PO4-) necessary for the estimation of acid-base balance were measured. Results Urine pH reached a steady state 3 days after switching from ordinary daily diets to specified regimens. The amount of acid generated ([SO42-] +organic acid-gut alkai) were linearly related with those of the excretion of acid (titratable acidity+ [NH4+] - [HCO3-]), indicating that H+ in urine is generated by the metabolic degradation of food materials. Uric acid and excreted urine pH retained a linear relationship, where uric acid excretion increased from 302 mg/day at pH 5.9 to 413 mg/day at pH 6.5, despite the fact that the alkali diet contained a smaller purine load than the acid diet. Conclusion We conclude that alkalization of urine by eating nutritionally well-designed food is effective for removing uric acid from the body. PMID:20955624

Effects of Pu-erh ripened tea on hyperuricemic mice studied by serum metabolomics.

PubMed

Zhao, Ran; Chen, Dong; Wu, Hualing

2017-11-15

To evaluate effects of Pu-erh ripened tea in hyperuricemic mice, a mouse hyperuricemia model was developed by oral administration of potassium oxonate for 7 d. Serum metabolomics, based on gas chromatography-mass spectrometry, was used to generate metabolic profiles from normal control, hyperuricemic and allopurinol-treated hyperuricemic mice, as well as hyperuricemic mice given Pu-erh ripened tea at three doses. Pu-erh ripened tea significantly lowered serum uric acid levels. Twelve potential biomarkers associated with hyperuricemia were identified. Pu-erh ripened tea and allopurinol differed in their metabolic effects in the hyperuricemic mice. Levels of glutamic acid, indolelactate, L-allothreonine, nicotinoylglycine, isoleucine, l-cysteine and glycocyamine, all involved in amino acid metabolism, were significantly changed in hyperuricemic mice treated Pu-erh ripened tea. Thus, modulating amino acid metabolism might be the primary mechanism of anti-hyperuricemia by Pu-erh ripened tea. Copyright © 2017 Elsevier B.V. All rights reserved.

Management of Gout and Hyperuricemia in CKD.

PubMed

Vargas-Santos, Ana Beatriz; Neogi, Tuhina

2017-09-01

Hyperuricemia and gout, the clinical manifestation of monosodium urate crystal deposition, are common in patients with chronic kidney disease (CKD). Although the presence of CKD poses additional challenges in gout management, effective urate lowering is possible for most patients with CKD. Initial doses of urate-lowering therapy are lower than in the non-CKD population, whereas incremental dose escalation is guided by regular monitoring of serum urate levels to reach the target level of <6mg/dL (or <5mg/dL for patients with tophi). Management of gout flares with presently available agents can be more challenging due to potential nephrotoxicity and/or contraindications in the setting of other common comorbid conditions. At present, asymptomatic hyperuricemia is not an indication for urate-lowering therapy, though emerging data may support a potential renoprotective effect. Copyright © 2017 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Gout and hyperuricemia.

PubMed

Wortmann, Robert L

2002-05-01

Gout continues to be a health problem around the world despite the availability of effective therapies. Although the prevalence is influenced by genetic factors, the associations of alcohol consumption, obesity, and hypertension appear to be partially responsible for the increased prevalence of gout and hyperuricemia in African and Oriental countries. The association between hyperuricemia and cardiovascular disease seems linked to insulin resistance. This relation, in part, explains the common coexistence of hyperlipidemia and glucose intolerance in patients with gout. Accordingly, it is recommended that one pay more attention to dietary manipulation in patients with gout in addition to managing hypertension, obesity, and other medical problems. Although acute gout attacks can be treated, eliminating gout requires effective removal of urate from the body. Allopurinol remains a dominant urate-lowering agent, however its use may be limited by allergic reactions. Uricosuric agents are also effective urate-lowering agents and provide an alternative to allopurinol. Strategies to treat patients who are sensitive to allopurinol continue to evolve.

Fad diets and their effect on urinary stone formation.

PubMed

Nouvenne, Antonio; Ticinesi, Andrea; Morelli, Ilaria; Guida, Loredana; Borghi, Loris; Meschi, Tiziana

2014-09-01

The influence of unhealthy dietary habits on urinary stone formation has been widely recognized in literature. Dietary advice is indeed the cornerstone prescription for prevention of nephrolithiasis as well. However, only a small amount of medical literature has addressed the influence of popular or fad diets, often self-prescribed for the management of obesity and overweight or for cultural beliefs, on the risk of kidney stones. Thereby in this paper we analyze the current knowledge on the effects of some popular diets on overall lithogenic risk. High-protein diets, like Dukan diet, raise some concerns, since animal proteins are able to increase urinary calcium and to decrease urinary citrate excretion, thus leading to a high overall lithogenic risk. Low-carbohydrate diets, like Atkins diet or zone diet, may have a protective role against kidney stone formation, but there are also evidences stating that this dietary approach may rise calciuria and decrease citraturia, since it is generally associated to a relatively high intake of animal proteins. Vegan diet can be harmful for urinary stone disease, especially for the risk of hyperuricemia and micronutrient deficiencies, even if only few studies have addressed this specific matter. On the other side, the benefits of a lacto-ovo-vegetarian diet on kidney stone prevention have been largely emphasized, provided that the intake of calcium and oxalate is balanced. Traditional Mediterranean diet should exert a protective effect on nephrolithiasis as well, even if specific studies have not been carried out yet. High phytate and antioxidant content of this diet have however demonstrated to be beneficial in preventing the formation of new or recurrent calculi. Anyway, at the current state of knowledge, the most effective dietary approach to prevent kidney stone disease is a mild animal protein restriction, a balanced intake of carbohydrates and fats and a high intake of fruit and vegetables. Other fundamental aspects, which are often neglected in fad diets, are a normal intake of milk and dairy products and salt restriction. All these nutritional aspects should be greatly taken into account when patients who are willing to undergo fad or commercial diets ask for dietary advice.

Febuxostat (Feburic tablet) in the management of hyperuricemia in a general practice cohort of Japanese patients with a high prevalence of cardiovascular problems.

PubMed

Hiramitsu, Shinya; Ishiguro, Yoshiaki; Matsuyama, Hiroyuki; Yamada, Kenji; Kato, Kazuo; Noba, Manji; Uemura, Akihisa; Matsubara, Yoshirou; Yoshida, Satoshi; Kani, Atsushi; Tokuda, Mamoru; Kato, Hisashi; Hasegawa, Kazuo; Uchiyama, Tatsushi; Matsubara, Shiro; Mori, Kazuma; Kimura, Hisashi; Shino, Kenji; Kato, Yasuchika; Ishii, Junichi

2014-01-01

Hyperuricemia is increasing in prevalence and this is paralleled by an increased incidence of acute gout. In addition, there is growing evidence of an association between high serum levels of uric acid (sUA) and cardiovascular disease (CVD). In this preliminary report, we present 12-16 week results from a multicenter, general practice study in which we evaluated the usefulness of febuxostat in a cohort of untreated patients with hyperuricemia with a high prevalence of CVD. Febuxostat titrated from 10 mg/day up to 40 mg/day resulted in statistically significant and clinically relevant reductions in sUA after 12-16 weeks. A "responder" level of 6.0 mg/dL or lower was achieved in 95 of 100 (95%) patients. Significant reductions in sUA were achieved regardless of the presence/absence of coexisting diseases (e.g. CVD, renal insufficiency, diabetes and obesity) or the class of antihypertensive agent being used by the patient. No serious adverse reactions were noted with febuxostat. Although allopurinol has been used generally for hyperuricemia/gout, it is excreted fully via the kidneys, restricting its use in patients with reduced renal function, and its three-times-daily administration leads to poor adherence. Based on the results of this study, febuxostat may provide an easier option than allopurinol for clinicians specializing in CVDs.

Effects of complete water fasting and regeneration diet on kidney function, oxidative stress and antioxidants.

PubMed

Mojto, V; Gvozdjakova, A; Kucharska, J; Rausova, Z; Vancova, O; Valuch, J

2018-01-01

The aim of the study was to observe the influence of 11-days complete water fasting (WF) and regeneration diet (RD) on renal function, body weight, blood pressure and oxidative stress. Therapeutic WF is considered a healing method. Ten volunteers drank only water for 11 days, followed by RD for the next 11 days. Data on body weight, blood pressure, kidney functions, antioxidants, lipid peroxidation, cholesterols, triacylglycerols and selected biochemical parameters were obtained. WF increased uric acid and creatinine and decreased glomerular filtration rate. After RD, the parameters were comparable to baseline values. Urea was not affected. Lipid peroxidation (TBARS) decreased and maintained stable after RD. Fasting decreased α-tocopherol and increased γ-tocopherol, no significant changes were found after RD. Coenzyme Q10 decreased after RD. HDL-cholesterol decreased in WF. Total- and LDL-cholesterol decreased after RD. Other biochemical parameters were within the range of reference values. The effect of the complete fasting on kidney function was manifested by hyperuricemia. Renal function was slightly decreased, however maintained within the reference values. After RD, it returned to baseline values. The positive effect of the complete water fasting was in the reduction of oxidative stress, body weight and blood pressure (Tab. 3, Ref. 25).

Uric Acid Excretion Predicts Increased Blood Pressure Among American Adolescents of African Descent.

PubMed

Mrug, Sylvie; Mrug, Michal; Morris, Anjana Madan; Reynolds, Nina; Patel, Anita; Hill, Danielle C; Feig, Daniel I

2017-04-01

Hyperuricemia predicts the incidence of hypertension in adults and its treatment has blood pressure (BP)-lowering effects in adolescents. To date, no studies have examined the predictive usage of hyperuricemia or urinary uric acid excretion on BP changes in adolescents. Mechanistic models suggest that uric acid impairs both endothelial function and vascular compliance, which would potentially exacerbate a myriad of hypertensive mechanisms, yet little is known about interaction of uric acid and other hypertension risk factors. The primary study was aimed at the effects of stress on BP in adolescents. A community sample of 84 low-income, urban adolescents (50% male, 95% African American, mean age = 13.36 ± 1 years) was recruited from public schools. Youth completed a 12-hour (overnight) urine collection at home and their BP was measured during rest and in response to acute psychosocial stress. Seventy-six of the adolescents participated in a follow-up visit at 1.5 years when their resting BP was reassessed. In this substudy, we assessed the relationship of renal urate excretion and BP reactivity. After adjusting for resting BP levels at baseline and other covariates, higher levels of uric acid excretion predicted greater BP reactivity to acute psychosocial stress and higher resting BP at 18 months. Urinary excretion of uric acid can serve as an alternative, noninvasive measure of serum uric acid levels that are predictive of BP changes. As hyperuricemia-associated hypertension is treatable, urban adolescents may benefit from routine screening for hyperuricemia or high uric acid excretion. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Effect of ethanol on metabolism of purine bases (hypoxanthine, xanthine, and uric acid).

PubMed

Yamamoto, Tetsuya; Moriwaki, Yuji; Takahashi, Sumio

2005-06-01

There are many factors that contribute to hyperuricemia, including obesity, insulin resistance, alcohol consumption, diuretic use, hypertension, renal insufficiency, genetic makeup, etc. Of these, alcohol (ethanol) is the most important. Ethanol enhances adenine nucleotide degradation and increases lactic acid level in blood, leading to hyperuricemia. In beer, purines also contribute to an increase in plasma uric acid. Although rare, dehydration and ketoacidosis (due to ethanol ingestion) are associated with the ethanol-induced increase in serum uric acid levels. Ethanol also increases the plasma concentrations and urinary excretion of hypoxanthine and xanthine via the acceleration of adenine nucleotide degradation and a possible weak inhibition of xanthine dehydrogenase activity. Since many factors such as the ALDH2*1 gene and ADH2*2 gene, daily drinking habits, exercise, and dehydration enhance the increase in plasma concentration of uric acid induced by ethanol, it is important to pay attention to these factors, as well as ingested ethanol volume, type of alcoholic beverage, and the administration of anti-hyperuricemic agents, to prevent and treat ethanol-induced hyperuricemia.

Fad diets and their effect on urinary stone formation

PubMed Central

Nouvenne, Antonio; Ticinesi, Andrea; Morelli, Ilaria; Guida, Loredana; Meschi, Tiziana

2014-01-01

The influence of unhealthy dietary habits on urinary stone formation has been widely recognized in literature. Dietary advice is indeed the cornerstone prescription for prevention of nephrolithiasis as well. However, only a small amount of medical literature has addressed the influence of popular or fad diets, often self-prescribed for the management of obesity and overweight or for cultural beliefs, on the risk of kidney stones. Thereby in this paper we analyze the current knowledge on the effects of some popular diets on overall lithogenic risk. High-protein diets, like Dukan diet, raise some concerns, since animal proteins are able to increase urinary calcium and to decrease urinary citrate excretion, thus leading to a high overall lithogenic risk. Low-carbohydrate diets, like Atkins diet or zone diet, may have a protective role against kidney stone formation, but there are also evidences stating that this dietary approach may rise calciuria and decrease citraturia, since it is generally associated to a relatively high intake of animal proteins. Vegan diet can be harmful for urinary stone disease, especially for the risk of hyperuricemia and micronutrient deficiencies, even if only few studies have addressed this specific matter. On the other side, the benefits of a lacto-ovo-vegetarian diet on kidney stone prevention have been largely emphasized, provided that the intake of calcium and oxalate is balanced. Traditional Mediterranean diet should exert a protective effect on nephrolithiasis as well, even if specific studies have not been carried out yet. High phytate and antioxidant content of this diet have however demonstrated to be beneficial in preventing the formation of new or recurrent calculi. Anyway, at the current state of knowledge, the most effective dietary approach to prevent kidney stone disease is a mild animal protein restriction, a balanced intake of carbohydrates and fats and a high intake of fruit and vegetables. Other fundamental aspects, which are often neglected in fad diets, are a normal intake of milk and dairy products and salt restriction. All these nutritional aspects should be greatly taken into account when patients who are willing to undergo fad or commercial diets ask for dietary advice. PMID:26816783

Comparison of the Renoprotective Effect of Febuxostat for the Treatment of Hyperuricemia between Patients with and without Type 2 Diabetes Mellitus: A Retrospective Observational Study.

PubMed

Ito, Hiroyuki; Antoku, Shinichi; Abe, Mariko; Omoto, Takashi; Shinozaki, Masahiro; Nishio, Shinya; Mifune, Mizuo; Togane, Michiko; Nakata, Masaya; Yamashita, Tatsuya

Objective The effects of febuxostat therapy on hyperuricemia in patients with and without type 2 diabetes were compared in this retrospective observational study after pair-matching using the propensity scores. Methods In total, 160 patients with hyperuricemia were studied as the treated set, and the 155 subjects in whom the administration of febuxostat was not discontinued during the observation period were investigated in the full analysis. The study subjects were divided into two groups based on the style of initiation of febuxostat: initial and switching therapy from allopurinol administration. Results The reduction in the serum uric acid (sUA) levels at six months after the initiation of febuxostat administration did not significantly differ between the patients with and without diabetes in both the initial (206±114 and 226±113 μmol/L in patients with and without diabetes, respectively) and switching (154±91 and 129±90 μmol/L in patients with and without diabetes, respectively) therapy groups. The eGFR values were significantly increased compared to the baseline levels only in the patients without diabetes. The changes in the eGFR values were significantly associated with the presence of diabetes and sUA at baseline in a multivariate analysis. The frequency of adverse events was not significantly different between the patients with and without diabetes. Conclusion Although febuxostat exerted a similar sUA-lowering effect against hyperuricemia in patients with type 2 diabetes compared to those without, the renoprotective effect was attenuated in those with diabetes compared to nondiabetic subjects.

Comparison of the Renoprotective Effect of Febuxostat for the Treatment of Hyperuricemia between Patients with and without Type 2 Diabetes Mellitus: A Retrospective Observational Study

PubMed Central

Ito, Hiroyuki; Antoku, Shinichi; Abe, Mariko; Omoto, Takashi; Shinozaki, Masahiro; Nishio, Shinya; Mifune, Mizuo; Togane, Michiko; Nakata, Masaya; Yamashita, Tatsuya

2016-01-01

Objective The effects of febuxostat therapy on hyperuricemia in patients with and without type 2 diabetes were compared in this retrospective observational study after pair-matching using the propensity scores. Methods In total, 160 patients with hyperuricemia were studied as the treated set, and the 155 subjects in whom the administration of febuxostat was not discontinued during the observation period were investigated in the full analysis. The study subjects were divided into two groups based on the style of initiation of febuxostat: initial and switching therapy from allopurinol administration. Results The reduction in the serum uric acid (sUA) levels at six months after the initiation of febuxostat administration did not significantly differ between the patients with and without diabetes in both the initial (206±114 and 226±113 μmol/L in patients with and without diabetes, respectively) and switching (154±91 and 129±90 μmol/L in patients with and without diabetes, respectively) therapy groups. The eGFR values were significantly increased compared to the baseline levels only in the patients without diabetes. The changes in the eGFR values were significantly associated with the presence of diabetes and sUA at baseline in a multivariate analysis. The frequency of adverse events was not significantly different between the patients with and without diabetes. Conclusion Although febuxostat exerted a similar sUA-lowering effect against hyperuricemia in patients with type 2 diabetes compared to those without, the renoprotective effect was attenuated in those with diabetes compared to nondiabetic subjects. PMID:27853065

How can machine-learning methods assist in virtual screening for hyperuricemia? A healthcare machine-learning approach.

PubMed

Ichikawa, Daisuke; Saito, Toki; Ujita, Waka; Oyama, Hiroshi

2016-12-01

Our purpose was to develop a new machine-learning approach (a virtual health check-up) toward identification of those at high risk of hyperuricemia. Applying the system to general health check-ups is expected to reduce medical costs compared with administering an additional test. Data were collected during annual health check-ups performed in Japan between 2011 and 2013 (inclusive). We prepared training and test datasets from the health check-up data to build prediction models; these were composed of 43,524 and 17,789 persons, respectively. Gradient-boosting decision tree (GBDT), random forest (RF), and logistic regression (LR) approaches were trained using the training dataset and were then used to predict hyperuricemia in the test dataset. Undersampling was applied to build the prediction models to deal with the imbalanced class dataset. The results showed that the RF and GBDT approaches afforded the best performances in terms of sensitivity and specificity, respectively. The area under the curve (AUC) values of the models, which reflected the total discriminative ability of the classification, were 0.796 [95% confidence interval (CI): 0.766-0.825] for the GBDT, 0.784 [95% CI: 0.752-0.815] for the RF, and 0.785 [95% CI: 0.752-0.819] for the LR approaches. No significant differences were observed between pairs of each approach. Small changes occurred in the AUCs after applying undersampling to build the models. We developed a virtual health check-up that predicted the development of hyperuricemia using machine-learning methods. The GBDT, RF, and LR methods had similar predictive capability. Undersampling did not remarkably improve predictive power. Copyright © 2016 Elsevier Inc. All rights reserved.

Serum uric acid and target organ damage in essential hypertension

PubMed Central

Ofori, Sandra N; Odia, Osaretin J

2014-01-01

Background Hypertension is a major risk factor for cardiovascular mortality, as it acts through its effects on target organs, such as the heart and kidneys. Hyperuricemia increases cardiovascular risk in patients with hypertension. Objective To assess the relationship between serum uric acid and target organ damage (left ventricular hypertrophy and microalbuminuria) in untreated patients with essential hypertension. Patients and methods: A cross-sectional study was carried out in 130 (85 females, 45 males) newly diagnosed, untreated patients with essential hypertension. Sixty-five healthy age- and sex-matched non-hypertensive individuals served as controls for comparison. Left ventricular hypertrophy was evaluated by cardiac ultrasound scan, and microalbuminuria was assessed in an early morning midstream urine sample by immunoturbidimetry. Blood samples were collected for assessing uric acid levels. Results Mean serum uric acid was significantly higher among the patients with hypertension (379.7±109.2 μmol/L) than in the controls (296.9±89.8 μmol/L; P<0.001), and the prevalence of hyperuricemia was 46.9% among the hypertensive patients and 16.9% among the controls (P<0.001). Among the hypertensive patients, microalbuminuria was present in 54.1% of those with hyperuricemia and in 24.6% of those with normal uric acid levels (P=0.001). Similarly, left ventricular hypertrophy was more common in the hypertensive patients with hyperuricemia (70.5% versus 42.0%, respectively; P=0.001). There was a significant linear relationship between mean uric acid levels and the number of target organ damage (none versus one versus two: P=0.012). Conclusion These results indicate that serum uric acid is associated with target organ damage in patients with hypertension, even at the time of diagnosis; thus, it is a reliable marker of cardiovascular damage in our patient population. PMID:24833906

The Prevalence of the Risk Factors for Atherosclerosis among Type 2 Diabetic Patients Is Greater in the Progressive Stages of Chronic Kidney Disease

PubMed Central

Ito, Hiroyuki; Antoku, Shinichi; Furusho, Masahide; Shinozaki, Masahiro; Abe, Mariko; Mifune, Mizuo; Togane, Michiko; Ito, Kiyoko; Sanaka, Tsutomu

2013-01-01

Background/Aims The prevalence of the risk factors for atherosclerosis, other than diabetes mellitus, among type 2 diabetic patients with different stages of chronic kidney disease (CKD) determined by glomerular filtration rate (GFR) was investigated. Methods The prevalence of ten risk factors (age ≥65 years, history of smoking, male gender, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia) was determined in 2,107 Japanese type 2 diabetic patients with different stages of CKD (six stages according to GFR). Results The risk factors for age ≥65 years and male gender were found in 49 and 62% of the study subjects, respectively. The percentages of subjects with a current history of smoking, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia were 35, 44, 47, 70, 61, 13, 21 and 26%, respectively. The prevalence of age ≥65 years, male gender, albuminuria, hypertension, hypo-HDL-cholesterolemia, hyperuricemia and anemia was greater in the later stages of GFR, whereas the prevalence of hypercholesterolemia and obesity did not differ between stages. The prevalence of a current history of smoking was lower in the later stages of GFR. The cumulative number of risk factors increased from 3.1 to 6.8 in the later stages of GFR. Conclusion Among type 2 diabetic patients with CKD, the total number of risk factors increases with the progression of renal dysfunction. It is important to pay attention to newly recognized risk factors for hyperuricemia and anemia, in addition to hypertension, albuminuria and hypo-HDL-cholesterolemia, in monitoring diabetic patients with later stages of CKD. PMID:23904855

The impact of serum uric acid reduction on renal function and blood pressure in chronic kidney disease patients with hyperuricemia.

PubMed

Tsuji, Takayuki; Ohishi, Kazuhisa; Takeda, Asumi; Goto, Daiki; Sato, Taichi; Ohashi, Naro; Fujigaki, Yoshihide; Kato, Akihiko; Yasuda, Hideo

2018-04-26

Febuxostat is tolerable in chronic kidney disease (CKD) patients with hyperuricemia. However, the long-term effect of lowering uric acid with febuxostat on renal function and blood pressure has not been elucidated. This was a 2 years retrospective observational study. 86 CKD patients with hyperuricemia who continued with allopurinol (allopurinol group, n = 30), switched from allopurinol to febuxostat (switched group, n = 25), or were newly prescribed febuxostat (febuxostat group, n = 31) were included in this study. Serum uric acid, estimated glomerular filtration rate (eGFR), blood pressure, and urinary protein were analyzed. Moreover, the impact of serum uric acid reduction on renal function and blood pressure was assessed. Serum uric acid in the switched and febuxostat groups was significantly reduced at 6 months (switched group; 8.49 ± 1.32-7.19 ± 1.14 mg/dL, p < 0.0001, febuxostat group; 9.43 ± 1.63-6.31 ± 0.90 mg/dL, p < 0.0001). In the allopurinol group, serum uric acid was increased (6.86 ± 0.87-7.10 ± 0.85 mg/dL, p = 0.0213). eGFR was significantly increased (35.2 ± 12.8-37.3 ± 13.9 mL/min/1.73 m 2 , p = 0.0232), while mean arterial pressure (93.1 ± 10.8-88.2 ± 9.5 mmHg, p = 0.0039) was significantly decreased at 6 months in the febuxostat group, resulting in the retention of eGFR for 2 years. The impact of serum uric acid reduction might have beneficial effects on CKD progression and blood pressure. However, a large prospective study is needed to determine the long-term efficacy of febuxostat therapy in CKD patients with hyperuricemia.

Effect of urate-lowering therapies on renal disease progression in patients with hyperuricemia.

PubMed

Levy, Gerald D; Rashid, Nazia; Niu, Fang; Cheetham, T Craig

2014-05-01

To evaluate the association between hyperuricemia and renal disease progression in a real-world, large observational database study. We conducted a population-based retrospective cohort study identifying 111,992 patients with hyperuricemia (> 7 mg/dl) from a large medical group. The final cohort were ≥ 18 years old, urate-lowering therapy (ULT)-naïve, and had the following laboratory results available: at least 1 glomerular filtration rate (GFR) level before the index date and at least 1 serum uric acid (sUA) level and GFR in the followup 36-month period. The cohort was categorized into 3 groups: never treated (NoTx), ULT time receiving therapy of < 80% (< 80%), and ULT time receiving therapy of ≥ 80% (≥ 80%). Outcomes were defined as a ≥ 30% reduction in GFR from baseline, dialysis, or GFR of ≤ 15 ml/min. A subanalysis of patients with sUA < 6 mg/dl at study conclusion was performed. Cox proportional hazards regression model determined factors associated with renal function decline. A total of 16,186 patients met inclusion criteria. There were 11,192 NoTx patients, 3902 with < 80% time receiving ULT, and 1092 with ≥ 80% time receiving ULT. Factors associated with renal disease progression were age, sex, hypertension, diabetes, congestive heart failure, hospitalizations, rheumatoid arthritis, and higher sUA at baseline. Time receiving therapy was not associated with renal outcomes. Patients who achieved sUA < 6 mg/dl had a 37% reduction in outcome events (p < 0.0001; HR 0.63, 95% CI: 0.5-0.78). Hyperuricemia is an independent risk factor for renal function decline. Patients treated with ULT who achieved sUA < 6 mg/dl on ULT showed a 37% reduction in outcome events.

Uric Acid Is a Strong Risk Marker for Developing Hypertension From Prehypertension: A 5-Year Japanese Cohort Study.

PubMed

Kuwabara, Masanari; Hisatome, Ichiro; Niwa, Koichiro; Hara, Shigeko; Roncal-Jimenez, Carlos A; Bjornstad, Petter; Nakagawa, Takahiko; Andres-Hernando, Ana; Sato, Yuka; Jensen, Thomas; Garcia, Gabriela; Rodriguez-Iturbe, Bernardo; Ohno, Minoru; Lanaspa, Miguel A; Johnson, Richard J

2018-01-01

Prehypertension frequently progresses to hypertension, a condition associated with high morbidity and mortality from cardiovascular diseases and stroke. However, the risk factors for developing hypertension from prehypertension remain poorly understood. We conducted a retrospective cohort study using the data from 3584 prehypertensive Japanese adults (52.1±11.0 years, 2081 men) found to be prehypertensive in 2004 and reexamined in 2009. We calculated the cumulative incidences of hypertension over 5 years, examined risk factors, and calculated odds ratios (ORs) for developing hypertension after adjustments for age, sex, body mass index, smoking and drinking habits, baseline systolic and diastolic blood pressure, pulse rate, diabetes mellitus, dyslipidemia, chronic kidney disease, and serum uric acid levels. The additional analysis evaluated whether serum uric acid (hyperuricemia) constituted an independent risk factor for developing hypertension. The cumulative incidence of hypertension from prehypertension over 5 years was 25.3%. There were no significant differences between women and men (24.4% versus 26.0%; P =0.28). The cumulative incidence of hypertension in subjects with hyperuricemia (n=726) was significantly higher than those without hyperuricemia (n=2858; 30.7% versus 24.0%; P <0.001). After multivariable adjustments, the risk factors for developing hypertension from prehypertension were age (OR, 1.023; P <0.001), female sex (OR, 1.595; P <0.001), higher body mass index (OR, 1.051; P <0.001), higher baseline systolic (OR, 1.072; P <0.001) and diastolic blood pressure (OR, 1.085; P <0.001), and higher serum uric acid (OR, 1.149; P <0.001). Increased serum uric acid is a strong risk marker for developing hypertension from prehypertension. Further studies are needed to determine whether treatment of hyperuricemia in prehypertensive subjects could impede the onset of hypertension. © 2017 American Heart Association, Inc.

Uric acid and transforming growth factor in fructose-induced production of reactive oxygen species in skeletal muscle.

PubMed

Madlala, Hlengiwe P; Maarman, Gerald J; Ojuka, Edward

2016-04-01

The consumption of fructose, a major constituent of the modern diet, has raised increasing concern about the effects of fructose on health. Research suggests that excessive intake of fructose (>50 g/d) causes hyperuricemia, insulin resistance, mitochondrial dysfunction, de novo lipogenesis by the liver, and increased production of reactive oxygen species (ROS) in muscle. In a number of tissues, uric acid has been shown to stimulate the production of ROS via activation of transforming growth factor β1 and NADPH (nicotinamide adenine dinucleotide phosphate) oxidase 4. The role of uric acid in fructose-induced production of ROS in skeletal muscle, however, has not been investigated. This review examines the evidence for fructose-induced production of ROS in skeletal muscle, highlights proposed mechanisms, and identifies gaps in current knowledge. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Genomic Influences on Hyperuricemia and Gout.

PubMed

Merriman, Tony

2017-08-01

Genome-wide association studies (GWAS) have identified nearly 30 loci associated with urate concentrations that also influence the subsequent risk of gout. The ABCG2 Q141 K variant is highly likely to be causal and results in internalization of ABCG2, which can be rescued by drugs. Three other GWAS loci contain uric acid transporter genes, which are also highly likely to be causal. However identification of causal genes at other urate loci is challenging. Finally, relatively little is known about the genetic control of progression from hyperuricemia to gout. Only 4 small GWAS have been published for gout. Copyright © 2017 Elsevier Inc. All rights reserved.

Febuxostat: drug review and update.

PubMed

Grewal, Harmanjot K; Martinez, Joseph R; Espinoza, Luis R

2014-05-01

Gouty arthritis and hyperuricemia have ailed humans for centuries. Recent advances in understanding of the mechanism(s) of their development have changed our perception of the disease process. Despite these gains, the treatment options available are limited. The FDA approval of febuxostat for the treatment of hyperuricemia in gout has been a significant step forward. Since its approval in 2009, febuxostat has proven to be safe and efficacious although concerns remain regarding its long-term effects and superiority to other uricosuric agents, such as allopurinol. A comprehensive literature review of PubMed and Ovid examining clinical trials and post-marketing studies yielded congruent findings on efficacy and safety in elderly populations and those with mild-to-moderate renal/hepatic impairment. A lack of literature and clinical studies was found with regard to comparison of febuxostat to FDA-approved high-dose allopurinol (> 300 mg), the safety of febuxostat in the treatment of severe renal/hepatic impairment and the benefit in the treatment of secondary cases of hyperuricemia. Febuxostat is effective in the treatment of mild-to-moderate renal/hepatic impairment with dramatic effects on the serum urate level. It can be used safely in patients with hypersensitivity reactions to allopurinol. Further research is needed to determine the long-term benefits and risks.

Anti-Gouty Arthritis and Antihyperuricemia Effects of Sunflower (Helianthus annuus) Head Extract in Gouty and Hyperuricemia Animal Models.

PubMed

Li, Lanzhou; Teng, Meiyu; Liu, Yange; Qu, Yidi; Zhang, Yuanzhu; Lin, Feng; Wang, Di

2017-01-01

This study was performed to investigate the therapeutic effects and possible mechanisms of sunflower (Helianthus annuus) head extract (SHE) on gout. First, the components of sunflower head powder and SHE were analyzed systematically. SHE, especially SHEB (extracted with 20% ethanol and 80% double-distilled water), strongly suppressed the swelling of the ankles in rats with acute gout induced by monosodium urate (MSU) crystals and reduced the levels of uric acid and xanthine oxidase (XO) in mice with hyperuricemia induced by oteracil potassium and yeast extract powder. Hematoxylin and eosin staining indicated that SHEB reduced inflammation cells and increased the joint space in the ankle compared with the control rats with MSU-induced gout. In the rats with acute gout, among 13 detected inflammatory cytokines, SHEB significantly enhanced the serum levels of interleukin-10 and the monocyte chemoattractant protein 1 α . In the mice with hyperuricemia, SHEB reduced the levels of glutathione peroxidase, superoxide dismutase, malondialdehyde, and nitrogen monoxide in liver tissues. The potential therapeutic effects of SHE on gout are probably due to the production of anti-inflammatory cytokines and the suppression of XO activity via the modulation of oxidative stress status.

The Association of Dietary Intake of Purine-Rich Vegetables, Sugar-Sweetened Beverages and Dairy with Plasma Urate, in a Cross-Sectional Study

PubMed Central

Zgaga, Lina; Theodoratou, Evropi; Kyle, Janet; Farrington, Susan M.; Agakov, Felix; Tenesa, Albert; Walker, Marion; McNeill, Geraldine; Wright, Alan F.; Rudan, Igor; Dunlop, Malcolm G.; Campbell, Harry

2012-01-01

Introduction Hyperuricemia is a strong risk factor for gout. The incidence of gout and hyperuricemia has increased recently, which is thought to be, in part, due to changes in diet and lifestyle. Objective of this study was to investigate the association between plasma urate concentration and: a) food items: dairy, sugar-sweetened beverages (SSB) and purine-rich vegetables; b) related nutrients: lactose, calcium and fructose. Methods A total of 2,076 healthy participants (44% female) from a population-based case-control study in Scotland (1999–2006) were included in this study. Dietary data was collected using a semi-quantitative food frequency questionnaire (FFQ). Nutrient intake was calculated using FFQ and composition of foods information. Urate concentration was measured in plasma. Results Mean urate concentration was 283.8±72.1 mmol/dL (females: 260.1±68.9 mmol/dL and males: 302.3±69.2 mmol/dL). Using multivariate regression analysis we found that dairy, calcium and lactose intakes were inversely associated with urate (p = 0.008, p = 0.003, p = 0.0007, respectively). Overall SSB consumption was positively associated with urate (p = 0.008), however, energy-adjusted fructose intake was not associated with urate (p = 0.66). The intake of purine-rich vegetables was not associated to plasma urate (p = 0.38). Conclusions Our results suggest that limiting purine-rich vegetables intake for lowering plasma urate may be ineffectual, despite current recommendations. Although a positive association between plasma urate and SSB consumption was found, there was no association with fructose intake, suggesting that fructose is not the causal agent underlying the SSB-urate association. The abundant evidence supporting the inverse association between plasma urate concentration and dairy consumption should be reflected in dietary guidelines for hyperuricemic individuals and gout patients. Further research is needed to establish which nutrients and food products influence plasma urate concentration, to inform the development of evidence-based dietary guidelines. PMID:22701608

Prevalence and features of fatty liver detected by physical examination in Guangzhou

PubMed Central

Liao, Xian-Hua; Cao, Xu; Liu, Jie; Xie, Xiao-Hua; Sun, Yan-Hong; Zhong, Bi-Hui

2013-01-01

AIM: To investigate the prevalence of fatty liver discovered upon physical examination of Chinese patients and determine the associated clinical characteristics. METHODS: A total of 3433 consecutive patients who received physical examinations at the Huangpu Division of the First Affiliated Hospital at Sun Yat-sen University in Guangzhou, China from June 2010 to December 2010 were retrospectively enrolled in the study. Results of biochemical tests, abdominal ultrasound, electrocardiography, and chest X-ray were collected. The diagnosis of fatty liver was made if a patient met any two of the three following ultrasonic criteria: (1) liver and kidney echo discrepancy and presence of an increased liver echogenicity (bright); (2) unclear intrahepatic duct structure; and (3) liver far field echo decay. RESULTS: The study population consisted of 2201 males and 1232 females, with a mean age of 37.4 ± 12.8 years. When all 3433 patients were considered, the overall prevalence of hyperlipidemia was 38.1%, of fatty liver was 26.0%, of increased alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels was 11.9%, of gallstone was 11.4%, of hyperglycemia was 7.3%, of hypertension was 7.1%, and of hyperuricemia was 6.2%. Of the 2605 patients who completed the abdominal ultrasonography exam, 677 (26.0%) were diagnosed with fatty liver and the prevalence was higher in males (32.5% vs females: 15.3%, P < 0.001). The overall prevalence of fatty liver increased with age, with the peak prevalence (39.5%) found in the 60 to 70-year-old age group. Among patients between the ages of 18 to 50-year-old, the prevalence of fatty liver was significantly higher in males (20.2% vs females: 8.7%, P < 0.001); the difference in prevalence between the two sexes in patients > 50-year-old did not reach statistical significance. Only 430 of the patients diagnosed with fatty liver had complete information; among those, increased ALT and/or AST levels were detected in only 30%, with all disturbances being mild or moderate. In these 430 patients, the overall prevalence of hypertriglyceridemia was 31.4%, of mixed type hyperlipidemia was 20.9%, of hypercholesterolemia was 12.3%, of hyperglycemia was 17.6%, of hypertension was 16.0%, of hyperuricemia was 15.3%, and of gallstone was 14.4%. Again, the prevalences of hypertriglyceridemia and hyperuricemia were higher in males (hypertriglyceridemia, 36.0% vs females: 12.0%, P < 0.05; hyperuricemia, 17.3% vs females: 7.2%, P < 0.05); in contrast, however, the prevalences of mixed type hyperlipidemia and hypercholesterolemia was higher in females (mixed type hyperlipidemia, 18.7% vs females: 30.1%, P < 0.05, hypercholesterolemia, 9.5% vs females: 24.1%, P < 0.05). Finally, comparison of the fatty liver group to the non-fatty liver group showed that prevalences of hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia were higher in the former (all P < 0.01). CONCLUSION: A high prevalence of fatty liver is detected upon physical examination in Guangzhou, and the primary associated clinical findings are hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia. PMID:23983438

Serum uric acid and target organ damage in essential hypertension.

PubMed

Ofori, Sandra N; Odia, Osaretin J

2014-01-01

Hypertension is a major risk factor for cardiovascular mortality, as it acts through its effects on target organs, such as the heart and kidneys. Hyperuricemia increases cardiovascular risk in patients with hypertension. To assess the relationship between serum uric acid and target organ damage (left ventricular hypertrophy and microalbuminuria) in untreated patients with essential hypertension. A cross-sectional study was carried out in 130 (85 females, 45 males) newly diagnosed, untreated patients with essential hypertension. Sixty-five healthy age- and sex-matched non-hypertensive individuals served as controls for comparison. Left ventricular hypertrophy was evaluated by cardiac ultrasound scan, and microalbuminuria was assessed in an early morning midstream urine sample by immunoturbidimetry. Blood samples were collected for assessing uric acid levels. Mean serum uric acid was significantly higher among the patients with hypertension (379.7±109.2 μmol/L) than in the controls (296.9±89.8 μmol/L; P<0.001), and the prevalence of hyperuricemia was 46.9% among the hypertensive patients and 16.9% among the controls (P<0.001). Among the hypertensive patients, microalbuminuria was present in 54.1% of those with hyperuricemia and in 24.6% of those with normal uric acid levels (P=0.001). Similarly, left ventricular hypertrophy was more common in the hypertensive patients with hyperuricemia (70.5% versus 42.0%, respectively; P=0.001). There was a significant linear relationship between mean uric acid levels and the number of target organ damage (none versus one versus two: P=0.012). These results indicate that serum uric acid is associated with target organ damage in patients with hypertension, even at the time of diagnosis; thus, it is a reliable marker of cardiovascular damage in our patient population.

Evaluating the urate-lowering effects of different microbial fermented extracts in hyperuricemic models accompanied with a safety study.

PubMed

Chen, Rong-Jane; Chen, Mei-Huei; Chen, Yen-Lin; Hsiao, Ching-Mao; Chen, Hsiu-Min; Chen, Siao-Jhen; Wu, Ming-Der; Yech, Yi-Jen; Yuan, Gwo-Fang; Wang, Ying-Jan

2017-07-01

Uric acid (UA) is an end product of purine metabolism by the enzyme xanthine oxidase (XOD). Hyperuricemia is characterized by the accumulation of serum UA and is an important risk factor for gout and many chronic disorders. XOD inhibitors or uricase (catalyzes UA to the more soluble end product) can prevent these chronic diseases. However, currently available hypouricemic agents induce severe side effects. Therefore, we developed new microbial fermented extracts (MFEs) with substantial XOD inhibition activity from Lactobacillus (MFE-21) and Acetobacter (MFE-25), and MFE-120 with high uricase activity from Aspergillus. The urate-lowering effects and safety of these MFEs were evaluated. Our results showed that MFE-25 exerts superior urate-lowering effects in the therapeutic model. In the preventive model, both MFE-120 and MFE-25 significantly reduced UA. The results of the safety study showed that no organ toxicity and no treatment-related adverse effects were observed in mice treated with high doses of MFEs. Taken together, the results showed the effectiveness of MFEs in reducing hyperuricemia without systemic toxicity in mice at high doses, suggesting that they are safe for use in the treatment and prevention of hyperuricemia. Copyright © 2016. Published by Elsevier B.V.

Allopurinol Reduces the Lethality Associated with Acute Renal Failure Induced by Crotalus durissus terrificus Snake Venom: Comparison with Probenecid

PubMed Central

Frezzatti, Rodrigo; Silveira, Paulo Flavio

2011-01-01

Background Acute renal failure is one of the most serious complications of envenoming resulting from Crotalus durissus terrificus bites. This study evaluated the relevance of hyperuricemia and oxidative stress and the effects of allopurinol and probenecid in renal dysfunction caused by direct nephrotoxicity of C. d. terrificus venom. Methodology/Principal Findings Hematocrit, protein, renal function and redox status were assessed in mice. High ratio of oxidized/reduced glutathione and hyperuricemia induced by C. d. terrificus venom were ameliorated by both, allopurinol or probenecid, but only allopurinol significantly reduced the lethality caused by C. d. terrificus venom. The effectiveness of probenecid is compromised probably because it promoted hypercreatinemia and hypocreatinuria and worsed the urinary hypo-osmolality in envenomed mice. In turn, the highest effectiveness of allopurinol might be due to its ability to diminish the intracellular formation of uric acid. Conclusions/Significance Data provide consistent evidences linking uric acid with the acute renal failure induced by C. d. terrificus venom, as well as that this envenoming in mice constitutes an attractive animal model suitable for studying the hyperuricemia and that the allopurinol deserves to be clinically evaluated as an approach complementary to anti-snake venom serotherapy. PMID:21909449

Effects of Sodium Glucose Cotransporter-2 Inhibitors on Serum Uric Acid in Type 2 Diabetes Mellitus.

PubMed

Ahmadieh, Hala; Azar, Sami

2017-09-01

Hyperuricemia has been linked to metabolic syndrome, cardiovascular disease, and chronic kidney disease. Hyperuricemia and type 2 diabetes mellitus were inter-related, type 2 diabetes mellitus was more at risk of having a higher serum uric acid level, and also individuals with higher serum uric acid had higher risk of developing type 2 diabetes in the future. Insulin resistance seems to play an important role in the causal relationship between metabolic syndrome, type 2 diabetes, and hyperuricemia. Oral diabetic drugs that would have additional beneficial effects on reducing serum uric acid levels are of importance. Selective SGLT2 inhibitors were extensively studied in type 2 diabetes mellitus and were found to have improvement of glycemic control, in addition to their proven metabolic effects on weight and blood pressure. Additional beneficial effect of SGLT2 inhibitors on serum uric acid level reduction is investigated. Recently, data have been accumulating showing that they have additional beneficial effects on serum uric acid reduction. As for the postulated mechanism, serum uric acid decreased in SGLT2 inhibitor users as a result of the increase in the urinary excretion rate of uric acid, due to the inhibition of uric acid reabsorption mediated by the effect of the drug on the GLUT9 isoform 2, located at the collecting duct of the renal tubule.

Efficacy and Safety of Chinese Medicinal Herbs for the Treatment of Hyperuricemia: A Systematic Review and Meta-Analysis

PubMed Central

Lin, Jianping; Chen, Shaoqing; Li, Shuzhen; Lu, Meili

2016-01-01

Background. Chinese medicinal herbs may be useful for the treatment of hyperuricemia, but there has been no systematic assessment of their efficacy and safety. Objectives. To systematically assess the efficacy and safety of Chinese medicinal herbs for the treatment of hyperuricemia. Methods. Six electronic databases were searched from their inception to December 2015. Randomized controlled clinical trials (RCTs) were included. Cochrane criteria were applied to assess the risk of bias. Data analysis was performed using RevMan software version 5.2. Results. Eleven RCTs with 838 patients were included. There was no significant difference in serum uric acid between Chinese medicinal herbs and traditional Western medicine (SME: 0.19, 95% CI: −0.04 to 0.43; p = 0.10). In terms of overall efficacy, the Chinese medicinal herbs were significantly superior to Western medicine (RR: 1.11; 95% CI: 1.04 to 1.17; p = 0.0007). The Chinese medicinal herbs were better than Western medicine in reducing the adverse reactions (RR: 0.30; 95% CI: 0.15 to 0.62; p = 0.001). And all these funnel plots showed unlikelihood of publishing bias. Conclusions. The results indicate that Chinese medicinal herbs may have greater overall efficacy with fewer adverse drug reactions, although the evidence is weak owing to the low methodological quality and the small number of the included trials. PMID:27818696

Efficacy of Febuxostat for Slowing the GFR Decline in Patients With CKD and Asymptomatic Hyperuricemia: A 6-Month, Double-Blind, Randomized, Placebo-Controlled Trial.

PubMed

Sircar, Dipankar; Chatterjee, Soumya; Waikhom, Rajesh; Golay, Vishal; Raychaudhury, Arpita; Chatterjee, Suparna; Pandey, Rajendra

2015-12-01

Hyperuricemia is a putative risk factor for the progression of chronic kidney disease (CKD). We hypothesized that control of asymptomatic hyperuricemia may slow disease progression in CKD. This was a single-center, double-blind, randomized, parallel-group, placebo-controlled study. Eligible participants were adults from Eastern India aged 18 to 65 years with CKD stages 3 and 4, with asymptomatic hyperuricemia. The intervention group received febuxostat, 40mg, once daily for 6 months, while the placebo group received placebo; both groups were followed up for 6 months. The primary outcome was the proportion of patients showing a >10% decline in estimated glomerular filtration rate (eGFR) from baseline in the febuxostat and placebo groups. Secondary outcomes included changes in eGFRs in the 2 groups from baseline and at the end of the study period. 45 patients in the febuxostat group and 48 in the placebo group were analyzed. Mean eGFR in the febuxostat group showed a nonsignificant increase from 31.5±13.6 (SD) to 34.7±18.1mL/min/1.73m(2) at 6 months. With placebo, mean eGFR decreased from a baseline of 32.6±11.6 to 28.2±11.5mL/min/1.73m(2) (P=0.003). The difference between groups was 6.5 (95% CI, 0.08-12.81) mL/min/1.73m(2) at 6 months (P=0.05). 17 of 45 (38%) participants in the febuxostat group had a >10% decline in eGFR over baseline compared with 26 of 48 (54%) from the placebo group (P<0.004). Limitations of this study included small numbers of patients and short follow-up, and ∼10% of the randomly assigned population dropped out prior to completion. Febuxostat slowed the decline in eGFR in CKD stages 3 and 4 compared to placebo. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Rationale, design, and baseline characteristics of a study to evaluate the effect of febuxostat in preventing cerebral, cardiovascular, and renal events in patients with hyperuricemia.

PubMed

Kojima, Sunao; Matsui, Kunihiko; Ogawa, Hisao; Jinnouchi, Hideaki; Hiramitsu, Shinya; Hayashi, Takahiro; Yokota, Naoto; Kawai, Naoki; Tokutake, Eiichi; Uchiyama, Kazuaki; Sugawara, Masahiro; Kakuda, Hirokazu; Wakasa, Yutaka; Mori, Hisao; Hisatome, Ichiro; Waki, Masako; Ohya, Yusuke; Kimura, Kazuo; Saito, Yoshihiko

2017-01-01

Since uric acid is associated with cardiovascular and renal disease, a treatment to maintain blood uric acid level may be required in patients with hyperuricemia. This study aims to evaluate preventive effects of febuxostat, a selective xanthine oxidase inhibitor, on cerebral, cardiovascular, and renal events in patients with hyperuricemia compared to conventional treatment. This study is a prospective randomized open-label blinded endpoint study. Patient enrolment was started in November 2013 and was completed in October 2014. The patients will be followed for at least 3 years. The primary endpoint is a composite of cerebral, cardiovascular, and renal events, and all deaths including death due to cerebral, cardiovascular, and renal disease, new or recurring cerebrovascular disease, new or recurring non-fatal coronary artery disease, cardiac failure requiring hospitalization, arteriosclerotic disease requiring treatment, renal impairment, new atrial fibrillation, and all deaths other than cerebral or cardiovascular or renal disease. These events will be independently evaluated by the Event Assessment Committee under blinded information regarding the treatment group. The study was registered at ClinicalTrials.gov with the identifier NCT01984749. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

Autosomal dominant tubulointerstitial kidney disease caused by uromodulin mutations: seek and you will find.

PubMed

Raffler, Gabriele; Zitt, Emanuel; Sprenger-Mähr, Hannelore; Nagel, Mato; Lhotta, Karl

2016-04-01

Uromodulin (UMOD)-associated kidney disease belongs to the group of autosomal dominant interstitial kidney diseases and is caused by mutations in the UMOD gene. Affected patients present with hyperuricemia, gout, and progressive renal failure. The disease is thought to be very rare but is probably underdiagnosed. Two index patients from two families with tubulointerstitial nephropathy and hyperuricemia were examined, including blood and urine chemistry, ultrasound, and mutation analysis of the UMOD gene. In addition, other available family members were studied. In a 46-year-old female patient with a fractional excretion of uric acid of 3 %, analysis of the UMOD gene revealed a p.W202S missense mutation. The same mutation was found in her 72-year-old father, who suffers from gout and end-stage renal disease. The second index patient was a 47-year-old female with chronic kidney disease and gout for more than 10 years. Her fractional uric acid excretion was 3.5 %. Genetic analysis identified a novel p.H250Q UMOD mutation that was also present in her 12-year-old son, who had normal renal function and uric acid levels. In patients suffering from chronic tubulointerstitial nephropathy, hyperuricemia, and a low fractional excretion of uric acid mutation, analysis of the UMOD gene should be performed to diagnose UMOD-associated kidney disease.

Anti-Gouty Arthritis and Antihyperuricemia Effects of Sunflower (Helianthus annuus) Head Extract in Gouty and Hyperuricemia Animal Models

PubMed Central

Li, Lanzhou; Teng, Meiyu; Liu, Yange; Qu, Yidi; Zhang, Yuanzhu

2017-01-01

This study was performed to investigate the therapeutic effects and possible mechanisms of sunflower (Helianthus annuus) head extract (SHE) on gout. First, the components of sunflower head powder and SHE were analyzed systematically. SHE, especially SHEB (extracted with 20% ethanol and 80% double-distilled water), strongly suppressed the swelling of the ankles in rats with acute gout induced by monosodium urate (MSU) crystals and reduced the levels of uric acid and xanthine oxidase (XO) in mice with hyperuricemia induced by oteracil potassium and yeast extract powder. Hematoxylin and eosin staining indicated that SHEB reduced inflammation cells and increased the joint space in the ankle compared with the control rats with MSU-induced gout. In the rats with acute gout, among 13 detected inflammatory cytokines, SHEB significantly enhanced the serum levels of interleukin-10 and the monocyte chemoattractant protein 1α. In the mice with hyperuricemia, SHEB reduced the levels of glutathione peroxidase, superoxide dismutase, malondialdehyde, and nitrogen monoxide in liver tissues. The potential therapeutic effects of SHE on gout are probably due to the production of anti-inflammatory cytokines and the suppression of XO activity via the modulation of oxidative stress status. PMID:28929115

Efficacy and safety of losartan in treatment of hyperuricemia and posttransplantation erythrocytosis: results of a prospective, open, randomized, case-control study.

PubMed

Zhu, X; Chen, J; Han, F; Cheng, M; Xu, L; Zhang, L; Ding, X; Le, Y

2009-11-01

Hyperuricemia and posttransplantation erythrocytosis (PTE) are frequent complications after kidney transplantation and are important risk factors for cardiovascular events. Losartan decreases serum uric acid and hemoglobin (Hb) concentrations and may be a useful agent for treatment of hyperuricemia and PTE. To evaluate the influence of losartan on serum creatinine (SCr), serum uric acid, and hemoglobin (Hb) concentrations in patients after kidney transplantation and to evaluate the safety profile of losartan in these patients. Sixty-six Han Chinese patients (43 men and 23 women; mean [SD] age, 40.45 [11.50] years) were enrolled in the study. All patients had undergone a first cadaveric donor kidney transplantation at least 3 months previously and had stable graft function with SCr concentration less than 176.8 micromol/L and Hb concentration greater than 110 g/L. The patients were divided into 2 groups (losartan group, n = 34; and control group, n = 32) according to the odevity of patient identification number. Patients in the losartan group received losartan, 50 mg/d; patients in the control group did not receive losartan. Each patient was followed up for 6 months. Nine patients in the losartan group and 5 patients in the control group dropped out because of acute renal insufficiency, anemia, acute rejection, or poor compliance. The serum uric acid concentration in the losartan group continuously decreased at months 1, 2, 3, and 6 (P = .12, P = .01, P = .04, and P = .005 compared with baseline, and P = .02, P = .003, P = .02, and P = .006 compared with control), especially in the patients with hyperuricemia (P = .02, P < .001, P = .003, and P < .001 compared with baseline, and P = .02, P = .002, P = .02, and P = .002 compared with control). The Hb level in the losartan group decreased significantly at months 1, 2, 3, and 6 (P = .003, P < .001, P = .004, and P = 0.02 compared with baseline, and P = .001, P < .001, P = .001, and P = .005 compared with control), especially in patients with PTE. In patients without PTE, there was no significant decline in Hb concentration in the losartan group compared with baseline. There was no significant decline in estimated glomerular filtration rate in the losartan group. Losartan may be an effective agent for treatment of hyperuricemia and PTE in Han Chinese patients after kidney transplantation. However, in some patients, losartan may not be safe.

Changing electrolyte and acido-basic profile in HIV-infected patients in the HAART era.

PubMed

Isnard Bagnis, Corinne; Du Montcel, Sophie Tezenas; Fonfrede, Michele; Jaudon, Marie Chantal; Thibault, Vincent; Carcelain, Guislaine; Valantin, Marc Antoine; Izzedine, Hassan; Servais, Aude; Katlama, Christine; Deray, Gilbert

2006-01-01

HIV-infected patients may develop a variety of underreported metabolic abnormalities that may be classified into HIVAN, specific HIV abnormalities, coincidental renal disorders and anti-retroviral-treatment-induced side effects. Our descriptive cross-sectional study evaluates the prevalence of electrolyte and acid base disorders in HIV patients in the HAART era in a tertiary care teaching hospital. All consecutive HIV-infected patients (n = 1,232) presenting at our Department of Infectious Disease over 3 months were included. All available biochemical data obtained at admission or on the day of the visit were analyzed. We identified risk factors for electrolyte and acid base disorders with univariate regression analysis and multivariate stepwise regression analysis. Variables tested for significance included age, sex, absolute CD4 and CD8 counts, hepatitis B and C antibodies, and use and type of anti-retroviral medication. Most frequent and clinically relevant abnormalities were hyperuricemia in 41.3%, hypophosphatemia in 17.2% and low bicarbonate level in 13.6% of HIV-tested patients. Plasma magnesium was out of the normal range in 38.9% and blood glucose in 25.3% of the tested patients. When CD4 count was below 200/mm3, 9.2% of tested patients experienced low serum calcium (vs. 0.5% if CD4 count >200/mm3, p < 0.002), 11.4% increased creatinine plasma level (vs. 2.3% if CD4 count >200/mm3, p < 0.0001) and 24.5% low serum bicarbonate (vs. 13.7% if CD4 count >200/mm3, p < 0.0001). Protease inhibitor treatment was a significant risk factor of hyperuricemia (p < 0.003). Non-nucleoside reverse transcriptase inhibitor therapy was significantly associated with less hyperuricemia (OR = 0.6, 95% CI 0.38-0.96) and with hypophosphatemia (OR = 2.0, 95% CI 1.1-3.4). The profile of biochemical abnormalities in HIV-infected patients has changed, hyperuricemia and hypophosphatemia being the most prevalent. Causes are poorly understood. Interpretation of drug-induced side effects in the HIV patient is only meaningful if performed versus a control group of patients. Copyright 2006 S. Karger AG, Basel

Investigation into the association between P2RX7 gene polymorphisms and susceptibility to primary gout and hyperuricemia in a Chinese Han male population.

PubMed

Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao

2017-04-01

The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P < .05 was regarded as statistically significant. Three SNPs (rs2230911, rs208294 and rs435309) did not deviate significantly from HWE (P > .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P < .001]. There was also a higher risk of primary gout in genotype (CG + GG) compared with genotype CC [OR (95% CI) = 1.876 (1.303, 2.701), P = .001]. However, no significant difference in allelic or genotypic frequency was observed between primary gout patients and hyperuricemia patients (P > .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for primary gout.

Low serum uric acid concentration augments insulin effects on the prevalence of metabolic syndrome.

PubMed

Porchia, Leonardo M; Gonzalez-Mejia, M Elba; Torres-Rasgado, Enrique; Ruiz-Vivanco, Guadalupe; Pérez-Fuentes, Ricardo

2018-05-01

Insulin and uric acid were shown affect the prevalence of Metabolic Syndrome (MetS), but no studies examine their interaction. Therefore, we conducted this study to determine their biological interaction in subjects from central Mexico. 433 subjects were enrolled for a cross-sectional study. MetS was defined according to the Harmonizing Definition. Hyperuricemia was defined as ≥7.0 mg/dL in males and ≥5.8 mg/dL in females. Hyperinsulinemia was defined as ≥11.0 μU/mL. Pearson correlation coefficient (r) was calculated to determine the association between uric acid or insulin and MetS. Logistic regression was used to determine the risk (odds ratio) of developing MetS. Biological interactions were determined by the PROCESS Macro and Anderson's method. Insulin and uric acid levels were elevated in MetS positive group (p < .05) and correlated with the number of MetS components (r = 0.276 and r = 0.166, p < .001, respectively). The interaction between uric acid and insulin was associated with the number of MetS components (PROCESS Model 1, interaction coefficient = -0.009, 95%CI: -0.017 to -0.001, p = .036). Johnson-Neyman analysis suggests the interaction is lost when uric acid concentration increased >7.0 mg/dL. When the cohort was separated by hyperinsulinemia and hyperuricemia, there was a significant risk of developing MetS for subjects with hyperuricemia (odds ratio = 2.3; 95%CI: 1.1-4.8, p < .05), hyperinsulinemia (odds ratio = 3.1; 95%CI: 1.9-4.9, p < .05), or both (odds ratio = 7.4; 95%CI: 3.2-17.2, p < .05); however, there was no multiplicative or additive interaction. Here, we show that uric acid and insulin augments the prevalence of MetS; however, no biological interaction was determined for hyperuricemia and hyperinsulinemia. Copyright © 2017 Diabetes India. Published by Elsevier Ltd. All rights reserved.

The effect of febuxostat to prevent a further reduction in renal function of patients with hyperuricemia who have never had gout and are complicated by chronic kidney disease stage 3: study protocol for a multicenter randomized controlled study

PubMed Central

2014-01-01

Background Hyperuricemia is a risk factor for the onset of chronic kidney disease (CKD) and is significantly associated with the progression of CKD. However, there is no sufficient evidence by interventional research supporting a cause-effect relationship. Hyperuricemic patients without gouty arthritis, whose serum urate (SUA) concentration is ≥8.0 mg/dL and who have a complication, are treated by pharmacotherapy in addition to lifestyle guidance. Nevertheless, there is no evidence that rationalizes pharmacotherapy for patients with hyperuricemia who have no complication and whose SUA concentration is below 9.0 mg/dL. Methods/Design The FEATHER (FEbuxostat versus placebo rAndomized controlled Trial regarding reduced renal function in patients with Hyperuricemia complicated by chRonic kidney disease stage 3) study is a prospective, multicenter, double-blind, randomized, placebo-controlled trial of febuxostat—a novel, nonpurine, selective, xanthine oxidase inhibitor. The present study will enroll, at 64 medical institutions in Japan, 400 Japanese patients aged 20 years or older who have hyperuricemia without gouty arthritis, who present CKD stage 3, and whose SUA concentration is 7.1-10.0 mg/dL. Patients are randomly assigned to either the febuxostat or the control group, in which febuxostat tablets and placebo are administered orally, respectively. The dosage of the study drugs should be one 10-mg tablet/day at weeks 1 to 4 after study initiation, increased to one 20-mg tablet/day at weeks 5 to 8, and elevated to one 40-mg tablet/day at week 9 and then maintained until week 108. The primary endpoint is estimated glomerular filtration rate (eGFR) slope. The secondary endpoints include the amount and percent rate of change in eGFR from baseline to week 108, the amount and percent rate of change in SUA concentration from baseline to week 108, the proportion of patients who achieved an SUA concentration ≤6.0 mg/dL, and the incidence of renal function deterioration. Discussion The present study aims to examine whether febuxostat prevents a further reduction in renal function as assessed with eGFR in subjects and will (1) provide evidence to indicate the inverse association between a reduction in SUA concentration and an improvement in renal function and (2) rationalize pharmacotherapy for subjects and clarify its clinical relevance. Trial registration UMIN Identifier: UMIN000008343 PMID:24433285

Hypercalcemia in tumor lysis syndrome.

PubMed

Shah, Binay Kumar

2014-09-01

Tumor lysis syndrome (TLS) is characterized by hyperkalemia, hyperuricemia, hypocalcemia and hyperphosphatemia. This report describes a case of hypercalcemia in TLS in a patient with diffuse large B cell lymphoma.

Prevalence and features of fatty liver detected by physical examination in Guangzhou.

PubMed

Liao, Xian-Hua; Cao, Xu; Liu, Jie; Xie, Xiao-Hua; Sun, Yan-Hong; Zhong, Bi-Hui

2013-08-28

To investigate the prevalence of fatty liver discovered upon physical examination of Chinese patients and determine the associated clinical characteristics. A total of 3433 consecutive patients who received physical examinations at the Huangpu Division of the First Affiliated Hospital at Sun Yat-sen University in Guangzhou, China from June 2010 to December 2010 were retrospectively enrolled in the study. Results of biochemical tests, abdominal ultrasound, electrocardiography, and chest X-ray were collected. The diagnosis of fatty liver was made if a patient met any two of the three following ultrasonic criteria: (1) liver and kidney echo discrepancy and presence of an increased liver echogenicity (bright); (2) unclear intrahepatic duct structure; and (3) liver far field echo decay. The study population consisted of 2201 males and 1232 females, with a mean age of 37.4 ± 12.8 years. When all 3433 patients were considered, the overall prevalence of hyperlipidemia was 38.1%, of fatty liver was 26.0%, of increased alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels was 11.9%, of gallstone was 11.4%, of hyperglycemia was 7.3%, of hypertension was 7.1%, and of hyperuricemia was 6.2%. Of the 2605 patients who completed the abdominal ultrasonography exam, 677 (26.0%) were diagnosed with fatty liver and the prevalence was higher in males (32.5% vs females: 15.3%, P < 0.001). The overall prevalence of fatty liver increased with age, with the peak prevalence (39.5%) found in the 60 to 70-year-old age group. Among patients between the ages of 18 to 50-year-old, the prevalence of fatty liver was significantly higher in males (20.2% vs females: 8.7%, P < 0.001); the difference in prevalence between the two sexes in patients > 50-year-old did not reach statistical significance. Only 430 of the patients diagnosed with fatty liver had complete information; among those, increased ALT and/or AST levels were detected in only 30%, with all disturbances being mild or moderate. In these 430 patients, the overall prevalence of hypertriglyceridemia was 31.4%, of mixed type hyperlipidemia was 20.9%, of hypercholesterolemia was 12.3%, of hyperglycemia was 17.6%, of hypertension was 16.0%, of hyperuricemia was 15.3%, and of gallstone was 14.4%. Again, the prevalences of hypertriglyceridemia and hyperuricemia were higher in males (hypertriglyceridemia, 36.0% vs females: 12.0%, P < 0.05; hyperuricemia, 17.3% vs females: 7.2%, P < 0.05); in contrast, however, the prevalences of mixed type hyperlipidemia and hypercholesterolemia was higher in females (mixed type hyperlipidemia, 18.7% vs females: 30.1%, P < 0.05, hypercholesterolemia, 9.5% vs females: 24.1%, P < 0.05). Finally, comparison of the fatty liver group to the non-fatty liver group showed that prevalences of hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia were higher in the former (all P < 0.01). A high prevalence of fatty liver is detected upon physical examination in Guangzhou, and the primary associated clinical findings are hyperlipidemia, hyperglycemia, hypertension, and hyperuricemia.

Inborn Errors of Fructose Metabolism. What Can We Learn from Them?

PubMed Central

Tran, Christel

2017-01-01

Fructose is one of the main sweetening agents in the human diet and its ingestion is increasing globally. Dietary sugar has particular effects on those whose capacity to metabolize fructose is limited. If intolerance to carbohydrates is a frequent finding in children, inborn errors of carbohydrate metabolism are rare conditions. Three inborn errors are known in the pathway of fructose metabolism; (1) essential or benign fructosuria due to fructokinase deficiency; (2) hereditary fructose intolerance; and (3) fructose-1,6-bisphosphatase deficiency. In this review the focus is set on the description of the clinical symptoms and biochemical anomalies in the three inborn errors of metabolism. The potential toxic effects of fructose in healthy humans also are discussed. Studies conducted in patients with inborn errors of fructose metabolism helped to understand fructose metabolism and its potential toxicity in healthy human. Influence of fructose on the glycolytic pathway and on purine catabolism is the cause of hypoglycemia, lactic acidosis and hyperuricemia. The discovery that fructose-mediated generation of uric acid may have a causal role in diabetes and obesity provided new understandings into pathogenesis for these frequent diseases. PMID:28368361

Fructose containing sugars do not raise blood pressure or uric acid at normal levels of human consumption.

PubMed

Angelopoulos, Theodore J; Lowndes, Joshua; Sinnett, Stephanie; Rippe, James M

2015-02-01

The impact of fructose, commonly consumed with sugars by humans, on blood pressure and uric acid has yet to be defined. A total of 267 weight-stable participants drank sugar-sweetened milk every day for 10 weeks as part of their usual, mixed-nutrient diet. Groups 1 and 2 had 9% estimated caloric intake from fructose or glucose, respectively, added to milk. Groups 3 and 4 had 18% of estimated caloric intake from high fructose corn syrup or sucrose, respectively, added to the milk. Blood pressure and uric acid were determined prior to and after the 10-week intervention. There was no effect of sugar type on either blood pressure or uric acid (interaction P>.05), and a significant time effect for blood pressure was noted (P<.05). The authors conclude that 10 weeks of consumption of fructose at the 50th percentile level, whether consumed as pure fructose or with fructose-glucose-containing sugars, does not promote hyperuricemia or increase blood pressure. © 2014 Wiley Periodicals, Inc.

Inborn Errors of Fructose Metabolism. What Can We Learn from Them?

PubMed

Tran, Christel

2017-04-03

Fructose is one of the main sweetening agents in the human diet and its ingestion is increasing globally. Dietary sugar has particular effects on those whose capacity to metabolize fructose is limited. If intolerance to carbohydrates is a frequent finding in children, inborn errors of carbohydrate metabolism are rare conditions. Three inborn errors are known in the pathway of fructose metabolism; (1) essential or benign fructosuria due to fructokinase deficiency; (2) hereditary fructose intolerance; and (3) fructose-1,6-bisphosphatase deficiency. In this review the focus is set on the description of the clinical symptoms and biochemical anomalies in the three inborn errors of metabolism. The potential toxic effects of fructose in healthy humans also are discussed. Studies conducted in patients with inborn errors of fructose metabolism helped to understand fructose metabolism and its potential toxicity in healthy human. Influence of fructose on the glycolytic pathway and on purine catabolism is the cause of hypoglycemia, lactic acidosis and hyperuricemia. The discovery that fructose-mediated generation of uric acid may have a causal role in diabetes and obesity provided new understandings into pathogenesis for these frequent diseases.

Prevalence of hyperuricaemia in a rural population of Nigerian Niger Delta region.

PubMed

Alikor, C A; Emem-Chioma, P C; Odia, O J

2013-01-01

Hyperuricemia is a cardiovascular disease risk factor that has been poorly researched into in Africa and its prevalence is largely unknown in the rural areas in Nigeria and in the Niger Delta region of Nigeria in particular. A cross-sectional rural survey involving 500 subjects aged 15 years and above. Demographic and social data were obtained using a questionnaire. Anthropometric (height, weight, waist circumference) and blood pressure measurements were taken. Blood samples were taken for blood uric acid, glucose and lipid check. The mean age of the study subjects was 41.32 +/- 17.0 (males, 42.84 +/- 17.8; females, 40.62 +/- 16.6) with a range of 15 years to 95 years. The male to female ratio was 1:2.3. The mean serum uric acid was 337.58 +/- 94.59 mmol/l with a significant higher mean for females (males 333.20 +/- 88.70, females 339.56 +/- 97.21, p < 0.001). Hyperuricemia was found in 86 subject giving a prevalence of 17.2% with higher prevalence in males (males 25%, females 13.7%; x2 = 7.75, p = 0.006). Correlational analysis of serum uric acid with other parameters revealed that waist circumference, total cholesterol, low-density lipoprotein and gender had significant association with uric acid. Male gender was found to be a significant predictor for hyperuricaemia following a logistic regression. The prevalence of hyperuricemia is high in this rural community of study. There is need for more research considering the cardiovascular and other implications of hyperuricaemia.

Phloretin attenuates hyperuricemia-induced endothelial dysfunction through co-inhibiting inflammation and GLUT9-mediated uric acid uptake.

PubMed

Liu, Shuyun; Yuan, Yujia; Zhou, Yijie; Zhao, Meng; Chen, Younan; Cheng, Jingqiu; Lu, Yanrong; Liu, Jingping

2017-10-01

Hyperuricemia is an important risk factor for cardiovascular and renal diseases. Phloretin had shown antioxidant and anti-inflammatory properties, but its role in endothelial injury is rarely reported. In this study, we aimed to investigate the protective effect of phloretin on UA-induced injury in human umbilical vein endothelial cells. The effects of UA and phloretin on cell viability, inflammation, THP-1 monocyte adhesion, endothelial cell tube formation, GLUT9 expression and UA uptake in human umbilical vein endothelial cells were evaluated. The changes of nuclear factor-kappa B/extracellular regulated protein kinases signalling were also analysed. Our results showed that UA reduced cell viability and tube formation, and increased inflammation and monocytes adhesion in human umbilical vein endothelial cells in a dose-dependent manner. In contrast, phloretin significantly attenuated pro-inflammatory factors expression and endothelial injury induced by UA. Phloretin inhibited the activation of extracellular regulated protein kinases/nuclear factor-kappa B pathway, and reduced GLUT9 and it mediated UA uptake in human umbilical vein endothelial cells. These results indicated that phloretin attenuated UA-induced endothelial injury via a synergic mechanism including direct anti-inflammatory effect and lowering cellular UA uptake. Our study suggested that phloretin might be a promising therapy for hyperuricemia-related cardiovascular diseases. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

The efficacy of febuxostat 10 mg for the prevention of hyperuricemia associated with tumor lysis syndrome (TLS) in Japanese patients with non-Hodgkin's lymphoma
.

PubMed

Yasu, Takeo; Kobayashi, Shunsuke; Horii, Mai; Kurokawa, Yosuke

2016-12-01

Tumor lysis syndrome (TLS) is a life-threatening oncologic emergency. The control of serum uric acid level (UA) is important for prevention of TLS. Febuxostat has demonstrated its superiority over allopurinol in decreasing UA level. We retrospectively evaluated the efficacy of febuxostat 10 mg in prevention of hyperuricemia associated with TLS (HU-TLS) in 12 patients with non-Hodgkin's lymphoma (NHL). Mean UA levels were found to significantly decrease (p = 0.003). HU-TLS was prevented in all patients. Thus, febuxostat 10 mg is effective in prevention of HU-TLS. Future study is need to determine whether the incidence of HU-TLS change with dosage of febuxostat.
.

[Atorvastatin improves reflow after percutaneous coronary intervention in patients with acute ST-segment elevation myocardial infarction by decreasing serum uric acid level].

PubMed

Yan, Ling; Ye, Lu; Wang, Kun; Zhou, Jie; Zhu, Chunjia

2016-05-25

Objective: To investigate the effect of atorvastatin on reflow in patients with acute ST-segment elevation myocardial infarction (STEMI) after percutaneous coronary intervention (PCI) and its relation to serum uric acid levels. Methods: One hundred and fourteen STEMI patients undergoing primary PCI were enrolled and randomly divided into two groups:55 cases received oral atorvastatin 20 mg before PCI (routine dose group) and 59 cases received oral atorvastatin 80 mg before PCI (high dose group). According to the initial serum uric acid level, patients in two groups were further divided into normal uric acid subgroup and hyperuricemia subgroup. The changes of uric acid level and coronary artery blood flow after PCI were observed. Correlations between the decrease of uric acid, the dose of atorvastatin and the blood flow of coronary artery after PCI were analyzed. Results: Serum uric acid levels were decreased after treatment in both groups (all P <0.05), and patients with hyperuricemia showed more significant decrease in serum uric acid level ( P <0.05). Compared with the routine dose group, serum uric acid level in patients with hyperuricemia decreased more significantly in the high dose group ( P <0.05), but no significant difference was observed between patients with normal serum uric acid levels in two groups ( P >0.05). Among 114 patients, there were 19 cases without reflow after PCI (16.7%). In the routine dose group, there were 12 patients without reflow, in which 3 had normal uric acid and 9 had high uric acid levels ( P <0.01). In the high dose group, there were 7 patients without reflow, in which 2 had normal uric acid and 5 had high uric acid ( P <0.05). Logistic regression analysis showed that hyperuricemia was one of independent risk factors for no-reflow after PCI ( OR =1.01, 95% CI :1.01-1.11, P <0.01). The incidence of no-flow after PCI in the routine dose group was 21.8% (12/55), and that in the high dose group was 11.9% (7/59) ( P <0.01). Conclusion: High dose atorvastatin can decrease serum uric acid levels and improve reflow after PCI in patients with STEMI.

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

PubMed

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

Lesinurad

MedlinePlus

... oxidase inhibitor to treat hyperuricemia (high levels of uric acid) in people with gout (sudden attacks of redness, ... is in a class of medications called selective uric acid reabsorption inhibitors. It works by helping the kidneys ...

Phosphorescent inner filter effect-based sensing of xanthine oxidase and its inhibitors with Mn-doped ZnS quantum dots.

PubMed

Tang, Dandan; Zhang, Jinyi; Zhou, Rongxin; Xie, Ya-Ni; Hou, Xiandeng; Xu, Kailai; Wu, Peng

2018-05-10

Overexpression and crystallization of uric acid have been recognized as the course of hyperuricemia and gout, which is produced via xanthine oxidase (XOD)-catalyzed oxidation of xanthine. Therefore, the medicinal therapy of hyperuricemia and gout is majorly based on the inhibition of the XOD enzymatic pathway. The spectroscopic nature of xanthine and uric acid, namely both absorption (near the ultraviolet region) and emission (non-fluorescent) characteristics, hinders optical assay development for XOD analysis. Therefore, the state-of-the-art analysis of XOD and the screening of XOD inhibitors are majorly based on chromatography. Here, we found the near ultraviolet absorption of uric acid overlapped well with the absorption of a large bandgap semiconductor quantum dots, ZnS. On the other hand, the intrinsic weak fluorescence of ZnS QDs can be substantially improved via transition metal ion doping. Therefore, herein, we developed an inner filter effect-based assay for XOD analysis and inhibitor screening with Mn-doped ZnS QDs. The phosphorescence of Mn-doped ZnS QDs could be quenched by uric acid generated from xanthine catabolism by XOD, leading to the phosphorescence turn-off detection of XOD with a limit of detection (3σ) of 0.02 U L-1. Furthermore, the existence of XOD inhibitors could inhibit the XOD enzymatic reaction, resulting in weakened phosphorescence quenching. Therefore, the proposed assay could also be explored for the facile screening analysis of XOD inhibitors, which is important for the potential medicinal therapy of hyperuricemia and gout.

Comparison of febuxostat and allopurinol for hyperuricemia in cardiac surgery patients with chronic kidney disease (NU-FLASH trial for CKD).

PubMed

Sezai, Akira; Soma, Masayoshi; Nakata, Kin-ichi; Osaka, Shunji; Ishii, Yusuke; Yaoita, Hiroko; Hata, Hiroaki; Shiono, Motomi

2015-10-01

The NU-FLASH trial demonstrated that febuxostat was more effective for hyperuricemia than allopurinol. This time, we compared these medications in patients with chronic kidney disease (CKD) from the NU-FLASH trial. In the NU-FLASH trial, 141 cardiac surgery patients with hyperuricemia were randomized to a febuxostat group or an allopurinol group. This study analyzed 109 patients with an estimated glomerular filtration rate (eGFR) ≤60 mL/min/1.73 m(2), and also analyzed 87 patients with stage 3 CKD. The primary endpoint was the serum uric acid level. Secondary endpoints included serum creatinine, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, total cholesterol, triglycerides, low-density lipoprotein, high-density lipoprotein, and high-sensitivity C-reactive protein. Among patients with an eGFR≤60 mL/min/1.73 m(2), uric acid levels were significantly lower in the febuxostat group than the allopurinol group from 1 month of treatment onward. The serum creatinine, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, and high-sensitivity C-reactive protein were also significantly lower in the febuxostat group. Similar results were obtained in the patients with stage 3 CKD. In cardiac surgery patients with renal dysfunction, febuxostat reduced uric acid earlier than allopurinol, had a stronger renoprotective effect than allopurinol, and also had superior antioxidant and anti-inflammatory effects. Copyright © 2015. Published by Elsevier Ltd.

Mangiferin alleviates hypertension induced by hyperuricemia via increasing nitric oxide releases.

PubMed

Yang, Hua; Bai, Wenwei; Gao, Lihui; Jiang, Jun; Tang, Yingxi; Niu, Yanfen; Lin, Hua; Li, Ling

2018-06-06

Mangiferin, a natural glucosyl xanthone, was confirmed to be an effective uric acid (UA)- lowering agent with dual action of inhibiting production and promoting excretion of UA. In this study, we aimed to evaluate the effect of mangiferin on alleviating hypertension induced by hyperuricemia. Mangiferin (30, 60, 120 mg/kg) was administered intragastrically to hyperuricemic rats induced by gavage with potassium oxonate (750 mg/kg). Systolic blood pressure (SBP), serum levels of UA, nitric oxide (NO), C-reactionprotein (CRP) and ONOO - were measured. The mRNA and protein levels of endothelial nitric oxide synthase (eNOS), intercellular adhesion molecule-1 (ICAM-1), CRP were also analyzed. Human umbilical vein endothelial cells (HUVECs) were used in vitro studies. Administration of mangiferin significantly decreased the serum urate level and SBP at 8 weeks and last to 12 weeks. Further more, mangiferin could increase the release of NO and decrease the level of CRP in blood. In addition, mangiferin reversed the protein expression of eNOS, CRP, ICAM-1 and ONOO - in aortic segments in hyperuricemic rats. The results in vitro were consistent with the observed results in vivo. Taken together, these data suggested that mangiferin has played an important part in alleviating hypertension induced by hyperuricemia via increasing NO secretion and improving endothelial function. Copyright © 2018 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

Ketohexokinase C blockade ameliorates fructose-induced metabolic dysfunction in fructose-sensitive mice.

PubMed

Lanaspa, Miguel A; Andres-Hernando, Ana; Orlicky, David J; Cicerchi, Christina; Jang, Cholsoon; Li, Nanxing; Milagres, Tamara; Kuwabara, Masanari; Wempe, Michael F; Rabinowitz, Joshua D; Johnson, Richard J; Tolan, Dean R

2018-04-23

Increasing evidence suggests a role for excessive intake of fructose in the Western diet as a contributor to the current epidemics of metabolic syndrome and obesity. Hereditary fructose intolerance (HFI) is a difficult and potentially lethal orphan disease associated with impaired fructose metabolism. In HFI, the deficiency of aldolase B results in the accumulation of intracellular phosphorylated fructose, leading to phosphate sequestration and depletion, increased adenosine triphosphate (ATP) turnover, and a plethora of conditions that lead to clinical manifestations such as fatty liver, hyperuricemia, Fanconi syndrome, and severe hypoglycemia. Unfortunately, there is currently no treatment for HFI, and avoiding sugar and fructose has become challenging in our society. In this report, through use of genetically modified mice and pharmacological inhibitors, we demonstrate that the absence or inhibition of ketohexokinase (Khk), an enzyme upstream of aldolase B, is sufficient to prevent hypoglycemia and liver and intestinal injury associated with HFI. Herein we provide evidence for the first time to our knowledge of a potential therapeutic approach for HFI. Mechanistically, our studies suggest that it is the inhibition of the Khk C isoform, not the A isoform, that protects animals from HFI.

Cost-effectiveness analysis of febuxostat in patients with gout in Spain.

PubMed

Perez-Ruiz, F; Díaz-Torné, C; Carcedo, D

2016-06-01

Objectives Cost-effectiveness of febuxostat compared with allopurinol in the treatment of hyperuricemia in patients with gout. Methods Costs, clinical outcomes, and QALYs were estimated using a Markov model. Febuxostat 80 mg and 120 mg sequentially, used as first line and second line therapy, was compared with allopurinol 300 mg. Patients switched to the next treatment in the sequence according to a dichotomous response vs no response (target serum urate level < 6 mg/dl outcome) after 3 months of active treatment. A 3% discount rate and 5-year time horizon were applied. National Health System. Results The addition of febuxostat to any therapeutic strategy was an efficient option, with incremental cost-effectiveness ratios (ICER) compared with allopurinol 300 mg ranging from €5268-€9737. Conclusions Febuxostat is a cost-effective treatment in Spain for the management of hyperuricemia in gout patients, with ICERs far below accepted Spanish efficiency thresholds (30 000€/QALY).

Serum Uric Acid Levels and Diabetic Peripheral Neuropathy in Type 2 Diabetes: a Systematic Review and Meta-analysis.

PubMed

Yu, Shuai; Chen, Ying; Hou, Xu; Xu, Donghua; Che, Kui; Li, Changgui; Yan, Shengli; Wang, Yangang; Wang, Bin

2016-03-01

Previous studies suggested a possible association between serum uric acid levels and peripheral neuropathy in patients with type 2 diabetes, but no definite evidence was available. A systematic review and meta-analysis of relevant studies were performed to comprehensively estimate the association. Pubmed, Web of Science, Embase, and China Biology Medicine (CBM) databases were searched for eligible studies. Study-specific data were combined using random-effect or fixed-effect models of meta-analysis according to between-study heterogeneity. Twelve studies were finally included into the meta-analysis, which involved a total of 1388 type 2 diabetic patients with peripheral neuropathy and 4746 patients without peripheral neuropathy. Meta-analysis showed that there were obvious increased serum uric acid levels in diabetic patients with peripheral neuropathy (weighted mean difference [WMD] = 50.03 μmol/L, 95% confidence interval [95%CI] 22.14-77.93, P = 0.0004). Hyperuricemia was also significantly associated with increased risk of peripheral neuropathy in patients with type 2 diabetes (risk ratio [RR] = 2.83, 95%CI 2.13-3.76, P < 0.00001). Meta-analysis of two studies with adjusted risk estimates showed that hyperuricemia was independently associated with increased risk of peripheral neuropathy in type 2 diabetic patients (RR = 1.95, 95%CI 1.23-3.11, P = 0.005). Type 2 diabetic patients with peripheral neuropathy have obvious increased serum uric acid levels, and hyperuricemia is associated with increased risk of peripheral neuropathy. Further prospective cohort studies are needed to validate the impact of serum uric acid levels on peripheral neuropathy risk.

Preparation, characterization and systemic application of self-assembled hydroxyethyl starch nanoparticles-loaded flavonoid Morin for hyperuricemia therapy

PubMed Central

Li, Jianbo; Yang, Yang; Lu, Likang; Ma, Qiujin; Zhang, Jinjie

2018-01-01

Background Morin, one of the most widely distributed flavonoids in plants, has been identified as a potent antihyperuricemic agent. Its poor water solubility and fast in vivo clearance, however, have limited its application in the treatment of hyperuricemia. In this study, a novel amphiphilic polymer (hydroxyethyl starch-deoxycholic acid [HES-DOCA]) was synthesized to overcome these limitations. Methods HES-DOCA conjugates with various substitution degrees were prepared by chemical grafting DOCA to HES through ester formation. The structures of the conjugates were confirmed by infrared spectroscopy and 1H-NMR. Physicochemical characterizations of HES-DOCA nanoparticles-loaded Morin (Morin/HES-DOCA-NPs) were studied using dynamic light scattering and transmission electron microscopy (TEM). In vitro release studies were performed to evaluate the release properties of Morin from the NPs. Subsequently, in vivo pharmacokinetic parameters of Morin/HES-DOCA-NPs were investigated in Wistar rats through intravenous administration (2 mg/kg, equivalent to Morin). Antihyperuricemic efficacy of the NPs was evaluated in a rat hyperuricemic model. Results The optimized HES-based amphiphilic polymer contained approximately 10 DOCA groups per 100 anhydroglucose units of HES, which can spontaneously self-assemble to form spherical NPs as demonstrated by TEM images. Morin/HES-DOCA-NPs were monodispersed (polydispersity index = 0.05) with a mean diameter of 197 nm and exhibited a zeta potential of −14 mV. The use of DOCA as the polymer’s hydrophobic segment enabled high drug loading efficiency (15.6%). After systemic administration, Morin/HES-DOCA-NPs exhibited significantly longer half-life and higher systemic exposure (elimination half-life and area under the plasma concentration–time curve) compared with free drug Morin. In a rat hyperuricemic model, treatment with Morin/HES-DOCA-NPs demonstrated superior therapeutic efficacy over Morin in decreasing serum uric acid level, increasing the uricosuric action, as well as attenuating hyperuricemia-associated inflammation in kidney of rats. Conclusion Collectively, these findings suggest that the novel HES-based NP formulation of Morin may have great potential for clinical treatment of hyperuricemia. PMID:29692610

Risk Factor for Diabetes Mellitus and High Blood Glucose With HMG-CoA Reductase Inhibitors Using a Postmarketing Surveillance Database in Japan.

PubMed

Hashiguchi, Masayuki; Maruyama, Junya; Shimizu, Mikiko; Takahashi, Daichi; Shiga, Tsuyoshi

2018-02-20

To investigate whether 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitor (statin) use is associated with an increased risk of diabetes mellitus and hyperglycemia, we performed a nested case-control study using a postmarketing surveillance database in Japan. The database cohort included 26,849 cases of statin use and 5308 cases of other lipid-lowering drug use in patients with hyperlipidemia. Participants received at least 1 type of statin, had a clear medication history of statin use, and had no complications of diabetes mellitus. Cases were defined as onset of diabetes mellitus or hyperglycemia during statin intake. For each case, 20 controls were randomly selected and matched by time point. The factors associated with an increased risk of diabetes mellitus and hyperglycemia during statin intake examined included sex, age, body mass index, statin use duration, complications, concomitant medication, and clinical laboratory tests. Statin-associated diabetes mellitus or hyperglycemia was identified based on abnormal elevation of blood glucose concentrations beyond the reference range. A total of 19,868 patients met the inclusion criteria, of whom 24 were patients in the case group. Two complicating factors, fatty liver (adjusted odds ratio 16.10) and hyperuricemia (adjusted odds ratio 28.96), were extracted for onset of diabetes mellitus or hyperglycemia. Nonalcoholic fatty liver was associated with diabetes mellitus, obesity, and insulin resistance, and hyperuricemia was associated with lifestyle. This study suggested that the onset of diabetes mellitus or hyperglycemia might be increased with statin use in patients with complications of fatty liver and hyperuricemia. © 2018, The American College of Clinical Pharmacology.

Hyperuricemia, Type 2 Diabetes Mellitus, and Hypertension: an Emerging Association.

PubMed

Mortada, Ibrahim

2017-09-01

Uric acid is the final oxidation product of purine metabolism in circulation and has been associated with the occurrence of gout and kidney stones. Type 2 diabetes mellitus and hypertension are two important public health challenges, and both are linked to increased risk of cardiovascular events. Hyperuricemia has recently emerged as an independent risk factor in the development of type 2 diabetes mellitus and hypertension through several proposed mechanisms. Few clinical trials investigated the use of uric acid lowering agents in the management of these two disease entities; however, their results provided encouraging evidence to a potential role for these agents in fighting disease burden. Larger randomized controlled trials are therefore warranted to establish the role of uric acid as a promising target for novel therapeutic interventions in the management of type 2 diabetes mellitus and hypertension.

Serum uric acid is a GFR-independent long-term predictor of acute and chronic renal insufficiency: the Jerusalem Lipid Research Clinic cohort study

PubMed Central

Kark, Jeremy D.

2011-01-01

Background. Kidney disease is commonly accompanied by hyperuricemia. However, the contribution of serum uric acid (SUA) to kidney injury is debated. Our objective was to assess the long-term prediction of renal failure by SUA. Methods. Visit 2 participants in the Jerusalem Lipid Research Clinic cohort with normal baseline kidney function were followed for 24–28 years. SUA levels were assessed for associations with acute renal failure (ARF) and chronic renal failure (CRF) as defined by hospital discharge records, and mortality, ascertained through linkage with the national population registry. Results. Among 2449 eligible participants (1470 men, 979 women aged 35–78 years in 1976–79), SUA was positively linked with male sex, serum creatinine and components of the metabolic syndrome but was lower in smokers and in diabetic subjects. The 22- to 25-year incidence of hospital-diagnosed kidney failure (145 first events, 67% CRF) and the 24- to 28-year mortality (587 events) were higher in subject with hyperuricemia (>6.5 mg/dL in men and >5.3 mg/dL in women, reflecting the upper quintiles), independent of baseline kidney function and covariates. Hyperuricemia conferred adjusted hazard ratios of 1.36 (P = 0.003), 2.14 (P < 0.001) and 2.87 (P = 0.003) for mortality, CRF and ARF, respectively. Conclusions. SUA predicts renal failure incidence and all-cause mortality independently of demographic and clinical covariates. These results lend support to the undertaking of clinical trials to examine the effect of uric acid-lowering strategies on kidney outcomes. PMID:21220750

GLUT9 influences uric acid concentration in patients with Lesch-Nyhan disease.

PubMed

Torres, Rosa J; Puig, Juan G

2018-06-01

Patients with deficient hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity present hyperuricemia and/or hyperuricosuria, with a variable degree of neurological manifestations. Hyperuricemia in HPRT deficiency is due to uric acid overproduction and is frequently treated with allopurinol. Renal uric acid excretion is sharply increased in these patients. In recent years, several renal tubular urate transporter single nucleotide polymorphisms (SNPs), including those of the GLUT9, ABCG2 and URAT1 genes, have been described that influence the renal handling of uric acid and modulate serum urate levels. In the present study, we analyzed whether GLUT9, ABCG2 and URAT1 gene SNPs are able to influence uric acid levels and allopurinol response in patients with HPRT deficiency. Three SNPs, URAT1 rs11231825, GLUT9 rs16890979 and ABCG2 rs2231142, previously associated in our population with hyperuricemia and gout, were analyzed in 27 patients with HPRT deficiency treated with allopurinol for at least 5 years. Patients with HPRT deficiency having allele A of rs16890979 in the GLUT9 gene present with a lower serum urate concentration at diagnosis, before allopurinol treatment is instituted, and need lower allopurinol doses to maintain serum urate levels between 268 and 446 μmol/L (4.5 and 7.5 mg/dL). No relationship between rs2231142 in the ABCG2 gene or rs11231825 in the URAT1 gene and serum urate levels or allopurinol response was found in our patients with HPRT deficiency. GLUT9 SNPs influence the renal handling of uric acid and modulate serum urate levels and the response to treatment in patients with uric acid overproduction due to HPRT deficiency. © 2018 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans.

PubMed

Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N

2015-11-05

Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.

Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese.

PubMed

Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

2015-05-13

Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10(-13), BCAS3), 9p24.2 (rs12236871, P=1.48 × 10(-10), RFX3) and 11p15.5 (rs179785, P=1.28 × 10(-8), KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis.

A community-based epidemiological study of elevated serum alanine aminotransferase levels in Kinmen, Taiwan

PubMed Central

Liu, Chi-Ming; Tung, Tao-Hsin; Liu, Jorn-Hon; Chen, Victor Tze-Kai; Lin, Ching-Heng; Hsu, Chung-Te; Chou, Pesus

2005-01-01

AIM: To explore any gender-related differences in prevalence of and condition-associated factors related to an elevated serum alanine aminotransferase (ALT) level amongst residents of Kinmen, Taiwan. METHODS: A total of 11 898 of a potential 20 112 regional residents aged 30 years or more completed a related questionnaire that was carried out by the Yang-Ming Crusade between 1991 and 1994 inclusively, with blood samples being collected by public nurses. The overall questionnaire response rate was 59.3% (52.4% for males and 66.0% for females). RESULTS: The prevalence of an elevated serum ALT level for this sub-population was found to be 7.2%, the prevalence revealing a statistically significant decrease with increasing population age (P<0.0001). Males exhibited a greater prevalence of elevated serum ALT level than did females (9.4% vs 5.3%, P<0.0001). Using multiple logistic regression analysis, in addition to male gender, a younger age, greater waist circumference, presence of type-2 diabetes and hyperuricemia were the significant factors associated with an elevated serum ALT level for both males and females. Gender-related differences as regards associated factors were also revealed. For males, obesity was significantly related to an elevated serum ALT level (OR = 1.28, 95%CI: 1.00-1.66) but this was not so for females (OR = 1.09, 95%CI: 0.84-1.42). Hypertriglyceridemia (OR = 1.80, 95%CI: 1.36-2.39) and hyperuricemia (OR = 1.61, 95%CI: 1.03-2.52) were significantly related to elevated serum ALT levels only for females. CONCLUSION: Several gender-related differences were noted pertaining to the prevalence of and relationship between obesity, hypertriglyceridemia and hyperuricemia and elevated serum ALT level in the present study. PMID:15786537

Gout, allopurinol intake and clinical outcomes in the hospitalized multimorbid elderly.

PubMed

Franchi, Carlotta; Salerno, Francesco; Conca, Alessio; Djade, Codjo D; Tettamanti, Mauro; Pasina, Luca; Corrao, Salvatore; Marengoni, Alessandra; Marcucci, Maura; Mannucci, Pier Mannuccio; Nobili, Alessandro

2014-11-01

Increased serum uric acid has been considered a cardiovascular risk factor but no study has assessed its relation with hospital mortality or length of stay. On the basis of data obtained from a prospective registry, the prevalence of gout/hyperuricemia and its association with these and other clinical parameters was evaluated in an Italian cohort of elderly patients acutely admitted to internal medicine or geriatric wards. While the prevalence of gout was calculated by counting patients with this diagnosis hyperuricemia was inferred in patients taking allopurinol at hospital admission or discharge, on the assumption that this drug was only prescribed owing to the finding of high serum levels of uric acid. A series of clinical and demographic variables were evaluated for their association with gout/hyperuricemia. Of 1380 patients, 139 (10%) had a diagnosis of gout or were prescribed allopurinol. They had more co-morbidities (7.0 vs 5.6; P<0.0001) and consumed more drugs (6.8 vs 5.0; P<0.0001). The CIRS (co-morbidity index) was worse in these patients (OR 1.28 95% CI 1.15-1.41). Multivariable regression analysis showed that only renal and heart failures were independently associated with gout/allopurinol intake. Moreover, this combined event was associated with an increased risk of adverse events during hospitalization (OR 1.66, 95% CI 1.16-2.36), but not with the risk of re-hospitalization, length of hospital stay or death. Gout/allopurinol intake has a high prevalence in elderly patients acutely admitted to hospital and are associated with renal and cardiovascular diseases, an increased rate of adverse events and a high degree of drug consumption. In contrast, this finding did not affect the length of hospitalization nor hospital mortality. Copyright © 2014 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

An allopurinol-controlled, multicenter, randomized, double-blind, parallel between-group, comparative study of febuxostat in Chinese patients with gout and hyperuricemia.

PubMed

Huang, Xinfang; Du, Hui; Gu, Jieruo; Zhao, Dongbao; Jiang, Lindi; Li, Xinfu; Zuo, Xiaoxia; Liu, Yi; Li, Zhanguo; Li, Xiangpei; Zhu, Ping; Li, Juan; Zhang, Zhiyi; Huang, Anbin; Zhang, Yuanchao; Bao, Chunde

2014-07-01

Febuxostat, a novel non-purine selective inhibitor of xanthine oxidase, has been identified as a potential alternative to allopurinol in patients with hyperuricemia. The purpose of this study was to compare the urate-lowering (UL) efficacy and safety of daily febuxostat and allopurinol in Chinese gout patients with hyperuricemia. Gout patients (n = 512) with serum uric acid (sUA) concentrations of at least 8.0 mg/dL were randomized to receive daily febuxostat 40 mg or 80 mg or allopurinol 300 mg for 28 weeks. Prophylaxis against gout flares with meloxicam or colchicine was provided during weeks 1 through 8. The primary endpoint was the percentage of subjects achieving a sUA concentration of <6.0 mg/dL at the last three monthly measurements. The primary endpoint was reached in 44.77% of patients receiving 80 mg of febuxostat, 27.33% of those receiving 40 mg of febuxostat, and 23.84% of those receiving allopurinol. The UL efficacy in the febuxostat 80 mg group was higher than in the allopurinol (P < 0.0001) and febuxostat 40 mg (P = 0.0008) groups. The UL efficacy of the febuxostat 40 mg group was statistically non-inferior to that of the allopurinol group. No significant change in the number of tophi was observed during the final visit relative to baseline in each treatment group. The rate of gout flares requiring treatment from weeks 9 through 28 and the incidence of adverse events was similar among treatment groups. The UL efficacy of daily febuxostat 80 mg was greater than that of febuxostat 40 mg and allopurinol 300 mg, which exhibited comparable UL efficacy. Safety of febuxostat and allopurinol was comparable at the doses tested. © 2014 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

Modeling and Simulation for Estimating the Influence of Renal Dysfunction on the Hypouricemic Effect of Febuxostat in Hyperuricemic Patients Due to Overproduction or Underexcretion of Uric Acid.

PubMed

Hirai, Toshinori; Kimura, Toshimi; Echizen, Hirotoshi

2016-01-01

Whether renal dysfunction influences the hypouricemic effect of febuxostat, a xanthine oxidase (XO) inhibitor, in patients with hyperuricemia due to overproduction or underexcretion of uric acid (UA) remains unclear. We aimed to address this question with a modeling and simulation approach. The pharmacokinetics (PK) of febuxostat were analyzed using data from the literature. A kinetic model of UA was retrieved from a previous human study. Renal UA clearance was estimated as a function of creatinine clearance (CLcr) but non-renal UA clearance was assumed constant. A reversible inhibition model for bovine XO was adopted. Integrating these kinetic formulas, we developed a PK-pharmacodynamic (PK-PD) model for estimating the time course of the hypouricemic effect of febuxostat as a function of baseline UA level, febuxostat dose, treatment duration, body weight, and CLcr. Using the Monte Carlo simulation method, we examined the performance of the model by comparing predicted UA levels with those reported in the literature. We also modified the models for application to hyperuricemia due to UA overproduction or underexcretion. Thirty-nine data sets comprising 735 volunteers or patients were retrieved from the literature. A good correlation was observed between the hypouricemic effects of febuxostat estimated by our PK-PD model and those reported in the articles (observed) (r=0.89, p<0.001). The hypouricemic effect was estimated to be augmented in patients with renal dysfunction irrespective of the etiology of hyperuricemia. While validation in clinical studies is needed, the modeling and simulation approach may be useful for individualizing febuxostat doses in patients with various clinical characteristics.

Comparison of Various Anthropometric and Body Fat Indices in Identifying Cardiometabolic Disturbances in Chinese Men and Women

PubMed Central

Zhang, Zhe-qing; Deng, Juan; He, Li-ping; Ling, Wen-hua; Su, Yi-xiang; Chen, Yu-ming

2013-01-01

Background Although many adiposity indices may be used to predict obesity-related health risks, uncertainty remains over which of them performs best. Objective This study compared the predictive capability of direct and indirect adiposity measures in identifying people at higher risk of metabolic abnormalities. Methods This population-based cross-sectional study recruited 2780 women and 1160 men. Body weight and height, waist circumference (WC), and hip circumference (HC) were measured and body mass index (BMI), waist-to-hip ratio (WHR), and waist-to-height ratio (WHtR) were calculated. Body fat (and percentage of fat) over the whole body and the trunk were determined by bioelectrical impedance analysis (BIA). Blood pressure, fasting lipid profiles, and glucose and urine acid levels were assessed. Results In women, the ROC and the multivariate logistic regression analyses both showed that WHtR consistently had the best performance in identifying hypertension, dyslipidemia, hyperuricemia, diabetes/IFG, and metabolic syndrome (MetS). In men, the ROC analysis showed that WHtR was the best predictor of hypertension, WHtR and WC were equally good predictors of dyslipidemia and MetS, and WHtR was the second-best predictor of hyperuricemia and diabetes/IFG. The multivariate logistic regression also found WHtR to be superior in discriminating between MetS, diabetes/IFG, and dyslipidemia while BMI performed better in predicting hypertension and hyperuricemia in men. The BIA-derived indices were the second-worst predictors for all of the endpoints, and HC was the worst. Conclusion WHtR was the best predictor of various metabolic abnormalities. BMI may be used as an alternative measure of obesity for identifying hypertension in both sexes. PMID:23951031

A phase 3, multicenter, randomized, allopurinol-controlled study assessing the safety and efficacy of oral febuxostat in Chinese gout patients with hyperuricemia.

PubMed

Xu, Shaoyong; Liu, Xiangyang; Ming, Jie; Chen, Shenren; Wang, Yangang; Liu, Xiumei; Liu, Hong; Peng, Yongde; Wang, Jianqin; Lin, Jinying; Ji, Haiwang; Liu, Bin; Lu, Ying; Liu, Peng; Zhang, Yonghong; Ji, Qiuhe

2015-07-01

To compare the efficiency and safety of febuxostat with those of allopurinol in Chinese patients with gout and hyperuricemia. The trial which was conducted at 13 centers in China during 2011-2013 included a 2-week run-in and a 24-week treatment period. A total of 504 eligible participants with gout and with serum urate ≥ 480 μmol/L were randomly assigned 1 : 1 : 1 to febuxostat 40 mg/day, febuxostat 80 mg/day and allopurinol 300 mg/day groups. The primary efficacy endpoint was the percentage of subjects whose last three serum urate levels were < 360 μmol/L. The primary efficacy endpoint was reached by 33.5% of subjects taking febuxostat 80 mg/day, 22.5% of those taking febuxostat 40 mg/day and 17.0% of those taking allopurinol 300 mg/day (P < 0.001 for the comparison between febuxostat 80 mg/day and allopurinol 300 mg/day groups; P = 0.216 for the comparison between febuxostat 40 mg/day and allopurinol 300 mg/day groups). The incidence of gout flare was relatively high in each group during the first 8 weeks and gradually decreased thereafter. There was no statistically significant difference between the three groups (P > 0.05). The incidence of adverse events was similar in the three treatment groups. The most frequent treatment-related adverse events were liver function test abnormalities. Febuxostat 80 mg/day had superior urate-lowering efficacy to that of febuxostat 40 mg/day or allopurinol 300 mg/day, which was comparable in Chinese gout patients with hyperuricemia. Febuxostat, at a daily dose of 40 or 80 mg, was safe and well tolerated. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

An inverted J-shaped association of serum uric acid with muscle strength among Japanese adult men: a cross-sectional study

PubMed Central

2013-01-01

Background Uric acid (UA) may protect muscle function from oxidative damage due to reactive oxygen species through its powerful antioxidant capacity. However, several studies have demonstrated that hyperuricemia is closely related to systemic inflammation and has oxidant properties effects, both of which may increase the risk of muscle strength loss. The purpose of this study was to examine the association of serum UA concentration with grip strength and leg extension power in adult men. Methods This study is a cross-sectional survey in which 630 Japanese male employees aged 30 years and older participated. Five hundred and eighty-six subjects participated in the measurement of grip strength, and 355 subjects participated in the measurement of leg extension power. Blood samples were obtained for serum UA analysis. Results After adjustment for potential confounders, grip strength differed significantly between participants with and those without hyperuricemia (geometric mean and 95% confidence interval [CI]: 40.3 [39.2–41.3] kg vs. 41.9 [41.3–42.5] kg; P = 0.01). In addition, serum UA levels (quartiles) showed an inverted J-shaped curve with grip strength (mean and 95% CI: Q1, 41.6 [40.6–42.6] kg; Q2, 42.2 [41.2–43.2] kg; Q3, 41.8 [40.8–42.8] kg; Q4, 40.4 [39.3–41.4] kg; P for quadratic trend = 0.05). The results in the leg extension power group were similar to those observed in the grip strength group. Conclusion This population-based cross-sectional study shows for the first time that hyperuricemia is associated with poor muscle strength. Moreover, the results indicate an inverted J-shaped association between serum UA quartiles and muscle strength. PMID:24000893

Association of serum uric acid with aortic stiffness and pressure in a Chinese workplace setting.

PubMed

Chen, Xin; Li, Yan; Sheng, Chang-Sheng; Huang, Qi-Fang; Zheng, Yang; Wang, Ji-Guang

2010-04-01

In the present analysis, we investigated the association of serum uric acid with aortic stiffness and pressure as measured by carotid-femoral pulse wave velocity (cf-PWV) and central systolic blood pressure (SBP), respectively. Our study was conducted in the framework of cardiovascular health examinations for the employees of a factory and their family members (ages 15-79 years). We performed arterial measurements using the SphygmoCor device. Hyperuricemia was defined as a serum uric acid concentration of at least 420 micromol/l in men and 360 micromol/l in women. The 940 study participants included 207 (22.0%) hypertensive patients, of whom 92 (9.8%) took antihypertensive medication. Men (n = 620), compared with women (n = 320), had significantly (P < or = 0.03) higher serum uric acid concentration (363 +/- 76 vs. 272 +/- 64 micromol/l), prevalence of hyperuricemia (17.9% vs. 7.5%), cf-PWV (7.41 vs. 7.16 m/s), and central SBP (114.4 vs. 108.8 mm Hg). Both before and after adjustment for age, serum uric acid was significantly (P < or = 0.02) and positively associated with cf-PWV and central SBP in all subjects and in men and women separately. After full adjustment for covariates, the association with cf-PWV remained statistically significant (P < or = 0.009) in all subjects and men, and with central SBP in all subjects only. Categorical analyses were confirmatory. In all subjects, patients with hyperuricemia had significantly (P = 0.03) higher cf-PWV (7.51 vs. 7.29 m/s) and central SBP (114.9 vs. 112.1 mm Hg) than those with normal serum uric acid. Serum uric acid was associated with aortic stiffness and pressure in a Chinese workplace setting, especially in men.

Effect of losartan versus candesartan on uric acid, renal function, and fibrinogen in patients with hypertension and hyperuricemia associated with diuretics.

PubMed

Rayner, Brian L; Trinder, Yvonne A; Baines, Donette; Isaacs, Sedick; Opie, Lionel H

2006-02-01

Hyperuricemia may counter benefits of blood pressure (BP) reduction, although this is controversial. We examined the effects of candesartan and losartan on uric acid, creatinine, and fibrinogen. Patients with hypertension and serum uric acid > or = 0.42 mmol/L (7 mg/dL) associated with diuretics were randomized to receive losartan 50 to 100 mg or candesartan 8 to 16 mg for 24 weeks. At randomization and after 24 weeks, systolic and diastolic BP, serum uric acid, creatinine, and fibrinogen were measured. A total of 59 patients were entered into the study (30 in the losartan and 29 in the candesartan group). Mean systolic and diastolic BP were reduced in the candesartan group, from 156 mm Hg at baseline to 132 mm Hg at 24 weeks, and from 90.9 to 80.8 mm Hg respectively, P < .0001), and in the losartan group from 150.3 to 132 mm Hg and from 89.6 to 77.6 respectively, P < 0001). Overall mean values of fibrinogen levels were again reduced from 4.39 g/L at baseline to 4.01 g/L at 24 weeks (P < .02). Mean values of serum uric acid in the losartan and candesartan groups were similar at baseline (0.44 and 0.46 mmol/L, respectively), but they were lower in the losartan group after 24 weeks (0.39 and 0.48 mmol/L, P = .01). Twelve patients (44%) in the candesartan group had a 10% increase in serum creatinine compared with four patients (14.2%) in the losartan group (P < .02). Candesartan and losartan lowered BP, but only losartan reduced uric acid. The lowering of fibrinogen in both groups may explain the reduction in stroke with angiotensin receptor blockers. The effect of persistent hyperuricemia on renal function requires further study.

Hyperuricemia in the inhabitants of the Marshall Islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adams, W.H.; Harper, J.A.; Heotis, P.M.

1984-06-01

Annual medical examinations are conducted by Brookhaven National Laboratory (BNL) for a population of Marshallese who were accidentally exposed to radioactive fallout in 1954, for a comparison population, and for all inhabitants of the atolls of Rongelap and Utirik. Disease surveillance includes analysis of serum samples. Elevated serum uric acid (SUA) levels are common along Pacific populations, and modifying environmental factors have been investigated as a cause for this finding. The authors have studied SUA levels of people living in the Marshall Islands, and have found elevated values similar to those reported for other Micronesian populations. The nearly Gaussian distributionmore » of individual serum uric acid values for men, and for women less than or equal to45 years of age, indicates that the elevation is due to a regularized increase in serum uric acid rather than to a subpopulation that has pathologic hyperuricemia. The higher serum uric acid levels appear, therefore, to be normal for the Marshallese, a conclusion supported by the infrequency of clinical gout in the population tested.« less

Evaluation of cardiovascular risk in stages of gout by a complex multimodal ultrasonography.

PubMed

Gancheva, Rada; Kundurdjiev, Atanas; Ivanova, Mariana; Kundurzhiev, Todor; Kolarov, Zlatimir

2017-01-01

The aim of our work was to assess ultrasound features of cardiovascular (CV) risk in stages of gout. Cross-sectional complex multimodal ultrasound study of 169 age-matched patients, with similar distribution of arterial hypertension, diabetes mellitus, obesity and chronic renal failure, was divided into four groups: 41 with asymptomatic hyperuricemia, 52 gout without tophi, 42 gouty tophi and 34 controls with osteoarthritis. Parameters independently associated with CV risk were measured: renal resistive index (RRI), left ventricular mass index (LVMi), mitral annulus early diastolic velocity (e'), intima-media thickness (IMT) and common carotid artery resistive index (CCARI). Multivariate analyses were performed to evaluate the impact of gout stages and CV risk factors on ultrasound alterations. Gouty tophi increased the risk of having IMT >0.90 mm with an OR 11.51 (95 % CI 2.32-57.21, p = 0.003), gout without tophi raised the risk with an OR 6.25 (95 % CI 1.37-28.44, p = 0.018), while asymptomatic hyperuricemia had no effect on IMT. The category of CCARI >0.70 was influenced by tophi with an OR 11.18 (95 % CI 2.61-47.83, p = 0.001) and by arterial hypertension with an OR 3.22 (95 % CI 1.11-9.36, p = 0.032). Neither asymptomatic hyperuricemia nor gout without tophi modified the development of abnormally high CCARI. Gout stages had no impact on LVMi, e' and RRI. Tophi are related to worsened ultrasonographic parameters evaluating target organs in gout, relative to earlier stages of the disease. They create a strong risk of carotid arteries' changes even beyond arterial hypertension.

Hyperferritinemia increases the risk of hyperuricemia in HFE-hereditary hemochromatosis.

PubMed

Flais, Jérémy; Bardou-Jacquet, Edouard; Deugnier, Yves; Coiffier, Guillaume; Perdriger, Aleth; Chalès, Gérard; Ropert, Martine; Loréal, Olivier; Guggenbuhl, Pascal

2017-05-01

Hyperuricemia is becoming increasingly frequent in the population, and is known to be sometimes the cause of gout. The impact of uric acid is still not clearly understood, however. The iron metabolism may interact with the uric acid metabolism. The aim of this study was to examine the relationship between the serum uric acid and serum ferritin levels in a cohort of hemochromatosis patients who were homozygous for the HFE p.Cys282Tyr mutation. 738 patients with the HFE gene mutation Cys282Tyr in the homozygous state were included in the study. The variables measured during the initial evaluation were compared in univariate analysis by Student's t test. In multivariate analysis, linear stepwise regression was used. In the group of hyperuricemic patients, ferritinemia was significantly higher than in the group of non-hyperuricemic patients (1576.7±1387.4μg/l vs. 1095.63±1319.24μg/l, P<0.005). With multivariate analysis, only ferritin and BMI independently explained the uricemia (R 2 =0.258) after adjustment for age, glycemia and CRP. The correlation between uricemia and log(ferritin) with partial regression correlation coefficients was 0.307 (P<0.01). The increase in uricemia is associated with the increase in ferritin in a population of patients who were homozygous for the HFE gene mutation p.Cys282Tyr and this independently of factors commonly associated with hyperuricemia. The increase in uric acid associated with hyperferritinemia, could be a response to the visceral toxicity of excess non-transferrin bound iron linked to oxidative stress via the antioxidant properties of uric acid. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Gout in African Americans.

PubMed

Krishnan, Eswar

2014-09-01

African Americans have a substantially higher prevalence of risk factors for gout than Caucasians. The aim of the present study was to compare the risk for incident gout among African Americans and Caucasians. Incidence rates of physician-diagnosed gout among 11,559 Caucasian men and 931 African American men aged 35 to 57 years and at high cardiovascular risk, observed for 7 years as a part of the Multiple Risk Factor Intervention Trial, were analyzed. Cox regression models were used to account for potential confounding by age, body mass index, diuretic use, hypertension and diabetes status, aspirin and alcohol consumption, and kidney disease. At baseline, after accounting for risk factors, African Americans had a 14% lower prevalence of hyperuricemia than Caucasians. Incidence of gout increased with increasing prevalence of risk factors in both Caucasians and African Americans. Ethnic disparities in incidence rates were most apparent among those without other risk factors for gout. In separate Cox regression models, after accounting for risk factors, African American ethnicity was associated with a hazard ratio of 0.78 (95% confidence interval [CI], 0.66-0.93) for physician-diagnosed gout and 0.88 (95% CI, 0.85-0.90) for incident hyperuricemia. Significant interactions were observed; the association was the strongest (hazard ratio 0.47; 0.37-0.60). These associations were unaffected by addition of serum urate as a covariate or by using alternate case definitions for gout. After accounting for the higher prevalence of risk factors, African American ethnicity is associated with a significantly lower risk for gout and hyperuricemia compared with Caucasian ethnicity. Copyright © 2014 Elsevier Inc. All rights reserved.

Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

PubMed Central

Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

2010-01-01

The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

Comparative pharmacokinetic study of the main components of cortex fraxini after oral administration in normal and hyperuricemic rats.

PubMed

Wang, Yinan; Zhao, Min; Ye, Hao; Shao, Yizhen; Yu, Yongbo; Wang, Miao; Zhao, Chunjie

2017-08-01

Cortex Fraxini is an important traditional Chinese herbal medicine used for the treatment of gout and hyperuricemia. An efficient and rapid ultra-performance liquid chromatography mass spectrometry method was developed and validated for simultaneous quantitation of six coumarins (aesculin, fraxin, aesculetin, fraxetin, sopoletin and 7-hydroxycoumarin) in normal and hyperuricemic rats plasma after oral administration of Cortex Fraxini. The method could successfully be applied for pharmacokinetics studies. The pharmacokinetic behavior of six coumarins in normal and hyperuricemia rats plasma was determined. Results showed that, for some of analytes, the pharmacokinetic parameters (AUC 0-t , AUC 0-∞ , C max , T max and CL) were significantly different between normal and hyperuricemic rats. The different pharmacokinetic parameters might result from renal impairment or a change of metabolic enzymes in the pathological state. The pharmacokinetic study in pathological state could provide more useful information to guide the clinical use of traditional Chinese herbal medicine. Copyright © 2017 John Wiley & Sons, Ltd.

Prevention and treatment of hyperuricemia with rasburicase in children with leukemia and non-Hodgkin's lymphoma.

PubMed

Rényi, Imre; Bárdi, Edit; Udvardi, Erzsébet; Kovács, Gábor; Bartyik, Katalin; Kajtár, Pál; Masát, Péter; Nagy, Kálmán; Galántai, Ilona; Kiss, Csongor

2007-01-01

To prevent acute renal failure in children at risk for developing tumor lysis syndrome due to acute lymphoblastic leukemia or non-Hodgkin's lymphoma treated according to international BFM protocols, we investigated recombinant urate oxidase (rasburicase) in the first Central European openlabeled, prospective, multicenter phase IV trial. Rasburicase was administered intravenously, at 0.2 mg/kg for 5 consecutive days to 36 patients. Blood levels of uric acid, creatinine, phosphorus, calcium, lactate dehydrogenase and complete blood count were measured daily during rasburicase treatment and on days 6, 7 and 12. Initial uric acid level decreased significantly by 4 hours (from 343 micromol/L to 58 micromol/L, p<0.001), except for one steroid-resistant patient who required hemodialysis on day 14 after having introduced combined cytostatic treatment. Comparing the data of a subgroup of 12 patients receiving rasburicase with that of a historic cohort of 14 patients treated with allopurinol indicated the superiority of rasburicase over allopurinol in prophylaxis and treatment of hyperuricemia in children with leukemia and lymphoma.

[Acute encephalopathy due to late-onset maple syrup urine disease in a school boy].

PubMed

Qu, Su-Qing; Yang, Li-Cai; Luan, Zuo; Du, Kan; Yang, Hui

2012-03-01

Maple syrup urine disease is a common amino acids metabolic disease. In most patients, onset occurs in the neonatal period and infancy. In this study, the case of a school boy with acute encephalopathy due to late-onset maple syrup urine disease is summarized. The boy (8.5 years) was admitted because of acute encephalopathy after suffering from infection for two days at the age of eight and a half years. Metabolic acidosis, hyperuricemia and decreased protein level in cerebrospinal fluid were found by general laboratory tests. Magnetic resonance imaging of the brain revealed signal intensity abnormalities in the bilateral cerebellum dentate nucleus, brainstem, thalamus, putamen, caudate nucleus and cortex of the cerebral hemispheres. On T1WI and T2WI scanning, hyperintensive signal was found. Blood leucine and valine were significantly elevated. Urinary 2-hydroxy isovaleric acid, 3-hydroxybutyric acid, 2-keto isovaleric acid, and 2-keto acid also increased. Both the blood amino acid and urine organic acid profiles led to the diagnosis of maple syrup urine disease. In the acute period, the patient was treated with a large dose of vitamin B1, glucose, L-carnitine and a protein-restrict diet. The patient's condition improved significantly after five days of treatment, and he recovered completely two days later. Afterwards, treatment with vitamin B1, L-carnitine and a protein-restrict diet (1 g/kg/day) was continued. One and a half months later, blood amino acids and urine organic acids returned to normal. Magnetic resonance imaging of the brain also indicated a great improvement. It was concluded that inborn metabolic disease should be considered in the patients with an onset similar to acute encephalopathy. Early diagnosis and proper treatment can prevent brain damage and improve prognosis.

Purine derivate content and amino acid profile in larval stages of three edible insects.

PubMed

Bednářová, Martina; Borkovcová, Marie; Komprda, Tomáš

2014-01-15

Considering their high content of protein, insects are a valuable alternative protein source. However, no evaluation of their purine content has so far been done. High content of purine derivates may lead to the exclusion of such food from the diet of people with specific diseases. The aim of this study was to analyse the content of selected purine derivates and amino acid profile in the three insect species most often used for entomophagy in Europe and compare them with the purine content in egg white and chicken breast. The content of individual purine derivates and their total content were significantly dependent on insect species. The purine content in all three species was significantly higher (P < 0.05) than in egg white, but some values were significantly lower (P < 0.05) than in chicken breast. The total protein content was 548.9 g kg(-1) dry matter (DM) in mealworm (Tenebrio molitor), 551.6 g kg(-1) DM in superworm (Zophobas atratus) and 564.9 g kg(-1) DM in cricket (Gryllus assimilis). Larvae of mealworm and superworm are protein-rich and purine-low meat alternatives. In contrast, cricket nymphs are protein-rich and purine-rich and cannot be recommended for people with hyperuricemia or gout. © 2013 Society of Chemical Industry.

[Consensus document for the detection and management of chronic kidney disease].

PubMed

Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador

2014-11-01

Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014. Published by Elsevier Espana.

Protection by Purines in Toxin Models of Parkinson’s Disease

DTIC Science & Technology

2014-08-01

Nucleoside transport and metabolism in erythrocytes from the Yucatan miniature pig. Evidence that inosine functions as an in vivo energy substrate...BJ, Choi HK. Prevalence of gout and hyperuricemia in the us general population: The national health and nutrition examination survey 2007–2008

Complex Analysis of Urate Transporters SLC2A9, SLC22A12 and Functional Characterization of Non-Synonymous Allelic Variants of GLUT9 in the Czech Population: No Evidence of Effect on Hyperuricemia and Gout

PubMed Central

Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

2014-01-01

Objective Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. Methods The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. Results We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Conclusion Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9. PMID:25268603

Cichorium intybus L. promotes intestinal uric acid excretion by modulating ABCG2 in experimental hyperuricemia.

PubMed

Wang, Yu; Lin, Zhijian; Zhang, Bing; Nie, Anzheng; Bian, Meng

2017-01-01

Excessive production and/or reduced excretion of uric acid could lead to hyperuricemia, which could be a major cause of disability. Hyperuricemia has received increasing attention in the last few decades due to its global prevalence. Cichorium intybus L., commonly known as chicory, is a perennial herb of the asteraceae family. It was previously shown to exert potent hypouricemic effects linked with decreasing uric acid formation in the liver by down-regulating the activity of xanthine oxidase, and increasing uric acid excretion by up-regulating the renal OAT3 mRNA expression. The present study aimed to evaluate its extra-renal excretion and possible molecular mechanism underlying the transporter responsible for intestinal uric acid excretion in vivo. Chicory was administered intragastrically to hyperuricemic rats induced by drinking 10% fructose water. The uricosuric effect was evaluated by determining the serum uric acid level as well as the intestinal uric acid excretion by HPLC. The location and expression levels of ATP-binding cassette transporter, sub-family G, member 2 (ABCG2) in jejunum and ileum were analyzed. The administration of chicory decreased the serum uric acid level significantly and increased the intestinal uric acid excretion obviously in hyperuricemic rats induced by 10% fructose drinking. Staining showed that ABCG2 was expressed in the apical membrane of the epithelium and glands of the jejunum and ileum in rats. Further examination showed that chicory enhanced the mRNA and protein expressions of ABCG2 markedly in a dose-dependent manner in jejunum and ileum. These findings indicate that chicory increases uric acid excretion by intestines, which may be related to the stimulation of intestinal uric acid excretion via down-regulating the mRNA and protein expressions of ABCG2.

Association of four genetic loci with uric acid levels and reduced renal function: the J-SHIPP Suita study.

PubMed

Tabara, Yasuharu; Kohara, Katsuhiko; Kawamoto, Ryuichi; Hiura, Yumiko; Nishimura, Kunihiro; Morisaki, Takayuki; Kokubo, Yoshihiro; Okamura, Tomonori; Tomoike, Hitonobu; Iwai, Naoharu; Miki, Tetsuro

2010-01-01

Recent genome-wide association studies have identified several genetic variants as susceptibility loci for serum uric acid (UA) levels. We also identified a common nonsense mutation, W258X, responsible for renal hypouricemia. Here, we investigated clinical implications of these genetic variants by cross-sectional and longitudinal genetic epidemiological analysis. The study enrolled 5,165 Japanese subjects aged 64 ± 12 years from the general population. Clinical parameters were obtained from the personal health records, evaluated at medical checkups. Serum UA levels were significantly different between the SLC22A12 rs11231825 (CC/CT/TT: 4.5 ± 1.6, 5.0 ± 1.4, 5.3 ± 1.4 mg/dl; p = 7.6 × 10(-20)), SLC2A9 rs1014290 (TT/TG/GG: 4.9 ± 1.4, 5.1 ± 1.4, 5.3 ± 1.4 mg/dl; p = 3.1 × 10(-11)) and ABCG2 rs2231142 (TT/TG/GG: 5.3 ± 1.5, 5.2 ± 1.4, 5.1 ± 1.4 mg/dl; p = 2.0 × 10(-5)) genotypes. During 9.4 years of follow-up, 87 new cases of hyperuricemia were diagnosed. Multiple logistic regression analysis identified the accumulation of risk alleles as a significant determinant of future development of hyperuricemia (OR = 7.94; 95% CI: 1.97-53.6). In contrast, subjects with nonsense mutation predominantly showed lower UA levels (XX/XW/WW: 1.3 ± 1.7, 3.6 ± 1.0, 5.2 ± 1.4 mg/dl; p = 9.3 × 10(-82)). However, these subjects showed significantly reduced renal function (β = -0.111; p < 0.001) independently of possible covariates. Accumulation of risk genotypes was an independent risk factor for future development of hyperuricemia. Genetically developed hypouricemia was an independent risk factor for decreased renal function. Copyright © 2010 S. Karger AG, Basel.

Low-level lead exposure and the prevalence of gout: an observational study.

PubMed

Krishnan, Eswar; Lingala, Bharathi; Bhalla, Vivek

2012-08-21

Blood lead levels (BLLs) less than 1.21 µmol/L (<25 µg/dL) among adults are considered acceptable by current national standards. Lead toxicity can lead to gouty arthritis (gout), but whether the low lead exposure in the contemporary general population confers risk for gout is not known. To determine whether BLLs within the range currently considered acceptable are associated with gout. Population-based cross-sectional study. The National Health and Nutrition Examination Survey for 2005 through 2008. 6153 civilians aged 40 years or older with an estimated glomerular filtration rate greater than 10 mL/min per 1.73 m2. Outcome variables were self-reported physician diagnosis of gout and serum urate level. Blood lead level was the principal exposure variable. Additional data collected were anthropometric measures, blood pressure, dietary purine intake, medication use, medical history, and serum creatinine concentration. The prevalence of gout was 6.05% (95% CI, 4.49% to 7.62%) among patients in the highest BLL quartile (mean, 0.19 µmol/L [3.95 µg/dL]) compared with 1.76% (CI, 1.10% to 2.42%) among those in the lowest quartile (mean, 0.04 µmol/L [0.89 µg/dL]). Each doubling of BLL was associated with an unadjusted odds ratio of 1.74 (CI, 1.47 to 2.05) for gout and 1.25 (CI, 1.12 to 1.40) for hyperuricemia. After adjustment for renal function, diabetes, diuretic use, hypertension, race, body mass index, income, and education level, the highest BLL quartile was associated with a 3.6-fold higher risk for gout and a 1.9-fold higher risk for hyperuricemia compared with the lowest quartile. Blood lead level does not necessarily reflect the total body lead burden. Blood lead levels in the range currently considered acceptable are associated with increased prevalence of gout and hyperuricemia.

Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

PubMed

Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

2014-01-01

Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

Head fat is a novel method of measuring metabolic disorder in Chinese obese patients

PubMed Central

2014-01-01

Background Body adiposity, especially ectopic fat accumulation, has a range of metabolic and cardiovascular effects. The aim of this study was to investigate the association between head fat and metabolic values in Chinese obese patients. Methods Data of this cross-sectional study from 66 obese patients were collected. Fat distribution was measured by dual-energy X-ray absorptiometry, and data of body weight, body mass index (BMI), neck circumference (NC), waist circumference (WC), hip circumference (HC), visceral index, basal metabolism (BM), glucose metabolism, lipid levels, uric acid (UA) had been collected. Results 1) Head fat was significantly associated with BMI, WC, HC, visceral index, BM, total fat and total fat excluding head fat in both males and females (p < 0.05). Head fat was positively correlated with upper limb fat, trunk fat, weight, fasting plasma C peptide, fasting plasma insulin and UA in women(p < 0.05), and the association was not statistically significant in male (p > 0.05). Head fat was positively corrected with NC in males (p < 0.05) but not females (p > 0.05). There was no significant correlation between head fat and fasting plasma glucose, total choleslerolemia, triglyceridemia, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and free fat acid in either gender (p > 0.05). 2) Receiver operating characteristic analysis showed that a head fat of 1925.6 g and a head fat of 1567.85 g were the best cut-off values to determine subjects with low high-density lipoprotein cholesterol and hyperuricemia respectively. Conclusions Head fat accumulation was closely associated with increased body fat, hyperinsulinemia, hyperuricemia, and impared lipid profile, suggesting it might be used as an indicator for dyslipidemia and hyperuricemia. PMID:25015267

Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese

PubMed Central

Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

2015-01-01

Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10−13, BCAS3), 9p24.2 (rs12236871, P=1.48 × 10−10, RFX3) and 11p15.5 (rs179785, P=1.28 × 10−8, KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis. PMID:25967671

Effects of febuxostat on serum urate level in Japanese hyperuricemia patients.

PubMed

Yamamoto, Tetsuya; Hidaka, Yuji; Inaba, Masaaki; Ishimura, Eiji; Ooyama, Hiroshi; Kakuda, Hirokazu; Moriwaki, Yuji; Higami, Kenshi; Ohtawara, Akira; Hosoya, Tatsuo; Nishikawa, Hazime; Taniguchi, Atsuo; Ueda, Takanori; Yamauchi, Takahiro; Fujimori, Shin; Mineo, Ikuo; Yamanaka, Hisashi

2015-09-01

We assessed the efficacy and adverse effects of febuxostat in male hyperuricemia patients. This was a 12-week, multicenter, open-label, uncontrolled study. The enrolled subjects were 89 hyperuricemic male patients (12 overexcretors, 56 normal excretors, and 21 underexcretors). The endpoint was percent change in serum urate level. The concentration of urate in serum before and 12 weeks after beginning administration of febuxostat in the overexcretors was 9.34 ± 1.48 and 5.59 ± 1.17 mg/dl, respectively, while those were 8.59 ± 1.24 and 5.41 ± 1.35 mg/dl, respectively, in the normal excretors, and 8.29 ± 1.01and 5.11 ± 1.71 mg/dl, respectively, in the underexcretors. After 12 weeks, the rate of change in serum urate after beginning administration of febuxostat was - 0.384 ± 0.186 in the overexcretors, - 0.368 ± 0.128 in the normal excretors, and - 0.365 ± 0.217 in the underexcretors, with no significant differences among them. A common adverse event related to febuxostat was gout flare. Febuxostat effectively reduced the concentration of urate in serum in hyperuricemic patients regardless of the level of uric acid excreted in urine without severe adverse effects.

The kidney in hyperuricemia and gout.

PubMed

Mount, David B

2013-03-01

Gout is a painful inflammatory arthritis associated with hyperuricemia, with a prevalence of almost 10 million in the USA. Reduced renal excretion of urate is the underlying hyperuricemic mechanism in the vast majority of gout patients; most of the genes that affect serum urate level (SUA) encode urate transporters or associated regulatory proteins. Acquired influences can also modulate SUA and renal urate excretion, sometimes precipitating acute gout. Coincidentally, the prevalence of renal comorbidities in gout - hypertension, chronic kidney disease (CKD), and nephrolithiasis - is very high. Recent advances in genetics and molecular physiology have greatly enhanced the understanding of renal reabsorption and secretion of filtered urate. Moreover, baseline SUA appears to be set by the net balance of absorption and secretion across epithelial cells in the kidney and intestine. There have also been substantial advances in the management of gout in patients with CKD. The stage is set for an increasingly molecular understanding of baseline and regulated urate transport by the kidney and intestine. The increasing prevalence of gout with CKD will be balanced by an expanding spectrum of therapeutic options for this important disease.

[Consensus document for the detection and management of chronic kidney disease].

PubMed

Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador

2014-11-01

Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

Correlation between epicardial fat thickness and biochemical markers of metabolic risk.

PubMed

Rubio-Guerra, Alberto Francisco; Benítez-Maldonado, Daniel Rabindranath; Lozano-Nuevo, José Juan; Arana-Pazos, Karla Corina; Huerta-Ramirez, Saul; Narváez-Rivera, Jorge Luis

2018-02-28

Epicardial fat has been associated with increased cardiovascular risk and the development of atherosclerosis. Transthoracic echocardiography provides a reliable measurement of epicardial fat thickness (EFT). The aim of this study is to evaluate the relationship between EFT and biochemical parameters of metabolic risk. We assessed 211 patients who underwent echocardiography; EFT was measured by two cardiologists. In addition, patients' glycaemia, lipid profile and serum uric acid were measured. Statistical analysis was performed with the Pearson coefficient test and Odds ratio. A positive correlation between EFT with glycaemia (r=.064), total serum cholesterol (r=.0056), high density lipoproteins (r=-.038), or with triglycerides (r=.118) was not observed. However, we did find a significant positive correlation between EFT and serum uric acid (r=.415, P<.00001). The odds ratio for EFT>3mm in patients with hyperuricemia was 6.26 (IC 95 2.79-14, P<.0001). Hyperuricemia is strongly associated with EFT in Mexican patients; EFT is a useful tool for global cardiovascular risk calculation. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

Coffee, tea, and caffeine consumption and serum uric acid level: the third national health and nutrition examination survey.

PubMed

Choi, Hyon K; Curhan, Gary

2007-06-15

Coffee is one of the most widely consumed beverages in the world and may affect serum uric acid levels and risk of gout via various mechanisms. Our objective was to evaluate the relationship between coffee, tea, and caffeine intake and serum uric acid level in a nationally representative sample of men and women. Using data from 14,758 participants ages >/=20 years in the Third National Health and Nutrition Examination Survey (1988-1994), we examined the relationship between coffee, tea, and caffeine intake and serum uric acid level using linear regression. Additionally, we examined the relationship with hyperuricemia (serum uric acid >7.0 mg/dl among men and >5.7 mg/dl among women) using logistic regression. Intake was assessed by a food frequency questionnaire. Serum uric acid level decreased with increasing coffee intake. After adjusting for age and sex, serum uric acid level associated with coffee intake of 4 to 5 and >/=6 cups daily was lower than that associated with no intake by 0.26 mg/dl (95% confidence interval [95% CI] 0.11, 0.41) and 0.43 mg/dl (95% CI 0.23, 0.65; P for trend < 0.001), respectively. After adjusting for other covariates, the differences remained significant (P for trend < 0.001). Similarly, there was a modest inverse association between decaffeinated coffee intake and serum uric acid levels (multivariate P for trend 0.035). Total caffeine from coffee and other beverages and tea intake were not associated with serum uric acid levels (multivariate P for trend 0.15). The multivariate odds ratio for hyperuricemia in individuals with coffee intake >/=6 cups daily compared with those with no coffee use was 0.57 (95% CI 0.35, 0.94; P for trend 0.001). These findings from a nationally representative sample of US adults suggest that coffee consumption is associated with lower serum uric acid level and hyperuricemia frequency, but tea consumption is not. The inverse association with coffee appears to be via components of coffee other than caffeine.

Autosomal Dominant Tubulointerstitial Kidney Disease: Clinical Presentation of Patients With ADTKD-UMOD and ADTKD-MUC1.

PubMed

Ayasreh, Nadia; Bullich, Gemma; Miquel, Rosa; Furlano, Mónica; Ruiz, Patricia; Lorente, Laura; Valero, Oliver; García-González, Miguel Angel; Arhda, Nisrine; Garin, Intza; Martínez, Víctor; Pérez-Gómez, Vanessa; Fulladosa, Xavier; Arroyo, David; Martínez-Vea, Alberto; Espinosa, Mario; Ballarín, Jose; Ars, Elisabet; Torra, Roser

2018-05-18

Autosomal dominant tubulointerstitial kidney disease (ADTKD) is a rare underdiagnosed cause of end-stage renal disease (ESRD). ADTKD is caused by mutations in at least 4 different genes: MUC1, UMOD, HNF1B, and REN. Retrospective cohort study. 56 families (131 affected individuals) with ADTKD referred from different Spanish hospitals. Clinical, laboratory, radiologic, and pathologic data were collected, and genetic testing for UMOD, MUC1, REN, and HNF1B was performed. Hyperuricemia, ultrasound findings, renal histology, genetic mutations. Age at ESRD, rate of decline in estimated glomerular filtration rate. ADTKD was diagnosed in 25 families (45%), 9 carried UMOD pathogenic variants (41 affected members), and 16 carried the MUC1 pathogenic mutation c.(428)dupC (90 affected members). No pathogenic variants were identified in REN or HNF1B. Among the 77 individuals who developed ESRD, median age at onset of ESRD was 51 years for those with ADTKD-MUC1 versus 56 years (P=0.1) for those with ADTKD-UMOD. Individuals with the MUC1 duplication presented higher risk for developing ESRD (HR, 2.24; P=0.03). The slope of decline in estimated glomerular filtration rate showed no significant difference between groups (-3.0mL/min/1.73m 2 per year in the ADTKD-UMOD group versus -3.9mL/min/1.73m 2 per year in the ADTKD-MUC1 group; P=0.2). The prevalence of hyperuricemia was significantly higher in individuals with ADTKD-UMOD (87% vs 54%; P=0.006). Although gout occurred more frequently in this group, the difference was not statistically significant (24% vs 7%; P=0.07). Relatively small Spanish cohort. MUC1 analysis limited to cytosine duplication. The main genetic cause of ADTKD in our Spanish cohort is the MUC1 pathogenic mutation c.(428)dupC. Renal survival may be worse in individuals with the MUC1 mutation than in those with UMOD mutations. Clinical presentation does not permit distinguishing between these variants. However, hyperuricemia and gout are more frequent in individuals with ADTKD-UMOD. Copyright © 2018 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Characterization of Mesoamerican Nephropathy in a Kidney Failure Hotspot in Nicaragua.

PubMed

Kupferman, Joseph; Amador, Juan José; Lynch, Katherine E; Laws, Rebecca L; López-Pilarte, Damaris; Ramírez-Rubio, Oriana; Kaufman, James S; Lau, Jorge Luis; Weiner, Daniel E; Robles, Ninoska Violeta; Verma, Karina P; Scammell, Madeleine K; McClean, Michael D; Brooks, Daniel R; Friedman, David J

2016-11-01

Mesoamerican nephropathy (MeN) is a kidney disease of unknown cause that mainly affects working-age men in Central America. Despite being a major cause of morbidity and mortality in this region, its clinical characteristics have not been well defined. Cross-sectional family-based study. 266 members of 24 families with high chronic kidney disease (CKD) burdens in a MeN hotspot in Northwestern Nicaragua. We compared clinical and biochemical characteristics of affected individuals first with their unaffected relatives and then with NHANES (National Health and Nutrition Examination Survey) participants with CKD in order to reveal identifying features of MeN. CKD defined as serum creatinine level ≥ 1.5mg/dL in men and ≥1.4mg/dL in women. Clinical and biochemical parameters, including serum sodium, potassium, bicarbonate, calcium, magnesium, phosphorus, and uric acid. Hyperuricemia, in many cases severe, was common among patients with MeN. Uric acid levels in patients with MeN were higher than those in NHANES participants (mean, 9.6 vs 7.4mg/dL for men in each group) despite more frequent use of uric acid-lowering medications in Nicaraguan individuals (71.7% vs 11.2%). In multivariable linear mixed-effects regression analysis, uric acid levels were 2.0mg/dL (95% CI, 1.0-3.0; P<0.001) higher in patients with MeN compared with their NHANES counterparts after adjusting for age, estimated glomerular filtration rate, and uric acid-lowering therapies. In contrast to prior reports, hyponatremia and hypokalemia were not common. CKD defined by single serum creatinine measurement; population likely not representative of full MeN phenotype spectrum across Central America; major differences between MeN and NHANES groups in important characteristics such as age, ancestry, and recruitment method. Hyperuricemia out of proportion to the degree of decreased kidney function was common among Nicaraguan patients with MeN. Our results suggest that rather than being solely a consequence of CKD, hyperuricemia may play a role in MeN pathogenesis, a hypothesis that deserves further study. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

[Consensus document for the detection and management of chronic kidney disease].

PubMed

Martínez-Castelao, Alberto; Górriz, José L; Bover, Jordi; Segura-de la Morena, Julián; Cebollada, Jesús; Escalada, Javier; Esmatjes, Enric; Fácila, Lorenzo; Gamarra, Javier; Gràcia, Silvia; Hernández-Moreno, Julio; Llisterri-Caro, José L; Mazón, Pilar; Montañés, Rosario; Morales-Olivas, Francisco; Muñoz-Torres, Manuel; de Pablos-Velasco, Pedro; de Santiago, Ana; Sánchez-Celaya, Marta; Suárez, Carmen; Tranche, Salvador

2014-01-01

Chronic kidney disease (CKD) is an important global health problem, involving to 10% of the Spanish population, promoting high morbidity and mortality for the patient and an elevate consumption of the total health resources for the National Health System. This is a summary of an executive consensus document of ten scientific societies involved in the care of the renal patient, that actualizes the consensus document published in 2007. The central extended document can be consulted in the web page of each society. The aspects included in the document are: Concept, epidemiology and risk factors for CKD. Diagnostic criteria, evaluation and stages of CKD, albuminuria and glomerular filtration rate estimation. Progression factors for renal damage. Patient remission criteria. Follow-up and objectives of each speciality control. Nephrotoxicity prevention. Cardio-vascular damage detection. Diet, life-style and treatment attitudes: hypertension, dyslipidaemia, hyperglycemia, smoking, obesity, hyperuricemia, anemia, mineral and bone disorders. Multidisciplinary management for Primary Care, other specialities and Nephrology. Integrated management of CKD patient in haemodialysis, peritoneal dialysis and renal transplant patients. Management of the uremic patient in palliative care. We hope that this document may be of help for the multidisciplinary management of CKD patients by summarizing the most updated recommendations. Copyright © 2014 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

Hydroxychavicol: a potent xanthine oxidase inhibitor obtained from the leaves of betel, Piper betle.

PubMed

Murata, Kazuya; Nakao, Kikuyo; Hirata, Noriko; Namba, Kensuke; Nomi, Takao; Kitamura, Yoshihisa; Moriyama, Kenzo; Shintani, Takahiro; Iinuma, Munekazu; Matsuda, Hideaki

2009-07-01

The screening of Piperaceous plants for xanthine oxidase inhibitory activity revealed that the extract of the leaves of Piper betle possesses potent activity. Activity-guided purification led us to obtain hydroxychavicol as an active principle. Hydroxychavicol is a more potent xanthine oxidase inhibitor than allopurinol, which is clinically used for the treatment of hyperuricemia.

The dual actions of Paederia scandens extract as a hypouricemic agent: xanthine oxidase inhibitory activity and uricosuric effect.

PubMed

Yan, Haiyan; Ma, Ying; Liu, Mei; Zhou, Lanlan

2008-09-01

Hyperuricemia is associated with a number of pathological conditions, such as gout. Lowering of elevated uric acid levels in the blood could be achieved by xanthine oxidase inhibitors and inhibitors of renal urate reabsorption. Some natural compounds isolated from herbs used in traditional Chinese medicine have been previously demonstrated to act as xanthine oxidase inhibitors. In the present investigation, Paederia scandens (Lour.) Merrill (Rubiaceae) extract (PSE; 4.5, 2.25, and 1.125 g/kg) orally for 14 days was demonstrated to possess in vivo potent hypouricemic activity in hyperuricemic rats pretreated with potassium oxonate. In addition, PSE was also demonstrated to be an inhibitor of xanthine oxidase. Lineweaver-Burk analysis of the enzyme kinetics indicated that the inhibition of PSE was of a mixed type. Using an oxonate-induced hyperuricemic rat model, PSE was indeed shown to exhibit uricosuric action in vivo, which could explain, at least in part, the observed hypouricemic effect of PSE in these rats. The potential application of this compound in the treatment of conditions associated with hyperuricemia is discussed.

ARISTOLOCHIA BRACTEOLATE RETZ. ATTENUATES HYPERURICEMIA IN A METABOLIC ARTHRITIS RAT MODEL.

PubMed

Li, Yun-Peng; Wu, Shuang; Ran, Afou; Xu, Da-Yong; Wei, Jing-Mei; Zhao, Zi-Long

2017-01-01

The leaves of Aristolochia bracteolata Retz. has been documented in the folk medicine literature for its anti-arthritic activity. The target of the research envisaged was to elucidate the activity of A. bracteolata extract on hyperuricemic condition in arthritis rat model. Dried and powdered plant leaves were extracted using ether and chloroform. Potassium oxonate was injected intra-articularly to produce arthritis. The hyperuricemic effect, of A. bracteolate was analyzed by studying levels of uric acid in serum as well as in urine of arthritis induced rats. Effects of plant extracts were also studied on BUN (blood urea nitrogen) levels and fraction of uric acid excreted. Results indicate that administration of A. bracteolata presented substantial change in uric acid concentration, augmented by potassium oxonate administration in rats. The reduction in levels of uric acid levels was nearly same as allopurinol. The investigation also revealed that the primary plant extract has nephroprotective effect by enhancing the production of Prostaglandin E 2 and Interleukin-1. Histological studies of rat kidney slices indicated the safety of the present plant extract. The crude extract of A. bracteolate can be used to reduce hyperuricemia in metabolic arthritis produced in rat model, without inducing any potential damaging effects.

Evaluation of uric acid levels, thyroid function, and anthropometric parameters in Japanese children with Down syndrome.

PubMed

Niegawa, Tomomi; Takitani, Kimitaka; Takaya, Ryuzo; Ishiro, Manabu; Kuroyanagi, Yuichi; Okasora, Keisuke; Minami, Yukako; Matsuda, Takuya; Tamai, Hiroshi

2017-09-01

Down syndrome, caused by trisomy 21, is characterized by congenital abnormalities as well as mental retardation. From the neonatal stage through adolescence, patients with Down syndrome often have several complications. Thus, it is important to attain knowledge of the prevalence of these comorbidities in children with Down syndrome. We, therefore, evaluated the biochemical data, thyroid function, and anthropometric parameters, and analyzed the association among them in Japanese children and early adolescents with Down syndrome. There was no difference in the prevalence of obesity and overweight between boys and girls. The level of uric acid was higher in boys than in girls. Moreover, the prevalence of hyperuricemia was also higher in boys than in girls (approximately 32% and 10%, respectively). The prevalence of subclinical hypothyroidism in children with Down syndrome was approximately 20%, with no significant sex differences. The levels of uric acid and dehydroepiandrosterone-sulfate were positively associated with age, while the levels of thyroid-stimulating hormone and free thyroxine had a negative association with age. Overall, children with Down syndrome, exhibit a higher incidence of hyperuricemia. Therefore, uric acid levels, as well as thyroid function, from childhood to early adulthood should be monitored in this patient cohort.

Traditional Uighur Medicine Karapxa decoction, inhibits liver xanthine oxidase and reduces serum uric acid concentrations in hyperuricemic mice and scavenges free radicals in vitro.

PubMed

Amat, Nurmuhammat; Umar, Anwar; Hoxur, Parida; Anaydulla, Mihrigul; Imam, Guzalnur; Aziz, Ranagul; Upur, Halmurat; Kijjoa, Anake; Moore, Nicholas

2015-04-25

Karapxa decoction (KD) is a Traditional Uighur Medicine used for hepatitis, cholecystitis, gastralgia, oedema, gout and arthralgia. Because of its purported effect in gout, its effects were tested in hyperuricemic mice models induced by yeast extract paste or potassium oxonate, as well as its capacity to scavenge free radicals in vitro. Hyperuricemia was induced in mice by yeast extract paste or potassium oxonate. KD was given orally for 14 days at 200, 400 and 800 mg/kg/day, with Allopurinol 10 mg/kg/day as positive control. Serum uric acid (UA), and liver xanthine oxidase activity (XO) were measured. Scavenging activity of KD on 1, 1-diphenyl-2-picrylhydrazyl radicals (DPP•), nitric oxide (•NO), superoxide (O2•-), efficiency against lipid peroxidation, and XO inhibition were determined in vitro. KD inhibited liver XO activity and reduced serum uric acid in hyperuricemic mice. KD also showed noticeable antioxidant activity, scavenging free radicals (DPP•, •NO and O2•-). It was effective against lipid peroxidation and inhibited XO in vitro. This study supports the traditional use of Karapxa decoction to treat hyperuricemia and gout.

NALP3 inflammasome functional polymorphisms and gout susceptibility.

PubMed

Miao, Zhi-Min; Zhao, Shi-Hua; Yan, Sheng-Li; Li, Chang-Gui; Wang, Yan-Gang; Meng, Dong-Mei; Zhou, Li; Mi, Qing-Sheng

2009-01-01

Gout is the most common autoinflammatory arthritis characterized by elevated serum urate and recurrent attacks of intra-articular crystal deposition of monosodium urate (MSU). Although the pathogenesis of gout is still unclear, accumulated studies indicate that genetic factors trigger gout development, including some susceptibility genes that control the production and clearance of urate and lead to hyperuricemia. However, the epidemiological evidence suggests that only less than 10% of hyperuricemia patients develop gout, indicating that other genes unrelated to the urate metabolism may also contribute to the diseases susceptibility. Accumulated evidences have implied that MSU crystal-induced inflammation is a paradigm of innate immunity and that NALP3 inflammasome, an innate immune complex containing NALP3, ASC and CARD-8, is involved in gout development. Recent studies suggest that NALP3 and CARD-8 functional mutations contribute to the development of autoinflammatory diseases including hereditary periodic fever syndrome, arthritis as well as hypertension susceptibility. Taking into account these genetic findings, here we would like to propose a novel hypothesis that functional mutations in NALP3 inflammasome may make NALP3 inflammasome as attractive susceptibility candidates and genetic markers for gout. Further clinical genetic studies need to be performed to confirm the role of NALP3 inflammasome in the etiology of gout.

The Effect of Allopurinol on Renal Function.

PubMed

Krishnamurthy, Aneesa; Lazaro, Deana; Stefanov, Dimitre G; Blumenthal, David; Gerber, Donald; Patel, Sheetal

2017-01-01

Hyperuricemia is associated with development of gout, hypertension, and renal disease. The impact of allopurinol, a urate-lowering therapy, on renal function is unclear, especially in patients with chronic kidney disease who are at higher risk of hypersensitivity reaction. The aim of this study was to determine the effect of allopurinol on kidney function in hyperuricemic male veterans. This is a retrospective cohort study using pharmacy, medical, and laboratory records of veterans enrolled at the Veterans Administration New York Harbor Healthcare System, Brooklyn campus. Fifty patients with hyperuricemia defined as a serum uric acid greater than 7 mg/dL (average of ~9 mg/dL), newly started on allopurinol for any reason, with evidence of treatment compliance, were matched by age, race, sex, and estimated glomerular filtration rate (EGFR) to 50 hyperuricemic control subjects. The retrospective cases were observed from October 2000 until November 2006, at which time there was a change in the laboratory analyzer, making further comparisons inappropriate. On average, patients treated with a mean 221 (SD, 96) mg/d dose of allopurinol achieved 11.9 mL/min higher GFR (95% confidence interval, 4.8-11.9 mg/d dose; P = 0.01) than did the control group. Treatment effect was found to depend on the initial EGFR, as indicated by the significant treatment by initial EGFR interaction (P = 0.004) and increased with a higher initial EGFR. The allopurinol-treated group had a 0.10 mg/dL lower final creatinine level (95% confidence interval, 0.003-0.20 mg/dL; P = 0.04) than did the control subjects, adjusted for initial creatinine and age. The average length of follow-up was 3.4 years. There were 5 mild adverse events in the treated cases. Treatment of hyperuricemic patients with allopurinol over an average of 3.4 years resulted in a significant improvement of kidney function in this male cohort from the Veterans Administration Healthcare System. Clinicians should consider this potential benefit of allopurinol in the treatment of patients with hyperuricemia, those with overall maintained renal function.

THE BASIC DATA FOR RESIDENTS AGED 15 YEARS OR YOUNGER WHO RECEIVED A COMPREHENSIVE HEALTH CHECK IN 2011-2012 AS A PART OF THE FUKUSHIMA HEALTH MANAGEMENT SURVEY AFTER THE GREAT EAST JAPAN EARTHQUAKE.

PubMed

Kawasaki, Yukihiko; Hosoya, Mitsuaki; Yasumura, Seiji; Ohira, Tetsuya; Satoh, Hiroaki; Suzuki, Hitoshi; Sakai, Akira; Ohtsuru, Akira; Takahashi, Atsushi; Ozasa, Kotaro; Kobashi, Gen; Kamiya, Kenji; Yamashita, Shunichi; Abe, Masafumi

2015-01-01

To assist in the long-term health management of residents and evaluate the health impacts after the Tokyo Electric Power Company's Fukushima Daiichi Nuclear Power Plant accident in Fukushima Prefecture, the Fukushima prefectural government decided to implement the Fukushima Health Management Survey. This report describes the results for residents aged 15 years or younger who received health checks and evaluates the data obtained from 2011 and 2012. The target group consisted of residents aged 15 years or younger who had lived in the evacuation zone. The health checks were performed on receipt of an application from any of the residents. The checks, which included the measurements of height, weight, blood pressure, biochemical laboratory findings, and peripheral blood findings, were performed as required. 1) A total of 17,934 (64.5%) and 11,780 (43.5%) residents aged 15 years or younger received health checks in 2011 and 2012, respectively. 2) In both years, a number of male and female residents in the 7-15 year age group were found to suffer from obesity, hyperlipidemia, hyperuricemia, or liver dysfunction. Furthermore, pediatric aged 15 years or younger were commonly observed to suffer from hypertension or glucose metabolic abnormalities. 3) A comparison of data from 2012 and 2011 demonstrated that both males and females frequently showed increased body height and decreased body weight in 2012. The prevalence of hypertension, glucose metabolic abnormalities, or high γ-GTP values in males and females in the 7-15 year age group in 2012 was lower than that in 2011. However, the prevalence of hyperuricemia among residents in the 7-15 year age group was higher in 2012 than in 2011. These results suggested that some residents aged 15 years or under who had lived in the evacuation zone had developed obesity, hyperlipidemia, hyperuricemia, liver dysfunction, hypertension, or glucose metabolic abnormalities. Therefore, we think that it is necessary to continue the health checks for these residents in order to ameliorate these lifestyle-related diseases.

The basic data for residents aged 16 years or older who received a comprehensive health check examinations in 2011-2012 as a part of the Fukushima Health Management Survey after the great East Japan earthquake.

PubMed

Kawasaki, Yukihiko; Hosoya, Mitsuaki; Yasumura, Seiji; Ohira, Tetsuya; Satoh, Hiroaki; Suzuki, Hitoshi; Sakai, Akira; Ohtsuru, Akira; Takahashi, Atsushi; Ozasa, Kotaro; Kobashi, Gen; Kamiya, Kenji; Yamashita, Shunichi; Abe, Masafumi

2014-01-01

To assist in the long-term health management of residents and evaluate health impacts after the Tokyo Electric Power Company's Fukushima Daiichi Nuclear Power Plant accident in Fukushima Prefecture, the Fukushima prefectural government decided to conduct the Fukushima Health Management Survey. This report describes the results for residents aged 16 years or older who received the health check examinations and evaluates the data obtained from 2011 and 2012. The target group consisted of residents aged 16 years or older who had lived in the evacuation zone. The health check examinations were performed on receipt of an application for a health check examination from any of the residents. The examinations, including measurements of height, weight, abdominal circumference/body mass index (BMI), blood pressure, biochemical laboratory findings, and peripheral blood findings, were performed as required. 1) A total of 56,399 (30.9%) and 47,009 (25.4%) residents aged 16 years or older received health checks in 2011 and 2012, respectively. 2) In both years, a number of male and female residents in the 16-39 year age group were found to suffer obesity, hyperlipidemia, hyperuricemia, or liver dysfunction, and the prevalence of obesity and hyperlipidemia among residents increased with age. Furthermore, the proportion of residents with hypertension, glucose metabolic abnormalities or renal dysfunction was higher in those aged 40 years or older. 3) The frequencies of obesity, hypertension and hyperlipidemia among residents in 2012 were lower than those in 2011. However, the prevalence of liver dysfunction, hyperuricemia, glucose metabolic abnormalities and renal dysfunction among residents was higher in 2012 than in 2011. These results suggested the number of residents who had lived in the evacuation zone with obesity, hyperlipidemia, hyperuricemia, liver dysfunction, hypertension, glucose metabolic abnormalities, or renal dysfunction increased with age in all age groups. Therefore, we think that it is necessary to continue with health check examinations for these residents in order to ameliorate lifestyle-related disease.

[Risk factors for non communicable chronic diseases among workers of a financial company].

PubMed

Fagalde, María del Pilar; del Solar, José Antonio; Guerrero, Marcia; Atalah, Eduardo

2005-08-01

The epidemic of cardiovascular diseases in Chile, requires the development of strategies in health promotion and prevention. To assess the prevalence of risk factors for chronic non communicable diseases among workers of a financial company in Metropolitan Santiago. Assessment of 2,225 workers (1,383 males with a median age of 49 years and 842 females with a median age of 43 years). All answered an enquiry about education, medical history, smoking habits and physical activity. Body mass index and blood pressure were measured and a blood sample was obtained to measure blood glucose and lipid levels. Logistic repression models were used to determine the main risk factors for hypertension, diabetes, obesity, hypercholesterolemia and hyperuricemia. Sixteen percent of studied subjects were obese, 49% had overweight, 57% had hypercholesterolemia, 28% had high blood pressure, 4% were diabetic, 4% had hyperuricemia, 45% smoked and 83% were sedentary. Each worker had a mean of 2.4+/-1.1 risk factors. This figure was significantly higher among men, obese subjects, those older than 40 years and those with a lower educational level. There is an important disease burden among the studied subjects, specially among obese and older individuals. Healthy lifestyles should be promoted in this population.

Serum Uric Acid and Risk for Acute Kidney Injury Following Contrast.

PubMed

Kanbay, Mehmet; Solak, Yalcin; Afsar, Baris; Nistor, Ionut; Aslan, Gamze; Çağlayan, Ozlem Hilal; Aykanat, Asli; Donciu, Mihaela-Dora; Lanaspa, Miguel A; Ejaz, Ahsan A; Johnson, Richard J; Covic, Adrian

2017-02-01

Contrast-induced acute kidney injury (CI-AKI) is a common cause of hospital-acquired acute kidney injury (AKI). We evaluated the evidence that uric acid (UA) plays a pathogenic role in CI-AKI. Ten studies were eligible for inclusion for meta-analysis. Hyperuricemia predicted risk for cases with AKI in prospective cohort studies. Higher levels of serum UA (SUA), as defined by the authors, were associated with a 2-fold increased risk to develop AKI (pooled odds ratio 2.03; 95% confidence interval [CI] 1.48-2.78). Significant heterogeneity was found in cohort studies ( P = .001, I 2 = 85.7%). In 2 clinical trials, lowering of SUA with saline hydration was significantly associated with reduced risk for AKI compared with saline hydration alone or saline hydration with N-acetyl cysteine. An analysis of 2 randomized controlled trials found that allopurinol with saline hydration had a significant protective effect on renal function (assessed by serum creatinine values) compared with hydration alone (mean difference: -0.52 mg/dL; 95% CI: -0.81 to -0.22). Hyperuricemia independently predicts CI-AKI. Two clinical trials suggest lowering SUA may prevent CI-AKI. The mechanism by which UA induces CI-AKI is likely related to acute uricosuria.

White blood cell count and the incidence of hyperuricemia: insights from a community-based study.

PubMed

Liu, Jian; Shen, Pingyan; Ma, Xiaobo; Yu, Xialian; Ni, Liyan; Hao, Xu; Wang, Weiming; Chen, Nan

2018-06-23

Hyperuricemia (HUA) is a risk factor for chronic kidney disease (CKD). The relationship between HUA and white blood cell (WBC) count remains unknown. A sampling survey for CKD was conducted in Sanlin community in 2012 and 2014. CKD was defined as proteinuria in at least the microalbuminuric stage or an estimated GFR of 60 mL/(min∙1.73 m 2 ). HUA was defined as serum uric acid > 420 μmol/L in men and > 360 μmol/L in women. This study included 1024 participants. The prevalence of HUAwas 17.77%. Patients with HUA were more likely to have higher levels of WBC count, which was positively associated with HUA prevalence. This association was also observed in participants without CKD, diabetes mellitus, hyperlipidemia, or obesity. Multivariate logistic regression analysis showed that WBC count was independently associated with the risk for HUA in male and female participants. Compared with participants without HUA, inflammatory factors such as high-sensitivity C-reactive protein, tumor necrosis factor-α, and interleukin 6 increased in participants with HUA. Hence, WBC count is positively associated with HUA, and this association is independent of conventional risk factors for CKD.

Renal Transport of Uric Acid: Evolving Concepts and Uncertainties

PubMed Central

Bobulescu, Ion Alexandru; Moe, Orson W.

2013-01-01

In addition to its role as a metabolic waste product, uric acid has been proposed to be an important molecule with multiple functions in human physiology and pathophysiology and may be linked to human diseases beyond nephrolithiasis and gout. Uric acid homeostasis is determined by the balance between production, intestinal secretion, and renal excretion. The kidney is an important regulator of circulating uric acid levels, by reabsorbing around 90% of filtered urate, while being responsible for 60–70% of total body uric acid excretion. Defective renal handling of urate is a frequent pathophysiologic factor underpinning hyperuricemia and gout. In spite of tremendous advances over the past decade, the molecular mechanisms of renal urate transport are still incompletely understood. Many transport proteins are candidate participants in urate handling, with URAT1 and GLUT9 being the best characterized to date. Understanding these transporters is increasingly important for the practicing clinician as new research unveils their physiology, importance in drug action, and genetic association with uric acid levels in human populations. The future may see the introduction of new drugs that specifically act on individual renal urate transporters for the treatment of hyperuricemia and gout. PMID:23089270

Atherogenic Index of Plasma Predicts Hyperuricemia in Rural Population: A Cross-Sectional Study from Northeast China.

PubMed

Chang, Ye; Li, Yuan; Guo, Xiaofan; Guo, Liang; Sun, Yingxian

2016-09-02

We aimed to determine the association of atherogenic index of plasma (AIP) with hyperuricemia (HUA) in the rural population of northeast China. This cross-sectional study was conducted in the rural areas of northeast China from January 2012 to August 2013, and the final analysis included data obtained form 5253 men and 6092 women. 1104 participants (9.7%) suffered from HUA. Spearman rank test showed that AIP was positively correlated with uric acid in both sexes (r = 0.310 for men and r = 0.347 for women, both p < 0.001). AIP was classified into three groups: the low (<0.11), the intermediate (0.11-0.21) and the increased (>0.21) risk. The prevalence of HUA increased with AIP. Multivariate logistic regression analysis showed that, compared to the low AIP group, participants in increased AIP group had a 2.536-fold risk for HUA (2.164-fold in male and 2.960-fold in female) after adjustment for covariates. Results of receiver operating characteristic curves showed that the area under the curve (95% confidence intervals) was 0.686 (0.665-0.707) for male and 0.730 (0.706-0.755) for female. We indicated that increased AIP was associated with higher serum uric acid levels and could be identified as an independent risk factor of HUA in the rural population of northeast China.

Metabolic Effects of Mulberry Leaves: Exploring Potential Benefits in Type 2 Diabetes and Hyperuricemia

PubMed Central

Hunyadi, A.; Liktor-Busa, E.; Márki, Á.; Martins, A.; Jedlinszki, N.; Hsieh, T. J.; Báthori, M.; Hohmann, J.; Zupkó, I.

2013-01-01

The leaves of Morus alba L. have a long history in Traditional Chinese Medicine and also became valued by the ethnopharmacology of many other cultures. The worldwide known antidiabetic use of the drug has been suggested to arise from a complex combination effect of various constituents. Moreover, the drug is also a potential antihyperuricemic agent. Considering that type 2 diabetes and hyperuricemia are vice-versa in each other's important risk factors, the use of mulberry originated phytotherapeutics might provide an excellent option for the prevention and/or treatment of both conditions. Here we report a series of relevant in vitro and in vivo studies on the bioactivity of an extract of mulberry leaves and its fractions obtained by a stepwise gradient on silica gel. In vivo antihyperglycemic and antihyperuricemic activity, plasma antioxidant status, as well as in vitro glucose consumption by adipocytes in the presence or absence of insulin, xanthine oxidase inhibition, free radical scavenging activity, and inhibition of lipid peroxidation were tested. Known bioactive constituents of M. alba (chlorogenic acid, rutin, isoquercitrin, and loliolide) were identified and quantified from the HPLC-DAD fingerprint chromatograms. Iminosugar contents were investigated by MS/MS, 1-deoxynojirimycin was quantified, and amounts of 2-O-alpha-D-galactopyranosyl-1-deoxynojirimicin and fagomine were additionally estimated. PMID:24381639

Analysis of Risk Factors for Colonic Diverticular Bleeding: A Matched Case-Control Study.

PubMed

Sugihara, Yuusaku; Kudo, Shin-ei; Miyachi, Hideyuki; Misawa, Masashi; Okoshi, Shogo; Okada, Hiroyuki; Yamamoto, Kazuhide

2016-03-01

Diverticular bleeding can occasionally cause massive bleeding that requires urgent colonoscopy (CS) and treatment. The aim of this study was to identify significant risk factors for colonic diverticular hemorrhage. Between January 2009 and December 2012, 26,602 patients underwent CS at our institution. One hundred twenty-three patients underwent an urgent CS due to acute lower gastrointestinal hemorrhage. Seventy-two patients were diagnosed with colonic diverticular hemorrhage. One hundred forty-nine age- and sex-matched controls were selected from the patients with nonbleeding diverticula who underwent CS during the same period. The relationship of risk factors to diverticular bleeding was compared between the cases and controls. Uni- and multivariate conditional logistic regression analyses demonstrated that the use of nonsteroidal anti-inflammatory drugs (odds ratio [OR], 14.70; 95% confidence interval [CI], 3.89 to 55.80; p<0.0001), as well as the presence of cerebrovascular disease (OR, 8.66; 95% CI, 2.33 to 32.10; p=0.00126), and hyperuricemia (OR, 15.5; 95% CI, 1.74 to 138.00; p=0.014) remained statistically significant predictors of diverticular bleeding. Nonsteroidal anti-inflammatory drugs, cerebrovascular disease and hyperuricemia were significant risks for colonic diverticular hemorrhage. The knowledge obtained from this study may provide some insight into the diagnostic process for patients with lower gastrointestinal bleeding.

Evaluation of uric acid levels, thyroid function, and anthropometric parameters in Japanese children with Down syndrome

PubMed Central

Niegawa, Tomomi; Takitani, Kimitaka; Takaya, Ryuzo; Ishiro, Manabu; Kuroyanagi, Yuichi; Okasora, Keisuke; Minami, Yukako; Matsuda, Takuya; Tamai, Hiroshi

2017-01-01

Down syndrome, caused by trisomy 21, is characterized by congenital abnormalities as well as mental retardation. From the neonatal stage through adolescence, patients with Down syndrome often have several complications. Thus, it is important to attain knowledge of the prevalence of these comorbidities in children with Down syndrome. We, therefore, evaluated the biochemical data, thyroid function, and anthropometric parameters, and analyzed the association among them in Japanese children and early adolescents with Down syndrome. There was no difference in the prevalence of obesity and overweight between boys and girls. The level of uric acid was higher in boys than in girls. Moreover, the prevalence of hyperuricemia was also higher in boys than in girls (approximately 32% and 10%, respectively). The prevalence of subclinical hypothyroidism in children with Down syndrome was approximately 20%, with no significant sex differences. The levels of uric acid and dehydroepiandrosterone-sulfate were positively associated with age, while the levels of thyroid-stimulating hormone and free thyroxine had a negative association with age. Overall, children with Down syndrome, exhibit a higher incidence of hyperuricemia. Therefore, uric acid levels, as well as thyroid function, from childhood to early adulthood should be monitored in this patient cohort. PMID:28955133

Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia

PubMed Central

Landry, Nichole K.; El-Achkar, Tarek M.; Lieske, John C.

2017-01-01

Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys’ thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies. PMID:29145399

Adverse effects of the classic antioxidant uric acid in adipocytes: NADPH oxidase-mediated oxidative/nitrosative stress.

PubMed

Sautin, Yuri Y; Nakagawa, Takahiko; Zharikov, Sergey; Johnson, Richard J

2007-08-01

Uric acid is considered a major antioxidant in human blood that may protect against aging and oxidative stress. Despite its proposed protective properties, elevated levels of uric acid are commonly associated with increased risk for cardiovascular disease and mortality. Furthermore, recent experimental studies suggest that uric acid may have a causal role in hypertension and metabolic syndrome. All these conditions are thought to be mediated by oxidative stress. In this study we demonstrate that differentiation of cultured mouse adipocytes is associated with increased production of reactive oxygen species (ROS) and uptake of uric acid. Soluble uric acid stimulated an increase in NADPH oxidase activity and ROS production in mature adipocytes but not in preadipocytes. The stimulation of NADPH oxidase-dependent ROS by uric acid resulted in activation of MAP kinases p38 and ERK1/2, a decrease in nitric oxide bioavailability, and an increase in protein nitrosylation and lipid oxidation. Collectively, our results suggest that hyperuricemia induces redox-dependent signaling and oxidative stress in adipocytes. Since oxidative stress in the adipose tissue has recently been recognized as a major cause of insulin resistance and cardiovascular disease, hyperuricemia-induced alterations in oxidative homeostasis in the adipose tissue might play an important role in these derangements.

Salivary uric acid as a noninvasive biomarker for monitoring the efficacy of urate-lowering therapy in a patient with chronic gouty arthropathy.

PubMed

Zhao, Jianxing; Huang, Ying

2015-10-23

Monitoring blood uric acid (UA) is important in all patients on urate-lowering therapy so that the selection of the effective drugs and dosage adjustments could be made until the target level is reached. The issue is that frequent needle jabs are unacceptable. Reported mean levels of salivary UA were 185-240 μmol/l in healthy adults. A linear correlation was demonstrated between UA concentrations in saliva and plasma. We monitored salivary UA instead of plasmatic UA in a patient with gout. Allopurinol and benzbromarone were used as the therapeutic drugs. Salivary UA; urinary UA and creatinine; and plasmatic UA, creatinine, kynurenine and tryptophan were measured by HPLC. Salivary UA indicated the efficacy of therapy accurately and conveniently. After eight weeks therapy, the weekly mean levels of salivary UA were reduced and maintained to <300 μmol/l, which was equivalent to <360 μmol/l of plasmatic UA according to the salivary UA/plasmatic UA ratio of this patient. Measurement of salivary UA is a noninvasive and useful way for monitoring the status of hyperuricemia and the therapeutic efficacy of urate-lowering therapy. It has value for the management of hyperuricemia and gout. Copyright © 2015 Elsevier B.V. All rights reserved.

Management of hyperuricemia in gout: focus on febuxostat

PubMed Central

Reinders, Mattheus K; Jansen, Tim L Th A

2010-01-01

Gout is the most common inflammatory arthritis in an elderly population, and can be diagnosed with absolute certainty by polarization microscopy. However, diagnosis may be challenging because atypical presentations are more common in the elderly. Management of hyperuricemia in the elderly with gout requires special consideration because of co-medication, contra-indications, and risk of adverse reactions. Urate-lowering agents include allopurinol and uricosuric agents. These also must be used sensibly in the elderly, especially when renal function impairment is present. However, if used at the lowest dose that maintains the serum urate level below 5.0 to 6.0 mg/dL (0.30 to 0.36 mmol/L), the excess urate in the body will eventually be eliminated, acute flares will no longer occur, and tophi will resolve. Febuxostat, a new xanthine oxidase inhibitor, is welcomed, as few alternatives for allopurinol are available. Its pharmacokinetics and pharmacodynamics are not significantly altered in patients with moderate renal function or hepatic impairment. Its antihyperuricemic efficacy at 80 to 120 mg/day is better than “standard dosage” allopurinol (300 mg/day). Long-term safety data and efficacy data on tophus diminishment and reduction of gout flares have recently become available. Febuxostat may provide an important option in patients unable to use allopurinol, or refractory to allopurinol. PMID:20169038

The ygeW encoded protein from Escherichia coli is a knotted ancestral catabolic transcarbamylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yongdong; Jin, Zhongmin; Yu, Xiaolin

Purine degradation plays an essential role in nitrogen metabolism in most organisms. Uric acid is the final product of purine catabolism in humans, anthropoid apes, birds, uricotelic reptiles, and almost all insects. Elevated levels of uric acid in blood (hyperuricemia) cause human diseases such as gout, kidney stones, and renal failure. Although no enzyme has been identified that further degrades uric acid in humans, it can be oxidized to produce allantoin by free-radical attack. Indeed, elevated levels of allantoin are found in patients with rheumatoid arthritis, chronic lung disease, bacterial meningitis, and noninsulin-dependent diabetes mellitus. In other mammals, some insectsmore » and gastropods, uric acid is enzymatically degraded to the more soluble allantoin through the sequential action of three enzymes: urate oxidase, 5-hydroxyisourate (HIU) hydrolase and 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) decarboxylase. Therefore, an elective treatment for acute hyperuricemia is the administration of urate oxidase. Many organisms, including plants, some fungi and several bacteria, are able to catabolize allantoin to release nitrogen, carbon, and energy. In Arabidopsis thaliana and Eschrichia coli, S-allantoin has recently been shown to be degraded to glycolate and urea by four enzymes: allantoinase, allantoate amidohydrolase, ureidoglycine aminohydrolase, and ureidoglycolate amidohydrolase.« less

Current Concepts of Hyperuricemia and Gout

PubMed Central

Klinenberg, James R.

1969-01-01

Recent studies have confirmed that gout is an inborn error of metabolism. It has now become evident that the hyperuricemia associated with gout might occur either due to overproduction of uric acid, underexcretion of uric acid or a combination of these processes. Furthermore, patients with excessive purine synthesis may have a specific enzyme defect resulting in altered feedback inhibition of purine synthesis. A neurological disease manifest by mental retardation, choreo-athetosis, aggressive behavior, lip-biting and self-mutilation and associated with decidedly increased purine biosynthesis serves as a prototype of this kind of disorder. Other defects in regulation of purine biosynthesis have been postulated but their existence not yet confirmed. It has been demonstrated that urate crystals which are deposited from hyperuricemic body fluids set up an acute inflammatory reaction by means of a variety of chemical mediators. Thus, acute gouty arthritis is now recognized as an example of “crystal induced” synovitis. The treatment of gout consists of (1) the control of acute gouty attacks, and (2) the maintenance of normal serum uric acid concentrations. This latter may be achieved either with uricosuric drugs or with xanthine oxidase inhibition. With these principles in mind, it is now possible to avoid many of the severe crippling effects of gout and to restore the vast majority of gouty patients to useful and productive lives. PMID:5773483

Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia.

PubMed

Ma, Lijie; Liu, Yan; Landry, Nichole K; El-Achkar, Tarek M; Lieske, John C; Wu, Xue-Ru

2017-01-01

Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys' thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies.

Uric acid causes kidney injury through inducing fibroblast expansion, Endothelin-1 expression, and inflammation.

PubMed

Romi, Muhammad Mansyur; Arfian, Nur; Tranggono, Untung; Setyaningsih, Wiwit Ananda Wahyu; Sari, Dwi Cahyani Ratna

2017-10-31

Uric acid (UA) plays important roles in inducing renal inflammation, intra-renal vasoconstriction and renal damage. Endothelin-1 (ET-1) is a well-known profibrotic factor in the kidney and is associated with fibroblast expansion. We examined the role of hyperuricemia conditions in causing elevation of ET-1 expression and kidney injury. Hyperuricemia was induced in mice using daily intraperitoneal injection of uric acid 125 mg/Kg body weight. An NaCl injection was used in control mice. Mice were euthanized on days-7 (UA7) and 14 (UA14). We also added allopurinol groups (UAL7 and UAL14) with supplementation of allopurinol 50 mg/Kg body weight orally. Uric acid and creatinine serum were measured from blood serum. Periodic Acid Schiff (PAS) and Sirius Red staining were done for glomerulosclerosis, tubular injury and fibrosis quantification. mRNA expression examination was performed for nephrin, podocin, preproEndothelin-1 (ppET-1), MCP-1 and ICAM-1. PDGFRβ immunostaining was done for quantification of fibroblast, while α-SMA immunostaining was done for localizing myofibroblast. Western blot analysis was conducted to quantify TGF-β1, α-SMA and Endothelin A Receptor (ETAR) protein expression. Uric acid and creatinine levels were elevated after 7 and 14 days and followed by significant increase of glomerulosclerosis and tubular injury score in the uric acid group (p < 0.05 vs. control). Both UA7 and UA14 groups had higher fibrosis, tubular injury and glomerulosclerosis with significant increase of fibroblast cell number compared with control. RT-PCR revealed down-regulation of nephrin and podocin expression (p < 0.05 vs. control), and up-regulation of MCP-1, ET-1 and ICAM-1 expression (p < 0.05 vs. control). Western blot revealed higher expression of TGF-β1 and α-SMA protein expression. Determination of allopurinol attenuated kidney injury was based on reduction of fibroblast cell number, inflammation mediators and ppET-1 expression with reduction of TGF-β1 and α-SMA protein expression. UA induced glomerulosclerosis, tubular injury and renal fibrosis with reduction of podocyte function and inflammatory mediator elevation. ET-1 and fibroblast expansion might modulate hyperuricemia induced renal fibrosis.

Feasibility of body roundness index for identifying a clustering of cardiometabolic abnormalities compared to BMI, waist circumference and other anthropometric indices: the China Health and Nutrition Survey, 2008 to 2009.

PubMed

Tian, Simiao; Zhang, Xiuzhi; Xu, Yang; Dong, Huimin

2016-08-01

The body mass index (BMI) and waist circumference (WC) are commonly used anthropometric measures for predicting cardiovascular diseases risk factors, but it is uncertain which specific measure might be the most appropriate predictor of a cluster of cardiometabolic abnormalities (CMA) in Chinese adults. A body shape index (ABSI) and body roundness index (BRI) have been recently developed as alternative anthropometric indices that may better reflect health status. The main aims of this study were to investigate the predictive capacity of ABSI and BRI in identifying various CMA compared to BMI, WC, waist-to-hip ratio (WHpR), and waist-to-height ratio (WHtR), and to determine whether there exists a best single predictor of all CMA.We used data from the 2009 wave of the China Health and Nutrition Survey, and the final analysis included 8126 adults aged 18 to 85 years with available fasting blood samples and anthropometric measurements. Receiver-operating characteristic (ROC) analyses were conducted to assess the best anthropometric indices to predict the risk of hypertension, diabetes, dyslipidemia, hyperuricemia, and metabolic syndrome (MetS). Logistic regression models were fit to evaluate the OR of each CMA according to anthropometric indices.In women, the ROC analysis showed that BRI and WHtR had the best predictive capability in identifying all of CMA (area under the curves [AUCs] ranged from 0.658 to 0.721). In men, BRI and WHtR were better predictor of hypertension, diabetes, and at least 1 CMA (AUC: 0.668, 0.708, and 0.698, respectively), whereas BMI and WC were more sensitive predictor of dyslipidemia, hyperuricemia, and MetS. Furthermore, the ABSI showed the lowest AUCs for each CMA. According to the multivariate logistic regression analysis, BRI and WHtR were superior in discriminating hyperuricemia and at least 1 CMA while BMI performed better in predicting hypertension, diabetes, and MetS in women. In men, WC and BRI were the 2 best predictor of all CMA except MetS, and the ABSI was the worst.Our results showed the novel index BRI could be used as a single suitable anthropometric measure in simultaneously identifying a cluster of CMA compared to BMI and WHtR, especially in Chinese women, whereas the ABSI showed the weakest discriminative power.

Gout and arrhythmias: In search for causation beyond association.

PubMed

Giannopoulos, Georgios; Angelidis, Christos; Deftereos, Spyridon

2018-06-13

Gout is a systemic disease, characterized by the formation and deposition of crystals in tissues (mainly in and around the joints) of individuals with elevated serum uric acid levels. Lately, a considerable number of reports relating elevated uric acid and/or gout with rhythm disorders, such as atrial fibrillation, have been published. This review summarizes evidence linking common arrhythmias and hyperuricemia/gout and discusses questions or controversies that surround it. Overall, existing evidence may not be overwhelming, but strongly suggests a positive correlation between uric acid levels and common rhythm disorders. Needless to say that such a link - as a univariate association between the two - is to be expected, given the extensive overlap of risk factors and comorbidities of hyperuricemia/gout and arrhythmias. However, the observed associations seem to persist - in most studies - after extensive adjustment for potential confounders. Still, multivariable analyses of epidemiologically collected data cannot substitute for proof coming from basic and clinical studies. There is obviously a need for further basic research to establish a causal relationship between uric acid effects and arrhythmias, as well as translational studies and clinical trials to investigate the therapeutic implications of such a relationship. Simply put, we are fairly certain that there is association, but proof of causation is what we are still in want of. Copyright © 2018. Published by Elsevier Inc.

Switching from allopurinol to febuxostat for the treatment of hyperuricemia and renal function in patients with chronic kidney disease.

PubMed

Tsuruta, Yuki; Mochizuki, Toshio; Moriyama, Takahito; Itabashi, Mitsuyo; Takei, Takashi; Tsuchiya, Ken; Nitta, Kosaku

2014-11-01

Hyperuricemia is a frequent complication of chronic kidney disease (CKD). Febuxostat is a novel xanthine oxidase inhibitor that is metabolized by many metabolic pathways in the kidney and the liver. We performed a 1-year cohort study of 73 hyperuricemic patients who had an estimated glomerular filtration rate (eGFR) below 45 ml/min and were being treated with urate-lowering therapy. In 51 patients, treatment was changed from allopurinol to febuxostat, and the other 22 patients were continued on allopurinol. The serum levels of uric acid (UA) level, creatinine, and other biochemical parameters were measured at baseline and after 3, 6, 9, and 12 months of treatment. The serum UA levels significantly decreased from 6.1 ± 1.0 to 5.7 ± 1.2 mg/dl in the febuxostat group and significantly increased from 6.2 ± 1.1 to 6.6 ± 1.1 mg/dl in the allopurinol group. The eGFR decreased 27.3 to 25.7 ml/min in the febuxostat group and from 26.1 to 19.9 ml/min in the allopurinol group. The switch from allopurinol to febuxostat was significantly associated with the changes in eGFR according to a multiple regression analysis (β = -0.22145, P < 0.05). Febuxostat reduced the serum UA levels and slowed the progression of renal disease in our CKD cohort in comparison with allopurinol.

A common variant of MAF/c-MAF, transcriptional factor gene in the kidney, is associated with gout susceptibility.

PubMed

Higashino, Toshihide; Matsuo, Hirotaka; Okada, Yukinori; Nakashima, Hiroshi; Shimizu, Seiko; Sakiyama, Masayuki; Tadokoro, Shin; Nakayama, Akiyoshi; Kawaguchi, Makoto; Komatsu, Mako; Hishida, Asahi; Nakatochi, Masahiro; Ooyama, Hiroshi; Imaki, Junko; Shinomiya, Nariyoshi

2018-01-01

Gout is a multifactorial disease characterized by acute inflammatory arthritis, and it is caused as a consequence of hyperuricemia. A recent meta-analysis of genome-wide association studies has newly identified the relationship between serum uric acid (SUA) levels and rs889472, a single nucleotide polymorphism of musculoaponeurotic fibrosarcoma oncogene (MAF/c-MAF). However, it remained unclear whether rs889472 is associated with gout susceptibility. In the present study, we investigate the association between c-MAF rs889472 and gout in Japanese male population. We genotyped 625 male patients who were clinically diagnosed as gout and 1221 male control subjects without hyperuricemia or a history of gout by TaqMan method. As a result, the major allele (C), which reportedly increases SUA levels, had a higher frequency in the gout cases (58.8%) than in the controls (55.0%). A logistic regression analysis showed a significant association between rs889472 and gout (p = 0.029, odds ratio = 1.17; 95% confidence interval 1.02-1.34). C-MAF is reported as a pivotal transcriptional factor in the development and differentiation of renal proximal tubular cells. Because urate is mainly regulated in renal proximal tubular cells, c-MAF may have an important role in urate regulation in the kidney and influence not only SUA but also gout susceptibility. Our finding shows that rs889472 of c-MAF is associated with gout susceptibility.

Taurine decreased uric acid levels in hyperuricemic rats and alleviated kidney injury.

PubMed

Feng, Ying; Sun, Fang; Gao, Yongchao; Yang, Jiancheng; Wu, Gaofeng; Lin, Shumei; Hu, Jianmin

2017-07-29

Hyperuricemia can lead to direct kidney damage. Taurine participates in several renal physiological processes and has been shown as a renoprotective agent. It has been reported that taurine could reduce uric acid levels in diabetic rats, but to date there was no research on the effects of taurine on hyperuricemic rats with kidney injury. In present study, hyperuricemic rat models were induced by intragastric administration of adenine and ethambutol hydrochloride for 10 days, and taurine (1% or 2%) were added in the drinking water 7 days in advance for consecutively 17 days. The results showed that taurine alleviated renal morphological and pathological changes as well as kidney dysfunction in hyperuricemic rats. Taurine could efficiently decrease the elevated xanthine oxidase activities in hyperuricemic rats, indicating its effect on the regulation of uric acid formation. The reabsorption and secretion of uric acid are dependent on a number of urate transporters. Expressions of three urate transporters were significantly down-regulated in hyperuricemic rats, while taurine prevented the decrease of mRNA and protein expression levels of these urate transporters. The results indicate that taurine might play a role in the regulation of renal uric acid excretion. Therefore, taurine could be a promising agent for the treatment of hyperuricemia. Copyright © 2017 Elsevier Inc. All rights reserved.

Lack of Gene-Diuretic Interactions on the Risk of Incident Gout: the Nurses’ Health Study and Health Professionals Follow-Up Study

PubMed Central

Bao, Ying; Curhan, Gary; Merriman, Tony; Plenge, Robert; Kraft, Peter; Choi, Hyon K.

2015-01-01

Background Diuretic-induced gout might occur only among those with a genetic predisposition to hyperuricemia, as suggested by a recent study with 108 self-reported gout cases. Methods We examined the role of urate genes on the risk of diuretic-induced incident gout in 6850 women from the Nurses’ Health Study (NHS) and in 4,223 men from the Health Professionals Follow-up Study (HPFS). Two published genetic risk scores (GRS) were calculated using urate-associated SNPs for eight genes (GRS8) and for 29 genes (GRS29). Results Our analyses included 727 and 354 confirmed incident gout cases in the HPFS and NHS, respectively. The multivariate RR for diuretic use was 2.20 and 1.69 among those with a GRS8 < and ≥ the median (p for interaction=0.27). The corresponding RRs using GRS29 were 2.19 and 1.88 (p for interaction=0.40). The lack of interaction persisted in the NHS (all p values >0.20) and in our analyses limited to those with hypertension in both cohorts. SLC22A11 (OAT4) showed a significant interaction only among women but in the opposite direction to the recent study. Conclusion In these large prospective studies, individuals with a genetic predisposition for hyperuricemia are not at a higher risk of developing diuretic-induced gout than those without. PMID:25667207

Association of plasma free amino acids with hyperuricemia in relation to diabetes mellitus, dyslipidemia, hypertension and metabolic syndrome.

PubMed

Mahbub, M H; Yamaguchi, Natsu; Takahashi, Hidekazu; Hase, Ryosuke; Ishimaru, Yasutaka; Sunagawa, Hiroshi; Amano, Hiroki; Kobayashi-Miura, Mikiko; Kanda, Hideyuki; Fujita, Yasuyuki; Yamamoto, Hiroshi; Yamamoto, Mai; Kikuchi, Shinya; Ikeda, Atsuko; Kageyama, Naoko; Nakamura, Mina; Tanabe, Tsuyoshi

2017-12-15

Previous studies demonstrated independent contributions of plasma free amino acids (PFAAs) and high uric acid (UA) concentrations to increased risks of lifestyle-related diseases (LSRDs), but the important associations between these factors and LSRDs remain unknown. We quantified PFAAs and UA amongst Japanese subjects without LSRDs (no-LSRD, n = 2805), and with diabetes mellitus (DM, n = 415), dyslipidemia (n = 3207), hypertension (n = 2736) and metabolic syndrome (MetS, n = 717). The concentrations of most amino acids differed significantly between the subjects with and without hyperuricemia (HU) and also between the no-LSRD and LSRD groups (p < 0.05 to 0.001). After adjustment, the logistic regression analyses revealed that lysine in DM, alanine, proline and tyrosine in dyslipidemia, histidine, lysine and ornithine in hypertension, and lysine and tyrosine in MetS demonstrated significant positive associations with HU among the patients with LSRDs only (p < 0.05 to 0.005). By contrast, arginine, asparagine and threonine showed significant inverse associations with HU in the no-LSRD group only (p < 0.05 to 0.01). For the first time, we provide evidence for distinct patterns of association between PFAAs and HU in LSRDs, and postulate the possibility of interplay between PFAAs and UA in their pathophysiology.

Feasibility of body roundness index for identifying a clustering of cardiometabolic abnormalities compared to BMI, waist circumference and other anthropometric indices: the China Health and Nutrition Survey, 2008 to 2009

PubMed Central

Tian, Simiao; Zhang, Xiuzhi; Xu, Yang; Dong, Huimin

2016-01-01

Abstract The body mass index (BMI) and waist circumference (WC) are commonly used anthropometric measures for predicting cardiovascular diseases risk factors, but it is uncertain which specific measure might be the most appropriate predictor of a cluster of cardiometabolic abnormalities (CMA) in Chinese adults. A body shape index (ABSI) and body roundness index (BRI) have been recently developed as alternative anthropometric indices that may better reflect health status. The main aims of this study were to investigate the predictive capacity of ABSI and BRI in identifying various CMA compared to BMI, WC, waist-to-hip ratio (WHpR), and waist-to-height ratio (WHtR), and to determine whether there exists a best single predictor of all CMA. We used data from the 2009 wave of the China Health and Nutrition Survey, and the final analysis included 8126 adults aged 18 to 85 years with available fasting blood samples and anthropometric measurements. Receiver-operating characteristic (ROC) analyses were conducted to assess the best anthropometric indices to predict the risk of hypertension, diabetes, dyslipidemia, hyperuricemia, and metabolic syndrome (MetS). Logistic regression models were fit to evaluate the OR of each CMA according to anthropometric indices. In women, the ROC analysis showed that BRI and WHtR had the best predictive capability in identifying all of CMA (area under the curves [AUCs] ranged from 0.658 to 0.721). In men, BRI and WHtR were better predictor of hypertension, diabetes, and at least 1 CMA (AUC: 0.668, 0.708, and 0.698, respectively), whereas BMI and WC were more sensitive predictor of dyslipidemia, hyperuricemia, and MetS. Furthermore, the ABSI showed the lowest AUCs for each CMA. According to the multivariate logistic regression analysis, BRI and WHtR were superior in discriminating hyperuricemia and at least 1 CMA while BMI performed better in predicting hypertension, diabetes, and MetS in women. In men, WC and BRI were the 2 best predictor of all CMA except MetS, and the ABSI was the worst. Our results showed the novel index BRI could be used as a single suitable anthropometric measure in simultaneously identifying a cluster of CMA compared to BMI and WHtR, especially in Chinese women, whereas the ABSI showed the weakest discriminative power. PMID:27559964

Heat Stress Nephropathy From Exercise-Induced Uric Acid Crystalluria: A Perspective on Mesoamerican Nephropathy.

PubMed

Roncal-Jimenez, Carlos; García-Trabanino, Ramón; Barregard, Lars; Lanaspa, Miguel A; Wesseling, Catharina; Harra, Tamara; Aragón, Aurora; Grases, Felix; Jarquin, Emmanuel R; González, Marvin A; Weiss, Ilana; Glaser, Jason; Sánchez-Lozada, Laura G; Johnson, Richard J

2016-01-01

Mesoamerican nephropathy (MeN), an epidemic in Central America, is a chronic kidney disease of unknown cause. In this article, we argue that MeN may be a uric acid disorder. Individuals at risk for developing the disease are primarily male workers exposed to heat stress and physical exertion that predisposes to recurrent water and volume depletion, often accompanied by urinary concentration and acidification. Uric acid is generated during heat stress, in part consequent to nucleotide release from muscles. We hypothesize that working in the sugarcane fields may result in cyclic uricosuria in which uric acid concentrations exceed solubility, leading to the formation of dihydrate urate crystals and local injury. Consistent with this hypothesis, we present pilot data documenting the common presence of urate crystals in the urine of sugarcane workers from El Salvador. High end-of-workday urinary uric acid concentrations were common in a pilot study, particularly if urine pH was corrected to 7. Hyperuricemia may induce glomerular hypertension, whereas the increased urinary uric acid may directly injure renal tubules. Thus, MeN may result from exercise and heat stress associated with dehydration-induced hyperuricemia and uricosuria. Increased hydration with water and salt, urinary alkalinization, reduction in sugary beverage intake, and inhibitors of uric acid synthesis should be tested for disease prevention. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Glycogen Storage Disease Type Ia: Linkage of Glucose, Glycogen, Lactic Acid, Triglyceride, and Uric Acid Metabolism

PubMed Central

Sever, Sakine; Weinstein, David A.; Wolfsdorf, Joseph I.; Gedik, Reyhan; Schaefer, Ernst J.

2013-01-01

Case Summary A female presented in infancy with hypotonia, undetectable serum glucose, lactic acidosis, and triglycerides > 5,000 mg/dl. The diagnosis of type 1A glycogen storage disease (GSD) was made by liver biopsy that showed increased glycogen and absent glucose-6-phosphatase enzyme activity. She was treated with dextrose feeding, which was replaced by frequent cornstarch feeding, with improvement of her metabolic parameters. At age 18 years she had marked hypertriglyceridemia (3,860 mg/dl) and eruptive xanthomas, and was treated with fenofibrate, atorvastatin, and fish oil. At age 29 years she was noted to have multiple liver adenomas, severe anemia, and hyperuricemia. Aggressive cornstarch therapy was commenced with a goal of maintaining her blood glucose levels > 75 mg/dl and lactate levels < 2 mmol/L. After 15 months on this regimen, her lipids levels (measured in mg/dl) off all medications were: total cholesterol 222, triglycerides 179, high density lipoprotein cholesterol 32, and calculated low density lipoprotein cholesterol 154. Her weight was stable with a body mass index of 24.8 kg/m2. Her liver adenomas had decreased in size, and her anemia and hyperuricemia had improved. She was homozygous for the R83C missense mutation in G6PC. Our data indicate that optimized metabolic control to maintain blood glucose levels > 75 mg/dl is critical in the management of this disease. PMID:23312056

Comprehensive Comparison between Empty Nest and Non-Empty Nest Elderly: A Cross-Sectional Study among Rural Populations in Northeast China.

PubMed

Chang, Ye; Guo, Xiaofan; Guo, Liang; Li, Zhao; Yang, Hongmei; Yu, Shasha; Sun, Guozhe; Sun, Yingxian

2016-08-27

This study aimed to comprehensively compare the general characteristics, lifestyles, serum parameters, ultrasonic cardiogram (UCG) parameters, depression, quality of life, and various comorbidities between empty nest and non-empty nest elderly among rural populations in northeast China. This analysis was based on our previous study which was conducted from January 2012 to August 2013, using a multistage, stratified, random cluster sampling scheme. The final analyzed sample consisted of 3208 participants aged no less than 60 years, which was further classified into three groups: non-empty nest group, empty nest group (living as a couple), and empty nest group (living alone). More than half of the participants were empty nest elderly (60.5%). There were no significant statistical differences for serum parameters, UCG parameters, lifestyles, dietary pattern, and scores of Patient Health Questionnaire-9 (PHQ-9) and World Health Organization Quality of Life questionnaire, abbreviated version (WHOQOL-BREF) among the three groups. Empty nest elderly showed no more risk for comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, left atrial enlargement (LAE), and stroke. Our study indicated that empty nest elderly showed no more risk for depression, low quality of life and comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, LAE, and stroke among rural populations in northeast China.

Saponins extracted from Dioscorea collettii rhizomes regulate the expression of urate transporters in chronic hyperuricemia rats.

PubMed

Zhu, Liran; Dong, Yifan; Na, Sha; Han, Ru; Wei, Chengyin; Chen, Guangliang

2017-09-01

The current study aimed to investigate whether the saponins, bioactive component of effects of D. collettii, could reduce the serum uric acid level in a hyperuricemic mouse via regulation of urate transporters. Chronic hyperuricemia model was established by combine administration of adenine (100mg/kg) and ethambutol (250mg/kg). In the model group, the serum uric acid (SUA), urine uric acid (UUA) volume, and 24-h UUA values increased significantly, while the uric acid clearance rate (CUr) and creatinine clearance rate (CCr) values decreased. Further, the model groups showed significantly lower expression of organic anion transporter 1 (OAT1) and organic anion transporter 3 (OAT3) and significantly higher expression of renal tubular urate transporter 1 (URAT1), glucose transporter 9 (GLUT9) and URAT1 mRNA than the normal control group. Saponins administration was found to have a dose-dependent effect, as evidenced by the increase in the 24-h UUA, CUr and CCr values; the decrease in SUA; the decrease in the renal expression of URAT1 mRNA and URAT1 and GLUT9 proteins; and the increase in the renal expression of the OAT1 and OAT3 proteins. The saponins extracted from D. collettii rhizomes had an obvious anti-hyperuricemic effect through downregulation of the URAT1 mRNA and the URAT1 and GLUT9 proteins and upregulation of the OAT1 and OAT3 proteins. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Updates on the treatment of gout, including a review of updated treatment guidelines and use of small molecule therapies for difficult-to-treat gout and gout flares.

PubMed

Soskind, Rose; Abazia, Daniel T; Bridgeman, Mary Barna

2017-08-01

Gout is a rheumatologic condition associated with elevated serum uric acid levels and deposition of monosodium urate crystals in joints and soft tissues. Areas covered: In this article, we describe the role of currently available drug therapies for managing acute gout flares and used in reducing serum urate levels. Further, we explore the role of novel small molecular therapies and biologic agents in the treatment of refractory or severe gout symptoms. A literature search of MEDLINE and MEDLINE In-Process & Other Non-Indexed Citations Databases (1996-June 2017) was conducted utilizing the key words 'gout', 'interleukin-1 inhibitors', 'acute gout', 'gout treatment', 'urate lowering therapies', 'hyperuricemia', 'colchicine', 'pegloticase', 'lesinurad', 'xanthine oxidase', 'xanthine oxidase inhibitors', 'allopurinol', 'febuxostat', 'uricosurics', 'probenecid', and 'benzbromarone'. All published articles regarding therapeutic management of gout and hyperuricemia were evaluated. References of selected articles, data from poster presentations, and abstract publications were additionally reviewed. Expert opinion: Numerous therapies are currently available to managing acute gout flares and for lowering serum urate levels; advances in the understanding of the pathophysiology of this disorder has led to the emergence of targeted therapies and novel biologic preparations currently in development which may improve the clinical management of severe or refractory cases of disease that fail to respond to traditional therapies.

Identification of crypto- and neochlorogenic lactones as potent xanthine oxidase inhibitors in roasted coffee beans.

PubMed

Honda, Sari; Miura, Yukari; Masuda, Akiko; Masuda, Toshiya

2014-01-01

Xanthine oxidase (XO) inhibitory activity has been found in boiling water extracts from roasted coffee beans. Therefore, assay-guided purification of the extracts was performed using size-exclusion column chromatography, and subsequently with reversed phase HPLC to afford lactone derivatives of chlorogenic acids. Among the tested lactones, crypto- and neochlorogenic lactones showed potent XO inhibitory activities compared with three major chlorogenic acids found in coffee beans. These XO inhibitory lactones may ameliorate gout and hyperuricemia in humans who drink coffee.

[ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].

PubMed

Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I

2016-03-01

The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.

Stabilization of the predominant disease-causing aldolase variant (A149P) with zwitterionic osmolytes.

PubMed

Stopa, Jack D; Chandani, Sushil; Tolan, Dean R

2011-02-08

Hereditary fructose intolerance (HFI) is a disease of carbohydrate metabolism that can result in hyperuricemia, hypoglycemia, liver and kidney failure, coma, and death. Currently, the only treatment for HFI is a strict fructose-free diet. HFI arises from aldolase B deficiency, and the most predominant HFI mutation is an alanine to proline substitution at position 149 (A149P). The resulting aldolase B with the A149P substitution (AP-aldolase) has activity that is <100-fold that of the wild type. The X-ray crystal structure of AP-aldolase at both 4 and 18 °C reveals disordered adjacent loops of the (α/β)(8) fold centered around the substitution, which leads to a dimeric structure as opposed to the wild-type tetramer. The effects of osmolytes were tested for restoration of structure and function. An initial screen of osmolytes (glycerol, sucrose, polyethylene glycol, 2,4-methylpentanediol, glutamic acid, arginine, glycine, proline, betaine, sarcosine, and trimethylamine N-oxide) reveals that glycine, along with similarly structured compounds, betaine and sarcosine, protects AP-aldolase structure and activity from thermal inactivation. The concentration and functional moieties required for thermal protection show a zwitterion requirement. The effects of osmolytes in restoring structure and function of AP-aldolase are described. Testing of zwitterionic osmolytes of increasing size and decreasing fractional polar surface area suggests that osmolyte-mediated AP-aldolase stabilization occurs neither primarily through excluded volume effects nor through transfer free energy effects. These data suggest that AP-aldolase is stabilized by binding to the native structure, and they provide a foundation for developing stabilizing compounds for potential therapeutics for HFI.

Preventive and Therapeutic Role of Functional Ingredients of Barley Grass for Chronic Diseases in Human Beings

PubMed Central

Du, Juan; Yang, Xiaomeng; Li, Xia; Li, Ling; Zhou, Yan; Yang, Tao

2018-01-01

Barley grass powder is the best functional food that provides nutrition and eliminates toxins from cells in human beings; however, its functional ingredients have played an important role as health benefit. In order to better cognize the preventive and therapeutic role of barley grass for chronic diseases, we carried out the systematic strategies for functional ingredients of barley grass, based on the comprehensive databases, especially the PubMed, Baidu, ISI Web of Science, and CNKI, between 2008 and 2017. Barley grass is rich in functional ingredients, such as gamma-aminobutyric acid (GABA), flavonoids, saponarin, lutonarin, superoxide dismutase (SOD), K, Ca, Se, tryptophan, chlorophyll, vitamins (A, B1, C, and E), dietary fiber, polysaccharide, alkaloid, metallothioneins, and polyphenols. Barley grass promotes sleep; has antidiabetic effect; regulates blood pressure; enhances immunity; protects liver; has anti-acne/detoxifying and antidepressant effects; improves gastrointestinal function; has anticancer, anti-inflammatory, antioxidant, hypolipidemic, and antigout effects; reduces hyperuricemia; prevents hypoxia, cardiovascular diseases, fatigue, and constipation; alleviates atopic dermatitis; is a calcium supplement; improves cognition; and so on. These results support that barley grass may be one of the best functional foods for preventive chronic diseases and the best raw material of modern diet structure in promoting the development of large health industry and further reveal that GABA, flavonoids, SOD, K-Ca, vitamins, and tryptophan mechanism of barley grass have preventive and therapeutic role for chronic diseases. This paper can be used as a scientific evidence for developing functional foods and novel drugs for barley grass for preventive chronic diseases.

An old disease with new insights: Update on diagnosis and treatment of gout

PubMed Central

Bitik, Berivan; Öztürk, M. Akif

2014-01-01

Gout is an acute and chronic inflammatory disorder associated with high morbidity and impaired quality of life. There has been a substantial increase in the prevalence and incidence of gout in recent years. Novel diagnostic and therapeutic options have provided new insights into the pathogenesis and management of hyperuricemia and gout in the last decade. This clinical review aims to summarize the diagnostic process and management of acute and chronic gout. PMID:27708879

Circulating Levels of Uric Acid and Risk for Metabolic Syndrome.

PubMed

Rubio-Guerra, Alberto F; Morales-López, Herlinda; Garro-Almendaro, Ana K; Vargas-Ayala, German; Durán-Salgado, Montserrat B; Huerta-Ramírez, Saul; Lozano-Nuevo, Jose J

2017-01-01

Hyperuricemia leads to insulin resistance, whereas insulin resistance decreases renal excretion of uric acid, both mechanisms link elevated serum uric acid with metabolic syndrome. The aim of this study is to evaluate the probability for the development of metabolic syndrome in low-income young adults with hyperuricaemia. We evaluated 103 patients less than 40 years of age, from a low-income population, and without history of cardiovascular disease, in all of them the presence of metabolic syndrome was assessed in accordance with the International Diabetes Federation criteria. In all patients, fasting serum uric acid levels were measured; hyperuricaemia was defined as serum uric acid values 6.5 mg/dl in men and 5.1 mg/dl in women. Statistical analysis was performed with odds ratio. 83 of our patients (80.5%) suffered metabolic syndrome, the odds ratio for the presence of metabolic syndrome in patients with hyperuricaemia was 5.1 (p=0.002, I.C 1.8- 14.5). When patients were evaluated by gender a significantly association between hyperuricaemia and metabolic syndrome was found in women (odds ratio 3.6, p=0.048, C.I. 1.0-12.9), and men (odds ratio 10.2, p= 0.015, IC 1.5-13.2). When uric acid was correlated with the components of metabolic syndrome, we only found a positive correlation with waist circumference (r=0.483). Our results showed a significant association between hyperuricemia and metabolic syndrome in low-income young adults in Mexico. DR is associated with estimated risk of CVD in type 2 diabetic patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Losartan vs. amlodipine treatment in elderly oncologic hypertensive patients: a randomized clinical trial.

PubMed

Motta, Massimo; Russo, Cristina; Vacante, Marco; Liardo, Rocco Luca Emanuele; Reitano, Francesca; Cammalleri, Lisa; Costanzo, Mario; Benfatto, Giuseppe; Frazzetto, Paola; Mondati, Enrico; Malaguarnera, Michele; Pennisi, Giovanni

2011-01-01

Elderly neoplastic patients frequently may show hypertension and hyperuricemia, before and after chemotherapeutic treatments. The purpose of this study was to evaluate the efficacy of losartan which is an antihypertensive drug with uricosuric properties vs. amlodipine in hypertensive neoplastic elderly patients. This was an open-labeled, randomized, comparative trial. The study was performed as a 30-day study. Seventy patients with cancer were randomly assigned to receive losartan or amlodipine. Blood pressure (BP), blood urea nitrogen (BUN) levels, creatinine, serum and urinary uric acid, creatinine and uric acid clearance were determined before and after chemotherapy. One day after chemotherapy in losartan group vs. amlodipine group we observed a significant difference in urinary uric acid (p<0.001) of 18 mg/24 h vs. 40 mg/24 h. Thirty days after chemotherapy we observed a significant difference in azotemia of 0.0 mg/dl vs. 3.8 mg/dl (p<0.001), serum uric acid of 0.05 mg/dl vs. 0.49 mg/dl (p<0.001), urinary uric acid (p<0.001) of 23 mg/24 h vs. 0.0 mg/24 h, GFR of 2 ml/min/1.73 m(2) vs. -8 ml/min/1.73 m(2) (p<0.05) and systolic BP (SBP) of 3.6 mmHg vs. 0.8 mmHg (p<0.05). The findings of the present study support the effective role of losartan compared to amlodipine in treating hypertension and hyperuricemia in elderly patients under chemotherapeutic treatment. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

The dual actions of morin (3,5,7,2',4'-pentahydroxyflavone) as a hypouricemic agent: uricosuric effect and xanthine oxidase inhibitory activity.

PubMed

Yu, Zhifeng; Fong, Wing Ping; Cheng, Christopher H K

2006-01-01

Hyperuricemia is associated with a number of pathological conditions such as gout. Lowering of elevated uric acid level in the blood could be achieved by xanthine oxidase inhibitors and inhibitors of renal urate reabsorption. Some natural compounds isolated from herbs used in traditional Chinese medicine have been previously demonstrated to possess xanthine oxidase inhibitory activities. In the present investigation, morin (3,5,7,2',4'-pentahydroxyflavone), which occurs in the twigs of Morus alba L. documented in traditional Chinese medicinal literature to treat conditions akin to gout, was demonstrated to exert potent inhibitory action on urate uptake in rat renal brush-border membrane vesicles, indicating that this compound acts on the kidney to inhibit urate reabsorption. Lineweaver-Burk transformation of the inhibition kinetics data demonstrated that the inhibition of urate uptake was of a competitive type, with a K(i) value of 17.4 microM. In addition, morin was also demonstrated to be an inhibitor of xanthine oxidase. Lineweaver-Burk analysis of the enzyme kinetics indicated that the mode of inhibition was of a mixed type, with K(i) and K(ies) values being 7.9 and 35.1 microM, respectively. Using an oxonate-induced hyperuricemic rat model, morin was indeed shown to exhibit an in vivo uricosuric action, which could explain, in part at least, the observed hypouricemic effect of morin in these rats. The potential application of this compound in the treatment of conditions associated with hyperuricemia was discussed.

Effect of vitamin C supplementation on lipid profile, serum uric acid, and ascorbic acid in children on hemodialysis.

PubMed

El Mashad, Ghada Mohamed; ElSayed, Hanan M; Nosair, Nahla A

2016-01-01

Children with end-stage renal disease (ESRD) suffer from dyslipidemia and hyperuricemia that might play a causal role in the progression of cardiovascular disease (CVD). The aim of the study is to assess the effects of Vitamin C supplementation on uric acid, ascorbic acid, and serum lipid levels among children on hemodialysis (HD). This prospective study was conducted in the pediatric nephrology unit at Menoufia University Hospital. The study included a total of 60 children with ESRD on maintenance HD therapy. They were divided into two groups: Group I (supplemented group, n = 30) received intravenous Vitamin C supplementation and Group II (control, n = 30) received placebo (intravenous saline) for three months. The results are shown as a mean ± standard deviation. Statistical evaluation was performed by SPSS software (version 11.5) using paired t-test. After supplementation with Vitamin C, the serum Vitamin C and high-density lipoprotein levels increased significantly with a significant reduction in the levels of serum uric acid, cholesterol, low-density lipoproteins, and triglyceride at the end of the study period. No significant changes were observed in the control group. Vitamin C can serve as a useful urate lowering medicine in HD patients to avoid complications of hyperuricemia. Furthermore, it had favorable effects on the lipid profile. This improvement can be considered as a preventive strategy in the progression of CVD in HD patients. Vitamin C supplementation improves ascorbic acid deficiency in these patients.

Mutations in the mitochondrial seryl-tRNA synthetase cause hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis, HUPRA syndrome.

PubMed

Belostotsky, Ruth; Ben-Shalom, Efrat; Rinat, Choni; Becker-Cohen, Rachel; Feinstein, Sofia; Zeligson, Sharon; Segel, Reeval; Elpeleg, Orly; Nassar, Suheir; Frishberg, Yaacov

2011-02-11

An uncharacterized multisystemic mitochondrial cytopathy was diagnosed in two infants from consanguineous Palestinian kindred living in a single village. The most significant clinical findings were tubulopathy (hyperuricemia, metabolic alkalosis), pulmonary hypertension, and progressive renal failure in infancy (HUPRA syndrome). Analysis of the consanguineous pedigree suggested that the causative mutation is in the nuclear DNA. By using genome-wide SNP homozygosity analysis, we identified a homozygous identity-by-descent region on chromosome 19 and detected the pathogenic mutation c.1169A>G (p.Asp390Gly) in SARS2, encoding the mitochondrial seryl-tRNA synthetase. The same homozygous mutation was later identified in a third infant with HUPRA syndrome. The carrier rate of this mutation among inhabitants of this Palestinian isolate was found to be 1:15. The mature enzyme catalyzes the ligation of serine to two mitochondrial tRNA isoacceptors: tRNA(Ser)(AGY) and tRNA(Ser)(UCN). Analysis of amino acylation of the two target tRNAs, extracted from immortalized peripheral lymphocytes derived from two patients, revealed that the p.Asp390Gly mutation significantly impacts on the acylation of tRNA(Ser)(AGY) but probably not that of tRNA(Ser)(UCN). Marked decrease in the expression of the nonacylated transcript and the complete absence of the acylated tRNA(Ser)(AGY) suggest that this mutation leads to significant loss of function and that the uncharged transcripts undergo degradation. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Comprehensive Comparison between Empty Nest and Non-Empty Nest Elderly: A Cross-Sectional Study among Rural Populations in Northeast China

PubMed Central

Chang, Ye; Guo, Xiaofan; Guo, Liang; Li, Zhao; Yang, Hongmei; Yu, Shasha; Sun, Guozhe; Sun, Yingxian

2016-01-01

This study aimed to comprehensively compare the general characteristics, lifestyles, serum parameters, ultrasonic cardiogram (UCG) parameters, depression, quality of life, and various comorbidities between empty nest and non-empty nest elderly among rural populations in northeast China. This analysis was based on our previous study which was conducted from January 2012 to August 2013, using a multistage, stratified, random cluster sampling scheme. The final analyzed sample consisted of 3208 participants aged no less than 60 years, which was further classified into three groups: non-empty nest group, empty nest group (living as a couple), and empty nest group (living alone). More than half of the participants were empty nest elderly (60.5%). There were no significant statistical differences for serum parameters, UCG parameters, lifestyles, dietary pattern, and scores of Patient Health Questionnaire-9 (PHQ-9) and World Health Organization Quality of Life questionnaire, abbreviated version (WHOQOL-BREF) among the three groups. Empty nest elderly showed no more risk for comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, left atrial enlargement (LAE), and stroke. Our study indicated that empty nest elderly showed no more risk for depression, low quality of life and comorbidities such as general obesity, abdominal obesity, hyperuricemia, hyperhomocysteinemia, diabetes, dyslipidemia, LAE, and stroke among rural populations in northeast China. PMID:27618905

The Potential Biomarkers to Identify the Development of Steatosis in Hyperuricemia

PubMed Central

He, Xiaojuan; Lu, Cheng; He, Bing; Niu, Xuyan; Xiao, Cheng; Xu, Gang; Bian, Zhaoxiang; Zu, Xianpeng; Zhang, Ge; Zhang, Weidong; Lu, Aiping

2016-01-01

Hyperuricemia (HU) often progresses to combine with non-alcoholic fatty liver disease (NAFLD) in the clinical scenario, which further exacerbates metabolic disorders; early detection of biomarkers, if obtained during the HU progression, may be beneficial for preventing its combination with NAFLD. This study aimed to decipher the biomarkers and mechanisms of the development of steatosis in HU. Four groups of subjects undergoing health screening, including healthy subjects, subjects with HU, subjects with HU combined with NAFLD (HU+NAFLD) and subjects with HU initially and then with HU+NAFLD one year later (HU→HU+NAFLD), were recruited in this study. The metabolic profiles of all subjects’ serum were analyzed by liquid chromatography quadruple time-of-flight mass spectrometry. The metabolomic data from subjects with HU and HU+NAFLD were compared, and the biomarkers for the progression from HU to HU+NAFLD were predicted. The metabolomic data from HU→HU+NAFLD subjects were collected for further verification. The results showed that the progression was associated with disturbances of phospholipase metabolism, purine nucleotide degradation and Liver X receptor/retinoic X receptor activation as characterized by up-regulated phosphatidic acid, cholesterol ester (18:0) and down-regulated inosine. These metabolic alterations may be at least partially responsible for the development of steatosis in HU. This study provides a new paradigm for better understanding and further prevention of disease progression. PMID:26890003

A concise history of gout and hyperuricemia and their treatment.

PubMed

Nuki, George; Simkin, Peter A

2006-01-01

First identified by the Egyptians in 2640 BC, podagra (acute gout occurring in the first metatarsophalangeal joint) was later recognized by Hippocrates in the fifth century BC, who referred to it as 'the unwalkable disease'. The term is derived from the Latin word gutta (or 'drop'), and referred to the prevailing medieval belief that an excess of one of the four 'humors'--which in equilibrium were thought to maintain health--would, under certain circumstances, 'drop' or flow into a joint, causing pain and inflammation. Throughout history, gout has been associated with rich foods and excessive alcohol consumption. Because it is clearly associated with a lifestyle that, at least in the past, could only be afforded by the affluent, gout has been referred to as the 'disease of kings'. Although there is evidence that colchicine, an alkaloid derived from the autumn crocus (Colchicum autumnale), was used as a powerful purgative in ancient Greece more than 2000 years ago, its first use as a selective and specific treatment for gout is attributed to the Byzantine Christian physician Alexander of Tralles in the sixth century AD. Uricosuric agents were first used at the end of the 19th century. In the modern era, nonsteroidal anti-inflammatory drugs are usually the drugs of choice for treating acute gout. Perhaps the most important historical advance in the treatment of hyperuricemia was the development of xanthine oxidase inhibitors, which are effective in reducing plasma and urinary urate levels and have been shown to reverse the development of tophaceous deposits.

The relationships among hyperuricemia, body mass index and impaired renal function in type 2 diabetic patients.

PubMed

Li, Yongmei; Fan, Xing; Li, Chunjun; Zhi, Xinyue; Peng, Liyuan; Han, Hongling; Sun, Bei

2018-03-28

Chronic kidney disease (CKD) is a common chronic microvascular complication and the major cause of death in diabetic patients. This study was conceived to explore the possible mechanisms of how hyperuricemia and obesity contribute to renal function impairment in type 2 diabetic (T2DM) patients. A cross-sectional study in 609 participants recruited from a T2DM population in North China was conducted. The multiplicative interaction between body mass index (BMI) and uric acid (UA) level was assessed using an interaction term in a logistic regression analysis. Our results indicate that male T2DM patients having higher BMI (OR 1.711, p = 0.038), blood urine nitrogen (BUN) (OR 1.100, p = 0.034), and 24-hour urinary micro-albumin levels (OR 1.004, p = 0.021) were much more likely to have high UA. Whereas, for female T2DM patients, the OR of BMI, BUN, and triglyceride were 1.169 (p = 0.001), 1.337 (p = 0.000), and 1.359 (p = 0.006), respectively. In this study population, obesity and elevated UA work together to increase the risk of renal injury. In vitro experiments indicate that reactive oxygen species (ROS) production increased with UA treatment in human renal glomerular endothelial cells (HRGECs), while endothelial nitric oxide synthase (eNOS) production level dropped. UA also increased monocyte chemotactic protein-1 (MCP-1) expression and nuclear factor kappa B (NF-κB) activation. Taken together, our results indicate that high concentrations of UA lead to endothelial dysfunction through the activation of the inflammatory response and induction of oxidative stress, even in non-obese T2DM patients.

The prevention and treatment of hypoadiponectinemia-associated human diseases by up-regulation of plasma adiponectin.

PubMed

Hossain, Md Murad; Mukheem, Abdul; Kamarul, Tunku

2015-08-15

Hypoadiponectinemia is characterized by low plasma adiponectin levels that can be caused by genetic factors, such as single nucleotide polymorphisms (SNPs) and mutations in the adiponectin gene or by visceral fat deposition/obesity. Reports have suggested that hypoadiponectinemia is associated with dyslipidemia, hypertension, hyperuricemia, metabolic syndrome, atherosclerosis, type 2 diabetes mellitus and various cardiovascular diseases. Previous studies have highlighted several potential strategies to up-regulate adiponectin secretion and function, including visceral fat reduction through diet therapy and exercise, administration of exogenous adiponectin, treatment with peroxisome proliferator-activating receptor gamma (PPARγ) agonists (e.g., thiazolidinediones (TZDs)) and ligands (e.g., bezafibrate and fenofibrate) or the blocking of the renin-angiotensin system. Likewise, the up-regulation of the expression and stimulation of adiponectin receptors by using adiponectin receptor agonists would be an effective method to treat obesity-related conditions. Notably, adiponectin is an abundantly expressed bioactive protein that also exhibits a wide spectrum of biological properties, such as insulin-sensitizing, anti-diabetic, anti-inflammatory and anti-atherosclerotic activities. Although targeting adiponectin and its receptors has been useful for treating diabetes and other metabolic-related diseases in experimental studies, current drug development based on adiponectin/adiponectin receptors for clinical applications is scarce, and there is a lack of available clinical trial data. This comprehensive review discusses the strategies that are presently being pursued to harness the potential of adiponectin up-regulation. In addition, we examined the current status of drug development and its potential for clinical applications. Copyright © 2015 Elsevier Inc. All rights reserved.

Evidence Report: Risk of Renal Stone Formation

NASA Technical Reports Server (NTRS)

Sibonga, Jean D.; Pietrzyk, Robert

2017-01-01

The formation of renal stones poses an in-flight health risk of high severity, not only because of the impact of renal colic on human performance but also because of complications that could potentially lead to crew evacuation, such as hematuria, infection, hydronephrosis, and sepsis. Evidence for risk factors comes from urine analyses of crewmembers, documenting changes to the urinary environment that are conducive to increased saturation of stone-forming salts, which are the driving force for nucleation and growth of a stone nidus. Further, renal stones have been documented in astronauts after return to Earth and in one cosmonaut during flight. Biochemical analysis of urine specimens has provided indication of hypercalciuria and hyperuricemia, reduced urine volumes, and increased urine saturation of calcium oxalate and calcium phosphate. A major contributor to the risk for renal stone formation is bone atrophy with increased turnover of the bone minerals. Dietary and fluid intakes also play major roles in the risk because of the influence on urine pH (more acidic) and on volume (decreased). Historically, specific assessments on urine samples from some Skylab crewmembers indicated that calcium excretion increased early in flight, notable by day 10 of flight, and almost exceeded the upper threshold for normal excretion (300mg/day in males). Other crewmember data documented reduced intake of fluid and reduced intake of potassium, phosphorus, magnesium, and citrate (an inhibitor of calcium stone formation) in the diet. Hence, data from both short-duration and long-duration missions indicate that space travel induces risk factors for renal stone formation that continue to persist after flight; this risk has been documented by reported kidney stones in crewmembers.

Fructose suppresses uric acid excretion to the intestinal lumen as a result of the induction of oxidative stress by NADPH oxidase activation.

PubMed

Kaneko, Chihiro; Ogura, Jiro; Sasaki, Shunichi; Okamoto, Keisuke; Kobayashi, Masaki; Kuwayama, Kaori; Narumi, Katsuya; Iseki, Ken

2017-03-01

A high intake of fructose increases the risk for hyperuricemia. It has been reported that long-term fructose consumption suppressed renal uric acid excretion and increased serum uric acid level. However, the effect of single administration of fructose on excretion of uric acid has not been clarified. We used male Wistar rats, which were orally administered fructose (5g/kg). Those rats were used in each experiment at 12h after administration. Single administration of fructose suppressed the function of ileal uric acid excretion and had no effect on the function of renal uric acid excretion. Breast cancer resistance protein (BCRP) predominantly contributes to intestinal excretion of uric acid as an active homodimer. Single administration of fructose decreased BCRP homodimer level in the ileum. Moreover, diphenyleneiodonium (DPI), an inhibitor of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox), recovered the suppression of the function of ileal uric acid excretion and the Bcrp homodimer level in the ileum of rats that received single administration of fructose. Single administration of fructose decreases in BCRP homodimer level, resulting in the suppression the function of ileal uric acid excretion. The suppression of the function of ileal uric acid excretion by single administration of fructose is caused by the activation of Nox. The results of our study provide a new insight into the mechanism of fructose-induced hyperuricemia. Copyright © 2016 Elsevier B.V. All rights reserved.

A comparative study of efficacy and safety of febuxostat and allopurinol in pyrazinamide-induced hyperuricemic tubercular patients

PubMed Central

Pichholiya, Meenu; Yadav, Arvind Kumar; Luhadia, S. K.; Tahashildar, Jameela; Aseri, M. L.

2016-01-01

Objectives: To compare the efficacy and safety of febuxostat and allopurinol in pyrazinamide (PZA)-induced hyperuricemia in patients taking antitubercular therapy (ATT). Methods: This randomized controlled study was conducted at a tertiary care teaching institute of Rajasthan in all the sputum-positive tubercular patients aged between 18 and 65 years of either sex. Serum uric acid level was monitored at 0th, 2nd, 4th, 6th, and 8th week of ATT. Patients whose uric acid level was found to be increased at 2nd week were finally recruited in the study. Ninety patients who developed hyperuricemia due to ATT were divided randomly into three groups (Group A - febuxostat, Group B - allopurinol, and Group C - control) of thirty patients each. Mean serum uric acid levels were calculated at all the weeks in all the groups, and serum uric acid levels were compared by applying student's t-test and ANOVA. Results: Mean serum uric acid level decreased from 10.698 mg/dl (at 2nd week) to 7.846 mg/dl (at 8th week) in Group A and from 11.34 mg/dl (at 2nd week) to 7.280 mg/dl (at 8th week) in Group B. Numbers of adverse events encountered across both the treatment groups were same with both the drugs. Conclusion: Allopurinol and febuxostat were equally efficacious in lowering PZA induced raised serum uric acid level in tubercular patients, and it was possible to continue ATT without withdrawing PZA. PMID:27721537

Glycogen storage disease type Ia: linkage of glucose, glycogen, lactic acid, triglyceride, and uric acid metabolism.

PubMed

Sever, Sakine; Weinstein, David A; Wolfsdorf, Joseph I; Gedik, Reyhan; Schaefer, Ernst J

2012-01-01

A female presented in infancy with hypotonia, undetectable serum glucose, lactic acidosis, and triglycerides >5000 mg/dL. The diagnosis of type 1A glycogen storage disease was made via the result of a liver biopsy, which showed increased glycogen and absent glucose-6-phosphatase enzyme activity. The patient was treated with dextrose administered orally, which was replaced by frequent feedings of cornstarch, which resulted in an improvement of her metabolic parameters. At age 18 years of age, she had marked hypertriglyceridemia (3860 mg/dL) and eruptive xanthomas and was treated with fenofibrate, atorvastatin, and fish oil. At age 29 years she was noted to have multiple liver adenomas, severe anemia, and hyperuricemia. Aggressive cornstarch therapy was commenced with a goal of maintaining her blood glucose levels >75 mg/dL and lactate levels <2 mmol/L. After 15 months on this regimen, her lipids levels (measured in mg/dL) off all medications were as follows: total cholesterol 222, triglycerides 179, high-density lipoprotein cholesterol 32, and calculated low-density lipoprotein cholesterol 154. Her weight was stable with a body mass index of 24.8 kg/m(2). Her liver adenomas had decreased in size, and her anemia and hyperuricemia had improved. She was homozygous for the R83C missense mutation in G6PC. Our data indicate that optimized metabolic control to maintain blood glucose levels >75 mg/dL is critical in the management of this disease. Copyright © 2012. Published by Elsevier Inc.

Genetics of gout.

PubMed

Choi, Hyon K; Zhu, Yanyan; Mount, David B

2010-03-01

This review provides an update on recent findings with regards to the genetics of hyperuricemia and gout, including recent data from genome-wide association studies (GWAS). Five GWAS around the same time reported that genetic variants of SLC2A9/GLUT9 were associated with lower serum uric acid (SUA) levels and the effects were stronger among women (e.g. SUA level difference per copy of a minor allele, -0.46 mg/dl in women vs. -0.22 mg/dl in men). One study involving four cohorts and one meta-analysis of 14 genome-wide scans found that genetic variants of ABCG2 were associated with higher SUA concentrations and these effects were stronger among men (e.g. uric acid level difference per copy of the minor allele, 0.32 mg/dl in men vs. 0.18 mg/dl in women). Limited data indicate that these associations likely translate into those with the risk of gout. Functional determination that GLUT9 and ABCG2 can transport urate at the apical border of proximal tubules implicates them as substantial players in the renal excretion of urate. Furthermore, five novel genetic loci have been reported in the meta-analysis of 14 genome-wide scans. Combined with their activities as urate transporters and their strong associations with serum uric acid concentrations, GLUT9 and ABCG2 appeared to be important modulators of uric acid levels and likely of the risk of gout. Together with a growing list of environmental risk factors, these genetic data add considerably to our understanding of the pathogenesis of hyperuricemia and gout.

Polymorphisms of uric transporter proteins in the pathogenesis of gout in a Chinese Han population.

PubMed

Wan, W; Xu, X; Zhao, D B; Pang, Y F; Wang, Y X

2015-03-30

In this study, we analyzed single nucleotide polymorphisms (SNP) in urate transporter genes to examine the pathogenesis of gout. We conducted a 1:1-matched case-control study that included 110 patients with acute gout attacks as the patient group and 110 healthy age- and gender-matched subjects as the control group. Clinical parameters were recorded and blood biochemistry tests were conducted for both groups. Multivariate logistic regression analysis was used to analyze the data. Hyperuricemia, hypercholesterolemia, and hypertriglyceridemia were found to be the main risk factors for the onset of gout, with relative risks of 29.2 (P < 0.001), 25.5 (P = 0.003), and 11.2 (P < 0.001). For all detected SNP, rs2231142, located in ABCG2, showed the largest frequency differences for the G/G, G/T, and T/T genotypes between groups: the distribution of these genotypes in the case group was 22, 49, and 26 individuals, respectively, and was 54, 38, and 9 individuals, respectively, in the control group. There was a statistically significant difference between the 2 groups (P < 0.001) and the odds ratio was 7.091 (95% confidence interval = 2.867-17.541). Other SNPs (rs1165196, rs1165205, rs1183201, rs17300741, rs2078267, rs2242206, rs3733591, and rs9358856) showed no significant difference between the groups (P > 0.05). The risk factors of gout were hyperuricemia, hypercholesterolemia, hypertriglyceridemia, and the T/T genotype of the rs2231142 locus in the ABCG2 gene; expression of the G/G genotype may be a protective factor against gout development.

Discordant American College of Physicians and international rheumatology guidelines for gout management: consensus statement of the Gout, Hyperuricemia and Crystal-Associated Disease Network (G-CAN).

PubMed

Dalbeth, Nicola; Bardin, Thomas; Doherty, Michael; Lioté, Frédéric; Richette, Pascal; Saag, Kenneth G; So, Alexander K; Stamp, Lisa K; Choi, Hyon K; Terkeltaub, Robert

2017-09-01

In November 2016, the American College of Physicians (ACP) published a clinical practice guideline on the management of acute and recurrent gout. This guideline differs substantially from the latest guidelines generated by the American College of Rheumatology (ACR), European League Against Rheumatism (EULAR) and 3e (Evidence, Expertise, Exchange) Initiative, despite reviewing largely the same body of evidence. The Gout, Hyperuricemia and Crystal-Associated Disease Network (G-CAN) convened an expert panel to review the methodology and conclusions of these four sets of guidelines and examine possible reasons for discordance between them. The G-CAN position, presented here, is that the fundamental pathophysiological knowledge underlying gout care, and evidence from clinical experience and clinical trials, supports a treat-to-target approach for gout aimed at lowering serum urate levels to below the saturation threshold at which monosodium urate crystals form. This practice, which is truly evidence-based and promotes the steady reduction in tissue urate crystal deposits, is promoted by the ACR, EULAR and 3e Initiative recommendations. By contrast, the ACP does not provide a clear recommendation for urate-lowering therapy (ULT) for patients with frequent, recurrent flares or those with tophi, nor does it recommend monitoring serum urate levels of patients prescribed ULT. Results from emerging clinical trials that have gout symptoms as the primary end point are expected to resolve this debate for all clinicians in the near term future.

National Cholesterol Educational Program and International Diabetes Federation diagnostic criteria for metabolic syndrome in an Italian cohort: results from the FIBAR Study.

PubMed

Mannucci, E; Monami, M; Bardini, G; Ognibene, A; Rotella, C M

2007-12-01

The adoption of the International Diabetes Federation (IDF) criteria for metabolic syndrome (MS), in comparison with the National Cholesterol Educational Program (NCEP) criteria, produces different changes in estimates of prevalence in diverse populations. Few data are available in Caucasian non-diabetic subjects. The prevalence of NCEP- and IDF-defined MS was assessed in a sample of 2,945 individuals, aged 55.2+/-11.5 yr, enrolled in a screening program for diabetes. Association of different definitions of MS with glucose intolerance (120-min glucose 7.8 mmol/l after a 75 g-oral glucose load) and hyperuricemia (>0.38 mmol/l) was also assessed. The prevalence of MS was 16.6% and 29.7% with NCEP and IDF definitions, respectively. The prevalence of NCEP-defined MS was higher than IDF-MS through all age ranges; among those aged >60 yr, the prevalence of IDF-MS reached 52.8% (vs 33.1% for NCEP-MS). Both NCEP- and IDF-MS were associated with glucose intolerance and hyperuricemia. Individuals fulfilling IDF, but not NCEP criteria for MS, showed a prevalence of glucose intolerance (22.7%) significantly (p<0.05) lower than those fulfilling NCEP criteria only (31.6%) or both sets of criteria (31.8%). In Caucasian subjects without known diabetes, IDF criteria produce a relevant increase in estimates of prevalence of MS, particularly in older subjects, when compared with NCEP criteria. NCEP-MS seems to be more effective than IDF-MS in the identification of glucose intolerant subjects.

Coexistence of Sarcoidosis and Gouty Arthritis.

PubMed

Semiz, Hüseyin; Kobak, Senol

2017-08-21

Sarcoidosis is an inflammatory disease with unknown cause characterized by non-caseating granuloma formations. It may present with bilateral hilar lymphadenopathy, skin lesions, the involvement of eye and symptoms on the locomotor system. Gouty arthritis is an autoinflammatory disease characterized by hyperuricemia, recurrent arthritis attacks and the deposition of monosodium urate crystals in the joints and the surrounding tissues. We reported the coexistence of sarcoidosis and gouty arthritis in this paper. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Patients with gout differ from healthy subjects in renal response to changes in serum uric acid.

PubMed

Liu, Sha; Perez-Ruiz, Fernando; Miner, Jeffrey N

2017-03-01

Our objectives were to determine whether a change in serum uric acid (sUA) resulted in a corresponding change in the fractional excretion of uric acid (FEUA) and whether the renal response was different in patients with gout versus healthy subjects. FEUA was calculated from previously published studies and four new phase I studies in healthy subjects and/or patients with gout before and after treatment to lower or raise sUA. Treatments included xanthine oxidase inhibitors to lower sUA as well as infusion of uric acid and provision of a high-purine diet to raise sUA. Plots were created of FEUA versus sUA before and after treatment. For the phase I studies, percent change in FEUA per mg/dL change in sUA was calculated separately for healthy subjects and patients with gout, and compared using Student's t test. Analysis of previously published data and the new phase I clinical data indicates that changing sUA by a non-renal mechanism leads to a change in FEUA. The magnitude of change is greater in subjects with higher baseline FEUA versus patients with gout. Healthy subjects excrete more urate than do patients with gout at physiological urate-filtered load; this difference disappears when the urate-filtered load is decreased to ∼5000mg/24hours. These observations are consistent with a less saturated urate reabsorption system in patients with gout versus healthy subjects, resulting in elevated retention of uric acid. Further investigation could lead to the discovery of mechanisms responsible for the etiology of hyperuricemia/gout. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Association of lead exposure, serum uric acid and parameters of renal function in Nigerian lead-exposed workers.

PubMed

Alasia, D D; Emem-Chioma, P C; Wokoma, F S

2010-10-01

The presence of hyperuricemia and renal function impairment, especially in the absence of urate stone formation is strongly suggestive of lead nephropathy. The evaluation of this association is essential in areas where lead exposure is still prevalent and uncontrolled. To determine the relationship between serum uric acid and renal function indices in lead-exposed workers. A cross-sectional study of 190 adults with occupational lead exposure and 80 adults (comparison group), matched for age and sex was performed in Port Harcourt, South-south Nigeria. Blood lead was used as the biomarker of lead exposure while serum urea, serum creatinine, urine albumin (using urine albumin:creatinine ratio), estimated glomerular filtration rate (GFR) and serum uric acid were the renal function indices measured. Occupationally lead-exposed subjects had a significantly (p = 0.008) higher mean±SD blood lead levels (50.37±24.58 μg/dL) than the comparison group (41.40±26.85). The mean±SD serum urea (8.6±2.3 mg/dL), creatinine (1.0±0.2 mg/dL) and serum uric acid (4.6±1.2 mg/dL) were significantly (p < 0.01) higher in the study subjects than the comparison group (7.6±2.4, 0.9±0.2, and 3.9±1.1 mg/dL, respectively). The mean±SD creatinine clearance was significantly (p = 0.002) lower in the study subjects than the comparison group (98.9±21.3 vs. 108.2±25.2 mL/min/1.72 m2). Serum uric acid level correlated positively with serum creatinine (r = 0.134) and negatively with GFR (r = -0.151). People with occupational lead exposure are at risk of developing hyperuricemia and renal impairment.

A comparative study of efficacy and safety of febuxostat and allopurinol in pyrazinamide-induced hyperuricemic tubercular patients.

PubMed

Pichholiya, Meenu; Yadav, Arvind Kumar; Luhadia, S K; Tahashildar, Jameela; Aseri, M L

2016-01-01

To compare the efficacy and safety of febuxostat and allopurinol in pyrazinamide (PZA)-induced hyperuricemia in patients taking antitubercular therapy (ATT). This randomized controlled study was conducted at a tertiary care teaching institute of Rajasthan in all the sputum-positive tubercular patients aged between 18 and 65 years of either sex. Serum uric acid level was monitored at 0 th , 2 nd , 4 th , 6 th , and 8 th week of ATT. Patients whose uric acid level was found to be increased at 2 nd week were finally recruited in the study. Ninety patients who developed hyperuricemia due to ATT were divided randomly into three groups (Group A - febuxostat, Group B - allopurinol, and Group C - control) of thirty patients each. Mean serum uric acid levels were calculated at all the weeks in all the groups, and serum uric acid levels were compared by applying student's t -test and ANOVA. Mean serum uric acid level decreased from 10.698 mg/dl (at 2 nd week) to 7.846 mg/dl (at 8 th week) in Group A and from 11.34 mg/dl (at 2 nd week) to 7.280 mg/dl (at 8 th week) in Group B. Numbers of adverse events encountered across both the treatment groups were same with both the drugs. Allopurinol and febuxostat were equally efficacious in lowering PZA induced raised serum uric acid level in tubercular patients, and it was possible to continue ATT without withdrawing PZA.

Critical Roles of Two Hydrophobic Residues within Human Glucose Transporter 9 (hSLC2A9) in Substrate Selectivity and Urate Transport*

PubMed Central

Long, Wentong; Panwar, Pankaj; Witkowska, Kate; Wong, Kenneth; O'Neill, Debbie; Chen, Xing-Zhen; Lemieux, M. Joanne; Cheeseman, Chris I.

2015-01-01

High blood urate levels (hyperuricemia) have been found to be a significant risk factor for cardiovascular diseases and inflammatory arthritis, such as hypertension and gout. Human glucose transporter 9 (hSLC2A9) is an essential protein that mainly regulates urate/hexose homeostasis in human kidney and liver. hSLC2A9 is a high affinity-low capacity hexose transporter and a high capacity urate transporter. Our previous studies identified a single hydrophobic residue in trans-membrane domain 7 of class II glucose transporters as a determinant of fructose transport. A mutation of isoleucine 335 to valine (I355V) in hSLC2A9 can reduce fructose transport while not affecting glucose fluxes. This current study demonstrates that the I335V mutant transports urate similarly to the wild type hSLC2A9; however, Ile-335 is necessary for urate/fructose trans-acceleration exchange to occur. Furthermore, Trp-110 is a critical site for urate transport. Two structural models of the class II glucose transporters, hSLC2A9 and hSLC2A5, based on the crystal structure of hSLC2A1 (GLUT1), reveal that Ile-335 (or the homologous Ile-296 in hSLC2A5) is a key component for protein conformational changes when the protein translocates substrates. The hSLC2A9 model also predicted that Trp-110 is a crucial site that could directly interact with urate during transport. Together, these studies confirm that hSLC2A9 transports both urate and fructose, but it interacts with them in different ways. Therefore, this study advances our understanding of how hSLC2A9 mediates urate and fructose transport, providing further information for developing pharmacological agents to treat hyperuricemia and related diseases, such as gout, hypertension, and diabetes. PMID:25922070

Hyperuricemia Causes Pancreatic β-Cell Death and Dysfunction through NF-κB Signaling Pathway

PubMed Central

Jia, Lu; Xing, Jing; Ding, Ying; Shen, Yachen; Shi, Xuhui; Ren, Wei; Wan, Meng; Guo, Jianjin; Zheng, Shujing; Liu, Yun; Liang, Xiubin; Su, Dongming

2013-01-01

Accumulating clinical evidence suggests that hyperuricemia is associated with an increased risk of type 2 diabetes. However, it is still unclear whether elevated levels of uric acid can cause direct injury of pancreatic β-cells. In this study, we examined the effects of uric acid on β-cell viability and function. Uric acid solution or normal saline was administered intraperitoneally to mice daily for 4 weeks. Uric acid-treated mice exhibited significantly impaired glucose tolerance and lower insulin levels in response to glucose challenge than did control mice. However, there were no significant differences in insulin sensitivity between the two groups. In comparison to the islets in control mice, the islets in the uric acid–treated mice were markedly smaller in size and contained less insulin. Treatment of β-cells in vitro with uric acid activated the NF-κB signaling pathway through IκBα phosphorylation, resulting in upregulated inducible nitric oxide synthase (iNOS) expression and excessive nitric oxide (NO) production. Uric acid treatment also increased apoptosis and downregulated Bcl-2 expression in Min6 cells. In addition, a reduction in insulin secretion under glucose challenge was observed in the uric acid–treated mouse islets. These deleterious effects of uric acid on pancreatic β-cells were attenuated by benzbromarone, an inhibitor of uric acid transporters, NOS inhibitor L-NMMA, and Bay 11–7082, an NF-κB inhibitor. Further investigation indicated that uric acid suppressed levels of MafA protein through enhancing its degradation. Collectively, our data suggested that an elevated level of uric acid causes β-cell injury via the NF-κB-iNOS-NO signaling axis. PMID:24205181

Evaluation of a Pharmacokinetic-Pharmacodynamic Model for Hypouricemic Effects of Febuxostat Using Datasets Obtained from Real-world Patients.

PubMed

Hirai, Toshinori; Itoh, Toshimasa; Kimura, Toshimi; Echizen, Hirotoshi

2018-06-06

Febuxostat is an active xanthine oxidase (XO) inhibitor that is widely used in the hyperuricemia treatment. We aimed to evaluate the predictive performance of a pharmacokinetic-pharmacodynamic (PK-PD) model for hypouricemic effects of febuxostat. Previously, we have formulated a PK--PD model for predicting hypouricemic effects of febuxostat as a function of baseline serum urate levels, body weight, renal function, and drug dose using datasets reported in preapproval studies (Hirai T et al., Biol Pharm Bull 2016; 39: 1013-21). Using an updated model with sensitivity analysis, we examined the predictive performance of the PK-PD model using datasets obtained from the medical records of patients who received febuxostat from March 2011 to December 2015 at Tokyo Women's Medical University Hospital. Multivariate regression analysis was performed to explore clinical variables to improve the predictive performance of the model. A total of 1,199 serum urate data were retrieved from 168 patients (age: 60.5 ±17.7 years, 71.4% males) who received febuxostat as hyperuricemia treatment. There was a significant correlation (r=0.68, p<0.01) between serum urate levels observed and those predicted by the modified PK-PD model. A multivariate regression analysis revealed that the predictive performance of the model may be improved further by considering comorbidities, such as diabetes mellitus, estimated glomerular filtration rate (eGFR), and co-administration of loop diuretics (r = 0.77, p<0.01). The PK-PD model may be useful for predicting individualized maintenance doses of febuxostat in real-world patients. This article is protected by copyright. All rights reserved.

Renoprotective effects of febuxostat in hyperuricemic patients with chronic kidney disease: a parallel-group, randomized, controlled trial.

PubMed

Tanaka, Kenichi; Nakayama, Masaaki; Kanno, Makoto; Kimura, Hiroshi; Watanabe, Kimio; Tani, Yoshihiro; Hayashi, Yoshimitsu; Asahi, Koichi; Terawaki, Hiroyuki; Watanabe, Tsuyoshi

2015-12-01

Hyperuricemia is associated with the onset of chronic kidney disease (CKD) and renal disease progression. Febuxostat, a novel, non-purine, selective xanthine oxidase inhibitor, has been reported to have a stronger effect on hyperuricemia than conventional therapy with allopurinol. However, few data are available regarding the clinical effect of febuxostat in patients with CKD. A prospective, randomized, open-label, parallel-group trial was conducted in hyperuricemic patients with stage 3 CKD. Patients were randomly assigned to treatment with febuxostat (n = 21) or to continue conventional therapy (n = 19). Treatment was continued for 12 weeks. The efficacy of febuxostat was determined by monitoring serum uric acid (UA) levels, blood pressures, renal function, and urinary protein levels. In addition, urinary liver-type fatty acid-binding protein (L-FABP), urinary albumin, urinary beta 2 microglobulin (β2MG), and serum high sensitivity C-reactive protein were measured before and 12 weeks after febuxostat was added to the treatment. Febuxostat resulted in a significantly greater reduction in serum UA (-2.2 mg/dL) than conventional therapy (-0.3 mg/dL, P < 0.001). Serum creatinine and estimated glomerular filtration rate changed little during the study period in each group. However, treatment with febuxostat for 12 weeks reduced the urinary levels of L-FABP, albumin, and β2MG, whereas the levels of these markers did not change in the control group. Febuxostat reduced serum UA levels more effectively than conventional therapy and might have a renoprotective effect in hyperuricemic patients with CKD. Further studies should clarify whether febuxostat prevents the progression of renal disease and improves the prognosis of CKD.

What is the incidence of kidney stones after chemotherapy in patients with lymphoproliferative or myeloproliferative disorders?

PubMed

Mirheydar, Hossein S; Banapour, Pooya; Massoudi, Rustin; Palazzi, Kerrin L; Jabaji, Ramzi; Reid, Erin G; Millard, Frederick E; Kane, Christopher J; Sur, Roger L

2014-01-01

This study describes the incidence and risk factors of de novo nephrolithiasis among patients with lymphoproliferative or myeloproliferative diseases who have undergone chemotherapy. From 2001 to 2011, patients with lymphoproliferative or myeloproliferative disorders treated with chemotherapy were retrospectively identified. The incidence of image proven nephrolithiasis after chemotherapy was determined. Demographic and clinical variables were recorded. Patients with a history of nephrolithiasis prior to chemotherapy were excluded. The primary outcome was incidence of nephrolithiasis, and secondary outcomes were risk factors predictive of de novo stone. Comparative statistics were used to compare demographic and disease specific variables for patients who developed de novo stones versus those who did not. A total of 1,316 patients were identified and the incidence of de novo nephrolithiasis was 5.5% (72/1316; symptomatic stones 1.8% 24/1316). Among patients with nephrolithiasis, 72.2% had lymphoproliferative disorders, 27.8% had myeloproliferative disorders, and 25% utilized allopurinol. The median urinary pH was 5.5, and the mean serum uric acid, calcium, potassium and phosphorus levels were 7.5, 9.6, 4.3, and 3.8 mg/dL, respectively. In univariate analysis, mean uric acid (p=0.013), calcium (p<0.001)), and potassium (p=0.039) levels were higher in stone formers. Diabetes mellitus (p<0.001), hypertension (p=0.003), and hyperlipidemia (p<0.001) were more common in stone formers. In multivariate analysis, diabetes mellitus, hyperuricemia, and hypercalcemia predicted stone. We report the incidence of de novo nephrolithiasis in patients who have undergone chemotherapy. Diabetes mellitus, hyperuricemia, and hypercalcemia are patient-specific risk factors that increase the odds of developing an upper tract stone following chemotherapy.

Prevalence of monosodium urate deposits in a population of rheumatoid arthritis patients with hyperuricemia.

PubMed

Petsch, Christina; Araujo, Elizabeth G; Englbrecht, Matthias; Bayat, Sara; Cavallaro, Alexander; Hueber, Axel J; Lell, Michael; Schett, Georg; Manger, Bernhard; Rech, Juergen

2016-06-01

To investigate the prevalence of monosodium urate (MSU) crystal deposits, indicative for gout, in a population of rheumatoid arthritis (RA) patients with concomitant hyperuricemia and to analyze the clinical and disease-specific characteristics of RA patients who exhibit MSU crystal deposits. Overall, 100 consecutive patients with the diagnosis of RA and a serum urate level above 6mg/dl underwent dual energy computed tomography (DECT) of both feet and hands to search for MSU crystals in a prospective study between October 2011 and July 2013. Presence and extent of MSU crystal deposits on DECT was assessed by automated volume measurement. Demographic and disease-specific characteristics were recorded and included into two logistic regression models to test for the factors associated with MSU crystal deposits in RA. Hyperuricemic RA patients were mostly male (55%), over 60 years of age (63 ± 11 years), had established disease (8.7 ± 10.5 years) and a mean disease activity score 28 (DAS 28) of 3.2. In total, 20 out of 100 patients displayed MSU crystal deposits in DECT. Interestingly, the majority (70%) of the RA patients positive for MSU crystal deposits were seronegative RA patients. Hence, every third seronegative RA patient had MSU crystal deposits. According to logistic regression model analysis, seronegative status correlated positively with presence of urate deposits (p = 0.019). These data show that a considerable number of RA patients display periarticular MSU crystal deposits. Seronegative patients were shown to be predominantly affected with every third patient being positive for urate deposits. Copyright © 2016 Elsevier Inc. All rights reserved.

Gout and Metabolic Syndrome: a Tangled Web.

PubMed

Thottam, Gabrielle E; Krasnokutsky, Svetlana; Pillinger, Michael H

2017-08-26

The complexity of gout continues to unravel with each new investigation. Gout sits at the intersection of multiple intrinsically complex processes, and its prevalence, impact on healthcare costs, and association with important co-morbidities make it increasingly relevant. The association between gout and type 2 diabetes, hypertension, hyperlipidemia, cardiovascular disease, renal disease, and obesity suggest that either gout, or its necessary precursor hyperuricemia, may play an important role in the manifestations of the metabolic syndrome. In this review, we analyze the complex interconnections between gout and metabolic syndrome, by reviewing gout's physiologic and epidemiologic relationships with its major co-morbidities. Increasing evidence supports gout's association with metabolic syndrome. More specifically, both human studies and animal models suggest that hyperuricemia may play a role in promoting inflammation, hypertension and cardiovascular disease, adipogenesis and lipogenesis, insulin and glucose dysregulation, and liver disease. Fructose ingestion is associated with increased rates of hypertension, weight gain, impaired glucose tolerance, and dyslipidemia and is a key driver of urate biosynthesis. AMP kinase (AMPK) is a central regulator of processes that tend to mitigate against the metabolic syndrome. Within hepatocytes, leukocytes, and other cells, a fructose/urate metabolic loop drives key inhibitors of AMPK, including AMP deaminase and fructokinase, that may tilt the balance toward metabolic syndrome progression. Preliminary evidence suggests that agents that block the intracellular synthesis of urate may restore AMPK activity and help maintain metabolic homeostasis. Gout is both an inflammatory and a metabolic disease. With further investigation of urate's role, the possibility of proper gout management additionally mitigating metabolic syndrome is an evolving and important question.

Relationship between renal function and renal volume in autosomal dominant polycystic kidney disease: cross-sectional study.

PubMed

Torres-Sánchez, M J; Ávila-Barranco, E; Esteban de la Rosa, R J; Fernández-Castillo, R; Esteban, M A; Carrero, J J; García-Valverde, M; Bravo-Soto, J A

2016-03-01

To determine in patients with autosomal dominant polycystic kidney disease the relationship between total renal volume (the sum of both kidneys, TRV) as measured by magnetic resonance and renal function; and its behaviour according to sex and the presence of arterial hypertension, hypercholesterolaemia and hyperglycemia. Cross-sectional study including patients with autosomal dominant polycystic kidney disease who underwent periodic reviews at Nephrology external consultations at Hospital de las Nieves de Granada, and who underwent an magnetic resonance to estimate renal volume between January 2008 and March 2011. We evaluated 67 patients (59.7% women, average age of 48±14.4 years) and found a significant positive association between TRV and serum creatinine or urea, which was reversed compared with estimated glomerular filtration by MDRD-4 and Cockcroft-Gault. Women showed an average serum creatinine level and a significantly lower TRV level compared with males. Subgroups affected by arterial hypertension and hyperuricemia presented average values for serum creatinine and urea, higher for TRV and lower for estimated glomerular filtration. The hypercholesterolaemia subgroup showed higher average values for urea and lower for estimated glomerular filtration, without detecting significant differences compared with TRV. The volume of polycystic kidneys measured by magnetic resonance is associated with renal function, and can be useful as a complementary study to monitor disease progression. The presence of arterial hypertension, hyperuricemia or hypercholesterolaemia is associated with a poorer renal function. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Medicina Interna (SEMI). All rights reserved.

Serum uric acid levels and mortality in the Japanese population: the Yamagata (Takahata) study.

PubMed

Kamei, Keita; Konta, Tsuneo; Ichikawa, Kazunobu; Sato, Hiroko; Suzuki, Natsuko; Kabasawa, Asami; Suzuki, Kazuko; Hirayama, Atsushi; Shibata, Yoko; Watanabe, Tetsu; Kato, Takeo; Ueno, Yoshiyuki; Kayama, Takamasa; Kubota, Isao

2016-12-01

Serum uric acid level is regulated by gender, dietary habit, genetic predisposition, and renal function, and is associated with the development of renal and cardiovascular diseases. This study prospectively investigated the association between serum uric acid levels and mortality in a community-based population. Three thousand four hundred and eighty-seven subjects regardless of the antihyperuricemic medication (45 % male; mean age 62 years old) from the Takahata town in Japan participated in this study and were followed up for 8 years (median 7.5 years). We examined the association between serum uric acid levels at baseline and the all-cause and cardiovascular mortality, respectively, in this population. One hundred seventy-nine subjects died during the follow-up period, with 49 deaths attributed to cardiovascular causes. Kaplan-Meier analysis revealed that the all-cause mortality was significantly higher along with the increase in serum uric acid levels at baseline among female (Log-rank P < 0.01), but not male subjects (P = 0.97). Cox-proportional hazard model analysis with adjustment for possible confounders including age, renal function, and comorbidities revealed that hyperuricemia (uric acid ≥7.0 mg/dL) was an independent risk factor for all-cause and cardiovascular mortality, respectively, in female [hazard ratio (HR) 5.92, 95 % confidence interval (CI) 2.10-14.6 for all-cause mortality, and HR 10.7, 95 % CI 1.76-50.2 for cardiovascular mortality], but not male subjects. Hyperuricemia was an independent risk for all-cause and cardiovascular mortality in female, but not among the male subjects in a community-based population.

Prevalence of metabolic syndrome and associated factors in women aged 35 to 65 years who were enrolled in a family health program in Brazil.

PubMed

Schmitt, Ana Carolina Basso; Cardoso, Maria Regina Alves; Lopes, Heno; Pereira, Wendry Maria Paixão; Pereira, Elaine Cristina; de Rezende, Debora Aparecida Paccola; Guarizi, Rubia Guibo; Dellu, Mayra Cecilia; Oliveira, Jéssica de Moura; Flauzino, Erika; Blümel, Juan E; Aldrighi, José Mendes

2013-04-01

The aims of this study were to estimate the prevalence of metabolic syndrome among women aged 35 to 65 years and to identify associated factors. This was a cross-sectional study. We randomly selected 581 women (aged 35-65 y) from among those enrolled in a family health program in the city of Pindamonhangaba, Brazil. Metabolic syndrome was identified in accordance with the definition of the National Cholesterol Education Program Adult Treatment Panel III. Health conditions and lifestyle habits were evaluated by a survey, and anthropometric measurements were obtained. The prevalence of metabolic syndrome was estimated, and Poisson regression was used to evaluate the associations between metabolic syndrome `and the factors investigated. The prevalence of metabolic syndrome was 42.2% (95% CI, 38.1-46.2). The most common metabolic syndrome component was abdominal obesity (60.6%), followed by low levels of high-density lipoprotein cholesterol (51.3%), high levels of triglycerides (41.4%), high blood pressure (31.7%), and diabetes (13.9%). The following factors were associated with metabolic syndrome: the 45- to 54-year age group (prevalence ratio, 1.54; 95% CI, 1.08-2.01), the 55- to 65-year age group (prevalence ratio, 3.51; 95% CI, 1.49-3.10), hyperuricemia (prevalence ratio, 2.95; 95% CI, 1.15-1.86), and sleep apnea risk (prevalence ratio, 2.41; 95% CI, 1.16-1.82). We found an inverse association between metabolic syndrome and having had more than 5 years of schooling (prevalence ratio, 0.65; 95% CI, 0.65-1.04). The prevalence of metabolic syndrome is high, and the associated clinical factors are hyperuricemia and risk of sleep apnea.

Melatonin protects against uric acid-induced mitochondrial dysfunction, oxidative stress, and triglyceride accumulation in C2C12 myotubes.

PubMed

Maarman, Gerald J; Andrew, Brittany M; Blackhurst, Dee M; Ojuka, Edward O

2017-04-01

Excess uric acid has been shown to induce oxidative stress, triglyceride accumulation, and mitochondrial dysfunction in the liver and is an independent predictor of type-2 diabetes. Skeletal muscle plays a dominant role in type 2 diabetes and presents a large surface area to plasma uric acid. However, the effects of uric acid on skeletal muscle are underinvestigated. Our aim was therefore to characterize the effects of excessive uric acid on oxidative stress, triglyceride content, and mitochondrial function in skeletal muscle C 2 C 12 myotubes and assess how these are modulated by the antioxidant molecule melatonin. Differentiated C 2 C 12 myotubes were exposed to 750 µM uric acid or uric acid + 10 nM melatonin for 72 h. Compared with control, uric acid increased triglyceride content by ~237%, oxidative stress by 32%, and antioxidant capacity by 135%. Uric acid also reduced endogenous ROUTINE respiration, complex II-linked oxidative phosphorylation, and electron transfer system capacities. Melatonin counteracted the effects of uric acid without further altering antioxidant capacity. Our data demonstrate that excess uric acid has adverse effects on skeletal muscle similar to those previously reported in hepatocytes and suggest that melatonin at a low physiological concentration of 10 nM may be a possible therapy against some adverse effects of excess uric acid. NEW & NOTEWORTHY Few studies have investigated the effects of uric acid on skeletal muscle. This study shows that hyperuricemia induces mitochondrial dysfunction and triglyceride accumulation in skeletal muscle. The findings may explain why hyperuricemia is an independent predictor of diabetes. Copyright © 2017 the American Physiological Society.

Impact of uric acid levels on the risk of long-term cardiovascular mortality in patients with type 2 diabetes mellitus.

PubMed

Ilundain-González, Ana Isabel; Gimeno-Orna, José Antonio; Sáenz-Abad, Daniel; Pons-Dolset, Jordi; Cebollada-Del Hoyo, Jesús; Lahoza-Pérez, María Del Carmen

Hyperuricemia is associated to cardiovascular disease. However, the contribution of uric acid (UA) to cardiovascular mortality in diabetic patients is controversial. To assess the impact of UA levels on the risk of cardiovascular mortality risk in a cohort of patients with type 2 diabetes mellitus (T2DM). A prospective cohort study on outpatients with T2DM. The clinical endpoint was cardiovascular death. Anthropometric, demographic, clinical, and biochemical variables were collected, including UA levels, urinary albumin excretion and estimated glomerular filtration rate. The independent contribution of UA levels to cardiovascular mortality was assessed using multivariate Cox regression models, progressively adjusted for potential confounders. A total of 452 patients with a mean age of 65.9 (SD 9.5) years were enrolled. Mean UA level was 4.2mg/dL. Quartiles of UA levels were Q1 < 3.3; Q2: 3.3-4.2; Q3: 4.3-5.1; Q4 > 5.1mg/dL. UA levels significantly correlated with estimated glomerular filtration rate (Rho=-0.227; p<0.001). During a median follow-up time of 13 years, cardiovascular mortality rates were higher in Q4 of the UA distribution (Q1: 10.7; Q2: 11.7; Q3: 10.7; Q4: 21.6 per 1000 patient-years; p = 0.027). UA was a predictor of cardiovascular mortality in the univariate analysis (HR1mg/dL = 1.30; p=0.002), but not in a multivariate analysis adjusted for urinary albumin excretion and eGFR (HR1mg/dL=1.20; p=0.12). High UA levels are associated to cardiovascular mortality in patients with T2DM. However, the role of UA may be mediated by impaired kidney function in patients with hyperuricemia. Copyright © 2018 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

[Association between urinary polycyclic aromatic hydrocarbon metabolites and elevated serum uric acid levels in coke oven workers].

PubMed

Deng, Siyun; Deng, Qifei; Hu, Die; Li, Jun; Zhu, Xiaoyan; Guo, Huan; Wu, Tangchun

2014-06-01

To analyze the relationship between metabolites of polycyclic aromatic hydrocarbons (PAHs) and serum uric acid levels in coke oven workers and to provide new clues to the pathogenic mechanism of PAHs. A total of 1302 coke oven workers were divided into four groups, namely control group and low-, intermediate-, and high-dose exposure groups. The concentrations of ambient PAHs at each workplace were determined by high-performance liquid chromatography. The detailed information on the occupational history and health of workers was collected by questionnaire survey and physical examination, and so were their blood and urine samples. Serum uric acid and creatinine levels were measured using a Hitachi 7020 automatic biochemical analyzer. Ten urinary PAH metabolites were detected by gas chromatography-mass spectrometry. Serum uric acid levels were the highest in the high-dose exposure group, followed by the intermediate- and low-dose exposure groups, and were the lowest in the control group. There were significant correlations between serum uric acid levels and the quartiles of 1-hydroxynaphthalene and 1-hydroxyphenanthrene (P < 0.05). After adjustment for PAH metabolite-related relationship, only urinary 1-hydroxyphenanthrene was significantly correlated with serum uric acid levels (P = 0.001). After adjustment for confounding factors and using the 1st quartile of 1-hydroxyphenanthrene as a reference, the odds ratio for hyperuricemia in subjects with the 2nd, 3rd, and 4th quartiles of 1-hydroxyphenanthrene were 1.55, 1.57, and 2.35, respectively. Urinary 1-hydroxyphenanthrene is associated with a dose-response increase in serum uric acid levels in coke oven workers, and exposure to phenanthrene in PAHs may be a risk factor for hyperuricemia.

[Cross-sectional study on high-normal blood pressure and chronic kidney disease in occupational physical examination population in Changsha].

PubMed

Cao, Xia; Xie, Xiumei; Xu, Guo; Yuan, Hong; Chen, Zhiheng

2014-06-01

To investigate the relationship between high-normal blood pressure and chronic kidney disease (CKD) in occupational physical examination population in Changsha. With a convenient sampling method, a cross-sectional survey of representative sample of 11 274 white collar workers was conducted in Changsha between March 2011 and May 2011 in a large comprehensive hospital. All subjects were assigned into 4 groups: a normal blood pressure group, a high-normal blood pressure group, an undiagnosed hypertension group, and a diagnosed hypertension group. Anthropometry, blood pressure, blood sample and urine sample were measured with standard instruments and methodology for all the subjects. Multiple logistic regression analysis was used to identify risk factors for CKD. The prevalence of CKD in the normal blood pressure, high-normal blood pressure, undiagnosed hypertension, and diagnosed hypertension were 3.31%, 6.60%, 11.78%, and 17.35%, respectively. The prevalence of CKD in males was significantly higher than that in females (P<0.01). For males with high-normal blood pressure, the CKD risk was significantly greater (OR, 1.30; 95% CI:1.03 - 1.63) than those with optimal blood pressure. The logistic regression analysis showed that there was an additive effect of hyperuricemia on CKD risk in men with high-normal blood pressure compared with men with optimal blood pressure (OR, 2.25; 95% CI, 1.59 - 3.19; P<0.05). The prevalence of CKD in people with the high-normal blood pressure is 6.60% in occupational physical examination population in Changsha. CKD is a high risk for men with highnormal blood pressure and hyperuricemia is an independent risk factor.

Dietary Sodium Modifies Serum Uric Acid Concentrations in Humans.

PubMed

Todd, Alwyn S; Walker, Robert J; MacGinley, Robert J; Kelly, Jaimon; Merriman, Tony R; Major, Tanya J; Johnson, Richard J

2017-11-06

Subjects with hypertension are frequently obese or insulin resistant, both conditions in which hyperuricemia is common. Obese and insulin-resistant subjects are also known to have blood pressure that is more sensitive to changes in dietary sodium intake. Whether hyperuricemia is a resulting consequence, moderating or contributing factor to the development of hypertension has not been fully evaluated and very few studies have reported interactions between sodium intake and serum uric acid. We performed further analysis of our randomized controlled clinical trials (Australian New Zealand Clinical Trials Registry #12609000161224 and #12609000292279) designed to assess the effects of modifying sodium intake on concentrations of serum markers, including uric acid. Uric acid and other variables (including blood pressure, renin, and aldosterone) were measured at baseline and 4 weeks following the commencement of low (60 mmol/day), moderate (150 mmol/day), and high (200-250 mmol/day) dietary sodium intake. The median aldosterone-to-renin ratio was 1.90 [pg/ml]/[pg/ml] (range 0.10-11.04). Serum uric acid fell significantly in both the moderate and high interventions compared to the low sodium intervention. This pattern of response occurred when all subjects were analyzed, and when normotensive or hypertensive subjects were analyzed alone. Although previously reported in hypertensive subjects, these data provide evidence in normotensive subjects of an interaction between dietary sodium intake and serum uric acid. As this interaction is present in the absence of hypertension, it is possible it could play a role in hypertension development, and will need to be considered in future trials of dietary sodium intake. The trials were registered with the Australian and New Zealand Clinical Trials Registry as ACTRN12609000161224 and ACTRN1260. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

ALDH16A1 is a novel non-catalytic enzyme that may be involved in the etiology of gout via protein-protein interactions with HPRT1.

PubMed

Vasiliou, Vasilis; Sandoval, Monica; Backos, Donald S; Jackson, Brian C; Chen, Ying; Reigan, Philip; Lanaspa, Miguel A; Johnson, Richard J; Koppaka, Vindhya; Thompson, David C

2013-02-25

Gout, a common form of inflammatory arthritis, is strongly associated with elevated uric acid concentrations in the blood (hyperuricemia). A recent study in Icelanders identified a rare missense single nucleotide polymorphism (SNP) in the ALDH16A1 gene, ALDH16A1*2, to be associated with gout and serum uric acid levels. ALDH16A1 is a novel and rather unique member of the ALDH superfamily in relation to its gene and protein structures. ALDH16 genes are present in fish, amphibians, protista, bacteria but absent from archaea, fungi and plants. In most mammalian species, two ALDH16A1 spliced variants (ALDH16A1, long form and ALDH16A1_v2, short form) have been identified and both are expressed in HepG-2, HK-2 and HK-293 human cell lines. The ALDH16 proteins contain two ALDH domains (as opposed to one in the other members of the superfamily), four transmembrane and one coiled-coil domains. The active site of ALDH16 proteins from bacterial, frog and lower animals contain the catalytically important cysteine residue (Cys-302); this residue is absent from the mammalian and fish orthologs. Molecular modeling predicts that both the short and long forms of human ALDH16A1 protein would lack catalytic activity but may interact with the hypoxanthine-guanine phosphoribosyltransferase (HPRT1) protein, a key enzyme involved in uric acid metabolism and gout. Interestingly, such protein-protein interactions with HPRT1 are predicted to be impaired for the long or short forms of ALDH16A1*2. These results lead to the intriguing possibility that association between ALDH16A1 and HPRT1 may be required for optimal HPRT activity with disruption of this interaction possibly contributing to the hyperuricemia seen in ALDH16A1*2 carriers. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

ALDH16A1 is a novel non-catalytic enzyme that may be involved in the etiology of gout via protein–protein interactions with HPRT1

PubMed Central

Vasiliou, Vasilis; Sandoval, Monica; Backos, Donald S.; Jackson, Brian C.; Chen, Ying; Reigan, Philip; Lanaspa, Miguel A.; Johnson, Richard J.; Koppaka, Vindhya; Thompson, David C.

2013-01-01

Gout, a common form of inflammatory arthritis, is strongly associated with elevated uric acid concentrations in the blood (hyperuricemia). A recent study in Icelanders identified a rare missense single nucleotide polymorphism (SNP) in the ALDH16A1 gene, ALDH16A1*2, to be associated with gout and serum uric acid levels. ALDH16A1 is a novel and rather unique member of the ALDH superfamily in relation to its gene and protein structures. ALDH16 genes are present in fish, amphibians, protista, bacteria but absent from archaea, fungi and plants. In most mammalian species, two ALDH16A1 spliced variants (ALDH16A1, long form and ALDH16A1_v2, short form) have been identified and both are expressed in HepG-2, HK-2 and HK-293 human cell lines. The ALDH16 proteins contain two ALDH domains (as opposed to one in the other members of the superfamily), four transmembrane and one coiled-coil domains. The active site of ALDH16 proteins from bacterial, frog and lower animals contain the catalytically important cysteine residue (Cys-302); this residue is absent from the mammalian and fish orthologs. Molecular modeling predicts that both the short and long forms of human ALDH16A1 protein would lack catalytic activity but may interact with the hypoxanthine-guanine phosphoribosyltransferase (HPRT1) protein, a key enzyme involved in uric acid metabolism and gout. Interestingly, such protein-protein interactions with HPRT1 are predicted to be impaired for the long or short forms of ALDH16A1*2. These results lead to the intriguing possibility that association between ALDH16A1 and HPRT1 may be required for optimal HPRT activity with disruption of this interaction possibly contributing to the hyperuricemia seen in ALDH16A1*2 carriers. PMID:23348497

Uric acid upregulates the adiponectin-adiponectin receptor 1 pathway in renal proximal tubule epithelial cells

PubMed Central

Yang, Qingmei; Fu, Chensheng; Xiao, Jing; Ye, Zhibin

2018-01-01

Adiponectin (APN) is a protein hormone that is primarily derived from adipocytes. It can also be secreted by renal cells. Hypoadiponectinemia has been documented in patients with hyperuricemia, however, whether soluble uric acid (SUA) regulates the expression of APN and APN receptor 1 (AdipoR1) in renal proximal tubule epithelial cells (PTECs) remains to be elucidated. The present study investigated the expression of APN and AdipoR1 in cultured PTECs that were exposed to SUA through immunofluorescence and western blot analysis. In addition, Sprague-Dawley rats with oxonic acid-induced hyperuricemia (HUA) with or without febuxostat treatment were employed as an animal model to measure 24 h urine protein, serum creatinine, urea nitrogen, uric acid and homeostasis model assessment of insulin resistance. Renal pathology was evaluated using hematoxylin and eosin and immunohistochemical staining. APN and AdipoR1 expression in the renal cortex were evaluated by western blotting. The results demonstrated that, in PTECs, the expression of APN and AdipoR1 was constant and increased upon SUA exposure. Similar observations were made within the proximal renal tubules of rats, and the oxonic acid-induced increases in APN and AdipoR1 were offset by febuxostat treatment. Furthermore, SUA-treated PTECs exhibited an increase in the expression of NLR family pyrin domain-containing (NLRP) 3, which was dose-dependent. NLRP3 expression was also significantly increased in the renal cortex of HUA rats compared with control and febuxostat-treated rats. In conclusion, SUA enhanced the expression of APN and AdipoR1 in PTECs, which was associated with an increase in NLRP3 expression. The APN-AdipoR1 pathway was demonstrated to have an important role in in vitro and in vivo models of renal proximal tubule inflammatory injury. Therefore, this pathway may be a potential therapy target in urate nephropathy. PMID:29359786

Association between the abdominal obesity anthropometric indicators and metabolic disorders in a Chinese population.

PubMed

Dong, J; Ni, Y-Q; Chu, X; Liu, Y-Q; Liu, G-X; Zhao, J; Yang, Y-B; Yan, Y-X

2016-02-01

Obesity has become a major health problem in contemporary society and it is closely related to many chronic diseases, so it is an important issue for measuring adiposity accurately and predicting its future. Prevention and treatment of overweight and obesity has become one of the key prevention and treatment of metabolic disorders. In this study, we compared the ability of the four anthropometric indicators (body mass index, waist circumstance, waist-height ratio, waist-to-hip ratio) to identify metabolic disorders (hypertension, hyperlipidaemia, hyperglycemia and hyperuricemia) by receiver operating characteristic (ROC) curve analyses and to provide evidence for clinical practice. In this large scale cross-sectional study, 13,275 Han adults (including 7595 males and 5680 females) received physical examination between January, 2009 and January, 2010 in Xuanwu Hospital of Capital Medical University were investigated by the means of questionnaire, Meanwhile, the physical examination and serological results were recorded. A package known as Statistical Package for Social Scientist (SPSS) was employed to analyse the responses while t-test, one-way analysis of variance (ANOVA), ROC analysis and chi-square statistical methods were used to test the hypotheses. WC, WHtR, WHR and BMI were all significantly (P < 0.001) correlated with all metabolic risk factors regardless of gender. And the area under the curve (AUC) of WHtR was significantly greater than that of WC, BMI or WHR in the prediction of hypertension, hyperlipidaemia, hyperglycemia and hyperuricemia. Our data show that WHtR was the best predictor of various metabolic disorders. The diagnostic value in descending order was WHtR > WHR > WC > BMI. Therefore we recommend WHtR in assessment of obese patients, in order to better assess the risks of their metabolic diseases. Copyright © 2015 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Elevated Serum Triglyceride and Retinol-Binding Protein 4 Levels Associated with Fructose-Sweetened Beverages in Adolescents

PubMed Central

Chan, Te-Fu; Lin, Wei-Ting; Chen, Yi-Ling; Huang, Hsiao-Ling; Yang, Wei-Zeng; Lee, Chun-Ying; Chen, Meng-Hsueh; Wang, Tsu-Nai; Huang, Meng-Chuan; Chiu, Yu-Wen; Huang, Chun-Chi; Tsai, Sharon; Lin, Chih-Lung; Lee, Chien-Hung

2014-01-01

Background The metabolic effect of fructose in sugar-sweetened beverages (SSB) has been linked to de novo lipogenesis and uric acid (UA) production. Objectives This study investigated the biological effects of SSB consumption on serum lipid profiles and retinol-binding protein 4 (RBP4) among Taiwanese adolescents. Methods We evaluated the anthropometric parameters and biochemical outcomes of 200 representative adolescents (98 boys and 102 girls) who were randomly selected from a large-scale cross-sectional study. Data were analyzed using multiple regression models adjusted for covariates. Results Increased SSB consumption was associated with increased waist and hip circumferences, body mass index (BMI) values and serum UA, triglyceride (TG) and RBP4 levels. Adolescents who consumed >500 ml/day of beverages half-to-heavily sweetened with high-fructose corn syrup (HFCS) exhibited TG and RBP4 levels 22.7 mg/dl and 13.92 ng/ml higher than non-drinkers, respectively. HFCS drinkers with hyperuricemia had higher TG levels than HFCS drinkers with normal UA levels (98.6 vs. 81.6 mg/dl). The intake of HFCS-rich SSBs and high value of BMI (≥24) interactively reinforced RBP4 levels among overweight/obese adolescents. Circulating RBP4 levels were significantly correlated with weight-related outcomes and TG and UA concentration among HFCS drinkers (r = 0.253 to 0.404), but not among non-drinkers. Conclusions High-quantity HFCS-rich beverage consumption is associated with higher TG and RBP4 levels. Hyperuricemia is likely to intensify the influence of HFCS-rich SSB intake on elevated TG levels, and in overweight and obese adolescents, high BMI may modify the action of fructose on higher circulating levels of RBP4. PMID:24475021

Serum uric acid is not independently associated with plasma renin activity and plasma aldosterone in hypertensive adults.

PubMed

Mulè, G; Castiglia, A; Morreale, M; Geraci, G; Cusumano, C; Guarino, L; Altieri, D; Panzica, M; Vaccaro, F; Cottone, S

2017-04-01

In experimental investigations conducted in rats, raising serum uric acid (SUA) levels resulted in the stimulation of intrarenal renin expression. Studies in humans exploring the association of SUA with plasma renin activity (PRA) yielded conflicting results. Moreover, little is known about the relationship of SUA with plasma aldosterone concentration (PAC). The study aimed to assess the relationship between SUA levels, PRA, and PAC and the influence of age, gender, body mass index (BMI), and hyperuricemia on these relationships in subjects with essential hypertension (EH). We enrolled 372 hypertensive patients (mean age 45 ± 12 years, men 67%) with uncomplicated EH that was not pharmacologically treated. The study population was divided in tertiles according to SUA levels. While PRA did not differ significantly across the three tertiles, PAC was higher in subjects belonging to the uppermost tertile of SUA than those in the lower ones (p = 0.0429); however, this difference lost statistical significance after adjustment for age, sex, BMI, and serum creatinine. Univariate correlation analyses showed significant associations of SUA with PRA (r = 0.137; p = 0.008) and PAC (r = 0.179; p < 0.001). However, these relationships were not significant after correcting for confounding factors in multiple linear regression analyses. We did not observe statistically significant effect modification by gender, age, BMI, and hyperuricemia. SUA levels are weakly associated with PRA and PAC in adults with untreated EH. These relationships were lost after adjustment for age, sex, BMI, and serum creatinine. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

Acupuncture for serum uric acid in patients with asymptomatic hyperuricemia: A randomized, double-blind, placebo-controlled trial.

PubMed

Huang, Yingjuan; Meng, Jun; Sun, Baoguo; Xiang, Ting; Zhou, Xin; Xu, Biyu; Wu, Yingzi; Chen, Zexiong; Zhang, Shijun

2017-04-01

Hyperuricemia (HUA) is the most common disease associated with cardiovascular disease, metabolic syndrome, hypertension, and kidney disease. The objective of the current study was to evaluate the preliminary efficacy, mechanism, and safety of acupuncture on serum uric acid in patients with asymptomatic HUA. A randomized, placebo-controlled trial among 123 patients with asymptomatic HUA was conducted. The acupoints used in the acupuncture group were bilateral Five Shu in Spleen Meridian. Each participant received the intervention once daily for 10 consecutive days. The sham group received the same treatment duration on the same acupoints by the Park Sham Device. All patients underwent measurements of serum or urine creatinine, uric acid, serum lipid profiles, fasting plasma glucose, HbA1c, xanthine oxidase (XOD) and urate-anion exchanger (URAT-1). At the end of the intervention, the individuals in the acupuncture group were found to have significantly less levels of serum uric acid than those in the sham group [(453±65 vs. 528±81) μmol/L, p<0.01]. Acupuncture was effective on increasing the urine uric acid level, urine pH value and 24-hour urine volume than the sham treatment (p<0.05 for all). Interestingly, acupuncture significantly decreased the level of URAT-1 (p<0.01) but not XOD than that of the sham intervention. The adverse events were that 3 patients experienced severe pain. Acupuncture on Five Shu in Spleen Meridian appeared to be safe and efficacious for decreasing serum uric acid in a Chinese HUA patient population. The mechanism might be associated with the decrease level of enzyme URAT-1. ChiCTR-TRC-13004122. Copyright © 2017 Elsevier B.V. All rights reserved.

Characteristic and Outcome of Psoriatic Arthritis Patients with Hyperuricemia.

PubMed

AlJohani, Roa'A; Polachek, Ari; Ye, Justine Yang; Chandran, Vinod; Gladman, Dafna D

2018-02-01

To determine the characteristics of patients with psoriatic arthritis (PsA) who have hyperuricemia (HUC) and their outcomes, especially cardiovascular (CVD) and kidney diseases. Patients have been followed prospectively at the PsA clinic according to a standard protocol at 6- to 12-month intervals. We defined HUC in men > 450 µ mol/l or women > 360 µ mol/l. We matched patients with HUC based on sex and age ± 5 years with normal uric acid patients. Demographics information and disease characteristics were reviewed. Outcomes of patients with HUC, especially CVD and kidney diseases, were recorded. Conditional logistic regression was performed to determine factors independently associated with HUC in patients with PsA. There were 325 (31.9%) out of 1019 patients with PsA who had HUC. Of these, 318 cases were matched to 318 controls. There were 11 (3.4%) out of 325 patients with HUC who had gout. Patients with HUC had longer disease duration and a higher Psoriasis Area and Severity Index. They had more concurrent comorbidities, including CVD and metabolic diseases, as well as higher prevalence of kidney stones and higher creatinine. Only 1 patient with HUC was treated with allopurinol at first evaluation visit and 7 patients during followup. Over the followup, 163 of the 318 patients had persistent HUC (pHUC) for more than 2 visits. Patients with pHUC developed more myocardial infarction, heart failure, and renal impairment. Multivariate analysis showed an association between pHUC, PsA disease duration, and obesity. HUC is common in patients with PsA, especially in those with longer disease duration and obesity. Proper control of HUC and metabolic diseases may play a preventive role in improving PsA outcomes.

Elevated serum uric acid increases risks for developing high LDL cholesterol and hypertriglyceridemia: A five-year cohort study in Japan.

PubMed

Kuwabara, Masanari; Borghi, Claudio; Cicero, Arrigo F G; Hisatome, Ichiro; Niwa, Koichiro; Ohno, Minoru; Johnson, Richard J; Lanaspa, Miguel A

2018-06-15

High serum uric acid (SUA) is associated with the dyslipidemia, but whether hyperuricemia predicts an increase in serum low-density lipoprotein (LDL) cholesterol is unknown. This study is to evaluate whether an elevated SUA predicts the development of high LDL cholesterol as well as hypertriglyceridemia. This is a retrospective 5-year cohort study of 6476 healthy Japanese adults (age, 45.7 ± 10.1 years; 2.243 men) who underwent health examinations at 2004 and were reevaluated in 2009 at St. Luke's International Hospital, Tokyo, Japan. Subjects were included if at their baseline examination they did not have hypertension, diabetes mellitus, dyslipidemia, chronic kidney disease, or if they were on medication for hyperuricemia and/or gout. The analysis was adjusted for age, body mass index (BMI), smoking and drinking habits, baseline estimated glomerular filtration rate (eGFR), baseline SUA and SUA change over the 5 years. High baseline SUA was an independent risk for developing high LDL cholesterol both in men (OR: 1.159 per 1 mg/dL increase, 95% CI:1.009-1.331) and women (OR: 1.215, 95% CI:1.061-1.390). Other risk factors included a higher baseline LDL cholesterol, higher BMI, and higher baseline eGFR (the latter two in women only). Increased SUA over 5 years were also independent risks for developing high LDL cholesterol and hypertriglyceridemia, but not for low high-density lipoprotein (HDL) cholesterol. This is the first study to report that an elevated SUA increases the risk for developing high LDL cholesterol, as well as hypertriglyceridemia. This may shed light into the role of SUA in cardiovascular disease. Copyright © 2018 Elsevier B.V. All rights reserved.

Hyperuricemia Is a Risk Factor for the Onset of Impaired Fasting Glucose in Men with a High Plasma Glucose Level: A Community-Based Study

PubMed Central

Miyake, Teruki; Kumagi, Teru; Furukawa, Shinya; Hirooka, Masashi; Kawasaki, Keitarou; Koizumi, Mitsuhito; Todo, Yasuhiko; Yamamoto, Shin; Abe, Masanori; Kitai, Kohichiro; Matsuura, Bunzo; Hiasa, Yoichi

2014-01-01

Background It is not clear whether elevated uric acid is a risk factor for the onset of impaired fasting glucose after stratifying by baseline fasting plasma glucose levels. We conducted a community-based retrospective longitudinal cohort study to clarify the relationship between uric acid levels and the onset of impaired fasting glucose, according to baseline fasting plasma glucose levels. Methods We enrolled 6,403 persons (3,194 men and 3,209 women), each of whom was 18–80 years old and had >2 annual check-ups during 2003–2010. After excluding persons who had fasting plasma glucose levels ≥6.11 mM and/or were currently taking anti-diabetic agents, the remaining 5,924 subjects were classified into quartiles according to baseline fasting plasma glucose levels. The onset of impaired fasting glucose was defined as fasting plasma glucose ≥6.11 mM during the observation period. Results In the quartile groups, 0.9%, 2.1%, 3.4%, and 20.2% of the men developed impaired fasting glucose, respectively, and 0.1%, 0.3%, 0.5%, and 5.6% of the women developed impaired fasting glucose, respectively (P trend <0.001). After adjusting for age, body mass index, systolic blood pressure, triacylglycerols, high density lipoprotein-cholesterol, creatinine, fatty liver, family history of diabetes, alcohol consumption, and current smoking, uric acid levels were positively associated with onset of impaired fasting glucose in men with highest-quartile fasting plasma glucose levels (adjusted hazard ratio, 1.003; 95% confidence interval, 1.0001–1.005, P = 0.041). Conclusions Among men with high fasting plasma glucose, hyperuricemia may be independently associated with an elevated risk of developing impaired fasting glucose. PMID:25237894

ABCG2 variant has opposing effects on onset ages of Parkinson's disease and gout.

PubMed

Matsuo, Hirotaka; Tomiyama, Hiroyuki; Satake, Wataru; Chiba, Toshinori; Onoue, Hiroyuki; Kawamura, Yusuke; Nakayama, Akiyoshi; Shimizu, Seiko; Sakiyama, Masayuki; Funayama, Manabu; Nishioka, Kenya; Shimizu, Toru; Kaida, Kenichi; Kamakura, Keiko; Toda, Tatsushi; Hattori, Nobutaka; Shinomiya, Nariyoshi

2015-03-01

Uric acid (urate) has been suggested to play a protective role in Parkinson's disease onset through its antioxidant activity. Dysfunction of ABCG2, a high-capacity urate exporter, is a major cause for early-onset gout based on hyperuricemia. In this study, the effects of a dysfunctional ABCG2 variant (Q141K, rs2231142) were analyzed on the ages at onset of gout patients (N = 507) and Parkinson's disease patients (N = 1015). The Q141K variant hastened the gout onset (P = 0.0027), but significantly associated with later Parkinson's disease onset (P = 0.025). Our findings will be helpful for development of more effective prevention of Parkinson's disease.

The genetic basis of gout.

PubMed

Merriman, Tony R; Choi, Hyon K; Dalbeth, Nicola

2014-05-01

Gout results from deposition of monosodium urate (MSU) crystals. Elevated serum urate concentrations (hyperuricemia) are not sufficient for the development of disease. Genome-wide association studies (GWAS) have identified 28 loci controlling serum urate levels. The largest genetic effects are seen in genes involved in the renal excretion of uric acid, with others being involved in glycolysis. Whereas much is understood about the genetic control of serum urate levels, little is known about the genetic control of inflammatory responses to MSU crystals. Extending knowledge in this area depends on recruitment of large, clinically ascertained gout sample sets suitable for GWAS. Copyright © 2014 Elsevier Inc. All rights reserved.

Global metabolomic profiling targeting childhood obesity in the Hispanic population.

PubMed

Butte, Nancy F; Liu, Yan; Zakeri, Issa F; Mohney, Robert P; Mehta, Nitesh; Voruganti, V Saroja; Göring, Harald; Cole, Shelley A; Comuzzie, Anthony G

2015-08-01

Metabolomics may unravel important biological pathways involved in the pathophysiology of childhood obesity. We aimed to 1) identify metabolites that differ significantly between nonobese and obese Hispanic children; 2) collapse metabolites into principal components (PCs) associated with obesity and metabolic risk, specifically hyperinsulinemia, hypertriglyceridemia, hyperleptinemia, and hyperuricemia; and 3) identify metabolites associated with energy expenditure and fat oxidation. This trial was a cross-sectional observational study of metabolomics by using gas chromatography-mass spectrometry and ultrahigh-performance liquid chromatography-tandem mass spectrometry analyses performed on fasting plasma samples from 353 nonobese and 450 obese Hispanic children. Branched-chained amino acids (BCAAs) (Leu, Ile, and Val) and their catabolites, propionylcarnitine and butyrylcarnitine, were significantly elevated in obese children. Strikingly lower lysolipids and dicarboxylated fatty acids were seen in obese children. Steroid derivatives were markedly higher in obese children as were markers of inflammation and oxidative stress. PC6 (BCAAs and aromatic AAs) and PC10 (asparagine, glycine, and serine) made the largest contributions to body mass index, and PC10 and PC12 (acylcarnitines) made the largest contributions to adiposity. Metabolic risk factors and total energy expenditure were associated with PC6, PC9 (AA and tricarboxylic acid cycle metabolites), and PC10. Fat oxidation was inversely related to PC8 (lysolipids) and positively related to PC16 (acylcarnitines). Global metabolomic profiling in nonobese and obese children replicates the increased BCAA and acylcarnitine catabolism and changes in nucleotides, lysolipids, and inflammation markers seen in obese adults; however, a strong signature of reduced fatty acid catabolism and increased steroid derivatives may be unique to obese children. Metabolic flexibility in fuel use observed in obese children may occur through the activation of alternative intermediary pathways. Insulin resistance, hyperleptinemia, hypertriglyceridemia, hyperuricemia, and oxidative stress and inflammation evident in obese children are associated with distinct metabolomic profiles. © 2015 American Society for Nutrition.

Genetic variation underlying renal uric acid excretion in Hispanic children: the Viva La Familia Study.

PubMed

Chittoor, Geetha; Haack, Karin; Mehta, Nitesh R; Laston, Sandra; Cole, Shelley A; Comuzzie, Anthony G; Butte, Nancy F; Voruganti, V Saroja

2017-01-17

Reduced renal excretion of uric acid plays a significant role in the development of hyperuricemia and gout in adults. Hyperuricemia has been associated with chronic kidney disease and cardiovascular disease in children and adults. There are limited genome-wide association studies associating genetic polymorphisms with renal urate excretion measures. Therefore, we investigated the genetic factors that influence the excretion of uric acid and related indices in 768 Hispanic children of the Viva La Familia Study. We performed a genome-wide association analysis for 24-h urinary excretion measures such as urinary uric acid/urinary creatinine ratio, uric acid clearance, fractional excretion of uric acid, and glomerular load of uric acid in SOLAR, while accounting for non-independence among family members. All renal urate excretion measures were significantly heritable (p <2 × 10 -6 ) and ranged from 0.41 to 0.74. Empirical threshold for genome-wide significance was set at p <1 × 10 -7 . We observed a strong association (p < 8 × 10 -8 ) of uric acid clearance with a single nucleotide polymorphism (SNP) in zinc finger protein 446 (ZNF446) (rs2033711 (A/G), MAF: 0.30). The minor allele (G) was associated with increased uric acid clearance. Also, we found suggestive associations of uric acid clearance with SNPs in ZNF324, ZNF584, and ZNF132 (in a 72 kb region of 19q13; p <1 × 10 -6 , MAFs: 0.28-0.31). For the first time, we showed the importance of 19q13 region in the regulation of renal urate excretion in Hispanic children. Our findings indicate differences in inherent genetic architecture and shared environmental risk factors between our cohort and other pediatric and adult populations.

Relationship between serum uric acid and mortality among hemodialysis patients: Retrospective analysis of Korean end-stage renal disease registry data

PubMed Central

Kim, Chang Seong; Jin, Dong-Chan; Yun, Young Cheol; Bae, Eun Hui; Ma, Seong Kwon; Kim, Soo Wan

2017-01-01

Background It is thought that hyperuricemia might lower the risk of mortality among hemodialysis patients, unlike in the general population, but the evidence is controversial. The aim of the current study was to evaluate the impact of serum uric acid level on the long-term clinical outcomes of hemodialysis patients in Korea. Methods Retrospective analysis was performed on data from the End-Stage Renal Disease Registry of the Korean Society of Nephrology. This included data for 7,333 patients (mean age, 61 ± 14 years; 61% male) who received hemodialysis from January 2001 through April 2015. Initial laboratory data were used in the analysis. Results The mean serum uric acid level in this study was 7.1 ± 1.7 mg/dL. Body mass index, normalized protein catabolic rate, albumin, and cholesterol were positively correlated with serum uric acid level after controlling for age and sex. After controlling for demographic data, comorbidities, and residual renal function, a higher uric acid level was independently associated with a significantly lower all-cause mortality (hazard ratio [HR], 0.90 per 1 mg/dL increase in uric acid level; 95% confidence interval [CI], 0.83–0.97; P = 0.008), but not cardiovascular mortality (HR, 0.90; 95% CI, 0.80–1.01; P = 0.078). Comparing uric acid levels in the highest and lowest quintiles, the HR for all-cause mortality was 0.65 (95% CI, 0.42–0.99; P = 0.046). Conclusion Hyperuricemia was strongly associated with a lower risk of all-cause mortality, but there seems to be no significant association between serum uric acid level and cardiovascular mortality among Korean hemodialysis patients with end-stage renal disease. PMID:29285429

TRAUMATIC (FOREIGN BODY) PERICARDITIS IN A TOCO TOUCAN (RAMPHASTOS TOCO).

PubMed

Máinez, Mireia; Rosell, Jorge; Such, Roger; Cardona, Teresa; Juan-Sallés, Carles

2016-12-01

An approximately 10-yr-old, captive-born female toco toucan ( Ramphastos toco ) was presented due to an acute onset of depression and apathy. On visual and physical examination, it showed an abnormal posture and dehydration, respectively. Serum biochemistry revealed hyperuricemia (39.4 mg/dl) and elevated glutamic oxaloacetic transaminase (GOT; 1,050 U/L). Radiographs demonstrated an enlargement of the cardiac silhouette. The bird died 7 days after presentation, despite treatment with enrofloxacin, allopurinol, a preparation of hepatorenal protectors, and complex B vitamins with dextrose. Necropsy revealed severe fibrinohemorrhagic pericarditis with a 15 mm long and 2.5 mm diameter, rigid foreign body in the pericardial exudate. Microscopically, this foreign body was of vegetal origin.

ABCG2 variant has opposing effects on onset ages of Parkinson's disease and gout

PubMed Central

Matsuo, Hirotaka; Tomiyama, Hiroyuki; Satake, Wataru; Chiba, Toshinori; Onoue, Hiroyuki; Kawamura, Yusuke; Nakayama, Akiyoshi; Shimizu, Seiko; Sakiyama, Masayuki; Funayama, Manabu; Nishioka, Kenya; Shimizu, Toru; Kaida, Kenichi; Kamakura, Keiko; Toda, Tatsushi; Hattori, Nobutaka; Shinomiya, Nariyoshi

2015-01-01

Uric acid (urate) has been suggested to play a protective role in Parkinson's disease onset through its antioxidant activity. Dysfunction of ABCG2, a high-capacity urate exporter, is a major cause for early-onset gout based on hyperuricemia. In this study, the effects of a dysfunctional ABCG2 variant (Q141K, rs2231142) were analyzed on the ages at onset of gout patients (N = 507) and Parkinson's disease patients (N = 1015). The Q141K variant hastened the gout onset (P = 0.0027), but significantly associated with later Parkinson's disease onset (P = 0.025). Our findings will be helpful for development of more effective prevention of Parkinson's disease. PMID:25815357

Functional and Structural Characterization of Purine Nucleoside Phosphorylase from Kluyveromyces lactis and Its Potential Applications in Reducing Purine Content in Food

PubMed Central

Mahor, Durga; Priyanka, Anu; Prasad, Gandham S; Thakur, Krishan Gopal

2016-01-01

Consumption of foods and beverages with high purine content increases the risk of hyperuricemia, which causes gout and can lead to cardiovascular, renal, and other metabolic disorders. As patients often find dietary restrictions challenging, enzymatically lowering purine content in popular foods and beverages offers a safe and attractive strategy to control hyperuricemia. Here, we report structurally and functionally characterized purine nucleoside phosphorylase (PNP) from Kluyveromyces lactis (KlacPNP), a key enzyme involved in the purine degradation pathway. We report a 1.97 Å resolution crystal structure of homotrimeric KlacPNP with an intrinsically bound hypoxanthine in the active site. KlacPNP belongs to the nucleoside phosphorylase-I (NP-I) family, and it specifically utilizes 6-oxopurine substrates in the following order: inosine > guanosine > xanthosine, but is inactive towards adenosine. To engineer enzymes with broad substrate specificity, we created two point variants, KlacPNPN256D and KlacPNPN256E, by replacing the catalytically active Asn256 with Asp and Glu, respectively, based on structural and comparative sequence analysis. KlacPNPN256D not only displayed broad substrate specificity by utilizing both 6-oxopurines and 6-aminopurines in the order adenosine > inosine > xanthosine > guanosine, but also displayed reversal of substrate specificity. In contrast, KlacPNPN256E was highly specific to inosine and could not utilize other tested substrates. Beer consumption is associated with increased risk of developing gout, owing to its high purine content. Here, we demonstrate that KlacPNP and KlacPNPN256D could be used to catalyze a key reaction involved in lowering beer purine content. Biochemical properties of these enzymes such as activity across a wide pH range, optimum activity at about 25°C, and stability for months at about 8°C, make them suitable candidates for food and beverage industries. Since KlacPNPN256D has broad substrate specificity, a combination of engineered KlacPNP and other enzymes involved in purine degradation could effectively lower the purine content in foods and beverages. PMID:27768715

Temporal Relationship Between Hyperuricemia and Insulin Resistance and Its Impact on Future Risk of Hypertension.

PubMed

Han, Tianshu; Lan, Li; Qu, Rongge; Xu, Qian; Jiang, Ruyue; Na, Lixin; Sun, Changhao

2017-10-01

Although hyperuricemia and insulin resistance significantly correlated, their temporal sequence and how the sequence influence on future risk of hypertension are largely unknown. This study assessed temporal relationship between uric acid and insulin resistance and its impact on future risk of hypertension by examining a longitudinal cohort including 8543 subjects aged 20 to 74 years from China, with an average follow-up of 5.3 years. Measurements of fasting uric acid, as well as fasting and 2-hour serum glucose and insulin, were obtained at baseline and follow-up. Indicators of hepatic and peripheral insulin resistance were calculated. Cross-lagged panel and mediation analysis were used to examine the temporal relationship between uric acid and insulin resistance and its impact on follow-up hypertension. After adjusting for covariates, the cross-lagged path coefficients ( β 1 values) from baseline uric acid to follow-up insulin resistance indices were significantly greater than path coefficients ( β 2 values) from baseline insulin resistance indices to follow-up uric acid ( β 1 =0.110 versus β 2 =0.017; P <0.001, for hepatic insulin resistance; β 1 =-0.208 versus β 2 =-0.021; P <0.001, for peripheral insulin resistance). The path coefficients from baseline uric acid to follow-up insulin resistance indices in the hypertensive group were significantly greater than that in the normotensive group ( P <0.001 for the difference of β 1 values in the 2 groups). Insulin resistance partially mediated the effect of uric acid on subsequent hypertension, and the mediation effect of peripheral insulin resistance was significantly greater than that of hepatic insulin resistance (31.3% versus 13.2%; P <0.001, for the difference of mediation effects). These findings provide evidence that higher uric acid levels probably precede insulin resistance, and peripheral insulin resistance likely plays a more important role in the development of hypertension than hepatic insulin resistance does. © 2017 American Heart Association, Inc.

Serum Uric Acid Level Predicts Progression of IgA Nephropathy in Females but Not in Males

PubMed Central

Shoji, Tatsuya; Shinzawa, Maki; Hasuike, Yukiko; Nagatoya, Katsuyuki; Yamauchi, Atsushi; Hayashi, Terumasa; Kuragano, Takayuki; Moriyama, Toshiki; Isaka, Yoshitaka; Nakanishi, Takeshi

2016-01-01

Background Immunoglobulin A nephropathy (IgAN) is one of most common forms of glomerulonephritis. At this point, the clinical impact of hyperuricemia on IgAN is not clear. The aim of the present study was to explore the clinical impact of hyperuricemia on the progression of IgAN. Study Design Multicenter retrospective cohort study. Setting & Participants 935 IgAN patients who were diagnosed by kidney biopsy at Osaka University Hospital, Osaka General Hospital, and Osaka Rosai Hospital. were included in this study. Predictor Uric acid levels at renal biopsy. Outcomes The outcome of interest was the time from the kidney biopsy to the time when a 50% increase in the baseline serum creatinine level was observed, which was defined as "progression". Measurements The baseline characteristics according to the kidney biopsy at the time of diagnosis were collected from the medical records, and included age, gender, body mass index, hypertension, diabetes (use of antidiabetic drugs), serum levels of creatinine, urinary protein, smoking status, RAAS blockers and steroid therapy. Results An elevated serum uric acid level was an independent risk factor for progression in female patients (per 1.0 mg/dL, multivariate-adjusted incident rate ratio 1.33 [95% confidence interval 1.07, 1.64], P = 0.008) but not in male patients (1.02 [0.81, 1.29], P = 0.855). To control a confounding effect of renal function on an association between serum uric acid level and progression in female patients, age- and serum creatinine-matched and propensity score-matched analyses were performed, and these results also supported the effect by uric acid on kidney disease progression independent of basal kidney function. Limitations A cohort analyzed retorospectively. Conclusions This study revealed that an elevated uric acid level was an independent risk factor for ESKD in female IgAN patients. Therefore, uric acid might be a treatable target in female IgAN patients. PMID:27560997

Effects of Febuxostat on Oxidative Stress.

PubMed

Fukui, Toshiki; Maruyama, Mie; Yamauchi, Kazuhiro; Yoshitaka, Sumie; Yasuda, Tadashi; Abe, Youichi

2015-07-01

We previously examined factors that affect the measured derivatives of reactive oxygen metabolites (d-ROMs), an indicator of reactive oxygen species production, and biological antioxidant potential (BAP), an indicator of antioxidant capacity, in typical health checkup examinees and reported the usefulness of measuring both indicators simultaneously. In addition, a positive correlation reportedly exists between d-ROMs and the visceral fat area measured by using computed tomography. A recent study of the relationship between uric acid levels and various obesity-related factors found that visceral fat was the factor most strongly related to uric acid levels. Uric acid is itself a potent endogenous antioxidant, but because reactive oxygen species are produced during uric acid generation, it is suggested that uric acid may have opposing effects. The objective of this study was to analyze the effect of febuxostat, a novel xanthine oxidase inhibitor, on oxidative stress. Study subjects were 43 hyperuricemia outpatients receiving care in the internal medicine department of our institution. The subjects were divided into a new administration group (29 patients) and a switched administration group (14 patients); the latter were allopurinol-treated patients with hyperuricemia who were switched to febuxostat. In addition to measuring the patients' uric acid and creatinine levels and estimated glomerular filtration rate before and after treatment, their d-ROMs and BAP as well as the BAP/d-ROMs ratio were also measured. Both groups exhibited significant decreases in uric acid levels, as well as significant decreases in d-ROMs and BAP. No significant changes were observed in the BAP/dROMs ratio or renal function, including creatinine levels and estimated glomerular filtration rate. Febuxostat could significantly reduce d-ROMs. However, BAP levels were also significantly reduced concurrently. No changes were observed in the BAP/d-ROMs ratios. This regulatory mechanism is believed to have counteracted changes in the in vivo oxidative stress balance caused by febuxostat administration. Copyright © 2015 Elsevier HS Journals, Inc. All rights reserved.

Phytochemical investigation of some traditional chinese medicines and endophyte cultures.

PubMed

Tan, R X; Meng, J C; Hostettmann, K

2000-01-01

For many social and environmental reasons, over the last few decades, there has been an increase in chronic and life-threatening diseases including mycoses, hyperuricemia-related disorders and some mental illnesses such as depression, anxiety and Parkinson's disease. In order to fight these diseases, compounds acting on various biological targets, including enzymes such as xanthine oxidase or monoamine oxidase, have to be screened. The enzyme xanthine oxidase catalyses the oxidation of hypoxanthine to xanthine and then to uric acid, which plays a crucial role in hyperuricemiarelated disorders such as gout and renal stones. One of the therapeutic approaches to treat these diseases is the use of xanthine oxidase inhibitors that block the production of uric acid. Monoamine oxidases (E.C.1.4.3.4) A and B catalyse the oxidative deamination of monoamines in the central nervous system and peripheral tissues. Inhibitors of MAO A are clinically useful to treat anxiety and depression since they are expected to increase both noradrenalin and serotonin levels in the brain. On the other hand, inhibition of MAO B appears to be an effective approach for the prevention and adjunct treatment of Parkinson's disease. In traditional Chinese medical practice, many medicinal herbs have been used to treat chronic diseases such as fungal infections, hyperuricemia-based disorders and mental illnesses. This usage is indicative for the presumable presence of antifungal phytochemicals and inhibitors of xanthine and monoamine oxidases. Plants do not represent the only source for interesting natural products; some endophytes ('special' microorganisms living inside the healthy host plant) are also known to produce secondary metabolites of promising pharmaceutical and/or agricultural potential. The above observations prompted us to search for natural antifungal compounds and inhibitors of xanthine and monoamine oxidases in different Chinese plants and endophyte cultures. The active constituents isolated were mainly mono-, sesqui-, di-, and triterpenes, sterols, coumarins, flavonoids, phenylethanoids, stilbenoids, alkaloids and alcohols.

Prevalence and Risk Factors of CKD in Chinese Patients with Periodontal Disease

PubMed Central

Chen, Wei; Liang, Mengjun; Luo, Wei; Wu, Xianfeng; Ruan, Yiping; Wang, Jie; Xu, Ricong; Zhan, Xiaojiang; Yu, Jianwen; Tan, Jiaqing; Dong, Xiuqing; Zhang, Jincai; Yu, Xueqing

2013-01-01

Background Periodontal disease is common among adults and is associated with an increasing risk of chronic kidney disease (CKD). We aimed to investigate the prevalence and risk factors of CKD in patients with periodontal disease in China. Methods In the current cross-sectional study, patients with periodontal disease were included from Guangdong Provincial Stomatological Hospital between March 2011 and August 2011. CKD was defined as estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m2, the presence of albuminuria, or hematuria. All patients with periodontal disease underwent a periodontal examination, including periodontal probing pocket depth, gingival recession, and clinical attachment level by Florida Probe. They completed a questionnaire and had blood and urine samples taken. The adjusted prevalence of indicators of kidney damage was calculated and risk factors associated with CKD were analyzed. Results A total of 1392 patients with periodontal disease were invited to participate this study and 1268 completed the survey and examination. After adjusting for age and sex, the prevalence of reduced eGFR, albuminuria, and hematuria was 2.7% (95% CI 1.7–3.7), 6.7% (95% CI 5.5–8.1) and 10.9% (95% CI 9.2–12.5), respectively. The adjusted prevalence of CKD was 18.2% (95% CI 16.2–20.3). Age, male, diabetes, hypertension, history of CKD, hyperuricemia, and interleukin-6 levels (≥7.54 ng/L) were independent risk factors for reduced eGFR. Female, diabetes, hypertension, history of CKD, hyperuricemia, high level of cholesterol, and high sensitivity C-reactive protein (hsCRP) (≥1.03 mg/L) and TNF-α levels (≥1.12 ng/L) were independently associated with an increased risk of albuminuria. Female, lower education (

Historical perspective: visceral obesity and related comorbidity in Joannes Baptista Morgagni's 'De sedibus et causis morborum per anatomen indagata'.

PubMed

Enzi, G; Busetto, L; Inelmen, E M; Coin, A; Sergi, G

2003-04-01

In recent years, advances in epidemiological approaches and laboratory technology, along with the availability of sophisticated imaging methods to evaluate body fat distribution, made it possible to define the close correlation between visceral fat accumulation and the occurrence of metabolic abnormalities, cardiovascular diseases and respiratory disturbances in obese patients. Some 250 y ago, JB Morgagni with the help of only a knife for anatomical dissection, an acute mind, and an observational skillfulness was able to identify the intra-abdominal and mediastinal fat accumulation in android obesity. He clearly described the association between visceral obesity, hypertension, hyperuricemia, atherosclerosis and obstructive sleep apnea syndrome, long before the modern recognition of this syndrome.

[Chronic tophaceous gout].

PubMed

González-Rozas, M; Prieto de Paula, J M; Franco Hidalgo, S; López Pedreira, M R

2013-09-01

Gout is a common illness, usually of unknown etiology, is more frequent in men, and with a prevalence that increases with age. It is characterized by recurrent episodes of acute arthritis due to the deposition of monosodium urate crystals in joints. The underlying disorder in most cases is hyperuricemia, usually as a consequence of impairment in its renal excretion. Although it is generally believed that both the diagnosis and treatment are simple, the truth is that the level of adherence of clinical decisions using the existing guidelines is poor. We describe a case of chronic tophaceous gout, and review the general characteristics of this condition. Copyright © 2011 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

Natural Products for Antithrombosis

PubMed Central

Chen, Cen; Zhang, Qian; Wang, Feng-Qin; Hu, Yuan-Jia; Xia, Zhi-Ning

2015-01-01

Thrombosis is considered to be closely related to several diseases such as atherosclerosis, ischemic heart disease and stroke, as well as rheumatoid arthritis, hyperuricemia, and various inflammatory conditions. More and more studies have been focused on understanding the mechanism of molecular and cellular basis of thrombus formation as well as preventing thrombosis for the treatment of thrombotic diseases. In reality, there is considerable interest in the role of natural products and their bioactive components in the prevention and treatment of thrombosis related disorders. This paper briefly describes the mechanisms of thrombus formation on three aspects, including coagulation system, platelet activation, and aggregation, and change of blood flow conditions. Furthermore, the natural products for antithrombosis by anticoagulation, antiplatelet aggregation, and fibrinolysis were summarized, respectively. PMID:26075003

Impact of Hyperuricemia on Long-term Outcomes of Kidney Transplantation: Analysis of the FAVORIT Study.

PubMed

Kalil, Roberto S; Carpenter, Myra A; Ivanova, Anastasia; Gravens-Mueller, Lisa; John, Alin A; Weir, Matthew R; Pesavento, Todd; Bostom, Andrew G; Pfeffer, Marc A; Hunsicker, Lawrence G

2017-12-01

Elevated uric acid concentration is associated with higher rates of cardiovascular (CV) morbidity and mortality in the general population. It is not known whether hyperuricemia increases the risk for CV death or transplant failure in kidney transplant recipients. Post hoc cohort analysis of the FAVORIT Study, a randomized controlled trial that examined the effect of homocysteine-lowering vitamins on CV disease in kidney transplantation. Adult recipients of kidney transplants in the United States, Canada, or Brazil participating in the FAVORIT Study, with hyperhomocysteinemia, stable kidney function, and no known history of CV disease. Uric acid concentration. The primary end point was a composite of CV events. Secondary end points were all-cause mortality and transplant failure. Risk factors included in statistical models were age, sex, race, country, treatment assignment, smoking history, body mass index, presence of diabetes mellitus, history of CV disease, blood pressure, estimated glomerular filtration rate (eGFR), donor type, transplant vintage, lipid concentrations, albumin-creatinine ratio, and uric acid concentration. Cox proportional hazards models were fit to examine the association of uric acid concentration with study end points after risk adjustment. 3,512 of 4,110 FAVORIT participants with baseline uric acid concentrations were studied. Median follow-up was 3.9 (IQR, 3.0-5.3) years. 503 patients had a primary CV event, 401 died, and 287 had transplant failure. In unadjusted analyses, uric acid concentration was significantly related to each outcome. Uric acid concentration was also strongly associated with eGFR. The relationship between uric acid concentration and study end points was no longer significant in fully adjusted multivariable models (P=0.5 for CV events; P=0.09 for death, and P=0.1 for transplant failure). Unknown use of uric acid-lowering agents among study participants. Following kidney transplantation, uric acid concentrations are not independently associated with CV events, mortality, or transplant failure. The strong association between uric acid concentrations with traditional risk factors and eGFR is a possible explanation. Copyright © 2017 National Kidney Foundation, Inc. All rights reserved.

[Effect of febuxostat on epithelial-to-mesenchymal transition of kidney tubules, serum interleukin-6 and transforming growth factor β(1) in hyperuricemic rats].

PubMed

Lin, Z M; Zhang, R S; Fan, C X; Liang, Y L; Li, L; Zhao, L; Qu, J C; Xu, X; Zhao, H Y; Liu, X N; Zhu, K S

2017-05-01

Objective: To observe the effect of febuxostat on epithelial-to-mesenchymal transition (EMT) of kidney tubules and the levels of serum IL-6 nad transforming growth factor (TGF)β(1) in hyperuricemic rats. Methods: Forty male SD rats were divided into 4 groups: normal control group (NC group), oteracil potassium group (OP group), oteracil potassium with febuxostat group (OF group) and oteracil potassium with benzbromarone group (OB group). Each group had 10 rats and balanced in body weights. To induce hyperuricemia, rats were given oteracil potassium by gastric gavage once a day for eight weeks. Rats in OF group and OB group were given either febuxostat or benbromarone starting with oteracil potassium, and rats in NC group was given saline only. Blood samples were taken before, and at the end of 4 and 8 weeks of the treatments and serum uric acid, creatinine, blood usea nitrogen(BUN), IL-6 and TGFβ(1) contents were measured at each time point. Renal pathological changes were observed via HE and Masson staining, and the expression of α-SMA and E-cadherin were detected by immunohistochemistry. Results: Compared with those in NC group, the levels of serum uric acid, creatinine, BUN, IL-6 and TGFβ(1) in the another three groups were increased significantly (all P <0.01). However, the IL-6 and TGFβ(1) contents in OF group were much lower than those in OP group ( P <0.01). HE and Masson staining showed that OF group had less damage and tubulointerstitial fibrosis than OP group and OB group ( P <0.01). Moreover, the expression of α-SMA was significantly down-regulated ( P <0.01) and that of E-cadherin was significantly up-regulated in OF group compared with those in OP group. Conclusion: Febuxostat treatment significantly inhibited EMT and reduced the levels of IL-6 and TGFβ(1) in hyperuricemia rats.

Influence of the ABCG2 gout risk 141 K allele on urate metabolism during a fructose challenge.

PubMed

Dalbeth, Nicola; House, Meaghan E; Gamble, Gregory D; Pool, Bregina; Horne, Anne; Purvis, Lauren; Stewart, Angela; Merriman, Marilyn; Cadzow, Murray; Phipps-Green, Amanda; Merriman, Tony R

2014-01-30

Both genetic variation in ATP-binding cassette sub-family G member 2 (ABCG2) and intake of fructose-containing beverages are major risk factors for hyperuricemia and gout. This study aimed to test the hypothesis that the ABCG2 gout risk allele 141 K promotes the hyperuricaemic response to fructose loading. Healthy volunteers (n = 74) provided serum and urine samples immediately before and 30, 60, 120 and 180 minutes after ingesting a 64 g fructose solution. Data were analyzed based on the presence or absence of the ABCG2 141 K gout risk allele. The 141 K risk allele was present in 23 participants (31%). Overall, serum urate (SU) concentrations during the fructose load were similar in those with and without the 141 K allele (PSNP = 0.15). However, the 141 K allele was associated with a smaller increase in SU following fructose intake (PSNP <0.0001). Those with the 141 K allele also had a smaller increase in serum glucose following the fructose load (PSNP = 0.002). Higher fractional excretion of uric acid (FEUA) at baseline and throughout the fructose load was observed in those with the 141 K risk allele (PSNP <0.0001). However, the change in FEUA in response to fructose was not different in those with and without the 141 K risk allele (PSNP = 0.39). The 141 K allele effects on serum urate and glucose were more pronounced in Polynesian participants and in those with a body mass index ≥25 kg/m². In contrast to the predicted responses for a hyperuricemia/gout risk allele, the 141 K allele is associated with smaller increases in SU and higher FEUA following a fructose load. The results suggest that ABCG2 interacts with extra-renal metabolic pathways in a complex manner to regulate SU and gout risk. The study was registered by the Australian Clinical Trials Registry (ACTRN12610001036000).

Diabetes, overweight and risk of postmenopausal breast cancer: a case-control study in Uruguay.

PubMed

Ronco, Alvaro L; De Stefani, Eduardo; Deneo-Pellegrini, Hugo; Quarneti, Aldo

2012-01-01

Obese postmenopausal women increase their risk of developing breast cancer (BC), in particular if they display an android-type pattern of adiposity, which is also associated to increased risks of diabetes mellitus, hypertension and cardiovascular disease. In order to explore the associations among anthropometry (body mass index, body composition, somatotype), some specific items of medical history (diabetes, hypertension, dislypidemias, hyperuricemia) and the risk of BC in Uruguayan women, a case-control study was carried out between 2004-2009 at our Oncology Unit. 912 women of ages between 23-69 years (367 new BC cases and 545 non hospitalized, age-matched controls with a normal mammography) were interviewed. Twenty body measurements were taken in order to calculate body composition and somatotype. Patients were queried on socio-demographics, reproductive history, family history of cancer, a brief food frequency questionnaire and on personal history of diabetes, dislypidemias, hyperuricemia, hypertension and gallbladder stones. Uni- and multivariate analyses were done, generating odds ratios (ORs) as an expression of relative risks. A personal history of diabetes was positively associated to BC risk (OR=1.64, 95% CI 1.00-2.69), being higher among postmenopausal women (OR=1.92, 95% CI 1.04-3.52). The risks of BC for diabetes in postmenopausal women with overweight combined with dislypidemia (OR=9.33, 95% CI 2.10-41.5) and high fat/muscle ratio (OR=7.81, 95% CI 2.01-30.3) were significantly high. As a conclusion, a personal history of diabetes and overweight was strongly associated to BC. The studied sample had a subset of high-risk of BC featured by postmenopausal overweight and diabetic women, who also had a personal history of hypertension and/or dyslipidemia. The present results could contribute to define new high risk groups and individuals for primary as well as for secondary prevention, since this pattern linked to the metabolic syndrome is usually not considered for BC prevention.

New developments in the epidemiology and genetics of gout.

PubMed

Zaka, Raihana; Williams, Charlene J

2006-06-01

The prevalence of gout appears to be rapidly increasing worldwide and is no longer a disorder suffered primarily by over-fed alcohol consumers. Emerging risk factors include longevity, metabolic syndrome, and new classes of pharmacologic agents. In some ethnic populations, no obvious risk factors can explain the high incidence of hyperuricemia and gout, suggesting a genetic liability. Studies to identify genes associated with gout have included families with defects in purine metabolism, as well as families in whom the occurrence of gout is secondary to renal disorders such as juvenile hyperuricemic nephropathy and medullary cystic kidney disease. Case-control studies of isolated aboriginal cohorts suffering from primary gout have revealed several chromosomal loci that may harbor genes that are important to the development and/or progression of gout.

A case of Werner's syndrome associated with osteosarcoma.

PubMed

Murata, K; Hatamochi, A; Shinkai, H; Ishikawa, Y; Kawaguchi, N; Goto, M

1999-10-01

We described a case of Werner's syndrome associated with osteosarcoma. A 37-year-old Japanese man was diagnosed as having Werner's syndrome by the presence of juvenile cataracts, skin sclerosis and hyperpigmentation of the feet, high-pitched voice, characteristic bird-like appearance of the face with beak-shaped nose, thinning of the entire skin and hyperkeratoses on soles, hyperlipemia, hyperuricemia, diabetes melitus, and the mutated responsible gene (WRN). He had a 3-month history of a tumor on his left forearm. Histologically, the tumor included four histological patterns; a malignant fibrous histiocytoma-like, a desmoid-like, a dermatofibrosarcoma protuberans-like, and a chondrosarcoma-like pattern. Tumoral osteoid formation was also found in the tumor. Therefore, the tumor was diagnosed as osteosarcoma.

The influence of seasonality on the content of goyazensolide and on anti-inflammatory and anti-hyperuricemic effects of the ethanolic extract of Lychnophora passerina (Brazilian arnica).

PubMed

de Albuquerque Ugoline, Bruno César; de Souza, Jacqueline; Ferrari, Fernanda Cristina; Ferraz-Filha, Zilma Schimith; Coelho, Grazielle Brandão; Saúde-Guimarães, Dênia Antunes

2017-02-23

Lychnophora passerina (Mart ex DC) Gardn (Asteraceae), popularly known as Brazilian arnica, is used in Brazilian folk medicine to treat pain, rheumatism, bruises, inflammatory diseases and insect bites. Investigate the influence of the seasons on the anti-inflammatory and anti-hyperuricemic activities of ethanolic extract of L. passerina and the ratio of the goyazensolide content, main chemical constituent of the ethanolic extract, with these activities. Ethanolic extracts of aerial parts of L. passerina were obtained from seasons: summer (ES), autumn (EA), winter (EW) and spring (EP). The sesquiterpene lactone goyazensolide, major metabolite, was quantified in ES, EA, EW and EP by a developed and validated HPLC-DAD method. The in vivo anti-hyperuricemic and anti-inflammatory effects of the ethanolic extracts from L. passerina and goyazensolide were assayed on experimental model of oxonate-induced hyperuricemia in mice, liver xanthine oxidase (XOD) inhibition and on carrageenan-induced paw edema in mice. HPLC method using aqueous solution of acetic acid 0.01% (v/v) and acetonitrile with acetic acid 0.01% (v/v) as a mobile phase in a gradient system, with coumarin as an internal standard and DAD detection at 270nm was developed. The validation parameters showed linearity in a range within 10.0-150.0µg/ml, with intraday and interday precisions a range of 0.61-3.82. The accuracy values of intraday and interday analysis within 87.58-100.95%. EA showed the highest goyazensolide content. From the third to the sixth hour after injection of carrageenan, treatments with all extracts at the dose of 125mg/kg were able to reduce edema. Goyazensolide (10mg/kg) showed significant reduction of paw swelling from the second hour assay. This sesquiterpene lactone was more active than extracts and presented similar effect to indomethacin. Treatments with ES, EA and EP (125mg/kg) and goyazensolide (10mg/kg) reduced serum urate levels compared to hyperuricemic control group and were able to inhibit liver XOD activity. One of the mechanisms by which ES, EA, EP and goyazensolide exercise their anti-hyperuricemic effect is by the inhibition of liver XOD activity. Goyazensolide was identified as the main compound present in ES, EA, EW and EP and it is shown to be one of the chemical constituents responsible for the anti-inflammatory and anti-hyperuricemic effects of the ethanolic extracts. The anti-inflammatory and anti-hyperuricemic activities of the ethanolic extracts from L. passerina were not proportionally influenced by the variation of goyazensolide content throughout the seasons. The involvement of goyazensolide on in vivo anti-inflammatory and anti-hyperuricemic activities of L.passerina extracts was confirmed, as well as the possibility of participation of other constituents on these effects. This study demonstrated that the aerial parts of L. passerina may be collected in any season for use as anti-inflammatory agent. For use in hyperuricemia, the best seasons for the collection are summer, autumn and spring. The ethanolic extract of L. passerina and goyazensolide can be considered promising agents in the therapeutic of inflammation, hyperuricemia and gout. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Sugar consumption, metabolic disease and obesity: The state of the controversy.

PubMed

Stanhope, Kimber L

2016-01-01

The impact of sugar consumption on health continues to be a controversial topic. The objective of this review is to discuss the evidence and lack of evidence that allows the controversy to continue, and why resolution of the controversy is important. There are plausible mechanisms and research evidence that supports the suggestion that consumption of excess sugar promotes the development of cardiovascular disease (CVD) and type 2 diabetes (T2DM) both directly and indirectly. The direct pathway involves the unregulated hepatic uptake and metabolism of fructose, leading to liver lipid accumulation, dyslipidemia, decreased insulin sensitivity and increased uric acid levels. The epidemiological data suggest that these direct effects of fructose are pertinent to the consumption of the fructose-containing sugars, sucrose and high fructose corn syrup (HFCS), which are the predominant added sugars. Consumption of added sugar is associated with development and/or prevalence of fatty liver, dyslipidemia, insulin resistance, hyperuricemia, CVD and T2DM, often independent of body weight gain or total energy intake. There are diet intervention studies in which human subjects exhibited increased circulating lipids and decreased insulin sensitivity when consuming high sugar compared with control diets. Most recently, our group has reported that supplementing the ad libitum diets of young adults with beverages containing 0%, 10%, 17.5% or 25% of daily energy requirement (Ereq) as HFCS increased lipid/lipoprotein risk factors for CVD and uric acid in a dose-response manner. However, un-confounded studies conducted in healthy humans under a controlled, energy-balanced diet protocol that enables determination of the effects of sugar with diets that do not allow for body weight gain are lacking. Furthermore, recent reports conclude that there are no adverse effects of consuming beverages containing up to 30% Ereq sucrose or HFCS, and the conclusions from several meta-analyses suggest that fructose has no specific adverse effects relative to any other carbohydrate. Consumption of excess sugar may also promote the development of CVD and T2DM indirectly by causing increased body weight and fat gain, but this is also a topic of controversy. Mechanistically, it is plausible that fructose consumption causes increased energy intake and reduced energy expenditure due to its failure to stimulate leptin production. Functional magnetic resonance imaging (fMRI) of the brain demonstrates that the brain responds differently to fructose or fructose-containing sugars compared with glucose or aspartame. Some epidemiological studies show that sugar consumption is associated with body weight gain, and there are intervention studies in which consumption of ad libitum high-sugar diets promoted increased body weight gain compared with consumption of ad libitum low- sugar diets. However, there are no studies in which energy intake and weight gain were compared in subjects consuming high or low sugar, blinded, ad libitum diets formulated to ensure both groups consumed a comparable macronutrient distribution and the same amounts of fiber. There is also little data to determine whether the form in which added sugar is consumed, as beverage or as solid food, affects its potential to promote weight gain. It will be very challenging to obtain the funding to conduct the clinical diet studies needed to address these evidence gaps, especially at the levels of added sugar that are commonly consumed. Yet, filling these evidence gaps may be necessary for supporting the policy changes that will help to turn the food environment into one that does not promote the development of obesity and metabolic disease.

Long-lasting response to oral therapy in a young male with monogenic diabetes as part of HNF1B-related disease.

PubMed

Carrillo, Elena; Lomas, Amparo; Pinés, Pedro J; Lamas, Cristina

2017-01-01

Mutations in hepatocyte nuclear factor 1β gene ( HNF1B ) are responsible for a multisystemic syndrome where monogenic diabetes (classically known as MODY 5) and renal anomalies, mostly cysts, are the most characteristic findings. Urogenital malformations, altered liver function tests, hypomagnesemia or hyperuricemia and gout are also part of the syndrome. Diabetes in these patients usually requires early insulinization. We present the case of a young non-obese male patient with a personal history of renal multicystic dysplasia and a debut of diabetes during adolescence with simple hyperglycemia, negative pancreatic autoimmunity and detectable C-peptide levels. He also presented epididymal and seminal vesicle cysts, hypertransaminasemia, hyperuricemia and low magnesium levels. In the light of these facts we considered the possibility of a HNF1B mutation. The sequencing study of this gene confirmed a heterozygous mutation leading to a truncated and less functional protein. Genetic studies of his relatives were negative; consequently, it was classified as a de novo mutation. In particular, our patient maintained good control of his diabetes on oral antidiabetic agents for a long period of time. He eventually needed insulinization although oral therapy was continued alongside, allowing reduction of prandial insulin requirements. The real prevalence of mutations in HNF1B is probably underestimated owing to a wide phenotypical variability. As endocrinologists, we should consider this possibility in young non-obese diabetic patients with a history of chronic non-diabetic nephropathy, especially in the presence of some of the other characteristic manifestations. HNF1B mutations are a rare cause of monogenic diabetes, often being a part of a multisystemic syndrome.The combination of young-onset diabetes and genitourinary anomalies with slowly progressive nephropathy of non-diabetic origin in non-obese subjects should rise the suspicion of such occurrence. A family history may not be present.Once diagnosis is made, treatment of diabetes with oral agents is worth trying, since the response can be sustained for a longer period than the one usually described. Oral treatment can help postpone insulinization and, once this is necessary, can help reduce the required doses.

Efficacy and safety of febuxostat in the treatment of hyperuricemia in stable kidney transplant recipients.

PubMed

Sofue, Tadashi; Inui, Masashi; Hara, Taiga; Nishijima, Yoko; Moriwaki, Kumiko; Hayashida, Yushi; Ueda, Nobufumi; Nishiyama, Akira; Kakehi, Yoshiyuki; Kohno, Masakazu

2014-01-01

Post-transplant hyperuricemia (PTHU), defined as serum uric acid concentration ≥7.0 mg/dL or need for treatment with allopurinol or benzbromarone, reduces long-term allograft survival in kidney transplant recipients. Febuxostat, a new nonpurine selective xanthine oxidase inhibitor, is well tolerated in patients with moderate renal impairment. However, its efficacy and safety in kidney recipients with PTHU is unclear. We therefore assessed the efficacy and safety of febuxostat in stable kidney transplant recipients with PTHU. Of 93 stable adult kidney transplant recipients, 51 were diagnosed with PTHU (PTHU group) and 42 were not (NPTHU group). Of the 51 patients with PTHU, 26 were treated with febuxostat (FX group) and 25 were not (NFX group), at the discretion of each attending physician. One-year changes in serum uric acid concentrations, rates of achievement of target uric acid (<6.0 mg/dL), estimated glomerular filtration rates in allografts, and adverse events were retrospectively analyzed in the FX, NFX, and NPTHU groups. The FX group showed significantly greater decreases in serum uric acid (-2.0±1.1 mg/dL versus 0.0±0.8 mg/dL per year, P<0.01) and tended to show a higher rate of achieving target uric acid levels (50% versus 24%; odds ratio 3.17 [95% confidence interval 0.96-10.5], P=0.08) than the NFX group. Although baseline allograft estimated glomerular filtration rates tended to be lower in the FX group than in the NFX group (40±14 mL/min/1.73 m(2) versus 47±19 mL/min/1.73 m(2)), changes in allograft estimated glomerular filtration rate were similar (+1.0±4.9 mL/min/1.73 m(2) versus -0.2±6.9 mL/min/1.73 m(2) per year, P=0.50). None of the patients in the FX group experienced any severe adverse effects, such as pancytopenia or attacks of gout, throughout the entire study period. Nephrologists were more likely than urologists to start febuxostat in kidney transplant recipients with PTHU (69% versus 8%). Treatment with febuxostat sufficiently lowered uric acid levels without severe adverse effects in stable kidney transplant recipients with PTHU.

Sugar consumption, metabolic disease and obesity: The state of the controversy

PubMed Central

Stanhope, Kimber L.

2016-01-01

The impact of sugar consumption on health continues to be a controversial topic. The objective of this review is to discuss the evidence and lack of evidence that allows the controversy to continue, and why resolution of the controversy is important. There are plausible mechanisms and research evidence that support the suggestion that consumption of excess sugar promotes the development of cardiovascular disease (CVD) and type 2 diabetes (T2DM) both directly and indirectly. The direct pathway involves the unregulated hepatic uptake and metabolism of fructose, which leads to liver lipid accumulation, dyslipidemia, decreased insulin sensitivity and increased uric acid levels. The epidemiological data suggest that these direct effects of fructose are pertinent to the consumption of the fructose-containing sugars, sucrose and HFCS, which are the predominant added sugars. Consumption of added sugar is associated with development and/or prevalence of fatty liver, dyslipidemia, insulin resistance, hyperuricemia, cardiovascular disease and type 2 diabetes, and many of these associations are independent of body weight gain or total energy intake. There are diet intervention studies in which human subjects exhibited increased circulating lipids and decreased insulin sensitivity when consuming high sugar compared with control diets. Most recently, our group has reported that supplementing the ad libitum diets of young adults with beverages containing 0, 10, 17.5 or 25% of daily energy requirement (Ereq) as high fructose corn syrup (HFCS) increased lipid/lipoprotein risk factors for cardiovascular disease (CVD) and uric acid in a dose response manner. However, un-confounded studies conducted in healthy humans under a controlled, energy-balanced diet protocol that allow determination of the effects of sugar with diets that do not allow for body weight gain are lacking. Furthermore, there are recent reports that conclude that there are no adverse effects of consuming beverages containing up to 30% Ereq sucrose or HFCS, and the conclusions from several meta-analyses suggest that fructose has no specific adverse effects relative to any other carbohydrate. Consumption of excess sugar may also promote the development the development of CVD and T2DM indirectly by causing increased body weight and fat gain, but this is also a topic of controversy. Mechanistically, it is plausible that fructose consumption causes increased energy intake and reduced energy expenditure due to its failure to stimulate leptin production. Functional magnetic resonance imaging of the brain demonstrates that the brain responds differently to fructose or fructose-containing sugars compared with glucose or aspartame. There are epidemiological studies which show sugar consumption is associated with body weight gain, and there are intervention studies in which consumption of ad libitum high sugar diets promoted increased body weight gain compared with consumption of ad libitum low sugar diets. However, there are no studies in which energy intake and weight gain were compared in subjects consuming high or low sugar, blinded, ad libitum diets formulated to ensure both groups consumed a comparable macronutrient distribution and the same amounts of fiber. There is also little data to determine whether the form in which added sugar is consumed, as beverage or as solid food, affects its potential to promote weight gain. It will be very challenging to obtain the funding to conduct the clinical diet studies needed to address these evidence gaps, especially at the levels of added sugar that are commonly consumed. Yet, filling these evidence gaps may be necessary for supporting the policy changes that will help to turn the food environment into one that does not promote the development of obesity and metabolic disease. PMID:26376619

Febuxostat hypersensitivity: another cause of DRESS syndrome in chronic kidney disease?

PubMed

Paschou, E; Gavriilaki, E; Papaioannou, G; Tsompanakou, A; Kalaitzoglou, A; Sabanis, N

2016-11-01

Febuxostat is a xanthine oxidase inhibitor that during the last years has successfully replaced allopurinol treatment in patients with chronic kidney disease (CKD) and hyperuricemia. Several adverse events have been observed during therapy with febuxostat. DRESS (Drug Reaction with Eosinophilia and Systemic Symptoms) syndrome induced by febuxostat has been poorly described, mainly in patient with CKD who previously developed allopurinol hypersensitivity syndrome. DRESS syndrome is characterized by manifold cutaneous reactions and systemic disorders with potential devastating consequences. The underlying pathogenetic mechanisms remain unidentified, though immune responses are often complicated. P-i concept can partially explain the phenomenon. The role of renal insufficiency appears to be crucial and further investigation is required. The present article describes the case of a CKD patient that developed febuxostat-related DRESS syndrome.

Emerging role of rasburicase in the management of increased plasma uric acid levels in patients with hematologic malignancies

PubMed Central

Kennedy, LeAnne D; Koontz, Susannah; Rao, Kamakshi

2011-01-01

Tumor lysis syndrome (TLS) is defined as a group of metabolic derangements that result from the massive and abrupt release of cellular components into the bloodstream after rapid lysis of tumor cells. Breakdown of released materials leads to a number of electrolyte abnormalities, including elevated uric acid concentrations in the blood (hyperuricemia), which carries potentially serious consequences. The diagnosis, prevention, and management of TLS is complicated by variability in definitions, differences in risk factors based on patient- and tumor-specific characteristics, and practitioner preferences in terms of pharmaceutical management strategies. The best prevention and management option for a particular patient depends on the patient’s baseline risk for TLS development, the severity of symptoms in the event of TLS development, practical management considerations, and financial implications of treatment. PMID:22287858

Saponins from sea cucumber and their biological activities.

PubMed

Zhao, Yingcai; Xue, Changhu; Zhang, Tiantian; Wang, YuMing

2018-06-22

Sea cucumbers, belonging to the phylum Echinodermata, have been valued for centuries as a nutritious and functional food with various bioactivities. Sea cucumbers can produce highly active substances, notably saponins, the main secondary metabolites, which are the basis of their chemical defense. The saponins are mostly triterpene glycosides with triterpenes or steroid in aglycone, which possess multiple biological properties including anti-tumor, hypolipidemic activity, improvement of nonalcoholic fatty liver, inhibition of fat accumulation, anti-hyperuricemia, promotion of bone marrow hematopoiesis, anti-hypertension, etc. Sea cucumber saponins have received attention due to their rich sources, low toxicity, high efficiency, and few side effects. This review summarizes current research on the structure and activities of sea cucumber saponins based on the physiological and pharmacological activities from source, experimental models, efficacy and mechanisms, which may provide a valuable reference for the development of sea cucumber saponins.

Efficacy and safety of febuxostat in the treatment of hyperuricemia in stable kidney transplant recipients

PubMed Central

Sofue, Tadashi; Inui, Masashi; Hara, Taiga; Nishijima, Yoko; Moriwaki, Kumiko; Hayashida, Yushi; Ueda, Nobufumi; Nishiyama, Akira; Kakehi, Yoshiyuki; Kohno, Masakazu

2014-01-01

Background Post-transplant hyperuricemia (PTHU), defined as serum uric acid concentration ≥7.0 mg/dL or need for treatment with allopurinol or benzbromarone, reduces long-term allograft survival in kidney transplant recipients. Febuxostat, a new nonpurine selective xanthine oxidase inhibitor, is well tolerated in patients with moderate renal impairment. However, its efficacy and safety in kidney recipients with PTHU is unclear. We therefore assessed the efficacy and safety of febuxostat in stable kidney transplant recipients with PTHU. Methods Of 93 stable adult kidney transplant recipients, 51 were diagnosed with PTHU (PTHU group) and 42 were not (NPTHU group). Of the 51 patients with PTHU, 26 were treated with febuxostat (FX group) and 25 were not (NFX group), at the discretion of each attending physician. One-year changes in serum uric acid concentrations, rates of achievement of target uric acid (<6.0 mg/dL), estimated glomerular filtration rates in allografts, and adverse events were retrospectively analyzed in the FX, NFX, and NPTHU groups. Results The FX group showed significantly greater decreases in serum uric acid (−2.0±1.1 mg/dL versus 0.0±0.8 mg/dL per year, P<0.01) and tended to show a higher rate of achieving target uric acid levels (50% versus 24%; odds ratio 3.17 [95% confidence interval 0.96–10.5], P=0.08) than the NFX group. Although baseline allograft estimated glomerular filtration rates tended to be lower in the FX group than in the NFX group (40±14 mL/min/1.73 m2 versus 47±19 mL/min/1.73 m2), changes in allograft estimated glomerular filtration rate were similar (+1.0±4.9 mL/min/1.73 m2 versus −0.2±6.9 mL/min/1.73 m2 per year, P=0.50). None of the patients in the FX group experienced any severe adverse effects, such as pancytopenia or attacks of gout, throughout the entire study period. Nephrologists were more likely than urologists to start febuxostat in kidney transplant recipients with PTHU (69% versus 8%). Conclusion Treatment with febuxostat sufficiently lowered uric acid levels without severe adverse effects in stable kidney transplant recipients with PTHU. PMID:24600205

Effects of febuxostat on platelet-derived microparticles and adiponectin in patients with hyperuricemia.

PubMed

Nishizawa, Tohru; Taniura, Takehito; Nomura, Shosaku

2015-12-01

Platelet-derived microparticles (PDMPs) and adiponectin play an important role in the development of atherothrombosis. We investigated the effect of febuxostat on circulating PDMP levels and adiponectin in hyperuricemic patients. Levels of PDMP and biomarkers were measured using an ELISA at baseline and after 2 and 6 months of treatment. Plasma levels of PDMPs and biomarkers were higher, while those of adiponectin were lower in hyperuricemic patients than in normouricemic controls. Uric acid and interleukin (IL)-6 levels decreased significantly in hyperuricemic patients after 2 months of febuxostat treatment. However, PDMP and biomarkers decreased significantly in hyperuricemic patients after only 6 months of febuxostat treatment and adiponectin increased significantly. These results suggest that the effects of febuxostat for PDMPs seen may be the effect on xanthine oxidase but not the decrease of uric acid, and febuxostat may be beneficial for primary prevention of atherothrombosis in hyperuricemic patients.

Epidemiology of Gout

PubMed Central

Choi, Hyon

2014-01-01

Synopsis Gout is the most prevalent inflammatory arthritis in men. The findings of several epidemiological studies from a diverse range of countries suggest that the prevalence of gout has risen over the last few decades. Whilst incidence data are scarce, data from the US suggests that the incidence of gout is also rising. Evidence from prospective epidemiological studies has confirmed dietary factors (animal purines, alcohol and fructose), obesity, the metabolic syndrome, hypertension, diuretic use, and chronic kidney disease as clinically relevant risk factors for hyperuricemia and gout. Low-fat dairy products, coffee, and vitamin C appear to have a protective effect. Further prospective studies are required to examine other proposed risk factors for hyperuricaemia and gout such as the use of β-blockers and angiotension-II receptor antagonists (other than losartan), obstructive sleep apnoea, and osteoarthritis, and putative protective factors such as calcium-channel blockers and losartan. PMID:24703341

Febuxostat for the chronic management of hyperuricemia in patients with gout.

PubMed

Chinchilla, Sandra Pamela; Urionaguena, Irati; Perez-Ruiz, Fernando

2016-01-01

Febuxostat is a non-purine, selective inhibitor of both isoforms of xanthine oxido-reductase (XOR), and a major alternative to the scarce number of urate-lowering medications available in the last decades. Its inhibition of XOR is more potent than allopurinol in a mg to mg comparison, what is associated to achievement of serum urate target more frequently than allopurinol at doses tested in clinical trials, especially in patients with the highest baseline serum urate levels. Its pharmacokinetics is not greatly dependent on renal clearance, contrary to allopurinol, what may be an advantage in patients with chronic kidney disease. Several trials are further evaluating both the cardiovascular safety of febuxostat and its possible beneficial effect on renal function preservation. Still scarce, but clinically interesting, evidence on its use in transplant patients has been recently released.

[A case of rhabdomyolysis caused by saw palmetto of healthy foods].

PubMed

Hanaka, Minako; Yoshii, Chiharu; Yatera, Kazuhiro; Ito, Chiyo; Chojin, Yasuo; Nagata, Shuya; Yamasaki, Kei; Nishida, Chinatsu; Kawanami, Toshinori; Kawanami, Yukiko; Ishimoto, Hiroshi; Mukae, Hiroshi

2012-06-01

An 82-year-old man visited our hospital when he developed a fever of over 38 degrees C after having consumed 5 types of health foods. He had previously been treated for chronic obstructive pulmonary disease, hypertension and hyperuricemia. Blood examination on admission revealed renal dysfunction, marked elevation of C-reactive protein, and an elevated level of serum creatine kinase. According to the laboratory data and his clinical history, rhabdomyolysis complicated by acute renal failure was suspected, but his condition improved and his fever was reduced with fluid infusion. As a drug lymphocyte stimulation test was positive for only saw palmetto in the 5 health foods, we diagnosed the case as rhabdomyolysis induced by saw palmetto. We believe that this is the first case of a health food being the cause of rhabdomyolysis.

Uric acid concentrations are associated with insulin resistance and birthweight in normotensive pregnant women.

PubMed

Laughon, S Katherine; Catov, Janet; Roberts, James M

2009-12-01

We sought to investigate whether uric acid concentrations are increased in pregnant women with insulin resistance and to correlate both with fetal growth. Uric acid, glucose, and insulin were measured in plasma at 20.4 (+/-2.0) weeks' gestation in 263 women. The association between uric acid and insulin resistance, as estimated using the homeostasis model assessment (HOMA), was analyzed and related to birthweights. In 212 (80.6%) women who remained normotensive throughout pregnancy, HOMA increased 1.23 U per 1-mg/dL increase in uric acid (95% confidence interval, 1.07-1.42; P=.003). Infants born to normotensive women in the upper quartile of uric acid and lowest HOMA quartile weighed 435.6 g less than infants of women with highest uric acid and HOMA quartiles (P<.005). Increasing uric acid concentrations were associated with insulin resistance in midpregnancy. Hyperuricemia was associated with lower birthweight in normotensive women, and this effect was attenuated by insulin resistance.

Adiponectin as a routine clinical biomarker.

PubMed

Kishida, Ken; Funahashi, Tohru; Shimomura, Iichiro

2014-01-01

Adiponectin is a protein synthesized and secreted predominantly by adipocytes into the peripheral blood. However, circulating adiponectin level is inversely related with body weight, especially visceral fat accumulation. The mechanism of this paradoxical relation remains obscure. Low circulating adiponectin concentrations (hypoadiponectinemia; <4 μg/mL) are associated with a variety of diseases, including dysmetabolism (type 2 diabetes, insulin resistance, hypertension, dyslipidemia, metabolic syndrome, hyperuricemia), atherosclerosis (coronary artery disease, stroke, peripheral artery disease), sleep apnea, non-alcoholic fatty liver disease, gastritis and gastro-esophageal reflux disease, inflammatory bowel diseases, pancreatitis, osteoporosis, and cancer (endometrial cancer, postmenopausal breast cancer, leukemia, colon cancer, gastric cancer, prostate cancer). On the other hand, hyperadiponectinemia is associated with cardiac, renal and pulmonary diseases. This review article focuses on the significance of adiponectin as a clinical biomarker of obesity-related diseases. Routine measurement of adiponectin in patients with lifestyle-related diseases is highly recommended. Copyright © 2013 Elsevier Ltd. All rights reserved.

Bilateral Proliferative Retinopathy as the Initial Presentation of Chronic Myeloid Leukemia

PubMed Central

Macedo, Mafalda S. F.; Figueiredo, Ana R. M.; Ferreira, Natália N.; Barbosa, Irene M. A.; Furtado, Maria João F. B. S.; Correia, Nuno F. C. B. A.; Gomes, Miguel P.; Lume, Miguel R. B.; Menéres, Maria João S.; Santos, Marinho M. N.; Meireles S., M. Angelina C.

2013-01-01

The authors report a rare case of a 48-year-old male with chronic myeloid leukemia (CML) who initially presented with a bilateral proliferative retinopathy. The patient complained of recent visual loss and floaters in both eyes (BE). Ophthalmologic evaluation revealed a best corrected visual acuity (BCVA) of 20/50 in the right eye and 20/200 in the left eye (LE). Fundoscopy showed the presence of bilateral peripheral capillary dropout with multiple retinal sea fan neovascularisations, which were confirmed on fluorescein angiography. Full blood count revealed hyperleukocytosis, thrombocytosis, anemia, and hyperuricemia. Bone marrow aspiration and biopsy showed the reciprocal chromosomal translocation t (9;22), diagnostic of CML. The patient was started on hydroxyurea, allopurinol and imatinib mesylate. He received bilateral panretinal laser photocoagulation and a vitrectomy was performed in the LE. The patient has been in complete hematologic, cytogenetic, and major molecular remission while on imatinib and his BCVA is 20/25 in BE. PMID:24339689

Serum uric acid as prognostic marker of coronary heart disease (CHD).

PubMed

Purnima, Samudrala; El-Aal, Bahiga Galal Abd

A substantial body of epidemiological and experimental evidence suggests the significance of serum uric acid as an important and independent risk factor of cardio vascular and renal diseases especially in patients with diabetes mellitus, hypertension. Hyperuricemia is a risk factor of coronary heart disease. Several studies showed positive association between hyperuricemia and CHD risk factors. To analyze the serum uric acid levels in patients with diabetes and hypertension, which helps in understanding its role as prognostic marker of coronary heart disease. The study was conducted in population of Wadi-Al Dawasir (K.S.A.) aged 20-80 years through random sampling from October 2012 to June 2013. It included 250 samples and the cases were categorized into diabetic and hypertensive. In the cases, purely hypertensive were 52, diabetic were 57 and mixed group included both diabetic and hypertensive patients 65. Fasting blood was collected to analyze lipid profile which included (total cholesterol, triglycerides, high density lipoprotein, low density lipoprotein) and serum uric acid in association with age and heredity was also studied. Patient demographics were recorded. The study revealed significant association of serum uric acid (p<0.014*) and total cholesterol (p<0.007**) triglycerides (p<0.009**) low density lipoprotein (p<0.044*) in hypertensive group. Serum uric acid levels in the mixed group patients with diabetes and hypertension reported serum uric acid (p<0.0037), total cholesterol (p<0.089+) proved to have increased risk of coronary heart disease. When compared to controls (non-diabetic p<0.529) and (non-hypertensive p<0.021*) with respect to serum uric acid levels show the magnitude of risk to coronary heart disease. With progressing age the association of lipid profile and serum uric acid reported (p<0.001**) in diabetics. Significant correlations were found between serum uric acid and risk factors for CHD. This is first study of its kind in this region of K.S.A., which helps the community to understand the role of serum uric acid in coronary heart disease, justifies the objective of research in taking preventive measures to combat the deleterious effect of coronary heart disease. Prevention and early detection of elevated uric acid in both hypertensive and diabetic patients could serve as effective investigative tool in reducing coronary heart disease. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

The role of uric acid in the pathogenesis of diabetic retinopathy based on notch pathway.

PubMed

Zhu, Dan-Dan; Wang, Yun-Zhi; Zou, Chen; She, Xin-Ping; Zheng, Zhi

2018-06-19

Uric acid has been proposed as an independent risk factor of diabetic retinopathy. Although Notch signaling was reported to be affected in the presence of high concentrations of uric acid or glucose, the underlying mechanisms of hyperuricemia through the Notch signaling pathway to promote the development of diabetic retinopathy remain unknown. We incubated human retinal endothelial cells (HRECs) with high glucose, high uric acid and high glucose plus high glucose respectively and evaluated the apoptosis rate in different treated cells by Tunel staining. We induced diabetic model by intraperitoneally streptozotocin. Then healthy rats and diabetic rats were given with adenine and oteracil potassium by gavage. Using automatic biochemical analyzer to detect blood glucose, uric acid, urea nitrogen, creatinine levels, to verify the success of modeling. The expression and mRNA levels of ICAM-1, IL-6, MCP-1, TNF-a, receptors Notch 1, ligands Dll 1, Dll 4, Jagged 1, Jagged 2 were detected by RT-PCR and Western-Blot. Notch1 siRNA was used to interfere Notch signaling pathway, the expression and mRNA levels of ICAM-1, IL-6, MCP-1 and TNF-α was detected by RT-PCR and Western blot respectively. In vitro models, the apoptosis of HRECs cells in high uric acid plus high glucose group was the most significant. In vitro and vivo models, detection of inflammatory cytokines revealed that the expression of inflammatory cytokines increased most significantly in high uric acid plus high glucose group. Notch signaling pathway activity was also increased most significantly in high uric acid plus high glucose group. After Notch 1 siRNA transfection in high glucose and high glucose plus uric acid group, the activity of Notch signaling pathway was successfully down-regulated. We found that the apoptosis of HRECs was significantly decreased in cells transfected with Notch 1 siRNA compared to the blank vector group, and the expression of inflammatory cytokines in cells was also significantly decreased. Our study reported that high uric acid can promote the inflammation of the retina and increase the activity of Notch signaling pathway on the basis of high glucose. Hyperuricemia promotes the development of diabetic retinopathy by increasing the activity of Notch signaling pathway. Notch signaling pathway is a potential therapeutic target for diabetic retinopathy. Copyright © 2018. Published by Elsevier Inc.

Accuracy of the HumaSensplus point-of-care uric acid meter using capillary blood obtained by fingertip puncture.

PubMed

Fabre, Stéphanie; Clerson, Pierre; Launay, Jean-Marie; Gautier, Jean-François; Vidal-Trecan, Tiphaine; Riveline, Jean-Pierre; Platt, Adam; Abrahamsson, Anna; Miner, Jeffrey N; Hughes, Glen; Richette, Pascal; Bardin, Thomas

2018-05-02

The uric acid (UA) level in patients with gout is a key factor in disease management and is typically measured in the laboratory using plasma samples obtained after venous puncture. This study aimed to assess the reliability of immediate UA measurement with capillary blood samples obtained by fingertip puncture with the HumaSens plus point-of-care meter. UA levels were measured using both the HumaSens plus meter in the clinic and the routine plasma UA method in the biochemistry laboratory of 238 consenting diabetic patients. HumaSens plus capillary and routine plasma UA measurements were compared by linear regression, Bland-Altman plots, intraclass correlation coefficient (ICC), and Lin's concordance coefficient. Values outside the dynamic range of the meter, low (LO) or high (HI), were analyzed separately. The best capillary UA thresholds for detecting hyperuricemia were determined by receiver operating characteristic (ROC) curves. The impact of potential confounding factors (demographic and biological parameters/treatments) was assessed. Capillary and routine plasma UA levels were compared to reference plasma UA measurements by liquid chromatography-mass spectrometry (LC-MS) for a subgroup of 67 patients. In total, 205 patients had capillary and routine plasma UA measurements available. ICC was 0.90 (95% confidence interval (CI) 0.87-0.92), Lin's coefficient was 0.91 (0.88-0.93), and the Bland-Altman plot showed good agreement over all tested values. Overall, 17 patients showed values outside the dynamic range. LO values were concordant with plasma values, but HI values were considered uninterpretable. Capillary UA thresholds of 299 and 340 μmol/l gave the best results for detecting hyperuricemia (corresponding to routine plasma UA thresholds of 300 and 360 μmol/l, respectively). No significant confounding factor was found among those tested, except for hematocrit; however, this had a negligible influence on the assay reliability. When capillary and routine plasma results were discordant, comparison with LC-MS measurements showed that plasma measurements had better concordance: capillary UA, ICC 0.84 (95% CI 0.75-0.90), Lin's coefficient 0.84 (0.77-0.91); plasma UA, ICC 0.96 (0.94-0.98), Lin's coefficient 0.96 (0.94-0.98). UA measurements with the HumaSens plus meter were reasonably comparable with those of the laboratory assay. The meter is easy to use and may be useful in the clinic and in epidemiologic studies.

Does Altered Uric Acid Metabolism Contribute to Diabetic Kidney Disease Pathophysiology?

PubMed

Gul, Ambreen; Zager, Philip

2018-03-01

Multiple experimental and clinical studies have identified pathways by which uric acid may facilitate the development and progression of chronic kidney disease (CKD) in people with diabetes. However, it remains uncertain if the association of uric acid with CKD represents a pathogenic effect or merely reflects renal impairment. In contrast to many published reports, a recent Mendelian randomization study did not identify a causal link between uric acid and CKD in people with type 1 diabetes. Two recent multicenter randomized control trials, Preventing Early Renal Function Loss in Diabetes (PERL) and FEbuxostat versus placebo rAndomized controlled Trial regarding reduced renal function in patients with Hyperuricemia complicated by chRonic kidney disease stage 3 (FEATHER), were recently designed to assess if uric acid lowering slows progression of CKD. We review the evidence supporting a role for uric acid in the pathogenesis of CKD in people with diabetes and the putative benefits of uric acid lowering.

Therapeutic Effects of Xanthine Oxidase Inhibitors: Renaissance Half a Century after the Discovery of Allopurinol

PubMed Central

PACHER, PÁL; NIVOROZHKIN, ALEX; SZABÓ, CSABA

2008-01-01

The prototypical xanthine oxidase (XO) inhibitor allopurinol, has been the cornerstone of the clinical management of gout and conditions associated with hyperuricemia for several decades. More recent data indicate that XO also plays an important role in various forms of ischemic and other types of tissue and vascular injuries, inflammatory diseases, and chronic heart failure. Allopurinol and its active metabolite oxypurinol showed considerable promise in the treatment of these conditions both in experimental animals and in small-scale human clinical trials. Although some of the beneficial effects of these compounds may be unrelated to the inhibition of the XO, the encouraging findings rekindled significant interest in the development of additional, novel series of XO inhibitors for various therapeutic indications. Here we present a critical overview of the effects of XO inhibitors in various pathophysiological conditions and also review the various emerging therapeutic strategies offered by this approach. PMID:16507884

Structure-based design and biological evaluation of novel 2-(indol-2-yl) thiazole derivatives as xanthine oxidase inhibitors.

PubMed

Song, Jeong Uk; Jang, Jae Wan; Kim, Tae Hun; Park, Heuisul; Park, Wan Su; Jung, Sang-Hun; Kim, Geun Tae

2016-02-01

Inhibition of xanthine oxidase (XO) has obviously been a central concept for controlling hyperuricemia, which causes serious and painful inflammatory arthritis disease such as gout. We discovered a series of novel 2-(indol-2-yl)thiazole derivatives as XO inhibitors at the level of nanomolar activity. Structure-guided design using molecular modeling program (Accelrys Software program) provided an excellent basis for optimization of 2-(indol-2-yl)thiazole compounds. Structure-activity relationship indicated that hydrophobic alkoxy group (isopropoxy, cyclopentoxy) at 5-position and hydrogen binding acceptor (NO2, CN) at 7-position of indole ring appear as critical functional groups. Among the compounds, 2-(7-nitro-5-isopropoxy-indol-2-yl)-4-methylthiazole-5-carboxylic acid (9m) exhibits the most potent XO inhibitory activity (IC50 value: 5.1 nM) and the excellent uric acid lowering activity in potassium oxonate induced hyperuricemic rat model. Copyright © 2016. Published by Elsevier Ltd.

Rank in Self-Defense Forces and risk factors for atherosclerotic disease.

PubMed

Sakuta, Hidenari; Suzuki, Takashi

2005-10-01

Socioeconomic status is associated with prevalence of and risk for atherosclerotic disease. We investigated the relationship between rank in the Self-Defense Forces (SDFs) and risk factors for atherosclerotic disease among middle-aged, male, SDFs personnel. Subjects were classified into five groups according to their ranks in the SDFs, i.e., class 1 (lowest, n = 289), class 2 (low, n = 170), class 3 (middle, n = 229), class 4 (high, n = 197), and class 5 (highest, n = 89). Low rank was associated with current cigarette smoking, alcohol abstaining, and poorer vegetable consumption. It was also associated with prevalence of type 2 diabetes, elevated gamma-glutamyltransferase activity, and high white blood cell counts. Prevalence of obesity, hypertension, hypercholesterolemia, hypertriglyceridemia, or hyperuricemia was not associated with rank in this population. Rank may be regarded as one of the markers that reflect individual health states among middle-aged male personnel.

Standardisation of the Japanese diet for use in animal experiments.

PubMed

Sugawara, Saeko; Mizowaki, Yui; Iwagaki, Yui; Sakamoto, Yu; Yamamoto, Kazushi; Tsuduki, Tsuyoshi

2017-11-01

The aim of this study was to develop a purified diet that mimics the characteristics of the Japanese diet using readily available materials with a simpler composition and a focus on quality, with the goal of facilitating performance of studies on the Japanese diet worldwide. The utility of the new diet was examined as a mimic of the standard Japanese diet for use in animal experiments. We examined whether a key characteristic of the Japanese diet of being less likely to cause obesity could be reproduced. The mimic diet had a balance of protein, fat and carbohydrate based on the 1975 Japanese diet, which is the least likely to cause obesity, and materials chosen with reference to the National Health and Nutrition Survey (NHNS). To examine similarities of the mimic diet with the model 1975 Japanese diet, we created a menu of the 1975 diet based on the NHNS and prepared the freeze-dried and powdered diet. The mimic diet, the 1975 Japanese diet, a control AIN-93G diet and a Western diet were fed to mice for 4 weeks. As a result, the mimic diet and the 1975 diet resulted in less accumulation of visceral fat and liver fat. Mice given these two diets showed similar effects. This indicates that the mimic diet used in this study has characteristics of the 1975 Japanese diet and could be used as a standard Japanese diet in animal experiments.

Wearable salivary uric acid mouthguard biosensor with integrated wireless electronics.

PubMed

Kim, Jayoung; Imani, Somayeh; de Araujo, William R; Warchall, Julian; Valdés-Ramírez, Gabriela; Paixão, Thiago R L C; Mercier, Patrick P; Wang, Joseph

2015-12-15

This article demonstrates an instrumented mouthguard capable of non-invasively monitoring salivary uric acid (SUA) levels. The enzyme (uricase)-modified screen printed electrode system has been integrated onto a mouthguard platform along with anatomically-miniaturized instrumentation electronics featuring a potentiostat, microcontroller, and a Bluetooth Low Energy (BLE) transceiver. Unlike RFID-based biosensing systems, which require large proximal power sources, the developed platform enables real-time wireless transmission of the sensed information to standard smartphones, laptops, and other consumer electronics for on-demand processing, diagnostics, or storage. The mouthguard biosensor system offers high sensitivity, selectivity, and stability towards uric acid detection in human saliva, covering the concentration ranges for both healthy people and hyperuricemia patients. The new wireless mouthguard biosensor system is able to monitor SUA level in real-time and continuous fashion, and can be readily expanded to an array of sensors for different analytes to enable an attractive wearable monitoring system for diverse health and fitness applications. Copyright © 2015 Elsevier B.V. All rights reserved.

Wearable salivary uric acid mouthguard biosensor with integrated wireless electronics

PubMed Central

Kim, Jayoung; Imani, Somayeh; de Araujo, William R.; Warchall, Julian; Valdés-Ramírez, Gabriela; Paixão, Thiago R.L.C.; Mercier, Patrick P.; Wang, Joseph

2016-01-01

This article demonstrates an instrumented mouthguard capable of non-invasively monitoring salivary uric acid (SUA) levels. The enzyme (uricase)-modified screen printed electrode system has been integrated onto a mouthguard platform along with anatomically-miniaturized instrumentation electronics featuring a potentiostat, microcontroller, and a Bluetooth Low Energy (BLE) transceiver. Unlike RFID-based biosensing systems, which require large proximal power sources, the developed platform enables real-time wireless transmission of the sensed information to standard smartphones, laptops, and other consumer electronics for on-demand processing, diagnostics, or storage. The mouthguard biosensor system offers high sensitivity, selectivity, and stability towards uric acid detection in human saliva, covering the concentration ranges for both healthy people and hyperuricemia patients. The new wireless mouthguard biosensor system is able to monitor SUA level in real-time and continuous fashion, and can be readily expanded to an array of sensors for different analytes to enable an attractive wearable monitoring system for diverse health and fitness applications. PMID:26276541

Limitations of the Current Standards of Care for Treating Gout and Crystal Deposition in the Primary Care Setting: A Review.

PubMed

Keenan, Robert T

2017-02-01

This article outlines several important issues regarding the management of patients with gout. The topics discussed include best practices for gout based on the most current guidelines, opportunities for improving gout management, and current and emerging therapies for gout. [PubMed and Google Scholar databases] were search for all articles and trials published before 2016, using the key terms [hyperuricemia, gout, tophi, joint erosion, joint damage, treatment guidelines, American College of Rheumatology (ACR), European League Against Rheumatism (EULAR), flare, comorbidity, epidemiology, adherence, serum uric acid (sUA), monosodium urate (MSU), <6 mg/dL, MSU crystal formation, as well as individual drug names and classes of treatments of interest (allopurinol, febuxostat, colchicine, non-steroidal anti-inflammatories (NSAIDs)]. Studies were selected that presented data on gout treatment, including drugs under development, and on the management of gout from both the physician and patient perspectives. The reference lists of identified articles were searched manually for additional publications. Gout, a progressive debilitating form of inflammatory arthritis, is caused by factors that elevate serum uric acid (sUA) levels, leading to hyperuricemia. Continued elevated sUA can result in monosodium urate crystal deposition in joints and soft tissues, causing acute and chronic inflammation. Crystal deposition can lead to chronic gout, with an increased number of flares, tophi development, and structural joint damage. The aims of gout treatment are to reduce the sUA level to <6 mg/dL, to inhibit the formation of new crystals, and to promote the dissolution of existing crystals. Gout is often poorly managed for several reasons, including a lack of adherence to treatment guidelines by health care providers, patients' poor adherence to therapy, and differences between a provider's and patient's perspectives regarding treatment. Patients need to be educated about their diagnosis and management of the disease, such as the importance of compliance with long-term treatment. Gout treatment may also confounded by contraindications to current standards of therapy and the limitations of current treatment paradigms. Recently approved medications, as well as drugs under development, may provide new ways for reaching the sUA target and also "curing" the disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

From genotype to phenotype; clinical variability in Lesch-Nyhan disease. The role of epigenetics.

PubMed

Trigueros Genao, M; Torres, R J

2014-11-01

Lesch-Nyhan disease is a rare genetic disease characterized by a deficiency in the function of the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT). Patients affected by this disease experience hyperuricemia, motor disorders, mental retardation and, in the most severe cases, self-mutilation. Its clinical manifestations depend on the enzymatic activity of HGPRT, which is classically linked to the type of alteration in the HGPRT gene. More than 400 mutations of this gene have been found. At present, one of the controversial aspects of the disease is the relationship between the genotype and phenotype; cases have been described lacking a mutation, such as the patient presented in this article, as well as families who despite sharing the same genetic defect show disorders with differing severity. Epigenetic processes, which modify the genetic expression without changing the sequence of the deoxyribonucleic acid (DNA), could explain the clinical variability observed in this disease. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

Relation between uric acid and metabolic syndrome in subjects with cardiometabolic risk

PubMed Central

da Silva, Hellen Abreu; Carraro, Júlia Cristina Cardoso; Bressan, Josefina; Hermsdorff, Helen Hermana Miranda

2015-01-01

Objective To identify possible relations between serum uric acid levels and metabolic syndrome and its components in a population with cardiometabolic risk. Methods This cross-sectional study included 80 subjects (46 women), with mean age of 48±16 years, seen at the Cardiovascular Health Program. Results The prevalence of hyperuricemia and metabolic syndrome was 6.3% and 47.1%, respectively. Uric acid level was significantly higher in individuals with metabolic syndrome (5.1±1.6mg/dL), as compared to those with no syndrome or with pre-syndrome (3.9±1.2 and 4.1±1.3mg/dL, respectively; p<0.05). The uric acid levels were significantly higher in men presenting abdominal obesity, and among women with abdominal obesity, lower HDL-c levels and higher blood pressure (p<0.05). Conclusion Uric acid concentrations were positively related to the occurrence of metabolic syndrome and its components, and there were differences between genders. Our results indicate serum uric acid as a potential biomarker for patients with cardiometabolic risk. PMID:26018145

Complications and total care of a child with acute leukemia.

PubMed

Vietti, T J; Ragab, A H

1975-03-01

The complications which occur in a child with acute leukemia depend on the stage of the disease and the therapeutic regiman. Most children will present with some manifestation of marrow failure. An occasional child will have marked leukocytosis and disturbance of organ function due to massive leukemic infiltrates. Metabolic disturbances such as hyperuricemia and hyperphosphatemia-hypocalcemia may develop, expecially after therapy is initiated. The myelosuppression and immunosuppression due to drug toxicity may result in opportunistic infections. Other toxicities which can occur with a chemotherapeutic regimen are numerois and varied, and the physician must be cognizant of them in order to minimize damage. Therapy to the central nervous system, either for subclinical or clinical disease, has been associated with a variety of symptoms ranging from meningismus to paraplegia and death. To prevent the development of these complications, and to manage them effectively if they occur, the physician must be knowlegeable about their etiology, clinical and laboratory manifestations, and treatment.

Uricase alkaline enzymosomes with enhanced stabilities and anti-hyperuricemia effects induced by favorable microenvironmental changes

PubMed Central

Zhou, Yunli; Zhang, Mi; He, Dan; Hu, Xueyuan; Xiong, Huarong; Wu, Jianyong; Zhu, Biyue; Zhang, Jingqing

2016-01-01

Enzyme therapy is an effective strategy to treat diseases. Three strategies were pursued to provide the favorable microenvironments for uricase (UCU) to eventually improve its features: using the right type of buffer to constitute the liquid media where catalyze reactions take place; entrapping UCU inside the selectively permeable lipid vesicle membranes; and entrapping catalase together with UCU inside the membranes. The nanosized alkaline enzymosomes containing UCU/(UCU and catalase) (ESU/ESUC) in bicine buffer had better thermal, hypothermal, acid-base and proteolytic stabilities, in vitro and in vivo kinetic characteristics, and uric acid lowering effects. The favorable microenvironments were conducive to the establishment of the enzymosomes with superior properties. It was the first time that two therapeutic enzymes were simultaneously entrapped into one enzymosome having the right type of buffer to achieve added treatment efficacy. The development of ESU/ESUC in bicine buffer provides valuable tactics in hypouricemic therapy and enzymosomal application. PMID:26823332

A ketogenic diet reduces metabolic syndrome-induced allodynia and promotes peripheral nerve growth in mice.

PubMed

Cooper, Michael A; Menta, Blaise W; Perez-Sanchez, Consuelo; Jack, Megan M; Khan, Zair W; Ryals, Janelle M; Winter, Michelle; Wright, Douglas E

2018-08-01

Current experiments investigated whether a ketogenic diet impacts neuropathy associated with obesity and prediabetes. Mice challenged with a ketogenic diet were compared to mice fed a high-fat diet or a high-fat diet plus exercise. Additionally, an intervention switching to a ketogenic diet following 8 weeks of high-fat diet was performed to compare how a control diet, exercise, or a ketogenic diet affects metabolic syndrome-induced neural complications. When challenged with a ketogenic diet, mice had reduced bodyweight and fat mass compared to high-fat-fed mice, and were similar to exercised, high-fat-fed mice. High-fat-fed, exercised and ketogenic-fed mice had mildly elevated blood glucose; conversely, ketogenic diet-fed mice were unique in having reduced serum insulin levels. Ketogenic diet-fed mice never developed mechanical allodynia contrary to mice fed a high-fat diet. Ketogenic diet fed mice also had increased epidermal axon density compared all other groups. When a ketogenic diet was used as an intervention, a ketogenic diet was unable to reverse high-fat fed-induced metabolic changes but was able to significantly reverse a high-fat diet-induced mechanical allodynia. As an intervention, a ketogenic diet also increased epidermal axon density. In vitro studies revealed increased neurite outgrowth in sensory neurons from mice fed a ketogenic diet and in neurons from normal diet-fed mice given ketone bodies in the culture medium. These results suggest a ketogenic diet can prevent certain complications of prediabetes and provides significant benefits to peripheral axons and sensory dysfunction. Published by Elsevier Inc.

Diet as a Therapeutic Option for Adult Inflammatory Bowel Disease.

PubMed

Kakodkar, Samir; Mutlu, Ece A

2017-12-01

There are many mechanisms to explain how food may drive and ameliorate inflammation. Although there are no consistent macronutrient associations inflammatory bowel disease (IBD) development, many exclusion diets have been described: IgG-4 guided exclusion diet; semivegetarian diet; low-fat, fiber-limited exclusion diet; Paleolithic diet; Maker's diet; vegan diet; Life without Bread diet; exclusive enteral nutrition (EEN), the Specific Carbohydrate Diet (SCD) and the low FODMAP diet. The literature on diet and IBD is reviewed with a particular focus on EEN, SCD, and low FODMAP diets. Lessons learned from the existing observations and strengths and shortcomings of existing data are presented. Copyright © 2017 Elsevier Inc. All rights reserved.

Diet choice patterns in rodents depend on novelty of the diet, exercise, species, and sex.

PubMed

Yang, Tiffany; Xu, Wei-Jie; York, Haley; Liang, Nu-Chu

2017-07-01

Prolonged consumption of a palatable, high fat (HF) diet paired with a lack of physical activity can exacerbate the development of obesity. Exercise can facilitate the maintenance of a healthy body weight, possibly though mediating changes in diet preference. Using a two-diet choice and wheel running (WR) paradigm, our laboratory previously demonstrated that WR induces HF diet avoidance with different persistency in male and female rats when HF diet and WR are introduced simultaneously. The aims of this study were to examine whether this behavior is species dependent and to what extent the novelty of the diet affects WR induced HF diet avoidance. Experiment 1 utilized male C57BL6 mice in a two-diet choice and WR paradigm. Results show that all mice preferred HF to chow diet regardless of exercise and the order in which exercise and HF diet were presented. Experiment 2A (diet novelty) utilized Sprague-Dawley rats that were first habituated to a 45% HF diet prior to the simultaneous introduction of WR and a novel high-carbohydrate, low-fat (DK) diet. All rats avoided the novel high-carbohydrate diet and neither male nor female wheel running rats exhibited reduction in HF diet intake or HF diet avoidance. After all rats were returned to a sedentary condition, female rats consumed significantly more of the DK diet than the male rats. In Experiment 2B (diet familiarity), rats remained sedentary and were re-habituated to the DK diet until intake stabilized. Subsequently, a 60% HF diet was introduced for all rats and for running rats, access to the running wheels were provided simultaneously. Consistent with our previous findings, HF diet intake and preference was significantly reduced in all wheel running rats. These data suggest that exercise induced HF diet avoidance is affected by species and the novelty of the diet. Copyright © 2017 Elsevier Inc. All rights reserved.

Isoflavone and Protein Constituents of Lactic Acid-Fermented Soy Milk Combine to Prevent Dyslipidemia in Rats Fed a High Cholesterol Diet

PubMed Central

Kobayashi, Maki; Egusa, Shintaro; Fukuda, Mitsuru

2014-01-01

A high cholesterol diet induces dyslipidemia. This study investigated whether isoflavone aglycones in lactic acid-fermented soy milk (LFS) improve lipid metabolism in rats fed a high cholesterol diet. Male Sprague-Dawley rats aged seven weeks were fed an AIN-93G diet, a 1% cholesterol diet (a high cholesterol diet), a high-cholesterol diet containing 4% isoflavone extract of LFS (LFS extract diet), a high-cholesterol diet containing 19.4% ethanol-washed LFS (ethanol-washed LFS diet, isoflavone-poor diet), or a high cholesterol diet containing 23.2% intact LFS (intact LFS diet) for five weeks. The plasma total cholesterol (TC) level was increased in the rats fed the LFS extract diet compared with those fed the high cholesterol diet. The TC level was decreased by the intact LFS and ethanol-washed LFS diets. The cholesterol-lowering effect was stronger in the rats fed the intact LFS diet than those fed the ethanol-washed LFS diet. The plasma triglyceride (TG) level was unchanged in the rats fed the LFS extract diet, but it decreased in rats fed the intact LFS and ethanol-washed LFS diets. Although, compared with the high cholesterol diet, the LFS extract and ethanol-washed LFS diets did not reduce hepatic cholesterol and TG, both levels were remarkably lowered by the intact LFS diet. These results suggest that the improvement in lipid metabolism of rats fed a high-cholesterol diet containing LFS isoflavone aglycones is not due to an independent effect but due to a cooperative effect with soy protein. PMID:25514389

[Analysis of the fatty acid profile of vegetarian and non-vegetarian diet in the context of some diet-related diseases prevention].

PubMed

Kornek, Agata; Kucharska, Alicja; Kamela, Katarzyna

2016-01-01

Research increasingly provide evidence that vegetarian diet can have a positive impact on health. The aim of this study was to analyze the fatty acid profile of vegetarian and non-vegetarian diet and prove which of them is more optimal in the context of some diet-related diseases prevention. The study involved 83 women (47 vegetarians and 36 non-vegetarians). Estimates of the supply of individual fatty acids in the diet was based on analysis of 3-day dietary records (calculations in a computer program DIETA 5). Found: - in vegan diet significantly lower percentage of energy from SFA than in lactoovovegetarian diet and non-vegetarian diet (5,2% vs 11,2% i 11,9%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from PUFA than in non-vegetarian diet (9,2% i 7,8% vs 5,0%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from LA than in non-vegetarian diet (6,7% i 5,5% vs 3,9%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from ALA than in non-vegetarian diet (1,3% i 1,2% vs. 0,8%) - in vegan and lactoovovegetarian diet - significantly lower intake of EPA+DHA than in non-vegetarian diet (0 mg i 15 mg vs 76 mg), - only 25% of non-vegetarian diets fulfilled recommendations on the content of EPA + DHA Conclusions: Vegetarian, particularly vegan, nutrition may promote good balancing of the fatty acids in the diet, except for the long chain polyunsaturated omega-3, which are also deficient in the case of conventional diet.

Ileostomy and your diet

MedlinePlus

... ileostomy - diet; Abdominal pouch - diet; End ileostomy - diet; Ostomy - diet; Inflammatory bowel disease - ileostomy and your diet; ... odor: Eating parsley, yogurt, and buttermilk. Keeping your ostomy devices clean. Using special deodorants or adding vanilla ...

Med Diet 4.0: the Mediterranean diet with four sustainable benefits.

PubMed

Dernini, S; Berry, E M; Serra-Majem, L; La Vecchia, C; Capone, R; Medina, F X; Aranceta-Bartrina, J; Belahsen, R; Burlingame, B; Calabrese, G; Corella, D; Donini, L M; Lairon, D; Meybeck, A; Pekcan, A G; Piscopo, S; Yngve, A; Trichopoulou, A

2017-05-01

To characterize the multiple dimensions and benefits of the Mediterranean diet as a sustainable diet, in order to revitalize this intangible food heritage at the country level; and to develop a multidimensional framework - the Med Diet 4.0 - in which four sustainability benefits of the Mediterranean diet are presented in parallel: major health and nutrition benefits, low environmental impacts and richness in biodiversity, high sociocultural food values, and positive local economic returns. A narrative review was applied at the country level to highlight the multiple sustainable benefits of the Mediterranean diet into a single multidimensional framework: the Med Diet 4.0. Setting/subjects We included studies published in English in peer-reviewed journals that contained data on the characterization of sustainable diets and of the Mediterranean diet. The methodological framework approach was finalized through a series of meetings, workshops and conferences where the framework was presented, discussed and ultimately refined. The Med Diet 4.0 provides a conceptual multidimensional framework to characterize the Mediterranean diet as a sustainable diet model, by applying principles of sustainability to the Mediterranean diet. By providing a broader understanding of the many sustainable benefits of the Mediterranean diet, the Med Diet 4.0 can contribute to the revitalization of the Mediterranean diet by improving its current perception not only as a healthy diet but also a sustainable lifestyle model, with country-specific and culturally appropriate variations. It also takes into account the identity and diversity of food cultures and systems, expressed within the notion of the Mediterranean diet, across the Mediterranean region and in other parts of the world. Further multidisciplinary studies are needed for the assessment of the sustainability of the Mediterranean diet to include these new dimensions.

[Analysis of the fatty acid profile of vegetarian and non-vegetarian diet in the context of some diet-related diseases prevention].

PubMed

Kornek, Agata; Kucharska, Alicja; Kamela, Katarzyna

Research increasingly provide evidence that vegetarian diet can have a positive impact on health. The aim of this study was to analyze the fatty acid profile of vegetarian and non-vegetarian diet and prove which of them is more optimal in the context of some diet-related diseases prevention. The study involved 83 women (47 vegetarians and 36 non-vegetarians). Estimates of the supply of individual fatty acids in the diet was based on analysis of 3-day dietary records (calculations in a computer program DIETA 5). Found: - in vegan diet significantly lower percentage of energy from SFA than in lactoovovegetarian diet and non-vegetarian diet (5,2% vs 11,2% i 11,9%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from PUFA than in non-vegetarian diet (9,2% i 7,8% vs 5,0%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from LA than in non-vegetarian diet (6,7% i 5,5% vs 3,9%), - in vegan and lactoovovegetarian diet - significantly higher percentage of energy from ALA than in non-vegetarian diet (1,3% i 1,2% vs. 0,8%) - in vegan and lactoovovegetarian diet - significantly lower intake of EPA+DHA than in non-vegetarian diet (0 mg i 15 mg vs 76 mg), - only 25% of non-vegetarian diets fulfilled recommendations on the content of EPA + DHA Conclusions: Vegetarian, particularly vegan, nutrition may promote good balancing of the fatty acids in the diet, except for the long chain polyunsaturated omega-3, which are also deficient in the case of conventional diet.

Diet composition exacerbates or attenuates soman toxicity in rats: implied metabolic control of nerve agent toxicity.

PubMed

Myers, Todd M; Langston, Jeffrey L

2011-06-01

To evaluate the role of diet composition on nerve agent toxicity, rats were fed four distinct diets ad libitum for 28 d prior to challenge with 110 μg/kg (1.0 LD(50), sc) soman. The four diets used were a standard rodent diet, a choline-enriched diet, a glucose-enriched diet, and a ketogenic diet. Body weight was recorded throughout the study. Toxic signs and survival were evaluated at key times for up to 72 h following soman exposure. Additionally, acquisition of discriminated shuttlebox avoidance performance was characterized beginning 24h after soman challenge and across the next 8 d (six behavioral sessions). Prior to exposure, body weight was highest in the standard diet group and lowest in the ketogenic diet group. Upon exposure, differences in soman toxicity as a function of diet became apparent within the first hour, with mortality in the glucose-enriched diet group reaching 80% and exceeding all other groups (in which mortality ranged from 0 to 6%). At 72 h after exposure, mortality was 100% in the glucose-enriched diet group, and survival approximated 50% in the standard and choline-enriched diet groups, but equaled 87% in the ketogenic diet group. Body weight loss was significantly reduced in the ketogenic and choline-enriched diet groups, relative to the standard diet group. At 1 and 4h after exposure, rats in the ketogenic diet group had significantly lower toxic sign scores than all other groups. The ketogenic diet group performed significantly better than the standard diet group on two measures of active avoidance performance. The exacerbated soman toxicity observed in the glucose-enriched diet group coupled with the attenuated soman toxicity observed in the ketogenic diet group implicates glucose availability in the toxic effects of soman. This increased glucose availability may enhance acetylcholine synthesis and/or utilization, thereby exacerbating peripheral and central soman toxicity. Published by Elsevier B.V.

Creation and Initial Validation of the International Dysphagia Diet Standardisation Initiative Functional Diet Scale.

PubMed

Steele, Catriona M; Namasivayam-MacDonald, Ashwini M; Guida, Brittany T; Cichero, Julie A; Duivestein, Janice; Hanson, Ben; Lam, Peter; Riquelme, Luis F

2018-05-01

To assess consensual validity, interrater reliability, and criterion validity of the International Dysphagia Diet Standardisation Initiative Functional Diet Scale, a new functional outcome scale intended to capture the severity of oropharyngeal dysphagia, as represented by the degree of diet texture restriction recommended for the patient. Participants assigned International Dysphagia Diet Standardisation Initiative Functional Diet Scale scores to 16 clinical cases. Consensual validity was measured against reference scores determined by an author reference panel. Interrater reliability was measured overall and across quartile subsets of the dataset. Criterion validity was evaluated versus Functional Oral Intake Scale (FOIS) scores assigned by survey respondents to the same case scenarios. Feedback was requested regarding ease and likelihood of use. Web-based survey. Respondents (N=170) from 29 countries. Not applicable. Consensual validity (percent agreement and Kendall τ), criterion validity (Spearman rank correlation), and interrater reliability (Kendall concordance and intraclass coefficients). The International Dysphagia Diet Standardisation Initiative Functional Diet Scale showed strong consensual validity, criterion validity, and interrater reliability. Scenarios involving liquid-only diets, transition from nonoral feeding, or trial diet advances in therapy showed the poorest consensus, indicating a need for clear instructions on how to score these situations. The International Dysphagia Diet Standardisation Initiative Functional Diet Scale showed greater sensitivity than the FOIS to specific changes in diet. Most (>70%) respondents indicated enthusiasm for implementing the International Dysphagia Diet Standardisation Initiative Functional Diet Scale. This initial validation study suggests that the International Dysphagia Diet Standardisation Initiative Functional Diet Scale has strong consensual and criterion validity and can be used reliably by clinicians to capture diet texture restriction and progression in people with dysphagia. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Creation and Initial Validation of the International Dysphagia Diet Standardisation Initiative Functional Diet Scale

PubMed Central

Steele, Catriona M.; Namasivayam-MacDonald, Ashwini M.; Guida, Brittany T.; Cichero, Julie A.; Duivestein, Janice; MRSc; Hanson, Ben; Lam, Peter; Riquelme, Luis F.

2018-01-01

Objective To assess consensual validity, interrater reliability, and criterion validity of the International Dysphagia Diet Standardisation Initiative Functional Diet Scale, a new functional outcome scale intended to capture the severity of oropharyngeal dysphagia, as represented by the degree of diet texture restriction recommended for the patient. Design Participants assigned International Dysphagia Diet Standardisation Initiative Functional Diet Scale scores to 16 clinical cases. Consensual validity was measured against reference scores determined by an author reference panel. Interrater reliability was measured overall and across quartile subsets of the dataset. Criterion validity was evaluated versus Functional Oral Intake Scale (FOIS) scores assigned by survey respondents to the same case scenarios. Feedback was requested regarding ease and likelihood of use. Setting Web-based survey. Participants Respondents (NZ170) from 29 countries. Interventions Not applicable. Main Outcome Measures Consensual validity (percent agreement and Kendall t), criterion validity (Spearman rank correlation), and interrater reliability (Kendall concordance and intraclass coefficients). Results The International Dysphagia Diet Standardisation Initiative Functional Diet Scale showed strong consensual validity, criterion validity, and interrater reliability. Scenarios involving liquid-only diets, transition from nonoral feeding, or trial diet advances in therapy showed the poorest consensus, indicating a need for clear instructions on how to score these situations. The International Dysphagia Diet Standardisation Initiative Functional Diet Scale showed greater sensitivity than the FOIS to specific changes in diet. Most (>70%) respondents indicated enthusiasm for implementing the International Dysphagia Diet Standardisation Initiative Functional Diet Scale. Conclusions This initial validation study suggests that the International Dysphagia Diet Standardisation Initiative Functional Diet Scale has strong consensual and criterion validity and can be used reliably by clinicians to capture diet texture restriction and progression in people with dysphagia. PMID:29428348

Food intake adjustments of chicks: short term reactions to deficiencies in lysine, methionine and tryptophan.

PubMed

Picard, M L; Uzu, G; Dunnington, E A; Siegel, P B

1993-09-01

1. Two experiments were conducted to compare food intake responses of broiler chicks fed diets varying in lysine, methionine, and tryptophan. Diet D was formulated to create simultaneous deficiencies of lysine, methionine, and tryptophan. Diet A matched National Research Council (1984) recommendations for broilers, and diets B and C were, respectively, 2:1 and 1:2 mixes of diets A and D. 2. Short-term food intake can provide information on the sequences of adaptation of chicks to a diet deficient in essential amino acids. 3. Chicks consumed 26% less of diet D than A during the first 24 h posthatch. When chicks fed diet A or D to 7 d of age were then fed one of 4 diets singly, within 24 h intake was lowest for chicks fed diet D. Within 48 h, food intake of diet C was more than that of diet D and less than that of diet A, while for diet B intake was more than of diet D but not different from diet A. 4. In the second experiment, chicks were fed diet A to 8 d and then diets A or D alone or given a choice of diets A and D from 8 to 20 d of age. Within 4 to 8 h, food intake of chicks fed diet D alone decreased markedly followed by partial recovery within 24 h. In a choice setting, consistent preference of Diet A over Diet D was observed within 7 h followed by stabilisation at about 65% diet A to 35% diet D. 5. Chicks fed diet D alone from 8 to 20 d of age, then placed in the same choice situation preferred diet A to D with a delay of less than one h and stabilisation at about 85%. Chicks provided a choice of diets A and D from 8 to 20 d, and then diet D alone reduced their food intake more quickly than those not given a choice initially. 6. Broiler chicks appear to react to amino acid deficiencies within a short period (hours) by adjusting their feed intake and/or selection. The response is influenced by age and prior experience.

Diet-induced thermogenesis is lower in rats fed a lard diet than in those fed a high oleic acid safflower oil diet, a safflower oil diet or a linseed oil diet.

PubMed

Takeuchi, H; Matsuo, T; Tokuyama, K; Shimomura, Y; Suzuki, M

1995-04-01

The objectives of the present study were to examine the effects of dietary fats differing in fatty acid composition on diet-induced thermogenesis, sympathetic activity in brown adipose tissue and body fat accumulation in rats. Rats were meal-fed for 12 wk an isoenergetic diet based on lard, high oleic acid safflower oil, safflower oil or linseed oil, and norepinephrine turnover rates in brown adipose tissue were then estimated. Whole-body oxygen consumption after the meal indicated that diet-induced thermogenesis was significantly lower in rats fed the lard diet than in those fed the other diets. The norepinephrine turnover rate in the interscapular brown adipose tissue was also significantly lower in the lard diet group than in the other diet groups. The carcass fat content was significantly higher in the lard diet group than in the other diet groups, whereas the abdominal adipose tissue weights were the same in all diet groups. These results suggest that the intake of animal fats rich in saturated fatty acids, compared with the intake of vegetable oils rich in monounsaturated or polyunsaturated fatty acids, decreases diet-induced thermogenesis by a decline of sympathetic activity in brown adipose tissue, resulting in the promotion of body fat accumulation.

The role of xanthine oxidoreductase and uric acid in metabolic syndrome.

PubMed

Battelli, Maria Giulia; Bortolotti, Massimo; Polito, Letizia; Bolognesi, Andrea

2018-08-01

Xanthine oxidoreductase (XOR) could contribute to the pathogenesis of metabolic syndrome through the oxidative stress and the inflammatory response induced by XOR-derived reactive oxygen species and uric acid. Hyperuricemia is strongly linked to hypertension, insulin resistance, obesity and hypertriglyceridemia. The serum level of XOR is correlated to triglyceride/high density lipoprotein cholesterol ratio, fasting glycemia, fasting insulinemia and insulin resistance index. Increased activity of endothelium-linked XOR may promote hypertension. In addition, XOR is implicated in pre-adipocyte differentiation and adipogenesis. XOR and uric acid play a role in cell transformation and proliferation as well as in the progression and metastatic process. Collected evidences confirm the contribution of XOR and uric acid in metabolic syndrome. However, in some circumstances XOR and uric acid may have anti-oxidant protective outcomes. The dual-face role of both XOR and uric acid explains the contradictory results obtained with XOR inhibitors and suggests caution in their therapeutic use. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Potassium in diet

MedlinePlus

... the diet; Hypokalemia - potassium in the diet; Chronic kidney disease - potassium in diet; Kidney failure - potassium in diet ... are also excellent sources of potassium. People with kidney problems, especially those on dialysis, should not eat ...

Unexpected Long-Term Protection of Adult Offspring Born to High-Fat Fed Dams against Obesity Induced by a Sucrose-Rich Diet

PubMed Central

Couvreur, Odile; Ferezou, Jacqueline; Gripois, Daniel; Serougne, Colette; Crépin, Delphine; Aubourg, Alain; Gertler, Arieh; Vacher, Claire-Marie; Taouis, Mohammed

2011-01-01

Background Metabolic and endocrine environment during early life is crucial for metabolic imprinting. When dams were fed a high fat diet (HF diet), rat offspring developed hypothalamic leptin resistance with lean phenotype when weaned on a normal diet. Interestingly, when grown on the HF diet, they appeared to be protected against the effects of HF diet as compared to offspring of normally fed dams. The mechanisms involved in the protective effect of maternal HF diet are unclear. Methodology/Principal Findings We thus investigated the impact of maternal high fat diet on offspring subjected to normal or high palatable diet (P diet) on metabolic and endocrine parameters. We compared offspring born to dams fed P or HF diet. Offspring born to dams fed control or P diet, when fed P diet exhibited a higher body weight, altered hypothalamic leptin sensitivity and metabolic parameters suggesting that maternal P diet has no protective effect on offspring. Whereas, maternal HF diet reduces body weight gain and circulating triglycerides, and ameliorates corpulence index of offspring, even when subjected to P diet. Interestingly, this protective effect is differently expressed in male and female offspring. Male offspring exhibited higher energy expenditure as mirrored by increased hypothalamic UCP-2 and liver AdipoR1/R2 expression, and a profound change in the arcuate nucleus astrocytic organization. In female offspring, the most striking impact of maternal HF diet is the reduced hypothalamic expression of NPY and POMC. Conclusions/Significance HF diet given during gestation and lactation protects, at least partially, offspring from excessive weight gain through several mechanisms depending upon gender including changes in arcuate nucleus astrocytic organization and increased hypothalamic UCP-2 and liver AdipoR1/2 expression in males and reduced hypothalamic expression of NPY and POMC in females. Taken together our results reveal new mechanisms involved in the protective effect of maternal HF diet. PMID:21464991

Effects of Diet Restriction and Diet Complexity on Life History Strategies in Side-Blotched Lizards (Uta stansburiana).

PubMed

Skinner, Heather M; Durso, Andrew M; Neuman-Lee, Lorin A; Durham, Susan L; Mueller, Sarah D; French, Susannah S

2016-11-01

Organisms must balance energy invested into self-maintenance, reproduction, and somatic growth over their lifetime. In this study, the effects of diet restriction and diet complexity on side-blotched lizards (Uta stansburiana) were analyzed. Thirty male lizards, housed in the laboratory, were fed either an ad libitum or a restricted diet for 18 days (phase 1). Individuals from both treatments were then assigned to a diet of the same quantity of food that was either simple (only crickets) or complex (crickets, cockroaches, waxworms, and mealworms) for 35 days (phase 2). We evaluated (1) how diet restriction affected life history strategies and (2) how diet complexity affected recovery from diet restriction as measured at the end of phase 2 by body mass, snout-vent length, calculated body condition score, wound healing, tail regrowth, bacterial killing ability, oxidative stress, and plasma testosterone and corticosterone concentrations. Lizards without diet restriction allocated more energy to self-maintenance (i.e., maintaining higher body condition scores, healing wounds more quickly) than lizards with diet restriction. Lizards with diet restriction had higher plasma testosterone concentrations and larger increases in snout-vent lengths than those fed ad libitum, which may reflect allocations toward reproduction and somatic growth. A complex diet resulted in better body condition and faster tail regrowth than a simple diet, suggesting that a complex diet enhanced recovery from diet restriction, although long-term life history choices remained unaltered. Finally, lizards on a complex diet consumed substantially less food while maintaining higher body condition, suggesting that key nutrients may be lacking from a simple diet. © 2017 Wiley Periodicals, Inc.

Comparative Study on the Cellular and Systemic Nutrient Sensing and Intermediary Metabolism after Partial Replacement of Fishmeal by Meat and Bone Meal in the Diet of Turbot (Scophthalmus maximus L.)

PubMed Central

Mai, Kangsen; Zhou, Huihui; Xu, Wei; He, Gen

2016-01-01

This study was designed to examine the cellular and systemic nutrient sensing mechanisms as well as the intermediary metabolism responses in turbot (Scophthalmus maximus L.) fed with fishmeal diet (FM diet), 45% of FM replaced by meat and bone meal diet (MBM diet) or MBM diet supplemented with essential amino acids to match the amino acid profile of FM diet (MBM+AA diet). During the one month feeding trial, feed intake was not affected by the different diets. However, MBM diet caused significant reduction of specific growth rate and nutrient retentions. Compared with the FM diet, MBM diet down-regulated target of rapamycin (TOR) and insulin-like growth factor (IGFs) signaling pathways, whereas up-regulated the amino acid response (AAR) signaling pathway. Moreover, MBM diet significantly decreased glucose and lipid anabolism, while increased muscle protein degradation and lipid catabolism in liver. MBM+AA diet had no effects on improvement of MBM diet deficiencies. Compared with fasted, re-feeding markedly activated the TOR signaling pathway, IGF signaling pathway and glucose, lipid metabolism, while significantly depressed the protein degradation signaling pathway. These results thus provided a comprehensive display of molecular responses and a better explanation of deficiencies generated after fishmeal replacement by other protein sources. PMID:27802317

Effects of hypocaloric diet, low-intensity resistance exercise with slow movement, or both on aortic hemodynamics and muscle mass in obese postmenopausal women.

PubMed

Figueroa, Arturo; Arjmandi, Bahram H; Wong, Alexei; Sanchez-Gonzalez, Marcos Angel; Simonavice, Emily; Daggy, Bruce

2013-09-01

This study aims to examine the independent and combined impact of hypocaloric diet and low-intensity resistance exercise training (LIRET) on aortic hemodynamics and appendicular skeletal muscle mass (ASM) in obese postmenopausal women. Forty-one obese postmenopausal women (mean [SD] age, 54 [1] y) were randomly assigned to LIRET (n = 13), diet (n = 14), or diet + LIRET (n = 14). Body weight, waist circumference, aortic systolic blood pressure, aortic pulse pressure, augmentation index, subendocardial viability ratio (SEVR; myocardial perfusion), and heart rate (HR) were measured before and after 12 weeks. ASM was assessed by dual-energy x-ray absorptiometry. Body weight (P < 0.001) and waist circumference (P < 0.01) decreased similarly after diet and diet + LIRET compared with no changes after LIRET. ASM did not change after diet + LIRET, and the decrease observed after diet (P < 0.001) was significant compared with LIRET. Aortic systolic blood pressure decreased similarly after LIRET (P < 0.05), diet (P < 0.01), and diet + LIRET (P < 0.01). Aortic pulse pressure (P < 0.05) decreased similarly after diet and diet + LIRET, but not after LIRET. SEVR (P < 0.01) increased similarly in both diet groups, whereas HR (P < 0.01) decreased only after diet. Changes in SEVR (P < 0.05) and HR (P< 0.01) with diet were different compared with LIRET. The augmentation index did not change in any group. Our findings suggest that diet-induced weight loss may reduce cardiovascular risk by improving SEVR via HR and aortic pulse pressure reductions in obese postmenopausal women. LIRET prevents ASM loss associated with hypocaloric diet but has no additive effects on aortic hemodynamics.

Comparison of low- and high-carbohydrate diets for type 2 diabetes management: a randomized trial.

PubMed

Tay, Jeannie; Luscombe-Marsh, Natalie D; Thompson, Campbell H; Noakes, Manny; Buckley, Jonathan D; Wittert, Gary A; Yancy, William S; Brinkworth, Grant D

2015-10-01

Few well-controlled studies have comprehensively examined the effects of very-low-carbohydrate diets on type 2 diabetes (T2D). We compared the effects of a very-low-carbohydrate, high-unsaturated fat, low-saturated fat (LC) diet with a high-carbohydrate, low-fat (HC) diet on glycemic control and cardiovascular disease risk factors in T2D after 52 wk. In this randomized controlled trial that was conducted in an outpatient research clinic, 115 obese adults with T2D [mean ± SD age: 58 ± 7 y; body mass index (in kg/m(2)): 34.6 ± 4.3; glycated hemoglobin (HbA1c): 7.3 ± 1.1%; duration of diabetes: 8 ± 6 y] were randomly assigned to consume either a hypocaloric LC diet [14% of energy as carbohydrate (carbohydrate <50 g/d), 28% of energy as protein, and 58% of energy as fat (<10% saturated fat)] or an energy-matched HC diet [53% of energy as carbohydrate, 17% of energy as protein, and 30% of energy as fat (<10% saturated fat)] combined with supervised aerobic and resistance exercise (60 min; 3 d/wk). Outcomes were glycemic control assessed with use of measurements of HbA1c, fasting blood glucose, glycemic variability assessed with use of 48-h continuous glucose monitoring, diabetes medication, weight, blood pressure, and lipids assessed at baseline, 24, and 52 wk. Both groups achieved similar completion rates (LC diet: 71%; HC diet: 65%) and mean (95% CI) reductions in weight [LC diet: -9.8 kg (-11.7, -7.9 kg); HC diet: -10.1 kg (-12.0, -8.2 kg)], blood pressure [LC diet: -7.1 (-10.6, -3.7)/-6.2 (-8.2, -4.1) mm Hg; HC diet: -5.8 (-9.4, -2.2)/-6.4 (-8.4, -4.3) mm Hg], HbA1c [LC diet: -1.0% (-1.2%, -0.7%); HC diet: -1.0% (-1.3%, -0.8%)], fasting glucose [LC diet: -0.7 mmol/L (-1.3, -0.1 mmol/L); HC diet: -1.5 mmol/L (-2.1, -0.8 mmol/L)], and LDL cholesterol [LC diet: -0.1 mmol/L (-0.3, 0.1 mmol/L); HC diet: -0.2 mmol/L (-0.4, 0.03 mmol/L)] (P-diet effect ≥ 0.10). Compared with the HC-diet group, the LC-diet group achieved greater mean (95% CI) reductions in the diabetes medication score [LC diet: -0.5 arbitrary units (-0.7, -0.4 arbitrary units); HC diet: -0.2 arbitrary units (-0.4, -0.06 arbitrary units); P = 0.02], glycemic variability assessed by measuring the continuous overall net glycemic action-1 [LC diet: -0.5 mmol/L (-0.6, -0.3 mmol/L); HC diet: -0.05 mmol/L (-0.2, -0.1 mmol/L); P = 0.003], and triglycerides [LC diet: -0.4 mmol/L (-0.5, -0.2 mmol/L); HC diet: -0.01 mmol/L (-0.2, 0.2 mmol/L); P = 0.001] and greater mean (95% CI) increases in HDL cholesterol [LC diet: 0.1 mmol/L (0.1, 0.2 mmol/L); HC diet: 0.06 mmol/L (-0.01, 0.1 mmol/L); P = 0.002]. Both diets achieved substantial weight loss and reduced HbA1c and fasting glucose. The LC diet, which was high in unsaturated fat and low in saturated fat, achieved greater improvements in the lipid profile, blood glucose stability, and reductions in diabetes medication requirements, suggesting an effective strategy for the optimization of T2D management. This trial was registered at www.anzctr.org.au as ACTRN12612000369820. © 2015 American Society for Nutrition.

Factors associated with choice of a low-fat or low-carbohydrate diet during a behavioral weight loss intervention☆, ☆☆

PubMed Central

McVay, Megan A.; Voils, Corrine I.; Coffman, Cynthia J.; Geiselman, Paula J.; Kolotkin, Ronette L.; Mayer, Stephanie B.; Smith, Valerie A.; Gaillard, Leslie; Turner, Marsha J.; Yancy, William S.

2016-01-01

Individuals undertaking a weight loss effort have a choice among proven dietary approaches. Factors contributing to choice of either a low-fat/low-calorie diet or a low-carbohydrate diet, two of the most studied and popular dietary approaches, are unknown. The current study used data from participants randomized to the ‘choice’ arm of a trial examining whether being able to choose a diet regimen yields higher weight loss than being randomly assigned to a diet. At study entry, participants attended a group session during which they were provided tailored feedback indicating which diet was most consistent with their food preferences using the Geiselman Food Preference Questionnaire (FPQ), information about both diets, and example meals for each diet. One week later, they indicated which diet they chose to follow during the 48-week study, with the option of switching diets after 12 weeks. Of 105 choice arm participants, 44 (42%) chose the low-fat/low-calorie diet and 61 (58%) chose the low-carbohydrate diet. In bivariate analyses, diet choice was not associated with age, race, sex, education, BMI, or diabetes (all p > 0.05). Low-carbohydrate diet choice was associated with baseline higher percent fat intake (p = 0.007), lower percent carbohydrate intake (p = 0.02), and food preferences consistent with a low-carbohydrate diet according to FPQ (p < 0.0001). In a multivariable logistic regression model, only FPQ diet preference was associated with diet choice (p = 0.001). Reported reasons for diet choice were generally similar for those choosing either diet; however, concerns about negative health effects of the unselected diet was rated as more influential among participants selecting the low-fat diet. Only three low-carbohydrate and two low-fat diet participants switched diets at 12 weeks. Results suggest that when provided a choice between two popular weight loss dietary approaches, an individual's selection is likely influenced by baseline dietary intake pattern, and especially by his or her dietary preferences. Research is needed to determine if congruency between food preferences and dietary approach is associated with weight loss. PMID:25149197

Effect of diet on oxidation of 17 beta-estradiol in vivo.

PubMed

Musey, P I; Collins, D C; Bradlow, H L; Gould, K G; Preedy, J R

1987-10-01

The effect of a high fat, low carbohydrate, low protein diet on the in vivo oxidation of 17 beta-estradiol was studied using radiometric methods. Five male chimpanzees were fed a normal (13%) fat diet or a high (65%) fat diet for 8 weeks. After a 4-week rest period, the animals were fed the alternative diet. The mean percent oxidation of 16 alpha-[3H]estradiol-17 beta 24 h after injection was 3.8 +/- 1.3% (+/- SD) on the normal diet vs. 18.4 +/- 4.7% on the high fat diet (P less than 0.01). In contrast, the mean percent oxidation of 2-[3H]estradiol 24 h after injection was 31.6 +/- 3.8% (+/- SD) on the normal diet vs. 20.0 +/- 3.5% on the high fat diet (P less than 0.05). These results suggest that the oxidation of 17 beta-estradiol to estriols relative to that to catechol estrogens is increased by a high fat diet.

Sodium in diet

MedlinePlus

Diet - sodium (salt); Hyponatremia - sodium in diet; Hypernatremia - sodium in diet; Heart failure - sodium in diet ... The body uses sodium to control blood pressure and blood volume. Your body also needs sodium for your muscles and nerves to work ...

The effect of purified compared with nonpurified diet on bone changes induced by hindlimb suspension of female rats

NASA Technical Reports Server (NTRS)

Tou, Janet C L.; Arnaud, Sara B.; Grindeland, Richard; Wade, Charles

2005-01-01

The purpose of this study was to compare the bone changes induced by unloading in rats fed different diets, because space flight studies use a semipurified diet, whereas space flight simulation studies typically use nonpurified diets. Female Sprague-Dawley rats were fed a purified American Institute of Nutrition (AIN) 93G diet or a standard nonpurified diet and kept ambulatory or subjected to unloading by hindlimb suspension (HLS) for 38 days. Bone mineral content (BMC), mechanical strength, and factors related to the diet that affect bone (i.e., urinary calcium excretion, estradiol, and corticosterone) were measured. Average food intakes (grams per day) differed for diets, but caloric intake (kilocalories per day) and the final body masses of treatment groups were similar. The HLS-induced decrease in femoral BMC was not statistically different for rats fed a nonpurified diet (-8.6%) compared with a purified AIN-93G diet (-11.4%). The HLS-induced decrease in femoral mechanical strength was not statistically different for rats fed a nonpurified diet (-24%) compared with a purified AIN-93G diet (-31%). However, bone lengths were decreased (P < 0.05) in rats fed a nonpurified diet compared with a purified diet. Plasma estradiol levels were lower (P < 0.05) in the HLS/AIN-93G group but similar in the HLS and ambulatory rats fed a nonpurified diet. Plasma estradiol was related to femoral BMC (r = 0.85, P < 0.01). Urinary calcium excretion was higher (P < 0.05) in rats fed a nonpurified diet than those fed a purified AIN-93G diet, which is consistent with the higher level of calcium in the nonpurified diet. Urinary corticosterone levels were higher (P < 0.05) in rats fed a nonpurified diet than rats fed the AIN-93G diet. Although the osteopenia induced by unloading was similar in both diet groups, there were differences in longitudinal bone growth, calcium excretion, plasma estradiol levels, and urinary corticosterone levels. Results indicate that the type of standard diet used is an important factor to consider when measuring bone end points.

Psoriasis Diet: Can Changing Your Diet Treat Psoriasis?

MedlinePlus

... my diet treat psoriasis? Answers from Lawrence E. Gibson, M.D. Although there's no special psoriasis diet, ... or rule out this condition. With Lawrence E. Gibson, M.D. Diet and nutrition. National Psoriasis Foundation. ...

DASH Diet: Reducing Hypertension through Diet and Lifestyle

MedlinePlus

... and Cardiovascular Health DASH Diet DASH Diet: Reducing Hypertension through Diet and Lifestyle Reviewed by Taylor Wolfram, ... vkusidey/iStock/Thinkstock Think you can't stop hypertension, or high blood pressure? You might be able ...

Factors associated with choice of a low-fat or low-carbohydrate diet during a behavioral weight loss intervention.

PubMed

McVay, Megan A; Voils, Corrine I; Coffman, Cynthia J; Geiselman, Paula J; Kolotkin, Ronette L; Mayer, Stephanie B; Smith, Valerie A; Gaillard, Leslie; Turner, Marsha J; Yancy, William S

2014-12-01

Individuals undertaking a weight loss effort have a choice among proven dietary approaches. Factors contributing to choice of either a low-fat/low-calorie diet or a low-carbohydrate diet, two of the most studied and popular dietary approaches, are unknown. The current study used data from participants randomized to the 'choice' arm of a trial examining whether being able to choose a diet regimen yields higher weight loss than being randomly assigned to a diet. At study entry, participants attended a group session during which they were provided tailored feedback indicating which diet was most consistent with their food preferences using the Geiselman Food Preference Questionnaire (FPQ), information about both diets, and example meals for each diet. One week later, they indicated which diet they chose to follow during the 48-week study, with the option of switching diets after 12 weeks. Of 105 choice arm participants, 44 (42%) chose the low-fat/low-calorie diet and 61 (58%) chose the low-carbohydrate diet. In bivariate analyses, diet choice was not associated with age, race, sex, education, BMI, or diabetes (all p > 0.05). Low-carbohydrate diet choice was associated with baseline higher percent fat intake (p = 0.007), lower percent carbohydrate intake (p = 0.02), and food preferences consistent with a low-carbohydrate diet according to FPQ (p < 0.0001). In a multivariable logistic regression model, only FPQ diet preference was associated with diet choice (p = 0.001). Reported reasons for diet choice were generally similar for those choosing either diet; however, concerns about negative health effects of the unselected diet was rated as more influential among participants selecting the low-fat diet. Only three low-carbohydrate and two low-fat diet participants switched diets at 12 weeks. Results suggest that when provided a choice between two popular weight loss dietary approaches, an individual's selection is likely influenced by baseline dietary intake pattern, and especially by his or her dietary preferences. Research is needed to determine if congruency between food preferences and dietary approach is associated with weight loss. Published by Elsevier Ltd.

Effect of semolina-jaggery diet on survival and development of Drosophila melanogaster.

PubMed

Chattopadhyay, Debarati; James, Joel; Roy, Debasish; Sen, Soumadeep; Chatterjee, Rishita; Thirumurugan, Kavitha

2015-01-01

Drosophila melanogaster is an ideal model organism for developmental studies. This study tests the potential of semolina-jaggery (SJ) diet as a new formulation for bulk rearing of flies. Semolina and jaggery are organic products obtained from wheat endosperm and cane sugar, respectively. Semolina is a rich source of carbohydrates and protein. Jaggery has a high content of dietary sugars. Moreover, preparation of semolina jaggery diet is cost-effective and easy. Thus, the current study aimed to compare survival and developmental parameters of flies fed the SJ diet to flies fed the standard cornmeal-sugar-yeast (CSY) diet. SJ diet enhanced survival of flies without affecting fecundity; male flies showed increased resistance to starvation. A higher number of flies emerged at F2 and F3 generation when fed the SJ diet than when fed the control CSY diet. SJ diet did not increase fly body weight and lipid percentage. Therefore, SJ diet can be used for bulk rearing of healthy flies at par with the standard cornmeal-sugar-yeast diet.

Wheel running decreases palatable diet preference in Sprague-Dawley rats.

PubMed

Moody, Laura; Liang, Joy; Choi, Pique P; Moran, Timothy H; Liang, Nu-Chu

2015-10-15

Physical activity has beneficial effects on not only improving some disease conditions but also by preventing the development of multiple disorders. Experiments in this study examined the effects of wheel running on intakes of chow and palatable diet e.g. high fat (HF) or high sucrose (HS) diet in male and female Sprague-Dawley rats. Experiment 1 demonstrated that acute wheel running results in robust HF or HS diet avoidance in male rats. Although female rats with running wheel access initially showed complete avoidance of the two palatable diets, the avoidance of the HS diet was transient. Experiment 2 demonstrated that male rats developed decreased HF diet preferences regardless of the order of diet and wheel running access presentation. Running associated changes in HF diet preference in females, on the other hand, depended on the testing schedule. In female rats, simultaneous presentation of the HF diet and running access resulted in transient complete HF diet avoidance whereas running experience prior to HF diet access did not affect the high preference for the HF diet. Ovariectomy in females resulted in HF diet preference patterns that were similar to those in male rats during simultaneous exposure of HF and wheel running access but similar to intact females when running occurred before HF exposure. Overall, the results demonstrated wheel running associated changes in palatable diet preferences that were in part sex dependent. Furthermore, ovarian hormones play a role in some of the sex differences. These data reveal complexity in the mechanisms underlying exercise associated changes in palatable diet preference. Published by Elsevier Inc.

Food & Nutrition: Nourish Your Body

Cancer.gov

Food & Nutrition: Nourish Your Body; food & nutrition; food and nutrition; food and nutrition articles; information about nutrition; health & nutrition; health and nutrition; health and nutrition articles; health and nutrition facts; health nutrition; nutrition and health; nutrition health; nutrition health articles; healthy; a healthy diet; diet healthy; eating healthy; healthy diet; healthy diets; nutrition diet; diet and nutrition; diet and nutrition articles; diet and nutrition article; diet nutrition; nutrition and diet; article on nutrition; article about nutrition; articles on nutrition; facts about nutrition; good nutrition; nutrition article; nutrition articles; healthy tips; eat healthy tips; eating healthy tips; healthy diet tips; healthy eating tip; healthy eating tips; healthy food tips; should eat; reasons why you should eat healthy; why people should eat healthy; why should I eat healthy; why should people eat healthy; why should we eat healthy; why should you eat healthy; why we should eat healthy; why you should eat healthy; healthy diet; a healthy diet; diets healthy eating; eat a healthy diet; eat healthy diet; eating a healthy diet; eating healthy diet; eating healthy diets; healthy diet; way to eat; best way to eat healthy; easy way to eat healthy; easy ways to eat healthy; healthy way of eating; healthy way to eat; healthy ways of eating; healthy ways to eat; ways to eat healthy; benefits; benefits eating healthy; benefits for eating healthy; benefits from eating healthy; benefits of eating healthy; benefits of healthy eating; benefits on eating healthy; benefits to eating healthy; eating healthy benefits; health benefits of eating healthy; eat healthier; eat healthier; eating healthier; healthier eating; healthier ways to eat; how can I eat healthier; how do I eat healthier; how to eat healthier; how to start eating healthier; tips to eat healthier; ways to start eating healthier

Monetary diet cost is positively associated with diet quality and obesity: an analysis of school-aged children in Southwest China.

PubMed

Zhang, Xiao; Gong, Yunhui; Jia, Peng; Zhang, Jieyi; Xue, Hongmei; Quan, Liming; Tian, Guo; Xiong, Jingyuan; Zhang, Lishi; Wang, Yu; Zhang, Lin; Cheng, Guo

2018-06-18

Little is known about the relationships between diet cost, dietary intake and obesity in Chinese populations. This study explored how diet cost was related to diet quality and obesity among school-aged children in Southwest China. Data from a cross-sectional study was analysed. Diet cost was estimated based on dietary intake assessed with 24-h dietary recalls and retail food prices. Diet quality was measured using the Chinese Children Dietary Index. Body height, weight, waist circumference and skinfold thicknesses were measured, and their body mass index standard deviation score (BMISDS), waist-to-height ratio (WHtR), fat mass index (FMI) and fat-free mass index (FFMI) were calculated. Multivariate regression models were used to explore the relevance of diet cost to diet quality and obesity. After adjustment for potential confounders, a positive association was observed between diet quality and energy-adjusted diet cost (β = 0.143, 95% confidence interval, CI: 0.014-0.285, Pfor-trend = 0.0006). Energy-adjusted diet cost also showed a positive association with FMI (β = 0.0354, 95% CI: 0.0001-0.0709, Pfor-trend = 0.01), BMISDS (β = 0.0200, 95% CI: 0.0006-0.0394, Pfor-trend = 0.002) and WHtR (β = 0.0010, 95% CI: 0.0003-0.0017, Pfor-trend = 0.02). Energy-adjusted diet cost was independently and positively associated with diet quality and obesity among Chinese school-aged children.

Effects of a eucaloric reduced-carbohydrate diet on body composition and fat distribution in women with PCOS.

PubMed

Goss, Amy M; Chandler-Laney, Paula C; Ovalle, Fernando; Goree, Laura Lee; Azziz, Ricardo; Desmond, Renee A; Wright Bates, G; Gower, Barbara A

2014-10-01

To determine if consumption of a reduced-carbohydrate (CHO) diet would result in preferential loss of adipose tissue under eucaloric conditions, and whether changes in adiposity were associated with changes in postprandial insulin concentration. In a crossover-diet intervention, 30 women with PCOS consumed a reduced-CHO diet (41:19:40% energy from CHO:protein:fat) for 8 weeks and a standard diet (55:18:27) for 8 weeks. Body composition by DXA and fat distribution by CT were assessed at baseline and following each diet phase. Insulin AUC was obtained from a solid meal test (SMT) during each diet phase. Participants lost 3.7% and 2.2% total fat following the reduced-CHO diet and STD diet, resp. (p<0.05 for difference between diets). The reduced-CHO diet induced a decrease in subcutaneous-abdominal, intra-abdominal, and thigh-intermuscular adipose tissue (-7.1%, -4.6%, and -11.5%, resp.), and the STD diet induced a decrease in total lean mass. Loss of fat mass following the reduced CHO diet arm was associated with lower insulin AUC (p<0.05) during the SMT. In women with PCOS, consumption of a diet lower in CHO resulted in preferential loss of fat mass from metabolically harmful adipose depots, whereas a diet high in CHO appeared to promote repartitioning of lean mass to fat mass. Copyright © 2014 Elsevier Inc. All rights reserved.

Mediterranean Diet and Diabetes: Prevention and Treatment

PubMed Central

Georgoulis, Michael; Kontogianni, Meropi D.; Yiannakouris, Nikos

2014-01-01

The aim of the present review is to examine current scientific knowledge on the association between the Mediterranean diet and diabetes mellitus (mostly type 2 diabetes). A definition of the Mediterranean diet and the tools widely used to evaluate adherence to this traditional diet (Mediterranean diet indices) are briefly presented. The review focuses on epidemiological data linking adherence to the Mediterranean diet with the risk of diabetes development, as well as evidence from interventional studies assessing the effect of the Mediterranean diet on diabetes control and the management of diabetes-related complications. The above mentioned data are explored on the basis of evaluating the Mediterranean diet as a whole dietary pattern, rather than focusing on the effect of its individual components. Possible protective mechanisms of the Mediterranean diet against diabetes are also briefly discussed. PMID:24714352

Effects of cocoa-enriched diet on orofacial pain in a murine model.

PubMed

Bowden, L N; Rohrs, E L; Omoto, K; Durham, P L; Holliday, L S; Morris, A D; Allen, K D; Caudle, R M; Neubert, J K

2017-06-01

To investigate and discuss the effects of cocoa on orofacial pain. The Department of Orthodontics at the University of Florida (UF). Male and female hairless rats (N=20/group) were tested. Rats were tested using the Orofacial Pain Assessment Device (OPAD) before and after changing their food from the standard chow to a cocoa-enriched or control-equivalent diet. Male rats fed the cocoa diet had a significantly higher operant pain index when tested at 37°C as compared to control diet-fed animals. Female rats on the cocoa diet had a significantly higher pain index when tested at 18°C and 44°C, as compared to animals fed the control diet. Capsaicin-induced pain was inhibited, with cocoa-diet male rats having a significantly higher pain index than control-diet male rats and cocoa-diet female rats at both 37°C and 44°C. Cocoa-diet female rats had a significantly higher pain index at 44°C than control-diet females. Mechanical sensitivity was affected following capsaicin cream, with a significantly decreased tolerated bottle distance in both cocoa- and control-diet animals, but there was no difference between cocoa- and control-diet groups. Using the OPAD operant system, we demonstrated that a diet rich in cocoa was effective in inhibiting neurogenic inflammatory pain in rats. This has implications for the use of novel alternative therapies such as diet modification for pain control. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A cellulose fiber-based diet for screwworm (Diptera: Calliphoridae) larvae.

PubMed

Chaudhury, M F; Skoda, S R

2007-02-01

A highly absorbent cellulose fiber from recycled paper was tested and compared with a polyacrylate gelling agent, Aquatain, normally used for bulking and solidifying larval rearing medium of screwworm, Cochliomyia hominivorax (Coquerel) (Diptera: Calliphoridae). The absorbent fiber, when mixed with water and dietary ingredients, produced a diet medium of homogeneous texture that supported larval growth and development comparable with the standard gelled diet. Larval and pupal weights from two concentrations of cellulose fiber-based diet were significantly higher than those obtained using gelled diet. The number of pupae per tray, percentage of adult emergence, oviposition, percentage of egg hatch, and adult longevity obtained from the insects reared in the cellulose fiber-based diet were comparable or slightly better than the biological parameters recorded from flies reared in the gelled diet. Moreover, results indicate that a lesser amount of the cellulose fiber-based diet than the normal amount of gelled diet per tray would support normal larval growth. Physical properties and texture of the new diet seem to allow the larvae to move and feed more freely than they do on the semisolid gelled diet, resulting in less wasted diet. The cellulose fiber is biodegradable and inexpensive, whereas the polyacrylate gel polymer is not biodegradable and is relatively expensive. Replacing gel with cellulose fiber in the screwworm larval diet for mass rearing should result in substantial cost savings in material and labor as well as eliminating concern of environmental pollution due to diet waste disposal.

Monetary Diet Cost, Diet Quality, and Parental Socioeconomic Status in Spanish Youth

PubMed Central

Ribas-Barba, Lourdes; Pérez-Rodrigo, Carmen; Bawaked, Rowaedh Ahmed; Fíto, Montserrat; Serra-Majem, Lluis

2016-01-01

Background Using a food-based analysis, healthy dietary patterns in adults are more expensive than less healthy ones; studies are needed in youth. Therefore, the objective of the present study was to determine relationships between monetary daily diet cost, diet quality, and parental socioeconomic status. Design and Methods Data were obtained from a representative national sample of 3534 children and young people in Spain, aged 2 to 24 years. Dietary assessment was performed with a 24-hour recall. Mediterranean diet adherence was measured by the KIDMED questionnaire. Average food cost was calculated from official Spanish government data. Monetary daily diet cost was expressed as euros per day (€/d) and euros per day standardized to a 1000kcal diet (€/1000kcal/d). Results Mean monetary daily diet cost was 3.16±1.57€/d (1.56±0.72€/1000kcal/d). Socioeconomic status was positively associated with monetary daily diet cost and diet quality measured by the KIDMED index (€/d and €/1000kcal/d, p<0.019). High Mediterranean diet adherence (KIDMED score 8–12) was 0.71 €/d (0.28€/1000kcal/d) more expensive than low compliance (KIDMED score 0–3). Analysis for nonlinear association between the KIDMED index and monetary daily diet cost per1000kcal showed no further cost increases beyond a KIDMED score of 8 (linear p<0.001; nonlinear p = 0.010). Conclusion Higher monetary daily diet cost is associated with healthy eating in Spanish youth. Higher socioeconomic status is a determinant for higher monetary daily diet cost and quality. PMID:27622518

[Influence of non-sodium restricted diet with diuretics on plasma rennin, renal blood flow and in patients with cirrhotic ascites].

PubMed

Zhu, Yin-fang; Gu, Xi-bing; Zhu, Hong-ying; Yang, Xiao-juan; Wang, Dong; Yu, Ping

2013-02-01

To explore influence of sodium restricted diet and non-sodium restricted diet on plasma rennin (PRA), angiotensin II (All), ALD, renal blood flow (RBF) and subside of ascites in patients with cirrhotic ascites. Eighty cases of hepatitis B with cirrhotic ascites were randomly divided into sodium restricted diet group and non-sodium restricted diet group. 39 cases were in non-sodium restricted diet group, taking sodium chloride 6500-8000 mg daily; 41 cases were in sodium restricted diet group, taking sodium chloride 5000 mg daily. Both groups received diuretics furosemide and spironolactone. Blood sodium, urine sodium, PRA, AII, ALD, RBF ascites subsiding were compared after treatment. In non-sodium restricted diet group, blood sodium and urine sodium increased 10 days after treatment compared with those before treatment, and compared with those of sodium restricted diet group 10 days after treatment, P <0. 01. RBF increased compared with that before treatment, and compared with that of sodium restricted diet group 10 days after treatment, P < 0. 01. Renal damage induced by low blood sodium after treatment was less in non-sodium restricted diet group than that in sodium restricted diet group, P <0. 05. Ascites disappearance upon discharge was more in sodium restricted diet group than that in non-sodium restricted diet group, P <0. 01. Time of ascites disappearance was shorter in non-sodium restricted diet group than that in sodium restricted diet group, P < 0. 01. Compared with sodium restricted diet, while using diuretics of both groups, non-sodium restricted diet can increase level of blood sodium, thus increasing excretion of urine sodium and diuretic effect. It can also decrease levels of PRA, AII and ALD, increase renal blood flow and prevent renal damage induced by low blood sodium and facilitate subsiding of ascites.

Performance, carcass characteristics, and ruminal pH of Nellore and Angus young bulls fed a whole shelled corn diet.

PubMed

Carvalho, J R R; Chizzotti, M L; Schoonmaker, J P; Teixeira, P D; Lopes, R C; Oliveira, C V R; Ladeira, M M

2016-06-01

The objectives of this study were to test the interaction of breed (Nellore or Angus) and diet (whole shelled corn [WSC] or ground corn [GC] with silage) on growth performance, carcass characteristics, and ruminal pH of young bulls. Thirty-six bulls (18 Nellore and 18 Angus) with the range in age of 18 to 22 mo and BW of 381 ± 12 kg were used in a completely randomized design experiment with a 2 × 2 factorial arrangement of treatments (2 breeds and 2 diets). Experimental diets (DM basis) included 1) a GC diet containing 30% corn silage and 70% GC- and soybean meal-based concentrate and 2) a WSC diet containing 85% WSC and 15% of a soybean meal- and mineral-based pelleted supplement. An additional 8 bulls were slaughtered at the beginning of the experimental period for determination of initial carcass weight. The treatments were Nellore fed the GC diet, Nellore fed the WSC diet, Angus fed the GC diet, and Angus fed the WSC diet. Greater DMI ( < 0.01), ADG ( < 0.01), and G:F ( < 0.01) were observed in Angus bulls compared with Nellore bulls, regardless of diet. Lower average ruminal pH ( = 0.04), maximum ruminal pH (P = 0.02), and DMI ( < 0.01) were observed in bulls fed the WSC diet than in those fed the GC diet. In addition, bulls fed the WSC diet had greater G:F ( < 0.01). The WSC diet led to greater variation in DMI compared with the GC diet ( < 0.01). Omasum and large intestine percentage was affected by diets only in the Angus breed ( < 0.02) and were greater when bulls were fed the GC diet. The WSC diet without forage may be useful for feedlots because this diet promoted greater G:F than the GC diet, regardless of breed. However, special care must be exercised in feed management during adaptation and throughout the feeding of Nellore animals to avoid digestive disorders and fluctuations in DMI.

Analysis Extract. AFSC 4D0X1 Diet Therapy (Active Duty)

DTIC Science & Technology

2002-07-01

Diet (s) exp-Lacto Vegetarian Active Active Active Active AD AD...3* 87* 22* V0143 Diet (s) exp-Lacto-Ovo Vegetarian Diet Active Active... Diet (s) exp-Ovo Vegetarian Active Active Active Active AD AD

The effects of elemental diet and subsequent food reintroduction on rheumatoid arthritis.

PubMed

Kavanaghi, R; Workman, E; Nash, P; Smith, M; Hazleman, B L; Hunter, J O

1995-03-01

The role of diet in rheumatoid arthritis (RA) remains controversial and there have been no controlled studies on the use of elemental diet in the treatment of RA. Elemental diet is an hypoallergenic protein-free artificial diet consisting of essential amino acids, glucose, trace elements and vitamins. This study was carried out to assess the role of elemental diet and subsequent food reintroduction in RA. Elemental diet (E028) (and a small number of foods) was given to 24 patients with definite RA in order to induce a remission and then foods were gradually introduced. Where a food was suspected of causing symptoms it was removed from the diet. Twenty-three control patients supplemented their usual diet with E028. After the elemental diet there was a statistically significant improvement in the diet group in grip strength (P = 0.008) and Ritchie score (P = 0.006) but not in ESR, CRP, thermographic joint score or functional score. The diet group lost more weight than the control group and this correlated with the improvement in grip strength. This improvement was not present following food reintroduction. As the improvements took place in more subjective disease parameters and because of the difficulties in adequately blinding studies of diet in arthritis, a placebo effect must be considered. There was a high default rate, only 38% of those patients originally enrolled completed the study. In conclusion, this study shows that elemental diet can cause an improvement in a number of disease parameters in RA but this is not sustained by an individualized diet. It also illustrates some of the difficulties involved in the study of diet in arthritis.

Increased serum and testicular androgen levels in F1 rats with lifetime exposure to soy isoflavones.

PubMed

McVey, Mark J; Cooke, Gerard M; Curran, Ivan H A

2004-07-01

The consequences of dietary soy isoflavones on serum and testicular androgen levels were examined in F1 male rats from a multigeneration study investigating the effects of diets varying in isoflavone content. Rats were fed either a soy-free casein based diet (AIN93G) or a diet in which alcohol-washed soy protein replaced casein as the protein source and to which increasing amounts of Novasoy, a commercially available isoflavone supplement were added. Analysis of these diets showed that the isoflavone content in each diet was 0 (diet 1; casein based control), 31.7 (diet 2; alcohol-washed soy-based diet control), 36.1 (diet 3), 74.5 (diet 4), 235.6 (diet 5) and 1046.6 (diet 6) mg total isoflavones/kg pelleted diet. The levels of isoflavones in diet 1 would represent a daily intake level of 0 mg isoflavones, diets 2 and 3 estimate a low soy-containing human diet (e.g. North American), diet 4 would correspond to Asian diets (e.g. Japanese) or adult humans taking isoflavone supplements, diet 5 approximates the isoflavone intake by babies fed soy based infant formula and diet 6 approximates fivefold the intake levels by babies or 10-fold the intake levels of adults consuming high isoflavone containing diets. Serum testosterone (T) from F1 male rats sacrificed on postnatal days (PND) 28, 70, 120, 240 and 360 were low at PND 28 (0.4 ng/ml), increased approximately five to sixfold at PND 70 (2.5-3.0 ng/ml) and thereafter declined to a steady state level of approximately 1 ng/ml by PND 120. However, rats on diets 5 and 6 demonstrated altered serum testosterone profiles such that at days 120, testosterone levels remained significantly elevated at approximately 3 ng/ml (P < 0.05). Serum dihydrotestosterone levels exhibited similar profiles and the levels in PND 120 rats on diet 5 or 6 were also significantly elevated (two to threefold, P < 0.05). The intra-testicular testosterone concentration in rats on diet 5 was also elevated at PND 120 compared with diet 1 (P < 0.05). These findings show that F1 male rats continuously exposed to a mixture of dietary soy isoflavones from conception onwards exhibit altered serum and testicular androgen profiles.

Influences of stearidonic acid-enriched soybean oil on the blood and organ biochemical parameters in rats.

PubMed

Kawabata, Terue; Shimoda, Kazumi; Horiguchi, Sayaka; Domon, Marina; Hagiwara, Chie; Takiyama, Miho; Kagawa, Yasuo

2013-02-01

In this study, we administered various diets of stearidonic acid (SDA, 18:4n-3) soybean oil to rats and examined the subsequent blood and organ biochemical parameters. Male Wistar rats (seven rats/group, six groups total) were fed diets supplemented with a test oil for 4 weeks. Diets containing test oils were: FFC diet (fish-oil-free control diet), C diet (control group, assuming a Japanese diet), SDA25 diet (25% 18:4n-3 soybean oil in the C diet), SDA50 (50% 18:4n-3 soybean oil in the C diet), ALA diet (34% flaxseed oil in the C diet), and EPA+DHA diet (34% fish oil in the C diet). The intake of 18:4n-3 showed increased relative efficiency of 20:5n-3 accretions in serum and liver triacylglycerol and significantly decreased the serum triacylglycerol level in rats. The results suggested that the consumption of 18:4n-3 soybean oil may modify the lipid and fatty acid profiles of body fats, even when EPA and DHA derived from fish is consumed. Copyright © 2012 Elsevier Ltd. All rights reserved.

Switching from high-fat to low-fat diet normalizes glucose metabolism and improves glucose-stimulated insulin secretion and insulin sensitivity but not body weight in C57BL/6J mice.

PubMed

Agardh, Carl-David; Ahrén, Bo

2012-03-01

Environmental factors such as a high-fat diet contribute to type 2 diabetes and obesity. This study examined glycemia, insulin sensitivity, and β-cell function after switching from a high-fat diet to a low-fat diet in mice. C57BL/6J mice were fed a high-fat diet or low-fat diet for 18 months, after which mice on the high-fat diet either maintained this diet or switched to a low-fat diet for 4 weeks. Body weight and glucose and insulin responses to intraperitoneal glucose were determined. Insulin secretion (insulinogenic index: the 10-minute insulin response divided by the 10-minute glucose level) and insulin sensitivity (1 divided by basal insulin) were determined. After 18 months on a high-fat diet, mice had glucose intolerance, marked hyperinsulinemia, and increased body weight compared to mice on a low-fat diet (P < 0.001). Switching from a high-fat diet to low-fat diet normalized glucose tolerance, reduced but not normalized body weight (P < 0.001), increased insulin secretion (248 ± 39 vs 141 ± 46 pmol/mmol; P = 0.028) and improved but not normalized insulin sensitivity (3.2 ± 0.1 vs 1.0 ± 0.1 [pmol/L]; P = 0.012). Switching from a high-fat diet to low-fat diet normalizes glucose tolerance and improves but not normalizes insulin secretion and insulin sensitivity. These effects are more pronounced than the reduced body weight.

Efficiency of two larval diets for mass-rearing of the mosquito Aedes aegypti

PubMed Central

Bond, J. G.; Ramírez-Osorio, A.; Marina, C. F.; Fernández-Salas, I.; Liedo, P.; Dor, A.

2017-01-01

Aedes aegypti is a major vector of arboviruses that may be controlled on an area-wide basis using the sterile insect technique (SIT). Larval diet is a major factor in mass-rearing for SIT programs. We compared dietary effects on immature development and adult fitness-related characteristics for an International Atomic Energy Agency (IAEA) diet, developed for rearing Ae. albopictus, and a standardized laboratory rodent diet (LRD), under a 14:10 h (light:dark) photoperiod ("light" treatment) or continuous darkness during larval rearing. Larval development was generally fastest in the IAEA diet, likely reflecting the high protein and lipid content of this diet. The proportion of larvae that survived to pupation or to adult emergence did not differ significantly between diets or light treatments. Insects from the LRD-dark treatment produced the highest proportion of male pupae (93% at 24 h after the beginning of pupation) whereas adult sex ratio from the IAEA diet tended to be more male-biased than that of the LRD diet. Adult longevity did not differ significantly with larval diet or light conditions, irrespective of sex. In other aspects the LRD diet generally performed best. Adult males from the LRD diet were significantly larger than those from the IAEA diet, irrespective of light treatment. Females from the LRD diet had ~25% higher fecundity and ~8% higher egg fertility compared to those from the IAEA diet. Adult flight ability did not differ between larval diets, and males had a similar number of copulations with wild females, irrespective of larval diet. The LRD diet had lower protein and fat content but a higher carbohydrate and energetic content than the IAEA diet. We conclude that the LRD diet is a low-cost standardized diet that is likely to be suitable for mass-rearing of Ae. aegypti for area-wide SIT-based vector control. PMID:29095933

Effect of semolina-jaggery diet on survival and development of Drosophila melanogaster

PubMed Central

Chattopadhyay, Debarati; James, Joel; Roy, Debasish; Sen, Soumadeep; Chatterjee, Rishita; Thirumurugan, Kavitha

2015-01-01

Drosophila melanogaster is an ideal model organism for developmental studies. This study tests the potential of semolina-jaggery (SJ) diet as a new formulation for bulk rearing of flies. Semolina and jaggery are organic products obtained from wheat endosperm and cane sugar, respectively. Semolina is a rich source of carbohydrates and protein. Jaggery has a high content of dietary sugars. Moreover, preparation of semolina jaggery diet is cost-effective and easy. Thus, the current study aimed to compare survival and developmental parameters of flies fed the SJ diet to flies fed the standard cornmeal-sugar-yeast (CSY) diet. SJ diet enhanced survival of flies without affecting fecundity; male flies showed increased resistance to starvation. A higher number of flies emerged at F2 and F3 generation when fed the SJ diet than when fed the control CSY diet. SJ diet did not increase fly body weight and lipid percentage. Therefore, SJ diet can be used for bulk rearing of healthy flies at par with the standard cornmeal-sugar-yeast diet. PMID:26252611

Dietary patterns among a national random sample of British adults

PubMed Central

Pryer, J; Nichols, R; Elliott, P; Thakrar, B; Brunner, E; Marmot, M

2001-01-01

STUDY OBJECTIVES—To identify groups within the UK male and female population who report similar patterns of diet.
DESIGN—National representative dietary survey, using seven day weighed dietary records, of men and women aged 16-64 years living in private households in Great Britain in 1986-7. Cluster analysis was used to aggregate participants into diet groups.
SETTING—Great Britain.
PARTICIPANTS—1087 men and 1110 women.
RESULTS—93% of men and 86% of women fell into one of four distinct diet groups. Among men the most prevalent diet group was "beer and convenience food" (34% of the male population); second was "traditional British diet" (18%); third was "healthier but sweet diet" (17.5%) and fourth was "healthier diet " (17%). Among women, the most prevalent diet group was " traditional British diet" (32%); second, was "healthy cosmopolitan diet" (25%); third was a "convenience food diet" (21%); and fourth was "healthier but sweet diet" (15%). There were important differences in nutrient profile, sociodemographic and behavioural characteristics between diet groups.
CONCLUSIONS—Cluster analysis identified four diet groups among men and four among women, which differed not only in terms of reported dietary intakes, but also with respect to nutrient, social and behavioural profiles. The groups identified could provide a useful basis for development, monitoring and targeting of public health nutrition policy in the UK.


Keywords: diet; cluster analysis; sociodemographic variables PMID:11112948

Selection of diet for culture of juvenile silver pomfret, Pampus argenteus

NASA Astrophysics Data System (ADS)

Peng, Shiming; Shi, Zhaohong; Yin, Fei; Sun, Peng; Wang, Jiangang

2012-03-01

Juvenile silver pomfret, Pampus argenteus, was grown in culture tanks for 9 weeks on four different diets, and their effects on fish growth, digestive enzyme activity, and body composition were assessed. The feeding regime was as follows: Diet 1: fish meat; Diet 2: fish meat+artificial feed; Diet 3: fish meat+artificial feed+Agamaki clam meat; Diet 4: fish meat+artificial feed+Agamaki clam+copepods. The greatest weight gain was associated with Diet 4, while the lowest weight gain was associated with Diet 1. No significant difference was observed in weight gain between fish receiving Diet 2 and Diet 3. Specific growth rate followed similar trends as weight gain. The feed conversion ratio (FCR) of fish fed Diet 1 was significantly higher than the other fish groups, but no significant differences were observed in FCRs of fish fed Diet 2, Diet 3 or Diet 4. There was also no significant difference in the hepatosomatic index (HSI) between the four diets. For fish that received Diets 2-4, containing artificial feed, higher protease activities were detected. A higher lipid content of the experimental diets also significantly increased lipase activities and body lipid content. No significant differences in amylase activity or body protein content were found between Diets 1-4. In conclusion, a variety of food components, including copepods and artificial feed, in the diet of silver pomfret significantly increased digestive enzyme activity and could improve growth performance.

Individual diet has sex-dependent effects on vertebrate gut microbiota.

PubMed

Bolnick, Daniel I; Snowberg, Lisa K; Hirsch, Philipp E; Lauber, Christian L; Org, Elin; Parks, Brian; Lusis, Aldons J; Knight, Rob; Caporaso, J Gregory; Svanbäck, Richard

2014-07-29

Vertebrates harbour diverse communities of symbiotic gut microbes. Host diet is known to alter microbiota composition, implying that dietary treatments might alleviate diseases arising from altered microbial composition ('dysbiosis'). However, it remains unclear whether diet effects are general or depend on host genotype. Here we show that gut microbiota composition depends on interactions between host diet and sex within populations of wild and laboratory fish, laboratory mice and humans. Within each of two natural fish populations (threespine stickleback and Eurasian perch), among-individual diet variation is correlated with individual differences in gut microbiota. However, these diet-microbiota associations are sex dependent. We document similar sex-specific diet-microbiota correlations in humans. Experimental diet manipulations in laboratory stickleback and mice confirmed that diet affects microbiota differently in males versus females. The prevalence of such genotype by environment (sex by diet) interactions implies that therapies to treat dysbiosis might have sex-specific effects.

Consumption of a low-carbohydrate and high-fat diet (the ketogenic diet) exaggerates biotin deficiency in mice.

PubMed

Yuasa, Masahiro; Matsui, Tomoyoshi; Ando, Saori; Ishii, Yoshie; Sawamura, Hiromi; Ebara, Shuhei; Watanabe, Toshiaki

2013-10-01

Biotin is a water-soluble vitamin that acts as a cofactor for several carboxylases. The ketogenic diet, a low-carbohydrate, high-fat diet, is used to treat drug-resistant epilepsy and promote weight loss. In Japan, the infant version of the ketogenic diet is known as the "ketone formula." However, as the special infant formulas used in Japan, including the ketone formula, do not contain sufficient amounts of biotin, biotin deficiency can develop in infants who consume the ketone formula. Therefore, the aim of this study was to evaluate the effects of the ketogenic diet on biotin status in mice. Male mice (N = 32) were divided into the following groups: control diet group, biotin-deficient (BD) diet group, ketogenic control diet group, and ketogenic biotin-deficient (KBD) diet group. Eight mice were used in each group. At 9 wk, the typical symptoms of biotin deficiency such as hair loss and dermatitis had only developed in the KBD diet group. The total protein expression level of biotin-dependent carboxylases and the total tissue biotin content were significantly decreased in the KBD and BD diet groups. However, these changes were more severe in the KBD diet group. These findings demonstrated that the ketogenic diet increases biotin bioavailability and consumption, and hence, promotes energy production by gluconeogenesis and branched-chain amino acid metabolism, which results in exaggerated biotin deficiency in biotin-deficient mice. Therefore, biotin supplementation is important for mice that consume the ketogenic diet. It is suggested that individuals that consume the ketogenic diet have an increased biotin requirement. Copyright © 2013 Elsevier Inc. All rights reserved.

A high dietary intake of sodium glutamate as flavoring (ajinomoto) causes gross changes in retinal morphology and function.

PubMed

Ohguro, Hiroshi; Katsushima, Harumi; Maruyama, Ikuyo; Maeda, Tadao; Yanagihashi, Satsuki; Metoki, Tomomi; Nakazawa, Mitsuru

2002-09-01

The purpose of this study was to investigate the effects of glutamate accumulation in vitreous on retinal structure and function, due to a diet high in sodium glutamate. Three different diet groups were created, consisting of rats fed on a regular diet (diet A), a moderate excess of sodium glutamate diet (diet B) and a large excess of sodium glutamate diet (diet C). After 1, 3 and 6 months of the administration of these diets, amino acids concentrations in vitreous were analyzed. In addition, retinal morphology and function by electroretinogram (ERG) of three different diet groups were studied. Significant accumulation of glutamate in vitreous was observed in rats following addition of sodium glutamate to the diet as compared to levels with a regular diet. In the retinal morphology, thickness of retinal neuronal layers was remarkably thinner in rats fed on sodium glutamate diets than in those on a regular diet. TdT-dUTP terminal nick-end labelling (TUNEL) staining revealed significant accumulation of the positive staining cells within the retinal ganglion cell layers in retinas from diets B and C as compared with that from diet A. Similar to this, immunohistochemistry demonstrated increased expression of glial fibrillary acidic protein (GFAP) within the retinal inner layers from diets B and C as compared with diet A. Functionally, ERG responses were reduced in rats fed on a sodium glutamate diets as compared with those on a regular diet. The present study suggests that a diet with excess sodium glutamate over a period of several years may increase glutamate concentrations in vitreous and may cause retinal cell destruction.

Betaine alleviates hepatic lipid accumulation via enhancing hepatic lipid export and fatty acid oxidation in rats fed with a high-fat diet.

PubMed

Xu, Li; Huang, Danping; Hu, Qiaolin; Wu, Jing; Wang, Yizhen; Feng, Jie

2015-06-28

To assess the effects of betaine on hepatic lipid accumulation and investigate the underlying mechanism, thirty-two male Sprague-Dawley rats weighing 100 (sd 2·50) g were divided into four groups, and started on one of four treatments: basal diet, basal diet with betaine administration, high-fat diet and high-fat diet with betaine administration. The results showed that no significant difference of body weight was found among experimental groups. Compared with high-fat diet-fed rats, a betaine supplementation decreased (P< 0·05) hepatic TAG accumulation induced by high-fat diet, which was also supported by hepatic histology results. Additionally, hepatic betaine-homocysteine methyltransferase concentration [corrected] as well as its mRNA abundance and lecithin level were found increased (P< 0·05) by betaine supplementation in both basal diet-fed rats and high-fat diet-fed rats. Betaine administration in high-fat diet-fed rats exhibited a higher (P< 0·05) concentration [corrected] of hepatic carnitine palmitoyltransferase 1 (CPT1) compared with high-fat diet-fed rats. High-fat diet inhibited (P< 0·05) the gene expression of hepatic PPARα and CPT1. However, betaine administration in high-fat diet-fed rats elevated (P< 0·05) the gene expression of PPARα and CPT1. Moreover, concentration, gene and protein expressions of hepatic fibroblast growth factor 21 (FGF21) were increased (P< 0·05) in response to betaine administration in high-fat diet group; meanwhile the gene expression of hepatic AMP-activated protein kinase was increased (P< 0·05) as well. The results suggest that betaine administration enhanced hepatic lipid export and fatty acid oxidation in high-fat diet-fed rats, thus effectively alleviating fat accumulation in the liver.

Measuring diet cost at the individual level: a comparison of three methods.

PubMed

Monsivais, P; Perrigue, M M; Adams, S L; Drewnowski, A

2013-11-01

Household-level food spending data are not suitable for population-based studies of the economics of nutrition. This study compared three methods of deriving diet cost at the individual level. Adult men and women (n=164) completed 4-day diet diaries and a food frequency questionnaire (FFQ). Food expenditures over 4 weeks and supermarket prices for 384 foods were obtained. Diet costs (US$/day) were estimated using: (1) diet diaries and expenditures; (2) diet diaries and supermarket prices; and (3) FFQs and supermarket prices. Agreement between the three methods was assessed on the basis of Pearson correlations and limits of agreement. Income-related differences in diet costs were estimated using general linear models. Diet diaries yielded mean (s.d.) diet costs of $10.04 (4.27) based on Method 1 and $8.28 (2.32) based on Method 2. FFQs yielded mean diet costs of $7.66 (2.72) based on Method 3. Correlations between energy intakes and costs were highest for Method 3 (r(2)=0.66), lower for Method 2 (r(2)=0.24) and lowest for Method 1 (r(2)=0.06). Cost estimates were significantly associated with household incomes. The weak association between food expenditures and food intake using Method 1 makes it least suitable for diet and health research. However, merging supermarket food prices with standard dietary assessment tools can provide estimates of individual diet cost that are more closely associated with food consumed. The derivation of individual diet cost can provide insights into some of the economic determinants of food choice, diet quality and health.

Effect of Weight Loss, Exercise, or Both on Undercarboxylated Osteocalcin and Insulin Secretion in Frail, Obese Older Adults.

PubMed

Colleluori, Georgia; Napoli, Nicola; Phadnis, Uma; Armamento-Villareal, Reina; Villareal, Dennis T

2017-01-01

Obesity exacerbates age-related decline in glucometabolic control. Undercarboxylated osteocalcin (UcOC) regulates pancreatic insulin secretion. The long-term effect of lifestyle interventions on UcOC and insulin secretion has not been investigated. One hundred seven frail, obese older adults were randomized into the control ( N = 27), diet ( N = 26), exercise ( N = 26), and diet-exercise ( N = 28) groups for 1 year. Main outcomes included changes in UcOC and disposition index (DI). UcOC increased in the diet group (36 ± 11.6%) but not in the other groups ( P < 0.05 between groups). Although similar increases in DI occurred in the diet-exercise and diet groups at 6 months, DI increased more in the diet-exercise group (92.4 ± 11.4%) than in the diet group (61.9 ± 15.3%) at 12 months ( P < 0.05). UcOC and body composition changes predicted DI variation in the diet group only ( R 2 = 0.712), while adipocytokines and physical function changes contributed to DI variation in both the diet (∆ R 2 = 0.140 and 0.107) and diet-exercise (∆ R 2 = 0.427 and 0.243) groups ( P < 0.05 for all). Diet, but not exercise or both, increases UcOC, whereas both diet and diet-exercise increase DI. UcOC accounts for DI variation only during active weight loss, while adipocytokines and physical function contribute to diet-exercise-induced DI variation, highlighting different mechanisms for lifestyle-induced improvements in insulin secretion. This trial was registered with ClinicalTrials.gov number NCT00146107.

Monetary Diet Cost, Diet Quality, and Parental Socioeconomic Status in Spanish Youth.

PubMed

Schröder, Helmut; Gomez, Santiago F; Ribas-Barba, Lourdes; Pérez-Rodrigo, Carmen; Bawaked, Rowaedh Ahmed; Fíto, Montserrat; Serra-Majem, Lluis

2016-01-01

Using a food-based analysis, healthy dietary patterns in adults are more expensive than less healthy ones; studies are needed in youth. Therefore, the objective of the present study was to determine relationships between monetary daily diet cost, diet quality, and parental socioeconomic status. Data were obtained from a representative national sample of 3534 children and young people in Spain, aged 2 to 24 years. Dietary assessment was performed with a 24-hour recall. Mediterranean diet adherence was measured by the KIDMED questionnaire. Average food cost was calculated from official Spanish government data. Monetary daily diet cost was expressed as euros per day (€/d) and euros per day standardized to a 1000kcal diet (€/1000kcal/d). Mean monetary daily diet cost was 3.16±1.57€/d (1.56±0.72€/1000kcal/d). Socioeconomic status was positively associated with monetary daily diet cost and diet quality measured by the KIDMED index (€/d and €/1000kcal/d, p<0.019). High Mediterranean diet adherence (KIDMED score 8-12) was 0.71 €/d (0.28€/1000kcal/d) more expensive than low compliance (KIDMED score 0-3). Analysis for nonlinear association between the KIDMED index and monetary daily diet cost per1000kcal showed no further cost increases beyond a KIDMED score of 8 (linear p<0.001; nonlinear p = 0.010). Higher monetary daily diet cost is associated with healthy eating in Spanish youth. Higher socioeconomic status is a determinant for higher monetary daily diet cost and quality.

Low folate and selenium in the mouse maternal diet alters liver gene expression patterns in the offspring after weaning.

PubMed

Barnett, Matthew P G; Bermingham, Emma N; Young, Wayne; Bassett, Shalome A; Hesketh, John E; Maciel-Dominguez, Anabel; McNabb, Warren C; Roy, Nicole C

2015-05-08

During pregnancy, selenium (Se) and folate requirements increase, with deficiencies linked to neural tube defects (folate) and DNA oxidation (Se). This study investigated the effect of a high-fat diet either supplemented with (diet H), or marginally deficient in (diet L), Se and folate. Pregnant female mice and their male offspring were assigned to one of four treatments: diet H during gestation, lactation and post-weaning; diet L during gestation, lactation and post-weaning; diet H during gestation and lactation but diet L fed to offspring post-weaning; or diet L during gestation and lactation followed by diet H fed to offspring post-weaning. Microarray and pathway analyses were performed using RNA from colon and liver of 12-week-old male offspring. Gene set enrichment analysis of liver gene expression showed that diet L affected several pathways including regulation of translation (protein biosynthesis), methyl group metabolism, and fatty acid metabolism; this effect was stronger when the diet was fed to mothers, rather than to offspring. No significant differences in individual gene expression were observed in colon but there were significant differences in cell cycle control pathways. In conclusion, a maternal low Se/folate diet during gestation and lactation has more effects on gene expression in offspring than the same diet fed to offspring post-weaning; low Se and folate in utero and during lactation thus has persistent metabolic effects in the offspring.

Effects of diet-deprivation and physical stimulation on the feeding behaviour of the larvae of the silkworm, Bombyx mori.

PubMed

Nagata, Shinji; Nagasawa, Hiromichi

2006-08-01

Continuous observations of larvae of the silkworm, Bombyx mori, revealed that feeding occurred at regular intervals throughout larval development. To investigate possible factors influencing meal-timing, the behaviours of diet-deprived Bombyx larvae were also analysed. Diet-deprivation resulted in longer durations of the first meals after diet replacement, but did not affect feeding patterns. Furthermore, long-term diet-deprivation promoted wandering behaviour and a consequent delay in feeding after diet replacement. Under diet-deprivation conditions, meal-starts appeared to be inducible by defecation and physical stimulation. However, stimulation-induced meal-starts were dependent on the time elapsed since the larvae's previous meals. Provided that more than 1h had elapsed since their previous meals, larvae could be induced to feed by defecation and tapping. At less than 1h post-meal, larvae were less likely to begin feeding after defecation or physical stimulation. Activated locomotions such as wandering and feeding were observed in the long-term diet-deprived larvae only after diet blocks were replaced, while long-term diet-deprived larvae did not show activated locomotion during the absence of diet blocks. Collectively, these data suggest that a combination of elevated locomotion activity and the presence of diet may be necessary for the initiation of feeding in diet-deprived larvae.

Wheel running decreases palatable diet preference in Sprague-Dawley rats

PubMed Central

Moody, Laura; Liang, Joy; Choi, Pique P.; Moran, Timothy H.; Liang, Nu-Chu

2015-01-01

Physical activity has beneficial effects on not only improving some disease conditions but also by preventing the development of multiple disorders. Experiments in this study examined the effects of wheel running on intakes of chow and palatable diet e.g. high fat (HF) or high sucrose (HS) diet in male and female Sprague Dawley rats. Experiment 1 demonstrated that acute wheel running results in robust HF or HS diet avoidance in male rats. Although female rats with running wheel access initially showed complete avoidance of the two palatable diets, the avoidance of the HS diet was transient. Experiment 2 demonstrated that male rats developed decreased HF diet preferences regardless of the order of diet and wheel running access presentation. Running associated changes in HF diet preference in females, on the other hand, depended on the testing schedule. In female rats, simultaneous presentation of the HF diet and running access resulted in transient complete HF diet avoidance whereas running experience prior to HF diet access did not affect the high preference for the HF diet. Ovariectomy in females resulted in HF diet preference patterns that were similar to those in male rats during simultaneous exposure of HF and wheel running access but similar to intact females when running occurred before HF exposure. Overall, the results demonstrated wheel running associated changes in palatable diet preferences that were in part sex dependent. Furthermore, ovarian hormones play a role in some of the sex differences. These data reveal complexity in the mechanisms underlying exercise associated changes in palatable diet preference. PMID:25791204

A low-carbohydrate, ketogenic diet versus a low-fat diet to treat obesity and hyperlipidemia: a randomized, controlled trial.

PubMed

Yancy, William S; Olsen, Maren K; Guyton, John R; Bakst, Ronna P; Westman, Eric C

2004-05-18

Low-carbohydrate diets remain popular despite a paucity of scientific evidence on their effectiveness. To compare the effects of a low-carbohydrate, ketogenic diet program with those of a low-fat, low-cholesterol, reduced-calorie diet. Randomized, controlled trial. Outpatient research clinic. 120 overweight, hyperlipidemic volunteers from the community. Low-carbohydrate diet (initially, <20 g of carbohydrate daily) plus nutritional supplementation, exercise recommendation, and group meetings, or low-fat diet (<30% energy from fat, <300 mg of cholesterol daily, and deficit of 500 to 1000 kcal/d) plus exercise recommendation and group meetings. Body weight, body composition, fasting serum lipid levels, and tolerability. A greater proportion of the low-carbohydrate diet group than the low-fat diet group completed the study (76% vs. 57%; P = 0.02). At 24 weeks, weight loss was greater in the low-carbohydrate diet group than in the low-fat diet group (mean change, -12.9% vs. -6.7%; P < 0.001). Patients in both groups lost substantially more fat mass (change, -9.4 kg with the low-carbohydrate diet vs. -4.8 kg with the low-fat diet) than fat-free mass (change, -3.3 kg vs. -2.4 kg, respectively). Compared with recipients of the low-fat diet, recipients of the low-carbohydrate diet had greater decreases in serum triglyceride levels (change, -0.84 mmol/L vs. -0.31 mmol/L [-74.2 mg/dL vs. -27.9 mg/dL]; P = 0.004) and greater increases in high-density lipoprotein cholesterol levels (0.14 mmol/L vs. -0.04 mmol/L [5.5 mg/dL vs. -1.6 mg/dL]; P < 0.001). Changes in low-density lipoprotein cholesterol level did not differ statistically (0.04 mmol/L [1.6 mg/dL] with the low-carbohydrate diet and -0.19 mmol/L [-7.4 mg/dL] with the low-fat diet; P = 0.2). Minor adverse effects were more frequent in the low-carbohydrate diet group. We could not definitively distinguish effects of the low-carbohydrate diet and those of the nutritional supplements provided only to that group. In addition, participants were healthy and were followed for only 24 weeks. These factors limit the generalizability of the study results. Compared with a low-fat diet, a low-carbohydrate diet program had better participant retention and greater weight loss. During active weight loss, serum triglyceride levels decreased more and high-density lipoprotein cholesterol level increased more with the low-carbohydrate diet than with the low-fat diet.

Diet quality of breast cancer survivors after a six-month weight management intervention: Improvements and association with weight loss

PubMed Central

Christifano, Danielle N.; Fazzino, Tera L.; Sullivan, Debra A.; Befort, Christie A.

2016-01-01

Purpose Obesity and diet quality are two distinct lifestyle factors associated with morbidity and mortality among breast cancer survivors. The purpose of this study was to examine diet quality changes during a weight loss intervention among breast cancer survivors, and whether diet quality change was an important factor related to weight loss. Methods Participants were overweight/obese breast cancer survivors (n=180) participating in a weight loss intervention. Diet quality scores were calculated using the Healthy Eating Index-2010. Paired sample t-tests were run to examine change in diet quality, and a latent difference model was constructed to examine whether change in diet quality was associated with weight change. Results Participants significantly improved diet quality (p=.001) and lost 13.2%± 5.8% (mean± SD) of their weight (p=.001). Six month HEI score was significantly associated with weight loss, controlling for baseline BMI (p=.003). Improvement in diet quality was also significantly associated with weight loss (p=.01). Conclusion Our findings indicate that a weight loss intervention can result in both clinically significant weight loss and improvement in diet quality, and that improved diet quality is predictive of weight loss. Both weight loss and diet quality are implicated in longevity and quality of life for breast cancer survivors. PMID:27635676

The effects of a high-animal- and a high-vegetable-protein diet on mineral balance and bowel function of young men.

PubMed

Van Dokkum, W; Wesstra, A; Luyken, R; Hermus, R J

1986-09-01

1. Twelve young men were given for periods of 20 d, each of three mixed diets, namely a low-protein (LP) diet (9% total energy as protein, 67% of animal origin), a high-animal-protein (HA) diet (16% total energy as protein, 67% of animal origin) and a high-vegetable-protein (HV) diet (16% total energy as protein, 67% of vegetable origin). Retention of calcium, magnesium, iron, zinc and copper as well as various bowel function indices were investigated during each dietary period. 2. Neither the HA diet nor the HV diet changed the retention of the minerals considerably. Only Fe balance decreased significantly on the HV diet. 3. Substituting the HV diet for the HA diet resulted in significant increases in faecal wet weight (17 g/d), defaecation frequency (0.12 stools/d), faecal volatile fatty acids (2.6 mmol/d) and a decrease in faecal bile acids (128 mumol/d). 4. It is concluded that a HV diet, rather than a HA diet is to be recommended with respect to bowel function, whereas the HV diet does not necessarily have a significant influence on mineral retention.

Mechanisms by Which Dehydration May Lead to Chronic Kidney Disease.

PubMed

Roncal-Jimenez, C; Lanaspa, M A; Jensen, T; Sanchez-Lozada, L G; Johnson, R J

2015-01-01

Dehydration, a condition that characterizes excessive loss of body water, is well known to be associated with acute renal dysfunction; however, it has largely been considered reversible and to be associated with no long-term effects on the kidney. Recently, an epidemic of chronic kidney disease has emerged in Central America in which the major risk factor seems to be recurrent heat-associated dehydration. This has led to studies investigating whether recurrent dehydration may lead to permanent kidney damage. Three major potential mechanisms have been identified, including the effects of vasopressin on the kidney, the activation of the aldose reductase-fructokinase pathway, and the effects of chronic hyperuricemia. The discovery of these pathways has also led to the recognition that mild dehydration may be a risk factor in progression of all types of chronic kidney diseases. Furthermore, there is some evidence that increasing hydration, particularly with water, may actually prevent CKD. Thus, a whole new area of investigation is developing that focuses on the role of water and osmolarity and their influence on kidney function and health. © 2015 S. Karger AG, Basel.

Genomewide scan for gout in taiwanese aborigines reveals linkage to chromosome 4q25.

PubMed

Cheng, Li Shu-Chuan; Chiang, Shang-Lun; Tu, Hung-Pin; Chang, Shun-Jen; Wang, Tsu-Nai; Ko, Allen Min-Jen; Chakraborty, Ranajit; Ko, Ying-Chin

2004-09-01

Gout is a disorder of uric-acid metabolism. The Pacific Austronesian population, including Taiwanese aborigines, has a remarkably high prevalence of hyperuricemia and gout, which suggests a founder effect across the Pacific region. We report here a genomewide linkage study of 21 multiplex pedigrees with gout from an aboriginal tribe in Taiwan. From observations of familial clustering, early onset of gout, and clinically severe manifestations, we hypothesized that a major gene plays a role in this trait. Using 382 random polymorphic markers spread across 22 autosomes, we demonstrated a highly significant linkage for gout at marker D4S2623 on chromosome 4q25 (P=.0002 by nonparametric linkage [the NPL(all) statistic]; empirical P=.0006; LOD=4.3, P=4.4x10-6 by logistic regression). When alcohol consumption was included as a covariate in the model, the LOD score increased to 5.66 (P=1.3x10-6). Quantitative traits, including serum uric acid and creatinine, also showed a moderate linkage to this region. To our knowledge, this is the first genome-scan report to identify a genetic locus harboring a gout-susceptibility gene.

The anti-hyperuricemic effect of epigallocatechin-3-gallate (EGCG) on hyperuricemic mice.

PubMed

Zhu, Chuang; Xu, Yan; Liu, Zeng-Hui; Wan, Xiao-Chun; Li, Da-Xiang; Tai, Ling-Ling

2018-01-01

Epigallocatechin-3-gallate (EGCG), a major constituent of green tea catechin, has been used for antioxidant. This study aimed to evaluate the antihyperuricemic activity of EGCG on hyperuricemic mice. We demonstrated that serum uric acid (UA) level was decreased significantly with dose-dependence by EGCG treated with 10, 20, and 50mg/kg. Compared with the model, data on blood urea nitrogen (BUN) supported that there was significance with high dose of EGCG (50mg/kg). Levels of serum creatinine (Cr) in each EGCG-treated group were decreased but not significant; the activities of hepatic xanthine oxidase (XOD) and adenosine deaminase (ADA) in high dose groups' EGCG were notably lower than those of model group. EGCG could downregulate the renal mRNA expression levels of glucose transporter 9 (GLUT9) and urate transporter 1 (URAT1) on hyperuricemic mice. These results presented that EGCG had obvious hypouricemic and renal protective effects on hyperuricemic mice. Our data may have a potential value in clinical practice in the treatment of hyperuricemia. Copyright © 2017. Published by Elsevier Masson SAS.

Measuring diet cost at the individual level: a comparison of three methods

PubMed Central

Monsivais, P; Perrigue, M M; Adams, S L; Drewnowski, A

2013-01-01

Background/objectives: Household-level food spending data are not suitable for population-based studies of the economics of nutrition. This study compared three methods of deriving diet cost at the individual level. Subjects/methods: Adult men and women (n=164) completed 4-day diet diaries and a food frequency questionnaire (FFQ). Food expenditures over 4 weeks and supermarket prices for 384 foods were obtained. Diet costs (US$/day) were estimated using: (1) diet diaries and expenditures; (2) diet diaries and supermarket prices; and (3) FFQs and supermarket prices. Agreement between the three methods was assessed on the basis of Pearson correlations and limits of agreement. Income-related differences in diet costs were estimated using general linear models. Results: Diet diaries yielded mean (s.d.) diet costs of $10.04 (4.27) based on Method 1 and $8.28 (2.32) based on Method 2. FFQs yielded mean diet costs of $7.66 (2.72) based on Method 3. Correlations between energy intakes and costs were highest for Method 3 (r2=0.66), lower for Method 2 (r2=0.24) and lowest for Method 1 (r2=0.06). Cost estimates were significantly associated with household incomes. Conclusion: The weak association between food expenditures and food intake using Method 1 makes it least suitable for diet and health research. However, merging supermarket food prices with standard dietary assessment tools can provide estimates of individual diet cost that are more closely associated with food consumed. The derivation of individual diet cost can provide insights into some of the economic determinants of food choice, diet quality and health. PMID:24045791

Greenhouse gas emissions of self-selected diets in the UK and their association with diet quality: is energy under-reporting a problem?

PubMed

Murakami, Kentaro; Livingstone, M Barbara E

2018-02-21

While the admittedly limited number of epidemiological findings on the association between diet-related greenhouse gas emissions (GHGE) and diet quality are not always consistent, potential influence of bias in the estimation of diet-related GHGE caused by misreporting of energy intake (EI) has not been investigated. This cross-sectional study evaluated diet-related GHGE in the UK and their association with diet quality, taking account of EI under-reporting. Dietary data used were from the National Diet and Nutrition Survey rolling programme 2008/2009-2013/2014, in which 4-day food diaries were collected from 3502 adults aged ≥19 years. Diet-related GHGE were estimated based on 133 food groups, using GHGE values from various secondary sources. Diet quality was assessed by the healthy diet indicator (HDI), Mediterranean diet score (MDS) and Dietary Approaches to Stop Hypertension (DASH) score. EI misreporting was assessed as reported EI divided by estimated energy requirement (EI:EER). Mean value of daily GHGE was 5.7 kg carbon dioxide equivalents (CO 2 eq), which is consistent with those reported from a number of national representative samples in other European countries. Mean EI:EER was 0.74. Assuming that all the dietary variables were misreported in proportion to the misreporting of EI, the mean value of the misreporting-adjusted diet-related GHGE was 8.2 kg CO 2 eq/d. In the entire population, after adjustment for potential confounders (i.e., age, sex, ethnicity, socioeconomic classification, smoking status and physical activity), diet-related GHGE were inversely associated with HDI and DASH score but not with MDS. However, with further adjustment for EI:EER, diet-related GHGE showed inverse associations with all three measures of diet quality. Similar associations were observed when only under-reporters (EI:EER < 0.70; n = 1578) were analysed. Conversely, in the analysis including only plausible reporters (EI:EER 0.70-1.43; n = 1895), diet-related GHGE showed inverse associations with all diet quality measures irrespective of adjustment. With taking account of EI under-reporting, this study showed inverse associations between diet-related GHGE and diet quality not only in the entire sample but also in the separate analyses of plausible reporters and under-reporters, as well as potential underreporting of diet-related GHGE.

Effects of individual and combined dietary weight loss and exercise interventions in postmenopausal women on adiponectin and leptin levels

PubMed Central

Abbenhardt, Clare; McTiernan, Anne; Alfano, Catherine M.; Wener, Mark H.; Campbell, Kristin L.; Duggan, Catherine; Foster-Schubert, Karen E.; Kong, Angela; Toriola, Adetunji T; Potter, John D.; Mason, Caitlin; Xiao, Liren; Blackburn, George L.; Bain, Carolyn; Ulrich, Cornelia M.

2013-01-01

Background Excess body weight and a sedentary lifestyle are associated with the development of several diseases, including cardiovascular disease, diabetes, and cancer in women. One proposed mechanism linking obesity to chronic diseases is an alteration in adipose-derived adiponectin and leptin levels. We investigated the effects of 12-month reduced calorie, weight loss and exercise interventions on adiponectin and leptin concentrations. Methods Overweight/obese postmenopausal women (n=439) were randomized as follows: 1) a reduced calorie, weight loss diet (diet; N=118); 2) moderate-to-vigorous intensity aerobic exercise (exercise; N=117); 3) a combination of a reduced calorie, weight loss diet and moderate-to-vigorous intensity aerobic exercise (diet+exercise; N=117); or 4) control (N=87). The reduced calorie diet had a 10% weight loss goal. The exercise intervention consisted of 45 minutes of moderate-to-vigorous aerobic activity 5 days/week. Adiponectin and leptin levels were measured at baseline and after 12 months of intervention using a radioimmunoassay. Results Adiponectin increased by 9.5 % in the diet group and 6.6 % in the diet+exercise group (both p≤0.0001 vs. control). Compared with controls, leptin decreased with all interventions (diet+exercise, −40.1%, p<0.0001; diet, −27.1%, p<0.0001; exercise, −12.7%, p=0.005). The results were not influenced by the baseline body mass index (BMI). The degree of weight loss was inversely associated with concentrations of adiponectin (diet, p-trend=0.0002; diet+exercise, p-trend=0.0005) and directly associated with leptin (diet, p-trend<0.0001; diet+exercise, p-trend<0.0001). Conclusion Weight loss through diet or diet+exercise increased adiponectin concentrations. Leptin concentrations decreased in all of the intervention groups, but the greatest reduction occurred with diet+exercise. Weight loss and exercise exerted some beneficial effects on chronic diseases via effects on adiponectin and leptin. PMID:23432360

Comparison of the Effects of the 1975 Japanese Diet and the Modern Mediterranean Diet on Lipid Metabolism in Mice.

PubMed

Mizowaki, Yui; Sugawara, Saeko; Yamamoto, Kazushi; Sakamoto, Yu; Iwagaki, Yui; Kawakami, Yuki; Igarashi, Miki; Tsuduki, Tsuyoshi

2017-01-01

The Japanese diet and the Mediterranean diet are both known to be good for health, but there had been no direct comparison of their health benefits. In this study, we compared the 1975 Japanese diet, which has been found to have high health benefits, with the 2010 Italian diet, which contributes to the longest life expectancy in Mediterranean countries. Diets were created using one-week menus of the two diets based on FAOSTAT Food Balance Sheets. The diets were prepared, freeze-dried, powdered and fed to mice for 4 weeks to examine their effects on lipid metabolism. In mice fed the Japanese diet, the visceral fat weight was lower, adipocytes were smaller, the liver weight was lower and liver TG tended to be lower than those fed the Italian diet, and little lipid accumulation was observed in hepatocytes of mice fed the Japanese diet. In addition, in mice fed the Japanese diet, the expression levels of genes related to fatty acid synthesis were lower, whereas those of genes related to catabolism of fatty acids and cholesterol were higher than those fed the Italian diet. Therefore, the Japanese diet reduced accumulation of lipids in the white adipose tissue and liver by suppressing fatty acid synthesis and promoting catabolism of fatty acids and cholesterol in the liver, compared to the Italian diet.

Patient Workload Profile: National Naval Medical Center (NNMC), Bethesda, MD.

DTIC Science & Technology

1980-06-01

Diets Sucrose-Fructose Elimination Diet Medium-Chain Triglyceride (MCT) Barium Enema Preparation Diet Ketogenic Diet 125 mg Calcium Test Diet ...Traditional Ketogenic Diet 150 gm and 300 gm Carbohydrate Sodium Restricted Diets Test Diets Sodium Restricted, Calorie Restricted Fat Free Test Diet Diets 100...Rations Served - NNMC, Bethesda 89 7-2 Regular and Therapeutic Diets - NNMC, Bethesda 91 7-3 Regular and Therapeutic Rations Served

Effect of Weight Loss, Exercise, or Both on Undercarboxylated Osteocalcin and Insulin Secretion in Frail, Obese Older Adults

PubMed Central

Napoli, Nicola; Phadnis, Uma; Armamento-Villareal, Reina

2017-01-01

Background Obesity exacerbates age-related decline in glucometabolic control. Undercarboxylated osteocalcin (UcOC) regulates pancreatic insulin secretion. The long-term effect of lifestyle interventions on UcOC and insulin secretion has not been investigated. Methods One hundred seven frail, obese older adults were randomized into the control (N = 27), diet (N = 26), exercise (N = 26), and diet-exercise (N = 28) groups for 1 year. Main outcomes included changes in UcOC and disposition index (DI). Results UcOC increased in the diet group (36 ± 11.6%) but not in the other groups (P < 0.05 between groups). Although similar increases in DI occurred in the diet-exercise and diet groups at 6 months, DI increased more in the diet-exercise group (92.4 ± 11.4%) than in the diet group (61.9 ± 15.3%) at 12 months (P < 0.05). UcOC and body composition changes predicted DI variation in the diet group only (R2 = 0.712), while adipocytokines and physical function changes contributed to DI variation in both the diet (∆R2 = 0.140 and 0.107) and diet-exercise (∆R2 = 0.427 and 0.243) groups (P < 0.05 for all). Conclusions Diet, but not exercise or both, increases UcOC, whereas both diet and diet-exercise increase DI. UcOC accounts for DI variation only during active weight loss, while adipocytokines and physical function contribute to diet-exercise-induced DI variation, highlighting different mechanisms for lifestyle-induced improvements in insulin secretion. This trial was registered with ClinicalTrials.gov number NCT00146107. PMID:28951766

High-nitrate vegetable diet increases plasma nitrate and nitrite concentrations and reduces blood pressure in healthy women.

PubMed

Ashworth, Ann; Mitchell, Klaus; Blackwell, Jamie R; Vanhatalo, Anni; Jones, Andrew M

2015-10-01

Epidemiological studies suggest that green leafy vegetables, which are high in dietary nitrate, are protective against CVD such as stroke. High blood pressure (BP) is a major risk factor for stroke and inorganic nitrate has been shown to reduce BP. The objective of the present study was to test the hypothesis that diets containing high-nitrate (HN) vegetables would increase plasma nitrate and nitrite concentrations and reduce BP in healthy women. A randomized, crossover trial, where participants received HN vegetables (HN diet) or avoided HN vegetables (Control diet) for 1 week. Before and after each intervention, resting BP and plasma nitrate and nitrite concentrations were measured. University of Exeter, UK. Nineteen healthy women (mean age 20 (sd 2) years; mean BMI 22·5 (sd 3·8) kg/m2). The HN diet significantly increased plasma nitrate concentration (before HN diet: mean 24·4 (sd 5·6) µmol/l; after HN diet: mean 61·0 (sd 44·1) µmol/l, P<0·05) and plasma nitrite concentration (before HN diet: mean 98 (sd 91) nmol/l; after HN diet: mean 185 (sd 34) nmol/l, P<0·05). No significant change in plasma nitrate or nitrite concentration was observed after the Control diet. The HN diet significantly reduced resting systolic BP (before HN diet: mean 107 (sd 9) mmHg; after HN diet: mean 103 (sd 6) mmHg, P<0·05). No significant change in systolic BP was observed after the Control diet (before Control diet: mean 106 (sd 8) mmHg; after Control diet: mean 106 (sd 8) mmHg). Consumption of HN vegetables significantly increased plasma nitrate and nitrite concentrations and reduced BP in normotensive women.

Food nitrogen footprint reductions related to a balanced Japanese diet.

PubMed

Oita, Azusa; Nagano, Ichiro; Matsuda, Hiroyuki

2018-04-01

Dietary choices largely affect human-induced reactive nitrogen accumulation in the environment and resultant environmental problems. A nitrogen footprint (NF) is an indicator of how an individual's consumption patterns impact nitrogen pollution. Here, we examined the impact of changes in the Japanese diet from 1961 to 2011 and the effect of alternative diets (the recommended protein diet, a pescetarian diet, a low-NF food diet, and a balanced Japanese diet) on the food NF. The annual per capita Japanese food NF has increased by 55% as a result of dietary changes since 1961. The 1975 Japanese diet, a balanced omnivorous diet that reportedly delays senescence, with a protein content similar to the current level, reduced the current food NF (15.2 kg N) to 12.6 kg N, which is comparable to the level in the recommended protein diet (12.3 kg N). These findings will help consumers make dietary choices to reduce their impacts on nitrogen pollution.

Management of symptomatic cholelithiasis while on ketogenic diet: a case report.

PubMed

Desai, Amita A; Thompson, Lindsey M; Abdelmoity, Ahmed T; Kayyali, Husam; St Peter, Shawn D

2014-09-01

The ketogenic diet is a treatment modality used for patients with refractory epilepsy. Development of cholelithiasis while on the ketogenic diet is a potential side effect that has been described in the literature. There however have not been any reports on the outcomes of continuing the diet after cholecystectomy. We present a 5-year-old boy with history of pharmacologically intractable epilepsy that was well controlled on the ketogenic diet. He underwent laparoscopic cholecystectomy for the development of symptomatic cholelithiasis 12 months after the initiation of ketogenic diet for seizure control. Patient tolerated the surgery well and was able to continue the ketogenic diet postoperatively. There have been no reports describing the continuation of ketogenic diet after cholecystectomy. This child demonstrates the safety of the procedure and the ability to continue the ketogenic diet without further biliary or surgical complications. Copyright © 2014 Elsevier Inc. All rights reserved.

Nutritional recovery with a soybean diet impaired the glucagon response but did not alter liver gluconeogenesis in the adult offspring of rats deprived of protein during pregnancy and lactation.

PubMed

Pacheco, Nelma Cristina Silva; de Almeida, Ana Paula Carli; de Siqueira, Kariny Cássia; de Lima, Faena Moura; Reis, Silvia Regina de Lima; Latorraca, Marcia Queiroz; Stoppiglia, Luiz Fabrizio

2018-06-22

Nutritional recovery of early malnutrition with soybean diet reduces liver glycogen stores in the fed state and produces liver insulin resistance. We investigated whether nutritional recovery on a soybean flour diet alters hepatic gluconeogenesis in the adult offspring of rats deprived of protein during pregnancy and lactation. Male rats from mothers that were fed either 17% (C) or 6% (L) protein during pregnancy and lactation were maintained on a 17% casein (CC, n=16 and LC, n=17), 17% soybean flour (CS, n=10 and LS, n=10) or 6% casein (LL, n=10) diet after weaning. The soybean diet reduced basal serum glucose (soybean diet=5.6±0.6 mmol/L vs casein diet= 6.2±0.6 mmol/L; p<0.05), but increased alanine aminotransferase mRNA/GAPDH (soybean diet =0.062 ±0.038 vs casein diet= 0.024 ±0.011; p<0.01) and phosphoenolpyruvate carboxykinase mRNA/GAPDH (soybean diet =1.53 ±0.52 vs casein diet= 0.95 ±0.43; p<0.05), and the glycerokinase protein content (soybean diet =0.86 ±0.08 vs casein diet= 0.75 ±0.11; p<0.05). The serum glucose concentration (recovered groups=5.6±0.5mmol/L vs control groups=6.2±0.7mmol/L, p<0.05) and pophosphoenolpyruvate carboxykinase activity (recovered groups=2.8±0.6μU/mg vs control groups=3.6±0.6μU/mg; p<0.05) were decreased in rats subjected to protein restriction in early life. The glucose area under the curve during the pyruvate tolerance test did not differ among the groups, whereas glucose area under the curve after glucagon infusion was reduced by early malnutrition (recovered groups=4210±572mg/dL.40min vs control groups=4493±688mg/dL.40min; p<0.001), and by the soybean diet (soybean diet= 3995±500mg/dL.40min vs casein diet=4686±576 mg/dL.40min, p<0.05). Thus, soybean diet impaired the response to glucagon, but did not alter gluconeogenesis.

PROP Nontaster Women Lose More Weight Following a Low-Carbohydrate Versus a Low-Fat Diet in a Randomized Controlled Trial.

PubMed

Burgess, Brenda; Raynor, Hollie A; Tepper, Beverly J

2017-10-01

Taste blindness to 6-n-propylthiouracil (PROP) associates with increased fat preference and intake. No studies have matched a diet to a woman's PROP phenotype to improve weight loss. This study investigated (1) whether PROP nontaster (NT) women would lose more weight following a low-carbohydrate (LC) diet than a low-fat (LF) diet, and (2) whether PROP supertaster (ST) women would lose more weight following a LF diet than a LC diet. One hundred seven women (BMI = 34.8 ± 0.5 kg/m 2 ), classified as PROP NTs (n = 47) and STs (n = 60), were randomized to a LC or LF diet within a 6-month lifestyle intervention. Assessments included 4-day dietary recalls and biobehavioral and psychosocial questionnaires. At 6 months, NTs lost more weight following the LC than the LF diet (-8.5 ± 0.5 kg vs. -6.6 ± 0.5 kg, P = 0.008); there was no difference between STs following either diet (-8.8 ± 0.4 vs. -8.9 ± 0.5, P = 0.35). Dietary self-reports were unrelated to weight loss, and prescription of a LC diet associated with greater self-efficacy. NT women lost more weight following the LC diet compared to the LF diet. Screening for PROP phenotype may help personalize diet therapy for NT women to optimize their short-term weight loss. © 2017 The Authors. Obesity published by Wiley Periodicals, Inc. on behalf of The Obesity Society (TOS).

Efficacy of and patient compliance with a ketogenic diet in adults with intractable epilepsy: a meta-analysis.

PubMed

Ye, Fang; Li, Xiao-Jia; Jiang, Wan-Lin; Sun, Hong-Bin; Liu, Jie

2015-01-01

Despite the successful use of a ketogenic diet in pediatric epilepsy, its application in adults has been limited. The aim of this meta-analysis was to summarize the findings of relevant published studies in order to identify the efficacy of and compliance with a ketogenic diet and its main subtypes (i.e., classic ketogenic diet and modified Atkins diet) in adults with intractable epilepsy, and to provide useful information for clinical practice. Electronic searches of PubMed, EMBASE, Google Scholar, and the ISI Web of Science were conducted to identify studies of the efficacy of and patient compliance with a ketogenic diet in adults with intractable epilepsy; the included studies were reviewed. Meta-analyses were performed using STATA to determine combined efficacy rates and combined rates of compliance with the ketogenic diet and its main subtypes. In total, 12 studies qualified for inclusion, and data from 270 patients were evaluated.The results of the meta-analysis revealed combined efficacy rates of all types of ketogenic diet, a classical ketogenic diet, and a modified Atkins diet were 42%, 52%, and 34%, respectively; the corresponding combined compliance rates were 45%, 38%, and 56%. The results indicate that a ketogenic diet is a promising complementary therapy in adult intractable epilepsy, and that while a classical ketogenic diet may be more effective, adult patients are likely to be less compliant with it than with a modified Atkins diet.

Effect of long-term administration of dietary fiber on the exocrine pancreas in the rat.

PubMed

Sommer, H; Kasper, H

1984-08-01

Male Sprague-Dawley rats (50--70g) were fed a standard laboratory diet containing 6% dietary fiber substances (diet I), the same diet supplemented with 5% guar (diet II), 10% wheat bran (diet III), or 5% pectin of high (76%) methylic esterification (diet IV), or a fiber-free diet (diet V). After a 6-week feeding period, the body weight of the animals had increased to 300--350g. The common bile duct was then canulated and the exocrine pancreatic function tested under urethane anesthesia (1.5 g/kg body weight). The tested fiber substances had no effect on the basal pancreatic secretion of volume, bicarbonate, lipase, amylase or protein, or on the wet weight and histological appearance of the organ. However, the fiber substances influenced the pancreatic response to maximal exogenous stimulation with secretin (3.0 CU/100 g X hour) and cholecystokinin (0.6 IDU/100 g X hour) and the enzyme content of the gland significantly. Compared with diet V, diet I increased the DNA content of the pancreas and its secretion of bicarbonate and protein, and decreased the protein concentration in the gland. Diet II reduced the pancreatic content of trypsinogen and protein. Diet III decreased the protein content, but increased the bicarbonate secretion, which was also increased by diet IV. -- We conclude that fiber substances influence stimulated secretion and the enzyme content of the pancrease to a varying degree.

A case of tophaceous gout in the lumbar spine: a review of the literature and treatment recommendations.

PubMed

Jegapragasan, Mithulan; Calniquer, Alejandro; Hwang, William D; Nguyen, Quynh T; Child, Zachary

2014-04-01

Study Design Case report. Objective The objective of this study is to report the occurrence of tophaceous gout in the lumbar spine. Methods Using a case report to illustrate the key points of gout in the spine, we provide a brief review of gout in the literature as it relates to its orthopedic and spinal manifestations as well as guidelines for management. Results This case report details the occurrence of a large and clinically significant finding of tophaceous gout in the lumbar spine in a 24-year-old man with a known history of gout and a 3-year history of progressive back pain. Conclusion A high index of suspicion can assist in diagnosis of patients presenting with back pain or neurologic findings with a history of gout. A previous history of gout (especially the presence of tophi), hyperuricemia, and the radiological characteristics presented here should aid the clinician in making the diagnosis of spinal gout. Early diagnosis has the potential to prevent the need for surgical intervention.

Identification of the free phenolic profile of Adlay bran by UPLC-QTOF-MS/MS and inhibitory mechanisms of phenolic acids against xanthine oxidase.

PubMed

Lin, Lianzhu; Yang, Qingyun; Zhao, Kun; Zhao, Mouming

2018-07-01

Adlay bran free phenolic extract has been previously demonstrated to possess potent xanthine oxidase (XOD) inhibitory activity. The aims of this study were to characterize the free phenolic profile of adlay bran and investigate the structure-activity relationship, underlying mechanism and interaction of phenolic acids as XOD inhibitors. A total of twenty phenolics including ten phenolic acids, two coumarins, two phenolic aldedhyes and six flavonoids were identified in a phenolic compound-guided separation by UPLC-QTOF-MS/MS. Adlay bran free phenolic extract possessed strong XOD inhibitory activity related to hydroxycinnamic acids with methoxyl groups. The hydrogen bonding and hydrophobic interactions were the main forces in the binding of adlay phenolics to XOD. Sinapic acid, identified in adlay bran for the first time, possessed strong XOD inhibitory activity in a mixed non-competitive manner, and synergistic effects with other adlay phenolic acids at low concentrations, and would be a promising agent for preventing and treating hyperuricemia. Copyright © 2018. Published by Elsevier Ltd.

[Effectiveness of a ketogenic diet in children with refractory epilepsy: a systematic review].

PubMed

Araya-Quintanilla, F; Celis-Rosati, A; Rodriguez-Leiva, C; Silva-Navarro, C; Silva-Pinto, Y; Toro-Jeria, B

2016-05-16

Epilepsy is a brain disorder that affects both children and adults. From the 1920s the ketogenic diet has gained prestige as another treatment option for patients with refractory epilepsy. A summary of the evidence will be made through a systematic review of randomized clinical trials that have compared a single ketogenic diet with other diet for the management of these patients. To determine the effectiveness of the ketogenic diet in reducing episodes of seizures in patients with refractory epilepsy. The search strategy included randomized controlled trials and controlled clinical trials. Databases used were Medline, LILACS, Central and CINAHL. Six articles that met our elegibility criteria. There is limited evidence that the ketogenic diet compared to the medium-chain triglyceride diet is more effective in reducing the frequency of seizures. There is also moderate evidence that classical ketogenic diet compared to the gradual diet (2.5:1 and 3:1) is more effective in reducing seizures. There is moderate evidence that classical ketogenic diet compared to Atkins diet is more effective in reducing the frequency of seizure. The decision to apply this type of diet should also be based on costs, preferences and safety of treatment. It should also take into account the likelihood that studies have indexing problems have been left out of the review.

Effect of dietary calcium deficiency and altered diet hardness on the jawbone growth: A micro-CT and bone histomorphometric study in rats.

PubMed

Fujita, Yuko; Goto, Shota; Ichikawa, Maika; Hamaguchi, Ayako; Maki, Kenshi

2016-12-01

We examined the effects of a low-calcium diet and altered diet hardness on bone architecture and metabolism in the maxilla and mandible. Male rats (n=48, 3 weeks old) were divided into six groups. In total, 24 rats were given a normal-calcium diet and the others were given a low-calcium diet. Each group was then divided into three subgroups, which were fed a 'hard̕ diet for 8 weeks, a 'soft̕ die for 8 weeks, or switched from the soft diet after 4 weeks to the hard diet for 4 weeks. The bone architecture was analyzed using cephalometry and micro-computed tomography, in addition, the bone metabolism was analyzed using serum bone markers and bone histomorphometry in the maxilla and mandible. Moreover, the bone formation patterns were evaluated using histopathologically in the midpalatal suture. The low-calcium diet affected bone architecture by increasing bone turnover and the soft diet affected bone architecture mainly by increasing bone resorption. The soft diet changed the chondrocyte cell layers into fibrous connective tissues in the midpalatal suture. At 4 weeks after the return to a hard diet from a soft diet, recovery of the deterioration in bone architectures was seen in the maxilla and mandible. We demonstrated that mastication with a hard diet is effective for recovering the collapsed equilibrium of jaw bone turnover and the deteriorating jaw bone architectures due to the poor masticatory function during the growing period. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Effects of food pattern change and physical exercise on cafeteria diet-induced obesity in female rats.

PubMed

Goularte, Jéferson F; Ferreira, Maria B C; Sanvitto, Gilberto L

2012-10-28

Obesity affects a large number of people around the world and appears to be the result of changes in food intake, eating habits and physical activity levels. Changes in dietary patterns and physical exercise are therefore strongly recommended to treat obesity and its complications. The present study tested the hypothesis that obesity and metabolic changes produced by a cafeteria diet can be prevented with dietary changes and/or physical exercise. A total of fifty-six female Wistar rats underwent one of five treatments: chow diet; cafeteria diet; cafeteria diet followed by a chow diet; cafeteria diet plus exercise; cafeteria diet followed by a chow diet plus exercise. The duration of the experiment was 34 weeks. The cafeteria diet resulted in higher energy intake, weight gain, increased visceral adipose tissue and liver weight, and insulin resistance. The cafeteria diet followed by the chow diet resulted in energy intake, body weight, visceral adipose tissue and liver weight and insulin sensitivity equal to that of the controls. Exercise increased total energy intake at week 34, but produced no changes in the animals' body weight or adipose tissue mass. However, insulin sensitivity in animals subjected to exercise and the diet was similar to that of the controls. The present study found that exposure to palatable food caused obesity and insulin resistance and a diet change was sufficient to prevent cafeteria diet-induced obesity and to maintain insulin sensitivity at normal levels. In addition, exercise resulted in normal insulin sensitivity in obese rats. These results may help to develop new approaches for the treatment of obesity and type 2 diabetes mellitus.

Maternal diet during early childhood, but not pregnancy, predicts diet quality and fruit and vegetable acceptance in offspring.

PubMed

Ashman, Amy M; Collins, Clare E; Hure, Alexis J; Jensen, Megan; Oldmeadow, Christopher

2016-07-01

Studies have identified prenatal flavour exposure as a determinant of taste preferences in infants; however, these studies have focused on relatively small samples and limited flavours. As many parents struggle with getting children to accept a variety of nutritious foods, a study of the factors influencing food acceptance is warranted. The objective of this study was to determine whether exposure to a wider variety of fruit and vegetables and overall higher diet quality in utero results in acceptance of a greater variety of these foods and better diet quality for offspring during childhood. This study is a secondary data analysis of pregnant women (n = 52) and their resulting offspring recruited for the Women and Their Children's Health study in NSW, Australia. Dietary intake of mothers and children was measured using food frequency questionnaires. Diet quality and vegetable and fruit variety were calculated using the Australian Recommended Food Score and the Australian Child and Adolescent Recommended Food Score. Associations between maternal and child diet quality and variety were assessed using Pearson's correlations and the total effect of in utero maternal pregnancy diet on childhood diet was decomposed into direct and indirect effect using mediation analysis. Maternal pregnancy and post-natal diet were both correlated with child diet for overall diet quality and fruit and vegetable variety (P < 0.001). Mediation analyses showed that the indirect effect of maternal pregnancy diet on child diet was mediated through maternal post-natal diet, particularly for fruit (P = 0.045) and vegetables (P = 0.055). Nutrition intervention should therefore be aimed at improving diet quality and variety in mothers with young children, in order to subsequently improve eating habits of offspring. © 2014 John Wiley & Sons Ltd.

Integrating Cellular Metabolism into a Multiscale Whole-Body Model

PubMed Central

Krauss, Markus; Schaller, Stephan; Borchers, Steffen; Findeisen, Rolf; Lippert, Jörg; Kuepfer, Lars

2012-01-01

Cellular metabolism continuously processes an enormous range of external compounds into endogenous metabolites and is as such a key element in human physiology. The multifaceted physiological role of the metabolic network fulfilling the catalytic conversions can only be fully understood from a whole-body perspective where the causal interplay of the metabolic states of individual cells, the surrounding tissue and the whole organism are simultaneously considered. We here present an approach relying on dynamic flux balance analysis that allows the integration of metabolic networks at the cellular scale into standardized physiologically-based pharmacokinetic models at the whole-body level. To evaluate our approach we integrated a genome-scale network reconstruction of a human hepatocyte into the liver tissue of a physiologically-based pharmacokinetic model of a human adult. The resulting multiscale model was used to investigate hyperuricemia therapy, ammonia detoxification and paracetamol-induced toxication at a systems level. The specific models simultaneously integrate multiple layers of biological organization and offer mechanistic insights into pathology and medication. The approach presented may in future support a mechanistic understanding in diagnostics and drug development. PMID:23133351

Protection against methotrexate toxicity by a soybean protein- and omega-3 fatty acid-containing diet: comparative study with a casein-containing diet.

PubMed

Mitsugi, Kenji; Nakamura, Tsuyoshi; Kashiwabara, Norio; Ariyama, Hiroshi; Tanaka, Risa; Baba, Eishi; Nakamura, Minoru; Harada, Mine; Nakano, Shuji

2004-07-01

Effects of two clinically used liquid diets on toxicity and antitumor activity of methotrexate (MTX) were investigated in Sprague-Dawley (SD) rats and tumor-bearing mice, respectively. Diets tested were commercially available formulas enriched either with soybean and omega-3 fatty acids or with casein. The soybean-containing diet offered significant protection against MTX toxicity in rats compared with the casein-containing diet, completely alleviating MTX-induced anorexia, diarrhea, and weight loss, when ingested as the sole diet and fed 7 days prior to and 7 days following intraperitoneal MTX injection. As a result, 90% of rats were alive on soybean-containing diet while all rats were dead on casein-containing diet. Histologic examination of the small intestine of MTX-treated rats revealed that the soybean-containing diet significantly prevented loss of mucosal villus tips compared to the casein-containing diet. Pharmocokinetic examination indicated that plasma MTX concentrations were similar for rats in the two diet-defined groups. No significant differences were observed between diets in survival of mice injected with L1210 mouse leukemia cells and subsequently with MTX. Thus the soybean-containing diet appeared to be superior to the casein-containing diet in preventing gastrointestinal toxicity while preserving antitumor activity. A soybean diet enriched in omega-3 fatty acids may be a useful adjunct to MTX treatment of human cancers.

The ketogenic diet and other dietary treatments for refractory epilepsy in children

PubMed Central

Sharma, Suvasini; Jain, Puneet

2014-01-01

The ketogenic diet is a high-fat, low-carbohydrate, and restricted protein diet that is useful in patients with refractory epilepsy. The efficacy of the ketogenic diet is better than most of the new antiepileptic drugs. Other modifications of the diet are also beneficial, such as the modified Atkins diet and the low glycemic index treatment. There is a lack of awareness of the ketogenic diet as a treatment modality for epilepsy amongst pediatricians and neurologists. In this review, the use of the ketogenic diet and other dietary treatments in refractory epilepsy is discussed. The Indian experience with the use of these dietary treatments is also briefly reviewed. PMID:25221391

Diet and Nutrition

MedlinePlus

... need to know about Wilson Disease Diet and Nutrition Food . . . . Adherence to a low copper diet is ... Symptoms Diagnosis Treatments Generic Zinc Options Inheritence Diet & Nutrition Kayser-Fleischer Rings Wilson Disease FAQs Definitions Transplantation ...

Diet myths and facts

MedlinePlus

Obesity - diet myths and facts; Overweight - diet myths and fact; Weight-loss diet myths and facts ... evidence: using the proposed effect of breakfast on obesity to show 2 practices that distort scientific evidence. ...

Substitution of red meat with legumes in the therapeutic lifestyle change diet based on dietary advice improves cardiometabolic risk factors in overweight type 2 diabetes patients: a cross-over randomized clinical trial.

PubMed

Hosseinpour-Niazi, S; Mirmiran, P; Hedayati, M; Azizi, F

2015-05-01

The objective of this study was to determine the effects of substitution of red meat with legumes in the Therapeutic Lifestyle Change (TLC) diet on cardiometabolic risk factors in type 2 diabetes patients based on dietary education. This study was a randomized, controlled, cross-over trial. Thirty-one participants (24 women and 7 men; age: 58.1 ± 6.0 years) with type 2 diabetes were randomly assigned to consume a control diet (legume-free TLC diet) and legume-based TLC diet for 8 weeks. Legume-based TLC diet was the same as the control diet, but the legume-based TLC group was advised to replace two servings of red meat with legumes, 3 days per week. After the interventional period, a washout period was conducted for 4 weeks. The groups were then advised to follow the alternate treatment for 8 weeks. Cardiometabolic risk factors were measured. Compared with the legume-free TLC diet, the legume-based TLC diet significantly decreased fasting blood glucose (P=0.04), fasting insulin (P=0.04), triglyceride concentrations (P=0.04) and low-density lipoprotein cholesterol (P=0.02). Total cholesterol concentrations decreased after consumption of both TLC diet and legume TLC diet; however, the data did not differ significantly between the two diets. body mass index (BMI), waist circumference, systolic and diastolic blood pressures did not change significantly after consumption of either the legume-free TLC diet or the legume-based TLC diet. Dietary advice given for substitution of red meat with legume intakes within a TLC diet-improved lipid profiles and glycemic control among diabetes patients, which were independent from BMI change. This trial was registered in the Iranian Registry of Clinical Trials (http://www.irct.ir) as IRCT201202251640N7.

Increased plasma ghrelin suppresses insulin release in wethers fed with a high-protein diet.

PubMed

Takahashi, T; Sato, K; Kato, S; Yonezawa, T; Kobayashi, Y; Ohtani, Y; Ohwada, S; Aso, H; Yamaguchi, T; Roh, S G; Katoh, K

2014-06-01

Ghrelin is a multifunctional peptide that promotes an increase of food intake and stimulates GH secretion. Ghrelin secretion is regulated by nutritional status and nutrients. Although a high-protein (HP) diet increases plasma ghrelin secretion in mammals, the mechanisms and the roles of the elevated ghrelin concentrations due to a HP diet have not been fully established. To clarify the roles of elevated acylated ghrelin upon intake of a HP diet, we investigated the regulation of ghrelin concentrations in plasma and tissues in wethers fed with either the HP diet or the control (CNT) diet for 14 days, and examined the action of the elevated plasma ghrelin by using a ghrelin-receptor antagonist. The HP diet gradually increased the plasma acylated-ghrelin concentrations, but the CNT diet did not. Although the GH concentrations did not vary significantly across the groups, an injection of ghrelin-receptor antagonist enhanced insulin levels in circulation in the HP diet group. In the fundus region of the stomach, the ghrelin levels did not differ between the HP and CNT diet groups, whereas ghrelin O-acyltransferase mRNA levels were higher in the group fed with HP diet than those of the CNT diet group were. These results indicate that the HP diet elevated the plasma ghrelin levels by increasing its synthesis; this elevation strongly suppresses the appearance of insulin in the circulation of wethers, but it is not involved in GH secretion. Overall, our findings indicate a role of endogenous ghrelin action in secretion of insulin, which acts as a regulator after the consumption of a HP diet. © 2014 Society for Endocrinology.

Effects of a high-protein/low carbohydrate versus a standard hypocaloric diet on adipocytokine levels and insulin resistance in obese patients along 9 months.

PubMed

de Luis, Daniel Antonio; Izaola, Olatz; Aller, Rocio; de la Fuente, Beatriz; Bachiller, Rosario; Romero, Enrique

2015-01-01

Recent dietary trials and observational studies have focused on the effects of diet on health outcomes such as improvement in levels of surrogate biomarkers. The aim of our study was to examine the changes in weight, adipocytokines levels and insulin resistance after a high-protein/low carbohydrate hypocaloric diet vs. a standard hypocaloric diet during an intervention of 9 months. 331 obese subjects were randomly allocated to one of two diets for a period of 9 months. Diet HP (n=168) (high-protein hypocaloric diet) consisted in a diet of 1050 cal/day, 33% of carbohydrates, 33% of fats and 34% of proteins. Diet S (n=163) (standard protein hypocaloric diet) consisted in a diet of 1093 cal/day, 53% carbohydrates, 27%fats, and 20% proteins. With the diets HP and S, BMI, weight, fat mass, waist circumference, waist-to-hip ratio, systolic blood pressure, total cholesterol, LDL-cholesterol, insulin and HOMA decreased. The decrease at 9 months of (BMI: -2.6±1.3kg/m(2) vs. -2.1±1.2kg/m(2):p<0.05), weight (-8.4±4.2kg vs. -5.0±4.1kg: p<0.05), fat mass (-5.1±4.1kg vs. -3.4±4.2kg: p<0.05), systolic blood pressure (-5.1±7.1mmHg vs. -3.1±2.1mmHg: p<0.05), (insulin levels -4.0±4.8 UI/L vs. -2.2±2.4 UI/L; p<0.05) and HOMA (-0.8±1.0 units vs. -0.3±1.0 units; p<0.05) was higher in diet HP than Diet S. With both diets, leptin levels decreased. A high-protein/low carbohydrate hypocaloric diet shows a higher weight loss, insulin and HOMA-R decreased after 9 months than a standard hypocaloric diet. The improvement in adipokine levels was similar with both diets. Copyright © 2015 Elsevier Inc. All rights reserved.

Evidence of changes in alpha-1/AT1 receptor function generated by diet-induced obesity.

PubMed

Juarez, Esther; Tufiño, Cecilia; Querejeta, Enrique; Bracho-Valdes, Ismael; Bobadilla-Lugo, Rosa A

2017-11-01

To study whether hypercaloric diet-induced obesity deteriorates vascular contractility of rat aorta through functional changes in α 1 adrenergic and/or AT1 Angiotensin II receptors. Angiotensin II- or phenylephrine-induced contraction was tested on isolated aorta rings with and without endothelium from female Wistar rats fed for 7 weeks with hypercaloric diet or standard diet. Vascular expression of Angiotensin II Receptor type 1 (AT1R), Angiotensin II Receptor type 2 (AT2R), Cyclooxygenase-1 (COX-1), Cyclooxygenase-2 (COX-2), inducible Nitric Oxide Synthase (iNOS) and endothelial Nitric Oxide Synthase (eNOS), as well as blood pressure, glucose, insulin and angiotensin II blood levels were measured. Diet-induced obesity did not significantly change agonist-induced contractions (Emax and pD 2 hypercaloric diet vs standard diet n.s.d.) of both intact (e+) or endothelium free (e-) vessels but significantly decrease both phenylephrine and angiotensin II contraction (Emax p < 0.01 hypercaloric diet vs standard diet) in the presence of both prazosin and losartan but only in endothelium-intact vessels. Diet-induced obesity did not change angiotensin II AT1, AT2 receptor proteins expression but reduced COX-1 and NOS2 ( p < 0.05 vs standard diet). Seven-week hypercaloric diet-induced obesity produces alterations in vascular adrenergic and angiotensin II receptor dynamics that suggest an endothelium-dependent adrenergic/angiotensin II crosstalk. These changes reflect early-stage vascular responses to obesity.

Effects of a caloric restriction weight loss diet and exercise on inflammatory biomarkers in overweight/obese postmenopausal women: a randomized controlled trial.

PubMed

Imayama, Ikuyo; Ulrich, Cornelia M; Alfano, Catherine M; Wang, Chiachi; Xiao, Liren; Wener, Mark H; Campbell, Kristin L; Duggan, Catherine; Foster-Schubert, Karen E; Kong, Angela; Mason, Caitlin E; Wang, Ching-Yun; Blackburn, George L; Bain, Carolyn E; Thompson, Henry J; McTiernan, Anne

2012-05-01

Obese and sedentary persons have increased risk for cancer; inflammation is a hypothesized mechanism. We examined the effects of a caloric restriction weight loss diet and exercise on inflammatory biomarkers in 439 women. Overweight and obese postmenopausal women were randomized to 1-year: caloric restriction diet (goal of 10% weight loss, N = 118), aerobic exercise (225 min/wk of moderate-to-vigorous activity, N = 117), combined diet + exercise (N = 117), or control (N = 87). Baseline and 1-year high-sensitivity C-reactive protein (hs-CRP), serum amyloid A (SAA), interleukin-6 (IL-6), leukocyte, and neutrophil levels were measured by investigators blind to group. Inflammatory biomarker changes were compared using generalized estimating equations. Models were adjusted for baseline body mass index (BMI), race/ethnicity, and age. Four hundred and thirty-eight (N = 1 in diet + exercise group was excluded) were analyzed. Relative to controls, hs-CRP decreased by geometric mean (95% confidence interval, P value): 0.92 mg/L (0.53-1.31, P < 0.001) in the diet and 0.87 mg/L (0.51-1.23, P < 0.0001) in the diet + exercise groups. IL-6 decreased by 0.34 pg/mL (0.13-0.55, P = 0.001) in the diet and 0.32 pg/mL (0.15-0.49, P < 0.001) in the diet + exercise groups. Neutrophil counts decreased by 0.31 × 10(9)/L (0.09-0.54, P = 0.006) in the diet and 0.30 × 10(9)/L (0.09-0.50, P = 0.005) in the diet + exercise groups. Diet and diet + exercise participants with 5% or more weight loss reduced inflammatory biomarkers (hs-CRP, SAA, and IL-6) compared with controls. The diet and diet + exercise groups reduced hs-CRP in all subgroups of baseline BMI, waist circumference, CRP level, and fasting glucose. Our findings indicate that a caloric restriction weight loss diet with or without exercise reduces biomarkers of inflammation in postmenopausal women, with potential clinical significance for cancer risk reduction. ©2012 AACR

Transcriptional markers of sub-optimal nutrition in developing Apis mellifera nurse workers

PubMed Central

2014-01-01

Background Honey bees (Apis mellifera) contribute substantially to the worldwide economy and ecosystem health as pollinators. Pollen is essential to the bee’s diet, providing protein, lipids, and micronutrients. The dramatic shifts in physiology, anatomy, and behavior that accompany normal worker development are highly plastic and recent work demonstrates that development, particularly the transition from nurse to foraging roles, is greatly impacted by diet. However, the role that diet plays in the developmental transition of newly eclosed bees to nurse workers is poorly understood. To further understand honey bee nutrition and the role of diet in nurse development, we used a high-throughput screen of the transcriptome of 3 day and 8 day old worker bees fed either honey and stored pollen (rich diet) or honey alone (poor diet) within the hive. We employed a three factor (age, diet, age x diet) analysis of the transcriptome to determine whether diet affected nurse worker physiology and whether poor diet altered the developmental processes normally associated with aging. Results Substantial changes in gene expression occurred due to starvation. Diet-induced changes in gene transcription occurring in younger bees were largely a subset of those occurring in older bees, but certain signatures of starvation were only evident 8 day old workers. Of the 18,542 annotated transcripts in the A. mellifera genome, 150 transcripts exhibited differential expression due to poor diet at 3d of age compared with 17,226 transcripts that differed due to poor diet at 8d of age, and poor diet caused more frequent down-regulation of gene expression in younger bees compared to older bees. In addition, the age-related physiological changes that accompanied early adult development differed due to the diet these young adult bees were fed. More frequent down-regulation of gene expression was observed in developing bees fed a poor diet compared to those fed an adequate diet. Functional analyses also suggest that the physiological and developmental processes occurring in well-fed bees are vastly different than those occurring in pollen deprived bees. Our data support the hypothesis that poor diet causes normal age-related development to go awry. Conclusion Poor nutrition has major consequences for the expression of genes underlying the physiology and age-related development of nurse worker bees. More work is certainly needed to fully understand the consequences of starvation and the complex biology of nutrition and development in this system, but the genes identified in the present study provide a starting point for understanding the consequences of poor diet and for mitigating the economic costs of colony starvation. PMID:24529032

Diet Intervention and Cerebrospinal Fluid Biomarkers in Amnestic Mild Cognitive Impairment

PubMed Central

Bayer-Carter, Jennifer L.; Green, Pattie S.; Montine, Thomas J.; VanFossen, Brian; Baker, Laura D.; Watson, G. Stennis; Bonner, Laura M.; Callaghan, Maureen; Leverenz, James B.; Walter, Brooke K.; Tsai, Elaine; Plymate, Stephen R.; Postupna, Nadia; Wilkinson, Charles W.; Zhang, Jing; Lampe, Johanna; Kahn, Steven E.; Craft, Suzanne

2011-01-01

Objective To compare the effects of a 4-week high–saturated fat/high–glycemic index (HIGH) diet with a low–saturated fat/low–glycemic index (LOW) diet on insulin and lipid metabolism, cerebrospinal fluid (CSF) markers of Alzheimer disease, and cognition for healthy adults and adults with amnestic mild cognitive impairment (aMCI). Design Randomized controlled trial. Setting Veterans Affairs Medical Center clinical research unit. Participants Forty-nine older adults (20 healthy adults with a mean [SD] age of 69.3 [7.4] years and 29 adults with aMCI with a mean [SD] age of 67.6 [6.8] years). Intervention Participants received the HIGH diet (fat, 45% [saturated fat, >25%]; carbohydrates, 35%–40% [glycemic index, >70]; and protein, 15%–20%) or the LOW diet (fat, 25%; [saturated fat, <7%]; carbohydrates, 55%–60% [glycemic index, <5]; and protein, 15%–20%) for 4 weeks. Cognitive tests, an oral glucose tolerance test, and lumbar puncture were conducted at baseline and during the fourth week of the diet. Main Outcome Measures The CSF concentrations of β-amyloid (Aβ42 and Aβ40), tau protein, insulin, F2-isoprostanes, and apolipoprotein E, plasma lipids and insulin, and measures of cognition. Results For the aMCI group, the LOW diet increased CSF Aβ42 concentrations, contrary to the pathologic pattern of lowered CSF Aβ42 typically observed in Alzheimer disease. The LOW diet had the opposite effect for healthy adults, ie, decreasing CSF Aβ42, whereas the HIGH diet increased CSF Aβ42. The CSF apolipoprotein E concentration was increased by the LOW diet and decreased by the HIGH diet for both groups. For the aMCI group, the CSF insulin concentration increased with the LOW diet, but the HIGH diet lowered the CSF insulin concentration for healthy adults. The HIGH diet increased and the LOW diet decreased plasma lipids, insulin, and CSF F2-isoprostane concentrations. Delayed visual memory improved for both groups after completion of 4 weeks of the LOW diet. Conclusion Our results suggest that diet may be a powerful environmental factor that modulates Alzheimer disease risk through its effects on central nervous system concentrations of Aβ42, lipoproteins, oxidative stress, and insulin. PMID:21670398

Estimates of diet selection in cattle grazing cornstalk residues by measurement of chemical composition and near infrared reflectance spectroscopy of diet samples collected by ruminal evacuation.

PubMed

Petzel, Emily A; Smart, Alexander J; St-Pierre, Benoit; Selman, Susan L; Bailey, Eric A; Beck, Erin E; Walker, Julie A; Wright, Cody L; Held, Jeffrey E; Brake, Derek W

2018-05-04

Six ruminally cannulated cows (570 ± 73 kg) fed corn residues were placed in a 6 × 6 Latin square to evaluate predictions of diet composition from ruminally collected diet samples. After complete ruminal evacuation, cows were fed 1-kg meals (dry matter [DM]-basis) containing different combinations of cornstalk and leaf and husk (LH) residues in ratios of 0:100, 20:80, 40:60, 60:40, 80:20, and 100:0. Diet samples from each meal were collected by removal of ruminal contents after 1-h and were either unrinsed, hand-rinsed or machine-rinsed to evaluate effects of endogenous compounds on predictions of diet composition. Diet samples were analyzed for neutral (NDF) and acid (ADF) detergent fiber, acid detergent insoluble ash (ADIA), acid detergent lignin (ADL), crude protein (CP), and near infrared reflectance spectroscopy (NIRS) to calculate diet composition. Rinsing type increased NDF and ADF content and decreased ADIA and CP content of diet samples (P < 0.01). Rinsing tended to increase (P < 0.06) ADL content of diet samples. Differences in concentration between cornstalk and LH residues within each chemical component were standardized by calculating a coefficient of variation (CV). Accuracy and precision of estimates of diet composition were analyzed by regressing predicted diet composition and known diet composition. Predictions of diet composition were improved by increasing differences in concentration of chemical components between cornstalk and LH residues up to a CV of 22.6 ± 5.4%. Predictions of diet composition from unrinsed ADIA and machine-rinsed NIRS had the greatest accuracy (slope = 0.98 and 0.95, respectively) and large coefficients of determination (r2 = 0.86 and 0.74, respectively). Subsequently, a field study (Exp. 2) was performed to evaluate predictions of diet composition in cattle (646 ± 89 kg) grazing corn residue. Five cows were placed in 1 of 10 paddocks and allowed to graze continuously or to strip-graze corn residues. Predictions of diet composition from ADIA, ADL, and NIRS did not differ (P = 0.99), and estimates of cornstalk intake tended to be greater (P = 0.09) in strip-grazed compared to continuously grazed cows. These data indicate that diet composition can be predicted by chemical components or NIRS by ruminal collection of diet samples among cattle grazing corn residues.

Differential effect of weight loss with low-fat diet or high-fat diet restriction on inflammation in the liver and adipose tissue of mice with diet-induced obesity

USDA-ARS?s Scientific Manuscript database

We studied the effects of weight loss induced by either a low-fat normal diet or restriction of high-fat diet on hepatic steatosis, inflammation in the liver and adipose tissue, and blood monocytes of obese mice. In mice with high-fat diet-induced obesity, weight loss was achieved by switching from ...

Comparison of the Availability and Cost of Foods Compatible With a Renal Diet Versus an Unrestricted Diet Using the Nutrition Environment Measures Survey.

PubMed

Sullivan, Catherine M; Pencak, Julie A; Freedman, Darcy A; Huml, Anne M; León, Janeen B; Nemcek, Jeanette; Theurer, Jacqueline; Sehgal, Ashwini R

2017-05-01

Hemodialysis patients' ability to access food that is both compatible with a renal diet and affordable is affected by the local food environment. Comparisons of the availability and cost of food items suitable for the renal diet versus a typical unrestricted diet were completed using the standard Nutrition Environment Measures Survey and a renal diet-modified Nutrition Environment Measures Survey. Cross-sectional study. Twelve grocery stores in Northeast Ohio. Availability and cost of food items in 12 categories. The mean total number of food items available differed significantly (P ≤ .001) between the unrestricted diet (38.9 ± 4.5) and renal diet (32.2 ± 4.7). The mean total cost per serving did not differ significantly (P = 0.48) between the unrestricted diet ($5.67 ± 2.50) and renal diet ($5.76 ± 2.74). The availability of renal diet food items is significantly less than that of unrestricted diet food items, but there is no difference in the cost of items that are available in grocery stores. Further work is needed to determine how to improve the food environment for patients with chronic diseases. Copyright © 2017 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Copper in diet

MedlinePlus

Diet - copper ... yeast are also sources of copper in the diet. ... day 9 to 13 years: 700 mcg/day Adolescents and adults Males and ... eat a balanced diet that contains a variety of foods from the ...

Gamma delta T cells promote inflammation and insulin resistance during high fat diet-induced obesity in mice

USDA-ARS?s Scientific Manuscript database

Gamma delta T cells are resident in adipose tissue and increase during diet-induced obesity. Their possible contribution to the inflammatory response that accompanies diet-induced obesity was investigated in mice after a 5-10 week high milk fat diet. The high milk fat diet resulted in significant in...

Corticosterone administration in drinking water decreases high-fat diet intake but not preference in male rats

PubMed Central

Boersma, Gretha J.; Tamashiro, Kellie L.; Moran, Timothy H.

2016-01-01

One of the mechanisms through which regular exercise contributes to weight maintenance could be by reducing intake and preference for high-fat (HF) diets. Indeed, we previously demonstrated that wheel-running rats robustly reduced HF diet intake and preference. The reduced HF diet preference by wheel running can be so profound that the rats consumed only the chow diet and completely avoided the HF diet. Because previous research indicates that exercise activates the hypothalamic-pituitary-adrenal axis and increases circulating levels of corticosterone, this study tested the hypothesis that elevation of circulating corticosterone is involved in wheel running-induced reduction in HF diet preference in rats. Experiment 1 measured plasma corticosterone levels under sedentary and wheel-running conditions in the two-diet-choice (high-carbohydrate chow vs. HF) feeding regimen. The results revealed that plasma corticosterone is significantly increased and positively correlated with the levels of running in wheel-running rats with two-diet choice. Experiments 2 and 3 determined whether elevated corticosterone without wheel running is sufficient to reduce HF diet intake and preference. Corticosterone was elevated by adding it to the drinking water. Compared with controls, corticosterone-drinking rats had reduced HF diet intake and body weight, but the HF diet preference between groups did not differ. The results of this study support a role for elevated corticosterone on the reduced HF diet intake during wheel running. The elevation of corticosterone alone, however, is not sufficient to produce a robust reduction in HF diet preference. PMID:26818055

Effects of a caloric restriction weight loss diet and exercise on inflammatory biomarkers in overweight/obese postmenopausal women: a randomized controlled trial

PubMed Central

Imayama, Ikuyo; Ulrich, Cornelia M.; Alfano, Catherine M.; Wang, Chiachi; Xiao, Liren; Wener, Mark H.; Campbell, Kristin L.; Duggan, Catherine; Foster-Schubert, Karen E.; Kong, Angela; Mason, Caitlin E.; Wang, Ching-Yun; Blackburn, George L.; Bain, Carolyn E.; Thompson, Henry J.; McTiernan, Anne

2012-01-01

Obese and sedentary persons have increased risk for cancer; inflammation is a hypothesized mechanism. We examined the effects of a caloric restriction weight loss diet and exercise on inflammatory biomarkers in 439 women. Overweight and obese postmenopausal women were randomized to 1-year: caloric restriction diet (goal of 10% weight loss, N=118), aerobic exercise (225 minutes/week of moderate-to-vigorous activity, N=117), combined diet+exercise (N=117) or control (N=87). Baseline and 1-year high-sensitivity C-reactive protein (hs-CRP), serum amyloid A (SAA), interleukin-6 (IL-6), leukocyte and neutrophil levels were measured by investigators blind to group. Inflammatory biomarker changes were compared using generalized estimating equations. Models were adjusted for baseline body mass index (BMI), race/ethnicity and age. 438 (N=1 in diet+exercise group was excluded) were analyzed. Relative to controls, hs-CRP decreased by geometric mean (95% confidence interval, p-value) 0.92mg/L (0.53–1.31, P<0.001) in the diet and 0.87mg/L (0.51–1.23, P<0.0001) in the diet+exercise groups. IL-6 decreased by 0.34pg/ml (0.13–0.55, P=0.001) in the diet and 0.32pg/ml (0.15–0.49, P<0.001) in the diet+exercise groups. Neutrophil counts decreased by 0.31×109/L (0.09–0.54, P=0.006) in the diet and 0.30×109/L (0.09–0.50, P=0.005) in the diet+exercise groups. Diet and diet+exercise participants with ≥5% weight loss reduced inflammatory biomarkers (hs-CRP, SAA, and IL-6) compared to controls. The diet and diet+exercise groups reduced hs-CRP in all subgroups of baseline BMI, waist circumference, CRP level, and fasting glucose. Our findings indicate that a caloric restriction weight loss diet with or without exercise reduces biomarkers of inflammation in postmenopausal women, with potential clinical significance for cancer risk reduction. PMID:22549948

Onset of Ulcerative Colitis during a Low-Carbohydrate Weight-Loss Diet and Treatment with a Plant-Based Diet: A Case Report.

PubMed

Chiba, Mitsuro; Tsuda, Satoko; Komatsu, Masafumi; Tozawa, Haruhiko; Takayama, Yuko

2016-01-01

Overweight and obesity are global health concerns. Various effective weight-loss diets have been developed, including the Atkins diet. The Atkins diet is known as an extreme low-carbohydrate diet. This diet reduces body weight and has gained widespread popularity. However, the metabolite profiles of such a diet have been shown to be detrimental to colonic health. Therefore, a concern for the long-term health effects of this diet exists. We encountered a case in which ulcerative colitis developed while the patient was following the Atkins diet.A man, 172 cm in height and weighing 72 kg, at age 36 years followed a low-carbohydrate weight-loss diet. His weight decreased to 66 kg as desired. Thereafter he noticed bloody stool. Colonoscopy revealed diffuse inflammation limited to the rectum, and he was diagnosed with ulcerative colitis. He underwent an educational hospitalization for ulcerative colitis. A plant-based/semivegetarian diet was provided during hospitalization. Bloody stool disappeared during hospitalization and he achieved remission without medication for inflammatory bowel disease.This case indicates that an onset of ulcerative colitis can be an adverse event to a low-carbohydrate weight-loss diet.

Role of postnatal dietary sodium in prenatally programmed hypertension.

PubMed

Stewart, Tyrus; Ascani, Jeannine; Craver, Randall D; Vehaskari, V Matti

2009-09-01

In this study we examined the short- and long-term impact of early life dietary sodium (Na) on prenatally programmed hypertension. Hypertension was induced in rat offspring by a maternal low protein (LP) diet. Control and LP offspring were randomized to a high (HS), standard (SS), or low (LS) Na diet after weaning. On the SS diet, the LP pups developed hypertension by 6 weeks of age. The development of hypertension was prevented by the LS diet and exacerbated by the HS diet. Kidney nitrotyrosine content, a measure of oxidative stress, was reduced by the LS diet compared with the HS diet. The modified diets had no effect on control pups. A group of animals on the SS diet was followed up to 51 weeks of age after an early life 3-week exposure to the HS or LS diet. This brief early exposure of LP animals to the LS diet prevented the later development of hypertension and ameliorated the nephrosclerosis observed after early exposure to the HS diet. The LP offspring with early exposure to LS diet had lost their salt-sensitivity when challenged with the HS diet at the age of 43-49 weeks. No effect of early life dietary Na was observed in control animals. These results show that hypertension in this model is salt sensitive and may, in part, be mediated by salt-induced renal oxidative stress and that there may exist a developmental window which allows postnatal "reprogramming" of the hypertension.

Rapeseed oil-rich diet alters in vitro menadione and nimesulide hepatic mitochondrial toxicity.

PubMed

Monteiro, João P; Silva, Ana M; Jurado, Amália S; Oliveira, Paulo J

2013-10-01

Diet-induced changes in the lipid composition of mitochondrial membranes have been shown to influence physiological processes. However, the modulation effect of diet on mitochondrially-active drugs has not yet received the deserved attention. Our hypothesis is that modulation of membrane dynamics by diet impacts drug-effects on liver mitochondrial functioning. In a previous work, we have shown that a diet rich in rapeseed oil altered mitochondrial membrane composition and bioenergetics in Wistar rats. In the present work, we investigated the influence of the modified diet on hepatic mitochondrial activity of two drugs, menadione and nimesulide, and FCCP, a classic protonophore, was used for comparison. The results showed that the effects of menadione and nimesulide were less severe on liver mitochondria for rats fed the modified diet than on rats fed the control diet. A specific effect on complex I seemed to be involved in drug-induced mitochondria dysfunction. Liver mitochondria from the modified diet group were more susceptible to nimesulide effects on MPT induction. The present work demonstrates that diet manipulation aimed at modifying mitochondrial membrane properties alters the toxicity of mitochondria active agents. This work highlights that diet may potentiate mitochondrial pharmacologic effects or increase drug-induced liabilities. Copyright © 2013 Elsevier Ltd. All rights reserved.

Your diet after gastric bypass surgery

MedlinePlus

Gastric bypass surgery - your diet; Obesity - diet after bypass; Weight loss - diet after bypass ... et al. American Association of Clinical Endocrinologists, The Obesity Society, and American Society for Metabolic & Bariatric Surgery ...

Changes in weight, papilledema, headache, visual field, and life status in response to diet and metformin in women with idiopathic intracranial hypertension with and without concurrent polycystic ovary syndrome or hyperinsulinemia.

PubMed

Glueck, Charles J; Golnik, Karl C; Aregawi, Dawit; Goldenberg, Naila; Sieve, Luann; Wang, Ping

2006-11-01

The authors hypothesized that a metformin (MET)-diet would improve symptoms of idiopathic intracranial hypertension (IIH) in women who also had polycystic ovary syndrome (PCOS) or hyperinsulinemia without PCOS. Changes in weight, papilledema, headache, visual fields, and overall life status were prospectively assessed in response to 6 to 14 months on 2.25 g/day MET-diet or diet alone in 36 women with IIH, 23 with PCOS, selected by baseline body mass index (BMI) > or = 25, and no previous surgery for IIH. Overall life status was graded using a self-reported 1-5 scale (1 = well, normal activities; 2 = unwell, usual activities; 3 = poor, usual activities; 4 = poor, no usual activities; 5 = totally disabled). Conventional treatment for IIH was maintained unchanged during MET-diet intervention. The diet was hypocaloric (1500 calories/day), high protein (26% of calories), and low carbohydrate (44%). Of the 23 women with PCOS, 20 received MET-diet and 3 diet only (could not tolerate MET). Of the 13 women without PCOS, 7 were hyperinsulinemic and received MET-diet and 6 received diet alone. The 3 treatment groups (diet only [n = 9], PCOS-MET-diet [n = 20], and hyperinsulinemia-MET-diet [n = 7]) did not differ by median entry BMI (33.3, 37.6, and 35.7 kg/m(2)) or by duration of treatment (10.2, 11.4, and 10.9 months). Median percent weight loss was greatest in the PCOS-MET group (7.7%, P = 0.0015), was 3.3% in the diet only group, and 2.4% (P = 0.04) in the hyperinsulinemia-MET group. Papilledema significantly improved in the diet-alone group from 100% at baseline to 13% (P = 0.03), and in the PCOS-MET group from 95% to 30% (P = 0.002). If headache persisted on therapy, it was less intense-less frequent (P = 0.03) in the diet-only group and in the PCOS-MET group (P = 0.04). As many women with IIH have PCOS, and because weight loss is central to IIH treatment, diet-MET is a novel approach to treat IIH in women with concurrent PCOS or hyperinsulinemia without PCOS.

The White Diet is preferred, better tolerated, and non-inferior to a clear-fluid diet for bowel preparation: A randomized controlled trial.

PubMed

Butt, Joshua; Bunn, Cate; Paul, Eldho; Gibson, Peter; Brown, Gregor

2016-02-01

Dietary restrictions contribute to the unpleasantness of bowel preparation for colonoscopy. We compare the effectiveness and tolerability of a low residue diet of white-colored foods ("White Diet") with a clear-fluid diet the day prior to colonoscopy in an endoscopist-blinded randomized non-inferiority trial. Adults undergoing outpatient colonoscopy were randomized with stratification by procedure timing to a White Diet or clear-fluid diet. All received a 2-L polyethylene glycol lavage solution with ascorbate, sodium sulfate, and electrolytes, the day-before for morning and as a split-dose for afternoon procedures. The primary end-point was successful bowel preparation (A or B on the Harefield Cleansing Scale). Regimen tolerance/acceptance was assessed by questionnaire. An intention-to-treat analysis with a predefined non-inferiority margin of 15% was used to compare efficacy. A total of 226 patients (average age 52 years, 51% male) were randomized (111 clear diet, 115 White Diet). Bowel preparation was successful in 91% on the clear-fluid diet vs 84.4% on the White Diet, difference being -6.6% (lower one sided 95% CI -13.8%), with no difference according to diet. The split-dose regimen (in 55%) had a higher success rate than day-before regimen (96% vs 80%, p < 0.001). The White Diet was preferred with less hunger and interference with daily activities (p < 0.001). Procedural/withdrawal time and polyp/adenoma detection were similar between groups. The White Diet was preferred and better tolerated by patients without detriment to the success of bowel preparation or colonoscopy performance, especially with the split-dose regimen. © 2015 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

Antioxidant Diet Protects Against Emphysema, but Increases Mortality in Cigarette Smoke-Exposed Mice

PubMed Central

Nyunoya, Toru; March, Thomas H.; Tesfaigzi, Yohannes; Seagrave, JeanClare

2012-01-01

Oxidative stress plays an important role in cigarette smoke-induced lung inflammation and emphysema. We produced an enriched diet by adding freeze-dried fruits and vegetables and additional supplements to the 8604 Teklad Rodent Diet, a standard rodent diet. In this study, we examined the effects of the antioxidant-enriched diet on cigarette smoke-induced lung inflammation and emphysema. CH3/HeN mice were fed either a regular diet or an antioxidant diet. These mice were exposed to filtered air, a low concentration of cigarette smoke (total particulate matter: 100 mg/m3) or a high concentration of cigarette smoke (total particulate matter: 250mg/m3) for 6 hours/day, 5 days/week for total 16 weeks. Surprisingly, increased mortality (53%) was observed in the high concentration of cigarette smoke-exposed mice fed the antioxidant diet compared to the high concentration of cigarette smoke-exposed mice that were fed a regular diet (13%). The necropsy analysis revealed nasal passage obstruction due to mucous plugging in cigarette smoke-exposed mice on the antioxidant diet. However, the antioxidant diet significantly reduced neutrophilic inflammation and emphysema in the high concentration of cigarette smoke-exposed mice as compared to the regular diet /high concentration of cigarette smoke controls. The antioxidant capacity in the bronchoalveolar fluid or oxidative damage to the lung tissue was not affected by the antioxidant diet. Pro-MMP-2, MMP-2, and MMP-9 activity did not correlate with the protective effects of AOD on cigarette smoke-induced emphysema. These data suggest that the antioxidant diet reduced cigarette smoke -induced inflammation and emphysema, but increased mortality in the obligate nose-breathing mice. PMID:21834692

Development of a Food Group-Based Diet Score and Its Association with Bone Mineral Density in the Elderly: The Rotterdam Study.

PubMed

de Jonge, Ester A L; Kiefte-de Jong, Jessica C; de Groot, Lisette C P G M; Voortman, Trudy; Schoufour, Josje D; Zillikens, M Carola; Hofman, Albert; Uitterlinden, André G; Franco, Oscar H; Rivadeneira, Fernando

2015-08-18

No diet score exists that summarizes the features of a diet that is optimal for bone mineral density (BMD) in the elderly. Our aims were (a) to develop a BMD-Diet Score reflecting a diet that may be beneficial for BMD based on the existing literature, and (b) to examine the association of the BMD-Diet Score and the Healthy Diet Indicator, a score based on guidelines of the World Health Organization, with BMD in Dutch elderly participating in a prospective cohort study, the Rotterdam Study (n = 5144). Baseline dietary intake, assessed using a food frequency questionnaire, was categorized into food groups. Food groups that were consistently associated with BMD in the literature were included in the BMD-Diet Score. BMD was measured repeatedly and was assessed using dual energy X-ray absorptiometry. The BMD-Diet Score considered intake of vegetables, fruits, fish, whole grains, legumes/beans and dairy products as "high-BMD" components and meat and confectionary as "low-BMD" components. After adjustment, the BMD-Diet Score was positively associated with BMD (β (95% confidence interval) = 0.009 (0.005, 0.012) g/cm(2) per standard deviation). This effect size was approximately three times as large as has been observed for the Healthy Diet Indicator. The food groups included in our BMD-Diet Score could be considered in the development of future dietary guidelines for healthy ageing.

Effect of a high monounsaturated vs high polyunsaturated fat hypocaloric diets in nonalcoholic fatty liver disease.

PubMed

Aller, R; de Luis, D A; Izaola, O; de la Fuente, B; Bachiller, R

2014-01-01

Hyperaminotransferasemia is an important problem in obese patients. We decide to examine the changes in hyperaminotransferasemia after weight reduction in obese patients with and without NAFLD secondary to a high monounsaturated fat vs. a high polyunsaturated fat hypocaloric diets. A population of 306 obese patients was randomly allocated to two groups: Diet M (high monounsaturated fat hypocaloric diet) and Diet P (high polyunsaturated fat hypocaloric diet). Patients were classified as group I (obese subjects; n=262) when serum ALT activity was normal or group II (NAFLD patients; n=44) when serum ALT activity was (≥ 43 UI/L). In NAFLD group with diet M, BMI, weight, fat mass, waist circumference, systolic blood pressure, total cholesterol, LDL cholesterol), insulin and HOMA-R decreased. In NAFLD group with diet P, BMI, weight, fat mass, waist circumference, systolic blood pressure, total cholesterol, LDL cholesterol), insulin and HOMA-R decreased, too. In NAFLD group, alanine aminotransferase [(diet M) -20.3±19.2 UI/L vs. (diet P) -14.2±20.1 UI/L], aspartate aminotransferase [(diet M) -11.3±12.2 UI/L vs. (diet P) -11.1±10.1 UI/L], and gammaglutamyl transferase [(diet M) -18.1±12.2 UI/L vs. (diet P) -10.9±20.1 UI/L] improved with both diets. We showed that weight reduction secondary to two hypocaloric diets was associated with improvement in hypertransaminasemia and insulin resistance in NAFLD patients.

Effects of dietary supplementation with ghee, hydrogenated oil, or olive oil on lipid profile and fatty streak formation in rabbits

PubMed Central

Hosseini, Mohsen; Asgary, Sedigheh

2012-01-01

BACKGROUND Coronary heart disease is the leading cause of mortality worldwide. A high-fat diet, rich in saturated fatty acids and low in polyunsaturated fatty acids, is said to be an important cause of atherosclerosis and cardiovascular diseases. METHODS In this experimental study, 40 male rabbits were randomly assigned to eight groups of five to receive normal diet, hypercholesterolemic diet, normal diet plus ghee, normal diet plus olive oil, normal diet plus hydrogenated oil, hypercholesterolemic diet plus ghee, hypercholesterolemic diet plus olive oil, and hypercholesterolemic diet plus hydrogenated oil. They received rabbit chow for a period of 12 weeks. At the start and end of the study, fasting blood samples were taken from all animals to measure biochemical factors including total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), triglyceride (TG), fasting blood sugar (FBS), and C-reactive protein (CRP). Moreover, aorta, left and right coronary arteries were dissected at the end of the study to investigate fatty streak formation (FSF). Data was analyzed in SPSS at a significance level of 0.05. RESULTS In rabbits under normal diet, ghee significantly increased TC, LDL, and HDL compared to the beginning (P < 0.01) and also to the other two types of fat (P < 0.05). Moreover, normal diet plus olive oil significantly enhanced FSF in left coronary arteries and aorta compared to normal diet plus ghee. In groups receiving hypercholesterolemic diets, ghee significantly increased HDL and CRP (P < 0.05) and significantly decreased FBS (P < 0.01). The hypecholesterolemic diet plus olive oil significantly increased HDL (P < 0.01). Supplementation of hypecholesterolemic diet with ghee significantly increased HDL and FBS in comparison with hydrogenated oil. Significant increase of FBS was also detected with the use of ghee compared to olive oil. Ghee also significantly reduced FSF in left and right coronary arteries compared to olive oil. FSF in left coronary arteries was significantly lower in the hypecholesterolemic diet plus ghee group compared to the hypecholesterolemic diet plus hydrogenated oil group. CONCLUSION According to the achieved results, future clinical trial studies and investigation of other risk factors such as inflammatory factors are required. PMID:23358722

Effects of Persian leek (Allium ampeloprasum) on hepatic lipids and the expression of proinflammatory gene in hamsters fed a high-fat/ high-cholesterol diet.

PubMed

Fatoorechi, Vahideh; Rismanchi, Marjan; Nasrollahzadeh, Javad

2016-01-01

Persian leek is one of the most widely used herbal foods among Iranians. In this study, effects of oral administration of Persian leek on plasma and liver lipids were examined in hamster. Male Syrian hamsters were randomly divided into three groups: control (standard diet), high fat control (high-fat/high-cholesterol diet), Persian leek (high-fat/high-cholesterol diet + 1% per weight of diet from dried powdered Persian leek) for 14 weeks. High fat diet increased plasma and liver lipids as compared to standard diet. Adding Persian leek to the high-fat/high-cholesterol diet resulted in no significant changes in the concentration of the plasma lipids or liver cholesterol. However, liver triglycerides (TG), plasma Alanine aminotransferase and gene expression of tumor necrosis factor- α were decreased in hamsters fed high-fat diet containing Persian leek as compared to high-fat diet only. Persian leek might be considered as a herbal food that can reduce liver TG accumulation induced by high fat diets.

Resistant starch reduces colonic and urinary p-cresol in rats fed a tyrosine-supplemented diet, whereas konjac mannan does not.

PubMed

Chen, Bixiao; Morioka, Sahya; Nakagawa, Tomoyuki; Hayakawa, Takashi

2016-10-01

The effect of resistant starch (RS) and konjac mannan (KM) to maintain and improve the large intestinal environment was compared. Wistar SPF rats were fed the following diets for 4 weeks: negative control diet (C diet), tyrosine-supplemented positive control diet (T diet), and luminacoid supplemented diets containing either high-molecular konjac mannan A (KMAT diet), low-molecular konjac mannan B (KMBT diet), high-amylose cornstarch (HAST diet), or heat-moisture-treated starch (HMTST diet). The luminacoid-fed group had an increased content of short-chain fatty acids in the cecum. HAS caused a significant decrease in p-cresol content in the cecum, whereas KM did not. Urinary p-cresol was reduced in the HAST group compared with the T group, but not the KM fed groups. Deterioration in the large intestinal environment was only improved completely in the HAST and HMTST groups, suggesting that RS is considerably more effective than KM in maintaining the large intestinal environment.

Alterations of fecal steroid composition induced by changes in dietary fiber consumption.

PubMed

Ullrich, I H; Lai, H Y; Vona, L; Reid, R L; Albrink, M J

1981-10-01

The short-term effects of high carbohydrate diets of normal foods either high or low in dietary fiber on fecal steroids and fiber was assessed in eight healthy young men. Each subject consumed in random order for 4 days a diet containing 59 g (high fiber) or 21 g (low fiber) neutral detergent fiber. After a 9-day rest period he consumed the other diet. Analysis of random fecal samples during their usual diet and after 4 days of each experimental diet showed an increased in primary bile acids from less than 4 to 32% of total bile acids, and a decreases of coprostanol from 76% (control diet) or 64% (low fiber diet) to 45% of total neutral sterol after the high fiber diet. Fecal fiber concentration doubled after the high fiber diet. We conclude that 4 days of high fiber diet is sufficient to cause a large increase in primary and decrease in secondary fecal steroids. Such changes have implications for prevention of arteriosclerosis and cancer of the colon.

Nutrition and Diet

MedlinePlus

... Thai HbH:Vietnamese Relevant links Living with Thalassemia NUTRITION AND EXERCISE ▶ Nutrition and Diet ▶ Diet for the ... Thalassemia (for providers) Exercise for Patients with Thalassemia Nutrition and Diet Nutritional deficiencies are common in thalassemia, ...

Food for Thought.

ERIC Educational Resources Information Center

Murfin, Brian

1998-01-01

The Inuit subsist on a diet of virtually all meat and fat yet avoid deficiency and heart diseases. Explains this paradox and discusses cultural and geographic influences on diet. The Inuit diet is compared with a typical American diet and the diet recommended by the U.S. Department of Agriculture in a laboratory exercise that measures dietary fat.…

The Gluten-Free Diet in the 3rd Millennium: Rules, Risks and Opportunities

PubMed Central

Welstead, Lori

2015-01-01

The gluten-free diet has long been considered the standard treatment for celiac disease. However, a significant number of patients continue to experience persistent symptoms despite following a gluten-free diet. Inadvertent gluten ingestion, fermentable carbohydrates, cross-contamination, and social or financial burdens present obstacles to maintaining a gluten-free diet. Proper diet education and follow-up by an expert Registered Dietitian (RD) is essential to ensure adequate nutrition on the gluten-free diet. Patients may experience unintended weight gain or elevated cholesterol levels after initiating the gluten-free diet due to adequate absorption and healing of the intestines. This review deals with the evolving gluten-free diet, optimal recommendations while considering the overall health of patients, and multi-factorial aspects of the permanent lifestyle change. PMID:28943615

Diet and Nutrition

MedlinePlus

... 05-04T19:35:54+00:00 DIET AND NUTRITION Just as diet and nutrition were concerns before your PH diagnosis, pulmonary hypertension ... Guide for a complete overview of diet and nutrition. Controlling Salt and Sodium Consumption Monitoring Your Fluid ...

Changes in Energy Intake and Diet Quality during an 18-Month Weight-Management Randomized Controlled Trial in Adults with Intellectual and Developmental Disabilities.

PubMed

Ptomey, Lauren T; Steger, Felicia L; Lee, Jaehoon; Sullivan, Debra K; Goetz, Jeannine R; Honas, Jeffery J; Washburn, Richard A; Gibson, Cheryl A; Donnelly, Joseph E

2018-06-01

Previous research indicates that individuals with intellectual and developmental disabilities (IDDs) are at risk for poor diet quality. The purpose of this secondary analysis was to determine whether two different weight-loss diets affect energy intake, macronutrient intake, and diet quality as measured by the Healthy Eating Index-2010 (HEI-2010) during a 6-month weight-loss period and 12-month weight-management period, and to examine differences in energy intake, macronutrient intake, and HEI-2010 between groups. Overweight/obese adults with IDDs took part in an 18-month randomized controlled trial and were assigned to either an enhanced Stop Light Diet utilizing portion-controlled meals or a conventional diet consisting of reducing energy intake and following the 2010 Dietary Guidelines for Americans. Proxy-assisted 3-day food records were collected at baseline, 6 months, and 18 months, and were analyzed using Nutrition Data System for Research software. HEI-2010 was calculated using the data from Nutrition Data System for Research. The study took place from June 2011 through May 2014 in the greater Kansas City metropolitan area. This was a secondary analysis of a weight-management intervention for adults with IDDs randomized to an enhanced Stop Light Diet or conventional diet, to examine differences in energy intake, macronutrient intake, and HEI-2010 across time and between groups. Independent- and paired-samples t tests and general mixed modeling for repeated measures were performed to examine group differences and changes at baseline, 6 months, and 18 months between the enhanced Stop Light Diet and conventional diet groups. One hundred and forty six participants (57% female, mean±standard deviation age=36.2±12.0 years) were randomized to either the enhanced Stop Light Diet or conventional diet group (77 enhanced Stop Light Diet, 69 conventional diet) and provided data for analysis at baseline, 124 completed the 6-month weight-loss period, and 101 completed the 18-month study. Participants on the enhanced Stop Light Diet diet significantly reduced energy intake at 6 and 18 months (both P<0.001), but those on the conventional diet did not (both P=0.13). However, when accounting for age, sex, race, education level, and support level (mild vs moderate IDD), there was a significant decrease during the 18-month intervention in energy intake for the enhanced Stop Light Diet and conventional diet groups combined (P<0.01 for time effect), but no significant group difference in this change (P=0.39 for group-by-time interaction). There was no significant change in total HEI-2010 score at 6 and 18 months (P=0.05 and P=0.38 for the enhanced Stop Light Diet group; P=0.22 and P=0.17 for the conventional diet group), and no significant group difference at 6 and 18 months (P=0.08 and P=0.42). However, when participants' age, sex, race, education level, and support level were accounted for, mixed modeling indicated a significant increase in total HEI-2010 scores for the enhanced Stop Light Diet and conventional diet groups combined during the 18-month intervention (P=0.01 for time effect). The results of this study found that after controlling for demographic factors, individuals with IDDs can decrease their energy intake and increase their diet quality, with no significant differences between the enhanced Stop Light Diet and conventional diet groups. Copyright © 2018 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

Why Do Only Some Women Develop Post Menopausal Osteoporosis

DTIC Science & Technology

2016-03-01

rat model, a high fructose diet was chosen. High fructose diet has been shown to produce increased levels of AGEs (pentosidine, carbodymethyllysine...endproducts, bone remodeling, bone mineral density, high fructose diet ...sixty rats 3b. Start the controlled research diets - Normal diet groups (3x n of 10) and High Fructose Diet groups (3x n of 10 3c. at the end of

Stroke Prevention & Treatment: Diet & Nutrition

MedlinePlus

... Diet & Nutrition Advertising Policy Stroke Prevention & Treatment: Diet & Nutrition A healthy diet can reduce your risk for ... Dysphagia How does a stroke affect eating and nutrition? Stroke can devastate a person's nutritional health because ...

Healthy diet: Health impact, prevalence, correlates, and interventions.

PubMed

de Ridder, Denise; Kroese, Floor; Evers, Catharine; Adriaanse, Marieke; Gillebaart, Marleen

2017-08-01

To discuss healthy diet from a psychological perspective by considering definitions of healthy diet in terms of consumer understanding; the health effects of specific dietary elements in terms of overweight and (chronic) illness; the prevalence of healthy diet; the psychological and environmental determinants of healthy diet; and the psychological interventions that have been designed to promote healthy diet. A systematic review of the psychological literature on healthy diet. Our findings suggest that consumers have a relatively poor understanding of a healthy diet. The literature also demonstrates that there is poor evidence on the health protective effects of single foods or nutrients. We further show that low SES is the single consistent risk factor for not adhering to a healthy diet. Our review of the literature on determinants demonstrates that intentions, habits, self-regulatory skills, and the social and physical environment are the most important determinants of a healthy diet, which are in turn amenable to change by intervention strategies with varying levels of effectiveness. Educational interventions generally show a limited effect on practising a healthy diet whereas interventions targeting habitual behaviour and/or the physical environment seem more promising. In view of the large number of people who are concerned about their diets and make attempts to change their dietary patterns, we conclude that it is crucial to gain a better understanding of both the automatic and environmental influences that are responsible for people not acting upon their good intentions for diet change.

Combined influence of healthy diet and active lifestyle on cardiovascular disease risk factors in adolescents.

PubMed

Cuenca-García, M; Ortega, F B; Ruiz, J R; González-Gross, M; Labayen, I; Jago, R; Martínez-Gómez, D; Dallongeville, J; Bel-Serrat, S; Marcos, A; Manios, Y; Breidenassel, C; Widhalm, K; Gottrand, F; Ferrari, M; Kafatos, A; Molnár, D; Moreno, L A; De Henauw, S; Castillo, M J; Sjöström, M

2014-06-01

To investigate the combined influence of diet quality and physical activity on cardiovascular disease (CVD) risk factors in adolescents, adolescents (n = 1513; 12.5-17.5 years) participating in the Healthy Lifestyle in Europe by Nutrition in Adolescence study were studied. Dietary intake was registered using a 24-h recall and a diet quality index was calculated. Physical activity was assessed by accelerometry. Lifestyle groups were computed as: healthy diet and active, unhealthy diet but active, healthy diet but inactive, and unhealthy diet and inactive. CVD risk factor measurements included cardiorespiratory fitness, adiposity indicators, blood lipid profile, blood pressure, and insulin resistance. A CVD risk score was computed. The healthy diet and active group had a healthier cardiorespiratory profile, fat mass index (FMI), triglycerides, and high-density lipoprotein cholesterol (HDL-C) levels and total cholesterol (TC)/HDL-C ratio (all P ≤ 0.05). Overall, active adolescents showed higher cardiorespiratory fitness, lower FMI, TC/HDL-C ratio, and homeostasis model assessment index and healthier blood pressure than their inactive peers with either healthy or unhealthy diet (all P ≤ 0.05). Healthy diet and active group had healthier CVD risk score compared with the inactive groups (all P ≤ 0.02). Thus, a combination of healthy diet and active lifestyle is associated with decreased CVD risk in adolescents. Moreover, an active lifestyle may reduce the adverse consequences of an unhealthy diet. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A randomized controlled trial to evaluate the effects of high Protein Complete (lActo) VEgetaRian (PACER) diet in non-diabetic obese Asian Indians in North India.

PubMed

Bhardwaj, Swati; Misra, Anoop; Gulati, Seema; Anoop, Shajith; Kamal, Vineet Kumar; Pandey, Ravindra Mohan

2017-12-01

In view of the increasing prevalence of obesity in largely vegetarian Asian Indians, it is important to research a high protein, low carbohydrate vegetarian diet. The present study was designed to evaluate the effects of a "High P rotein C omplete (lacto) V E geta R ian Diet (Acronym; 'PACER diet'), on weight, body composition and metabolic profiles in non-diabetic obese Asian Indians living in north India. In this 8-week randomized control trial, 102 vegetarian subjects with body mass index (BMI) >25 kg/m 2 were randomized to either a test diet (PACER diet; high protein, high fat and moderately low carbohydrate, lacto-vegetarian diet) or control diet (standard vegetarian diet formulated as the dietary guidelines for Asian Indians) after 4 weeks of diet and exercise run-in period. A standard exercise protocol was followed for both groups. Body weight, BMI, waist circumference (WC), blood pressure, fasting plasma glucose (FPG), fasting serum insulin and lipid profile were assessed before and after the intervention. There was significant weight loss along with improvements in cardio-metabolic risk factors among both the groups post intervention. Percent reductions in the intervention group for weight (6.1± 2.9; p < 0.001), WC (3.9 ± 1.7; p < 0.001), FPG (5.9 ± 3.2; p < 0.001), total cholesterol (10.2 ± 6.3: p < 0.001), serum triacylglycerol (13.6 ± 10.6; p < 0.001) and low-density lipoprotein cholesterol (11.9 ± 7.1; p < 0.001]) were significantly greater than the control diet group. In summary, intervention with a PACER diet (high protein, high fat and moderately low carbohydrate, lacto-vegetarian diet) showed significant improvement in weight loss, body composition and cardio-metabolic profile as compared to a standard vegetarian diet among obese Asian Indians in north India.

Diet-induced increases in chemerin are attenuated by exercise and mediate the effect of diet on insulin and HOMA-IR

PubMed Central

Lloyd, Jesse W.; Zerfass, Kristy M.; Heckstall, Ebony M.; Evans, Kristin A.

2015-01-01

Objectives: Chemerin concentrations are elevated in obesity and associated with inflammation and insulin resistance. Exercise improves insulin sensitivity, which may be facilitated by changes in chemerin. We explored the effects of chronic exercise on chemerin levels in diet-induced obese mice. Methods: We divided 40 mice into 4 groups: high-fat diet/exercise, high-fat diet/sedentary, normal diet/exercise, and normal diet/sedentary. A 9-week dietary intervention was followed by a 12-week exercise intervention (treadmill run: 11 m/min for 30 min, 3×/week). We analyzed blood samples before and after the exercise intervention. We used t-tests and linear regression to examine changes in chemerin, insulin resistance, and inflammatory markers, and associations between changes in chemerin and all other biomarkers. Results: Chemerin increased significantly across all mice over the 12-week intervention (mean ± SD = 40.7 ± 77.8%, p = 0.01), and this increase was smaller in the exercise versus sedentary mice (27.2 ± 83.9% versus 54.9 ± 70.5%, p = 0.29). The increase among the high-fat diet/exercise mice was ~44% lower than the increase among the high-fat diet/sedentary mice (55.7 ± 54.9% versus 99.8 ± 57.7%, p = 0.12). The high-fat diet mice showed significant increases in insulin (773.5 ± 1286.6%, p < 0.0001) and homeostatic model assessment of insulin resistance (HOMA-IR; 846.5 ± 1723.3%, p < 0.01). Mediation analyses showed that increases in chemerin explained a substantial amount of the diet-induced increases in insulin and HOMA-IR. Conclusion: Chronic exercise may attenuate diet-driven increases in circulating chemerin, and the insulin resistance associated with a high-fat diet may be mediated by diet-induced increases in chemerin. PMID:26445641

A Maternal Low-Fiber Diet Predisposes Offspring to Improved Metabolic Phenotypes in Adulthood in an Herbivorous Rodent.

PubMed

Zhang, Xue-Ying; Lou, Mei-Fang; Shen, Wei; Fu, Rong-Shu; Wang, De-Hua

The maternal or paternal dietary composition can have important effects on various aspects of their offspring's physiology. Studies from animal models and humans showed that a maternal high-fiber diet protected offspring against fat accumulation. However, little is known about how a maternal low-fiber diet modifies the metabolism of offspring in herbivorous rodents. We hypothesized that a maternal low-fiber diet would confer long-lasting beneficial effects on offspring metabolic phenotypes in herbivorous Brandt's vole (Lasiopodomys brandtii). Female voles were fed either a control (12.4% fiber) or a low-fiber (3.5% fiber) diet throughout pregnancy and lactation, and all offspring were fed the control diet after weaning till 14 wk old. Offspring were sampled from each litter at 18 d and 14 wk of age. Another subset of adult offspring at 15 wk of age was fed a high-fat diet for 8 wk. We found that there was no difference in litter size, litter mass, or pup mass before weaning between the two maternal diet groups. Offspring from the maternal low-fiber diet increased energy intake, body mass, and lean mass; suppressed fat accumulation; and improved glucose tolerance compared with those from the control diet. Moreover, the maternal low-fiber diet alleviated high-fat diet-induced obesity in the adult offspring. Serum leptin concentration and uncoupling protein 1 content in brown adipose tissue of offspring were not affected by a maternal low-fiber diet. We demonstrate that herbivorous females fed a low-fiber diet during pregnancy and lactation may predispose their offspring to accelerated growth of lean tissue, which may increase the opportunity for survival and reproduction in offspring.

Effects of high-impact exercise on the physical properties of bones of ovariectomized rats fed to a high-protein diet.

PubMed

Shimano, R C; Yanagihara, G R; Macedo, A P; Yamanaka, J S; Shimano, A C; Tavares, J M R S; Issa, J P M

2018-05-01

The aim of this study was to evaluate the effects of high-impact physical exercise as a prophylactic and therapeutic means in osteopenic bones of rats submitted to ovariectomy and protein diet intake. A total of 64 Wistar rats were divided into eight groups (n = 8 each), being: OVX, ovx, standard diet and sedentary; OVXE, ovx, standard diet and jump; OVXP, ovx, high-protein diet and sedentary; and OVXEP, ovx, high-protein diet and jump; SH, sham, standard diet and sedentary; SHE, sham, standard diet and jump; SHP, sham, high-protein diet and sedentary; and SHEP, sham, high-protein diet and jump. OVX surgery consists of ovariectomy, and sham was the control surgery. The jumping protocol consisted of 20 jumps/day, 5 days/week. The bone structure was evaluated by densitometry, mechanical tests, histomorphometric, and immunohistochemical analyses. A high-protein diet resulted in increased bone mineral density (P = .049), but decreased maximal load (P = .026) and bone volume fraction (P = .023). The benefits of physical exercise were demonstrated by higher values of the maximal load in the trained groups compared to the sedentary groups (P < .001). The sham groups had decreased immunostaining of osteocalcin (P = .004) and osteopontin (P = .010) compared to ovx groups. However, the high-protein diet (P = .005) and jump exercise (P = .017) resulted in lower immunostaining of osteopontin compared to the standard diet and sedentary groups, respectively. In this experimental model, it was concluded that ovariectomy and a high-fat diet can negatively affect bone tissue and the high-impact exercise was not enough to suppress the deleterious effects caused by the protein diet and ovariectomy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Greater adherence to a Mediterranean diet is associated with lower prevalence of colorectal adenomas in men of all races.

PubMed

Haslam, Alyson; Robb, Sara Wagner; Hébert, James R; Huang, Hanwen; Ebell, Mark H

2017-12-01

To examine potential racial differences in Mediterranean diet scores and whether these differences are associated with the prevalence of colorectal adenoma (CRA), a cross-sectional analysis of data from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial was performed. The authors hypothesize that people consuming a more Mediterranean-like diet have lower odds of CRA. Flexible sigmoidoscopy was used to determine the presence of colorectal adenoma. Mediterranean diet scores were calculated from food frequency questionnaire responses. Logistic regression was used to determine the association between Mediterranean diet scores and the odds of prevalent CRA, as well as the joint effects of race and diet. Asians, followed by blacks, had higher Mediterranean diet scores than whites. Generally, men with better Mediterranean diet scores (altMED) had lower odds of CRA, but black and Asian men had even lower odds of prevalent CRA with better altMED diet scores than did white men with higher altMED diet scores. In this study population, all men had lower odds of prevalent CRA, but black and Asian men, who had higher (more favorable) altMED diet scores than whites, had even lower odds of prevalent CRA compared with white men. An altMED diet prescription may be especially beneficial for certain subpopulations who may be at higher risk of CRA. Copyright © 2017 Elsevier Inc. All rights reserved.

Influence of a low- and a high-oxalate vegetarian diet on intestinal oxalate absorption and urinary excretion.

PubMed

Thomas, E; von Unruh, G E; Hesse, A

2008-09-01

To compare quantitatively the effect of a low- and a high-oxalate vegetarian diet on intestinal oxalate absorption and urinary excretion. Eight healthy volunteers (three men and five women, mean age 28.6+/-6.3) were studied. Each volunteer performed the [(13)C(2)]oxalate absorption test thrice on a low-oxalate mixed diet, thrice on a low-oxalate vegetarian diet and thrice on a high-oxalate vegetarian diet. For each test, the volunteers had to adhere to an identical diet and collect their 24-h urines. In the morning of the second day, a capsule containing [(13)C(2)]oxalate was ingested. On the low-oxalate vegetarian diet, mean intestinal oxalate absorption and urinary oxalate excretion increased significantly to 15.8+/-2.9% (P=0.012) and 0.414+/-0.126 mmol/day (P=0.012), compared to the mixed diet. On the high-oxalate vegetarian diet, oxalate absorption (12.5+/-4.6%, P=0.161) and urinary excretion (0.340+/-0.077 mmol/day, P=0.093) did not change significantly, compared to the mixed diet. A vegetarian diet can only be recommended for calcium oxalate stone patients, if the diet (1) contains the recommended amounts of divalent cations such as calcium and its timing of ingestion to a meal rich in oxalate is considered and (2) excludes foodstuffs with a high content of nutritional factors, such as phytic acid, which are able to chelate calcium.

Adherence to a low-fat vs. low-carbohydrate diet differs by insulin resistance status.

PubMed

McClain, A D; Otten, J J; Hekler, E B; Gardner, C D

2013-01-01

Previous research shows diminished weight loss success in insulin-resistant (IR) women assigned to a low-fat (LF) diet compared to those assigned to a low-carbohydrate (LC) diet. These secondary analyses examined the relationship between insulin-resistance status and dietary adherence to either a LF-diet or LC-diet among 81 free-living, overweight/obese women [age = 41.9 ± 5.7 years; body mass index (BMI) = 32.6 ± 3.6 kg/m(2)]. This study found differential adherence by insulin-resistance status only to a LF-diet, not a LC-diet. IR participants were less likely to adhere and lose weight on a LF-diet compared to insulin-sensitive (IS) participants assigned to the same diet. There were no significant differences between IR and IS participants assigned to LC-diet in relative adherence or weight loss. These results suggest that insulin resistance status may affect dietary adherence to weight loss diets, resulting in higher recidivism and diminished weight loss success of IR participants advised to follow LF-diets for weight loss. © 2012 Blackwell Publishing Ltd.

What maternal factors influence the diet of 2-year-old children living in deprived areas? A cross-sectional survey.

PubMed

Crombie, Iain K; Kiezebrink, Kirsty; Irvine, Linda; Wrieden, Wendy L; Swanson, Vivien; Power, Kevin; Slane, Peter W

2009-08-01

To investigate the maternal factors associated with poor diet among disadvantaged children. Survey of 300 mothers of 2-year-old children from areas of high deprivation in Scotland (response rate 81 %). A diet quality score was derived from reported consumption of carbohydrates, protein, fruit and vegetables, dairy products and restriction of sugary fatty foods. Most children (85 %) were classified as having a poor quality diet (low diet quality score). Mothers' general knowledge about healthy eating was high, but did not predict the quality of the children's diet. Lower frequencies of food preparation and serving, such as cooking with raw ingredients, providing breakfast daily and the family eating together, were also associated with a poorer diet. Regression modelling identified five significant factors. An increased risk of a poor diet was associated with mothers being unlikely to restrict sweets (OR = 21.63, 95 % CI 2.70, 173.30) or finding it difficult to provide 2-3 portions of fruit daily (OR = 2.94, 95 % CI 1.09, 7.95). Concern that the child did not eat enough increased the risk of a poor diet (OR = 2.37, 95 % CI 1.09, 5.16). Believing a healthy diet would help the child eat more reduced the risk of having a poor diet (OR = 0.28, 95 % CI 0.11, 0.74), as did providing breakfast daily (OR = 0.22, 95 % CI 0.05, 0.99). Interventions to improve children's diet could promote more positive intentions about preparing and serving of foods, particularly of specific meals at which the family eats together. The benefits of these behaviours to the child (improved diet, weight control) should be emphasised.

Corticosterone administration in drinking water decreases high-fat diet intake but not preference in male rats.

PubMed

Boersma, Gretha J; Tamashiro, Kellie L; Moran, Timothy H; Liang, Nu-Chu

2016-04-15

One of the mechanisms through which regular exercise contributes to weight maintenance could be by reducing intake and preference for high-fat (HF) diets. Indeed, we previously demonstrated that wheel-running rats robustly reduced HF diet intake and preference. The reduced HF diet preference by wheel running can be so profound that the rats consumed only the chow diet and completely avoided the HF diet. Because previous research indicates that exercise activates the hypothalamic-pituitary-adrenal axis and increases circulating levels of corticosterone, this study tested the hypothesis that elevation of circulating corticosterone is involved in wheel running-induced reduction in HF diet preference in rats.Experiment 1 measured plasma corticosterone levels under sedentary and wheel-running conditions in the two-diet-choice (high-carbohydrate chow vs. HF) feeding regimen. The results revealed that plasma corticosterone is significantly increased and positively correlated with the levels of running in wheel-running rats with two-diet choice.Experiments 2 and 3 determined whether elevated corticosterone without wheel running is sufficient to reduce HF diet intake and preference. Corticosterone was elevated by adding it to the drinking water. Compared with controls, corticosterone-drinking rats had reduced HF diet intake and body weight, but the HF diet preference between groups did not differ. The results of this study support a role for elevated corticosterone on the reduced HF diet intake during wheel running. The elevation of corticosterone alone, however, is not sufficient to produce a robust reduction in HF diet preference. Copyright © 2016 the American Physiological Society.

Effects of diet macronutrient composition on body composition and fat distribution during weight maintenance and weight loss.

PubMed

Goss, Amy M; Goree, Laura Lee; Ellis, Amy C; Chandler-Laney, Paula C; Casazza, Krista; Lockhart, Mark E; Gower, Barbara A

2013-06-01

Qualitative aspects of diet may affect body composition and propensity for weight gain or loss. We tested the hypothesis that consumption of a relatively low glycemic load (GL) diet would reduce total and visceral adipose tissue under both eucaloric and hypocaloric conditions. Participants were 69 healthy overweight men and women. Body composition was assessed by DXA and fat distribution by CT scan at baseline, after 8 weeks of a eucaloric diet intervention, and after 8 weeks of a hypocaloric (1000 kcal/day deficit) diet intervention. Participants were provided all food for both phases, and randomized to either a low GL diet (<45 points per 1000 kcal; n = 40) or high GL diet (>75 points per 1000 kcal, n = 29). After the eucaloric phase, participants who consumed the low GL diet had 11% less intra-abdominal fat (IAAT) than those who consumed the high GL diet (P < 0.05, adjusted for total fat mass and baseline IAAT). Participants lost an average of 5.8 kg during the hypocaloric phase, with no differences in the amount of weight loss with diet assignment (P = 0.39). Following weight loss, participants who consumed the low GL diet had 4.4% less total fat mass than those who consumed the high GL diet (P < 0.05, adjusted for lean mass and baseline fat mass). Consumption of a relatively low GL diet may affect energy partitioning, both inducing reduction in IAAT independent of weight change, and enhancing loss of fat relative to lean mass during weight loss. Copyright © 2012 The Obesity Society.

Effects of a High-Protein/Low-Carbohydrate Diet versus a Standard Hypocaloric Diet on Weight and Cardiovascular Risk Factors: Role of a Genetic Variation in the rs9939609 FTO Gene Variant.

PubMed

de Luis, Daniel Antonio; Aller, Rocío; Izaola, Olatz; Primo, David; Urdiales, Silvia; Romero, Enrique

2015-01-01

The common polymorphism rs9939609 of the fat mass- and obesity-associated gene (FTO) has been linked to obesity. Our aim was to investigate its role in weight loss after the administration of a high-protein/low-carbohydrate diet compared to a standard hypocaloric diet (1,000 kcal/day). During 9 months, 195 patients were randomly allocated to a high-protein hypocaloric diet (HP diet) and a standard hypocaloric diet (S diet). With the HP diet, BMI (-1.9 ± 1.2 vs. -2.10 ± 1.8; p < 0.05), weight (-6.5 ± 2.1 vs. -10.1 ± 4.1 kg; p < 0.05), fat mass (-3.9 ± 3.2 vs. -6.0 ± 3.4 kg; p < 0.05) and waist circumference (-5.7 ± 5.0 vs. -9.9 ± 5.5 cm; p < 0.05) decreased in both genotype groups (TT vs. AT + AA). With the S diet, BMI (-0.9 ± 1.1 vs. -1.8 ± 1.2; p < 0.05), weight (-3.2 ± 3.0 vs. -9.1 ± 3.6 kg; p < 0.05), fat mass (-3.0 ± 3.1 vs. -5.2 ± 3.1 kg; p < 0.05) and waist circumference (-3.1 ± 4.0 vs. -8.1 ± 4.9 cm; p < 0.05) decreased in both genotype groups. With the HP diet and in both genotype groups, glucose, insulin levels, homeostasis model assessment of insulin resistance (HOMA-IR), total cholesterol, triglycerides and low-density lipoprotein (LDL) decreased. With the S diet, total cholesterol and LDL decreased. Weight loss was better in A allele carriers than noncarriers, and metabolic improvement was better with the HP diet. © 2015 S. Karger AG, Basel.

Vegetarian Diet: Will It Help Me Lose Weight?

MedlinePlus

... Lifestyle Weight loss If I switch to a vegetarian diet, will I lose weight? Answers from Katherine Zeratsky, R.D., L.D. Not necessarily. A vegetarian diet is not inherently a weight-loss diet, but ...

The relationship between a Mediterranean diet and circulating adiponectin levels is influenced by cigarette smoking.

PubMed

Al-Attas, Omar Salem; Hussain, Tajamul; Al-Daghri, Nasser Mohammad; De Rosas, Edgard; Kazmi, Usamah; Vinodson, Benjamin

2013-01-01

Adherence to a Mediterranean diet has been shown to lower the risk of developing several chronic diseases. The ability to augment circulating adiponectin levels is proposed as an underlying mechanism mediating the beneficial effects of this diet. We aimed to examine whether the positive relationship between the Mediterranean diet and adiponectin is altered by cigarette smoking, taking potential confounders into consideration. Plasma adiponectin levels were enzymatically measured in 45 never smokers, 61 smokers and 34 ex-smokers who adhered to a Mediterranean style diet and in 41 never smokers who did not adhere to the diet. Plasma adiponectin levels increased significantly in nonsmoking diet adherents compared to nonsmoking non-diet adherents. Among the diet adherents adiponectin decreased significantly in both moderate and heavy smokers compared to never smokers and significantly increased in quitters compared to smokers. Multiple regression analysis, controlling for age, obesity, Mediterranean diet and insulin resistance revealed an independent inverse association of smoking with adiponectin. Adiponectin levels remained significant and similar in subjects stratified according to age (50 years), BMI (25 kg/m(2)) and HOMA-IR (1.6). Despite its positive effects on adiponectin, the Mediterranean diet failed to negate the adiponectin-lowering effect of cigarette smoking, demonstrating the profound and independent capacity of cigarette smoke to negatively influence human health.

Conditioned aversion of aluminum sulfate in black ducks

USGS Publications Warehouse

Sparling, D.W.

1990-01-01

Three experiments were conducted to determine if reduced consumption of foods with elevated Al levels by black ducks (Anas rubripes) was due to taste aversion, conditioned taste aversion or malaise. Black ducks preferred a diet with 1,000 ppm Al over a control diet but ate less of a diet with 5,000 ppm Al. Prior experience with the high Al diet enhanced preference for the control diet. Changes in body weight and food consumption through time suggested that aversion to the high Al diet was a conditioned response to mild malaise.

Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer

DTIC Science & Technology

2013-04-01

palatable ω3 FA diet for the mice in our study. A key finding was that switching a lard-based diet to a cocoa butter based diet eliminated the feeding...differences. The cocoa butter diet gives a more solid food pellet than the lard-based diet and is more palatable to the mice. Mice on a diet rich in...fat pad may involve production of TNF-α by SVCs or adipocytes and we intend to pursue this result in future studies. As we now have good data that

The Influence of Peers on Diet and Exercise Among Adolescents: A Systematic Review.

PubMed

Chung, Sophia Jihey; Ersig, Anne L; McCarthy, Ann Marie

Adolescents' diet and exercise are modifiable factors contributing to high rates of adolescent obesity. Diverse contextual factors, including family, social environment, and peers, affect adolescents' diet and exercise behaviors. Because peer influence increases during adolescence, peers' contributions to adolescents' diet and exercise behaviors should be examined as potential targets for intervention to reduce the prevalence of adolescent obesity. The purpose of this systematic review is to identify research examining the contribution of peers to diet and exercise of adolescents. The electronic databases PubMed, CINAHL, Web of Science, and SCOPUS were searched. A total of 24 unique articles were included: seven examined diet only, fourteen studied exercise only, and three explored diet and exercise. This review provided evidence that diet and exercise of adolescents were significantly associated with those of their peers. However, these associations differed depending on gender, the type of diet and exercise, and closeness of friends. Findings from this review suggest that peers could be possible targets for interventions to promote healthier diet and exercise among adolescents; however, more studies are needed to identify specific peer influences and develop tailored interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

Controversies and Recent Developments of the Low-FODMAP Diet

PubMed Central

Hill, Peta; Muir, Jane G.

2017-01-01

The low–fermentable oligo-, di-, and monosaccharide and polyol (FODMAP) diet is a 2-phased intervention, with strict reduction of all slowly absorbed or indigestible short-chain carbohydrates (ie, FODMAPs) followed by reintroduction of specific FODMAPs according to tolerance. The efficacy of the elimination phase of the FODMAP diet is well established, but the success of maintaining this diet has been shown in only a few observational studies. How the efficacy of the low-FODMAP diet compares with that of other therapies has received limited attention, but recent studies have shown this diet to be comparable or superior to diets that address eating style and choice of food as well as to gut hypnotherapy. There has been no comparison between the low-FODMAP diet and the gluten-free diet, which moderately reduces FODMAP intake. Mechanistically, dietary FODMAPs have very limited effects on the consistency of bowel actions but seem to suppress the release of histamine. Neither symptom pattern nor breath hydrogen testing for fructose or polyol malabsorption is a useful predictor of efficacy, but analysis of gut microbiota has potential. As a restrictive diet, the low-FODMAP diet carries risks of nutritional inadequacy and of fostering disordered eating, which has received little attention. Strict FODMAP restriction induces a potentially unfavorable gut microbiota, although the impact of this consequence upon health is unknown. This observation puts additional impetus on the reintroduction of FODMAPs according to tolerance during the maintenance phase of the diet. Studies of the low-FODMAP diet in children are few but do suggest benefit. However, such a strategy should be implemented with care due to the psychological and nutritional risks of a restrictive diet. Clinical wisdom is required in utilizing the low-FODMAP diet. PMID:28420945

Diet-induced increases in chemerin are attenuated by exercise and mediate the effect of diet on insulin and HOMA-IR.

PubMed

Lloyd, Jesse W; Zerfass, Kristy M; Heckstall, Ebony M; Evans, Kristin A

2015-10-01

Chemerin concentrations are elevated in obesity and associated with inflammation and insulin resistance. Exercise improves insulin sensitivity, which may be facilitated by changes in chemerin. We explored the effects of chronic exercise on chemerin levels in diet-induced obese mice. We divided 40 mice into 4 groups: high-fat diet/exercise, high-fat diet/sedentary, normal diet/exercise, and normal diet/sedentary. A 9-week dietary intervention was followed by a 12-week exercise intervention (treadmill run: 11 m/min for 30 min, 3×/week). We analyzed blood samples before and after the exercise intervention. We used t-tests and linear regression to examine changes in chemerin, insulin resistance, and inflammatory markers, and associations between changes in chemerin and all other biomarkers. Chemerin increased significantly across all mice over the 12-week intervention (mean ± SD = 40.7 ± 77.8%, p = 0.01), and this increase was smaller in the exercise versus sedentary mice (27.2 ± 83.9% versus 54.9 ± 70.5%, p = 0.29). The increase among the high-fat diet/exercise mice was ~44% lower than the increase among the high-fat diet/sedentary mice (55.7 ± 54.9% versus 99.8 ± 57.7%, p = 0.12). The high-fat diet mice showed significant increases in insulin (773.5 ± 1286.6%, p < 0.0001) and homeostatic model assessment of insulin resistance (HOMA-IR; 846.5 ± 1723.3%, p < 0.01). Mediation analyses showed that increases in chemerin explained a substantial amount of the diet-induced increases in insulin and HOMA-IR. Chronic exercise may attenuate diet-driven increases in circulating chemerin, and the insulin resistance associated with a high-fat diet may be mediated by diet-induced increases in chemerin.

Acceptability of a low-fat vegan diet compares favorably to a step II diet in a randomized, controlled trial.

PubMed

Barnard, Neal D; Scialli, Anthony R; Turner-McGrievy, Gabrielle; Lanou, Amy J

2004-01-01

This study aimed to assess the acceptability of a low-fat vegan diet, as compared with a more typical fat-modified diet, among overweight and obese adults. Through newspaper advertisements, 64 overweight, postmenopausal women were recruited, 59 of whom completed the study. The participants were assigned randomly to a low-fat vegan diet or, for comparison, to a National Cholesterol Education Program Step II (NCEP) diet. At baseline and 14 weeks later, dietary intake, dietary restraint, disinhibition, and hunger, as well as the acceptability and perceived benefits and adverse effects of each diet were assessed. Dietary restraint increased in the NCEP group (P <.001), indicating a greater subjective sense of constraint with regard to diet requirements, but was unchanged in the vegan group. Disinhibition and hunger scores fell in each group (P <.001 and P <.01, respectively). The acceptability of both diets was high, although the vegan group participants rated their diet as less easy to prepare than their usual diets (P <.05) and the NCEP participants foresaw continuation of their assigned diet to be more difficult than continuation of their baseline diets (P <.05). There were no between-group differences on any acceptability measures. The acceptability of a low-fat vegan diet is high and not demonstrably different from that of a more moderate low-fat diet among well-educated, postmenopausal women in a research environment.

Diet and Nutrition in Porphyria

MedlinePlus

... the APF You are here Home Diet and Nutrition A proper diet is important to all individuals, ... alter food intake. Therefore, attention to diet and nutrition is important in almost any disease. Porphyrias are ...

Subjective satiety and other experiences of a Paleolithic diet compared to a diabetes diet in patients with type 2 diabetes.

PubMed

Jönsson, Tommy; Granfeldt, Yvonne; Lindeberg, Staffan; Hallberg, Ann-Christine

2013-07-29

We found marked improvement of glycemic control and several cardiovascular risk factors in patients with type 2 diabetes given advice to follow a Paleolithic diet, as compared to a diabetes diet. We now report findings on subjective ratings of satiety at meal times and participants' other experiences of the two diets from the same study. In a randomized cross-over study, 13 patients with type 2 diabetes (3 women and 10 men), were instructed to eat a Paleolithic diet based on lean meat, fish, fruits, vegetables, root vegetables, eggs and nuts, and a diabetes diet designed in accordance with dietary guidelines, during two consecutive 3-month periods. In parallel with a four-day weighed food record, the participants recorded their subjective rating of satiety. Satiety quotients were calculated as the intra-meal quotient of change in satiety during a meal and consumed energy or weight of food and drink for that specific meal. All participants answered the same three open-ended questions in a survey following each diet: "What thoughts do you have about this diet?", "Describe your positive and negative experiences with this diet" and "How do you think this diet has affected your health?". The participants were equally satiated on both diets. The Paleolithic diet resulted in greater satiety quotients for energy per meal (p = 0.004), energy density per meal (p = 0.01) and glycemic load per meal (p = 0.02). The distribution of positive and negative comments from the survey did not differ between the two diets, and the comments were mostly positive. Among comments relating to recurring topics, there was no difference in distribution between the two diets for comments relating to tastelessness, but there was a trend towards more comments on the Paleolithic diet being satiating and improving blood sugar values, and significantly more comments on weight loss and difficulty adhering to the Paleolithic diet. A Paleolithic diet is more satiating per calorie than a diabetes diet in patients with type 2 diabetes. The Paleolithic diet was seen as instrumental in weight loss, albeit it was difficult to adhere to.

Treatment of Diabetic Mice with a Combination of Ketogenic Diet and Aerobic Exercise via Modulations of PPARs Gene Programs

PubMed Central

Xu, Lingyan; Xia, Jie; Wang, Dongmei; Qian, Min

2018-01-01

Type 2 diabetes is a prevalent chronic disease arising as a serious public health problem worldwide. Diet intervention is considered to be a critical strategy in glycemic control of diabetic patients. Recently, the low-carbohydrate ketogenic diet is shown to be effective in glycemic control and weight loss. However, hepatic lipid accumulation could be observed in mice treated with ketogenic diet. On the other hand, exercise is a well-known approach for treating nonalcoholic fatty liver disease. We thus hypothesize that the combination of ketogenic diet and exercise could improve insulin sensitivity, while minimizing adverse effect of hepatic steatosis. In order to test this hypothesis, we established diabetic mice model with streptozotocin (STZ) and divided them into control group, ketogenic diet group, and ketogenic diet with aerobic exercise group. We found that after six weeks of intervention, mice treated with ketogenic diet and ketogenic diet combined with exercise both have lower body weights, HbAlc level, HOMA index, and improvements in insulin sensitivity, compared with diabetes group. In addition, mice in ketogenic diet intervention exhibited hepatic steatosis shown by serum and hepatic parameters, as well as histochemistry staining in the liver, which could be largely relieved by exercise. Furthermore, gene analysis revealed that ketogenic diet in combination with exercise reduced PPARγ and lipid synthetic genes, as well as enhancing PPARα and lipid β-oxidation gene program in the liver compared to those in ketogenic diet without exercise. Overall, the present study demonstrated that the combination of ketogenic diet and a moderate-intensity aerobic exercise intervention improved insulin sensitivity in diabetic mice, while avoiding hepatic steatosis, which provided a novel strategy in the combat of diabetes. PMID:29743883

High-Fat-Diet-Induced Deficits in Dopamine Terminal Function Are Reversed by Restoring Insulin Signaling.

PubMed

Fordahl, Steve C; Jones, Sara R

2017-02-15

Systemically released insulin crosses the blood-brain barrier and binds to insulin receptors on several neural cell types, including dopaminergic neurons. Insulin has been shown to decrease dopamine neuron firing in the ventral tegmental area (VTA), but potentiate release and reuptake at dopamine terminals in the nucleus accumbens (NAc). Here we show that prolonged consumption of a high fat diet blocks insulin's effects in the NAc, but insulin's effects are restored by inhibiting protein tyrosine phosphatase 1B, which supports insulin receptor signaling. Mice fed a high fat diet (60% kcals from fat) displayed significantly higher fasting blood glucose 160 mg/dL, compared to 101 mg/dL for control-diet-fed mice, and high-fat-diet-fed mice showed reduced blood glucose clearance after an intraperitoneal glucose tolerance test. Using fast scan cyclic voltammetry to measure electrically evoked dopamine in brain slices containing the NAc core, high-fat-diet-fed mice exhibited slower dopamine reuptake compared to control-diet-fed mice (2.2 ± 0.1 and 2.67 ± 0.15 μM/s, respectively). Moreover, glucose clearance rate was negatively correlated with V max . Insulin (10 nM to 1 μM) dose dependently increased reuptake rates in control-diet-fed mice compared with in the high-fat-diet group; however, the small molecule insulin receptor sensitizing agent, TCS 401 (300 nM), restored reuptake in high-fat-diet-fed mice to control-diet levels, and a small molecule inhibitor of the insulin receptor, BMS 536924 (300 nM), attenuated reuptake, similar to high-fat-diet-fed mice. These data show that a high-fat diet impairs dopamine reuptake by attenuating insulin signaling at dopamine terminals.

Characterisation of Atherogenic Effects of Low Carbohydrate, High Protein Diet (LCHP) in ApoE/LDLR-/- Mice.

PubMed

Kostogrys, R B; Johann, C; Czyżyńska, I; Franczyk-Żarów, M; Drahun, A; Maślak, E; Jasztal, A; Gajda, M; Mateuszuk, Ł; Wrobel, T P; Baranska, M; Wybrańska, I; Jezkova, K; Nachtigal, P; Chlopicki, S

2015-08-01

Low Carbohydrate High Protein diet represents a popular strategy to achieve weight loss. The aim of this study was to characterize effects of low carbohydrate, high protein diet (LCHP) on atherosclerotic plaque development in brachiocephalic artery (BCA) in apoE/LDLR-/- mice and to elucidate mechanisms of proatherogenic effects of LCHP diet. Atherosclerosis plaques in brachiocephalic artery (BCA) as well as in aortic roots, lipoprotein profile, inflammation biomarkers, expression of SREBP-1 in the liver as well as mortality were analyzed in Control diet (AIN-93G) or LCHP (Low Carbohydrate High Protein) diet fed mice. Area of atherosclerotic plaques in aortic roots or BCA from LCHP diet fed mice was substantially increased as compared to mice fed control diet and was characterized by increased lipids and cholesterol contents (ORO staining, FT-IR analysis), increased macrophage infiltration (MOMA-2) and activity of MMPs (zymography). Pro-atherogenic phenotype of LCHP fed apoE/LDLR-/- mice was associated with increased plasma total cholesterol concentration, and in LDL and VLDL fractions, increased TG contents in VLDL, and a modest increase in plasma urea. LCHP diet increased SCD-1 index, activated SREBP-1 transcription factor in the liver and triggered acute phase response as evidence by an increased plasma concentration of haptoglobin, CRP or AGP. Finally, in long-term experiment survival of apoE/LDLR-/- mice fed LCHP diet was substantially reduced as compared to their counterparts fed control diet suggesting overall detrimental effects of LCHP diet on health. The pro-atherogenic effect of LCHP diet in apoE/LDLR-/- mice is associated with profound increase in LDL and VLDL cholesterol, VLDL triglicerides, liver SREBP-1 upregulation, and systemic inflammation.

Blunted hypothalamic ghrelin signaling reduces diet intake in rats fed a low-protein diet in late pregnancy

USDA-ARS?s Scientific Manuscript database

Diet intake in pregnant rats fed a low-protein (LP) diet was significantly reduced during late pregnancy despite elevated plasma levels of ghrelin. In this study, we hypothesized that ghrelin signaling in the hypothalamus is blunted under a low-protein diet condition and therefore, it does not stimu...

Beneficial effect of low carbohydrate in low calorie diets on visceral fat reduction in type 2 diabetic patients with obesity.

PubMed

Miyashita, Yoh; Koide, Nobukiyo; Ohtsuka, Masaki; Ozaki, Hiroshi; Itoh, Yoshiaki; Oyama, Tomokazu; Uetake, Takako; Ariga, Kiyoko; Shirai, Kohji

2004-09-01

The adequate composition of carbohydrate and fat in low calorie diets for type 2 diabetes mellitus patients with obesity is not fully established. The aim of this study was to investigate the effects of low carbohydrate diet on glucose and lipid metabolism, especially on visceral fat accumulation, and comparing that of a high carbohydrate diet. Obese subjects with type 2 diabetes mellitus were randomly assigned to take a low calorie and low carbohydrate diet (n = 11, 1000 kcal per day, protein:carbohydrate:fat = 25:40:35) or a low calorie and high carbohydrate diet (n = 11, 1000 kcal per day, protein:carbohydrate:fat = 25:65:10) for 4 weeks. Similar decreases in body weight and serum glucose levels were observed in both groups. Fasting serum insulin levels were reduced in the low carbohydrate diet group compared to the high carbohydrate diet group (-30% versus -10%, P < 0.05). Total serum cholesterol and triglyceride levels decreased in both groups, but were not significantly different from each other. High-density lipoprotein-cholesterol (HDL-C) increased in the low carbohydrate diet group but not in the high carbohydrate diet group (+15% versus 0%, P < 0.01). There was a larger decrease in visceral fat area measured by computed tomography in the low carbohydrate diet group compared to the high carbohydrate diet group (-40 cm(2) versus -10 cm(2), P < 0.05). The ratio of visceral fat area to subcutaneous fat area did not change in the high carbohydrate diet group (from 0.70 to 0.68), but it decreased significantly in the low carbohydrate diet group (from 0.69 to 0.47, P < 0.005). These results suggest that, when restrict diet was made isocaloric, a low calorie/low carbohydrate diet might be more effective treatment for a reduction of visceral fat, improved insulin sensitivity and increased in HDL-C levels than low calorie/high carbohydrate diet in obese subjects with type 2 diabetes mellitus.

Hard-Diet Feeding Recovers Neurogenesis in the Subventricular Zone and Olfactory Functions of Mice Impaired by Soft-Diet Feeding

PubMed Central

Utsugi, Chizuru; Miyazono, Sadaharu; Osada, Kazumi; Sasajima, Hitoshi; Noguchi, Tomohiro; Matsuda, Mitsuyoshi; Kashiwayanagi, Makoto

2014-01-01

The subventricular zone (SVZ) generates an immense number of neurons even during adulthood. These neurons migrate to the olfactory bulb (OB) and differentiate into granule cells and periglomerular cells. The information broadcast by general odorants is received by the olfactory sensory neurons and transmitted to the OB. Recent studies have shown that a reduction of mastication impairs both neurogenesis in the hippocampus and brain functions. To examine these effects, we first measured the difference in Fos-immunoreactivity (Fos-ir) at the principal sensory trigeminal nucleus (Pr5), which receives intraoral touch information via the trigeminal nerve, when female adult mice ingested a hard or soft diet to explore whether soft-diet feeding could mimic impaired mastication. Ingestion of a hard diet induced greater expression of Fos-ir cells at the Pr5 than did a soft diet or no diet. Bromodeoxyuridine-immunoreactive (BrdU-ir) structures in sagittal sections of the SVZ and in the OB of mice fed a soft or hard diet were studied to explore the effects of changes in mastication on newly generated neurons. After 1 month, the density of BrdU-ir cells in the SVZ and OB was lower in the soft-diet-fed mice than in the hard-diet-fed mice. The odor preferences of individual female mice to butyric acid were tested in a Y-maze apparatus. Avoidance of butyric acid was reduced by the soft-diet feeding. We then explored the effects of the hard-diet feeding on olfactory functions and neurogenesis in the SVZ of mice impaired by soft-diet feeding. At 3 months of hard-diet feeding, avoidance of butyric acid was reversed and responses to odors and neurogenesis were recovered in the SVZ. The present results suggest that feeding with a hard diet improves neurogenesis in the SVZ, which in turn enhances olfactory function at the OB. PMID:24817277

High-Moisture Diet for Laboratory Rats: Nutrient Analysis, Growth, and Organ Weights

NASA Technical Reports Server (NTRS)

Battles, August H.; Knapka, Joseph T.; Lewis, Laura; Lang, Marie T.; Gruendel, Douglas J.

1991-01-01

A diet (KSC-25) to be sterilized by irradiation was formulated to contain 66% moisture and to provide the required nutrients for growing rats. Analyses of the irradiated dry diet provided data to evaluate its nutrient content. The diet was evaluated for its ability to supply all nutrients, including water, required by immature rats. Sixteen Sprague-Dawley rats were fed the high-moisture diet with or without access to a water bottle. Rats (n = 16) fed an irradiated purified diet in a meal form with access to a water bottle were the control animals. Feed efficiency, food and water consumption, and growth rate data were collected during the 28-day study. Organ weights were collected on day 28. The test diet met or exceeded the National Research Council (NRC) estimated nutritional requirements for immature laboratory rats. The 66% moisture KSC-25 diet provided all nutrients, including water, required by weanling male Sprague-Dawley rats for growth equivalent to the established purified diet.

Epilepsy characteristics and psychosocial factors associated with ketogenic diet success.

PubMed

McNamara, Nancy A; Carbone, Loretta A; Shellhaas, Renée A

2013-10-01

The ketogenic diet is an effective therapy for childhood epilepsy, but its important impacts on families could affect successful treatment. We assessed medical and psychosocial factors associated with successful ketogenic diet treatment. A total of 23 families of patients treated with ketogenic diet completed questionnaires (30% response), including inquiries about challenges to successful dietary treatments and validated family functioning scales. Of these, 14 were considered successful (diet discontinued once the child was seizure-free or continued as clinically indicated). Family-identified challenges were food preparation time (n = 11) and that the diet was too restrictive (n = 9). Neither Medicaid insurance nor family functioning scale scores were significantly associated with successful treatment. Lower seizure frequency prior to ketogenic diet initiation (P = .02) and postdiet seizure improvement (P = .01) were associated with increased odds of success. Effective ketogenic diet treatment is dictated both by psychosocial and epilepsy-related influences. A focus on understanding the psychosocial issues may help to improve families' experiences and success with the ketogenic diet.

Diet and Inflammatory Bowel Disease.

PubMed

Knight-Sepulveda, Karina; Kais, Susan; Santaolalla, Rebeca; Abreu, Maria T

2015-08-01

Patients with inflammatory bowel disease (IBD) are increasingly becoming interested in nonpharmacologic approaches to managing their disease. One of the most frequently asked questions of IBD patients is what they should eat. The role of diet has become very important in the prevention and treatment of IBD. Although there is a general lack of rigorous scientific evidence that demonstrates which diet is best for certain patients, several diets-such as the low-fermentable oligosaccharide, disaccharide, monosaccharide, and polyol diet; the specific carbohydrate diet; the anti-inflammatory diet; and the Paleolithic diet-have become popular. This article discusses the diets commonly recommended to IBD patients and reviews the supporting data.

Association of increased monetary cost of dietary intake, diet quality and weight management in Spanish adults.

PubMed

Schröder, Helmut; Serra-Majem, Luis; Subirana, Isaac; Izquierdo-Pulido, Maria; Fitó, Montserrat; Elosua, Roberto

2016-03-14

Higher monetary diet cost is associated with healthier food choices and better weight management. How changes in diet cost affect changes in diet quality and weight remains unknown. The aim of this study was to assess the impact of changes in individual monetary diet cost on changes in diet quality, measured by the modified Mediterranean diet score recommendations (MDS-rec) and by energy density (ED), as well as changes in weight and BMI. We conducted a prospective, population-based study of 2181 male and female Spaniards aged between 25 and 74 years, who were followed up to the 2009-2010 academic year. We measured weight and height and recorded dietary data using a validated FFQ. Average food cost was calculated from official Spanish government data. We fitted multivariate linear and logistic regression models. The average daily diet cost increased from 3·68(SD0.0·89)€/8·36 MJ to 4·97(SD1·16)€/8·36 MJ during the study period. This increase was significantly associated with improvement in diet quality (Δ ED and Δ MDS-rec; P<0·0001). Each 1€ increase in monetary diet cost per 8·36 MJ was associated with a decrease of 0·3 kg in body weight (P=0·02) and 0·1 kg/m(2) in BMI (P=0·04). These associations were attenuated after adjusting for changes in diet quality indicators. An improvement in diet quality and better weight management were both associated with an increase in diet cost; this could be considered in food policy decisions.

Should you recommend a low-carb, high-protein diet?

PubMed

Tapper-Gardzina, Yvonne; Cotugna, Nancy; Vickery, Connie E

2002-04-01

Despite the billions of dollars spent each year on weight-loss diets and products, few individuals maintain their weight loss after initiating popular diet programs. One diet that has raised safety concerns among the scientific community is the low-carbohydrate, high-protein diet. This article evaluates the scientific validity of this diet so that clinicians can appropriately advise patients.

Distinctive diet-tissue isotopic discrimination factors derived from the exclusive bamboo-eating giant panda.

PubMed

Han, Han; Wei, Wei; Nie, Yonggang; Zhou, Wenliang; Hu, Yibo; Wu, Qi; Wei, Fuwen

2016-11-01

Stable isotope analysis is very useful in animal ecology, especially in diet reconstruction and trophic studies. Differences in isotope ratios between consumers and their diet, termed discrimination factors, are essential for studies of stable isotope ecology and are species-specific and tissue-specific. Given the specialized bamboo diet and clear foraging behavior, here, we calculated discrimination factors for carbon and nitrogen isotopes from diet to tissues (tooth enamel, hair keratin and bone collagen) for the giant panda (Ailuropoda melanoleuca), a species derived from meat-eating ancestors. Our results showed that carbon discrimination factor obtained from giant panda tooth enamel (ε 13 C diet-enamel = 10.0‰) and nitrogen discrimination factors from hair keratin (Δ 15 N diet-hair = 2.2‰) and bone collagen (Δ 15 N diet-collagen = 2.3‰) were lower, and carbon discrimination factors from hair keratin (Δ 13 C diet-hair = 5.0‰) and bone collagen (Δ 13 C diet-collagen = 6.1‰) were higher than those of other mammalian carnivores, omnivores and herbivores. Such distinctive values are likely the result of a low-nutrient and specialized bamboo diet, carnivore-like digestive system and exceptionally low metabolism in giant pandas. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Effect of High Intensity Interval and Continuous Swimming Training on Body Mass Adiposity Level and Serum Parameters in High-Fat Diet Fed Rats.

PubMed

da Rocha, Guilherme L; Crisp, Alex H; de Oliveira, Maria R M; da Silva, Carlos A; Silva, Jadson O; Duarte, Ana C G O; Sene-Fiorese, Marcela; Verlengia, Rozangela

2016-01-01

This study aimed to investigate the effects of interval and continuous training on the body mass gain and adiposity levels of rats fed a high-fat diet. Forty-eight male Sprague-Dawley rats were randomly divided into two groups, standard diet and high-fat diet, and received their respective diets for a period of four weeks without exercise stimuli. After this period, the animals were randomly divided into six groups (n = 8): control standard diet (CS), control high-fat diet (CH), continuous training standard diet (CTS), continuous training high-fat diet (CTH), interval training standard diet (ITS), and interval training high-fat diet (ITH). The interval and continuous training consisted of a swimming exercise performed over eight weeks. CH rats had greater body mass gain, sum of adipose tissues mass, and lower serum high density lipoprotein values than CS. The trained groups showed lower values of feed intake, caloric intake, body mass gain, and adiposity levels compared with the CH group. No significant differences were observed between the trained groups (CTS versus ITS and CTH versus ITH) on body mass gains and adiposity levels. In conclusion, both training methodologies were shown to be effective in controlling body mass gain and adiposity levels in high-fat diet fed rats.

Individual diet has sex-dependent effects on vertebrate gut microbiota

PubMed Central

Bolnick, Daniel I.; Snowberg, Lisa K.; Hirsch, Philipp E.; Lauber, Christian L.; Org, Elin; Parks, Brian; Lusis, Aldons J.; Knight, Rob; Caporaso, J. Gregory; Svanbäck, Richard

2014-01-01

Vertebrates harbour diverse communities of symbiotic gut microbes. Host diet is known to alter microbiota composition, implying that dietary treatments might alleviate diseases arising from altered microbial composition (‘dysbiosis’). However, it remains unclear whether diet effects are general or depend on host genotype. Here we show that gut microbiota composition depends on interactions between host diet and sex within populations of wild and laboratory fish, laboratory mice and humans. Within each of two natural fish populations (threespine stickleback and Eurasian perch), among-individual diet variation is correlated with individual differences in gut microbiota. However, these diet–microbiota associations are sex dependent. We document similar sex-specific diet–microbiota correlations in humans. Experimental diet manipulations in laboratory stickleback and mice confirmed that diet affects microbiota differently in males versus females. The prevalence of such genotype by environment (sex by diet) interactions implies that therapies to treat dysbiosis might have sex-specific effects. PMID:25072318

Is a healthy diet an environmentally sustainable diet?

PubMed

Macdiarmid, Jennie I

2013-02-01

The concept of a healthy and environmentally sustainable diet is not new, but with increasing concern about future global food security and climate change there is a renewed interest in this topic. Dietary intakes in UK accounts for approximately 20-30% of total annual greenhouse gas emissions (GHGE), with the greatest contributions coming from high intakes of meat and dairy products. Dietary proposals to help mitigate climate change (i.e. reduce GHGE) have focused on reducing consumption of meat and dairy products, but this must be considered in the context of the whole diet, alongside any possible nutritional consequences for health. Bringing together health and environmental impact of the diet raises the question of whether a healthy diet can also be an environmentally sustainable diet. While recent research showed that it is possible to achieve a realistic diet that meets dietary requirement for health and has lower GHGE, it cannot be assumed that a healthy diet will always have lower GHGE. With different combinations of food it is possible to consume a diet that meets dietary requirements for health, but has high GHGE. It is important to understand what constitutes a sustainable diet, but this then needs to be communicated effectively to try and change well-established dietary intakes of the population. Studies show that understanding of sustainable diets is poor and there are many misconceptions (e.g. the overestimation of the protein requirements for a healthy diet), which could contribute to the barriers towards changing dietary intakes.

Does a low FODMAPs diet reduce symptoms of functional abdominal pain disorders? A systematic review in adult and paediatric population, on behalf of Italian Society of Pediatrics.

PubMed

Turco, Rossella; Salvatore, Silvia; Miele, Erasmo; Romano, Claudio; Marseglia, Gian Luigi; Staiano, Annamaria

2018-05-15

Despite the rising of the Functional Gastrointestinal Disorders (FGIDs)' incidence in the last years, the etio-pathogenesis of FGIDs remains unclear. The diet seems to play an important role in these disorders. Indeed, at least two thirds of adult patients with Irritable Bowel Syndrome (IBS) and of children with FGIDs perceive their GI symptoms to be food-related. In particular, in the last years, more interest has been focused in the low Fermentable Oligosaccharides, Disaccharides, Monosaccharides, and Polyol (FODMAPs) diet. To provide a systematic review on the efficacy of a low FODMAPs diet in reducing symptoms associated with functional abdominal pain disorders. Cochrane Library, MEDLINE (via Pubmed), and EMBASE databases from inception to June 2017 were searched. We included randomized controlled trials (RCTs), prospective and retrospective studies, systematic reviews and meta-analyses, reporting the efficacy of the FODMAPs diet intervention in FGIDs patients. Nineteen studies were eligible. A FODMAPs-restricted diet is beneficial in 12/13 intervention trials. The low FODMAPs diet improves overall GI symptoms, especially abdominal pain and bloating. In children, only one study reported positive results of a low FODMAPs diet. No effect was found for the lactose free diet whilst fructose-restricted diet was effective in 3/4 studies. The duration of the intervention was very different among the studies, ranging from 2 days to 16 months, and from 3 and 9 weeks for the RCTs. The majority of the trials presented differences in symptoms scoring scales, diet, food diaries, and food frequencies questionnaire. The FODMAPs-restricted diet may be an effective dietary intervention for reducing IBS symptoms in adults. In children, there are promising data, although only one randomized double-blind study exists and further data are needed to better clarify the role of FODMAPs and fructose-restricted diet in IBS. The current evidence does not support the use of a lactose-restricted diet in children with FGIDs.

A low carbohydrate, high protein diet suppresses intratumoral androgen synthesis and slows castration-resistant prostate tumor growth in mice.

PubMed

Fokidis, H Bobby; Yieng Chin, Mei; Ho, Victor W; Adomat, Hans H; Soma, Kiran K; Fazli, Ladan; Nip, Ka Mun; Cox, Michael; Krystal, Gerald; Zoubeidi, Amina; Tomlinson Guns, Emma S

2015-06-01

Dietary factors continue to preside as dominant influences in prostate cancer prevalence and progression-free survival following primary treatment. We investigated the influence of a low carbohydrate diet, compared to a typical Western diet, on prostate cancer (PCa) tumor growth in vivo. LNCaP xenograft tumor growth was studied in both intact and castrated mice, representing a more advanced castration resistant PCa (CRPC). No differences in LNCaP tumor progression (total tumor volume) with diet was observed for intact mice (P = 0.471) however, castrated mice on the Low Carb diet saw a statistically significant reduction in tumor growth rate compared with Western diet fed mice (P = 0.017). No correlation with serum PSA was observed. Steroid profiles, alongside serum cholesterol and cholesteryl ester levels, were significantly altered by both diet and castration. Specifically, DHT concentration with the Low Carb diet was 58% that of the CRPC-bearing mice on the Western diet. Enzymes in the steroidogenesis pathway were directly impacted and tumors isolated from intact mice on the Low Carb diet had higher AKR1C3 protein levels and lower HSD17B2 protein levels than intact mice on the Western diet (ARK1C3: P = 0.074; HSD17B2: P = 0.091, with α = 0.1). In contrast, CRPC tumors from mice on Low Carb diets had higher concentrations of both HSD17B2 (P = 0.016) and SRD5A1 (P = 0.058 with α = 0.1) enzymes. There was no correlation between tumor growth in castrated mice for Low Carb diet versus Western diet and (a) serum insulin (b) GH serum levels (c) insulin receptor (IR) or (d) IGF-1R in tumor tissue. Intact mice fed Western diet had higher serum insulin which was associated with significantly higher blood glucose and tumor tissue IR. We conclude that both diet and castration have a significant impact on the endocrinology of mice bearing LNCaP xenograft tumors. The observed effects of diet on cholesterol and steroid regulation impact tumor tissue DHT specifically and are likely to be mechanistic drivers behind the observed tumor growth suppression. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gum chewing combined with oral intake of a semi-liquid diet in the postoperative care of patients after gynaecologic laparoscopic surgery.

PubMed

Pan, Yuping; Chen, Li; Zhong, Xiaorong; Feng, Suwen

2017-10-01

To evaluate the effects of gum chewing combined with a semi-liquid diet on patients after gynaecologic laparoscopic surgery. Previous studies suggested that chewing gum before traditional postoperative care promotes the postoperative recovery of bowel motility and function after open and laparoscopic surgery. However, gum chewing combined with a semi-liquid diet has not been reported in postoperative care of patients following gynaecologic laparoscopic surgery. A prospective randomised study. Total 234 patients were randomly assigned after elective gynaecologic laparoscopic surgery to a gum chewing and semi-liquid diet group, a semi-liquid only diet group or a liquid diet group. The gum chewing and semi-liquid diet group chewed sugar-free gum with an oral intake of a semi-liquid diet six hours postoperatively. The semi-liquid only diet and liquid diet groups received a semi-liquid diet or a liquid diet, respectively. The time to first bowel sounds, time to first regular postoperative bowel sounds, time to first passage of flatus, time to first defecation, serum gastrin and incidences of hunger, nausea, vomiting and abdominal distension were recorded. Hunger and gastrointestinal sensations were assessed using a four-point scale. Serum gastrin was assayed pre- and postoperatively using a gastrin radioimmunoassay kit. The gum chewing and semi-liquid diet group had first bowel sounds, first regular bowel sounds, first passage of flatus and first defecation earlier than the semi-liquid only and liquid groups. Increased serum gastrin was observed in the gum chewing and semi-liquid diet group. Incidences of nausea, vomiting and abdominal distention were not significantly different between these groups. Chewing gum combined with an oral intake of a semi-liquid diet is safe and accelerates the postoperative recovery of bowel function. It might be recommended as a better postoperative care regimen for patients after gynaecologic laparoscopic surgery. This study developed a new postoperative diet regimen to improve the postoperative care of patients undergoing laparoscopic gynecologic surgery. © 2016 John Wiley & Sons Ltd.

Metabolic and physiologic effects from consuming a hunter-gatherer (Paleolithic)-type diet in type 2 diabetes.

PubMed

Masharani, U; Sherchan, P; Schloetter, M; Stratford, S; Xiao, A; Sebastian, A; Nolte Kennedy, M; Frassetto, L

2015-08-01

The contemporary American diet figures centrally in the pathogenesis of numerous chronic diseases--'diseases of civilization'--such as obesity and diabetes. We investigated in type 2 diabetes whether a diet similar to that consumed by our pre-agricultural hunter-gatherer ancestors ('Paleolithic' type diet) confers health benefits. We performed an outpatient, metabolically controlled diet study in type 2 diabetes patients. We compared the findings in 14 participants consuming a Paleo diet comprising lean meat, fruits, vegetables and nuts, and excluding added salt, and non-Paleolithic-type foods comprising cereal grains, dairy or legumes, with 10 participants on a diet based on recommendations by the American Diabetes Association (ADA) containing moderate salt intake, low-fat dairy, whole grains and legumes. There were three ramp-up diets for 7 days, then 14 days of the test diet. Outcomes included the following: mean arterial blood pressure; 24-h urine electrolytes; hemoglobin A1c and fructosamine levels; insulin resistance by euglycemic hyperinsulinemic clamp and lipid levels. Both groups had improvements in metabolic measures, but the Paleo diet group had greater benefits on glucose control and lipid profiles. Also, on the Paleo diet, the most insulin-resistant subjects had a significant improvement in insulin sensitivity (r = 0.40, P = 0.02), but no such effect was seen in the most insulin-resistant subjects on the ADA diet (r = 0.39, P = 0.3). Even short-term consumption of a Paleolithic-type diet improved glucose control and lipid profiles in people with type 2 diabetes compared with a conventional diet containing moderate salt intake, low-fat dairy, whole grains and legumes.

Ketogenic diet does not impair spatial ability controlled by the hippocampus in male rats.

PubMed

Fukushima, Atsushi; Ogura, Yuji; Furuta, Miyako; Kakehashi, Chiaki; Funabashi, Toshiya; Akema, Tatsuo

2015-10-05

A ketogenic diet was recently shown to reduce glutamate accumulation in synaptic vesicles, decreasing glutamate transmission. We questioned whether a ketogenic diet affects hippocampal function, as glutamate transmission is critically involved in visuospatial ability. In the present study, male Wistar rats were maintained on a ketogenic diet containing 10% protein and 90% fat with complements for 3 weeks to change their energy expenditure from glucose-dependent to fat-dependent. Control rats were fed a diet containing 10% protein, 10% fat, and 80% carbohydrates. The fat-dependent energy expenditure induced by the ketogenic diet led to decreased body weight and increased blood ketone production, though the rats in the two groups consumed the same number of calories. The ketogenic diet did not alter food preferences for the control or high-fat diet containing 10% protein, 45% fat, and 45% carbohydrates. Anxiety in the open field was not altered by ingestion the ketogenic diet. However, rats fed the ketogenic diet performed better in the Y-maze test than rats fed the control diet. No difference was observed between the two groups in the Morris water maze test. Finally, Western blot revealed that the hippocampal expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate receptor subunit 1 (GluR1) was significantly increased in mice fed a ketogenic diet. These results suggest that hippocampal function is not impaired by a ketogenic diet and we speculate that the fat-dependent energy expenditure does not impair visuospatial ability. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of diet macronutrient composition on body composition and fat distribution during weight maintenance and weight loss

PubMed Central

Goss, Amy M.; Goree, Laura Lee; Ellis, Amy C.; Chandler-Laney, Paula C.; Casazza, Krista; Lockhart, Mark E.; Gower, Barbara A.

2012-01-01

Qualitative aspects of diet may affect body composition and propensity for weight gain or loss. We tested the hypothesis that consumption of a relatively low glycemic load (GL) diet would reduce total and visceral adipose tissue under both eucaloric and hypocaloric conditions. Participants were 69 healthy overweight men and women. Body composition was assessed by DXA and fat distribution by CT scan at baseline, after 8 weeks of a eucaloric diet intervention, and after 8 weeks of a hypocaloric (1000 kcal/d deficit) diet intervention. Participants were provided all food for both phases, and randomized to either a low GL diet (≤45 points per 1000 kcal; n=40) or high GL diet (>75 points per 1000 kcal, n=29). After the eucaloric phase, participants who consumed the low GL diet had 11% less intra-abdominal fat (IAAT) than those who consumed the high GL diet (P<0.05, adjusted for total fat mass and baseline IAAT). Participants lost an average of 5.8 kg during the hypocaloric phase, with no differences in the amount of weight loss with diet assignment (P=0.39). Following weight loss, participants who consumed the low GL diet had 4.4% less total fat mass than those who consumed the high GL diet (P<0.05, adjusted for lean mass and baseline fat mass). Consumption of a relatively low GL diet may affect energy partitioning, both inducing reduction in IAAT independent of weight change, and enhancing loss of fat relative to lean mass during weight loss. PMID:23671029

Effects of withdrawing high-fiber ingredients before marketing on finishing pig growth performance, carcass characteristics, and intestinal weights.

PubMed

Coble, Kyle F; DeRouchey, Joel M; Tokach, Mike D; Dritz, Steve S; Goodband, Robert D; Woodworth, Jason C

2018-02-15

Two experiments were conducted to determine the duration of high-fiber ingredient removal from finishing pig diets before marketing to restore carcass yield and carcass fat iodine value (IV), similar to pigs continuously fed a corn-soybean meal diet. In experiment 1, 288 pigs (initially 38.4 ± 0.3 kg body weight [BW]) were used in an 88-d study and fed either a low-fiber corn-soybean meal diet from day 0 to 88 or a high-fiber diet containing 30% corn distillers dried grains with solubles and 19% wheat middlings until day 20, 15, 10, 5, or 0 before slaughter and switched to the low-fiber corn-soybean meal diet thereafter. Diets were not balanced for net energy. From day 0 to 88, pigs continuously fed the high-fiber diet tended to have increased average daily feed intake (P = 0.072) and decreased G:F and carcass yield (P = 0.001) compared with pigs fed the low-fiber corn-soybean meal diet. Pigs continuously fed the high-fiber diet had greater (P < 0.010) IV of jowl, backfat, belly, and ham collar fat than those fed the low-fiber corn-soybean meal diet throughout. As days of withdrawal increased, pigs previously fed the high-fiber diet had increased carcass yield (quadratic; P = 0.039). Pigs continuously fed the high-fiber diet had heavier (percentage of hot carcass weight [HCW]) full large intestines (P = 0.003) than pigs fed the corn-soybean meal diet. Full large intestine weight decreased (linear; P = 0.018) as withdrawal time increased. Belly fat IV tended (linear; P = 0.080) to improve as withdrawal time increased. In experiment 2, a total of 1,089 pigs (initially 44.5 ± 0.1 kg BW) were used in a 96-d study with the same dietary treatments as in experiment 1, except pigs were fed the high-fiber diet until day 24, 19, 14, 9, or 0 before slaughter and then switched to the corn-soybean meal diet. Pigs fed the high-fiber diet throughout had decreased average daily gain and G:F (P = 0.001) compared with those fed the low-fiber corn-soybean meal diet. For pigs initially fed the high-fiber diet and then switched to the low-fiber corn-soybean meal diet, G:F tended to improve (linear; P = 0.070) as withdrawal period increased. Pigs fed the high-fiber diet throughout had decreased HCW (P = 0.001) compared with those fed the low-fiber corn-soybean meal diet and HCW marginally increased (quadratic; P = 0.077) as withdrawal period increased. In summary, switching pigs from a high-fiber diet to a corn-soybean meal diet for up to 24 d before market increased carcass yield (experiment 1) or HCW (experiment 2) with the improvement most prominent during the first 5 to 9 d after withdrawal.

Eating, Diet, and Nutrition for Constipation in Children

MedlinePlus

... Treatment Eating, Diet, & Nutrition Clinical Trials Eating, Diet, & Nutrition for Constipation in Children What should my child ... Management Liver Disease Urologic Diseases Endocrine Diseases Diet & Nutrition Blood Diseases Diagnostic Tests La información de la ...

Prolonged consumption of soy or fish-oil-enriched diets differentially affects the pattern of hypothalamic neuronal activation induced by refeeding in rats.

PubMed

Watanabe, Regina L H; Andrade, Iracema S; Zemdegs, Juliane C S; Albuquerque, Kelse T; Nascimento, Claudia M O; Oyama, Lila M; Carmo, Maria G T; Nogueira, Maria I; Ribeiro, Eliane B

2009-12-01

We used c-Fos immunoreactivity to estimate neuronal activation in hypothalamic feeding-regulatory areas of 3-month-old rats fed control or oil-enriched diets (soy or fish) since weaning. While no diet effect was observed in c-Fos immunoreactivity of 24-h fasted animals, the acute response to refeeding was modified by both hyperlipidic diets but with different patterns. Upon refeeding, control-diet rats had significantly increased c-Fos immunoreactivity only in the paraventricular hypothalamic nucleus (PVH, 142%). In soy-diet rats, refeeding with the soy diet increased c-Fos immunoreactivity in dorsomedial hypothalamic nucleus (DMH, 271%) and lateral hypothalamic area (LH, 303%). Refeeding fish-diet rats with the fish diet increased c-Fos immunoreactivity in PVH (161%), DMH (177%), VMH (81%), and ARC (127%). Compared to the fish-diet, c-Fos immunoreactivity was increased in LH by the soy-diet while it was decreased in ventromedial hypothalamic nucleus (VMH) and arcuate hypothalamic nucleus (ARC). Based on the known roles of the activated nuclei, it is suggested that, unlike the fish-diet, the soy-diet induced a potentially obesogenic profile, with high LH and low VMH/PVH activation after refeeding.

[Effects of low-protein diet plus alpha-keto acid on micro-inflammation and the relationship between micro-inflammation and nutritional status in patients performing continuous ambulatory peritoneal dialysis: a randomized controlled trial].

PubMed

Chen, Wei; Guo, Zhi-Yong; Wu, Hao; Sun, Li-Jing; Cai, Li-Li; Xu, Hai-Yan

2008-05-01

To investigate the effects of the combination of alpha-keto acid and low-protein diet on the levels of serum cytokines in patients performing continuous ambulatory peritoneal dialysis (CAPD) and to explore the relationship between inflammation and malnutrition in CAPD patients. Eighty-nine CAPD patients were randomized into three groups, and 78 cases completed a one-year follow-up and with complete data. There were 31 cases in low-protein diet plus alpha-keto acid group, 26 cases in low-protein diet group and 21 cases in routine-protein diet group. The levels of serum albumin (Alb), prealbumin (PA), retinol-binding protein (RBP), transferrin (TRF), cholesterol (TC), triglycerides (TG), leptin, and triceps skinfold thickness (TSF), mid-arm muscle circumference (MAMC), body mass index (BMI) were measured. The changes of serum interleukin-1alpha (IL-1alpha), interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha) and C-reactive protein (CRP) were also detected. Compared with low-protein diet group, serum levels of PA, RBP and TRF were significantly increased both in low-protein diet plus alpha-keto acid and routine-protein diet groups ( P<0.01), however, there was no significant difference in the levels of PA, RBP and TRF between low-protein diet plus alpha-keto acid group and routine-protein diet group. There was an increased tendency in the content of Alb, TC, TG, BMI, TSF and MAMC, but there were no significant differences. The plasma levels of IL-1alpha, IL-6 and TNF-alpha in low-protein diet plus alpha-keto acid group were decreased as compared with the routine-protein diet group, but there were no significant differences. The plasma level of CRP in low-protein diet plus alpha-keto acid group was lower than that in the routine-protein diet group ( P<0.01). The combination of alpha-keto acid and low-protein diet can ameliorate malnutrition and micro-inflammation in CAPD patients.

Can families eat better without spending more? Improving diet quality does not increase diet cost in a randomized clinical trial among youth with type 1 diabetes and their parents

PubMed Central

Lipsky, Leah M.; Eisenberg, Miriam H.; Liu, Aiyi; Mehta, Sanjeev N.; Laffel, Lori M.B.

2016-01-01

Background Although cost is a frequently cited barrier to healthful eating, limited prospective data exist. Objective This study examined the association of diet cost with diet quality change. Design An 18-month randomized clinical trial evaluated a dietary intervention. Participants/setting Youth with type 1 diabetes duration ≥1 year, age 8.0 to 16.9 years (N=136), receiving care at an outpatient tertiary diabetes center in Boston, Massachusetts participated along with a parent from 2010 to 2013. Eighty-two percent of participants were from middle to upper income households. Intervention The family-based behavioral intervention targeted intake of whole plant foods. Main outcome measures Diet quality as indicated by the Healthy Eating Index-2005 (HEI-2005, measures conformance to 2005 Dietary Guidelines for Americans) and whole plant food density (WPFD, cup/oz equivalents per 1000 kcal of target food groups) were calculated from three-day food records of youth and parent dietary intake at six and four time points, respectively. Food prices were obtained from two online supermarkets common to the study location; daily diet cost was calculated by summing prices of reported foods. Statistical analyses performed Random effects models estimated treatment group differences in time-varying diet cost. Separate models for youth and parent adjusted for covariates examined associations of time-varying change in diet quality with change in diet cost. Results There was no treatment effect on time-varying diet cost for either youth [β (95%CI) = −0.49 (−1.07, 0.08), p=.10] or parents [β=0.24 (−1.61, 2.08) p=.80]. Additionally, time-varying change in diet quality indicators was not associated with time-varying change in diet cost for youth. Among parents, a 1 cup/oz-equivalent increase in whole plant food density was associated with a $.63/day lower diet cost [β=−0.63 (−1.20, −0.05), p=0.03]. Conclusions Improved diet quality was not accompanied by greater cost for youth with type 1 diabetes and their parents participating in a randomized clinical trial. Findings challenge the prevailing assumption that improving diet quality necessitates greater cost. PMID:27597745

Meal pattern alterations associated with intermittent fasting for weight loss are normalized after high-fat diet re-feeding.

PubMed

Gotthardt, Juliet D; Bello, Nicholas T

2017-05-15

Alternate day, intermittent fasting (IMF) can be an effective weight loss strategy. However, the effects of IMF on eating behaviors are not well characterized. We investigated the acute and residual effects of IMF for weight loss on meal patterns in adult obese male C57BL/6 mice. After 8weeks of ad libitum high-fat diet to induce diet-induced obesity (DIO), mice were either continued on ad libitum high-fat diet (HFD) or placed on one of 5 diet strategies for weight loss: IMF of high-fat diet (IMF-HFD), pair-fed to IMF-HFD group (PF-HFD), ad libitum low-fat diet (LFD), IMF of low-fat diet (IMF-LFD), or pair-fed to IMF-LFD group (PF-LFD). After the 4-week diet period, all groups were refed the high-fat diet for 6weeks. By the end of the diet period, all 5 groups had lost weight compared with HFD group, but after 6weeks of HFD re-feeding all groups had similar body weights. On (Day 2) of the diet period, IMF-HFD had greater first meal size and faster eating rate compared with HFD. Also, first meal duration was greater in LFD and IMF-LFD compared with HFD. At the end of the diet period (Day 28), the intermittent fasting groups (IMF-HFD and IMF-LFD) had greater first meal sizes and faster first meal eating rate compared with their respective ad libitum fed groups on similar diets (HFD and LFD). Also, average meal duration was longer on Day 28 in the low-fat diet groups (LFD and IMF-LFD) compared with high-fat diet groups (HFD and IMF-HFD). After 6weeks of HFD re-feeding (Day 70), there were no differences in meal patterns in groups that had previously experienced intermittent fasting compared with ad libitum fed groups. These findings suggest that meal patterns are only transiently altered during alternate day intermittent fasting for weight loss in obese male mice. Copyright © 2017 Elsevier Inc. All rights reserved.